How Genetic Tests Work - Molecular (Sequence, Target, Array), Biochemical & Cytogenetics

How Genetic Tests Work - Molecular (sequence, target, array), Biochemical & Cytogenetics Contents [hide]

1 Understanding Genetic Testing

2 Uses of Genetic Testing

3 Types of Genetic Testing

3.1 Cytogenetic Testing

3.2 Biochemical Testing

3.3 Molecular Testing

4 Limitations to Genetic Testing

5 See Also

6 References

7 External Links [edit] Understanding Genetic Testing

Genetic testing involves examining a person’s DNA, found in blood or other tissues, for some abnormality linked to a disease or condition. DNA is actually a chemical alphabet composed of four units that make up all of the genes, or genetic material, found inside our cells. Genes are important for the body’s normal development and functioning. Each gene is unique due to the order of the four DNA units (see DNA).

When a mistake happens affecting part or all of the gene, this can result in an abnormal function or change in the body, leading to disease. The mistake can be fairly large or very small, and different types of genetic tests are used to identify the specific gene abnormality (see Genes and Their Properties).

1 The most common type of genetic testing is Newborn Screening. Almost every baby born in the United States has a blood sample tested for abnormal or missing genes or proteins. Early detection can allow the doctor to prescribe drugs or to place the baby on a specific diet in order to prevent or reduce the severity of a disease. Another type of testing, known as carrier testing, can help determine the risk of parents passing on a mutation to their child. Predictive or predispositional genetic testing can determine the risk of a healthy person developing a disease in the future. Finally, genetic tests can be used to look for gene abnormalities in persons suspected of having a genetic disease based on symptoms or family history.

Genetic testing is not always 100 percent accurate. Even when a genetic test positively detects a mutation, the test usually cannot determine when or what symptoms of the disease may show, which symptoms will occur first, how severe the disease will be, or how the disease will progress over time. If a test is negative, an individual may still be at risk for a disease. Therefore, it is important to speak to a health professional such as a genetic counselor to help you understand the benefits and risks of genetic testing and to answer any questions you may have before and after testing.

Genetic counselors are health professionals trained in the areas of medical genetics and counseling. Genetic counselors are trained to help persons as they consider testing, when they receive the results, and in the weeks and months afterward.

When deciding whether or not to have a genetic test for you or your child, several issues should be considered. In addition to the medical issues, genetic testing also raises some social, ethical, and legal issues you should be aware of. Below is a list of some of the issues you should discuss with your physician or genetic counselor:

What treatments are available for this genetic disease? What impact would the genetic test results have on my family? What happens if the results are uncertain or inconclusive? What are the risks for future pregnancies? What is the cost of the test and will my insurance cover it? Who will have access to the test results? What emotional support services are available? Do other family members have a right to know the test results? What is the risk of discrimination by my employer or insurer?

2 Uses of Genetic Testing

Genetic tests can be used for many different purposes.

Newborn screening is the most widespread use of genetic testing [See Chapter 4 for more information about newborn screening]. Almost every newborn in the U.S. is screened for several genetic diseases. Early detection of these diseases can lead to interventions to prevent the onset of symptoms or minimize disease severity.

Carrier testing can be used to help couples to learn if they carry—and thus risk passing to their children—an allele for a recessive condition such as cystic fibrosis, sickle cell anemia, and Tay-Sachs disease. This type of testing is typically offered to individuals who have a family history of a genetic disorder and to people in ethnic groups with an increased risk of specific genetic conditions. If both parents are tested, the test can provide information about a couple’s risk of having a child with a genetic condition.

Prenatal diagnostic testing is used to detect changes in a fetus’s genes or chromosomes. This type of testing is offered to couples with an increased risk of having a baby with a genetic or chromosomal disorder. A tissue sample for testing can be obtained through amniocentesis or chorionic villus sampling.

Genetic tests may be used to confirm a diagnosis in a symptomatic individual or used to monitor prognosis of a disease or response to treatment.

Predictive or predispositional genetic testing can identify individuals at risk of getting a disease prior to the onset of symptoms. These tests are particularly useful if an individual has a family history of a specific disease and an intervention is available to prevent the onset of disease or minimize disease severity. Predictive testing can identify mutations that increase a person’s risk of developing disorders with a genetic basis, such as certain types of cancer.

3 [edit] Types of Genetic Testing

Several different methods are currently used in genetic testing laboratories. The type of test will depend on the type of abnormality that is being measured. In general, three major types of genetic testing are available: cytogenetic, biochemical, and molecular testing.

[edit] Cytogenetic Testing

Cytogenetics involves the examination of whole chromosomes for abnormalities. Chromosomes of a dividing human cell can be clearly analyzed under a microscope. White blood cells, specifically T lymphocytes, are the most readily accessible cells for cytogenetic analysis since they are easily collected from blood and are capable of rapid division in cell culture. Cells from other tissues such as bone marrow (for leukemia), amniotic fluid (prenatal diagnosis), and other tissue biopsies can also be cultured for cytogenetic analysis.

Following several days of cell culture, chromosomes are fixed, spread on microscope slides, and then stained. The staining methods for routine analysis allow each of the chromosomes to be individually identified. The distinct bands of each chromosome revealed by staining allow for analysis of chromosome structure.

[edit] Biochemical Testing

The enormous numbers of biochemical reactions that routinely occur in cells require different types of proteins. Several classes of proteins exist to fulfill multiple functions, such as enzymes, transporters, structural proteins, regulatory proteins, receptors, and hormones. A mutation in any type of protein can result in disease if the mutation results in failure of the protein to correctly function.

Clinical testing for a biochemical disease utilizes techniques that examine the protein instead of the gene. Tests can be developed to directly measure protein activity (enzymes), level of metabolites (indirect measurement of protein activity), and the size or quantity of protein (structural proteins). These tests require a tissue sample in which the protein is present, typically blood, urine, amniotic fluid, or cerebrospinal fluid. Because proteins are more unstable than DNA and can degrade quickly, the sample must be collected, stored properly, and shipped promptly according to the laboratory’s specifications.

4 [edit] Molecular Testing

For small DNA mutations, direct DNA testing may be the most effective method, particularly if the function of the protein is not known and a biochemical test cannot be developed. A DNA test can be performed on any tissue sample and requires very small amounts of sample. Some genetic diseases can be caused by many different mutations, making molecular testing challenging. For example, more than 1,000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can cause cystic fibrosis (CF). It would be impractical to sequence the entire CFTR gene to identify the causative mutation since the gene is quite large. However, since the majority of CF cases are caused by approximately 30 mutations, this smaller group of mutations is first tested before more comprehensive testing is performed. Limitations to Genetic Testing

While the physical risks associated with most forms of genetic testing are small, since some tests only require a blood sample or buccal smear (retrieved from the inside of the cheek), there are many psychological, social, and financial effects on a person’s life that should be taken into consideration. See Also

Ethical, Legal, and Social Issues Pregnancy Screening / Reproductive Screening Inheritance

5 Repair of DNA

Photoreactivation Organisms have evolved at least four processes for repairing UV damage in DNA: photoreactivation, excision, error-prone, and recombination repair. Depending on the type of organism and the nature of the UV damage, these processes may successfully repair damage, partially repair the damage and create a mutation, or fail to work at all. The simplest process for repair of pyrimidine dimers is called photoreactivation which, as the name suggests, requires light. Photoreactivation is catalyzed by a single protein called photolyase, which uses the energy in a photon of light to chemically break apart a pyrimidine dimer in DNA. Photoreactivation probably represents the earliest type of UV repair system because many species, from bacteria through marsupials share the enzyme responsible. Humans and other placental mammals do not seem to have a photoreactivation process, but the gene which codes for photolyase has been conserved and may have evolved to play a role in the excision repair process. The PHR1 gene encoding photolyase is defective in the sensitive strain used in the experiments.

Excision repair In excision repair, the region of DNA containing the dimer or other damage is physically cut out and then replaced by new DNA synthesis (Figure 1). Excision repair has more steps and requires more enzymes than photoreactivation, but it can work on damage created by agents other than UV and on lesions other than pyrimidine dimers. In Escherichia coli bacteria, excision repair requires six proteins: three are involved in finding the damaged region of the DNA and cutting the DNA strand around the lesion; one participates in removing the damaged bit; DNA polymerase replaces the portion which was removed; and a final enzyme called DNA ligase glues the new and old portions back together. Mutations in the genes coding for any of these proteins will interfere with the process and cause the mutant bacterium to be highly sensitive to killing and mutation by UV light. The excision repair system probably repairs a large amount of UV damage. In yeast and other eukaryotes, DNA is wrapped up in more complicated structures than in bacteria, which may explain why these organisms seem to need more proteins to carry out excision repair. In yeast, at least twelve proteins may participate in excision repair. Researchers originally identified many of these by finding mutants unable to repair UV damage. We don't yet know the functions of all of these proteins, but scientists very recently found that the RAD1 and RAD10 gene products may act together in cutting DNA near dimers and that the RAD3 gene

6 product is needed to identify dimers to the other repair proteins. These genes have close counterparts in humans: for example, the protein made by the RAD3 gene has the same sequence of amino acids in over 50% of the positions as the product of its human counterpart, ERCC2. People with mutations in ERCC2 are very sensitive to sunlight and suffer from the disease xeroderma pigmentosum. Yeast with mutations in RAD3 are very sensitive to UV and are killed or mutated by very low doses of UV. RAD1 is mutated in the sensitive strain G948-1C/U.

Error-prone repair The excision process described in the previous section is mostly accurate, or error- free. Sometimes, however, mistakes are made when a cell tries to repair a lesion in its DNA. In the case of pyrimidine dimers, mistakes may happen when two dimers are near each other on opposite strands of the DNA (Figure 2). If the cell tries to do excision repair, it won't know how to copy the dimer when it tries to carry out the repair DNA synthesis because the dimer is not a normal part of DNA. It might make a mistake rather than not repair the gap in the DNA. Sometimes, unfortunately, an error-prone process is the only way to repair DNA damage. Most mutations arising after UV treatment of cells are the result of error-prone repair of the DNA lesions. In yeast, we know of several genes whose products are required for error-prone repair; one of them, RAD18, is mutated in the sensitive strain used in the experiments.

Recombinational repair When pyrimidine dimers block DNA replication in a eukaryotic chromosome, the polymerase can start replication at other places further downstream. The result of replicating a DNA molecule or chromosome containing a dimer is thus a gap in one strand of the DNA where the dimer blocked a portion from being copied (Figure 3). A gap in DNA means that one strand is missing information; the strand must be repaired before the cell divides. The most frequent way that cells fill such a gap is by genetic recombination with another DNA molecule or chromosome containing the same or similar information. The recombinational repair system is a fourth process involved in repair of UV damage to DNA. The genes which make the proteins functioning in this system have been identified because mutations in them block recombination. One important member of this group is the RAD51 gene, which makes a protein that can help DNA molecules find their similar partners and begin recombination.

Figure 1: Steps in Excision Repair

Figure 2: Steps in Error-prone Repair

Figure 3: Steps in Recombinational Repair

Step 1: DNA with dimer is replicated, leaving a gap in one daughter molecule.

7 Step 2: Recombination with other daughter molecule fills gap by transfer of good strand.

Step 3: DNA replication fills gap in donor daughter molecule.

8 Biochemistry 3107 - Fall 2001

DNA Repair

Direct Reversal

Direct repair systems reverse the mutagenic event. They are relatively rare. Examples are the photoreactivation repair system which can reverse the UV induced pyrimidine dimer formation and the removal of methyl groups by methyltransferases.

Pyrimidine dimers can be recognized by the enzyme photolyase which binds to the photodimer and, in the presence of visible light in the range 300-500 nm, will split the dimer.

[24-27]

Excision of the modified base

Bases which have been modified by alkylation or deamination may be removed from DNA by special DNA glycosylases.

[24-29] [S31-44]

Each type of modified base has a corresponding DNA glycosylases which removes the base leaving an apurinic or apyrimidinic site in the DNA. These sites are then recognized by AP endonucleases which remove the ribose-phosphate moiety from the backbone. The resulting gap can be reapired by DNA polymerase I and DNA ligase.

The following table lists a number of DNA glycosylases and their activities:

Glycosylase Base(s) recognized Ura-DNA glycosylase Uracil Hmu-DNA glycosylase Hydroxymethyl uracil 5-mC-DNA glycosylase 5-methylcytosine Formamidopyrimidines FaPy-DNA glycosylase 8 hydroxyguanine 5,6-HT--DNA glycosylase 5,6 hydrated thymines (endonuclease III)

9 Excision of modified nucleotides - Nucleotide Excision Repair

The Nucleotide Excision Repair pathway involves the removal of a short stretch of nucleotides containing a major distortion in the DNA double helix (including that caused by pyrimidine dimers). This pathway requires the uvrABC encoded excinuclease, a helicase encoded by uvrD, and DNA polymerase I.

[24-28] [S31-43]

 UvrA is both an ATPase and a DNA-binding protein (it contains Zn-finger motifs). It functions as a dimer and it recognizes and binds to damaged DNA. The function of UvrA is to lead UvrB to the site of damage.

 UvrB is an endonuclease and an ATPase, although the ATPase activity is cryptic and is only revealed when it is complexed with UvrA.

 UvrC then binds to UvrB. This complex nicks the DNA on either side of the lesion or damage. UvrC nicks DNA about 7 nucleotides on the 5' side of the damage; UvrB nicks DNA about 4 nucleotides on the 3' side of the damage.

 The UvrD helicase binds to this region and unwinds it. By so doing, it displaces the short single strand carrying the site of the damage. In total a region of 12-13 nucleotides is removed.

This region is then repaired by DNA polymerase I and DNA ligase.

Fidelity of DNA Replication

The process of DNA replication is remarkably accurate. Errors occur only once every 109 - 1010 nucleotides incorporated.

DNA polymerases, however, are not nearly so accurate. They make mistakes once every 104 - 105 nucleotides incorporated. The proofreading activity of a polymerase will improve the overall error rate by 102 - 103 but this still leaves a difference of 102 - 103 in the error rates between DNA synthesis and replication.

This difference is accomodated by mismatch repair systems which quickly fix any errors made during replication.

Excision of modified nucleotides - DNA Mismatch Repair

This classic repair system is required to repair errors that escape detection by the proofreading systems during DNA replication. DNA Mismatch repair systems can distinguish newly-synthesized DNA from parental DNA by virtue of the fact that the newly- synthesized DNA strands are non-methylated while parental DNA strands are methylated.

DNA in which one strand is methylated and the other non-methylated is described as hemimethylated.

Methylation of DNA is due to the activity of the dam methylase which methylates adenine bases in the sequence GATC. The importance of this methylation for maintaining the integrity of bacterial DNA is confirmed by the observation that dam- strains of E. coli have increased rates of spontaneous mutation.

The mismatch repair system can act at a distance - in other words, a mismatch can be repaired even though the nearest hemimethylated site is 1000 bp away.

Repair requires the products of the mutS, mutL and mutH genes which are believed to function as a complex. These genes were originally identified as MUTATOR genes since mutations in these genes will result in defective repair systems with the consequence that the cells will have a higher rate of spontaneous mutation than usual.

MutS recognizes and binds at the site of a base pair mismatch.

MutH binds at a hemimethyalted GATC sequence and cleaves the nonmethylated strand.

MutL is thought to act as a linker protein which binds MutS and MutH in a complex.

The DNA between the nick caused by MutH and the site of the mismatch is removed by exonuclease I or by exonuclease VII. The UvrD helicase is also involved. The resulting gap is repaired by DNA polymerase III and DNA ligase.

[S31-45]

11 FROM: J. Jiricny (1998) Replication errors: cha(lle)nging the genome. EMBO J. 7:6427-6436. NOTE: The above image may be restricted to users from licensed or registered sites.  View the MutS Exhibit from the Online Macromolecular Museum.

 View the MutH Exhibit from the Online Macromolecular Museum.

Repair and Cancer

In humans, at least one form of cancer is now known to be associated with a genetic defect in a gene whose product is likely to function in a mismatch repair system.

Human nonpolyposis colorectal cancer is associated with defects in a human counterpart to MutS (HNPCC Type 1) or MutL (HNPCC Type 2).

Genetic polymorphisms linked to HNPCC (type 1) were identified in a Newfoundland family and in a New Zealand family. Further isolation and sequencing of the locus identified it as coding for a homolog of MutS. Work to characterize the linkage in the Newfoundland family was carried out by Jane Green in the Faculty of Medicine at MUN. Subsequent work by Terry-Lynn Young identified a second family.

Online Mendelian Inheritance in Man entry on HNPCC (TYPE 1)

Genetic polymorphisms linked to HNPCC (type 2) have been identified in a locus identified coding for a homolog of MutL.

Online Mendelian Inheritance in Man entry on HNPCC (TYPE 2)

Recombination and Repair

12 The repair system known as postreplication repair permits the cell to tolerate damage without actually repairing it. It depends on the mechanisms of homologous genetic recombination to replace a damaged region of DNA that cannot be repaired with a good copy of the same region.

[24-30]

An example or model showing how this system might operate is as follows.

Let us suppose that a DNA molecule has acquired a thymine dimer:

Now also supose that this molecule is being replicated. A PolIII replisome will be unable to correctly copy the thymine dimer. Rather than stall at this point, it may simply skip over the problem:

It is now believed that DNA polymerase II (PolII) reinitiates DNA synthesis downstream of lesions such as thymine dimers.

Now, we are left with two daughter molecules, one of which is complete and one of which has an unpaired region containing a thymine dimer:

This cannot be repaired by the usual repair systems. However, the exposed ssDNA can be bound by the RecA protein which can then catalyse strand exchange with the correctly synthesised daugthter molecule:

This intermediate contains two Holliday junctions which can be cleaved (resolved) by the Ruv proteins to give:

One daughter molecule still contains the thymine dimer but the opposite strand has the correctgenetic sequence. The other daughter now conatins a gap but this gap can be repaired correctly by the usual repair systems.

Note, that under stress conditions, DNA polymerase V (see below) can copy thymine dimers. However, it often misincorporates a guanine nucleotide opposite the second thymine. This accounts for the observation that a thymine dimers (and, specifically, the second base of the dimer) is a hotspot for A -> G transitions.

SOS Repair

14 The SOS repair system is induced in response to major damage to the bacterial DNA or in response to agents which inhibit DNA replication. The system is a complex one with over 20 genes involved. Two of these are the important regulator genes: lexA and recA.

[Figure 10-17 from Snyder & Champness, Molecular Genetics of Bacteria]

LexA is a repressor that regulates the expression of all of the other SOS repair genes, including recA. It also regulates its own synthesis (i.e. it is autoregulatory). Normally, LexA blocks expression of the SOS repair genes.

The RecA protein is a multifunctional protein with ATPase and ssDNA binding activities. When bound by ssDNA, it is also a co-protease. Damage or severe stress to the cell generates ssDNA which activates this co-protease activity. The RecA co-protease activity then stimulates the protease activity of the LexA protein. As a result, LexA is no longer able to block transcription and the SOS repair genes are thereby induced and expressed.

Among the genes that are induced are uvrABC and D and also umuC and umuD. UmuD is cleaved by the RecA coprotease activity and the truncated protein, UmuD', in association with UmuC forms DNA polymerase V. PolV requires the  and  subunit of PolIII for optimal activity. , which functions as the sliding clamp, is required for processivity and  is the clamp loader. DNA synthesis by PolV is error-prone.

RESOURCE MATERIAL

VOET, VOET & 1. Chapter 24, DNA Replication, Repair and PRATT Recombination, pages 798 - 801

STRYER 1. Chapter 31, DNA Structure, Replication, and Repair, pages 811-813 LEHNINGER 1. Chapter 24, DNA Metabolism, pages 831 - 839

TAMARIN 1. Chapter 16, pages 472 - 480. WEB SITES  View the MutS Exhibit from the Online Macromolecular Museum.

 View the MutH Exhibit from the Online Macromolecular Museum.

Format and Original Material © Martin E. Mulligan, 1996-2001

15 Marita Cohn Molecular genetics of telomeres and telomerase

Project description

16 Telomeres are the terminal protein-DNA complexes of linear eukaryotic chromosomes, and are essential to ensure chromosome integrity and stability. Broken chromosome ends, lacking telomeres, show a propensity to fuse with each other and are also susceptible to degradation by exonucleases. Among a wide variety of eukaryotic species, the telomeric DNA consists of typically G-rich tandem repeats, 5-8 bp in length. These repeats are synthesized by telomerase, a telomere-specific RNP polymerase, which uses an internal RNA moiety as a template sequence for this procedure. In a reverse-transcriptase like manner, telomerase copies part of this RNA sequence into DNA.

The mechanism of telomere elongation by telomerase. In this example the telomerase enzyme is synthesizing the repeated sequence TTGGGG, which is the telomeric sequence of Tetrahymena thermophila.

The first detection of telomerase activity, in the ciliate Tetrahymena thermophila, was followed by its detection in a variety of organisms including vertebrates, yeast, and plants. In the absence of telomerase activity, telomeres shorten with each cell division. Normal human somatic cells lack detectable telomerase activity, whereas telomerase is activated in germ cells, immortalized cells and the majority of primary tumors. The correlation between telomerase activity and tumor growth has spurred

17 investigations of the possiblities to use telomerase activity as a target for anticancer drug treatments.

Our identification of much longer telomeric repeat units (16-26 bp) in several yeast species has expanded the previous range of telomeric repeat sequences to include not only more complex sequences, but also ones that are not necessarily G-rich. Despite a marked telomeric sequence diversity, all the yeast species examined show a conserved core. This may be partly explained by the preservation of a binding site for the RAP1 protein.

The length of telomeres are regulated, so that each species has a defined average mean length. The RAP1 protein has been shown to play a key role in a negative-feedback mechanism that controls the length of telomeric repeat tracts in yeast. A model has been proposed where the number of bound RAP1 protein molecules is sensed by the cell, and is used to measure the length of the telomere tract.

The "protein counting" model for telomere length regulation. The RAP1 proteins bind to the telomeric DNA. When a threshold number is reached, further telomere elongation by telomerase is inhibited.

How the "protein counting" mechanism is mediated is still largely unknown, but it has been proposed that the binding of a critical number of RAP1 protein molecules alters the shape of telomeres so that the telomerase enzyme can no longer access the end. When the telomeres shorten and the number of protein molecules decrease, the enzyme would regain its ability to bind and elongate the telomere. Several other yeast telomere binding proteins are involved in the assembly of the functional telomere cap of the yeast chromosome, and are implicated in the regulation of telomere length. How the actions of these proteins are coordinated to maintain telomeres within a defined range has yet to be determined.

18 The telomeric DNA sequences are bound by a number of different proteins which build up a protective cap on the chromosome. The RAP1 protein has been shown to regulate the length of the telomere, probably by controlling the access of telomerase to the end of the chromosome.

We have analyzed the Rap1p protein counting mechanism in two other yeast species; Saccharomyces castellii and Saccharomyces dairenensis, and have shown that they have RAP1 proteins with homologous functions. These species offer an advantage in the prediction of the number of bound Rap1p molecules, because they have homogeneously repeated telomeric DNA sequences, and thus constitute valuable new models for the analyses of the protein counting mechanism.

Fundamental knowledge of telomere maintenance will be of importance for the establishment of the role of telomerase in tumorigenesis. In our project we are characterizing the telomerase enzyme and the mechanisms of its DNA synthesizing activity, and we want to determine what factors that interact with telomerase to regulate its biochemical activity. We recently isolated the S. castellii CDC13 homolog (scasCDC13) and determined that the full-length protein specifically binds single-stranded telomeric DNA. The minimal binding site is an octamer sequence which overlaps the Rap1 binding site. The four nucleotides of most importance for the sequence specific binding were found to be conserved among telomeric sequences of

19 various different species, including those in human telomeres. Thus, further analysis of scasCdc13p function is promising interesting data on the details of the molecular mechanisms involved in telomere maintenance.

Telomerase is an enzyme that adds specific DNA sequence repeats ("TTAGGG" in all vertebrates) to the 3' ("three prime") end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. The telomeres contain condensed DNA material, giving stability to the chromosomes. The enzyme is a reverse transcriptase that carries its own RNA molecule, which is used as a template when it elongates telomeres, which are shortened after each replication cycle. Telomerase was discovered by Carol W. Greider and Elizabeth Blackburn in 1985 in the ciliate Tetrahymena.[1] There are some indicators that telomerase is of retroviral origin.[2]

Why do some cancer cells divide not into two, as cells are supposed to do in mitosis, but into three-four new cells that look thoroughly abnormal? This question was raised as early as the 1890s by the German tumor researcher David Hansemann, who could observe the strange mitosis even using the microscopes of his day. Now another David, Lund University researcher David Gisselsson, has found an answer.

Together with associates from the Section for Clinical Genetics, David Gisselsson has long been studying chromosome changes in various sorts of cancer cells. Contrary to the earlier belief that tumor cells are rather stable genetically, a few years ago he was able to show that genetic chaos prevails in certain severe cancer forms.

"The normal number of chromosomes in a human cell is 46. But in tumors from skeletal and pancreatic cancer, some cells can have far fewer than 46 chromosomes while others have several hundred. The structure of these chromosomes is also often abnormal-for example, they have lost some parts, traded segments with each other, and copied certain genes in mass production," says David Gisselsson.

The Lund scientists have scrutinized these phenomena in a series of studies. They have been able to demonstrate that certain tumor cells get stuck in mitosis, so that their chromosomes do not divide neatly in two directions, but rather get pulled apart in a disorganized manner into the daughter cells. This is because the ends of the chromosomes, the so-called telomers, have lost their protective exteriors.

20 Cells with truncated, unprotected telomers from different chromosomes actually ought to simply die, but this does not happen in these tumor cells. Instead, the naked telomers cling to each other. This can be the explanation for the abnormal number of chromosomes in some tumor cells, where certain ones have incorporated a number of extra chromosomes while others wind up with too few.

Having the wrong number of chromosomes does not lead directly to death in these tumor cells. On the other hand, they have problems with mitosis.

"We have observed that these cells sometimes try to divide, but they fail and go into an idle state. If they then try again, they tend to divide in three or four directions. This explains Hansemann's discovery from the 1890s!" says David Gisselsson.

In its latest study the Lund team has also shown that the daughter cells of those cells which divide in more than two directions have a completely random distribution of chromosomes. This genetic chaos is so great that the cells usually die.

Research groups in several countries have been studying von Hansemann mitosis at the molecular level, that is, what happens inside the cell. But this work has proven to have little relevance to the struggle against cancer. These are not the cells that make a tumor grow, since they themselves typically die off.

On the other hand, the Lund team now wishes to study substances that might be able to counteract cancer by further damaging already truncated telomers. In that way it may be possible to increase the genetic chaos in tumor cells in order to get more of them to simply die.

21 I. Introduction: Definitions and mutation rates

We have been using the term 'mutation' pretty loosely up to this point in the course...now we need to define it more precisely: mutation-- a change in the genetic material (ie. DNA). We are going to spend some time talking about how mutations can occur and what their consequences may be to cells; we will also be looking at the ways in which cells avoid mutations by repairing DNA damage.

Why this focus? Why are mutations important? There are several reasons: 1) they may have deleterious or (rarely) advantageous consequences to an organism (or its descendants); 2) they are important to geneticists: the most common way we study something is to break it--ie., we search for or make a variant (mutant) lacking the ability to perform a process which we want to study. These genetic variants possess mutant alleles of the genes we are interested in studying. 3) Mutations are important as the major source of genetic variation which fuels evolutionary change (as we will see later when we talk about population genetics and evolution).

Let's further define mutation as a heritable change in the genetic material. This point becomes important in multicellular organisms where we must distinguish between changes in gametes (germline mutations) and changes in body cells (somatic mutations). The former are passed on to one's offspring; the latter are not but we will see they can be very important in causing cancer.

In detection of germline mutations in humans and measurement of human mutation rates we have the problem of diploidy. Most forward mutations (normal gene to mutant form) are recessive and so won't be detected unless a zygote gets two copies of the mutant allele. [Reversion or reverse mutation (mutant back to normal) is generally much less frequent because there are a lot more ways to "break" a gene than there are to reverse an existing mutation.] So how can we detect and measure rates of new mutations? We can look at dominant mutations on occuring on the autosomes and at both recessive and dominant mutations on the X chromosome, since males are hemizygous for X-linked genes. Example: achondroplasia occurs sporadically (in families with no previous history) as a result of new mutations in the gene for the fibroblast growth factor receptor. One study detected seven infants born with sporadic achondroplasia in one year among

22 242,257 total births recorded. So the rate (actually a frequency but we won't be concerned about the difference for the purposes of thinking about rates in this course) is 7/242,257 x 1/2 (2 alleles per zygote) = 1.4 x 10e-5.

This rate is roughly in the middle of the range reported for various human genes: those with high mutation rates like NF1 (neurofibromatosis type 1) and DMD (Duchenne muscular dystrophy) (ca. 1 x 10e-4) and those with low rates of new mutation like the Huntington's Disease gene (1 x 10e-6). This hundred-fold range shows that mutation rates per gene can be intrinsically different.

Why might this be? Two possible explanations are: 1) target size and 2) hot spots. Some genes are large, meaning that there are many bases at which mutations could alter or disrupt their function. The large target argument could well be responsible for the high rates of mutation of the NF and DMD genes, as these are known to have very large protein coding regions. Alternatively, some genes may be in regions of chromosomes which are more susceptible to genetic damage/change or may contain sequences which are more likely to be altered by spontaneous mutations; the achondroplasia gene is known to contain a hot spot of the latter type (a CpG sequence, discussed below).

From studies like these in vivo and others using human cells in vitro, the overall human mutation rate is estimated to be about 1 x 10e-6 per gene per generation. (Therefore the HD gene rate is probably more typical than the other genes mentioned above.) This rate is similar to those measured in various prokaryotic and eukaryotic microorganisms. We can use the estimated human mutation rate to determine its impact on the likelihood of changes occurring in each generation: a rate of 1 x 10e-6 mutations/gene x 5 x 10e4 genes/haploid genome = 5 x 10e-2 mutations per gamete (=5/100 or 1/20). 1/20 x 2 gametes per zygote = 1/10 chance that each zygote carries a new mutation somewhere in the genome. This seems like a very high number but we need to remember that most mutations are recessive and thus will not be expressed in the heterozygous condition.

II. Types of Mutations

Mutations, or heritable alterations in the genetic material, may be gross (at the level of the chromosome, which we have already discussed) or point alterations (this technically means mutations not visible as cytological

23 abnormalities and/or those which map to a single "point" in experimental crosses). The latter can involve just a single nucleotide pair in DNA. In this section, we will be considering small changes in DNA, of the point mutation type.

A. Base pair (nucleotide pair) substitutions

These are of two types: transitions (purine to purine or pyrimidine to pyrimidine) and transversions (purine to pyrimidine or pyrimidine to purine). We break these down into the two categories because they can occur in different ways.

The consequences of base substitution mutations in protein coding regions of a gene depend on the substitution and its location. They may be silent, not resulting in a new amino acid in the protein sequence, eg. GCA or GCG codons in mRNA both mean arginine [this is often true in the third position of a codon, especially with transitions because of "wobble" base pairing]. A base substitution could also result in an amino acid substitution; this is referred to as a missense mutation. For example, CTC in the DNA sense strand [GAG in mRNA] will specify a glutamate residue in the protein; this is altered to CAC in the DNA or GUG in the mRNA, resulting in a valine residue in the beta-globin protein chain causing sickle-cell anemia. Missense mutations may have very serious consquences, as in the case of sickle-cell anemia, mild consequences as in the case of hemoglobin C (a different amino acid substitution in position 6 of beta-globin) or no phenotype as in the case of two known amino acid substitutions at position 7 of beta-globin. Finally, base substitutions in a protein coding region may mutate an amino acid codon to a termination codon or vice versa. The former type, which results in a prematurely shortened protein is referred to as a nonsense mutation. The effects of nonsense mutations are variable depending upon how much of the truncated protein is present and is required for its function.

Base substitution mutations may also occur in promoters or 5' regulatory regions of genes or in introns and may affect their transcription, translation, or splicing. Many of the beta-thalassemias are the result of these types of non-structural mutations that affect the level of expression of the globin genes. All of the types of mutation described above have been observed in human globin genes. Their consequences depend on what they do to the level of expression of the gene product and/or on what amino acid substitution may have occurred and where it is in the protein.

24 B. Frameshift mutations

These result from the insertion or deletion of one or more (not in multiples of three) nucleotides in the coding region of a gene. This causes an alteration of the reading frame: since codons are groups of three nucleotides, there are three possible reading frames for each gene although only one is used. eg. mRNA with sequence AUG CAG AUA AAC GCU GCA UAA amino acid sequence from the first reading frame: met gln ile asn ala ala stop the second reading frame gives: cys arg stop

A mutation of this sort changes all the amino acids downstream and is very likely to create a nonfunctional product since it may differ greatly from the normal protein. Further, reading frames other than the correct one often contain stop codons which will truncate the mutant protein prematurely.

III. Origins of spontaneous mutation

A. Definition and sources

A spontaneous mutation is one that occurs as a result of natural processes in cells. We can distinguish these from induced mutations; those that occur as a result of interaction of DNA with an outside agent or mutagen. Since some of the same mechanisms are involved in producing spontaneous and induced mutations, we will consider them together. Some so-called "spontaneous mutations" probably are the result of naturally occurring mutagens in the environment; nevertheless there are others that definitely arise spontaneously, for example, DNA replication errors.

B. DNA replication errors and polymerase accuracy

Mistakes in DNA replication where an incorrect nucleotide is added will lead to a mutation in the next round of DNA replication of the strand with the incorrect nucleotide.The frequency at which a DNA polymerase makes mistakes (inserts an incorrect base) will influence the spontaneous mutation frequency and it has been observed that different polymerases vary in their accuracy. One major factor affecting polymerase accuracy is the presence of a "proofreading" 3'-5' exonuclease which will remove incorrectly paired bases inserted by the polymerase. This was shown in vitro with purified DNA polymerases (those with 3'-5' exonucleases make fewer mistakes) and genetically by Drake with bacteriophage T4 mutants: T4 has its own

25 polymerase with a 3'-5' exo. Drake isolated mutator mutants (which had a higher spontaneous mutation rate than normal) and antimutator mutants (lower mutation rate than normal) in the polymerase gene and showed that the mutators had a higher ratio of polymerizing to exonuclease activity than normal and that the antimutators had a lower ratio. These studies showed that the function of the 3'-5' exonuclease is to prevent misincorporation during DNA replication and to prevent mutations. Mutator mutants have since been isolated in other organisms and have been shown to affect various components of the DNA replication complex; alterations in a number of these proteins are likely to affect the accuracy of the system.

C. Base alterations and base damage

The bases of DNA are subject to spontaneous structural alterations called tautomerization: they are capable of existing in two forms between which they interconvert. For example, guanine can exist in keto or enol forms. The keto form is favored but the enol form can occur by shifting a proton and some electrons; these forms are called tautomers or structural isomers. The various tautomer forms of the bases have different pairing properties. Thymine can also have an enol form; adenine and cytosine exist in amino or imino forms. If during DNA replication, G is in the enol form, the polymerase will add a T across from it instead of the normal C because the base pairing rules are changed (not a polymerase error). The result is a G:C to A:T transition; tautomerization causes transition mutations only.

Another mutatgenic process occurring in cells is spontaneous base degradation. The deamination of cytosine to uracil happens at a significant rate in cells.

Deamination can be repaired by a specific repair process which detects uracil, not normally present in DNA; otherwise the U will cause A to be inserted opposite it and cause a C:G to T:A transition when the DNA is replicated.

Deamination of methylcytosine to thymine can also occur. Methylcytosine occurs in the human genome at the sequence 5'CpG3', which is normally avoided in the coding regions of genes. If the meC is deaminated to T, there is no repair system which can recognize and remove it (because T is a normal base in DNA). This means that wherever CpG occurs in genes it is a

26 "hot spot" for mutation. Such a hot spot has recently been found in the achondroplasia gene.

A third type of spontaneous DNA damage that occurs frequently is damage to the bases by free radicals of oxygen. These arise in cells as a result of oxidative metabolism and also are formed by physical agents such as radiation. An important oxidation product is 8-hydroxyguanine, which mispairs with adenine, resulting in G:C to T:A transversions.

Still another type of spontaneous DNA damage is alkylation, the addition of alkyl (methyl, ethyl, occasionally propyl) groups to the bases or backbone of DNA. Alkylation can occur through reaction of compounds such as S- adenosyl methionine with DNA. Alkylated bases may be subject to spontaneous breakdown or mispairing.

D. Spontaneous frameshift mutations

Streisinger observed in the 1960's that frameshift mutations in bacteriophages tended to occur in areas with "runs" of repeats of one nucleotide.

Example: 5' AGTCAATCCATGAAAAAATCAG 3' 3' TCAGTTAGGTACTTTTTTAGTC 5'

He proposed that these frameshifts are the result of "slipped mispairing" between the template DNA strand and the newly synthesized strand during DNA replication. In the sequence above, a likely spot for frameshift mutations to occur would be in the stretch of 6 A:T base pairs. Subsequent studies with genes from other organisms, including humans, have shown that runs of repeated nucleotides are indeed hotspots for frameshift mutations.

27 IV. Mutagens

A mutagen is a natural or human-made agent (physical or chemical) which can alter the structure or sequence of DNA.

A. Chemical mutagens

The first report of mutagenic action of a chemical was in 1942 by Charlotte Auerbach, who showed that nitrogen mustard (component of poisonous mustard gas used in World Wars I and II) could cause mutations in cells. Since that time, many other mutagenic chemicals have been identified and there is a huge industry and government bureaucracy dedicated to finding them in food additives, industrial wastes, etc.

28 It is possible to distinguish chemical mutagens by their modes of action; some of these cause mutations by mechanisms similar to those which arise spontaneously while others are more like radiation (to be considered next) in their effects.

1. Base analogs These chemicals structurally resemble purines and pyrimidines and may be incorporated into DNA in place of the normal bases during DNA replication:

 bromouracil (BU)--artificially created compound extensively used in research. Resembles thymine (has Br atom instead of methyl group) and will be incorporated into DNA and pair with A like thymine. It has a higher likelihood for tautomerization to the enol form (BU*)  aminopurine --adenine analog which can pair with T or (less well) with C; causes A:T to G:C or G:C to A:T transitions. Base analogs cause transitions, as do spontaneous tautomerization events.

2. Chemicals which alter structure and pairing properties of bases There are many such mutagens; some well-known examples are:

 nitrous acid--formed by digestion of nitrites (preservatives) in foods. It causes C to U, meC to T, and A to hypoxanthine deaminations. [See above for the consequences of the first two events; hypoxanthine in DNA pairs with C and causes transitions. Deamination by nitrous acid, like spontaneous deamination, causes transitions.  nitrosoguanidine, methyl methanesulfonate, ethyl methanesulfonate--chemical mutagens that react with bases and add methyl or ethyl groups. Depending on the affected atom, the alkylated base may then degrade to yield a baseless site, which is mutagenic and recombinogenic, or mispair to result in mutations upon DNA replication.

3. Intercalating agents acridine orange, proflavin, ethidium bromide (used in labs as dyes and mutagens)

All are flat, multiple ring molecules which interact with bases of DNA and insert between them. This insertion causes a "stretching" of the DNA duplex and the DNA polymerase is "fooled" into inserting an extra base opposite an

29 intercalated molecule. The result is that intercalating agents cause frameshifts.

4. Agents altering DNA structure We are using this as a "catch-all" category which includes a variety of different kinds of agents. These may be:

 --large molecules which bind to bases in DNA and cause them to be noncoding--we refer to these as "bulky" lesions (eg. NAAAF)  --agents causing intra- and inter-strand crosslinks (eg. psoralens-- found in some vegetables and used in treatments of some skin conditions)  --chemicals causing DNA strand breaks (eg. peroxides)

What these agents have in common is that they probably cause mutations not directly but by induction of mutagenic repair processes (to be described later).

B. Radiation

Radiation was the first mutagenic agent known; its effects on genes were first reported in the 1920's. Radiation itself was discovered in 1890's: Roentgen discovered X-rays in 1895, Becquerel discovered radioactivity in 1896, and Marie and Pierre Curie discovered radioactive elements in 1898. These three discoveries and others led to the birth of atomic physics and our understanding of electromagnetic radiation.

1. EM spectrum Visible light and other forms of radiation are all types of electromagnetic radiation (consists of electric and magnetic waves). The length of EM waves (wavelength) varies widely and is inversely proportional to the energy they contain: this is the basis of the so-called EM spectrum.

The longest waves (AM radio) have the least energy while successively shorter waves and increasing energy are seen with FM radio, TV, microwaves, infrared, visible, ultraviolet (UV), X and gamma radiation. The portion which is biologically significant is UV and higher energy radiation.

30 2. Ionizing radiation X- and gamma-rays are energetic enough that they produce reactive ions (charged atoms or molecules) when they react with biological molecules; thus they are referred to as ionizing radiation. This term also includes corpuscular radiation--streams of atomic and subatomic particles emitted by radioactive elements: these are of two types, alpha- and beta-particles [alpha are helium nuclei, 2 protons and 2 neutrons; beta are electrons].

UV radiation is not ionizing but can react with DNA and other biological molecules and is also important as a mutagen.

The units now used for ionizing radiation of all types are rems (roentgen equivalent man): 1 rem of any ionizing radiation produces similar biological effects. The unit used previously was the rad (radiation absorbed dose). However, the effects of different types of radiation differ for one rad unit: one rad of alpha particles has a much greater damaging effect than one rad of gamma rays; alpha particles have a greater RBE (relative biological effectiveness) than gamma rays. The relationship between these units is that:

# rads x RBE = # rems

In addition to the energy type and total dose of radiation the dose rate should be considered: the same number of rems given in a brief, intense exposure (high dose rate) causes burns and skin damage versus a long-term weak exposure (low dose rate) which would only increase risk of mutation and cancer.

3. Sources of radiation Natural sources of radiation produce so-called background radiation. These include cosmic rays from the sun and outer space, radioactive elements in soil and terrestrial products (wood, stone) and in the atmosphere (radon). One's exposure due to background radiation varies with geographic location.

In addition, humans have created artificial sources of radiation which contribute to our radiation exposure. Among these are medical testing (diagnostic X-rays and other procedures), nuclear testing and power plants, and various other products (TV's, smoke detectors, airport X-rays).

31 Taken together, our overall total average exposure from all sources is about 350 mrem/year; the major contributor of which is from radon exposure. See the graph on page 281 of your text for the breakdown.

4. Biological effects of radiation Ionizing radiation produces a range of damage to cells and organisms primarily due to the production of free radicals of water (the hydroxyl or OH radical). Free radicals possess unpaired electrons and are chemically very reactive and will interact with DNA, proteins, lipids in cell membranes, etc. Thus X-rays can cause DNA and protein damage which may result in organelle failure, block cell division, or cause cell death. The rapidly dividing cell types (blood cell-forming areas of bone marrow, gastrointestinal tract lining) are the most affected by ionizing radiation and the severity of the effects depends upon the dose received. The information below is based upon accidental exposures of nuclear plant workers and victims of atomic bomb explosions such as those in Hiroshima and Nagasaki: sublethal dose (100-250 rems): nausea and vomiting early; 1-2 wk. latent period followed by malaise, anorexia, diarrhea, hair loss, recovery (latency due to time it takes hematopoetic or other damage to show up) lethal dose (350-450 rems): nausea and vomiting early; 1 wk. latent period followed by above with more severe symptoms including internal bleeding; a 50% chance of death [LD50 : dose at which half of exposed individuals will die; ca. 400 rems for humans]. Death is due to blood cell or gastrointestinal failure. supralethal dose (>650 rems): nausea and vomiting early, followed by shock, abdominal pain, diarrhea, fever and death within hours or days. Death is due to heart or CNS damage.

For the affected tissues and organs, the number of destroyed cells and the likelihood of their replacement determines the survival chances. The long term effects include increased cancer risk and increased risk of mutations in one's offspring.

5. Genetic effects of radiation Ionizing radiation produces a range of effects on DNA both through free radical effects and direct action:

32  -breaks in one or both strands (can lead to rearrangements, deletions, chromosome loss, death if unrepaired; this is from stimulation of recombination)  -damage to/loss of bases (mutations)  -crosslinking of DNA to itself or proteins

The genetic effects of radiation were reported in 1927 in Drosophila by Muller and in 1928 in plants (barley) by Stadler; both showed that the frequency of induced mutations is a function of X-ray dose. Their experiments revealed that there was a linear relationship between X-ray dose and induced mutation level, that there was no threshold or "safe" dose of radiation and that all doses are significant, and finally, that "split dose" experiments showed that the genetic effects of radiation are cumulative.

6. UV (ultraviolet) UV radiation is less energetic, and therefore non-ionizing, but its wavelengths are preferentially absorbed by bases of DNA and by aromatic amino acids of proteins, so it, too, has important biological and genetic effects.

UV is normally classified in terms of its wavelength: UV-C (180-290 nm)--"germicidal"--most energetic and lethal, it is not found in sunlight because it is absorbed by the ozone layer; UV-B (290-320 nm)--major lethal/mutagenic fraction of sunlight; UV-A (320 nm--visible)--"near UV"-- also has deleterious effects (primarily because it creates oxygen radicals) but it produces very few pyrimidine dimers. Tanning beds will have UV-A and UV-B. To see a graphic representation of the wavelengths of UV and ozone absorption, click here.

The major lethal lesions are pyrimidine dimers in DNA (produced by UV-B and UV-C)--these are the result of a covalent attachment between adjacent pyrimidines in one strand. This is shown here for a thymine-thymine dimer and here for a thymine-cytosine dimer. These dimers, like bulky lesions from chemicals, block transcription and DNA replication and are lethal if unrepaired. They can stimulate mutation and chromosome rearrangement as well.

V. DNA repair systems

33 Because DNA damage occurs spontaneously and as a result to ubiquitous environmental agents, most organisms possess some capacity to repair their DNA and DNA is the only macromolecule which IS repaired by cells. We can divide "repair" mechanisms into 3 categories: damage reversal--simplest; enzymatic action restores normal structure without breaking backbone damage removal--involves cutting out and replacing a damaged or inappropriate base or section of nucleotides damage tolerance--not truly repair but a way of coping with damage so that life can go on

We will look at examples of each type of repair, the mechanisms, the consequences of mutations in each, in both model organisms and in humans.

A. Damage reversal

1. Photoreactivation This is one of the simplest and perhaps oldest repair systems: it consists of a single enzyme which can split pyrimidine dimers (break the covalent bond) in presence of light. Click here to see the photoreactivation reaction.

The photolyase enzyme catalyzes this reaction; it is found in many bacteria, lower eukaryotes, insects, and plants. It seems to be absent in mammals (including humans). The gene is present in mammals but may code for a protein with an accessory function in another type of repair.

2. Ligation of single strand breaks X-rays and some chemicals like peroxides can cause breaks in backbone of DNA. Simple breaks in one strand are rapidly repaired by DNA ligase. Microbial mutants lacking ligase tend to have high levels of recombination since DNA ends are recombinogenic (very reactive). A human known only by the code name of 46BR was found to have mutations in both of her DNA ligase I genes; she had poor growth, immunodeficiency, and sun sensitivity and died at a young age of lymphoma. Fibroblast cells from 46BR are sensitive to killing by DNA damaging agents including ionizing radiation. In addition, the rare hereditary disease Bloom syndrome also somehow is involved with DNA ligase deficiency (although the Bloom syndrome protein

34 is a DNA helicase); patients' cultured cells have high levels of chromosome aberrations and spontaneous mutation.

B. Damage removal

1. Base excision repair The damaged or inappropriate base is removed from its sugar linkage and replaced. These are glycosylase enzymes which cut the base-sugar bond. example: uracil glycosylase--enzyme which removes uracil from DNA. Uracil is not supposed to be in DNA--can occur if RNA primers not removed in DNA replication or (more likely) if cytosine is deaminated (this is potentially mutagenic). The enzyme recognizes uracil and cuts the glyscosyl linkage to deoxyribose. The sugar is then cleaved and a new base put in by DNA polymerase using the other strand as a template. Mutants lacking uracil glycosylase have elevated spontaneous mutation levels (C to U is not fixed, which leads to transitions) and are hyper-sensitive to killing and mutation by nitrous acid (which causes C to U deamination).

There are other specific glycosylases for particular types of DNA damage caused by radiation and chemicals.

2. Mismatch repair This process occurs after DNA replication as a last "spellcheck" on its accuracy. In E. coli, it adds another 100-1000-fold accuracy to replication. It is carried out by a group of proteins which can scan DNA and look for incorrectly paired bases (or unpaired bases) which will have aberrant dimensions in the double helix. The incorrect nucleotide is removed as part of a short stretch and then the DNA polymerase gets a second try to get the right sequence.

Human mismatch repair proteins have recently been identified and are very similar to those of the prokaryote E. coli and the simple eukaryote yeast (this is an old invention of cells); mutations are found to be passed in the germline of families with some types of inherited colon cancer (HPNCC).

3. Nucleotide excision repair This system works on DNA damage which is "bulky" and creates a block to DNA replication and transcription (so--UV-induced dimers and some kinds of chemical adducts). It probably recognizes not a specific structure but a distortion in the double helix. The mechanism consists of cleavage of the

35 DNA strand containing the damage by endonucleases on either side of damage followed by exonuclease removal of a short segment containing the damaged region. DNA polymerase can fill in the gap that results. Excision repair is shown here .

Mutants that are defective in NER have been isolated in many organisms and are sensitive to killing and mutagenesis by UV and chemicals which act like UV. Humans with the hereditary disease xeroderma pigmentosum are sunlight-sensitive, they have very high risks of skin cancers on sun-exposed areas of the body and have defects in genes homologous to those required for NER in simple eukaryotes. NER mutants in lower organisms are UV- sensitive and have elevated levels of mutation and recombination induced by UV (because they are unable to use the accurate NER method to remove pyrimidine dimers and must use mutagenic or recombinogenic systems).

C. DNA damage tolerance

Not all DNA damage is or can be removed immediately; some of it may persist for a while. If a DNA replication fork encounters DNA damage such as a pyrimidine dimer it will normally act as a block to further replication.

However, in eukaryotes, DNA replication initiates at multiple sites and it may be able to resume downstream of a dimer, leaving a "gap" of single- stranded unreplicated DNA. The gap is potentially just as dangerous if not more so than the dimer if the cell divides. So there is a way to repair the gap by recombination with either the other homolog or the sister chromatid--this yields two intact daughter molecules, one of which still contains the dimer.

1. Recombinational (daughter-strand gap) repair This is a repair mechanism which promotes recombination to fix the daughter-strand gap--not the dimer--and is a way to cope with the problems of a non-coding lesion persisting in DNA. The events of recombinational repair are shown here . This type of recombinational repair is generally accurate (although it can cause homozygosis of deleterious recessive alleles) and requires a homolog or sister chromatid. The products of the human breast cancer susceptibility genes BRCA1 and BRCA2 may be involved in recombinational repair together with homologs of the yeast RAD51 and RAD52 genes.

36 A second type of recombinational repair which is used primarily to repair broken DNA ends such as are caused by ionizing radiation and chemical mutagens with similar action is the non-homologous end-joining reaction. This repair system is also employed by B and T cells of the immune system for genetic rearrangements needed for their function. The Ku70, Ku80, and DNA-dependent protein kinase proteins are needed for non-homologous end-joining. Rodent cell lines with mutations in these genes are very sensitive to killing by ionizing radiation and defective in immune system rearrangement.

2. Mutagenic repair (trans-lesion synthesis) An alternative scenario for a DNA polymerase blocked at a dimer is to change its specificity so that it can insert any nucleotide opposite the dimer and continue replication ("mutate or die" scenario). See the figure . We know that this can happen in bacteria and think that it probably happens in eukaryotes, though the mechanism is not well understood. This is a reason why repair may sometimes cause mutations.

VI. Checkpoints

Ataxia telangiectasia is a human autosomal recessive hereditary disease which causes several defects including about a hundred-fold increase in cancer susceptibility. AT patients' cells in culture show abnormalities including spontaneous and radiation-induced chromosome breaks and sensitivity to killing by X-rays. (Ironically, the patients also show extreme sensitivity to killing by X-ray doses intended to be therapeutic for their cancers.) However, AT cultured cells do not show a defect in repair of X-ray damage to their DNA; instead, unlike normal cells, they continue to replicate their DNA even when it has been damaged by X-rays. It is the failure to recognize DNA damage and respond appropriately by halting the cell cycle until repair can occur that leads to chromosome aberrations and death after X-ray in the AT patients.

The defect in AT is one in a cell cycle checkpoint, a decision point that governs progression through the next phase of the cell cycle. There are genetically controlled checkpoints that decide entry into a new cell cycle (G0 to G1 point), the decision to replicate the DNA (G1 to S point), and the decision to divide (G2 to M point). Mutations in the checkpoint genes can lead to uncontrolled cell growth, ie. cancer.

37 Although AT itself is a rare condition, it has been estimated that the frequency of heterozygotes with one AT mutation is about 1% in the population. These individuals also have a higher cancer risk and intermediate radiation sensitivity. Thus, screening by X-ray methods (eg. mammography) may increase the chances of an AT heterozygote developing cancer.

Last updated June 14, 1999.

Replication of a circular bacterial chromosome

38 Bacterial chromosomes are circular, and replication proceeds with two replication forks proceeding from an origin of replication (ori) to the terminus in opposite directions. This process is termed bidirectional replication. It is useful to consider one-half of the replicating chromosome at a time. This half-chromosome replicating unit is called a replichore. The two replichores of a circular chromosome undergo very similar processes. (Graphic computer art by Daniel Yuen)

Introduction

A common bacteria that colonizes intestines serves as a excellent example of a bacterium with a circular chromosome. Replication of the Escherichia coli chromosome proceeds in stages, which can be divided into three major headings; initiation, elongation and termination. Bacteria initiate DNA replication at a specific site on the chromosome, the replication origin oriC, from which replication proceeds bidirectionally to the terminus.[1] Initiation proceeds in a series of well defined biochemical steps, and is the only phase of DNA replication that is known to be regulated, but

39 is regulated such that replication occurs only once in each cell cycle. [2] During the elongation phase of replication, two distinct but related events occurs; that is the simultaneous synthesis of the leading and lagging strands. Several enzymes at the replication fork are essential to the synthesis of both strands. Parental strands are first unwound by DNA helicases, and the resulting topological stress is relieved by topoisomerase. Each separated strand is then stabilized by single stranded binding proteins [SSB]. From this point synthesis of leading and lagging strands is very different. Eventually, the two replication forks of the circular chromosome meet at a terminus region containing multiple copies of a 23 base pair sequence called Ter for terminus.[3] The Ter sequences function as a binding site for a protein called Tus (for Terminus Utilization Substance), whereby replication halts when either replication fork encounters a functional Tus-Ter complex.

Initiation

The E.coli bacterial replication origin, called oriC consists of 245 base pairs bearing DNA sequences that are highly conserved among bacterial replication origins. The chromosomal origin, functions as a site where enzymes assemble to form the machinery that will generate the replication fork.[4] Image:Tobeuploaded DNA sequence elements within oriC that are important for its function include DnaA boxes, a 9-mer repeat with a highly conserved consensus sequence 5' - TTATCCACA - 3' [5] , that are recognized by the DnaA protein. DnaA protein plays a crucial role in the initiation of chromosomal DNA replication. [6] Bound to ATP, and with the assistance of bacterial histone-like proteins [HU] DnaA then unwinds an AT-rich region near the left boundary of oriC, which carries three 13-mer motifs [7], and opens up the double-stranded DNA for entrance of other replication proteins.[8] This region also contains four “GATC” sequences that are recognized by DNA adenine methylase (Dam), an enzyme that modifies the

40 adenine base when this sequence is unmethylated or hemimethylated. The methylation of adenines is important as it alters the conformation of DNA to promote strand separation[9] , and it appears that this region of oriC has a natural tendency to unwind.[10]

DNA sequence motifs in oriC of the E. coli. The gray bars represent GATC sequences recognized by DNA adenine methyltransferase. Small blue arrows are 13-mer sequences near the left border of oriC that become single-stranded when oriC is bound by DnaA in association with ATP. The red boxes are DnaA box sequences recognized by DnaA protein. Smaller green boxes represent I sites bound by DnaA-ATP. The site within oriC to which integration host factor (IHF) binds is shown between DnaA boxes R1 and R5 (M). Dashed lines represent two regions bound by SeqA protein. (after Jon M. Kaguni 2006).[11] DnaA then recruits the replicative helicase, DnaB, from the DnaB- DnaC complex to the unwound region to form the pre-priming complex.[12] After DnaB translocates to the apex of each replication fork, the helicase both unwinds the parental DNA and interacts momentarily with primase .[13] In order for DNA replication to continue, single stranded binding proteins are needed to prevent the single strands of DNA from forming secondary structures and to prevent them from re-annealing. In addition, DNA gyrase is needed to relieve the topological stress created by the action of DnaB helicase.

41 Processivity of the DNA pol III replication complex is assured by a clamp. The DNA polymerase beta clamp in more detail (image).

Elongation

DNA-replication illustrated by the bacterial replication fork. The helix unwinds and both strands replicate simultaneously, during the unwinding process. The leading strand replicates continuously from 3' end of existing strand, with newest end of forming strand facing into replication fork. The lagging strand replicates by a series of fragments (Okazaki-fragments placed end-to-end, with newest ends of fragments facing away from fork; the Okazaki-fragments later ligated together. During replication, DNA polymerase III proof-reads for mismatched bases

Bacterial chromosomal replication occurs in a bidirectional manner, and has been investigated both genetically and autoradiographically, whereby results provide clear evidence for bidirectional replication in E. coli. In specific experiments, E. coli cells initiating chromosome replication after release from amino-acid starvation were incubated in [3H]thymine of moderate specific activity, followed by incubation in [3H] thymine plus [3H]thymidine of very high specific activity. The grain tracks produced in autoradiographs of chromosomes were denser on both ends than in the middle. The autoradiographic

42 patterns are, therefore, evidence that replication of the chromosome in E. coli is bidirectional.[1]

 See Figure 4 of D. M. Prescott, and P. L. Kuempel (1972): A grain track produced by an E. coli chromosome from cells labeled for 19 min with [3H] thymine, followed by labelingfor 2.5 min with [3H]thymine and ['H]thymidine. [1].[1]

The E. coli replicase DNA polymerase III is a 900 kD complex, possessing a dimeric structure.Each monomeric unit has a catalytic core, a dimerization subunit, and a processivity component .[14] DNA Pol III uses one set of its core subunits to synthesize the leading strand continuously, while the other set of core subunits cycles from one Okazaki fragment to the next on the looped lagging strand. Leading strand synthesis begins with the synthesis of a short RNA primer at the replication origin by the enzyme Primase (DnaG protein). Deoxynucleotides are then added to this primer by a single DNA polymerase III dimer, in an integrated complex with DnaB helicase. Leading strand synthesis then proceeds continuously, while the DNA is concurrently unwound at the replication fork. In contrast, lagging strand synthesis is accomplished in short Okazaki fragments. First, an RNA primer is synthesized by primase, and, like that in leading strand synthesis, DNA Pol III binds to the RNA primer and adds deoxyribonucleotides. When the synthesis of an Okazaki fragment has been completed, replication halts and the core subunits of DNA Pol III dissociates from the β sliding clamp [B sliding clap is the processivity subunit of DNA Pol III]. [15]The RNA primer is remove and replaced with DNA by DNA polymerase I [which also possesses proofreading exonuclease activity] and the remaining nick is sealed by DNA Ligase, which then ligates these fragments to form the lagging strand. Since replication of a circular chromosome occurs bidirectionally, when the replication fork moves around the circle, a structure shaped like the Greek letter theta Ө is formed. John Cairns provided a well- designed demonstration of E. coli chromosomal replication in 1963. In his experiment, he radioactively labeled the chromosome by growing

43 his cultures in a medium containing 3H-thymidine. The nucleoside base was incorporated uniformly into the bacterial chromosome. He then isolated the chromosomes by lysing the cells gently and placed them on an electron micrograph (EM) grid which he exposed to X-ray film for two months. This Experiment clearly demonstrates the theta replication model of circular bacterial chromosomes.[16]

 See Autoradiograph of intact replicating chromosome of E.coli [2][17]

Termination

Replication termination of prokaryotic occurs at specific sequences called replication termini.[18] In E.coli, there are 10 replication termini (Ter) located in a region opposite to the replication origin (Fig 5).The Ter sites have polarity, that is, they arrest replication forks, when they are present in one orientation with respect to ori, but allow forks to pass through unrestricted in the opposite orientation. The arrangement of the Ter sites forms a replication trap that forces the two forks, initiated at oriC, to meet each other within a well-defined region of the chromosome.[19]

 See locations and sequences of the replication termini of E. coli.(A) Map showing the ori and the 10 Ter sites. (B) The consensus sequence of Ter. [3][20]

The Ter sites specifically interact with the replication terminator protein called Tus, which is a polar contra-helicase, that is, it impedes the DNA unwinding activity of DnaB in an orientation-dependent manner.[21] The crystal structure of the Tus-Ter complex has been solved, and it reveals a protein that has structural asymmetry and has a DNA-binding domain, consisting of a series of β-strands, that invade the major groove of Ter DNA. The crystal structure was originally interpreted to account for replication fork arrest, solely on the basis of Tus-Ter, protein-DNA interaction, that allegedly was strong enough to form a nonspecific barrier, not only to DnaB helicase-catalyzed DNA unwinding, but in principle, to any protein that would unwind DNA .[22] When either replication fork encounters a functional Tus-Ter complex, it halts replication.

44  The crystal structure of the Ter DNA-Tus protein complex (A) showing the nonblocking and the fork-blocking faces of Tus. (B) A cross-sectional view of the helicase-arresting surface.[4][23]

Topoisomerase activities illustrated with on covalently closed circular DNA. Topisomerase enzymes are able to form supercoils in DNA, and interconvert covalentely closed circular DNA and their catenated forms. Replication of the DNA separating the opposing replication forks, leaves the completed chromosomes joined as ‘catenanes’ or topologically interlinked circles. The circles are not covalently linked, but cannot be separated because they are interwound and each is covalently closed. The catenated circles require the action of

45 topoisomerases to separate the circles [decatanation]. In E.coli, DNA topoisomerase IV plays the major role in the separation of the catenated chromosomes, transiently breaking both DNA strands of one chromosome and allowing the other chromosome to pass through the break.[24]

There has been some confusion about the role DNA gyrase plays in decatenation. To define the nomenclature, there are two types of topoisomerases: type I produces transient single-strand breaks in DNA and types II produces transient double-strand breaks. As a result, the type I enzyme removes supercoils from DNA one at a time, whereas the type II enzyme removes supercoils two at a time. The topo I of both prokaryotes and eukaryotes are the type I topoisomerase. The eukaryotic topo II, bacterial gyrase, and bacterial topo IV belong to the type II. We often forget that DNA gyrase does in fact have topoisomerase type II activity; thus, with it being a homologue of topoisomerase IV (also having topoisomerase II activity) we expect similarity in the two proteins' functions. DNA gyrase preliminary role is to introduce negative super coils into DNA, thereby relaxing positive supercoils that come into play during DNA replication. Topoisomerase IV also relaxes positive supercoils, therefore, DNA Gyrase and topoisomerase IV play an almost identical role in removing the positive supercoils ahead of a translocating DNA polymerase, allowing DNA replication to continue unhindered by topological strain. [25] Confusion arises when some scientific literature state that DNA gyrase is the sole enzyme responsible for decatanation. In an experiment conducted by Zechiedrich,Khodursky and Cozzarelli in 1997, it was found that topoisomerase IV is the only important decatenase of DNA replication intermediates in bacteria.[26] In this particular experiment, when DNA gyrase alone were inhibited, most of the catenanes were unlinked. However, when Topoisomerase IV alone was inhibited, decatenation was almost completely blocked. The results obtained suggest that Topoisomerase IV is the primary decatenase in vivo, and although DNA gyrase does play a role in

46 decatenation, its function is not as essential as topoisomerase IV in the decatentation of interlinked chromosomes.

Conclusion

Replication of circular chromosomal DNA. Partially replicated DNA forms a theta structure due to bidirectional replication. It is now known that not all bacteria have a single circular chromosome; in fact, some bacteria have multiple circular chromosomes, and many bacteria have linear chromosomes and linear plasmids. However, in bacterial cells which contain a single circular chromosome, such as E.coli, studies have shown DNA replication to occur at specific sequences called the Origin, and proceed bidirectionally in which the partially replicated chromosome forms a theta like structure. Replication continues until the replication fork encounters a functional Tus-Ter complex, which functions as a molecular trap to halt further replication of the molecule. With the assistance of topoisomerase IV in E.coli, the two catenanted circles are then separated forming two double stranded, circular chromosomes.

Summary

Although it is now well established that not all prokaryotic chromosomes exist as a single circular molecule of DNA as previously thought, it still holds true that in most bacterial cells, the chromosome replicates as a circular structure. The synthesis of a DNA molecule can be divided into three stages: initiation, elongation and termination, distinguished by the reactions taking place, and the enzymes involved. In bacterial cells with circular chromosomes, synthesis occurs at the replication fork, the place at which the DNA helix is unwound from the origin until they have copied the whole replicon. When the replication fork moves around the circle, it occurs

47 bidirectionally, and as a result, a structure shaped like the Greek letter theta Ө is formed. Finally since the bacterial chromosome is a single replicon, the fork meets on the other side and two complete double-stranded circular DNA molecules are formed. In this review, we will be focusing on the replication of circular bacterial chromosomes, and we will use a model prokaryote, namely the common gut bacterium Escherichia coli, to demonstrate how circular DNA molecules in prokaryotic organisms are replicated.

Acknowledgments

This is based on an article by Imalda Devaparanam and David Tribe made available under CC by SA licensing conditions from a University course activity at the Department of Microbiology and Immunology, University of Melbourne, 2007.

48 Mechanisms of Telomere Replication

PI: PRICE, CAROLYN M.

Abstract: Telomeric DNA is packed into a protective complex that acts as a cap over the chromosome end. This cap is essential for preventing chromosome fusions and hence the chromosomal rearrangements that result in cancer. The telomeric cap is a dynamic structure that balances the need to protect the DNA terminus from the DNA repair machinery with the need to allow access to telomerase and other replication enzymes. The architecture of the cap is still unclear, but it seems to be composed of a number of molecular interactions that include DNA-protein or protein-protein interactions with the single-strand overhang on the DNA terminus, the telomeric tract, and subtelomeric sequences. This proposal focuses on the single-strand overhang and its associated proteins because it is a particularly critical component of the cap. The proposal has two main goals: to define the architecture of the telomeric cap by ascertaining how factors that associate with or modulate overhang structure promote cap formation, and to determine how the DNA terminus is processed to generate the precise overhang structure that is required to form a functional cap. The specific aims are as follows: 1. To characterize the telomeric DNA structure generated by leading-strand synthesis in Tetrahymena. This aim tests current models for telomere replication and will establish the structures from which G-overhangs are generated. 2. To investigate the role of telomerase and repair proteins in telomere capping and G-overhang generation and maintenance. This will be achieved by deleting or mutating TERT, Ku70 or Rad51 and determining the effect on overhang structure and cap architecture. 3. To delineate the role of the Tetrahymena G- overhang binding protein in telomere capping and determine whether this protein specifies the boundaries for overhang processing. The Tetrahymena Pot1 homolog (tPot1) will be identified and the effect of tPot1 deletion or mutagenesis on capping and overhang processing will be determined. 4. To characterize the nucleases responsible for G- and C-strand cleavage. In vivo and in vitro processing assays will be developed with artificial telomere substrates. The proposed studies will give a much deeper understanding of the DNA processing

49 reactions that lead to assembly of the terminal DNA-protein complex, the architecture of this telomeric cap, and its role in chromosome protection and stabilization.

Termination of replication

Because bacteria have circular chromosomes, termination of replication occurs when the two replication forks meet each other on the opposite end of the parental chromosome. E coli regulate this process through the use of termination sequences which, when bound by the Tus protein, enable only one direction of replication fork to pass through. As a result, the replication forks are constrained to always meet within the termination region of the chromosome.[15]

Eukaryotes initiate DNA replication at multiple points in the chromosome, so replication forks meet and terminate at many points in the chromosome; these are not known to be regulated in any particular manner. Because eukaryotes have linear chromosomes, DNA replication often fails to synthesize to the very end of the chromosomes (telomeres), resulting in telomere shortening. This is a normal process in somatic cells — cells are only able to divide a certain number of times before the DNA loss prevents further division. (This is known as the Hayflick limit.) Within the germ cell line, which passes DNA to the next generation, the enzyme telomerase extends the repetitive sequences of the telomere region to prevent degradation. Telomerase can become mistakenly active in somatic cells, sometimes leading to cancer formation

50 Telomere shortening

Lagging strand during DNA replication

"Telomeres" shorten partly (see below) because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that

51 RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of lagging strand.

However, in vitro studies (von Zglinicki et al. 1995, 2000) have shown that telomeres are highly susceptible to oxidative stress. Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (ca. 20 bp) and actual telomere shortening rates (50-100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem

52 Origins of Replication

Although the semiconservative nature of DNA replication had been confirmed, many questions about replication remained. One of these questions was: is replication initiated at a specific site on the chromosome, or is it initiated at random sites, or even multiple sites?

The answer to this question depends somewhat on the organism being considered. Bacteria, for example, have a single specific origin of replication; in other words, bacterial replication begins at the same spot on the chromosome every time. In E. coli, this site is called OriC. OriC is a 9 base-pair (bp) sequence that is repeated four times within the region.

Eukaryotes also have specific sites at which replication is originated. However, because eukaryotic cells contain much more DNA than bacteria (humans have approximately 1500 times as much DNA as E.coli), there must be multiple origins of replication on each chromosome in order to replicate all of the DNA in a timely fashion. The amount of DNA replicated from a single origin is called a replicon.

Other research has revealed that DNA replication proceeds bidirectionally from an origin of replication. This means that replication proceeds in opposite directions away from the origin:

Note in the diagram how each original DNA molecule branches, or forks, at the point where replication is occurring. These branch points are called replication forks. Because replication is bi-directional, two replication forks form at each origin of replication. (Some rare examples have been seen where replication is unidirectional from the origin.) The open area of the chromosome between the replication forks is called a replication bubble.

53 DNA Polymerase I

DNA replication is catalyzed by a family of enzymes called DNA polymerases. The first of these enzymes to be discovered, DNA polymerase I, was isolated from bacteria (specifically, E. coli). Characterization of the activity of this enzyme in vitro revealed that it had certain requirements for activity. It needed 5'-triphosphate forms of the four nucleotides, and it required the presence of preexisting DNA. The DNA serves two purposes: 1) it serves as a template for the synthesis of the new DNA (the template determines the sequence of the new DNA strand, through the specificity of base pairing), and 2) it serves as a primer for DNA synthesis. It turns out that DNA polymerase I cannot initiate DNA synthesis without having a free 3'- OH to add a new nucleotide to. DNA synthesis therefore needs a primer, a preexisting piece of nucleic acid to serve as an initiator of DNA synthesis.

DNA polymerase I synthesizes DNA by forming a bond between the 5' phosphate of the incoming nucleotide (the other two phosphate groups from the nucleotide triphosphate are lost) and the 3' OH group of the nucleotide at the end of the growing DNA chain. If you draw this out for yourselves, you'll realize that this means the DNA chain being synthesized grows in a 5' to 3' direction. This is an important rule to remember: DNA polymerase synthesizes DNA only in a 5' to 3' direction.

In addition to its polymerase activity, DNA polymerase I has two other enzymatic activities, both of which are exonuclease activities. Exonucleases are enzymes that digest DNA (cleave phosphodiester bonds), chewing away at nucleotides from the end of the DNA chain. DNA polymerase I has 3' to 5' exonuclease activity, which degrades DNA in a direction opposite to that of synthesis. This provides the enzyme with a proofreading function: if a wrong nucleotide gets inserted into a growing chain, the enzyme can digest it out with the 3' to 5' exonuclease activity (almost like using the delete key while word processing), and insert the correct nucleotide.

DNA polymerase I also has a 5' to 3' exonuclease activity, which degrades nucleic acids in the same direction as synthesis. As we'll see, this activity is used to remove primers during DNA replication.

Multiple Polymerases

DNA polymerase I, it turns out, is not the main enzyme involved in replicating the bacterial chromosome. When the gene encoding the enzyme

54 was mutated in E. coli, the bacteria were still able to replicate their chromosomes. They were, however, deficient in DNA repair. This suggested that DNA polymerase I is primarily involved in DNA repair (although it does play a role in replication, as we will see), and that another yet-to-be- discovered enzyme would be responsible for replication.

Eventually, two other DNA polymerases were identified, and named DNA polymerases II and III. These both had 5' to 3' polymerase activity like DNA polymerase I, and 3' to 5' exonuclease activity. Neither of these enzymes had the 5' to 3' exonuclease activity found in DNA polymerase I. The various enzyme activities of the different polymerases are summarized in the table below.

DNA Polymerase DNA Polymerase Enzyme DNA Polymerase Activity III I II 5' to 3' Yes Yes Yes polymerase 3' to 5' Yes Yes Yes exonuclease 5' to 3' Yes No No exonuclease

DNA polymerase III turns out to be the main enzyme involved in DNA replication. DNA polymerase II is a minor enzyme involved in DNA repair. DNA polymerase I is the main polymerase involved in DNA repair, and plays a specialized role in DNA replication, using its 5' to 3' exonuclease activity.

The Mechanism of Prokaryotic DNA Replication

As mentioned above, DNA replication in E. coli begins at OriC. It starts when the polypeptide products of the dnaA gene bind to the origin. These polypeptides cause localized strand separation. This allows a complex of the protein products of the dnaB and dnaC genes to bind. This complex acts as a helicase, which functions to unwind the DNA further. This unwinding produces the two replication forks. The unwound single-stranded region is kept single stranded through the action of single-strand binding proteins.

55 There are other proteins that are found at the replication forks at this time, but their function is not well understood, so they will not be addressed.

At this point, a primer is needed so that DNA polymerase III can begin to act. As mentioned earlier, DNA synthesis needs a primer, so how is a primer produced? An enzyme called primase serves this purpose, by synthesizing a short stretch of RNA (generally from 5 to 15 nucleotides in length). RNA synthesis does not require a primer, so primase (which is a type of enzyme called an RNA polymerase) is able to synthesize a short primer where needed. Once this primer is made, DNA synthesis can begin, extending the polynucleotide chain originating with the RNA primer. Priming and synthesis occurs on both strands in the helicase complex moves along the parental DNA, shifting the replication fork, and allowing synthesis to continue.

This leads to another problem that has to be solved. As more DNA unwinds, and the replication fork moves along, synthesis of one strand (the lower strand in the diagram) can just continue, following the movement of the replication fork. The other strand being synthesized, however, cannot do this. As the replication fork moves along, it leaves a gap behind, as shown in panel B of the figure. To compensate for this, a second RNA primer must be synthesized a bit behind the first one, and DNA synthesized until it reaches the first primer (this is shown in panel C). You can easily imagine that as the replication fork progresses a bit further, this process will have to be repeated. Therefore, at each replication fork, the synthesis of one new DNA strand (the lower one in the figure) is continuous, while synthesis of the other strand must be accomplished in small increments, short stretch after short stretch; this type of synthesis is termed discontinuous. The strand of DNA that is synthesized continuously is called the leading strand, and the strand that is synthesized discontinuously is called the lagging strand. The small fragments of DNA making up the lagging strand are named Okazaki

56 fragments, after the researcher who discovered them. Okazaki fragments are typically about 1000 to 2000 nucleotides each.

Discontinuous replication solves one problem but still leaves one matter unsettled: the lagging strand will be composed of individual, unjoined fragments of DNA and RNA. This is where DNA polymerase I comes into play. DNA polymerase I uses its 5' to 3' exonuclease activity to digest away the primer RNA, and replaces the primer with DNA by extending the strand from the adjacent Okazaki fragment. At this point all that is left to be done is to physically join the Okazaki fragments. This is accomplished by an enzyme known as DNA ligase. DNA ligase is able to join the 5' end of one DNA strand to the 3' end of another DNA strand.

Eukaryotic DNA Replication

Synthesis of DNA in eukaryotes is less well understood, but the process appears to be basically the same as in prokaryotes, with a few notable exceptions. For one thing, eukaryotic DNA is complexed with histones to form chromatin. Every round of replication, therefore, requires that the histones be removed, then replaced after replication is complete. This requirement understandably slows the whole replication process down.

Eukaryotic cells are also much more complex than prokaryotes, because they contain organelles such as mitochondria and chloroplasts (in plants) that contain their own DNA, which must also be replicated. Eukaryotic cells therefore have more than three DNA polymerases; there have been five DNA polymerases identified so far.

Eukaryotes have another difference: eukaryotic chromosomes are linear, rather than circular as in prokaryotes.

DNA Replication: Summary of Key Points

 DNA replication is semiconservative, with each existing strand serving as a template for the synthesis of a new strand.  Replication begins at specific locations called origins of replication. Replication requires a primer , and proceeds bidirectionally from the point of origin, creating an expanding replication bubble.

57  On one strand (the leading strand), synthesis is continuous; on the other strand (the lagging strand) synthesis is discontinuous, producing a series of Okazaki fragments that must be ligated together.

Replication fork

From Wikipedia, the free encyclopedia

Jump to: navigation, search

Scheme of the replication fork. a: template, b: leading strand, c: lagging strand, d: replication fork, e: primer, f: Okazaki fragments

The replication fork is a structure that forms within the nucleus during DNA replication. It is created by helicases, which break the hydrogen bonds holding the two DNA strands together. The resulting structure has two branching "prongs", each one made up of a single strand of DNA, that are called the leading and lagging strands. DNA polymerase creates new partners for the two strands by adding nucleotides.

Leading strand

DNA replication

58 The leading strand is the DNA strand at the opposite side of the replication fork from the lagging strand. It goes from a 5' to 3' direction, because DNA Polymerase can only synthesize a new DNA strand in a 5' to 3' manner. On the leading strand, DNA polymerase III (DNA Pol III) "reads" the DNA and adds nucleotides to it continuously.

Lagging strand

The lagging strand is the DNA strand opposite the replication fork from the leading strand. It goes from a 3' to 5'.

When replicating, the original DNA splits in two, forming two "prongs" which resemble a fork (i.e. the "replication fork"). DNA has a ladder-like structure; imagine a ladder broken in half vertically, along the steps. Each half of the ladder now requires a new half to match it.

Pol III, the main DNA replication enzyme, cannot work in the 3' to 5' direction of the template strand, and so replication of the lagging strand is more complicated than of the leading strand.

On the lagging strand, primase "reads" the DNA and adds RNA to it in short, separated segments. DNA polymerase III lengthens the primed segments, forming Okazaki fragments. DNA polymerase I then "reads" the fragments, removes the RNA using its flap endonuclease domain, and replaces the RNA nucleotides with DNA nucleotides (this is necessary because RNA and DNA use slightly different kinds of nucleotides). DNA ligase joins thLog in / create account

How to Extract DNA From Fruits

CONTENTS

INTRODUCTION PROCEDURE Summary of the procedure Preliminary operations Preparation of the extracting solution Preparation of the mush Extracting the DNA

59 Filtration Removing the proteins Precipitating the DNA Observation through the microscope CONCLUSION

REFERENCES

Figure 1: Test tube with DNA extract

INTRODUCTION

In recent years, it is not uncommon to read articles on DNA in both scientific and popular magazines. DNA is regularly mentioned in the news and is often featured in TV detective or crime-scene investigation dramas. DNA, also known as DeoxyriboNucleic Acid, is a long molecule that holds the genetic information for all living beings, be it vegetable, animal or a simple microorganisms. It is capable of copying itself and can synthesize

60 RNA (RiboNucleic Acid). In more evolved or complex forms of life, DNA is contained in the nucleus of the cells. Except for the red blood cells of mammalians, which are devoid of a nuclei, all cells of a living being have their own DNA. The cells of an organism use certain parts of the DNA molecule, or genes, to produce the proteins they need to function. For a more detailed description of DNA including its structure, its functions and the mechanism by which proteins are produced, the reader should consult the texts listed [1] the Reference section of this paper, which are well written and contain excellent illustrations. In this article, I describe a simple experiment that will allow you to extract a bit of DNA from a banana, however, you can also try it using other fruits and even vegetables. It is an experiment that can be performed both at home and in a school laboratory.

PROCEDURE

SUMMARY OF THE PROCEDURE The procedure described below exploits the fact that the external membrane of cells and that of their nuclei are composed of fatty substances that can be broken down using a simple detergent. The first operation in this procedure is to break-up the fruit into a pulp or mush so that the cells are separated each from other as much as possible thereby exposing them to the action of the detergent. Secondly, the detergent is added to the pulp of the fruit so as to release the DNA from the cell membranes, which encapsulate it. Thirdly, it is necessary to filter the mixture to separate the nucleic acid from the remains of the cellular membranes. Finally, the DNA is precipitated in alcohol where it becomes visible. The DNA you obtain using this procedure can be observed with a microscope and can be used for other experiments like electrophoresis or other experiments.

PRELIMINARY OPERATIONS

MATERIALS - pot; - thermometer; - plastic salad bowl; - ice cubes; - 50 cc of 70 - 95 % 70-95% isopropyl or denatured alcohol (ethanol) in a closed bottle; - rags and absorbent paper tissues.

METHOD - The day before the experiment, prepare some ice cubes; - at least 2 hours before, place in a freezer a sealed vapor-tight plastic bottle with 50 cc of 70-95% isopropyl or ethyl denatured alcohol. This container must to be closed tightly to prevent alcohol vapors from being released since they are flammable; - 15 minutes before starting the procedure, warm a pot of tap water to 60°C;

61 Figure 2 - Before starting the experiment, it is important to perform the preliminary operations described here .

PREPARATION OF THE EXTRACTION SOLUTION

As mentioned previously, the DNA is held inside the nucleus of the cells of the fruit we are using. To free the DNA, it will be necessary to breakdown the membranes of the cells as well as those of the nuclei. As these membranes are made up of phospholipids, which are molecules rich in fats, we will dissolve them by using a simple household detergent. We will also use a little table salt, which helps to eliminate the proteins, called histones, on which the DNA is wrapped.

MATERIALS - 100 cc of distilled water but tap water can also be used ; - a scale to weigh few grams (if possible); - 3 g of table salt (a half teaspoon); - 10 cc of liquid detergent; - a 10 cc syringe without needle; - a 100 cc beaker; - a glass rod.

METHOD - Pour 3 g of salt and 80 cc of distilled water in a 100 cc beaker; - mix until the salt is completely dissolved; - with the syringe, take 10 cc of liquid detergent and add it to the solution; - add distilled water until you obtain a total volume of 100 cc; - while avoiding to produce bubbles, mix to homogenize the solution; - the extracting solution is ready.

62 Figure 3 - Preparation of the extracting solution (Distilled water, table salt, detergent, syringe, 100 cc beaker and spoon).

PREPARATION OF THE PULP

This operation serves to separate the cells from each other and to better expose them to the action of the extraction solution.

MATERIALS - 100 g of banana (or: kiwi, apple, pear, kaki, peas, onion, etc.); - balance; - knife; - chopping board and fork; - 250 cc beaker; - a teaspoon.

METHOD - Place 100 g of banana (without peel) on a chopping board and crush it with a fork until you obtain a pulp. If you use an onion, with a knife obtain cubes of about 5 mm of side or less. You can also use a mortar or a blender. If so, do not shred the pulp too much; - pour the mush in a 250 cc beaker.

63 Figure 4 - Preparation of the fruit pulp

EXTRACTING THE DNA

The aim of this operation is to breakdown the membranes of the cells and their nuclei to free the DNA. The pulp will heated to 60°C to speed up and help the process of breaking down the membrane walls. Heating the pulp also helps to deactivate certain enzymes like DNase that can degrade the DNA. However, if the pulp is held at an elevated temperatures for too long a time the DNA may begin to fragment du to the heat exposure. For this reason it is advised to cool the pulp after approximately 15 minutes in a bath of chilled water.

Figure 5 - Pour the extraction solution in the pulp and mix.

64 Figure 6 - The pulp should be kept at 60°C for no more than 15 minutes and then chilled to about 0°C for 5 minutes

MATERIALS - thermometer; - pot with water at 60°C; - salad bowl with tap water and ice cubes.

METHOD - Pour the extracting solution on the mush; - place the beaker in a bain-marie in the pot with water at 60°C; - mix the mush so to distribute the extracting solution and to make the temperature uniform; - after 15 minutes, place the beaker in a bain-marie in the water with ice cubes;

- mix the mush to make the temperature uniform; - after 5 minutes, remove the beaker from the cold water and prepare yourself for the filtration

How to Extract DNA From Fruits

G. Carboni, January 2007 Text editing by Donald Desaulniers, Ph.D.

67 FILTRATION

The filtration process is used to collect the liquid rich in DNA and to separate it from the cellular remnants and the other tissues of the fruit, which will be discarded.

MATERIALS - sieve with a diameter of about 12 cm; - coffee filter paper (laboratory filter is too much thick). Kitchen absorbent tissue paper can also be used, provided that it does not have any visible holes; - bowl.

METHOD - place the sieve on the bowl; - take a filter paper, soak it and place it in the sieve; Figure 7 - Filtering the pulp using a sieve, filter - pour a little pulp on the filter, taking care that is goes through paper and a bowl. the filter paper ; - mix with care to help the filtration and avoid ripping the filter paper; - the filtered liquid you will obtain is rich in DNA.

REMOVING THE PROTEINS (optional)

With this additional operation it is possible to obtain a purer DNA extract, but it it is not essential if you want to observe the DNA. Because DNA is wrapped on proteins called histones is will be necessary to remove these proteins to obtain a DNA extract of higher purity. To remove these histones, you can use proteolytic enzymes like Protease. While you can purchase protease in a shop that sells chemical products, you can also substitute it with a substance that is much easier to find; it is found in the juice of the pineapple which that contains Bromelain, a substance able to breakdown proteins into the amino acids of which they are composed.

68 Figure 9 - In a tube, pour 5 cc of filtrate and 1 cc of Figure 8 - Obtaining the pineapple juice. pineapple juice.

MATERIALS - Proteolytic enzyme (ex: Protease or pineapple juice); - a 5 cc syringe without needle.

METHOD - In a tube, pour 5 cc of the filtered solution; - add 1 cc of pineapple juice and mix; - wait 2 - 3 minutes to let to the bromelain react.

PRECIPITATING THE DNA

DNA is quite soluble in water and invisible, while it is insoluble in alcohol wherein it precipitates and becomes visible. By adding alcohol to the DNA filtrate solution in the tube, the DNA is rendered visible.

69 Figure 11 - Tube with DNA of the banana mixed with a numerous tiny air Figure 10 - Very slowly, pour some ice cold alcohol into bubbles freed from the alcohol which is warming up. In the tube and avoid mixing the alcohol with the filtrate. Figure 1, there are less bubbles and the DNA is observed as a milky substance.

MATERIALS - Some tubes for the possible repetition of the operation; - tubes holder; - icy alcohol (kept in a freezer).

METHOD - Slowly, pour in the tube of the previous step some icy alcohol by avoiding it mix with the filtrate; - the volume of the alcohol has to be about the same of that of the solution; - let the tube rest for 5 minutes to allow to the DNA to precipitate and accumulate in the tube.

Now, at the interface between alcohol and the filtrate you should be able to see a milky substance, which tends to increase in volume as time progresses. This milky substance is the DNA of the banana. Unfortunately, inside this milky little mass, you may observe numerous tiny bubbles. The presence of these bubbles is due to the property that the solubility of gases in a cold liquid is higher than in a warm one. While alcohol was in the freezer it likely absorbed some gases that are expelled as the liquid is warmed up.

70 OBSERVATION THROUGH THE MICROSCOPE (optional)

MATERIALS - some clean microscope slides; - hook made with a long metal wire; - dye to stain the nucleus (ex: Toluidine, Methylene Blue, Aceto- Orcein); - dropper; - microscope.

METHOD - with a long metal wire ending with a hook, extract a sample of DNA from the tube and place it on a clean microscope slide; - level the mass on the slide and stain it with a nuclear dye; - if necessary, add a little water and mount the coverslip. Figure 12 - Sample of banana DNA at By observing this preparation under the microscope, do not expect to about 100 X see the well-known double helix ladder structure of the DNA. You (stained with a 1% solution of Toluidine). cannot see it even with an electronic microscope. What you will see are clumps or flocks of DNA material which look like a tangled mass of protein strands as illustrated Figure 12.

CONCLUSION

This experiment was not so difficult to carry out after all, was it not?. The aim of this simple experiment was to provide you with an introduction to the procedures that are used in molecular biology. Often, the techniques used in modern microbiology laboratories are based on simple operations like this one. In other cases the procedures can be quite complex and may involve more sophisticated manipulations and equipment. In all cases a sound knowledge of biology and chemistry is essential to understanding how DNA is used in the fields of life sciences and health sciences. If this experiment has sparked an interest in pursuing future explorations, remember that resources available through the Internet you can lead you to new areas of discovery. If you would like to learn more, look at the document [2] in the References section of this paper. The extraction of the DNA is the first step of many other fascinating experiments.

BIBLIOGRAPHY

1 - Helena Curtis, N. Sue Barnes; "Biology"; Worth Publishers, Inc., New York; A biology text for high schools.

2 - http://www.funsci.com/texts/wsites_en.htm Look for the term: "SAPS". You will find the directions to made other interesting and fun experiments in biology.

Internet keywords: dna extraction, dna proteins amino acids ribosome.

71 357نبت: مبادئ الوراثة الجزيئية 2(1+1) التركيب البنائي للــ DAN و الــ RNA التكاثر الذاتي للـــ DNA ؟ الشفرة الوراثية، نسخ وترجمة المادة الوراثية DNA والوحدات الوراثية، توازن تركيب الجينات والسلسل الببتيدية، وظائف البناء المتشابه والبناء المختلف للــ DNA ؟ إعادة تنظيم المادة الوراثية في البكتيريا، البلزميدات والبيسومات والـ DNA ؟ تعديل التعبير عن الجينات.

نننن نننن » علم الحياء الجزيئ

يقوم علم اليحياء الجزيئي أو البيولوجيا الجزيئية (بالنجليزية: Molecular biology) بدراسة الحياء على المستوى الجزيئي ، لذلك فهو يتداخل مع كل من علم الحياء و الكيمياء في عدة فروع و يتقاطع مع الكيمياء الحيوية و علم الوراثة في عدة مناطق و تخصصات . تهتم البيولوجيا الجزيئية بدراسة مختلف العلقات المتبادلة بين كافة النظمة الخلوية و بخاصة العلقات بين الدنا و الرنا و عملية الصطناع البروتيني إضافة إلى آليات تنظيم هذه العملية و كافة العمليات الحيوية .

يصف وليم أستبوري علم الحياء الجزيئي في مقالة له في مجلة نيتشر :

" ... مممم ممم ممممم مم مم ممممممم مممممم مم مممم ممم مم مممم ممممممم مممممممم مم مممم ممممم ممممم ممم ممممممم م مممممم ممممممم مممم ممممممم مم ممم مممممم مممممم . ممم ممم مممم ممممم مممممم مممممممم ممممممم م ... مممم مممم مممممم ممم ممممم مممممممم ممممممم م ممممممممم مممممممم مممم مم ممممم ممم ممم ممممممم ممممممم morphology مم ممممممم ممممم مممممم genesis م ممممممم . "

[عدل] العلقة بعلوم اليحياء الخرى على المستوى الجزيئي

72 ،،، ،،،،،، ،،،،،،، ،،، ،،،،،،،، ،،،،،،،، ،،،، ،،،،،،،، ،،،، ،،،،،،، ،،،،،،،.

الباحثون في الحياء الجزيئية استخدموا تقنيات محددة منشؤها علم الحياء الجزيئي, ولكن مع تزايد الجمع بين هذه الفكار من تقنيات و علم الوراثه وعلم الكيمياء الحيويه و الفيزياء الحيويه مع انه ليس هناك ترابط بين هذه المجالت كما كان من قبل. الشكل التالي يمثل مخطط علقه بين بعض تلك المجالت

 الكيمياء الحيوية: هي دراسة المواد الكيميائية والعمليات الحيوية اللذان يحدثان في الكائنات الحيةة.  علم الوراثة: هو دراسة تأثير الختلفات الوراثية على الكائنات الحية. كثيرا ما يمكننا هذا من الستدلل علي غياب نمكون طبيعي (ومثال على ذلك: - جين واحد).

دراسه "المسوخ" الكائنات التي تفتقر الي واحد او أكثر من العناصر الفنية فيما يتعلق بما يسمي " و و بالنوع نالبري " أو نمط ظاهري طبيعي. التفاعلت الوراثية مثل epistasis يمكن أن تفند تفسيرات بسيطة في أغلب الحيان مثل هذه الدراسات "القاضية".

 علم الحياء الجزيئي : دراسه السس الجزيئيه من عمليه النسخ والستنساخ والترجمه

الجينيه. العقيدة المركزية لعل م الحياء الجزيئي حيث أنة نمادة وراثية سن س خت إلى آر إن أي وبعد ذلك ترجمت إلى البروتين، على الرغم م ن أن وهناك وصورة سم وب والغة في تبسيط علم الحياء الجزيئي ، ول يزال يوفر نقطه انطلق جيده لفهم الميدان. بيد ان هذه الصوره يجري تنقيحها في ضوء الدوار الجديده الناشئه للرنا .

سمعظم العمل في علم الحياء الجزيئي كمي ، تم انجاز الكثير من العمل المشترك في البيولوجيا الجزيئيه وعلوم الحاسوب والمعلوماتية الحيوية وعلم الحياء الحسابي . اعتبارا من مطلع العشرين ، ودراسه بنية الجينات وعلم الوراثه الجزيئية كان الحقل الثانوي البرز لعلم الحياء الجزيئي.

73 تركز على نحو متزايد العديد من الحقل الخرى لعلم الحياء على الجزيئات ، إما دراسة مباشرة و لتفاعلتهم في أماكن تواجدهم مثل في علم الحياء الخلوي وعلم الحياء التطوري ي ، أو بشكل غير و مباشر ، حيث تقنيات علم الحياء الجزيئي تستعمل لستنتاج الخواص التأريخية من السكان أو النوع، كما في مجالت علم اليحياء المتطورة مثل علم وراثة السكان و علم الوراثة العرقي phylogenetics . وهناك ايضا تقاليد عريقه دراسه الجزيئات البيولوجية "من الصفر" في الفيزياء اليحيوية .

[عدل] تقنيات اليحياء الجزئية

منذ أواخر خمسينات وأوائل نالستينات ، تعلم علماء الحياء الجزيئي كيفية تمييز وعزل ومعالجة المكونات الجزيئية للخليا والكائنات الحية. نتتضمن هذه نالمكونات الدنا (DNA) مستودع المعلومات الوراثية ؛ الرنا (RNA) الشبيه بالدي إن أي (DNA) . الذي وت ستراوح ووظائفها م ن والع ومل كالنسخة العاملة المؤقتة ل (DNA) دنا إلى هيكلية فعلية ومهام انزيمية كذلك الوظيفيه والهيكليه من أجهزة النقل. والبروتين هو الهيكل الرئيسي والنوع النزيمي للجزيئات في الخليه.

74 تسلسل مواقع القطع Recognition Sites لبعض النزيمات القاطعة

النزيم القاطع المصدر المقطع الذي تمميزة GGATCC Bacillus amyloliquefaciens H BamHI GAATTC Escherichia coli RY13 EcoRI GGCC Haemophilus aegyptius HaeIII AAGCTT Haemophilus influenzae Rd HindIII GTTAAC Haemophilus parainfluenzae HpaI CCGG Haemophilus parainfluenzae HpaII GATC Moraxella bovis MboI GCGGCCGC Nocardia otitidis-caviarum NotI GGCCNNNNNGGCC Streptomyces fimbriatus SfiI TCGA Thermus aquaticus TaqI

خريطة القطع المحددة RFLP's Map

لقد أنشاء العلماء خريطة تسمى خريطة القطع المحددة لكثير من الكائنات الحية.و هذه الخريطة تبين مكان القطع و محلها مقارنة بالقطع الخرى .و عملت هذه الخريطة عن طريق تقطيع جميع الكروموسومات بإضافة أنواع مختلفة من النزيمات القاطعة ثم رتبت هذه القطع بشكل منتظم.و كان الهدف من هذه الخريطة هو لتحديد نقاط و علمات على طول الشريط الطويل من الدي إن أي التي تتركب منه الكروموسومات و لكي يستطيعوا أن يقارنوا بين هذه القطع في الكائنات المختلفة.

خريطة للقطع المحدودة لـليمبدا فيج و فيروس الدينوفيرس.توضح مواقع القص لثلث أنواع من النزيمات القاطعة BamHI, EcoRI, and (( HindIII

75 فصل قطع الدي إن أي على لوح من الجل بالكهرباء(Gel Electrophoresis)

استعمل العلماء تقنية فصل البروتينات عن بعضها البعض بطريق انتقالها(رحلن) و انفصالها عن بعضها البعض، و ذلك عن طريق تعريضها إلى تيار كهربائي و هي على لوح من المادة الهلمية المعروفة بالجل.ولقد استعمل العلماء نفس الفكرة في فصل قطع الدي إن أي عن بعضها البعض.ومن المعروف أن الحمض النووي عبارة عن شحنة سالبة و لذلك فعند و ضع بعض من الدي إن أي في طرف من أطراف لوح الجيل ثم وتعريضها لتيار كهربائي بحيث يكون القطب السالب عند الطرف الذي وضعنا فيه الدي إن أي و القطب الموجب عن الطرف الخير من ألواح فان الدي إن إي ينتقل تلقائيا بتجاه الطرف الذي فيه

القطب الموجب و تتوقف حركة قطع الدي إن أي على حسب إحجامها على طول اللوح.فالقطع الصغيرة تتحرك بشكل اكبر من القطع الكبيرة. و بذلك يمكن فصل هذه القطع عن بعضها البعض.و يمكن تحديد ا لحجم الفعلي لكل قطعة عن طريق إضافة قطع معروفة الحجم من الدي إن أي و التي تكون مقياس يرجع إليه لستنتاج أحجام القطع.

وهناك نوعان أساسيان من ألواح الجيل.الول يسمى بجيل القروز (Agarose gel ) و الثاني بجيل البولي اكريليميد(Polyacrylamide gel ).و نظرا لصغر الفراغات التي بين البولي اكريليميد فانه يستخدم لفص القطع الصغيرة الحجم من الدي ان أي و في العادة التي تكون اصغر من 500جزيء من الحمض النووي و التي تتفاوت بين بعضها البعض بجزيء أو جزيئين (انظر الرسم A)..بينما يستخدم القروز للحجام الكبر من الدي إن أي. و التي يتراوح حجمها بين 300 إلى 10000 جزيء من الدي إن أي (انظر الرسم B)..ومادة القروز هي مادة سكرية مستخرجة من الطحالب و عند تحضيرها فإنها تشبه في قوامها الجيلتين الذي نأكله و لكنها أقوى في قوامها بعض الشيء و لكنها قابلة للتهتك أو النقطاع عند نقلها بغير حرص. و لقد واجهه العلماء صعوبات في فصل القطع الكبيرة من الدي إن أي و ذلك لن هذه القطع و عند وضعها على جيل القروز و بعد تسليط التيار الكهربائي عليها تتوقف لنها تتمدد بشكل متعرج على شكل ثعبان ملتوي طرف باتجاه القطب السالب و الخر بتجاه القطب الموجب.و لقد حلت هذه المشكلة عن طريق تعريض جل القروز إلى مستويات متفاوتة من القوة الكهربائية على طول اللوح و بذلك فان قطعة الدي إن أي الطويلة عندما تتعرض إلى تيار كهربائي مختلف

76 يجعلها تعدل من تمددها المتعرج قبل أن تدخل في التيار الكهربائي الجديد و يستمر هذا التفاوت في التيار و التعديل في قوام القطعة حتى تصل إلى المكان الذي يجب أن تقف فيه حسب حجمها. و يسمى هذا النوع من الفصل بالفصل عن طريق المجال الكهربائي المتردد (Pulsed-field gel electrophoresis ).و أمكنت هذه التقنية من فصل قطع كبيرة من الدي إن أي و حتى فصل قطع من الكروموسومات على الجل و تتراوح القطع التي يمكن فصلها بهذه الطريقة بين 220000 إلى 2.5 مليون جزيء من الدي إن أي (انظر الرسم .(C

ل تكون القطع المفصولة بالبولي اكريليميد و القروز واضحة للعيان و لذلك فان لوح الجيل يعرض إلى مادة لصباغة الدي ان أي و اشهر هذه المواد هو مادة برميدات الثيديوم ( Ethidium Bromide )و التي تلمع عند تعريضها للشعة فوق البنفسجية.و هناك طريقه أكثر دقه لمشاهدة القطع على لوح الجيل و هذه الطريقة تعتمد على إضافة مادة مشعة نووية إلى الدي إن أي قبل أن يوضع على لوح الجيل و لكن هذه الطريقة تحتاج إلى احتياطيات معينه لكي ل تضر بمن يستخدمها.

معرفة التسلسل النووي(DNA sequencing )

ل شك أن العلماء يحتاجون إلى معرفة التركيبة التسلسلية لكل جين و هذا يمكنهم من معرفة المزيد عن البروتين الذي يصنعه ذلك الجين وعن التركيبة التنظيمية لعمل الجين و قد يصلون على ضوءه إلى معرفة المور التي تتحكم في عمله.كما انه بمعرفة التسلسل النووي للجين يمكن مقارنته بالجينات التي سبق اكتشافها و هذا قد يعطي معلومات غزيرة عن وضيفة هذا الجين و يختصر الكثير من البحاث

و يتجنب اعادة اجرائها.وهناك طريقتان أساسيتان لمعرفة التسلسل النووي لي قطعة من الدي إن أي.الولى تسمى بالطريقة النزيمية (

77 Enzymatic method ) و الخرى بالطريقة الكيميائية(Chemical ).و لقد طغت الطريقة الولى حتى أصبحت هي الطريقة الكثر استعمال.

الطريقة النزيمية (Enzymatic method ): يطلق على هذه الطريقة أيضا طريقة سنجر ( Sanger procedure )نسبة إلى د.فريدريك سنجر و الذي أسس هذه الطريقة.كما أنها أيضا تعرف التسلسل عن طريق دي ديوكسي (dideoxy sequencing).و تترتكز هذه الطريقة على مفهوم يختلف الديوكسي نيوكلويتيد عن دي ديوكسي أن شريط الدي إن أي في الساس مبنى من جزيئات بيوكلوتيد بعدم و جود مجموعة (هيدروكسي)في من الديوكس النقطة الثالثة من حلقة السكر الخماسية الشكل.

نيوكلويتيد (deoxynucleotides (dNTPs )و يوجد على النقطة الثالثة من حلقة السكر الريبوزي مجموعة مؤكسدة أي مجموعة هيدروكسيه( OH)و هذه النقطة هي التي ترتبط في النقطة الخامسة من الجزيء الذي يليها و هكذا يتم الترابط نلتكون شريط طويل من الدي إن أي.و لقد قام د.ستنجر بالستفادة من هذه الخاصية نفبدل الجزيء من (OH)إلى (H ) عن طريق إضافة دي ديوكسيو بيوكلوتيد(ddNTPs) بدل من ديوكسي نيوكلوتيد(dNTPs ) و ذلك عن طريق نسخ الشريط مرة أخرى و هذا يؤدي الى توقف ترابط الجزيئات و يكون في طرف كل جزيء نوع واحد من الحماض النووية.

و إليك الخطوات الساسية للقيام بهذا الختبار بالترتيب:

1- القيام بنسخ الدي ان أي و ذلك على الشكل التالي:

أ- أضف إلى عينة الدي إن أي قطع من البريمر(specific primer)يعرف انه سوف يلتصق بالدي إن أي المراد نسخة و نمعرف(ملتصق بطرفة) بعنصر مشع.

ب- قسم العينة إلى أربع أنابيب اختبار و كل أنبوبة اكتب عليها السماء التالية (,dGTP, dATP ..(dCTP, and dTTP

ج- أضف إنزيم البولمريز ( DNA polymerase)

د-أضف إلى كل أنبوبة نوع واحد من الدي ديوكسي نيوكليتيد حسب اسم النبوب.و أضيف معه كمية من ديوكسي نيولكليتيد.سوف يحدث التفاعل و يبداء البريمر ببنان و تركيب و رص هذه الحماض النووية.وعند إضافته لدي ديوكسي نيوكليتيد فان الشريط يتوقف على هذه النقطة.ثم يحدث تفاعل أخر لنسخ شريط أخر و عند إضافة دي ديوكسي نيوكليتيد يتوقف التفاعل و هكذا تستمر العملية و ينتج عندي في النهاية قطع منسوخة و متفاوتة الطول في كل أنبوب اختبار.

2- أضيف كمية من كل الربعة أنابيب في حقل خاص على لوح القروز ثم امرر تيار كهربائي و من ثم تظهر على طول اللوح القطع المنسوخة و المتفاوتة الطوال كل حقل يعطيني ترتيب القطع.

78 3-تعريضها للشعة(Autoradiography) لكي يتسنى رؤية الدي إن أي و الذي عليه مادة مشعة.

4- ابدأ بقراءة لوح القروز من أسفل إلى أعلى.وكل ما مر على نسخة من الدي إن أي اعرف ترتيب و نوع الديديوكسي نيوكليتيد الذي في طرفة و استمر في القراءة إلى أن ينتهي لوح القروز.

و لتسهيل عملية القراءة استخدم الكمبيوتر لكي يقرأها بشكل إلي و ذلك بتعريض لوح القروز إلى أشعة ليزر و عن طريق وحدة استشعار و مضخم للنبضات (photomultiplier ) يستطيع الكمبيوتر أن يحدد نوع الدي ديوكسي نيوكليتيد و ثم يرتبها و يطبعها و يعطيك رسما بيانيا لماكن كل حمض نووي و باللوان.و ل تستخدم المواد المشعة في القراءة اللية بالكمبيوتر بل يستعاض عنها بمادة مضيئة( fluorescent ) توضع على البريمر على أن يكون لكل دي ديوكسي نيوكليتيد لون مختلف عن الخر(أي أربعة ألوان من المادة المضيئة) و بذلك يمكن أن تمر جميع القطع في ممر واحد كما هو واضح في الرسم الجانبي. و نظرا إلى أن جهاز الكمبيوتر قابل للخطاء فانه يلزم التدقيق و المراجعة لتفادي حدوث الخطاء.و لقد قامة أجهزة كمبيوتر عملقة تعمل على مدار الساعة و تحت مظلة مشروع الجينوم البشري بالكشف الكامل( 99% تقريبا )من التسلسل النووي لجميع الدي إن أي الموجود في النسان و قد سبق ذلك الكشف عن التسلسل النووي لكثير من الكائنات الحية و العمل جاري لمعرفة المزيد.

79 الناقلت ( Vectors)

الناقل و التي تسمى باللغة النجليزية "فيكتور" هي في الغالب فيروسات أو قطع من الحمض النووي موجودة في البكتيريا.كما أن هناك أنواع صناعية تم صنعها في المختبرات الطبية و هي في العادة مواد شبه صناعية لنها في الصل مصنعة من مواد موجودة في الطبيعة.و من لديهم اهتمام بالبروتكولت و الطرق التعامل مع هذه الناقلت اقترح عليك مراجعة هذه الصفحة ولتي تحتوي على العديد من الروابط المتعلقة بالعناية بالناقلت ( اضغط هنا )

البلزميد ( Plasmid )

و هي من اشهر الناقلت ،و هو عبارة عن قطعة صغيرة من الحمض النووي قابلة للتكاثر بمعزل عن بقية الحمض النووي الموجود في الكروموسومات .و هي شبيهة بالفيروس الصغير و لكنها ل تحتوي على طبقة خارجية من البروتين.

. و البلزميد عبارة عن قطعة من الحمض النووي موجود في البكتيريا خاصة في الي كولي(E.Coli) و بعض أنوع الخميرة ( Yeast) .و لدية القدرة على التكاثر الذاتي و بمعزل من بقية الكروموسومات

الموجودة في الخلية.كما أن هناك بلزميدات تستطيع التكاثر داخل البكتيريا و الخميرة في آن واحد. و يوجد نوعان من البلزميد على حسب نوع الحمض النووي فيها فهناك البلزميد المصنوع من الدي إن أي ( DNA ) و نوع أخر مصنوع من الر إن أي (RNA ). و هناك أنواع عديدة من البلزميد فمنها الصغير و منها الكبير كما أن منها ما ل يحتوي على أي جين بينما هناك أنواع كبيرة تحتوي على عدة جينات.و بالضافة إلى وحدة التكاثر الذاتي الموجد على البلزميد هناك الكثير من الجينات التي قد تكون على البلزميد و هي مفيدة للعلماء في عملية نسخ الجينات و القطع النووية فمثل فد يوجد على البلزميد جين خاص يكافح المضادات الحيوية كالمبيسيلين و التترسيكلين .و هذه الجينات الحامية من المضادات الحيوية تساعد في التعرف و عزل البكتيريا التي تحتوي على البلزميد الذي عليه الجين الذي كنا ننوي استنساخه (للمزيد راجع عملية نسخ الجينات و القطع النووية)و يعتقد نظريا أن الفيروسات المنتشرة في الصل كانت بلزميدات حيث أنها اكتسبت غلف بروتيني خارجي و أصبحت فيروسا..

80 الناقلت أنواع البلزميد التي تنمو في خميرة الخبز الفيروسية ( Viral : (Vectors

إن اشهر YIP, yeast integrating plasmid = selectable marker هذه النواع هي cloning sites+ الفيروسات البكتيرية المعروفة بالفيج ( Phage YRP, yeast replicating plasmid = YIP + ARS origin of). و هي عبارة replication عن قطعة من الدي ان YEP, yeast expression plasmid = YIP + 2 micron origin أي مغطاة of replication بغلف بروتيني. YCP, yeast centromere plasmid = YRP + centromere ومن اشهر sequence أنواع الفيج ما يسمى بفيج لمدا (lambda phage) و هو فيروس موجود في الي كولي E. coli. وهذا النوع من الناقلت تستطيع أن تحمل قطعة من الدي إن أي حتى غاية كيلوبيز.و لقد رحورت هذه الفيروسات لكي تستطيع حمل كمية اكبر من الدي إن أي.فعل سبيل المثال الكوزميد ( Cosmids ) عبارة عن تهجين جزء(قطعة من الدي ان تسمى اللصقة cohesive sequence و تعرف مختصرة بالكوز Cos sequence) من فيج ليمبدا(Phage ) مع بلزميد (Plasmid ) و الذي يستطيع نقل حتى 40 كيلوبيز (40kb ) و الباك الفيروسي المسمى بكروموسوم بي 1 الصناعي (PAC P1- derived Artificial Chromosomes / ) عبارة عن تحوير للفيج بي P1 Bacteriophage) 1 ) و إضافته إلى البلزميد..

Cos sequence from Lambda phage + Cosmid Plasmid PAC P1 Phage + Plasmid Modified E.coli fertility plasmid- BAC factor

الناقلت الكروموسومية الصناعية (Artificial Chromosomes ):

نظرا للحاجة إلى نقل إحجام كبيرة من الدي إن أي فقد قام بعض العلماء بتحوير بعض الناقلت الطبيعية لكي تقوم بهذه المهمة.و يوجد حاليا ناقلت على شكل كروموسوم و فيها القطع الساسية لكي تعمل على شكل كروموسوم.و من هذه النواع ما يعرف بــ الياك او كروموسوم الخميرة الصناعي(Yeast Artificial Chromosomes / YAC ) و الذي يستطيع نقل أكثر من 500 كيلوبيز (kb 500 ).و الياك عبارة عن قطعة من الدي ان أي مترابطة و تحتوي على طرفين للكروموسوم(Telomeres 2) و

81 مركز للكروموسوم(Centromere) و مركز للتكاثر(Autonomous replicating sequence ARS).بينما الباك البكتيري(Bacterial Artificial Chromosomes / BAC )و الذي يستطيع حمل حتى 150 كيلوبيز (kb 150 ) هو تحوير للبلزميد المعروف ببلزميد تناسل بكتيريا اليكولي(E.coli .((fertility plasmid-factor

حجم الدي ان أي نوع الناقل Vector الذي يستطيع حملة 10 -0 البلزميد Standard plasmid KB Kb 0-23 لمبدا بكتيريوفيج محور Lambda Bacteriophage

30-44 كوزميد Cosmid Kb 70-100 بكتريوفيج بي Bacteriophage P1 1 Kb كروموسوم بي 1 الصناعي P1Artificial chromosome Kb 150 -130 PAC P1 كروموسوم البكتيريا Bacterial Artificialبحد أقصى 300 الصناعي Kb Chromosome BAC كروموسوم الخميرة Yeast Artificial Chromosome 0.2-2 الصناعي Mb YAC المرجع:1996Human Molecular Genetics by T.Strachan and A.Read

النسخ والستنساخ(Cloning):

يشتهر بين الناس كلمة الستنساخ نظرا لرتباطها بخلق الكائنات أو إنشاء نسسخ منها.و لكن بالمصطلح الطبي فان كلمة نسخ أو استنساخ تعنى عملية إنشاء صورة طبقا الصل من المادة التي يراد نسخها.و قد يكون النسخ لقطعة من الدي إن أي أو نسخ كائن حي متكامل.و ل شك أن لغتنا العربية تفرق بين كلمة نسخ و استنساخ و لكننا سوف نستخدم كلمة نسخ أو استنساخ في حديثنا لنعني نفس الشيء. و في كلمة استنساخ باللغة العربية تعني ( Cloning)وينتج عنه نسخة أو مستنسخ (Clone).

82 عندما قام الدكتور... و فريقه العلمي بنشر (Nature 385, 810-13, 1997 )خبر استنساخ النعجة "دولي" في احد مختبرات اسكتلندا ( مختبر روزيلين ) عام 1997 زاد اهتمام العالم بموضوع الستنساخ و زاد الفضول العلمي في الحديث عن استنساخ النسان و فجر ذلك الخبر الكثير من التحفظات الدولية من كثير من المراكز الدينية و العلمية على الجانب الخلقي من عملية استنساخ النسان.

و بعد ذلك اخبر أصبحت كلمة استنساخ تستخدم بين العامة في الحديث عن عملية خلق نسخة أخرى من الحيوان أو النسان و بذلك بدأ البس بين الكثيرين في معنى هذه الكلمة.و ل شك فان العلماء كانوا و مازالوا يستعملون هذه الكلمة في الشارة إلى عملية صنع نسخة من أي مادة وراثية و ليس بالضرورة خلق أو نسخ كائن حي بالكامل. و لذلك فالعلماء يقسمون الستنساخ أو النسخ إلى 3 أنواع :

1- نسخ أو استنساخ القطع من الدي إن أي عن طريق الهندسة الوراثية و بما يعرف بتهجين الدي إن أي ( Recombinant DNA technology ) .

2- الستنساخ التكاثري أو الجنسي Reproductive cloning

3- الستنساخ العلجي Therapeutic cloning

نسخ أو استنساخ القطع من الدي إن أي عن طريق الهندسة الوراثية.

83 إن ما يهتم به العلماء في باب الستنساخ هو نسخ قطع من الدي إن أي كانت هذه القطع عبارة عن جين(مورث)أو جميع الجينوم(أي كل الدي إن أي الموجود في الكائن الحي).و اشهر العمليات التي تجرى هي نسخ قطعة من الدي إن أي. و يحتاج العلماء للقيام بنسخ القطع لنهم يحتاجون إلى كمية كبيرة من هذه النسخ و ذلك لندرة استخلصها في كل مرة من داخل الخلية و ذلك لوجود التعقيدات النشائية للكروموسومات .و على سبيل المثال فان الجين المنتج لسلسة بيتا في الهيموجلوبين و المعروف بمورث ببيتا جلوبين( Beta-Globin Gene) يمثل فقط 0.00005% من حجم الدي إن أي الكلي في الخلية(و الذي يتراوح ب 3بليين قاعدة نووية).كما أن الجين العملق و المعروف بجين الدستروفين( Dystrophin Gene ) و الذي يتراوح حجمه بال 2.5 ميقابيز (2.5Megabases ) ل يمثل أكثر من 0.08% من الحجم الكلي للدي إن أي في الخلية.و لذلك فان العلماء يحتاجون إلى إجراء نسخ لهذه الجينات أو القطعة من الدي إن أي لكي يتسنى لهم التعامل بها و إجراء التجارب عليها.و هناك طريقتان رئيسيتان للنسخ:

1- النسخ عن طريق استخدام الخليا الحية(Cell-Based DNA cloning)

2- النسخ عن طريق غير الخليا الحية(Cell-Free DNA cloning) و ذلك باستخدام البي سي أر( Polymerase chain reaction PCR).سوف نورد لهذه الطريقة صفحة مستقلة إنشاء ا.

النسخ عن طريق استخدام الخليا (Cell-Based DNA cloning)

يرتكز النسخ باستخدام الخليا الحية على ثلث خطوات:

1- تصميم قطعة مهجنة من الدي إن أي المراد نسخها و Construction of 1- دي إن أي من ناقل (Vector) و لدية القدرة على recombinant DNA molecules التكاثر.و ذلك عن طريق استخدام النزيمات القاطعة( by in Vitro attachment to Replicon(Vector). .(Restriction enzymes

2- نقل القطعة المهجنة و التي هي بداخل الناقل إلى خلية 2-Transformation using حية و في العادة تستخدم البكتيريا(Bacteria ) خاصة bacteria or yeast النوع المعروف باليكولي (E,coli او الخميرة( .(Yeast

84 3- اختيار المستعمرات البكتيرية التي تحتوي على الناقل Selective propagation of 3- و القطعة المهجنة و السماح لها بالتكاثر.عن طريق أطباق .cell clones الزراعة(Culture Plates) أو في محاليل سائلة.

4-استخلص القطع المهجنة و استخراج الدي ان أي منها Isolation of recombinant 3- بكميات كبيرة. DNA clones

1- تصميم القطع مهجنة من الدي إن

يعتمد النسخ باستخدام الخليا الحية على قدرة القطعة المراد نسخها على النقسام أو التكاثر الذاتي عندما توضع داخل الخلية الحية.و ل شك أن قطع الدي إن أي العادية ليس لديها القدرة على التكاثر الذاتي و لذلك فان العلماء قاموا بتجاوز هذا المر بان ادخلوا القطعة التي يريدون نسخها في ناقل من النواقل( Vectors ) المعروفة بقدرتها على التكاثر الذاتي(راجع موضوع النواقل).و بغض النظر عن نوع الناقل فان طريقة إدخال قطعة الدي ان أي المراد نسخها إلى الناقل تقريبا واحدة.و هذه الخطوات ببساطة كما يلي:

1- بعد أن يتم تحديد القطعة المراد نسخها يضاف إليها إنزيم قاطع محدد و ليكن مثل إنزيم ( أ )فيقوم هذا النزيم بقطع الدي إن أي في مكان محدد حسب التسلسل النووي.

2- يضاف نفس النزيم للناقل و الذي يقوم بقطعة أيضا في نفس التسلسل النووي.

3- تضاف القطع المراد نسخها بعد قطعها بالنزيم القاطع إلى الناقل رالمقطع. فتتداخل التسلسلت النووية بين الناقل و بين قطع الدي إن أي المراد نسخها. فنشاء من ذلك قطعة مهجنة من الناقل و بداخله القطعة المراد نسخها.و ترتبط قطعة الدي إن أي البلزميد من أطرافها برابطة هيدروجينية و هي رابطة ضعيفة لذلك يضاف إنزيم يسمى ليقيز أو اللصق(Ligase ) لكي يحول الترابط بين قطعة الدي إن أي و التناقل إلى رابطة قوية( ( Covalent Bond

85 إن أكثر لناقلت استخداما هي البلزميد و لكن يمكن استخدام الفيج أو الياك أو أي ناقل أخر.و الذي يحدد نوع الناقل المراد استخدامه هو في العادة كبر القطعة المراد استنساخها.ففي حالة القطع الصغيرة يستخدم البلزميد أو الفيج بينما يستخدم الياك أو الباك في حالة القطع الكبيرة.

2- نقل القطعة المهجنة و التي هي بداخل الناقل إلى خلية حية

في الغالب تستعمل البكتيريا خاصة النوع المعروف اليكولي(E.Coli) في عملية الزراعة و ذلك لسهولة إدخال الناقل إليها، و إلى سرعة انقسامها (تنقسم البكتريا تقريبا كل 20 دقيقة)، إضافة إلى توفر طرق الختيار خاصة التي تعتمد على خاصة الحماية من المضادات الحيوية.و يدخل البلزميد أو الفيج تلقائيا إلى داخل البكتيريا بينما الناقلت الخرى تحتاج إلى مساعدة ،و في العادة بتغيير تركيز الملح المحيطة بالبكتيريا أو تعرض إلى نبضة كهربائية لكي يسمح الجدار المحيط بالبكتيريا بدخول الناقلت.و من طبيعة البكتريا إنها تنقسم تلقائيا و بشكل سريع و كذلك البلزميدات.

3- اختيار المستعمرات البكتيرية التي تحتوي على الناقل و القطعة المهجنة

مع تكاثر الخليا البكتيرية و تكاثر البلزميد التي بداخلها ينتج لدينا أعداد كثيرة من المستعمرات البكتيرية و بها البلزميد المهجن.و لكن قد يكون في داخل الطبق الذي زرع فيه البكتريا بعض البكتريا التي ل تحتوي على البلزميد المهجن و لكي يمكن التعرف على البكتيريا التي تحتوي على البلزميد المهجن فنه في العادة يقام باستعمال ناقلت عليها جينات واقية من المضادات الحيوية، كالجين الواقي من المضاد الحيوي امبيسيلين أو لتترسيلين و غيرها. و بذلك فالمضاد الحيوي سوف يمنع تكاثر أي خلية بكتيرية ل تحتوي على البلزميد المهجن و الذي علي الجين الواقي من المضاد الحيوي.

4- استخلص القطع المهجنة و استخراج الدي ان أي منها بكميات كبيرة.

بعد أن يستعرف على المستعمرات التي تحتوي على البلزميد المهجن فانه يمكن نقلها إلى طبق جديد و يحافظ عليها و تغذى لكي تستمر بالتكاثر.و هذه البكتيريا يكون فيها أعداد كثيرة من البلزميد و بذلك تنتهي عملية النسخ.و يستفاد من هذه القطع المنسوخة في القيام بالمزيد من البحوث أو التجارب عليها كان يقام مثل إنتاج مكتبة من الدي إن أي أو محاولة استنتاج التسلسل النووي للقطعة.كما يمكن تحوير هذه العملية بحيث يحتوي البلزميد على قطعة من سي دي إن أي( cDNA) بدل و من ثم تحوير المراحل الخيرة من الزراعة لنتاج بروتين بدل من الدي إن أي. و هذه الطريقة هي التي تستعمل في إنتاج بعض الهرمونات كهرمون النمو .

ننننن PCR Polymerase Chain Reaction تفاعل البليمريز التتابعي

تحفظ المعلومات الوراثية و انتاج المواد لصنع الخليا و الحفاظ عليها في داخل الحمض النووي (DNA ) . و تقوم الخلية بمضاعفة كمية الحمض النووي وقت انقسام الخلية بشكل تلقائي و بشكل سريع مع وجود نظام تصحيح للخطاء خلل النسخ. . و تبلغ سرعة النسخ والمضاعفة إلى 1000 قاعدة نيتروجينية بالثانية ( داخل النظام الحيوي ) و هي كما ذكرنا تحدث في الخلية في وقت التكاثر والنقسام فقط .

ومع التطور في مجال التكنولوجيا الحيوية والذي يقوم على التعامل مع الحمض النووي (DNA ) بشكل أساسي ، استدعى ذلك العلماء على أن يبحثوا عن طريقة أو تقنية تقوم على مضاعفة كمية الحمض النووي (DNA ) بشكل كبير ، فكان هناك عدة محاولت لتنشيط الخلية على النقسام المستمر بإضافة عوامل النمو growth factors ، ولكن هذه الطريقة لم تكن ذات جده لدى العلماء لسباب كثيرة. إلى أن توصل العالم د. كري مولس Dr. Kerry Mullis في عام 1985 ( و قد حصل على جائزة نوبل في الكيمياء عام 1993)بنشر اختراعه لتقنية البي سي ار PCR فكانت هذه التقنية بوابة لكثير من التطورات المتسارعة في مجال التكنولوجيا الحيوية ، من أهم السباب التي ساعدت هذه التقنية على النتشار عدم اعتمادها على النظام الحيوي(أي الخلية) و التحكم بكمية الحمض النووي (DNA ) و وسرعة في النتاج ولكن كان من عيوب هذه التقنية عدم وجود نظام إصلح أخطاء الرتباط الخاطئ miss match .

نن نن PCR :

هو تقنية مخبريه تم اكتشافها عام 1983م تقريبا تقوم على إكثار نسخ الحمض النووي (DNA ) خارج النظام الحيوي . أي أنها طريقة لنسخ الحمض النووي في المختبر. و لذلك فهي تقنية حيوية لستنساخ قطعة من محددة من الحمض النووي و مضاعفة إنتاجها لكي يتسنى إجرى عليه اختبارات و فحوصات إضافية.

ما هي متطلبات PCR :

لتقوم بإنتاج الحمض النووي (DNA ) بواسطة PCR يتتطلب عليك توفير :

87 1. جهاز للتحكم بدرجات حرارة التفاعل بشمل دقيق و متتالي ( الدورة الحرارية Thermocycle ) : ويقوم هذا الجهاز بتغير درجة الحرارة بشكل سريع ، لن تغير درجة الحرارة هو الساس الذي تقوم عليه فكرة هذه التقنية .

2. البليمريز : وهو النزيم الذي يقوم ببناء وترتيب القواعد النيتروجينية ( حدات الحمض النووي (DNA ) ) ، ويجب أن يكون هذا النزيم مقاوم للحرارة العالية ليتمكن من العمل . و قد اكتشف انزيم مقاوم للحرارة و اسم تاج Tag

3. مجموعة متفرقة من القواعد النيتروجينية: ( A T C G ) ليتمكن النزيم من ترتيبها في مواقعها أثناء عملية نسخ الحمض النووي (DNA ) .

4. بريمر Primer : وهو قطعة صغيرة من الحمض النووي (DNA ) ليتمكن النزيم من بداء البناء و النسخ عليها .

5. والشيء الهم هو وجود نسخة من الحمض النووي (DNA ) المراد نسخه .

6. بالضافة إلى محلول أو وسط ليتم به التفاعل : وهذا المحلول يختلف بين تفاعل و أخر .

88 عم لي ن

ننننن :

بعد وضع الحمض النووي المراد نسخة مع البريمر و و إنزيم البوليمريز و مجموعة مع الحماض النووية في أنبوب داخل جهاز التحكم الحراري فان هناك 3 مراحل منفصلة تمر بها عملية النسخ:

1. مرحلة التفكيك Denature : رفع الحرارة إلى 94 مم وذلك لفك الحمض النووي (DNA ) الصل .

2. مرحلة اللتصاق anneal : إنزال الحرارة إلى ما بين 55-60 مم ليقوم البريمر باللتزاق فيزيائيا بواسطة الروابط الهيدروجينية مع الحمض النووي (DNA ) الصل .

3. مرحلة المتداد extend : ثم يقوم برفع درجة الحرارة إلى 75 مم ليقوم البلمريز بعمله في بناء الحمض النووي (DNA ) الجديد .

وهذه المراحل الثلث تعتبر دورة كاملة وفيها يصبح الحمض النووي (DNA ) الصل قد تضاعف ، وتعتمد كمية ناتج الحمض النووي (DNA ) على عدد الدورات ( والصورة التالية توضح العملية ) .

لمشاهدة هذه العملية اضغط على هنا.

89 ننننننن PCR :

لتقنية PCR تطبيقات كثيرة في مجال أبحاث الحمض النووي (DNA ) و الوراثة ومنها :

1. الكشف عن الطفرات الوراثية : وذلك عن طريق وضع بريمر خاص للطفرة لتكثير الجين الخاص بها . ومنه نقوم بمعرفة المرض إذا كان على زوجين الكروموسومات أو على احدهما ( allele ) .

2. تعين البصمة الوراثية .

3. الكشف عن الفيروسات : وهذه الطريق هي الدق في تحديد نوع وجنس الفيروس وكميته.

4. هو العنصر الهم في عملية التجميع الجيني ( Recombinant الحمض النووي (DNA ) ) : حيث نقوم بتكثير الجين المراد إدخاله على البلزمد أو الحمض النووي (DNA ) المضيف .

5. استخدامه في تغير نهايات الجين لتصبح متوافقة مع إنزيمات القطع ( Restriction enzyme ) .

6. هو العملية الساس في تحديد تتابع القواعد النيتروجينية في الحمض النووي (DNA ) ( الحمض النووي . ( DNA ) Sequencer)

7. معرفة طول الحمض النووي (DNA ) .

8. تقنية الحمض النووي (DNA ) المكمل ( cالحمض النووي (DNA ) ) .

9. تحديد الجين المطلوب من خليط من الجينات .

10. يستخدم في تقنية (microarrays ).

11. في مشروع الخارطة الجينية البشرية (human genome project ) .

12. الساوثرين بلوت (southern plot ) .

13. تقنية ارتباط الحمض النووي (DNA ) – بروتين ( الحمض النووي (DNA ) -Protein Interaction ) .

14. في مجال الطب الشرعي ( اختبار المومة ، حالت الغتصاب ، تحديد الهوية ... الخ ) .

وغيرها من التطبيقات المخبرية والبحثية .

ننننن PCR : هناك نوعان من PCR :

PCR .1 العادي : وهو ما تم شرحه والتطرق اليه في الخطوات السابقة . rtPCR .2 : وهو اختصار لـ ( Real Time PCR ) : وهذا النوع يقوم على نفس المبدأ ولكن الخلف الوحيد يكون مربتط الجهاز بكمبيوتر لتحديد الوقت الحقيقي لبدا التفاعل ومن ثم الكمية الحقيقية لعدد نسخ الحمض النووي (DNA ) ويعتمد ذلك على وجود قواعد نيتروجينية حرة مشعة لتحديد ذلك . مما يسهل على الباحثين الوقت لتحدد وجود الجين المطلوب أو ل ، وكمية الجين بدون الوصول إلى نهاية الدورات الحرارية المحددة .

90 لسماع تسجيل فديو لتسمية البي سي ار بهذا السم. اضغط هنا

ننن نننننن ننن نننننن ننننننن: ننننننن نننن ننننن من نننننن. 2007-6-17

صفحة الهندسة الوراثية الرئيسية

الستنساخ التكاثري (Reproductive cloning ) استنساخ الكائنات الحية بالكامل

يعرف الستنساخ التكاثري أو الجنسي بأنه إنتاج لكائن حي له نفس المادة الوراثية( Nuclear DNA ) لكائن حي أخر المنسوخ منه. لقد قام الفريق العلمي بمختبر روزلين بعملية استنساخ جنسي في عملية استنساخ للنعجة دولي.و تعرف هذه العملية أيضا بنقل نواة الخلية الجسمية (somatic cell nuclear transfer" (SCNT ). و بشكل مبسط نقل نواة من خلية من خليا الجسم غير الجنسية أي غير التي توجد في المبيض (في النثى )و من خليا الخصية(في الذكر).و الخلية التي استعملت لستنساخ دولي كان من خليا الثدي لنعجة أخرى.و من ثم أخذت أيضا بويضة من المبيض و قام العلماء من التخلص من النواة التي بداخل تلك البويضة ثم قاموا بزرع النواة التي أخذوها من ثدي في داخل البويضة. ثم قاموا بصعق تلك البويضة بالكهرباء لكي ينشطوا عملية النقسام. و بعد أن بدأت هذه البويضة في النقسام قاموا بغرزها داخل رحم نعجة و بعدها نما الجنين في الرحم فأصبح"بإذن ا" نعجة كاملة.

علميا فان دولي (أو أي حيوان أو إنسان )يستنسخ بهذه الطريقة ليس في الحقيقة نسخة مطابقة للم أو الب الذي اخذ منه النواة. فهناك بعض من المادة الوراثية موجود خارج النواة و هو بالتحديد موجود في داخل البويضة التي أزيل منها النواة.و هذه المادة الوراثية موجودة على جسيمات صغيرة تسمى بالميتوكوندريا ( Mitochondria ). و مع أن الميتوكوندريا مصنع هام للطاقة إل انه يكثر فيها الطفرات مع تقدم العمر وقد يكون

91 لها علقة بالهرم.

صفحة الهندسة الوراثية الرئيسية

الستنساخ العلجي Therapeutic cloning

و يقصد بذلك استنساخ كائنات حية لخذ خليا جذعية(Stem Cells) و ل يسمح لها للوصول إلى تخليق كائن حي كامل. و أهمية هذه الخليا تنبع في قدرة هذه الخليا في إنتاج أي خليا أو أعضاء كالكلية و الكبد و الخليا الدموية و التي يرجى في استخدامها علج الكثير من المراض التي ل يوجد لها علج شافي. و لقد قامة إحدى الشركات العلمية في ولية ماسيشيوستز بالوليات المتحدة المريكية (Advanced Cell Technologies ) في شهر نوفمبر من عام 2001 بالعلن عن محاولة ناجحة لستخلص خليا جذعية من أجنة مستنسخة و ذلك بعد أن قامة باستخدام 8 بويضات بشرية تم تفريغها من نواها ثم زرع بداخلها نوى خليا من الجلد.و لقد نجحوا في إنتاج خليا جذعية من بويضة واحدة بينما فشلة البويضات السبع.و يمكنك الرجوع إلى صفحة الخليا الجذعية للمزيد من المعلومات.

الوراثة الطبية | الم و الطفل | المتلزمات | الشرعية | من نحن

ننننننن

92 نننننن ننننن

يعتبر سرطان الثدي عند النساء ثاني السرطانات شيوعا عند النساء،.بينما هو من السرطانات النادرة لدى الرجال فهو يمثل فقط 1% من مجموع المصابين بسرطان الثدي.وفي السطر القادمة سوف نناقش سرطان الثدي من الناحية الوراثية و دور الجينات(المورثات)في الصابة بالمرض ولن نتطرق إلى الساليب العلجية.

الوراثة و سرطان الثدي

ل شك لدى العلماء أن سرطان الثدي من المراض التي تنتقل بالوراثة المتعددة السباب.فالمرأة تصاب بسرطان الثدي إذا كان لديها استعداد وراثي يجعلها قابله للصابة ثم تعرضه إلى شيء ما في البيئة المحيطة بها.وعلماء الوراثة يحاولون البحث عن الجينات التي تجعل المرأة لديها قابليه للصابة كما أنهم يقوم المهتمون بسرطان بشكل عام البحث عن المسببات البيئية. مع أننا قلنا أن سرطان الثدي ينتقل بالوراثة المتعددة السباب إل أن هناك بعض العائلت لديها قابلية عالية للصابة نتيجة لوجود عامل وراثي قوي.و بذلك قد ينتقل المرض(على شكل جين)من جيل إل أخر.و يقوم علماء الوراثة بإجراء البحاث الوراثية على هذه العائلت لكتشاف أنواع جديدة من الجينات.و قد تقراء في الصحف بين حين و أخر عن اكتشاف جين جديد يسبب سرطان الثدي فتتضافر الجهود لمحاولة اكتشاف السباب الحقيقية للسرطان والتي قد تفيد في اكتشاف طرق حديثة للوقاية من سرطان أو إنتاج علج جديد وفعال لهذا المرض الخبيث. و عند تكرر سرطان الثدي في عائلة ما فليس بالضرورة أن تكون هذه الصابة نتيجة عن وجود عوامل وراثية قوية في تلك السرة.فقط تكون ناتجة عن تضافر عدة أسباب مع بعضها البعض(أي الوراثة المتعددة السباب)أو ناتجة عن تعرض كل المصابين إلى مواد رمسرطنة في البيئة.فلذلك نستطيع أن نقول أن معظم المصابين بسرطان الثدي حدث لهم السرطان نتيجة لعوامل وراثية وبيئية مع بعضها البعض.بينما القليل من المصابين لديهم عوامل وراثية فقط أو بيئية فقط.لحظ أننا استعملنا كلمة عوامل ولم نقل أسباب و السبب في ذلك هو أن الشخص الذي أصيب بسرطان كان عنده لديه الستعداد منذ الولدة للصابة بسرطان نتيجة لعطب أو خلل أو تغير في احد الجينات(ويسمى هذا التغير بالطفرة) ولكن هذا التغيير لوحده ل يسبب في العادة بأي مرض ولكن مع مرور العمر أو بعد التعرض إلى شيء ما في البيئة(بعض الفيروسات او المواد الكيميائية او الشعات النووية) أدى إل إصابة النسخة الثانية من الجين بالعطب فسبب له الصابة بالسرطان.ولذلك تعتبر السرطانات و سرطان الثدي

الفحص قبل الزواج.. * بقلم : د. زهير عبدا رهبيني(*) كان الدكتور فالح بن زيد الفالح عضو مجلس الشورى قد أعد دراسة لتطوير النظام الصحي في المملكة، قدمها إلى مؤتمر الرؤية المستقبلية الذي نظمته وزارة التخطيط. وقد ذكر الدكتور الفالح في دراسته تطور النظام الصحي في المملكة والذي ينمو بشكل متنام مثل بقية الخدمات الخرى... النص التالي: «وبالرغم من هذا التطور الجيد والواضح في الخدمات

93 الصحية في المملكة العربية السعودية إل أن هناك مجموعة من المؤشرات التي تدل على قصور النظام الصحي في المملكة...». واكتفى بذكر المؤشر الول وهو أنهة «ل يزال معدل وفيات الرضع (21 في اللف) مرتفعا قياسا إلى دول أخرى تماثل المملكة في درجة التطور». إنة عدد الوفيات (وفيات الرضع) حتى عام 1405هـ 52 لكل ألف مولود حي، وانخفضت في عام 1420هـ إلى 21 لكل ألف مولود حي. ول شك أن هذا إنجاز للنظام الصحي السعودي وذلك يرجع إلى وضع الستراتيجيات للحد من الوفيات بسبب المراض المعدية مثل استكمال برامج التطعيم والتحصين ضد المراض المعدية المعروفة وأيضا بسبب العناية الفضل بالحوامل والولدة في مراكز صحية مهيأة. إن البرامج الصحية الستراتيجية المتدرجة هي من أهم العوامل في التقليل والحد من الصابة بالمراض وكذلك في التشخيص والعلج المبكر. وأقصد بالبرامج العملية الصحية والعلمية والتوعوية والقتصادية وغيرها للتقليل والحد من المراض ومن هذه البرامج التي ل بد من الشادة بها برنامج التطعيم للطفال حيث شمل البرنامج خططا استراتيجية للحد من المراض المعدية تتضمن النواحي الصحية والتوعوية والرشادية والترتيب القائم بين وزارة الصحة ووزارة الداخلية بإضافة المولود إلى بطاقة والده بعد النتهاء من التطعيم الساسي. كل هذه المور جعلت برنامج التطعيم يعتبر برنامجا ناجحا حيث كانت الصابة بشلل الطفال في عام 1405هـ هي 0 ،29 لكل مائة ألف والن ل توجد إصابة تذكر ول الحمد والمنة. ونقص التهاب الكبد الوبائي (ب) حتى سن 12 سنة من 6 ،7 لكل مائة ألف إلى 0 ،3 لكل مائة ألف من السكان. إذا كان السبب في نجاح النظام الصحي للتطعيم أنه كان برنامجا متكامل وليست مواعيد للتطعيم فقط بعد توفيق ا وعونه. أعود إلى عدد الوفيات في عام 1419/1420هـ وأقصد معدل وفيات الرضع حيث أنه ليزال مرتفعا (21 لكل ألف مولود حي) قياسا إلى دول أخرى تماثل المملكة في درجة التطور الصحي. إن السبب الحقيقي لهذا العدد ليس واضحا من المصادر الطبية المسؤولة في المملكة ولعل هذا يرجع إلى عدم وجود نظام دقيق للمعلومات إل لبعض المراض التي وضع لها سجل وطني مثل أمراض الورام والسرطان. إن تقارير الوفاة عادة غير دقيقة خاصة للرضع لنها ستمل أحيانا حسب السبب الخير للوفاة مثل توقف الجهاز التنفسي والدوري ول تعطي معلومات عن السبب المباشر للوفاة مثل: أن سبب الوفاة قد يكون بسبب المراض المعدية أو الوراثية أو لغيرها، وفي أحيان كثيرة تمل تقارير الوفاة من ق وبل الطبيب المناوب الذي قد ل يكون لديه دراية كافية عن حالة المريض السابقة. إنة انخفاض معدل الوفيات للرضع ب 60% من عام 1405ه إلى 1420ه يعود كما ذكرت إلى التطور الصحي ووضع البرامج للحد من المراض المعدية، ولكن تبقى ما نسبته 40% لم نعرف لها سببا مباشرا وهي في نظري عائدة بالدرجة الولى إلى المراض الوراثية وأخص منها أمراض التمثيل الوراثية (أمراض الستقلب أو أمراض اليض). لقد قام مستشفى الملك فيصل التخصصي ومركز البحاث بالرياض بدراسة استمرت لمدة ثلث سنوات من 1414هـ 1417هـ وذلك بأخذ عينات دم في اليوم الثاني أو الثالث لكل مولود يولد في ثلثة مراكز (أثنين في الرياض وواحد في جدة)، وكان الفحص يشمل ثلثين مرضا من أمراض التمثيل الغذائي، وقد تم مسح ثلثين ألف مولود خلل الثلث سنوات المذكورة وكانت النتيجة هي إصابة (مولود واحد) لكل 1400 مولود حي (ألف وأربعمائة مولود حي).

94 ولوضع معادلة بسيطة وهي ان طفل واحدا من ألف وأربعمائة طفل يكون مصابا بأحد المراض الثلثين التي جرت عليها الدراسة، فكم يكون عدد المصابين إذا عرفنا أن أمراض التمثيل الغذائي المعروفة تتجاوز خمسمائة مرض؟! وكم تكون الصابة بأحد المراض الوراثية إذا عرفنا أنها تتجاوز الن أكثر من عشرة آلف مرض؟ إن أمراض الدم الوراثية تعتبر جزءا بسيطا جدا من المراض الوراثية الموجودة في المملكة، بل إن كثيرا من المراض الوراثية الكثيرة الخرى هي أخطر منها وموجودة في مناطق معينة معروفة لذوي الختصاص بسبب كثرة الحالت لهذه المراض من مناطق معينة. إن أمراض الدم الوراثية موجودة في المنطقة الشرقية وجيزان وحول المدينة المنورة ولكن هناك أمراضا وراثية أخرى وخطيرة في نفس الوقت في مناطق أخرى من المملكة العربية السعودية. وعلى سبيل المثال وليس الحصر فأمراض الحموضة في الدم (Organic Acidemia) موجودة بنسبة كبيرة في منطقة القويعية والمنطقة الجنوبية، وبعض أمراض ارتفاع المونيا الوراثي أكثر شيوعا في منطقة وادي الدواسر وفي الخرمة، وبعض أمراض الحماض المينية معروفة في منطقة الباحة، وأمراض التمثيل الغذائي للمواد الدهنية موجودة في المنطقة الشمالية، وأمراض تخزين الجليكوجين موجودة في منطقة المدينة المنورة، وأمراض ارتفاع حمض اللكتيك (أمراض الميتوكندريا) أكثر في منطقة القصيم. كل المثلة السابقة معروفة لكل من يعمل عن قرب في مجال طب الوراثة، كما أن كثيرا من المتلزمات الناتجة عن الطفرات الوراثية أصبح لها نمط جغرافي معروف في المملكة. إن عيادات الوراثة في مستشفى الملك فيصل التخصصي والتي تضم حاليا عشر عيادات في السبوع لرؤية ومتابعة أكثر من مائة مريض أسبوعيا تستقبل ما ل يقل عن (عشرين حالة جديدة أسبوعيا ) من أمراض الوراثة الطبية والتشوهات عند الولدة والمتلزمات المختلفة، وهذا يعتبر جزءا بسيطا لما يحوة ل من الحالت إلى المستشفى المذكور فكم هو العدد الفعلي للمرضى غير المحولين في وزارة الصحة أو المرضى الذين يتابعون في المستشفيات والخدمات الصحية الخرى في كل من الحرس الوطني ووزارة الدفاع ووزارة الداخلية والمستشفيات الجامعية والقطاع الخاص. إنني أرى أن على وزارة الصحة أن تضع استراتيجيات طويلة المدى تحتوي على برامج الفحص المبكر لما قبل الزواج وأثناء الحمل وبعد الولدة وذلك للحد من النفقات العلجية الباهظة على الطفال المعوقين في وقت انخفضت فيه ميزانية الصرف الصحي على الفراد وذلك بسبب الزيادة السنوية في عدد السكان التي تصل إلى 3 ،7%، فقد كان معدل الصرف الصحي على الفرد عام 1404هـ يصل إلى 1085 ريال وانخفض في عام 1419هـ إلى 610 ريالت سعودية، ول شك أن وضع البرامج الصحية الوقائية سيقلل من النفاق العام على الصحة على المدى البعيد. إذا يتضح مما سبق أن برنامج الفحص قبل الزواج أو البرامج الوقائية الخرى مهمة ول أظن أنه يختلف عليها اثنان، ول أظن أن أهميتها ليست واضحة للمسؤولين في وزارة الصحة التي تقع عليها مسؤولية تطبيق مثل هذه البرامج بالدرجة الولى. لقد قامت الوزارة بالبدء ببرنامج الفحص قبل الزواج لبعض المراض الوبائية وأمراض الدم الوراثية استنادا على قرار مجلس الوزراء الصادر في محرم / 1423هـ. وقبل أن أعطي رأيي في البرنامج المذكور لبد من شكر القائمين على هذه البرامج لنها بدأت تضعها ضمن النظام الصحي السعودي، كما أن الفحص قبل الزواج لم يبدأ حقيقة كبرنامج متكامل كما هو الحال لبرنامج التطعيم مع اختلف آلية البرنامجين. إن الزواج ليس فحصا طبيا فقط بل هو ارتباط شرعي واجتماعي وله مداخلت كثيرة يجب التعامل معها كبرنامج وطني في مجتمع متحفظ على مثل هذه المور.

95 فهو أول مقتصر على أمراض الدم الوراثية التي تنتشر في مناطق معينة في المملكة فليس من الولوية أن تعمم على مناطق أخرى في المملكة ل يوجد بها مثل تلك المراض، فمثل منطقة القصيم ليست من المناطق التي يوجد بها أمراض الدم الوراثية فلماذا يعمم مثل هذا الفحص على تلك المنطقة!! إن من أهداف أي نظام صحي أن تقوم أهدافه على معقولية التكاليف وأن تقوم على أسس علمية صحيحة. نعم يمكن تطبيق مثل هذا البرنامج على المناطق التي تنتشر بها هذه المراض وأن تكون بشكل متكامل ومتوازن يراعي الجوانب الشرعية والسرية والجتماعية والطبية والقتصادية وغيرها. لو أردنا تطبيق هذا البرنامج على المنطقة الشرقية ومنطقة جيزان وحول منطقة المدينة المنورة حيث تكثر بها أمراض الدم الوراثية فهل وضعنا العتبارات التية: 1 كل برنامج للفحص قبل الزواج في العالم يجب أن يضم عيادات استشارية للمشورة الوراثية عند ظهور أي عينة إيجابية فليس من العدل أن يكون الفحص اجباريا أو شبه إجباري وكما ل توجد مثل هذه العيادات التي يجب أن تدار بأيد متدربة في هذا المجال. إن علم الطب الوراثي أصبح علما مستقل يضم تحته تخصصات كثيرة منها الطب الوراثي الكلينيكي وتخصص أمراض التمثيل الغذائي وتخصص الوراثة الجزيئية... ومنها تخصص معروف في المشورة الطبية الوراثية (Genetic Counselling). فالسؤال كم عيادة استشارية موجودة وموازية لمثل عدد الحالت التي ستظهر إيجابية، هل هناك برنامج لتدريب الكوادر السعودية لتغطية مثل هذا البرنامج لحقا . وهنا أريد أن أؤكد أن الفحص قبل الزواج ليست عينة دم تؤخذ ولكنه برنامج صحي متكامل. إن برنامج الفحص قبل الزواج يرتب إداريا من قبل اللجنة الوطنية للمراض الوراثية التي تضم تسعة أعضاء اثنان منهم يحملون شهادة التخصص في الطب الوراثي وكنت أتمنى أن يكون معظم أعضاء اللجنة أو على القل أكثر من 50% منهم لهم علقة بالتخصص المذكور وذلك لن وضع برنامج الفحص قبل الزواج يحتاج إلى أصحاب التخصص للنظرة الشمولية للمراض الوراثية بالمملكة. 2 إن الفحص قبل الزواج وتبعاته اللحقة يجب أن يتم بسرية كاملة لتفادي الوصمة الجتماعية، فهل أخذ في العتبار كيف يتم ذلك ضمن البرنامج المذكور خصوصا في مجتمعنا حيث العتبارات الجتماعية والسرية ل تخفى على أحد. ولعلي أوضح أكثر لو أن (س) أقبل على الزواج من (ص) وبالفحص قبل الزواج تبين أن (س) يحمل موروثات الدم المنجلية، فكيف تحفظ سرية هذا الفحص في مجتمعنا الذي قد يكون لمثل فصل هذا الزواج تبعات اجتماعية لم نأخذ حسابها ضمن البرنامج. وكمقدمة لفكرة الفحوصات المختلفة الموجودة فإنه كما هو معروف أن النسان يتكون من أجهزة وأعضاء تتركب من مليين الخليا. والخلية هي الوحدة الساسية للمخلوق الحي حيث تحتوي بداخلها على النواة والتي تحمل الحقيبة الوراثية. والحقيبة الوراثية تتكون من ست وأربعين صبغة وراثية في الخليا الجسدية مثل خليا الدم و الجلد والشعر وغيرها أما الخليا الجنسية (الحيوانات المنوية والبويضات) فتحتوي على ثلث وعشرين صبغة وراثية (كروموسومات). تحتوي الكروموسومات على المورثات (الجينات) وهي الشيفرة الوراثية التي نتكون البروتينات المختلفة في الجسم مثل النزيمات أو الهرمونات أو هيموجلوبين الدم وغيرها من مئات البروتينات التي تقوم بوظائف الجسم المختلفة. إن المرض الوراثي يعني تغيررا في الشيفرة الوراثية وهو ما يعرف بالطفرة التي تتسبب في إنتاج

96 بروتين ناقص أو غير طبيعي. ومثال ذلك أن حدوث طفرة في مورثة الهيموجلوبين قد يؤدي إلى هيموجلوبين غير طبيعي يظهر عمليا بشكل مرض الدم المنجلي أو أنيميا حوض البحر المتوسط (التلسيميا) أو غيرها من أمراض الدم الوراثية. ويمكن فهم السابق بالمعادلة التية: طفرة في المورثة (الجين) 3 بروتين غير طبيعي 3 وظيفة غير طبيعية (مرض). ويمكن تلخيص فحوصات حاملي المرض فيما يلي: 1 العلمات السريرية: يمكن للمتخصص في الطب الوراثي معرفة بعض العراض التي تظهر على حاملي بعض المراض الوراثية خصوصا المراض الوراثية السائدة (أي أن مورثة واحدة كافية لنقل المرض إلى 50% من الطفال) أو المراض الوراثية المرتبطة بالصبغة السينية ( Chromosome X) ويمكن مساندة الفحص السريري بالدراسات المختبرية كالتخطيط الكهربائي للعضلت أو التخطيط الكهربائي للعين أو عمل الشعات وغيرها من الفحوصات. 2 تحليل لناتج المورثة: ومثال ذلك أمراض الدم الوراثية حيث بالمكان قياس نوع الهيموجلوبين في الدم ومعرفة نسبه الطبيعية وغير الطبيعية وبالتالي يمكن معرفة الحامل للمرض، ولكن تبقى هذه الطريقة محدودة لمراض معينة حيث إن كثيرا من المراض الوراثية ل يعرف فيها طبيعة نوع البروتين المصاب، أو أنه سيعرف ولكن تبقى الطريقة مكلفة وتؤدى فقط في مختبرات البحاث. 3 التغيرات الثانوية لبعض المواد الكيميائية في الدم: بعض المراض الوراثية قد تؤدي إلى تغيرات كيميائية ثانوية يمكن معرفتها على المريض أو حامل المرض مثل ازدياد مادة الكرياتين في بعض أمراض حثل العضلت. ولكن تبقى هذه الطريقة أيضا محدودة كما أن حساسية الختبار ليست دقيقة أيضا . 4 المورثات: بعد اكتشاف الخارطة الوراثية أو الجينوم البشري (المجين) أصبح بالمكان معرفة أماكن المورثات لكثير من المراض الوراثية كما أن الطفرات الجينية قد تمت دراستها على كثير من المراض. ويمكن إجراء تحليل الطفرات الوراثية مباشرة على كثير من المراض. ولكن يجب التنبيه على أن الطفرات الوراثية أو التغيرات في المورثات تختلف من مجتمع إلى آخر، وعلى سبيل المثال فإن الطفرات في مورثة التليف الكيسي الرئوي سو جد أنها تختلف في المجتمع السعودي عنها في الغرب حسب الدراسات التي تمت ونشرت. وفي نظري إن هذه أهم طريقة لفحص حامل المرض وأنها أفضل طريقة يمكن تطبيقها على الفحص قبل الزواج لكثير من المراض الوراثية المنتشرة في المملكة (غير أمراض الدم الوراثية التي يمكن النظر إلى الهيموجلوبين غير الطبيعي مباشرة). ولكن قبل تطبيق هذه الفحوصات لبد من دراسة الطفرات الوراثية لكثير من المراض في المملكة وهذا الجهد يقع على وزارة الصحة ومراكز البحاث والجامعات في المملكة. وهنا أريد أن أؤكد أن المراض الوراثية ليست فقط أمراض الدم الوراثية بل هي عشرات من المراض التي تنتشر في المملكة حسب العوائل والقبائل في المناطق المختلفة. إن المتخصص في الطب الوراثي أصبح يعرف ما هي المراض الوراثية المنتشرة في كل منطقة وفي كل قبيلة من واقع الحالت اليومية إلى المستشفيات التخصصية. ويمكن تطبيق الفحوصات السابقة بأن يحدد فحص ما قبل الزواج لمراض الدم الوراثية للمنطقة الشرقية ومنطقة جيزان وحول منطقة المدينة المنورة، أما المناطق الخرى فينظر في طريقة فحص المورثات مباشرة لمراض وراثية محددة حسب انتشارها في كل منطقة. إن النظمة الصحية في العالم متعددة ول يوجد نظام مثالي إل أن النظام الصحي لي بلد لبد أن يعكس الرؤية الستراتيجية المتكاملة للمؤسسة التنفيذية ولكن القاسم المشترك للنظمة الصحية

97 الجيدة هو طبيعة تحقيقها لهداف معينة منها: 1 التغطية الشاملة والعادلة لكل المواطنين. 2 أن تكون ذات تكلفة معقولة. 3 أن تتم على أسس علمية صحية. ولو حاولنا إنزال هذه الهداف على الفحص قبل الزواج كبرنامج من برامج النظام الصحي فلبد أن يكون برنامج الفحص قبل الزواج شامل لكل مناطق المملكة مدنها وقراها. ولكن لبد أن يكون الفحص عادل بحيث ينظر للمراض الشائعة في كل منطقة أو قبيلة، فليس من العدل أن سينظر إلى أمراض غير موجودة في حين أنها أحوج إلى الفحص المبكر لمراض أخرى أكثر أهمية بالنسبة لهم. إن برامج الفحص قبل الزواج موجودة ومطبقة في دول أوروبا والوليات المتحدة المريكية وكندا وغيرها ولكنهم يصنفون هذه الفحوصات حسب العرق الموجود وعلى سبيل المثال فالمريكان ذوو البشرة السوداء لهم فحوصات معينة والمريكان من أصول أوروبية لهم فحوصات خاصة بهم كما أن يهود أمريكا لهم فحوصات متعلقة بأمراضهم. ولبد أن يكون البرنامج ذا تكلفة معقولة، وهنا أؤكد أن تعميم الفحص على أمراض الدم الوراثية لكل مناطق المملكة يضع الموال في غير مكانها الصحيح وإهدار للجهد، إذ كيف يمكن فرض الفحص بتكاليف قد تكون باهظة على منطقة ل يوجد بها مثل هذه المراض. كما أن اختيار المراض أو المورثات للفحص يجب أن يقوم على ضوابط وأسس ودراسات علمية صحية لذلك لبد من مشاركة أهل الخبرة في مثل هذه البرامج وأخص منهم العلماء وأطباء الوراثة والمرشدين الوراثيين والخصائيين الجتماعيين وغيرهم حيث إن هذا البرنامج هو برنامج وطني يحتاج لمشاركة الجميع من ذوي الختصاص. هنا يتبادر إلى الذهن السؤال التالي: هل برنامج الفحص قبل الزواج يكون اختياريا أم إجباريا ؟ والجواب في الحقيقة يحتاج إلى مقال آخر ولكن أسلخص ما أراه في النقاط التالية: 1 إن أكثر الدول التي سبقتنا إلى وضع برامج الفحص قبل الزواج جعلته اختياريا وليس إجباريا ، ومن جعله إجباريا لم يربط نتيجة الفحص على العلقة الزوجية مباشرة بل جعلوا الفحص إجباريا والقدام على الزواج اختياريا بغض النظر عن نتيجة الفحص. والسبب في نجاح تلك البرامج على الرغم من أنها اختيارية أنهم تبنوها كبرنامج متكامل يشمل القضايا التعليمية والتوعوية منذ المراحل الولى من الحياة فهو جزء من التعليم وجزء من البرامج التوعوية العلمية وجزء من الرعاية الصحية الولية وغيرها. لذلك أصبح هناك قناعة جماهيرية ووطنية في تلك الدول بأهمية هذه الفحوص وتطبيقاتها في الحياة. 2 إن الزواج هو قضية شرعية وقانونية لذلك كان لعلماء الدين والجتماع آراؤهم القوية في مثل هذه الفحوصات في تلك الدول. إن العلقة الزوجية والرتباط القلبي بين الرجل والمرأة المقدمين على الزواج ل يمكن منعها بجعل الفحص إجباريا أو اختياريا إذا لم يكن هناك قناعة نفسية لمثل هذه الجراءات. ومع الحماس لمثل هذا البرنامج في المملكة فإني لم أسمع رأي علمائنا الفاضل بإقرار إجبارية الفحص قبل الزواج ورأي السلم في جعله إجباريا وليس اختياريا ، وأقصد هنا هيئة كبار العلماء أو غيرها من الهيئات الشرعية في المملكة العربية السعودية. 3 يوجد في الدول التي تطبق برامج الفحص قبل الزواج العيادات الستشارية لمراض الوراثة وخاصة العيادات الستشارية لما قبل الزواج فكثيرا ما يأخذ المقدمون على الزواج موعدا لمناقشة كل المور التي لها علقة بالمراض الوراثية، ول أقصد أن نؤسس عندنا مثل هذه العيادات بدون النظرة الشرعية لمجتمعنا ولكن بالمكان الستفادة من الفكرة وتكييفها لتتماشى مع عاداتنا وتقاليدنا.

98 وهنا سؤال آخر: ما هو أفضل وقت لعمل هذه الفحوصات، هل يكون بعد الولدة أم في سني الدراسة أم قبل الزواج مباشرة؟ إن أخذ العينات من المواليد الجدد من أجل المعرفة هل هم يحملون مورثات مرضية معينة أم ل تعتبر مسألة شائكة قانونيا في المجتمعات غير السلمية حيث ينظر إلى هذه المورثات بدون أخذ الحق من النسان نفسه وهو في هذه الحالة المولود الجديد مما أثار قضايا قانونية، بالضافة إلى حفظ سرية المعلومات وما يتبع ذلك من قضايا تخص النسان وعلقته بشركات التأمين. كما أن أخذ العينة للفحص كما هو مقرر عندنا في المملكة غير مناسب والسبب أن العلقة النفسية والجتماعية بين الخاطب ومخطوبته في أحيان كثيرة تكون قد بدأت قبل الفحص وفي رأيي أن هذا قد يسبب إحراجا كبيرا إذا انقطعت هذه العلقة بسبب فحص الدم، فالمجتمع والقارب ل يعرفون سبب هذا الفصل مما يثير تساؤلت كثيرة فإذا سعرف السبب كانت مصيبة وإذا لم يعرف كانت المصيبة أكبر. وأنا أؤكد هنا أن الناس ل زالوا يجهلون طبيعة المراض الوراثية ومعنى المرض وحامل المرض فبكل بساطة يمكن أن يوصم النسان بأنه مريض وراثيا وتبقى وصمة اجتماعية في حين أنه ربما يحمل مورثات للمرض فقط وهذا شيء طبيعي فكل إنسان يحمل عددا من هذه المورثات المرضية التي يمكن أن ينقلها كمرض إلى أبنائه إذا كانت زوجته تحمل نفس الطفرات الوراثية. ومن هنا فإنني أرى أن يكون أنسب وقت لعمل هذه الفحوصات على الرجال والنساء هو عندما يكون المواطن طالبا أو طالبة في الثانوية العامة وقبل أن يرتبطا بالزواج. وهذه التجربة أثبتت نجاحها عندما طبقت على اليهود الشكنازي في ولية نيويورك بالوليات المتحدة المريكية فقد انتشرت بين هذا العرق أمراض وراثية خطيرة وكانت هناك إشكالت في التشخيص أثناء الحمل ومن ثم السقاط العلجي إذا ثبت إصابة الجنين بأحد هذه المراض فوضع المتخصصون برنامجا متكامل وهو أخذ عينات الدم لفحص المورثات لما يقارب عشرة أمراض وراثية من طلبة وطالبات الثانوية وترسل هذه العينات إلى مركز للتحاليل برقم معين ول يذكر خللها اسم الشخص مطلقا . والسبب في عدم ذكر السم هو للحفاظ على السرية تماما ول يعرف رقم العينة إل صاحبها ، وبعد ذلك تحفظ المعلومات حتى يأتي موعد الخطوبة وقبل كل ذلك يتم التأكد من الرقمين في مركز التحاليل هل هي متوافقة أم غير متوافقة وعندها سيشرع أيضا بإعطاء المشورة الوراثية بشكل غير مباشر ويترك الخيار أخيرا للرجل والمرأة. لقد أثبتت التجربة السابقة نجاحها حيث كانت هذه المراض شائعة وبعد هذه التجربة خلل العشرين سنة الماضية قلت بشكل كبير حتى أنها أصبحت تحت مستوى انتشارها العام في الوليات المتحدة المريكية. إن السبب المباشر في نجاح هذا البرنامج أنه لم يرتبط بأسبوع أو أسبوعين قبل الزواج بل كانت هناك استراتيجية بعيدة المدى كما أن البرنامج يحفظ السرية الكاملة لمن يريد الفحص ويتضمن القضايا الدينية والجتماعية والتعليمية أي أنه برنامج متكامل وليس مجرد عينة دم تؤخذ قبل الزواج. إن هذه التجربة يمكن تطويرها وترتيبها بحيث تصبح أكثر ملءمة لوضعنا الديني والجتماعي وربما اختيار الموعد النسب عند تعميمها على مختلف مناطق المملكة بحسب المراض الشائعة في كل منطقة أو قبيلة . وفي النهاية لعلي أخلص إلى النقاط التية: أول : تبني الفحص قبل الزواج كبرنامج متكامل. ثانيا : البدء ببرنامج الفحص المبكر للمواليد وجعله إجباريا قبل التوسع في برنامج الفحص قبل الزواج.

99 ثالثا : إشراك عدد أكبر من استشاريي الطب الوراثي في اللجنة الوطنية للمراض الوراثية بحيث يمثلون 50% على القل من أعضاء اللجنة. رابعا : النظر في وقت الفحص وجعله في مرحلة مبكرة قبل الشروع في الزواج وتحديد الخاطب لمخطوبته والحفاظ على سرية المعلومات وتفادي الوصمة الجتماعية. خامسا : الشروع في إنشاء عيادات استشارية للفحص قبل الزواج تضم طبيبا متخصصا ومرشدا وراثيا على القل. سادسا : مشاركة الوزارات الخرى مع وزارة الصحة في دعم هذا البرنامج وأخص بالذات وزارة التربية والتعليم ووزارة الثقافة والعلم لوضع استراتيجيات تعليمية وتوعوية عن المراض الوراثية والفحص المبكر للمراض الوراثية التي تشمل فحص ما قبل الزواج وأثناء الحمل والفحص المبكر للمواليد الجدد. سابعا : وضع برامج أكاديمية من خلل الكليات الصحية والطبية للتخصص في هذا المجال سواء في مجال التشخيص أو العلج أو المشورات الطبية. هذه بعض القتراحات والرؤية المستقبلية لبرنامج الفحص قبل الزواج فما كان صوابا فمن ا وما كان خطأ فمني ومن الشيطان. وصلى ا على نبينا محمد وآخر دعوانا أن الحمد ل رب العالمين.

(*) استشاري طب الطفال والطب الوراثي بمستشفى الملك فيصل التخصصي ومركز البيحاث بالرياض.

..... الرجوع ..... رؤية مستقبلية الفحص قبل الزواج.. لبد أن يصبح برنامجا صحيا وطنيا يأخذ في العتبار خصوصية مجتمعنا الفحص قبل الزواج.. رؤية مستقبلية الفحص قبل الزواج.. لبد أن يصبح برنامجا صحيا وطنيا يأخذ في العتبار خصوصية مجتمعنا