Meares K, Dawson DA, Horsburgh GH, Perrin MR, Burke T, Taylor TD (2008) Characterisation

1Erratum

3Meares K, Dawson DA, Horsburgh GH, Perrin MR, Burke T, Taylor TD (2008) 4Characterisation of 14 blue crane Grus paradisea (Gruidae, AVES) microsatellite 5loci for use in detecting illegal trade. Conservation Genetics, in press. 6 7This manuscript was published in Conservation Genetics in 2008 (online early) since publication 8we have observed errors in the second part of Table 1 and Table 2. 9 10The first part of Table 1 involving the characterization of the loci in blue crane did not contain 11errors and remains unchanged. 12 13The second part of Table 1 involving the cross-utility of the markers in other species, “Table 1 14continued” which is highlighted in yellow, contains errors. In the published version of this part of 15the table the samples sets of both species were contaminated by individuals from other species. The 16grey-crowned cranes (Balearica regulorum) genotyped mistakenly included 3 blue crane 17individuals and the wattled cranes (Grus carunculatus) genotyped included one blue crane and one 18grey-crowned crane. The true number of alleles and heterozygosity observed for all of the 14 blue 19crane loci when genotyped in grey-crowned and wattled crane is therefore much lower in these two 20species than previously published. The species origins of the samples which were originally mis- 21identified were confirmed by comparison of allele sizes between species using several loci which 22displayed species-specific alleles (see Meares et al. 2008, submitted to Molecular Ecology 23Resources). 24 25After correction, eleven of the blue crane loci were polymorphic in grey-crowned crane (not 14) and 2611 were polymorphic in wattled crane (not 14). Due to the reduced number of grey-crowned crane 27and wattled crane individuals genotyped, tests for Hardy Weinberg equilibrium and estimated null 28allele frequencies were not performed. 29 30These errors have been rectified in the Table below. 31 32Table 2 contains two minor errors. The numbers of grey-crowned cranes tested was 7 (not 10) and 33the number of wattled cranes tested was 8 (not 10). These corrections have been highlighted in 34yellow in the Table below. 35 36We sincerely apologise for these errors. 1 1 37Table 1 Characterisation of 14 blue crane (Grus paradisea) microsatellite loci in the blue crane, grey-crowned crane (Balearica regulorum) and wattled crane 38(Grus carunculatus). 39 Blue crane (Grus paradisea)

Locus‡ EMBL Primer sequence (5’ – 3’) with pigtail sequence underlined§ PRIMER3 Ta MgCl2 Repeat motif in n A Exp. Genotype of Observed allele sizes (bp) HO HE Deviation Est. null o o accession Tm ( C) ( C) (mM) blue crane allele library ‡ from allele number and size source HWE freq. clone name (bp) ¥ individual (P-value (J17718) if >0.10)

Gpa01 AM085152, F: HEX - TTTGGTTGCCGTCAGAATTG 61.97 63 1.5 (CA)8 19 4 297 291, 297 291, 293, 297, 299 0.58 0.54 NS -0.04 BC17E04 R: GTTTCTT-CTGACCTGGGTGTGTTCTGC 61.76 (290)

Gpa11† AM282892, F: HEX - CCCTCCTGGAATACATGACAAA 61.09 60 3.0 (TTTC)34 20 21 300 216, 236 186–346 0.75 0.96 ** (0.01) 0.11 BC43B09 R: AAGTCATTCTCAACAAGAAAGGAAAA 60.82

Gpa12 AM282893, F: FAM - GATCAATGCGAAGGATAGGGAGGT 61.70 60 3.0 (GATA)11 20 7 232, 232, 236 212, 216, 220, 224, 228, 0.75 0.83 NS 0.04 BC43C11& R: TCATCAATCTATTATTTGCCTCAGC 60.78 236 232, 236 AM282894

Gpa14 AM282896, F: FAM - TTTCGTACTCTGGTCATTGGATTT 61.07 57 2.0 (TTTC)12 20 12 283 286, 294 278–324 0.85 0.90 NS 0.02 BC43F06 R: GTTTCTT-AATAGGACAGCAGTGCTAAGAAGAAA 61.07 (276)

Gpa24 AM282908, F: HEX -GAGGGAATCTAGCACGCTCCAA 64.96 57 2.0 (GTTA)6 20 5 250 243, 251 239, 243, 247, 251, 255 0.50 0.62 NS (0.06) 0.12 BC45A12 R: GTTTCTT-TCAAAGCATCGTGTCCATGAAGT 64.06 (243)

Gpa32 AM282918, F: HEX -CCCAGCACACCGTGCATAAG 64.85 57 2.0 (GT)11 20 7 190 183, 189 177, 183, 185, 187, 189, 0.75 0.85 NS (0.07) 0.05 BC45H08 R: GTTTCTT-GCAGTCGGTCACATCCTTGG 64.02 (183) 191, 193

Gpa33 AM282919, F: FAM - GGCTTAGAAATGGGATACAGTTG 60.63 60 2.0 (TTTC)14 19 24 316 243, 243 205–417 0.90 0.97 NS 0.03

BC45H10 R: CCGTCCAAGCAAGAAGAAA 60.05 (TCTCTTTC)16

Gpa34 AM282920, F: HEX -GCACACAGTGAGGAGACCAGTGA 65.10 60 3.0 (TTTCTC)22 17 18 265 NA 249–413 0.88 0.95 NS 0.02 BC47A04 R: CCTTGATGTGGGAAGACAACTGC 65.22

Gpa35 AM282921, F: FAM - TCATCAGCTTCCAACAGGTCTCC 65.01 57 2.0 (GT)13 (TA)4 18 7 176 176, 178 172, 174, 176, 178, 180, 0.89 0.81 NS -0.07 BC47A05 R: GTTTCTT-TCAGGCACAATGTATAAGTGTTTGTGG 65.09 (169) 182, 184

Gpa36 AM282922, F: HEX -TTCATAGACATATGCTTACCTGTTCT 57.65 60 2.0 (GATA)10 19 5 228 228, 228 220, 224, 228, 232, 236 0.53 0.67 NS 0.10

BC47A12 R: ATCCATCCATCTATCTATCTATCTATCTATC 57.57 (GATG)2

Gpa37 AM282923, F: HEX -TGAACGTGTCTGATTTAAGGAA 57.43 60 2.0 (TC)2 CTC 19 27 231 194, 194 174–390 0.95 0.98 NS 0.00

BC47D01 R: AAAGTAGTCACTAGCCTGGGTTT 57.64 (TTTC)43

(TTC)2

Gpa38 AM282924, F: HEX -GGGCAGAAGCAAGTCTTTCA 60.52 60 3.0 (CTAT)13 20 6 193 188, 192 180, 184, 188, 192, 196, 0.90 0.81 NS -0.06 BC47H05 R: GAAGATGTTTGCTGGTTGCAC 60.69 200

Gpa39 AM282925, F: HEX -TGCACAGGTTTGGCCAAGAAG 65.66 57 2.0 (GA)2 20 7 125 122, 126 114, 118, 122, 126, 130, 0.85 0.81 NS -0.04

BC47H08 R: GTTTCTT-TTCCAAAGTGAAATTAAAGGTGTGTGG 65.13 (GATA)13 (118) 134, 138

Gpa41 AM282932, F: FAM - AATTCAGTCTAATGTAAATGTCCAAG 57.12 54 2.0 (TTTCTTCC)6 20 4 242 245, 245 237, 245, 253, 261 0.60 0.60 NS 0.00

BC49F10 R: CCATCATTAATGGAAAGAAAGAG 56.99 (TC)5

(TTTCTCTC)3

(TTTC)2 40

2 2 3 41 Table 1 continued 42 Grey-crowned crane (Balearica regulorum) Wattled crane (Grus carunculatus)

Locus‡ TD temp. n A Allele sizes (bp) ‡ HO HE Deviation Est. n A Allele sizes (bp) ‡ HO HE Deviation Est. (oC) from HWE null from HWE null allele allele freq. freq. Gpa01 66-60 7 1 293 0.00 0.00 - - 8 1 291 0.00 0.00 - -

Gpa11 63-57 7 7 234, 248, 258, 262, 270, 274, 310 1.00 0.90 NA NA 8 9 224, 230, 245, 248, 254, 258, 266, 0.88 0.93 NA NA 282, 294 Gpa12 63-57 7 3 196, 200, 204 0.43 0.63 NA NA 8 3 192, 196, 200 0.75 0.63 NA NA

Gpa14 60-54 6 6 246, 250, 254, 262, 266, 270 0.67 0.88 NA NA 8 5 270, 294, 298, 308, 358 0.38 0.81 NA NA

Gpa24 60-54 1 2 243, 247 1.00 1.00 NA NA 8 1 243 0.00 0.00 - -

Gpa32 60-54 2 1 177 0.00 0.00 - - 8 2 179, 181 0.50 0.50 NA NA

Gpa33 63-57 7 3 206, 214, 218 0.29 0.56 NA NA 5 8 218, 254, 314, 318, 326, 334, 336, 1.00 0.96 NA NA 344 Gpa34 63-57 7 7 132, 138, 144, 152, 164, 176, 220 0.86 0.85 NA NA 7 7 280, 286, 292, 298, 304, 320, 322 0.86 0.87 NA NA

Gpa35 60-54 7 2 159, 161 0.14 0.36 NA NA 8 1 169 0.00 0.00 - -

Gpa36 63-57 7 3 228, 232, 236 0.57 0.56 NA NA 8 4 220, 224, 228, 232 1.00 0.70 NA NS

Gpa37 63-57 2 2 197, 205 0.50 0.50 NA NA 8 8 121, 123, 129, 131, 133, 137, 141, 0.88 0.88 NA NA 147 Gpa38 63-57 2 1 189 0.00 0.00 - - 7 4 181, 185, 193, 197 1.00 0.67 NA NA

Gpa39 60-54 7 9 176, 198, 202, 206, 216, 222, 224, 0.57 0.90 NA NA 8 2 102, 106 0.13 0.13 NA NA 234, 250 Gpa41 57-51 7 7 187, 191, 207, 211, 215, 219, 227 1.00 0.88 NA NA 8 4 233, 249, 257, 265 0.38 0.35 NA NA

44 Tm, Melting temperature assigned by PRIMER v3 software (Rozen et al. 2000); 45 Ta, annealing temperature; 46 n, number of crane individuals that successfully amplified and were genotyped of the 20 blue crane, 10 wattled crane and 10 grey-crowned crane individuals tested, respectively; 47 A, number of alleles; 48 ¥, expected allele size based on the sequenced clone including the 7-bp length of the pigtail when used. The expected allele size excluding the length of the pigtail is shown in parentheses; 49 HO, observed heterozygosity calculated using CERVUS v2.0 (Marshall et al. 1988); 50 HE, expected heterozygosity calculated using CERVUS v2.0 (Marshall et al. 1988); 51 Deviation from HWE, deviations from Hardy-Weinberg equilibrium (HWE) calculated using GENEPOP 3.4 (Raymond, 1995); 52 Est. null allele freq., estimated null allele frequency calculated using CERVUS v2.0 (Marshall et al. 1988); 53 †, locus has high predicted null allele frequency of equal or above 0.1; 54 §, for some loci a “pigtail” sequence GTTTCTT added, to reduce noise from variable adenylation during the PCR (Brownstein et al. 1996); 55 ‡, the seven bases of the pigtail are included in the observed allele size; 56 NS, non-significant; NA, not available; *significant at the 5% level, **significant at the 1% level; ° ° ° 57 TD temp., maximum and minimum temperatures used in touchdown PCR. Touchdown PCR program used: 94 C for 3 min; 5 cycles of 94 C for 30 s, highest Ta, decreasing with 1 C increments per ° ° ° ° 58 cycle, 72 C for 30 s; followed by 25 cycles of 94 C for 30 s, lowest Ta for 30 s, 72 C for 30 s, completing the profile with an extension at 72 C for 4 min; 59 ‡Locus Gpa26 (clone BC45E05, AM282912) was monomorphic in 76 blue crane individuals but was not tested in wattled crane and grey-crowned crane. Primer sequences for this locus are F: 60 AACTAGGTTAACAGATGCATTAACAGG, R: GGAAGTGGCGGGTATAGGAA. 61 62 Sources of individuals genotyped: 63 Blue crane individuals originated from a wild population inhabiting the Karoo region, South Africa; 64 Wattled crane individuals originated from KwaZulu-Natal South Africa; 65 Grey-crowned crane individuals originated from KwaZulu-Natal, Eastern Cape and Mpumalanga provinces, South Africa (population structure currently uncertain).

66 67 Table 2 Cross-species utility of 14 blue crane Grus paradisea microsatellite loci. 68 Species Binomial name Order n Genetic Gpa01 Gpa11 Gpa12 Gpa14 Gpa24 Gpa32 Gpa33 Gpa34 Gpa35 Gpa36 Gpa37 Gpa38 Gpa39 Gpa41 distance to blue crane‡ Grey-crowned crane* Balearica regulorum Gruiformes 7 0.7 + + + + + + + + + + + + + +

Wattled crane* Grus carunculatus Gruiformes 8 0.7 + + + + + + + + + + + + + +

Houbara bustard† Chlamydotis undulata Gruiformes 1 16.9 + + – – – – – – – – – – – –

Grey-headed albatross† Diomedea chrysostma Procellariiformes 1 20.1 – + – – – – – – + – + + + –

Seychelles warbler† Acrocephalus sechellensis Passeriformes 1 21.6 – – – – – – – – – – – – – –

Cape parrot† Poicephalus robustus Psittaciformes 2 23.1 + + – – + + – – – – – – – –

Red jungle-fowl† Gallus gallus Galliformes 1 28.0 – – – – – – – – – – – – – –

Saltwater crocodile† Crocodylus porosus Crocodilia 1 NA – – – – – – – – – – – – – –

Human† Homo sapiens Primates 2 NA – – – – – – – – – – – – – –

69 70 n, number of individuals tested for amplification; 71 +, amplification observed on 2% agarose gel; 72 –, no amplification observed on 2% agarose gel, or non-specific amplification or amplification of a product over 200 bp larger or smaller than the size observed in blue crane; 73 *amplified using touchdown PCR (temperature range provided in Table 1) and genotyped using an ABI 3730 DNA Analyzer; 74 †, amplified using same PCR conditions as blue crane and visualised on a 2% agarose gel;

75 ‡, delta T50H DNA–DNA hybridisation distances based on Sibley et al. (1990); 76 NA, not available. 77