Materials and Methods s12

Online data supplement

Endothelial outgrowth cells are not derived from CD133+ cells or CD45+

hematopoietic precursors.

Frank Timmermans, Filip Van Hauwermeiren, Magda De Smedt, Robrecht Raedt, Frank Plasschaert,

Marc L De Buyzere, Thierry C. Gillebert, Jean Plum and Bart Vandekerckhove.

Online Supplemental Materials and Methods

Cell culture

For endothelial outgrowth culture, EBM2 medium with 10 % FCS and EGM2 MV Single

Quots (Cambrex, Verviers, Belgium) was used as previously described1-4. For endothelial differentiation conditions5, M199 medium was used (GibcoBRL, Merelbeke, Belgium) with 20 % FCS and human recombinant growth factors : insulin like growth factor 1, fibroblast growth factor 2 and vascular endothelial growth factor A (VEGFa165) (all growth factors from Peprotech, London, UK). The M199 conditions were used to test the umbilical cord blood (UCB) cell subsets in experiment 1 to 2, whereas EBM2 conditions were used in experiment 3 to 8 in Table 1. All bone marrow (BM) culture experiments were performed in EBM2 conditions.

An average of 150 x 106 UCB mononuclear cells (MNC) and 180 x 106 BM MNC were seeded onto 3 individual gelatin (Sigma-Aldrich, Bornem, Belgium) coated wells of 6 well plates (BD Bioscience, Erembodem, Belgium). MNC depleted for CD133 or CD34 cells were cultured at the same density as total MNC.

MACS enriched UCB and BM CD34+ cells, sorted CD34+CD45+ cells, CD133+ cells and

UCB CD14+ cells were all seeded at a density of 1-1.8 x 106 cells /2 cm2 on gelatin

1 (Sigma-Aldrich) coated 24 well plates. An average of 8500 sorted BM and 11 000 sorted

UCB CD34+CD45- cells were directly sorted on 1 gelatin coated well of a 24 well plate.

All purified cells were used in each experiment. The absolute number of plated UCB and

BM cell subsets are depicted in Supplemental Table II and Supplemental Table III respectively.

The number of high proliferative EC colonies (> 500 cells) was scored in each cell subset after 3-4 weeks of culture by visual inspection using phase-contrast light microscopy (Leica Microsystems, Brussels, Belgium)4. Serial images of cultures were taken using a Moticam 480 CCD camera (Motic, Suffolk, UK).

Cell labeling and flowcytometric analysis

Cells were detached using trypsin-free dissociation buffer (Invitrogen, Merelbeke,

Belgium). Before adding antibodies, FcR blocking was performed using human IgG

(Miltenyi Biotec, Bergisch Gladbach, Germany). The following (conjugated) monoclonal antibodies were used : CD3-PE, CD11b-PE, CD11c-PE , CD14-PE and APC, CD19-PE,

CD34-APC and PE, CD-38 PE, CD45-FITC, CD80-PE, HLA-DR-APC and rat anti- mouse-PE (all from BD Bioscience); CD1-APC, CD13-APC, CD31-PE and FITC,

CD33-PE, CD36-PE, CD45-PE, CD90-PE, CD146-PE, CD163-PE, CD235a-FITC and

MHC-I – PE (all from BD Pharmingen); CD105-FITC (Serotec, Oxford, UK); CD45-

APC and CD133-PE (clone AC133/1 and 293C3) (Miltenyi Biotec); VEGFR2-APC and

PE, CD144-PE (R&D, Abingdon, UK), vWF unconjugated (Abcam, Cambridge, UK);

Alexa Fluor 488 goat anti-mouse secondary antibody IgG (H+L) was used for

2 immunohistochemistry (Molecular Probes Invitrogen, Merelbeke, Belgium). Appropriate control isotype antibodies were used.

EOC, positive and negative control cells were incubated with FITC conjugated Ulex

Europaeus Agglutinin 1 (UEA-1) (Sigma-Aldrich) and 3,3’-dioctadecyloxacarbocyanine perchlorate (Dio) – labelled LDL (Biomedical Technologies Inc., Stoughton, MA) according to the manufacturer’s instructions. The results were analyzed using

CELLQuest Software (Becton Dickinson).

Conventional RT- PCR and real-time RT-PCR

RT-PCR was performed on MACS pre-enriched CD34+ UCB cells and bone marrow

(BM) cells that were subsequently enriched for the CD34+CD45+ and CD34+CD45- phenotype. For RT-PCR on sorted UCB and BM CD34+CD45- cells, cells were pooled to obtain enough template per experiment. RNA was extracted using an RNA isolation kit

(AurumTM Total RNA kit, Bio-Rad, Hercules,CA). cDNA was synthesized using

Eurogentec Reverse Transcriptase Core Kit (Eurogentec, Seraing, Belgium). The optimal annealing temperature for each primer pair was determined using a temperature gradient

PCR (Eppendorf Mastercycler Gradient, Wessling-Berzdorf, Germany) on diluted positive control cDNA (e.g. HUVEC cDNA/Daudi cell cDNA: 1/100). Gene and cDNA specificity of the primers was checked using NCBI-BLAST and GENATLAS, available on the internet. The following primers were used to amplify (35 to 40 cycles) target mRNA :

VEGFR2/KDR sense : GCAGGGGACAGAGGGACTTG; antisense : GAGGCCATCGCTGCACTCA 5

3 VE-CADHERIN/CD144 sense : ACCGGATGACCAAGTACAGC; antisense : ACACACTTTGGGCTGGTAGG vWF sense: ACATCACTGCCAGGCTGCAGTA;

antisense: CACAAGAGCAGAACATGCAGAG 6

CD146/Muc-18 : sense CCAAGGCAACCTCAGCCATGTC; antisense : CTCGACTCCACAGTCTGGGACG

CD133 sense : GCCACCGCTCTAGATACTGC; antisense : CAATGTTGTGATGGGCTTGTC2

CD34 : sense CCTCCCAAGTTTTAGGACAA; antisense : CAGCTGGTGATAAGGGTTAG

CD 45 sense : AACCTGAAGTGATGATTGCTG; antisense : CTCGACTCCACAGTCTGGGACG

HPRT was used as reference gene: sense TATGGACAGGACTGAACGTCTTGC; antisense : GACACAAACATGATTCAAATCCCTGA.

The amplicons were separated on a 2% agarose gel along with p-GEM markers

(Fermentas, St. Leon Rot, Germany), and stained with ethidium bromide.

Real-time RT-PCR was performed on equal numbers of sorted CD34+CD45- and

CD34+CD45+ cells. The reactions were run on a ABI Prism 7300 Sequence Detection

System (Applied Biosystems, Lennik, Belgium). PCR reagents were obtained from

Eurogentec as SYBR Green I mastermixes (Eurogentec), and used according to the manufacturer’s instructions. The following cycling conditions were used: 10 min at

95ºC, 40 cycles at 95ºC for 15 s and 60ºC for 60 s. After amplification, a melting curve

4 was generated for every PCR product to check for specificity of the PCR reaction; primers were designed using Primer Express Version 3.0 software (Applied Biosystems).

A non-template control was always included. Melting curves of all amplicons were determined on positive control cells. A detailed list of all real-time PCR primers used is shown in Supplemental Table IV.

In vitro matrigel angiogenesis assay

25 000 to 50 000 cells/cm2 were suspended in EBM2 medium (Cambrex) and were seeded on a matrigel coated well (Becton Dickinson) and allowed for tube formation during at least 24 hours at 37°C. Freshly isolated CD14+ cells and HUVEC served as negative or positive control, respectively.

Confocal microscopy

Von Willebrand Factor staining was performed on EOC, positive (HUVEC) and negative control cells lines (stromal cells). Briefly, after fixation (4 % paraformaldehyde, 10 minutes) and quenching (50 mM NH4Cl, 10 minutes), cells were permeabilized using 0.2-

0.5 % Triton X-100 (TX100) for 5 minutes and blocked using 0.4 % fish skin gelatine/PBS for 30 minutes. Cells were stained with monoclonal mouse anti-von

Willebrand factor antibodies (1:100) overnight at 4°C, followed by Alexa Fluor 488 goat anti-mouse secondary antibody IgG (H+L),1:1000 for 2 hours.

5 Online Supplemental Figure and Table legends

Supplemental Figure I : Characteristics of EOC derived from bone marrow

Figure IA shows the cobblestone morphology of confluent CD34+ BM derived EOC (50 x magnification). Flow cytometry histograms of indicated surface antigens, uptake of

LDL and binding of UEA-1 of these EOC is shown representatively in Supplemental

Figure IB. The shadowed histograms denote the control isotype-matched antibodies or unlabelled cells in case of UEA-1 and LDL-uptake experiments.

Supplemental Figure II : UCB CD34- cell generate monocytic endothelial-like cells

UCB CD34- cells after 2 weeks of culture generate attaching flat, spindle to oval cells (A:

100 x maginification; B: 200 x magnification) that fail to generate vascular tubes in matrigel (C : 50 x magnification). FACS histograms (D-H) show expression of CD34,

CD31, uptake of LDL and UEA-1 binding and all cells express the hematopoietic marker

CD45. The cells have low proliferative potential, as shown representatively in I.

Supplemental Figure III : Real-time PCR of endothelial antigens and CD133 on sorted bone marrow cell subsets

For each cell subset, a representative analysis for up to three independent experiments is shown. The expression of each gene is normalized according to the ΔΔ Ct – method using

HPRT as a reference gene (HPRT mRNA expression set to 1). The symbol ‘#’ denotes variable results while an asterisk stands for ‘not detected’. Sorted BM CD34+CD45- cells

6 (N=2) express VEGFR2, VE-Cadherin and CD146, but not CD133. BM CD34+CD45+

(N=3) and sorted BM CD133+ cells (N=2) express CD133, but not VEGFR2 or VE-

Cadherin. The expression of CD146 (#) was detected in one of three BM CD34+CD45+ and in one of two BM CD133+ samples. Cultured (6 weeks) BM CD34+CD45+ cells express low levels of all antigens tested.

Supplemental Figure IV : Differentiation of fresh UCB monocytes into endothelial-like cells.

Figure A shows the comparison of the relative expression of the tested genes between fresh sorted UCB CD14+CD45+, cultured CD14+CD45+ cells and HUVEC (N=3). The expression of all genes was normalized according to the ΔΔ Ct – method using HPRT as a reference gene (HPRT mRNA expression is set to 1). An asterisk denotes that the mRNA in question was not detected. Cultured CD14+CD45+ cells (12 day culture period) express the endothelial antigens VE-Cadherin, CD146 and Tie-2, whereas fresh isolated

CD14+CD45+ cells do not. HUVEC express much higher mRNA levels of these genes compared to cultured monocytes.

Culturing sorted UCB CD14+CD45+cells (N=5) generate numerous cell clusters (far more than sorted CD34+CD45+ cells (not shown)) with a central core of rounded cells with spindle-like cells at the periphery, consistent with ‘early EPC’ colonies7 (B). HUVEC clearly generate vascular tubes in matrigel (E, F, G; 50, 100 and 200 x magnification respectively) whereas cultured CD14+CD45+ cells do not or reveal some rudimentary cell contacts (H, I, J; same magnifications as HUVEC respectively). Cultured CD14+CD45+ cells were sorted into CD163-/low (R1 gate) and CD163+ cells (R2 gate) (K). Real-time

7 PCR on these sorted cell fractions shows that expression of VE-Cadherin and CD146 mRNA is confined to the CD163+ cell fraction, but not to the CD163-/low cells (L). The housekeeping gene (HKG) used was HPRT.

Supplemental Figure V : FACS analysis of CD34+CD45- cells

A gate (R2) was set on CD34+CD45- cells within a CD34+ MACS enriched UCB (raw A) and BM (raw B) cell population. UCB CD34+CD45- cells have borderline expression of

VEGFR2 compared to BM CD34+CD45- cells. The CD133 antigen was not detected within UCB CD34+CD45- cells, nor BM CD34+CD45- cells.

Supplemental Figure VI : Comparison between MACS enriched CD133+ and CD34+ cells

Representative dot plots are shown for three independent experiments (Cord blood: plots

A-C; Bone marrow: plots D-F). 100 000 events were recorded in each dot plot analysis.

A CD34+CD45- cell population is present within MACS enriched UCB CD34+ cells (A) and BM CD34+ cells (D). This CD34+CD45- cell population was no longer detected within MACS enriched CD133+ cells (Dot plot B and E). Neither could a CD133+CD45- cell population be detected within CD133+ MACS enriched cells (Dot plot C and F).

8 Supplemental Figure VII : UCB CD133+ cells generate monocytic endothelial- like cells

Sorted UCB CD133+ cells after 2 weeks of culture generate attaching flat, spindle to oval cells (A: 200 x maginification; B: 100 x magnification) that fail to generate vascular tubes in matrigel (C : 50 x magnification). FACS histograms (D-H) show expression of

CD34, CD31, uptake of LDL and UEA-1 binding and 100 % of the cells express CD45.

The progeny of the CD133+ cells have low proliferative potential, as shown representatively in I.

Supplemental Figure VIII : BM CD133- cells generate EOC

Culturing BM CD133- cells generates overgrowth of stromal cells (Figure A : 200 x magnification). Flow cytometry shows the presence of CD45-CD31+ ECs (Figure B (Gate

R2)) within the progeny of cultured BM CD133- cells. Culturing the sorted CD45-CD31+ cells shows a typical endothelial morphology (Figure C : 100 x magnification). FACS analysis is compatible with EOC (Figure D). The EOC have high proliferative potential

(Figure E).

Supplemental Table I : BM CD34+CD45+ HPC fail to generate EOC

The table shows the number of EOC colonies per sample for the indicated BM cell phenotype. The reciprocal populations CD34+ and CD34-, CD34+CD45+ and

CD34+CD45-, CD45- and CD45+, CD133+ and CD133- were always sorted simultaneously from the same BM sample. An asterisk indicates that EOC could not be visualized or enumerated due to overgrowth of stromal cells. All cell cultures were performed in

9 EBM2 conditions. The number of plated cells in each experiment is shown in

Supplemental Table III.

Supplemental Table II : Total number of plated UCB purified cells

The absolute number of the corresponding UCB cell subsets depicted in Table 1 of the manuscript are shown.

Supplemental Table III : Total number of plated BM purified cells

The absolute number of the corresponding BM cell subsets depicted in Supplemental

Table I are shown.

Supplemental Table IV : Real-time RT-PCR primers

Online Supplemental References

1) Lin Y, Weisdorf DJ, Solovey A, Hebbel RP. Origins of circulating

endothelial cells and endothelial outgrowth from blood. J Clin Invest.2000;

105:71-77.

2) Bompais H, Chagraoui J, Canron X, Crisan M, Liu XH, Anjo A, Tolla-Le

Port C, Leboeuf M, Charbord P, Bikfalvi A, Uzan G. Human endothelial

cells derived from circulating progenitors display specific functional

properties compared with mature vessel wall endothelial cells.

Blood.2004;103:2577-2584.

10 3) Yoon CH, Hur J, Park KW, Kim JH, Lee CS, Oh IY, Kim TY, Cho HJ,

Kang HJ, Chae IH, Yang HK, Oh BH, Park YB, Kim HS. Synergistic

neovascularization by mixed transplantation of early endothelial progenitor

cells and late outgrowth endothelial cells: the role of angiogenic cytokines

and matrix metalloproteinases. Circulation.2005;112:618-1627

4) Ingram DA, Mead LE, Tanaka H, Meade V, Fenoglio A, Mortell K, Pollok

K, Ferkowicz MJ, Gilley D, Yoder MC. Identification of a novel hierarchy

of endothelial progenitor cells using human peripheral and umbilical cord

blood. Blood.2004;104:2752-2760

5) Shi Q, Rafii S., Hong-De M, Wijelath ES, Yu C, Ishida A, Fujita Y, Kothari

S, Mohle R, Sauvage LR, Moore MAS, Storb RF, Hammond WP. Evidence

for circulating bone marrow-derived endothelial cells. Blood.1998;92:362-

6) Pelosi E, Valtieri, Coppola S, Botta R, Gabbianelli M, Lulli V, Marziali G,

Masella B, Muller R, Sgadari C, Testa U, Bonanno G, Peschle C.

Identification of the hemangioblast in postnatal life. Blood.2002;100:3203-

7) Hill JM, Zalos G, Halcox JPJ, Schenke WH, Waclawiw MA, Quyyumi AA,

Finkel T. Circulating endothelial progenitor cells, vascular function, and

cardiovascular risk. N Engl J Med.2003;348:593-600

8) Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A,

Speleman F. Accurate normalization of real-time quantitative RT-PCR data

11 by geometric averaging of multiple internal control genes.

Genome Biol.2002;Epub 2002 Jun 18.

9) Yang H, Li M, Chai H, Yan S, Lin P, Lumsden AB, Yao Q, Chen C. Effects

of cyclophilin A on cell proliferation and gene expressions in human

vascular smooth muscle cells and endothelial cells. J Surg

Res.2005;123:312-319

10) Schedel J, Seemayer CA, Pap T, Neidhart M, Kuchen S, Michel BA, Gay

RE, Muller-Ladner U, Gay S, Zacharias W. Targeting cathepsin L (CL) by

specific ribozymes decreases CL protein synthesis and cartilage destruction

in rheumatoid arthritis.Gene Ther. 2004;11:1040-1047

Online Supplemental Figures and Tables

Supplemental Figure I

12 Supplemental Figure II

Supplemental Figure III

Supplemental Figure IV

13 14 Supplemental Figure V

Supplemental Figure VI

Supplemental Figure VII

15 Supplemental Figure VIII

Supplemental Table I

16 Supplemental Table II

Exp 1 Exp 2 Exp 3 Exp 4 Exp 5 Exp 6 Exp 7 Exp 8

MNC 141 x 106 190 x 106 108 x 106 152 x 106 178 x 106 135 x 106 ------34- 121 x 106 148 x 106 109 x 106 169 x 106 136 x 106 178 x 106 ------34+ 1,54 x 106 1,53 x 106 1,26 x 106 1,31 x 106 1,48 x 106 1,20 x 106 ------34+45+ 1,40 x 106 0,99 x 106 1,32 x 106 1,03 x 106 1,09 x 106 1,60 x 106 1,30 x 106 1,40 x 106 34+45- 11600 10920 9230 9480 10490 13220 11250 13680 CD45+ ------178 x 106 137 x 106 204 x 106 ------CD45------0,73 x 106 0,62 x 106 1,30 x 106 ------CD133+ ------1,4 x 106 0,9 x 106 1,1 x 106 1,7x 106 1,6 x 106 --- CD133------135 x 106 180 x 106 150 x 106 170 x 106 155 x 106 ---

Supplemental Table III

Exp 1 Exp 2 Exp 3 Exp 4

MNC 210 x 106 165 x 106 170 x 106 172 x 106 34- 170 x 106 200 x 106 210 x 106 155 x 106 34+ 1,8 x 106 1,4 x 106 1,4 x 106 1,6 x 106 34+45+ 1,3 x 106 1,5 x 106 1,7 x 106 1,2 x 106 34+45- 6800 9500 10500 7400 CD133+ 2,1 x 106 1,8 x 106 1,7 x 106 1,3 x 106 CD133- 250 x 106 165 x 106 155 x 106 170 x 106

Supplemental Table IV