SAS Science 7: Meiosis, Genetic Disorders and Protein Synthesis
Total Page:16
File Type:pdf, Size:1020Kb

SAS Science 7: Meiosis, Genetic Disorders and Protein Synthesis
I. Multiple Choice Fill in the best answer for each question.
1. What is the chromosome theory of inheritance? a. Chromosomes are carried from parents to offspring on mutations. b. Genes are carried from parents to offspring on chromosomes. c. Mutations found in chromosomes are always harmful. d. Genes form RNA and are carried in the chromosome. 2. Walter Sutton discovered that the sex cells of grasshoppers have exactly a. 12 times the number of chromosomes found in the body cells. b. Twice the number of chromosomes found in the body cells. c. The same number of chromosomes found in the body cells. d. Half the number for chromosomes found in the body cells. 3. What is the total number of chromosomes found in all body cells EXCEPT sex cells? a. 12 c. 46 b. 23 d. 63 4. During protein synthesis, ribsomes a. bring amino acids to the messenger RNA b. read or “translate” the coded message from the DNA c. read or “translate” the coded message from the transfer RNA d. read or “translate” the coded message from the messenger RNA 5. What happens during meiosis? a. Each sex cell loses half of its chromosomes b. Chromosome pairs separate to form new sex cells c. Each sex cell copies itself to form four new chromosomes d. Chromosome pairs remain together when new sex cells are formed 6. When sex cell combine to produce offspring, each sex cell will contribute a. one fourth the normal number of chromosomes b. half the number of chromosomes c. the normal number of chromosomes d. twice the normal number of chromosomes 7. At the end of Meiosis I, chromosomes are a. double stranded c. lined up in the center of the cell b. single stranded d. do not have centromeres 8. What is the genetic code? a. the order of nitrogen bases along a gene b. the number of nitrogen bases in a DNA molecule c. the order of amino acids in a protein d. the number of guanine and cytosine bases in a chromosome 9. The order of bases along a gene determines the order in which a. sugars are put together to form a carbohydrate b. genes are arranged on a chromosome c. amino acids are put together to form a protein d. chromosomes are arranged in the nucleus 10. What are the base pairs that join with TACGACTAAGCT a. ATGCTGTAACGA b. UUGCUGUUUCGU c. AUGCUGAUUCGA d. UAGCAGUAACGU 11. What does the messenger RNA do during protein synthesis? a. copies the coded message from the DNA and carries it into the cytoplasm b. copies the coded message from the DNA and carries in into the nucleus c. carries amino acids and adds them to the growing protein d. copies the coded message from the protein and carries it into the nucleus 12. What does the transfer RNA molecules do during protein synthesis? a. copy the coded message from the DNA and carries it into the cytoplasm b. copy the coded message from the DNA and carries in into the nucleus c. carry amino acids and adds them to the growing protein d. copy the coded message from the protein and carries it into the nucleus 13. What is the total number of chromosomes found in Human sex cells? a. 12 c. 46 b. 23 d. 63 14. What is a mutation? a. any change that is harmful to an organism b. any change in a gene or chromosome c. any change that is helpful to an organism d. any change in the phenotype of the cell 15. A mutation is harmful to an organism if it a. changes the DNA of the organism b. changes the phenotype of the organism c. reduces the organism’s chances for survival and reproduction d. makes the organism better able to avoid predators 16. Where does protein synthesis take place? a. in the ribosomes c. in the chromosome b. in the nucleus d. in the DNA 17. Which nitrogen base in RNA is Not found in DNA? a. adenine c. uracil b. thymine d. guanine 18. Which combination of sex chromosomes results in a male human being? a. XX c. YY b. XY d. Both XX and XY 19. Genetic disorders are caused by a. mutations c. sickle-shaped cells b. protein synthesis d. RNA 20. Which genetic disorder causes the body to produce unusually think mucus in the lungs and intestine? a. Down Syndrome c. Sickle-Cell Disease b. Hemophilia d. Cystic fibrosis 21. Which genetic disorder causes a person to have low amounts of hemoglobin in their blood cells? a. Down Syndrome c. Sickle-Cell Disease b. Hemophilia d. Cystic fibrosis 22. Which genetic disorder is caused by an extra chromosome 21, and causes mental retardation as one of its symptoms? a. Down Syndrome c. Sickle-Cell Disease b. Hemophilia d. Cystic fibrosis 23. What is a karyotype? a. blood from a newborn baby b. a picture of a baby before it is born c. a picture of the chromosomes in a cell d. fluid that surrounds a baby before it is born 24. How can genetic counselors predict genetic disorders? a. by studying karyotypes and pedigree charts b. by taking pictures of the baby before it is born c. by exploring new methods of genetic engineering d. by studying the baby after birth 25. Sex-linked genes are genes that are on the a. X chromosome c. X and Y chromosome b. Y chromosome d. all chromosomes 26. What procedure helps diagnose a genetic disorder before a baby is born? a. genetic engineering c. pedigree chart b. selective breeding d. amniocentesis
II. True and False If the statement is True fill in A, if the statement is False fill in B.
27. An organism’s physical appearance is its phenotype. 28. The sex cells produced by meiosis have twice the number of chromosomes as the parent cells. 29. The number of four DNA nitrogen bases forms a genetic code for one amino acid. 30. Transfer RNA carries coded messages from the nucleus to the cytoplasm. 31. Meiosis produces four cells, each with half the number of chromosomes of body cells. 32. Meiosis goes through two stages. 33. Messenger RNA, ribosomes, transfer RNA, and genes are all responsible for protein synthesis. 34. Some mutations can be helpful. 35. Amino Acids are the building blocks of ribosomes. III. Using Science Skills Answer the following questions using the diagram provided.
36. Identify structure A a. amino acid c. ribosome b. protein d. transfer RNA 37. Identify structure B a. amino acid c. ribosome b. protein d. messenger RNA 38. Identify structure C a. amino acid c. ribosome b. messenger RNA d. transfer RNA 39. Identify structure D a. messenger RNA c. amino acid b. protein d. transfer RNA 40. Identify structure E a. amino acid c. ribosome b. protein d. transfer RNA NAME:
SAS Science 7: Meiosis, Genetic Disorders and Protein Synthesis
IV. Essay Write a COMPLETE answer to the questions below.
41. Step 1: Using the mRNA strand and the Genetic Code chart, list the amino acids in order from beginning to end. (5 pts)
mRNA UCGAUCCGUAACGUAGCCACAU
Step 2: If one nitrogen base on the messenger RNA was replaced by a different base, what effect might that have on protein synthesis? EXPLAIN your answer! (5pts) ESSAY!!!!!!
42. EXPLAIN how looking at a person’s karyotype can help genetic counselors determine genetic disorders AND the sex of the person. (10 points)