Environmental Science and Pollution Research International

Environmental Science and Pollution research International Electronic Supplementary Material

Integrated spatial health assessment of yellow perch (Perca flavescens) populations from the St. Lawrence River (QC, Canada), Part B: cellular and transcriptomic effects

a b a a c Audrey Bruneau , Catherine Landry , Maeva Giraudo , Mélanie Douville , Philippe Brodeur , Monique Boilyb, Pierre Gagnona, Magali Houdea* a Environment and Climate Change Canada, Aquatic Contaminants Research Division, Water Science and Technology Directorate, 105 McGill street, Montreal, QC, Canada, H2Y 2E7 b Centre de recherche en toxicologie de l’environnement (TOXEN), Departement des sciences biologiques, Universite du Quebec à Montreal, C.P. 8888, Succursale Centre-ville, Montreal, QC, Canada, H3C 3P8 c Ministère des Forêts, de la Faune et des Parcs, Direction de la gestion de la faune de la Mauricie et du Centre-du-Québec, 100, rue Laviolette, bureau 207, Trois-Rivières, QC, Canada, G9A 5S9

*Corresponding author Magali Houde Environment and Climate Change Canada 105 McGill Street, Montreal, QC, Canada, H2Y 2E7 T: 514-496-6774, F: 514-496-7398 E: [email protected]

1 Quantification of liver and plasma retinoids

In yellow perch, 3,4-didehydroretinol (vitamin A2, hereafter referred to DROH) is the dominant form of retinoid compared to the all-trans-retinol types (vitamin A1). Both types of retinoid groups have a similar metabolism, including transport proteins and enzymes, but the double bond found in all-trans-retinol types is absent in DROH. Organic compounds were extracted according to the method described by Spear and Moon (1986). Briefly, 200 mg of liver were crushed with 2.0 g of anhydrite sulfate sodium (Na2SO4). The resulting powder was transferred into a borosilicate tube and 5 mL of hexane with 0.1% of butylated hydroxytoluene (BHT) were added. Tubes were inverted for 15 minutes, centrifugated, at 1 625 × g for 5 minutes, and 0.5 mL of supernatant was transferred to a test tube, for evaporation at 45° C for 10 minutes using a vacufuge concentrator (EppendorfTM, Fisher Scientific, Ottawa, ON, Canada). The condensed was resuspended with 200 mL of acetonitrile, and vortexed during 30 seconds. All manipulations were operated under yellow light to prevent isomerization of retinoids. Samples (50 µL) were injected in the first HPLC system based on Doyon et al. (1998). This system was equipped with an analytic column ACE C18 to 4,6 × 250 mm formed with 5 µm intern particles (Canadian Life Science, Peterborough, ON, Canada), and a WatersTM481 detector configured at 326 nm for retinoid detection. The mobile phase was: 95% of methanol and 5% of water at 0 min; 68% methanol and 32% ethyl at 6 min; and then returned to initial solvent at 27 min. The flow rate 1 mL/min was constant for the 29 min of the chromatogram. The identification of retinoid compounds was based on injected standard from Sigma-Aldrich Ltd (Oakville, ON, Canada). Under these conditions all-trans-3,4-didehydroretinol (DROH) was detected at 6.5 min and 3,4- didehydropalmitate (DROH palmitate) at 17.2 min and were reported in the text as µg/g of liver. Plasma DROH analysis was based on Bérubé et al. (2005). Plasma was allowed to thaw for 30 min on ice. A 200 µL aliquot was transferred to a glass, screw-cap test tube along with 200 µL of methanol (containing 1.1 mg/mL BHT) followed by 1000 µL of a solvent mixture composed of ethyl acetate (50%) and hexane (50%; containing 0.068% glacial acetic acid). The mixture was vortexed for 1 min, centrifuged at 2000 × g for 5 min and 800µL of the organic phase was transferred to a clean test tube. The extraction was repeated once along with a third extraction conducted with 1000 µL hexane (containing 0.068% glacial acetic acid). The combined organic phases (800 µL + 1000µL + 1000 µL) were evaporated to dryness at 45 °C under a gentle stream of nitrogen gas. A volume of 80µL was injected into the HPLC (system described above) The

2 mobile phase was methanol:acetonitrile:tetrahydrofuran:0.35mM trifluroacetic acid (25.8%:55.7%:2.5%:16%) and flowed at 1 mL/min isocratically. Retinoids were separated on an Inertsil C18 analytical column (Chromatographic Sciences Company, Brockville, Ont., Canada; 150A-ODS2; 250mm × 4.6 mm; 5µm). Under these conditions DROH was detected at 14.2 min and is expressed in the text as ng/µl of plasma.

3 Online resource Fig. S1 Sampling sites for yellow perch collection during the campaign 2013 in the Saint-Lawrence River. Lake Saint-François and Lac Saint-Louis were located upstream of the Montreal island. Beauregard Island and Lake Saint-Pierre were located dowstream of the Montreal Island.

4 Online resource Table S1 List of gene names, symbols, functions, accession numbers and primers used in qRT-PCR experiments on yellow perch muscle and liver

Accession Gene names Symbol Species Primers number

Muscle Catalase cat Oplegnathus fasciatus AY734528.1 forward GTCGTCTCTTCTCCTACCCAG reverse ATCACGCTGGTAGTTGCTC Extracellular superoxide dismutase sod3 Maylandia zebra XM_004549496.1 forward GCCCCAGGAAGGAAAAGTCA 3 reverse CCAATCACAGACACACCCGT Glutathione peroxidase 4B gpx4b Danio rerio EU665237.1 forward CAGTTTGGAGGACAGGAGCC reverse GCCTTCATCCACTTCCACAGA Heat-shock protein-90 hsp90 Dicentrarchus labrax AY395632.1 forward ACCTGCCTCTCAACATCTCC reverse TTCTTGTAGTTCTCCTTGTCCTC Ubiquitin protein ligase E3 ubr5 Danio rerio BC081553.1 forward CTTCTGTCTGGTGGGGTCAA component n-recognin 5 reverse ACAAACCCTTCCTCATCGCA Liver

Peroxisome proliferator-activated pparα Sparus aurata AY590299.1 forward AAGCATCGTTCAGGCACTAC receptor alpha reverse GTCTGGGAAAGAGGAAGGTGT Peroxisome proliferator-activated pparβ Rachycentron canadum DQ350621.1 forward CCCTGTTTGTTGCTGCCATT receptor beta reverse CTCTGCTCCACCTGCTTCAC Peroxisome proliferator-activated pparγ Sparus aurata AY590304.1 forward CGCCAAACTGCTCCAGAAAA receptor gamma reverse CAGCAGTGGGTGTAAGCAAA High density lipoprotein-binding hdlbpa Danio rerio NM_201474.1 forward CCAGGAGTAGATGCCGAAAC protein a reverse GGTGTGTAGAGGCTGTTGGT Aldehyde dehydrogenase 2 aldh2 Danio rerio BC107974.1 forward TGCTACACCCGACACGAAC reverse GCTCTGCGACTTTCATCACC Aldehyde dehydrogenase family 16 aldh16a Danio rerio NM_001079954.2 forward GTGACAAAAACCAAGGAGGAAC member A1 1 reverse GGTAGTGGATACTTCTGACTGGG Apolipoprotein AI apoa1 Epinephelus coioides FJ426145.2 forward TGAAACCCTGAAAGCCGACC reverse CTCTGTGTGCTTGGCGGAA Apolipoprotein A-IV precursor apoa4 Anoplopoma fimbria BT082652.1 forward GAGGCTGAGGTGCTGAGAAA reverse CAGGGAGTCTGCGTATGGTG Lipoprotein lipase lpl Perca flavescens FJ826535.1 forward CGAGACGATGCCCAGTTTGT reverse AGTGCCTCCGTTGGGGTAAA Low-density lipoprotein receptor- lrp1 Danio rerio XM_005162219.2 forward TCTCACCACAGGCATCAACC related protein 1 reverse ACACAGCCACTCACACTTCT Rho GTPase-activating protein 35 arhgap3 Stegastes partitus XM_008280436.1 forward CAAGGCAGAGATGGAGAGCA 5 reverse GGCTCCAGCTACTGTGTTCA Hepatic glucose-6-phosphate g6pd Rhabdosargus sarba AY754640.1 forward AGTGATGAGTTGCGGGAGG dehydrogenase reverse AGGGATGGGGTGTGTCTTCT Glucose-6-phosphatase g6pc Osmerus mordax BT075183.1 forward ACACTGAGACCAAGAAGAGCA reverse AGGAAAGCAGGTAAAAGAGGG Glycogen synthase 2 gys2 Danio rerio NM_001018679.1 forward TGTCAGGTTTCGGCTGCTTC reverse TGCTTACAGGACTCTTCAGGC Heat shock 70 kDa protein 5 hspa5 Larimichthys crocea XM_010738795.1 forward ACAAAGGCACAGGCAACAAG reverse TGTCCTCGTCAGCAAAGC Phospholipid hydroperoxide gpx4 Thunnus maccoyii EF452498.3 forward ACCGCTCATCCTTTGTGG glutathione peroxidase reverse CACTACCTGACCTTCTCTGTTG Transthyretin precursor ttr Perca flavescens EU073714.1 forward GACGGACGACACTGGAGAGA reverse TGGCGTGCTACCCTCATTC Retinol dehydrogenase 3 rdh3 Salmo salar BT048126.2 forward CAGCAACCTTATCACGACACAC

5 reverse GTTCACTACAGCCCATAAGCCAC Retinol-binding protein rbp Epinephelus coioides FJ438490.1 forward CCCAGAGGGTTTGTTCCTACTT reverse AGGGGTTTCCTCAAAGGTGG Estrogen receptor beta-a esr2a Perca flavescens DQ984125.1 forward CCACGACTTCACCACCATACC reverse GTGACTGATGGACAGAGGGG Vitellogenin C vg-c Perca flavescens FJ804422.1 forward GGCACACATTGGATGGGGA reverse GCCTTGATTGTTGGCTTGGA Reference genes

Actin β actb Perca flavescens AY332493.2 forward ATGAGAGGTTCCGTTGCCC reverse AATGCTGTTGTAGGTGGTCTC Tubulin β tubb Takifugu rubripes XM_003979430.1 forward CAGTTCACCGCTATGTTCAGG reverse ATGTTGCTCTCTGCCTCTGT RNA polymerase III polr3f Pundamilia nyererei XM_005748597.1 forward ACAGTAAACAGAGTCCGATGGT reverse AGCGTGTTCAGGATGGTCTC Peptidylprolyl isomerase B ppib Oreochromis niloticus XM_003447514.2 forward GCAAAGACACCAACGGCTC reverse ACCACATCCATCCCCTCCA Ubiquitin-protein ligase (only for ubr5 Danio rerio BC081553.1 forward CTTCTGTCTGGTGGGGTCAA liver) reverse ACAAACCCTTCCTCATCGCA β-microglobulin b2m Perca flavescens HQ206491.1 forward TCAAGCCAACACCCTCATCT reverse CGTGTTTGGTTAGGTGGTAGTG Transmembrane protein 7 tmem7 Siniperca chuatsi AY909479.1 forward GACCTCCCTGGTTTTTCCAAG reverse ATCGTCGTCCTCGTCATCCT