Online Appendix Figure 1

Hepatic nuclear factor 4 alpha and the Ca-channel TRPC1 are novel disease candidate genes in diabetic nephropathy

Monika Niehof and Jürgen Borlak

Online Appendix

Online Appendix Table 1. Shift-probes sequences. Online Appendix Table 2. ChIP-PCR primer sequences. Online Appendix Table 3. Real-Time PCR primer sequences and amplification settings. Online Appendix Table 4. Representative data of obese Zucker diabetic fatty (ZDF) rats and of +/fa lean nondiabetic control rats. Online Appendix Table 5. Human kidney biopsies for immunohistochemistry, detailed patient information. Online Appendix Table 6. Target gene enrichment in ChIP-DNA. Online Appendix Table 7. PhastCons17way Wiggle Summary Statistics. Online Appendix Table 8. PLCB1 gene expression in STZ-induced diabetic rats. Online Appendix Table 9. Gene expression of potential TRCP1 interaction partners in kidneys of Zucker diabetic fatty (ZDF) rats.

Online Appendix Fig. 1 Stable gene expression of mitATPase6 in liver and kidney of Zucker diabetic fatty (ZDF) and STZ rats. Online Appendix Fig. 2 Aroclor 1254 increased HNF4 protein expression and in vitro binding to TRPC1 and PLCB1 Online Appendix Fig. 3 siRNA transfection efficiency in Caco-2 cells Online Appendix Fig. 4 Gene expression of HNF4 and TRPC1 (A) or PLCB1 (B) in kidney of Zucker diabetic fatty (ZDF) rat. Online Appendix Fig. 5 Stable gene expression of mitATPase6 HNF4 siRNA transfected Caco-2 cells

1 ONLINE APPENDIX TABLE 1. Shift-probes sequences.

Gene Accession Species Oligo Name Position Sequence Number huHNF1 NM_000545 human HNF1pro -273 to -247 AGGGCTGAAGTCCAAAGTTCAGTCCCTTC TRPC1 NM_003304 human probe131 -8189 to -8167 CTAGGAGTTCAAAGGCCAGCCTG PLCB1 NM_015192 human probe05 -936 to -914 AACGTAACCGTTTGCCCGGGTTT TRPC1 NM_053558 rat probe156 +4329 to +4351 ATCAGTGAACTTTGAGCTCAGGG PLCB1 NM_001077641 rat probe152 +310 to +322 CAGGCAGTTCAATGTCCAATTTT

2 ONLINE APPENDIX TABLE 2. ChIP-PCR primer sequences.

PCR Gene Accession number Species Position Primer sequence Fragment length Annealing

HNF1 NM_000545 human -195 to -214 fwd: CATGATGCCCCTACAAGGTT 274bp 60°C -449 to -468 rev: ATTGGAGCTGGGGAAATTCT TRPC1 NM_003304 human +1679 to +1698 fwd: TGGGTTGCCTGAGTTCTCTT 182bp 60°C +1839 to +1860 rev: TCTGTCCTCAGTTTGACAGGAA PLCB1 NM_05192 human -933 to -952 fwd: TCTGTCTCGAAAGCACAACG 110bp 60°C -843 to -862 rev: AGAAGAGCGCAGTTGAGAGG

LC-PCR Gene Accession number Species Position Primer sequence Fragment length Annealing Extension Fluorescence

HNF1 NM_000545 human -322 to -303 fwd: AGGCCATAGCTCCCTGTCC 149bp 66°C 9sec 86°C -193 to -173 rev: GCCCCTGCCTGTTCTGTTTA PCK1 NM_002591 human -521 to -501 fwd: GGCACAGAGCAGACAATCAA 169bp 65°C 9sec 83°C (PEPCK) -372 to -352 rev: TTGGCAAAACACCACAGCTA TRPC1 NM_003304 human -8263 to fwd: TTTGGCAGGGTATGATGACTC 119bp 67°C 8sec 86°C -8242 -8166 to rev: CAAGGGGTCACACTATGTTGTC -8144 PLCB1 NM_05192 human -933 to -952 fwd: TCTGTCTCGAAAGCACAACG 110bp 68°C 8sec 87°C -843 to -862 rev: AGAAGAGCGCAGTTGAGAGG ACTB NM_001101 human +539 to +559 fwd: CTCCTGAGCGCAAGTACTCC 188bp 65°C 8sec 89°C (ß-actin) +707 to +727 rev GCGCAAGTTAGGTTTTGTCA GAPDH NM_002046.3 human -6236 to fwd: ATGGTTGCCACTGGGGATCT 174bp 66°C 8sec 86°C -6216 -6082 to rev: TGCCAAAGCCTAGGGGAAGA -6062

3 ONLINE APPENDIX TABLE 3. Real-Time PCR primer sequences and amplification settings.

Gene Accession number Species Position Primer sequence Fragment length Annealing Extension Fluorescence

HNF4 NM_022180 rat +875 to +892 fwd: GCCTGCCTCAAAGCCATCAT 275bp 55°C 11sec 88°C +1130 to +1149 rev: GACCCTCCAAGCAGCATCTC TRPC1 NM_053558 rat +1613 to +1632 fwd: CCAAAGAGCAGAAGGACTGC 301bp 68°C 12sec 85°C +1894 to +1913 rev: GCTCGAGCAAACTTCCATTC PLCB1 XM_342524 rat +2011 to +2033 fwd: GATGGGATAGTGGCCAACAC 324bp 68°C 13sec 83°C +2315 to +2334 rev: ATTCCGCAGGCAGATGTAGT TRPC3 NM_021771 rat +387 to +406 fwd: CAATGCCTACAAGGGACTGG 213bp 60°C 9sec 87°C +580 to +599 rev: ATGGCTTCCACCTCTTCTGA TRPC4 NM_001083115 rat +158 to +178 fwd: TGGAGGAAGCCGAGATTTATT 291bp 68°C 12sec 87°C +428 to +448 rev: CCAAGATGATAGGCGTGATGT TRPC5 NM_080898 rat +1639 to +1658 fwd: CGCTCTTTGAAACCCTTCAG 236bp 60°C 10sec 84°C +1855 to +1874 rev: CTTCGTTCTCGCAAACTTCC TRPC7 EF673687 rat +2 to +21 fwd: TCAATTTCAACTGCGTGGAC 152bp 60°C 8sec 87°C +136 to +153 rev: CACGTAGCCCTTGCTGATG PKD2 NW_047421 rat +764 to +783 fwd: CGAGGACTGCGAGGTAAGAT 193bp 60°C 7sec 87°C +937 to +956 rev: GTGAAATTCGGAGCTGGGTA CAV1 NM_133651 rat +4 to +23 fwd: GCAGACGAGGTGAATGAGAAG 213bp 60°C 9sec 85°C +197 to +216 rev: CAGCAAGCGGTAAAACCAAT MitATPase6 AF115770 rat +188 to +204 fwd: CTAAAGGACGAACCTGA 315bp 55°C 13sec 83°C +487 to +503 rev: TGGCCTGCAGTAATGTT

HNF4 NM_000457 human +774 to +780 fwd: CTGCTCGGAGCCACCAAGAGATCCATG 371bp 60°C 15sec 88°C +1120 to +1144 rev: ATCATCTGCCAGGTGATGCTCTGCA TRPC1 NM_003304 human +507 to +526 fwd: TGGATGTTGCACCTGTCATT 325bp 60°C 13sec 82°C +812 to +831 rev: TTACATTGCCGGGCTAGTTC MitATPase6 NC_001807 human +188 to +204 fwd: CTAAAGGACGAACCTGA 315bp 55°C 13sec 83°C +487 to +503 rev: TGGCCTGCAGTAATGTT

4 ONLINE APPENDIX TABLE 4. Representative data of obese Zucker diabetic fatty (ZDF) rats and of +/fa lean nondiabetic control rats.

Obese Lean Age (weeks) 12,5 20 24 28 12,5 20 24 28 Blood glucose (mmol/l) Mean 20,3 25,0 29,0 27,0 6,4 7,1 6,9 6,9 SD 3,9 3,1 2,7 1,4 0,4 0,3 0,4 0,4 SEM 1,3 1,0 0,9 0,5 0,1 0,1 0,1 0,1 N 9 9 9 9 9 9 9 9 HbA1c (%) Mean 8,6 10,4 9,7 11,0 5,1 4,6 4,2 4,4 SD 0,5 1,1 0,7 0,7 0,0 0,1 0,1 0,1 SEM 0,2 0,4 0,2 0,2 0,0 0,0 0,0 0,0 N 9 9 9 9 9 9 9 9 Albumin/Creatinine (mg/mg) Mean 277,35 674,97 714,58 1207,57 11,40 6,05 7,47 5,99 SD 145,03 424,36 257,63 488,62 4,41 1,50 1,73 2,61 SEM 48,34 141,45 85,88 162,87 1,47 0,50 0,58 0,87 N 9 9 9 9 9 9 9 9

Obese Lean Age (weeks) 10 17 27 37 10 17 27 37 Blood glucose (mmol/l) Mean 11,9 29,7 32,5 44,9 7,3 8,0 7,2 15,5 SD 6,7 5,1 3,5 4,2 0,7 1,5 0,9 3,7 SEM 1,7 1,3 1,0 1,3 0,1 0,3 0,2 1,0 N 15 15 11 11 20 20 16 13 HbA1c (%) Mean 6,1 10,0 8,7 10,1 4,5 4,6 4,1 4,7 SD 0,9 1,6 1,2 0,9 0,1 0,1 0,1 0,1 SEM 0,2 0,4 0,4 0,3 0,0 0,0 0,0 0,0 N 15 15 11 9 20 20 16 12 Insulin (ng/ml) Mean 3,2 2,2 1,2 0,9 1,2 1,0 0,9 0,8 SD 1,2 1,1 0,6 0,3 0,3 0,2 0,2 0,4 SEM 0,3 0,3 0,2 0,1 0,1 0,0 0,1 0,1 N 15 15 11 11 20 20 16 13 Albumin (mg/kg/h) Mean 0,35 1,78 9,24 14,23 0,121 0,090 0,070 0,079 SD 0,24 1,09 6,70 7,69 0,041 0,069 0,033 0,051 SEM 0,06 0,28 2,02 2,32 0,009 0,015 0,008 0,014 N 15 15 11 11 20 20 16 13 Clearance Creatinine (ml/kg/min) Mean 5,4 4,0 7,6 4,5 6,0 4,9 6,7 4,5 SD 1,3 1,7 0,6 0,9 1,0 1,7 0,4 0,8 SEM 0,3 0,4 0,2 0,3 0,2 0,4 0,1 0,2 N 15 15 11 11 20 20 16 13 Urine flow (ml/kg/h) Mean 3,5 3,3 14,5 15,1 1,0 1,5 1,0 0,8 SD 1,8 2,1 3,6 4,6 0,3 0,6 0,2 0,1 SEM 0,5 0,5 1,1 1,4 0,4 0,3 0,4 0,0 N 15 15 11 11 20 20 16 13

Liver and kidney of fa/fa obese Zucker diabetic fatty (ZDF) rats and of +/fa lean nondiabetic control rats, aged 14 weeks were kindly provided by W. Linz and H. Ruetten, Sanofi-Aventis, Frankfurt, Germany (14). Phenotype data of representative studies are provided.

5 ONLINE APPENDIX TABLE 5. Human kidney biopsies for immunohistochemistry, detailed patient information.

Patient identification Sex Age Diagnosis numbers 12823/03 m 42 0-Biopsy, healthy 18305/03 m 40 0-Biopsy, healthy 5635/03 m 34 0-Biopsy, healthy Patient identification Sex Age Diagnosis Duration of Measures of numbers diabetes nephropathy 13914/02 m 73 Diabetes 5 years Creatin 3 mg%

mellitus Protein 1 g/d 1758/04 m 67 Diabetes 29 years Creatin 2.3 mg%

mellitus Protein 11 g/d 8414/98 f 67 Diabetes not available Creatin 2.5 mg%

mellitus

6 ONLINE APPENDIX TABLE 6. Target gene enrichment in ChIP-DNA. Target gene enrichment versus ß-actin in ChIP-DNA versus total input DNA was analyzed by real-time PCR. Calculation was performed using the Δ ΔCT-method in three independent experiments.

Gene Fold change SD HNF1 107.6 47.2 PEPCK 6.9 3.9 PLCB1 4.2 2.9 TRPC1 2.4 1.8

7 ONLINE APPENDIX TABLE 7. PhastCons17way Wiggle Summary Statistics. The PhastCons program (integrated in the UCSC genome browser) was used to analyze the level of sequence conservation amongst mammals and PhastCons17way (17 species) Wiggle Summary Statistics are shown.

Position: chr3:143,917,766-143,917,788 = huTRPC1 -8189 to -8167 (EMSA probe, Promoter) Total Bases in view: 23 Statistics on: 23 bases (% 100.0000 coverage) Database: hg18 Table: phastCons17way

Each data Data Data # of Data Bases Mean Standard Chrom value spans Minimum Maximum Range Variance start end values covered PhastCons score deviation # bases chr3 143917766 143917788 23 1 23 (100.00%) 0 0 0 0 0 0

Position: chr3:143,927,635-143,927,816 = huTRPC1 +1679 to +1869 (ChIP fragment, Intron 1) Total Bases in view: 182 Statistics on: 182 bases (% 100.0000 coverage) Database: hg18 Table: phastCons17way

Each data Mean Data Data # of Data Bases Standard Chrom value spans Minimum Maximum Range PhastCons Variance start end values covered deviation # bases score chr3 143927635 143927816 182 1 182 (100.00%) 0 0.732819 0.732819 0.138762 0.0505961 0.224936

Position: chr3:143,927,588-143,927,921 = huTRPC1 +1632 to +1965 (ChIP clone, Intron 1) Total Bases in view: 334 Statistics on: 334 bases (% 100.0000 coverage) Database: hg18 Table: phastCons17way

Each data Mean Data Data # of Data Bases Standard Chrom value spans Minimum Maximum Range PhastCons Variance start end values covered deviation # bases score chr3 143927588 143927921 334 1 334 (100.00%) 0 0.732819 0.732819 0.135887 0.0464812 0.215595

Position: chr20:8,060,360-8,060,382 = huPLCB1 -936 to -914 (EMSA probe, Promoter) Total Bases in view: 23 Statistics on: 23 bases (% 100.0000 coverage) Database: hg18 Table: phastCons17way

Each data Mean Data Data # of Data Bases Standard Chrom value spans Minimum Maximum Range PhastCons Variance start end values covered deviation # bases score chr20 8060360 8060382 23 1 23 (100.00%) 0 0 0 0 0 0

Position: chr20:8,060,344-8,060,453 = huPLCB1 -952 to -843 (ChIP fragment, Promoter) Total Bases in view: 110 Statistics on: 110 bases (% 100.0000 coverage) Database: hg18 Table: phastCons17way

Each data Data Data # of Data Bases Mean Standard Chrom value spans Minimum Maximum Range Variance start end values covered PhastCons score deviation # bases chr20 8060344 8060453 110 1 110 (100.00%) 0 0.228346 0.228346 0.0338583 0.00385828 0.0621151

Position: chr20:8,167,302-8,167,477 = huPLCB1 +106006 to +106181 (ChIP clone, Intron 2) Total Bases in view: 176 Statistics on: 176 bases (% 100.0000 coverage) Database: hg18 Table: phastCons17way Each data Mean Data Data # of Data Bases Standard Chrom value spans Minimum Maximum Range PhastCons Variance start end values covered deviation # bases score 7.88948e- chr20 8167302 8167477 176 1 176 (100.00%) 0 0.0374646 0.0374646 0.00527255 0.00888228 05

8 ONLINE APPENDIX TABLE 8. PLCB1 gene expression in STZ-induced diabetic rats. Gene expression was determined by with real-time RT-PCR and computed relative to expression of mitATPase6, a housekeeping gene.

Gene Organ Treatment Number of Mean SD [%] of the p-value*

animals control PLCB1 kidney control n=8 0.11 0.06 STZ n=7 0.14 0.04 125.7 0.1391 PLCB1 liver control n=8 3.12 3.69 STZ n=9 0.07 0.09 2.4 *A student's t test was used to compare the STZ group against the control group. The results were considered significant when the p value was less than 0.05. Values for the liver control group are not normal distributed, Shapiro-Wilks W test with p-value less than 0.05 (Statistica software, version 7.1, StatSoft), therefore no student's t-test was performed.

9 ONLINE APPENDIX TABLE 9. Gene expression of potential TRCP1 interaction partners in kidneys of Zucker diabetic fatty (ZDF) rats. Gene expression was determined by real-time RT-PCR in 14 weeks old ZDF rats (n=10 animals) and lean controls (n=10 animals). Gene expression was computed relative to expression of mitATPase6, a housekeeping gene.

Gene Treatment Mean SD p-value* TRPC3 control 0.9942 0.2905 ZDF 0.6395 0.2576 0.0157 TRPC4 control 0.6956 0.3895 ZDF 0.9364 0.4963 0.2649 TRPC5 control 1.4971 0.3484 ZDF 1.3604 0.6658 0.5974 TRCP7 control 0.8636 0.6102 ZDF 0.7646 0.6372 0.7418 PKD2 control 0.0887 0.0862 ZDF 0.0807 0.0615 0.8297 CAV1 control 0.7960 0.2985 ZDF 0.5724 0.1804 0.0816 *A student's t test was used to compare the ZDF group against the control group. The results were considered significant when the p value was less than 0.05.

10 ONLINE APPENDIX FIGURE LEGENDS

ONLINE APPENDIX FIGURE 1. Stable gene expression of mitATPase6 in liver and kidney of Zucker diabetic fatty (ZDF) and STZ rats. Gene expression was determined by real-time RT-PCR in kidney and liver of 14 weeks old ZDF rats (n=10) and lean controls (n=10) and in kidney (n=7) and in liver (n=9) of 2 months old STZ-induced diabetic rats (control n=8, respectively).

ONLINE APPENDIX FIGURE 2. Aroclor 1254 increased HNF4 protein expression and in vitro binding to TRPC1 and PLCB1. A: HNF4 western blot analysis (left) of 20 µg nuclear extract of control and Aroclor 1254 treated Caco-2 cells. Electrophoretic mobility shift assay with 2,5 µg nuclear extract of control or Aroclor 1254 treated Caco-2 cells and oligonucleotides corresponding to the A-site of the HNF1 promoter (HNF1pro) and to putative HNF4 binding-sites within the identified promoters (TRPC1, probe 131; PLCB1, probe 05) as 32P labeled probes. In supershift assays an antibody directed against HNF4 (+) was added. B: HNF4 western blot analysis (left) of 30 µg liver nuclear extract of control and Aroclor 1254 treated rats. Electrophoretic mobility shift assay with 2,5 µg rat liver nuclear extract of control or Aroclor 1254 treated animals and oligonucleotides corresponding to the A- site of the HNF1 promoter (HNF1pro) and to putative HNF4 binding-sites within the identified promoters (TRPC1, probe 131; PLCB1, probe 05) as 32P labeled probes. In supershift assays an antibody directed against HNF4 (+) was added.

ONLINE APPENDIX FIGURE 3. siRNA transfection efficiency in Caco-2 cells. Caco-2 cells (1,5x105 cells/well in 24-well plate) were transfected in triplicate for 48 h with 25 nM of Alexa-Fluor488 labeld siRNA using HiPerFect transfection reagent.

ONLINE APPENDIX FIGURE 4. Gene expression of HNF4 and TRPC1 (A) or PLCB1 (B) in kidney of Zucker diabetic fatty (ZDF) rat. Linear regression of correlation with 0.95 confidence interval are shown. Gene expression was determined by real-time PCR in 14 weeks old ZDF rats (n=10) and lean controls (n=10).

ONLINE APPENDIX FIGURE 5. Stable gene expression of mitATPase6 HNF4 siRNA transfected Caco-2 cells. Caco-2 cells (1,5x105 cells/well in 24-well plate) were transfected in triplicate for 48 h with 25 nM of HNF4 or Alexa-Fluor488 labeld siRNA (AF488, negative control) using HiPerFect transfection reagent. Gene expression in untransfected cells (control) is shown for comparison.

11 ONLINE APPENDIX FIGURE 1

1 5 0 0 s t i

n 1 0 0 0 u

t 5 0 0 a l e r 0 l l l l Z Z F F o o o o r r r T r T D D t t t t S S Z Z n n n n o o o o c c c c K i d n e y L i v e r K i d n e y L i v e r

12 ONLINE APPENDIX FIGURE 2 c c c o o o l l l r r r o o o A A A r r r c c c

t t A t o o o h h h n n n l r r r 2 2 2 o o o o A A A r c 7 7 7 c c

t h h h n 8 2 4 o

c 2 4 7 - + - + - + - + - + - + H N F 4  6 8 H N F 4 

5 5 H N F 4  H N F 4  4 2

C a c o - 2

H N F 1 p r o T R P C 1 P L C B 1 p r o b e 1 3 1 p r o b e 0 5 c c c o o o l l l r r r o o o A A A r r B r

t t t h h h n n n r l 2 2 2 o o o o o l c c 7 7 c 7 r t c n o r o A c - + - + - + - + - + - + H N F 4  6 8 H N F 4  5 5 H N F 4  H N F 4 

r a t l i v e r

H N F 1 p r o T R P C 1 P L C B 1 p r o b e 1 3 1 p r o b e 0 5

s 6 0 0 , 0 t i n u

4 0 0 , 0 e v i

t 2 0 0 , 0 a l e r 0 , 0