Cytoplasmic FMR1-Interacting Protein 2 Is a Major Genetic Factor Underlying Binge Eating

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Cytoplasmic FMR1-Interacting Protein 2 Is a Major Genetic Factor Underlying Binge Eating

Supplementary Information

Additional Details on Mice

Purchased CFW, B6J, and B6NJ mice were 7 weeks of age and were habituated in the vivarium one week. Behavioral testing was performed during the light phase of the 12 h light/dark cycle (0800 h to 1300 h; lights on at 0630 h). For QTL mapping, B6J females were crossed to B6NJ males to generate B6J x B6NJ-F1 mice that were intercrossed to generate

156 B6J x B6NJ-F2 offspring (78 F2 females, 78 F2 males; 7-12 weeks old at the beginning of testing). Mice were bred in a vivarium next door to the test rooms and were provided chow (Harlan® 2918) ad libitum in the home cage. Mice within a home cage were assigned the same experimental treatment.

Mice carrying two copies of the B6NJ allele (Cyfip2M1N; referred to in the current study as “Cyfip2N/N”) and mice carrying one copy of the B6NJ allele and one copy of the null allele (Cyfip2M1N/Cyfip2tm1a(EUCOMM)Wtsi ; referred to in the current study as “Cyfip2N/-”) were rederived at the Boston University Mouse Transgenic and Genome Engineering Core

Facility (headed by Dr. Kenneth Albrecht) using sperm obtained from The Jackson Laboratory and were generated from

ES cells that contained the “knockout first” allele on a C57BL/6N background (1). Thus, Cyfip2N/- mice contain one copy of the B6NJ missense mutation and one copy of the knockout allele. Cyfip2-/- mice die shortly after birth (2). Elevated Plus Maze in F2 Mice

On D24, each F2 mouse was transported in a clean transport cage from the vivarium to the testing room containing red- illuminating ceiling lights. Each mouse was placed into the center of the EPM and videotaped for 5 min using a ceiling- mounted webcam. The primary outcome measure was percent time spent in the open arms of the EPM [(open time)/

(open time + closed time) *100)]. We examined other measures, including freezing behavior in the open arms.

Additional Details on RNA-seq

The cDNA libraries were prepared using the Illumina TruSeq Stranded mRNA LT Sample Prep Kit (50 bp single-end reads). Samples were sequenced using the Illumina HiSeq 4000 with 16 samples per lane over four lanes. FASTQ files

(Phred>30) were used to align reads to the reference genome using TopHat (mm10). Read counts per gene were quantified using the HTSeq Python package. A minimum of one read count per gene across quadruplicates as well as a minimum of one count per million in at least 25% of the count files was required for inclusion in the analysis.

Transcriptome analysis was implemented in the BioConductor package limma using the default TMM normalization and

VOOM transformation (3). A linear model was employed where Cyfip2 Genotype was included as a factor and Sample

Replicate was treated as a repeated measure to estimate within-sample correlation using the lmFit() function to detect differential gene expression (≥ 1.1-fold change; FDR < 20%).

Table S1: Correlation (Pearson’s r) between consumption on a PF training day (D) with the final preference for the PF-paired side or the PF triangle on D22 in outbred CFW mice. P<0.05

5-TUL Correl. Correl. P-value P-value 20 mg PF side PF triangle PF side PF triangle D2 0.04 0.20 0.92 0.63 D4 0.20 0.44 0.64 0.27 D9 0.44 0.69 0.28 0.06 D11 0.60 0.82 0.12 0.01 D16 0.48 0.71 0.23 0.05 D18 0.54 0.74 0.17 0.04 5-TUL Correl. Correl. PF P-value P-value PF 45 mg PF side triangle PF side triangle D2 -0.18 -0.09 0.68 0.83 D4 0.36 0.17 0.38 0.68 D9 0.31 0.30 0.46 0.47 D11 0.25 0.60 0.56 0.12 D16 0.32 0.55 0.44 0.16 D18 0.5 0.77 0.21 0.03 5-TUT Correl. Correl. PF P-value P-value PF 20 mg PF side triangle PF side triangle D2 -0.33 -0.63 0.42 0.10 D4 0.02 0.22 0.96 0.60 D9 -0.13 -0.42 0.75 0.30 D11 0.03 -0.20 0.95 0.63 D16 -0.43 -0.40 0.29 0.33 D18 0.14 0.05 0.75 0.90 5-TUT Correl. Correl. PF P-value P-value PF 45 mg PF side triangle PF side triangle D2 -0.24 -0.28 0.57 0.50 D4 0.43 0.68 0.29 0.06 D9 -0.01 0.16 0.99 0.70 D11 -0.03 -0.08 0.94 0.85 D16 0.49 0.34 0.21 0.41 D18 0.50 0.74 0.21 0.04 Table S2: Correlation (Pearson’s r) between consumption (% BW) on a training day (D) with the final preference for the PF-paired side (s) or the PF triangle on D22 in B6J, B6NJ, F2, and Cyfip2N/- mice. P < 0.05

B6J PF (N=15) Correl. Correl. P-value PF P-value PF side PF side PF triangle triangle D2 -0.21 -0.32 0.46 0.25 D4 -0.21 -0.20 0.45 0.48 D9 -0.22 -0.10 0.42 0.72 D11 -0.47 -0.31 0.08 0.25 D16 -0.38 -0.30 0.16 0.29 D18 -0.55 -0.46 0.04 0.09 B6NJ PF (N=15) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.02 -0.12 0.93 0.66 D4 -0.08 0.06 0.77 0.82 D9 0.05 -0.22 0.85 0.43 D11 -0.12 -0.27 0.67 0.33 D16 -0.04 -0.19 0.87 0.51 D18 -0.10 0.03 0.73 0.91

F2 PF (N=156) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.14 -0.11 0.08 0.15 D4 -0.08 -0.14 0.31 0.09 D9 -0.07 -0.14 0.41 0.09 D11 -0.04 -0.09 0.58 0.26 D16 -0.12 -0.16 0.13 0.05 D18 -0.06 -0.13 0.43 0.12 NJ Chow (N=15; control Correl. Correl. PF P-value PF P-value experiment) PF side triangle side PF triangle D2 -0.32 -0.35 0.24 0.21 D4 -0.11 -0.19 0.70 0.50 D9 -0.38 -0.28 0.16 0.31 D11 0.52 0.32 0.045 0.24 D16 0.71 0.88 0.003 1.8x10-5 D18 0.62 0.86 0.013 4.1x10-5 NJ PF (N=15; control Correl. Correl. PF P-value PF P-value experiment) PF side triangle side PF triangle D2 -0.06 -0.16 0.84 0.56 D4 0.06 0.10 0.82 0.73 D9 -0.18 0.06 0.53 0.82 D11 0.19 0.25 0.50 0.37 D16 0.10 0.19 0.73 0.49 D18 -0.05 0.21 0.85 0.46 J/J F2: Cyfip2 PF (N=33) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.09 -0.17 0.61 0.35 D4 0.22 -0.06 0.21 0.73 D9 0.33 -0.08 0.06 0.67 D11 0.06 -0.17 0.72 0.34 D16 0.09 -0.14 0.61 0.43 D18 0.04 -0.18 0.81 0.33 J/N F2: Cyfip2 PF (N=32) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.09 -0.17 0.61 0.35 D4 0.22 -0.06 0.21 0.73 D9 0.33 -0.08 0.06 0.67 D11 0.06 -0.17 0.72 0.34 D16 0.09 -0.14 0.61 0.43 D18 0.04 -0.18 0.81 0.33 N/N F2: Cyfip2 PF (N=85) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.03 -0.12 0.86 0.52 D4 -0.02 0.08 0.93 0.66 D9 -0.06 -0.07 0.77 0.72 D11 0.03 0.02 0.87 0.91 D16 0.02 0.01 0.92 0.95 D18 -0.09 0.09 0.65 0.62 KO: Cyfip2 N/N Chow Correl. Correl. PF P-value PF P-value (N=22) PF side triangle side PF triangle D2 -0.32 -0.38 0.14 0.08 D4 -0.29 -0.36 0.19 0.10 D9 0.06 -0.11 0.79 0.62 D11 -0.15 -0.13 0.51 0.56 D16 0.02 -0.05 0.93 0.83 D18 0.06 0.01 0.81 0.96 KO: Cyfip2 N/-Chow Correl. Correl. PF P-value PF P-value (N=33) PF side triangle side PF triangle D2 -0.29 0.08 0.10 0.67 D4 -0.13 -0.10 0.48 0.59 D9 0.02 -0.07 0.90 0.71 D11 -0.42 -0.08 0.01 0.64 D16 -0.34 0.13 0.06 0.47 D18 -0.17 -0.10 0.35 0.59 KO: Cyfip2 N/N PF (N=24) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.07 0.11 0.73 0.61 D4 0.28 0.47 0.18 0.02 D9 0.31 0.42 0.14 0.04 D11 0.32 0.24 0.12 0.27 D16 0.20 0.28 0.34 0.18 D18 0.29 0.31 0.16 0.14 KO: Cyfip2 N/- PF (N=30) Correl. Correl. PF P-value PF P-value PF side triangle side PF triangle D2 -0.12 0.26 0.54 0.17 D4 0.13 0.23 0.50 0.22 D9 0.07 0.26 0.72 0.17 D11 0.17 0.37 0.37 0.05 D16 0.09 0.50 0.65 0.005 D18 0.11 0.54 0.55 0.002 Table S3: Polymorphic SNP markers used for QTL mapping in B6J x B6NJ-F2 mice. Red = removed from analysis. Green = new markers that were added to analysis. With the exception of the new markers (green-filled rows), ”No call” percentages are based off of 612 genotyped F2 mice, including the 156 mice comprising this study. Markers were chosen from the mouse Sanger SNP database (4) or from the study from Kumar and colleagues (2). In assessing marker performance via the percent no call rate, we examined the distribution of missing genotypes from 812 F 2 mice (including the 156 mice from this study and an additional 656 samples from a separate study) and identified seven autosomal markers that exhibited greater than a 20% no call rate that we removed from the analysis (red-filled cells). Most of the retained markers exhibited no call rates between 0 and 10%. We added two additional SNPs to refine the QTL locus on chromosome 11 (rs223857079, rs13481117; green-filled rows) for a total of 90 genome-wide markers that were used in QTL analysis.

% No Chr. bp (mm10) cM B6J B6NJ Type dbSNP Target Call 1 29,549,273 11.33 G A SNP rs263412184 Intergenic 0.85 1 59,847,167 30.44 G A SNP rs227085647 Bmpr2 8.90 1 88,806,692 44.98 C T SNP rs242608911 Intergenic 0.61 1 116,037,566 51.85 A C SNP rs32180662 Cntnap5a 3.29 1 163,132,699 72.42 A T SNP rs6341208 Intergenic 0.37 1 181,318,003 84.58 A C SNP rs51237371 Intergenic 1.83 2 24,187,191 16.24 A G SNP rs254201911 Il1f9 6.46 2 38,946,612 24.43 A G SNP rs33064547 Intergenic 2.44 2 60,051,388 34.36 A T SNP rs256008253 Baz2b 0.49 2 78,799,176 47.11 C T SNP rs33162749 Intergenic 1.34 2 138,480,020 68.27 T C SNP rs13476801 Intergenic 3.66 2 152,781,403 75.36 A G SNP rs217443774 Bcl2l1 3.54 102.0 2 179,627,071 T C SNP rs3697302 Cdh4 4 38.41 3 5,370,727 1.85 C T SNP rs13476956 Intergenic 0.49 3 23,824,920 9.23 T A SNP rs13477019 Intergenic 0.61 6030405A18Ri 3 54,914,906 25.91 A G SNP rs30751697 k 10.12 3 95,734,876 41.34 A G SNP rs13474735 Ecm1 0.37 3 119,108,318 52.04 A G SNP rs50526143 Dpyd 0.85 3 159,811,101 82.64 G T SNP rs260058764 Intergenic 19.39 4 21,873,684 9.22 C G SNP rs13460207 Sfrs18 2.68 4 40,805,010 20.58 A G SNP rs46850777 B4galt1 2.20 4 65,944,235 34.50 T C SNP rs13477746 Intergenic 0.98 4 109,874,495 51.36 A G SNP rs3680956 Intergenic 0.24 % No Chr. bp (mm10) cM B6J B6NJ Type dbSNP Target Call 4 124,654,566 57.85 T G SNP rs32865425 Pou3f1 2.93 4 138,221,673 70.22 C T SNP rs234702424 Hp1bp3 0.61 4 150,685,581 81.46 T C SNP rs32407463 Intergenic 2.56 5 18,710,388 8.37 A G SNP rs33367397 Intergenic 2.80 5 40,761,789 21.97 C T SNP rs33508711 Intergenic 19.15 5 59,833,642 31.78 T C SNP rs33209545 Intergenic 0.24 5 70,931,531 37.56 T C SNP rs29547790 Intergenic 11.10 5 89,775,351 44.34 C T SNP rs262569844 Adamts3 45.85 5 131,541,036 70.96 A G SNP rs3719791 Auts2 2.44 5 149,026,872 89.13 T C SNP rs33404968 Intergenic 8.90 6 39,400,456 18.21 T A SNP rs30899669 Mkrn1 1.34 6 60,591,379 29.06 A G SNP rs13478783 Intergenic 1.46 6 90,159,627 40.07 A C SNP rs245539697 Intergenic 1.10 6 117,470,880 55.04 C G SNP rs13478995 Intergenic 2.44 6 145,246,710 77.35 A G SNP rs30119689 Kras 1.71 7 30,306,475 17.41 A G SNP rs3148686 Clip3 2.32 7 56,131,292 33.44 G A SNP rs50155421 Herc2 67.80 7 71,816,909 41.11 C G SNP rs32060039 Intergenic 0.98 7 102,973,309 54.80 C T SNP rs243575509 Intergenic 0.49 7 120,135,179 64.46 G A SNP rs235606231 Zp2 1.22 8 14,127,388 6.54 C T SNP rs236928053 Dlgap2 0.49 8 29,097,075 16.52 T C SNP rs13479672 Intergenic 2.68 8 59,125,561 30.78 T C SNP rs245638874 Intergenic 5.37 8 85,365,179 41.58 A T SNP rs245783224 Mylk3 4.27 8 119,945,761 68.67 C T SNP rs230879074 Gm20388 3.90 9 3,994,759 0.39 C T SNP rs226723272 Intergenic 0.98 9 25,130,622 10.16 C G SNP rs217366063 Herpud2 0.61 9 58,886,107 31.82 G A SNP rs238448868 Neo1 19.02 9 86,220,923 46.49 A C SNP rs30522453 Intergenic 1.83 9 120,016,907 71.41 T G SNP rs49019729 Xirp1 0.85 10 29,612,666 16.69 C A SNP rs29330320 Intergenic 0.49 10 67,238,174 34.92 T C SNP rs13480628 Jmjd1c 10.98 4930547N16Ri 10 88,091,833 43.81 T C SNP rs246274290 k 1.10 10 109,378,627 57.03 C T SNP rs13480759 Intergenic 71.95 11 12,252,753 7.30 A T SNP rs223857079 Cobl 1.92 11 30,675,691 18.15 A C SNP rs48169870 Intergenic 13.05 11 46,222,615 27.63 G A SNP rs240617401 Cyfip2 9.63 % No Chr. bp (mm10) cM B6J B6NJ Type dbSNP Target Call 11 63,073,481 38.95 T C SNP rs6268547 Tekt3 24.15 11 79,251,980 46.80 G T SNP rs13481117 Wsb1 2.56 11 90,480,671 55.09 C T SNP rs238893157 Stxbp4 0.98 11 120,306,788 84.05 T C SNP rs49027247 Intergenic 0.49 12 28,409,763 10.93 G T SNP rs29165094 Intergenic 0.61 12 55,758,373 24.10 G T SNP rs6385807 Intergenic 0.61 12 91,595,674 44.60 A C SNP rs235238684 Intergenic 0.61 12 117,167,625 62.92 C T SNP rs229717662 Ptprn2 0.49 13 27,037,150 12.24 A G SNP rs13481734 Intergenic 1.59 13 52,758,052 27.35 T C SNP rs29248623 Intergenic 17.93 13 72,630,777 39.25 T C SNP rs29957076 Irx2 34.27 13 88,426,920 45.27 G A SNP rs29622109 Intergenic 19.88 13 119,143,521 67.25 C T SNP rs29235721 Intergenic 1.22 14 9,937,385 5.80 G A SNP rs31187642 Intergenic 2.93 14 74,415,721 39.25 T A SNP rs30264676 Intergenic 2.07 14 90,847,095 45.14 G T SNP rs262164631 Intergenic 10.24 14 116,603,597 60.23 A C SNP rs236603300 Intergenic 1.10 15 11,336,383 5.58 G T SNP rs246033409 Adamts12 2.68 15 37,462,413 14.99 A T SNP rs31810918 Intergenic 0.85 15 71,632,551 32.31 T C SNP rs31858887 Intergenic 5.12 16 12,261,912 7.23 T C SNP rs4162529 Shisa9 0.61 16 35,291,544 25.15 G A SNP rs258334795 Adcy5 0.85 16 60,954,616 36.06 C G SNP rs4193066 Intergenic 3.66 16 90,181,009 51.59 C G SNP rs4217166 Intergenic 3.54 17 5,332,903 3.15 T C SNP rs4137196 Arid1b 0.12 17 26,854,246 13.56 A T SNP rs46703123 Intergenic 0.61 17 67,752,883 38.88 G A SNP rs33387924 Lama1 1.46 17 89,708,416 59.66 C T SNP rs50807504 Intergenic 38.41 18 31,018,871 17.70 G A SNP rs257888249 Rit2 32.32 18 54,614,841 29.22 A C SNP rs13483369 Intergenic 20.85 18 90,448,757 59.64 A G SNP rs263687961 Intergenic 1.10 19 9,027,005 6.04 G C SNP rs31112038 Ahnak 1.34 19 16,602,218 11.66 T C SNP rs30709918 Intergenic 2.44 19 52,359,370 46.77 A G SNP rs30608930 Intergenic 0.12 X 64,312,439 34.62 C T SNP rs246222509 Intergenic 0.37 X 90,719,435 40.39 A C SNP rs221876655 Intergenic 4.63 X 120,419,803 49.63 T A SNP rs226119295 Pcdh11x 1.83 X 152,774,935 70.34 A G SNP rs226776950 intergenic 0.61

N/N J/J Table S4: Gene list for for binge-susceptible Cyfip2 F2 mice versus binge-resistant Cyfip2 F2 mice. Data are presented as differential expression in Cyfip2 N/N relative to Cyfip2 J/J.

log2F Av.Exp Gene C FC . t P adj.P 1110008P14Rik -0.17 1.13 5.73 -2.79 6.7E-03 1.5E-01 1110032F04Rik -0.40 1.32 3.26 -3.75 3.5E-04 2.9E-02 1190002N15Rik -0.21 1.16 5.15 -3.79 3.1E-04 2.9E-02 1700001L19Rik -0.35 1.27 3.18 -2.67 9.5E-03 1.7E-01 1700020I14Rik -0.15 1.11 6.59 -3.05 3.2E-03 9.9E-02 1700048O20Rik -0.30 1.23 3.83 -3.28 1.6E-03 6.6E-02 2310022B05Rik 0.16 1.11 5.97 3.69 4.3E-04 3.1E-02 2410066E13Rik -0.18 1.13 5.29 -2.82 6.3E-03 1.4E-01 3110035E14Rik -0.38 1.30 8.04 -4.53 2.2E-05 8.3E-03 4930422G04Rik -0.22 1.17 3.35 -2.77 7.1E-03 1.5E-01 4930447C04Rik -0.28 1.21 4.25 -3.09 2.9E-03 9.2E-02 4930570G19Rik -0.19 1.14 3.99 -2.58 1.2E-02 2.0E-01 4932415G12Rik -0.16 1.11 5.18 -2.96 4.2E-03 1.1E-01 6330403A02Rik -0.19 1.14 8.54 -3.84 2.6E-04 2.7E-02 9130024F11Rik -0.46 1.38 3.42 -3.83 2.7E-04 2.7E-02 9830001H06Rik 0.19 1.14 6.10 3.74 3.6E-04 2.9E-02 A830018L16Rik -0.14 1.10 6.33 -3.13 2.5E-03 8.6E-02 Abat 0.18 1.13 8.84 4.74 1.1E-05 5.9E-03 Abca1 0.18 1.14 6.11 3.72 3.9E-04 2.9E-02 Acot9 -0.21 1.16 3.78 -3.09 2.9E-03 9.2E-02 Acsl4 -0.15 1.11 6.47 -3.74 3.6E-04 2.9E-02 Acsl5 -0.21 1.15 5.80 -3.39 1.1E-03 5.5E-02 Actb 0.15 1.11 9.78 4.44 3.1E-05 9.7E-03 Actl10 -0.42 1.34 1.50 -2.75 7.5E-03 1.5E-01 Actn1 0.18 1.13 7.44 2.98 3.9E-03 1.1E-01 Actn2 0.20 1.15 6.47 2.61 1.1E-02 1.9E-01 Adam33 -0.58 1.49 1.74 -3.75 3.5E-04 2.9E-02 Adcy1 -0.14 1.10 9.69 -2.83 6.0E-03 1.4E-01 Adcy2 -0.21 1.16 7.01 -3.54 6.9E-04 4.1E-02 Adcy6 -0.17 1.13 5.58 -3.25 1.7E-03 7.1E-02 Adora2a 0.24 1.18 8.15 2.98 3.9E-03 1.1E-01 Adra1d -0.57 1.49 2.76 -3.01 3.6E-03 1.1E-01 Adrbk2 -0.18 1.13 7.08 -3.47 8.7E-04 4.6E-02 Agt 0.62 1.54 2.30 3.19 2.1E-03 8.0E-02 log2F Av.Exp Gene C FC . t P adj.P AI464131 0.15 1.11 5.36 3.19 2.1E-03 8.0E-02 Akap7 -0.16 1.12 5.11 -2.57 1.2E-02 2.0E-01 Amot 0.14 1.10 4.98 2.67 9.4E-03 1.7E-01 Amotl1 0.14 1.10 5.65 2.96 4.2E-03 1.1E-01 Angpt1 -0.42 1.34 2.78 -3.19 2.1E-03 8.0E-02 Ankrd63 0.19 1.14 6.89 2.82 6.3E-03 1.4E-01 Apod 0.16 1.12 7.18 3.13 2.5E-03 8.6E-02 Arhgap15 -0.40 1.32 3.22 -3.54 6.9E-04 4.1E-02 Arhgap42 -0.24 1.18 3.99 -2.90 5.0E-03 1.3E-01 Arhgef25 -0.16 1.11 6.81 -2.60 1.1E-02 1.9E-01 Atad2 -0.27 1.21 3.72 -3.73 3.8E-04 2.9E-02 Atm -0.15 1.11 5.23 -3.05 3.2E-03 9.8E-02 Atp11b -0.26 1.20 7.12 -6.63 5.1E-09 7.4E-05 B3galt2 -0.23 1.17 5.25 -3.41 1.1E-03 5.2E-02 B3gnt2 0.22 1.16 6.35 3.17 2.3E-03 8.3E-02 Baiap2 0.17 1.13 8.73 3.90 2.1E-04 2.5E-02 Baiap3 0.47 1.38 3.74 2.93 4.5E-03 1.2E-01 Basp1 -0.20 1.15 7.65 -3.01 3.6E-03 1.1E-01 Baz1a 0.25 1.19 3.15 2.72 8.3E-03 1.6E-01 BC023829 0.14 1.11 5.22 2.83 6.1E-03 1.4E-01 BC049635 -0.37 1.29 2.50 -2.58 1.2E-02 2.0E-01 Bcl11b 0.17 1.12 8.13 2.59 1.1E-02 1.9E-01 Bcl2 0.18 1.13 5.02 3.27 1.7E-03 6.8E-02 Bcor 0.19 1.14 4.82 3.04 3.3E-03 1.0E-01 Bend6 -0.15 1.11 6.97 -3.17 2.2E-03 8.3E-02 Bhlhe22 -0.45 1.37 3.55 -2.77 7.1E-03 1.5E-01 Bmp3 -0.55 1.46 2.85 -3.79 3.1E-04 2.9E-02 Bok -0.31 1.24 4.96 -4.31 5.0E-05 1.3E-02 C030013G03Ri k 0.59 1.50 1.34 2.68 9.1E-03 1.7E-01 C130074G19Ri k -0.23 1.18 5.62 -3.37 1.2E-03 5.7E-02 C1ql3 -0.57 1.49 4.80 -4.37 4.1E-05 1.1E-02 C4b 0.35 1.27 3.73 3.75 3.5E-04 2.9E-02 C730002L08Rik -0.70 1.63 2.96 -4.52 2.3E-05 8.3E-03 Cachd1 0.25 1.19 3.73 2.89 5.1E-03 1.3E-01 Cacna1g -0.24 1.18 6.14 -4.24 6.4E-05 1.4E-02 Cacna2d1 -0.18 1.13 7.89 -4.74 1.0E-05 5.9E-03 log2F Av.Exp Gene C FC . t P adj.P Cacna2d2 0.20 1.15 6.37 3.37 1.2E-03 5.7E-02 Cacng4 0.20 1.15 4.85 2.63 1.1E-02 1.8E-01 Cadps -0.15 1.11 7.57 -3.62 5.5E-04 3.5E-02 Cadps2 -0.32 1.25 5.93 -4.69 1.2E-05 6.0E-03 Camk1g 0.20 1.15 4.63 2.99 3.8E-03 1.1E-01 Camk2g -0.14 1.10 7.38 -2.79 6.6E-03 1.5E-01 Cap1 0.16 1.12 8.33 3.92 2.0E-04 2.5E-02 Capn6 -0.47 1.39 1.74 -3.14 2.4E-03 8.5E-02 Car10 -0.42 1.34 5.86 -3.79 3.1E-04 2.9E-02 Car12 0.21 1.16 5.72 2.73 7.9E-03 1.6E-01 Cav2 -0.15 1.11 5.25 -2.76 7.4E-03 1.5E-01 Cbln2 -0.37 1.29 4.63 -2.83 5.9E-03 1.4E-01 Ccbe1 -0.45 1.36 2.12 -2.64 1.0E-02 1.8E-01 Ccdc136 -0.17 1.12 5.39 -2.66 9.5E-03 1.7E-01 Ccdc6 0.17 1.12 5.69 3.73 3.8E-04 2.9E-02 Ccdc85a -0.17 1.13 5.77 -3.94 1.8E-04 2.4E-02 Cck -0.33 1.26 6.49 -3.22 1.9E-03 7.5E-02 Ccl27a -0.16 1.12 5.15 -3.24 1.8E-03 7.2E-02 Ccnd2 0.14 1.10 6.74 3.73 3.8E-04 2.9E-02 Cd34 -0.25 1.19 5.38 -3.54 7.0E-04 4.1E-02 Cd59a -0.32 1.25 3.79 -2.76 7.3E-03 1.5E-01 Cd82 0.19 1.14 4.24 2.73 7.8E-03 1.6E-01 Cdc25b -0.18 1.14 4.31 -3.00 3.6E-03 1.1E-01 Cdc42ep3 0.24 1.18 4.60 3.37 1.2E-03 5.7E-02 Cdk14 -0.27 1.20 7.32 -3.97 1.6E-04 2.3E-02 Cds1 -0.14 1.10 6.08 -2.60 1.1E-02 1.9E-01 Cep170b -0.14 1.10 7.99 -3.19 2.1E-03 8.0E-02 Chd5 -0.16 1.12 8.17 -4.03 1.4E-04 2.1E-02 Chl1 -0.16 1.12 7.16 -2.96 4.2E-03 1.1E-01 Chrm3 -0.22 1.17 4.47 -2.83 6.0E-03 1.4E-01 Chrna4 -0.22 1.17 4.99 -2.64 1.0E-02 1.8E-01 Ckb 0.14 1.10 10.30 3.68 4.4E-04 3.1E-02 Cldn11 0.20 1.15 7.19 3.73 3.7E-04 2.9E-02 Clic4 0.17 1.12 6.75 3.40 1.1E-03 5.3E-02 Cnih3 -0.34 1.26 5.63 -4.20 7.5E-05 1.5E-02 Cnksr2 -0.15 1.11 7.86 -3.70 4.2E-04 3.0E-02 Cnp 0.17 1.13 8.51 3.51 7.8E-04 4.4E-02 Cntnap4 -0.22 1.16 4.19 -2.96 4.2E-03 1.1E-01 log2F Av.Exp Gene C FC . t P adj.P Col11a1 -0.28 1.22 5.35 -3.87 2.4E-04 2.6E-02 Col12a1 -0.41 1.33 4.51 -4.30 5.2E-05 1.3E-02 Col19a1 -0.33 1.26 5.76 -4.71 1.2E-05 5.9E-03 Col24a1 -0.31 1.24 4.22 -2.97 4.1E-03 1.1E-01 Col25a1 -0.15 1.11 5.76 -2.79 6.7E-03 1.5E-01 Col5a1 -0.23 1.17 4.71 -2.60 1.1E-02 1.9E-01 Col6a4 -0.46 1.38 3.70 -2.67 9.3E-03 1.7E-01 Coro2a -0.20 1.15 4.83 -3.00 3.7E-03 1.1E-01 Coro6 -0.19 1.14 4.33 -2.62 1.1E-02 1.9E-01 Cpeb1 -0.14 1.11 5.85 -2.62 1.1E-02 1.9E-01 Cpne4 -0.39 1.31 6.15 -4.56 2.1E-05 8.1E-03 Cpne9 -0.37 1.29 5.26 -4.24 6.6E-05 1.4E-02 Creg2 -0.20 1.15 6.77 -3.73 3.8E-04 2.9E-02 Cry1 0.20 1.15 4.60 2.78 6.8E-03 1.5E-01 Csf1r 0.16 1.12 7.20 3.55 6.8E-04 4.1E-02 Ctps2 -0.16 1.12 5.22 -3.01 3.6E-03 1.1E-01 Cux2 -0.31 1.24 5.49 -3.21 2.0E-03 7.7E-02 Cyp2s1 0.36 1.28 3.41 2.74 7.6E-03 1.6E-01 D130043K22Rik -0.15 1.11 5.48 -3.13 2.5E-03 8.6E-02 Dact2 -0.14 1.10 5.75 -2.71 8.4E-03 1.6E-01 Ddit4 0.19 1.14 5.14 2.85 5.7E-03 1.3E-01 Dgkz -0.26 1.20 8.96 -4.20 7.6E-05 1.5E-02 Dkk3 -0.23 1.18 7.70 -3.15 2.4E-03 8.5E-02 Dlgap1 -0.24 1.18 8.41 -3.95 1.8E-04 2.4E-02 Dnajb5 0.18 1.13 6.75 3.09 2.8E-03 9.1E-02 Dnajc6 -0.14 1.10 8.13 -3.72 3.9E-04 2.9E-02 Doc2a -0.27 1.21 4.46 -3.21 2.0E-03 7.8E-02 Doc2b 0.21 1.16 6.60 3.02 3.5E-03 1.0E-01 Dock10 0.20 1.15 6.29 3.08 2.9E-03 9.3E-02 Dpp10 -0.19 1.14 6.67 -2.65 9.9E-03 1.8E-01 Dpy19l1 -0.18 1.13 6.79 -3.75 3.5E-04 2.9E-02 Dpy19l3 0.26 1.20 6.49 4.74 1.0E-05 5.9E-03 Drd2 0.28 1.21 6.95 3.45 9.3E-04 4.8E-02 Dscam -0.21 1.15 5.31 -3.01 3.6E-03 1.1E-01 E130012A19Rik -0.25 1.19 5.25 -2.79 6.8E-03 1.5E-01 Ecel1 0.23 1.18 4.79 2.85 5.7E-03 1.3E-01 Ednrb 0.22 1.16 6.01 3.89 2.2E-04 2.5E-02 Efhd1 0.17 1.13 4.30 2.62 1.1E-02 1.9E-01 log2F Av.Exp Gene C FC . t P adj.P Efhd2 -0.25 1.19 7.32 -3.70 4.2E-04 3.0E-02 Efr3a -0.17 1.13 6.44 -3.01 3.6E-03 1.1E-01 Efs 0.26 1.19 3.16 2.72 8.2E-03 1.6E-01 Egr1 0.23 1.17 7.98 2.76 7.3E-03 1.5E-01 Elavl2 -0.18 1.13 5.85 -3.40 1.1E-03 5.4E-02 Elmo1 0.16 1.12 7.42 3.89 2.2E-04 2.5E-02 Elovl5 0.15 1.11 6.50 4.27 5.9E-05 1.4E-02 Eltd1 0.18 1.13 5.00 3.34 1.3E-03 5.9E-02 Epha7 -0.14 1.10 6.48 -3.16 2.3E-03 8.3E-02 Ephb6 -0.18 1.13 6.99 -3.16 2.3E-03 8.3E-02 Erbb3 0.28 1.22 3.46 2.73 8.0E-03 1.6E-01 Etl4 -0.21 1.16 6.59 -4.13 9.5E-05 1.7E-02 Extl1 -0.16 1.12 6.00 -3.59 6.0E-04 3.8E-02 Fa2h 0.20 1.15 5.29 2.65 9.8E-03 1.8E-01 Faah -0.22 1.16 5.67 -2.78 6.9E-03 1.5E-01 Fabp3 -0.15 1.11 5.31 -2.67 9.4E-03 1.7E-01 Fam155a -0.16 1.11 5.75 -2.67 9.3E-03 1.7E-01 Fam189a1 -0.14 1.10 6.20 -3.16 2.3E-03 8.3E-02 Fam20a 0.21 1.16 3.33 2.59 1.1E-02 1.9E-01 Fam65b 0.19 1.14 6.49 4.15 9.1E-05 1.7E-02 Fam81a -0.28 1.21 7.01 -3.88 2.3E-04 2.6E-02 Fap -0.44 1.35 1.66 -2.81 6.3E-03 1.4E-01 Fbxw7 -0.19 1.14 7.52 -4.56 2.0E-05 8.1E-03 Fezf2 -0.42 1.34 3.47 -3.20 2.0E-03 7.8E-02 Fgf12 -0.15 1.11 7.27 -3.80 2.9E-04 2.9E-02 Fhl2 -0.26 1.20 4.51 -2.85 5.6E-03 1.3E-01 Fhod3 -0.43 1.35 5.13 -4.57 2.0E-05 8.1E-03 Fkbp1b -0.27 1.21 3.82 -2.72 8.2E-03 1.6E-01 Flna 0.19 1.14 7.42 3.79 3.1E-04 2.9E-02 Flot1 -0.18 1.14 6.09 -3.13 2.5E-03 8.6E-02 Flrt2 -0.16 1.12 6.12 -3.00 3.7E-03 1.1E-01 Flt1 0.15 1.11 6.11 2.67 9.4E-03 1.7E-01 Fmn1 -0.28 1.22 4.10 -2.89 5.1E-03 1.3E-01 Fndc9 0.32 1.25 3.12 3.15 2.4E-03 8.4E-02 Fosb 0.27 1.21 4.07 2.89 5.0E-03 1.3E-01 Fosl2 0.37 1.29 5.31 3.86 2.4E-04 2.6E-02 Frem1 -0.45 1.37 1.88 -2.80 6.6E-03 1.5E-01 Frrs1l -0.15 1.11 7.52 -3.73 3.7E-04 2.9E-02 log2F Av.Exp Gene C FC . t P adj.P Fut9 -0.14 1.10 7.66 -3.42 1.0E-03 5.1E-02 Fxyd6 -0.27 1.21 6.18 -3.68 4.4E-04 3.1E-02 Gaa 0.15 1.11 7.98 2.89 5.1E-03 1.3E-01 Gab1 0.15 1.11 5.26 2.66 9.6E-03 1.7E-01 Gabbr2 -0.21 1.16 6.89 -2.96 4.2E-03 1.1E-01 Gabra1 -0.16 1.12 8.05 -3.36 1.2E-03 5.8E-02 Gabra2 0.27 1.21 5.95 4.22 7.0E-05 1.5E-02 Gabra3 -0.31 1.24 6.90 -4.35 4.4E-05 1.2E-02 Gabra5 -0.17 1.12 5.21 -2.62 1.1E-02 1.8E-01 Gad1 0.15 1.11 8.82 2.80 6.6E-03 1.5E-01 Gad2 0.20 1.15 8.33 3.44 9.8E-04 5.0E-02 Gdpd5 0.21 1.16 5.72 3.63 5.2E-04 3.4E-02 Gfra2 -0.35 1.27 5.47 -3.50 8.1E-04 4.4E-02 Gls -0.14 1.10 8.63 -4.66 1.4E-05 6.5E-03 Glt8d2 -0.41 1.33 2.65 -2.67 9.2E-03 1.7E-01 Gm11549 -0.31 1.24 4.36 -2.74 7.8E-03 1.6E-01 Gm13889 0.24 1.18 3.74 2.82 6.2E-03 1.4E-01 Gm3002 -0.17 1.12 5.05 -2.93 4.6E-03 1.2E-01 Gm3893 -1.26 2.40 4.73 -5.57 4.1E-07 1.1E-03 Gna12 0.15 1.11 5.84 3.63 5.2E-04 3.4E-02 Gnai1 -0.14 1.10 7.35 -3.32 1.4E-03 6.1E-02 Gnal 0.15 1.11 9.47 2.85 5.7E-03 1.3E-01 Gnb4 -0.22 1.16 5.91 -3.73 3.8E-04 2.9E-02 Gng2 -0.30 1.23 7.36 -4.56 2.0E-05 8.1E-03 Golga7b -0.17 1.12 6.65 -2.97 4.0E-03 1.1E-01 Golim4 0.16 1.12 4.89 3.30 1.5E-03 6.5E-02 Gpr123 -0.22 1.17 5.26 -2.81 6.3E-03 1.4E-01 Gpr17 0.28 1.21 5.87 5.42 7.4E-07 1.1E-03 Gpr22 -0.33 1.26 5.18 -5.23 1.6E-06 2.1E-03 Gpr37 0.19 1.14 6.07 3.13 2.5E-03 8.6E-02 Gpr56 0.16 1.12 5.97 3.26 1.7E-03 7.0E-02 Gpr88 0.23 1.18 9.68 2.71 8.4E-03 1.6E-01 Gprc5b 0.14 1.10 7.21 3.88 2.3E-04 2.6E-02 Gpt2 0.15 1.11 6.15 4.11 1.0E-04 1.8E-02 Greb1l -0.31 1.24 3.41 -3.09 2.8E-03 9.1E-02 Gria4 -0.15 1.11 7.00 -4.79 8.7E-06 5.9E-03 Grin2a -0.21 1.15 5.33 -3.43 1.0E-03 5.0E-02 Grin3a -0.20 1.15 5.25 -2.68 9.1E-03 1.7E-01 log2F Av.Exp Gene C FC . t P adj.P Grm2 -0.65 1.57 4.14 -4.86 6.7E-06 5.7E-03 Gsn 0.20 1.15 5.91 3.60 5.8E-04 3.7E-02 Gstm1 0.14 1.10 7.47 3.46 9.2E-04 4.8E-02 Gtdc1 -0.16 1.12 5.39 -3.50 8.0E-04 4.4E-02 Gucy1a2 -0.15 1.11 7.12 -3.75 3.5E-04 2.9E-02 Hap1 0.15 1.11 7.02 2.65 1.0E-02 1.8E-01 Hcn1 -0.18 1.13 5.36 -2.60 1.1E-02 1.9E-01 Hdac9 -0.19 1.14 5.06 -2.64 1.0E-02 1.8E-01 Hecw1 -0.22 1.17 6.26 -5.07 2.9E-06 3.1E-03 Heph 0.26 1.20 3.19 2.72 8.1E-03 1.6E-01 Herc3 -0.16 1.12 6.98 -2.93 4.5E-03 1.2E-01 Herc6 -0.29 1.23 3.96 -3.14 2.4E-03 8.5E-02 Hivep1 -0.17 1.13 6.27 -3.51 7.8E-04 4.4E-02 Hkdc1 -0.67 1.59 2.88 -4.13 9.5E-05 1.7E-02 Hmgcs1 -0.14 1.10 8.08 -3.70 4.2E-04 3.0E-02 Hmgcs2 0.24 1.18 3.44 2.68 9.2E-03 1.7E-01 Hmgn1 0.14 1.10 5.94 2.94 4.4E-03 1.2E-01 Hook2 -0.17 1.13 3.71 -2.58 1.2E-02 2.0E-01 Hsd17b7 -0.16 1.12 4.58 -2.85 5.7E-03 1.3E-01 Hspa5 0.21 1.16 7.88 4.55 2.1E-05 8.1E-03 Htr1a -0.45 1.37 3.46 -4.80 8.2E-06 5.9E-03 Htr2a -0.30 1.23 4.14 -3.10 2.8E-03 9.0E-02 Hunk -0.38 1.30 3.57 -4.04 1.3E-04 2.0E-02 Id2 -0.14 1.10 6.64 -3.01 3.6E-03 1.1E-01 Id3 0.17 1.13 4.72 2.77 7.0E-03 1.5E-01 Id4 0.17 1.13 6.58 2.71 8.3E-03 1.6E-01 Igfbp5 0.15 1.11 7.22 2.96 4.2E-03 1.1E-01 Igsf11 0.22 1.17 5.73 3.87 2.3E-04 2.6E-02 Igsf21 -0.19 1.14 5.75 -3.23 1.9E-03 7.4E-02 Insig1 -0.17 1.13 6.25 -3.80 3.0E-04 2.9E-02 Ipcef1 -0.34 1.27 5.98 -4.09 1.1E-04 1.9E-02 Irf2bp2 0.14 1.10 5.62 3.08 2.9E-03 9.2E-02 Itgam 0.14 1.10 5.31 2.76 7.2E-03 1.5E-01 Itih5 0.15 1.11 6.08 3.10 2.7E-03 9.0E-02 Itpr2 0.16 1.12 4.89 2.80 6.6E-03 1.5E-01 Kazn 0.16 1.11 7.48 3.29 1.5E-03 6.5E-02 Kcnc2 -0.24 1.18 6.25 -3.46 9.1E-04 4.7E-02 Kcnh7 -0.34 1.27 4.10 -3.84 2.6E-04 2.7E-02 log2F Av.Exp Gene C FC . t P adj.P Kcnip2 0.17 1.12 8.30 2.97 4.1E-03 1.1E-01 Kcnj3 -0.31 1.24 4.44 -3.22 1.9E-03 7.5E-02 Kcnj6 -0.32 1.25 3.77 -2.66 9.6E-03 1.7E-01 Kcnj9 -0.26 1.20 6.43 -4.06 1.2E-04 1.9E-02 Kcnk4 -0.37 1.29 2.59 -2.81 6.3E-03 1.4E-01 Kcnk9 -0.30 1.23 3.56 -3.80 3.0E-04 2.9E-02 Kcnmb4 -0.22 1.17 4.92 -3.16 2.3E-03 8.3E-02 Kcnt2 -0.42 1.34 4.22 -5.08 2.8E-06 3.1E-03 Kcnv1 -0.20 1.15 6.66 -3.78 3.2E-04 2.9E-02 Kdm4b 0.20 1.15 6.67 3.71 4.0E-04 3.0E-02 Khdrbs3 -0.19 1.14 6.60 -3.03 3.4E-03 1.0E-01 Kirrel3 0.19 1.14 5.76 2.78 6.8E-03 1.5E-01 Klhl13 0.17 1.13 7.05 2.59 1.2E-02 2.0E-01 L3mbtl1 -0.21 1.15 3.81 -2.86 5.6E-03 1.3E-01 Lancl2 -0.17 1.12 6.06 -2.68 9.1E-03 1.7E-01 Ldhd -0.32 1.25 3.70 -3.69 4.4E-04 3.1E-02 Lmo4 -0.20 1.15 7.34 -3.77 3.3E-04 2.9E-02 Lnpep -0.14 1.10 5.94 -2.96 4.1E-03 1.1E-01 Lrp10 0.16 1.12 4.82 2.82 6.2E-03 1.4E-01 Lrrc10b 0.29 1.22 7.65 2.75 7.5E-03 1.5E-01 Lrrcc1 -0.14 1.11 4.97 -2.68 9.1E-03 1.7E-01 Lrrn1 0.16 1.12 5.82 3.09 2.8E-03 9.2E-02 Lrrtm1 0.16 1.12 5.55 2.89 5.1E-03 1.3E-01 Lypd6 -0.15 1.11 5.25 -2.86 5.5E-03 1.3E-01 Lypd6b -0.33 1.25 3.69 -3.33 1.4E-03 6.1E-02 Mag 0.23 1.17 7.32 3.54 7.1E-04 4.2E-02 Mal 0.22 1.16 8.18 3.60 5.8E-04 3.7E-02 Mal2 -0.15 1.11 7.62 -3.43 1.0E-03 5.1E-02 Map3k9 -0.23 1.17 6.49 -4.79 8.6E-06 5.9E-03 Mapk8 -0.15 1.11 6.90 -3.98 1.6E-04 2.3E-02 March4 0.15 1.11 5.07 2.87 5.3E-03 1.3E-01 Mblac2 -0.14 1.10 5.05 -2.90 4.9E-03 1.3E-01 Medag -0.42 1.34 3.96 -4.08 1.1E-04 1.9E-02 Mef2c -0.32 1.24 8.34 -4.89 5.8E-06 5.3E-03 Megf10 0.17 1.12 5.33 3.49 8.2E-04 4.5E-02 Meis1 0.35 1.27 3.43 2.85 5.6E-03 1.3E-01 Mesdc1 0.23 1.17 5.59 3.82 2.8E-04 2.8E-02 Mfsd4 -0.33 1.26 5.18 -3.90 2.1E-04 2.5E-02 log2F Av.Exp Gene C FC . t P adj.P Miat -0.31 1.24 8.90 -5.52 5.0E-07 1.1E-03 Midn 0.21 1.15 5.48 2.86 5.5E-03 1.3E-01 Mkx -0.43 1.35 3.76 -3.93 1.9E-04 2.4E-02 Mn1 0.18 1.13 6.00 3.30 1.5E-03 6.4E-02 Mobp 0.20 1.15 8.40 3.03 3.3E-03 1.0E-01 Mpped1 -0.22 1.16 7.46 -3.70 4.2E-04 3.0E-02 Mrgpre -0.24 1.18 3.15 -2.74 7.8E-03 1.6E-01 Mt2 0.20 1.15 6.00 3.55 6.8E-04 4.1E-02 Mtus1 0.18 1.13 5.84 3.66 4.8E-04 3.3E-02 Myh14 0.16 1.12 5.80 2.80 6.6E-03 1.5E-01 Myh9 0.15 1.11 6.60 3.15 2.4E-03 8.5E-02 Myl4 -0.44 1.36 3.32 -2.80 6.5E-03 1.5E-01 Myo10 0.21 1.16 5.72 4.53 2.3E-05 8.3E-03 Myrf 0.24 1.18 5.96 3.54 7.0E-04 4.1E-02 Myrip -0.16 1.12 5.96 -3.24 1.8E-03 7.3E-02 Napb -0.14 1.11 8.60 -3.25 1.7E-03 7.1E-02 Nav3 -0.18 1.13 6.05 -4.32 4.9E-05 1.3E-02 Ncald -0.34 1.26 8.50 -4.24 6.5E-05 1.4E-02 Ncam2 -0.16 1.12 6.04 -2.95 4.3E-03 1.2E-01 Ncdn 0.16 1.11 10.48 3.93 1.9E-04 2.4E-02 Nde1 0.16 1.12 4.45 2.83 6.1E-03 1.4E-01 Ndrg1 0.15 1.11 6.79 2.98 4.0E-03 1.1E-01 Ndst3 -0.30 1.23 4.81 -3.37 1.2E-03 5.7E-02 Necab2 0.18 1.13 7.23 2.95 4.2E-03 1.2E-01 Necab3 -0.26 1.20 5.52 -3.20 2.0E-03 7.8E-02 Neurod2 -0.30 1.23 5.01 -2.94 4.4E-03 1.2E-01 Neurod6 -0.42 1.33 5.13 -3.26 1.7E-03 7.0E-02 Nfib -0.17 1.13 6.48 -3.50 8.1E-04 4.4E-02 Ninl -0.30 1.23 3.14 -3.83 2.7E-04 2.7E-02 Nnat 0.28 1.21 6.45 3.35 1.3E-03 5.8E-02 Nnt -0.22 1.16 5.12 -3.07 3.0E-03 9.6E-02 Nol4 -0.14 1.10 6.51 -3.36 1.2E-03 5.8E-02 Notch1 0.20 1.15 5.45 3.68 4.5E-04 3.1E-02 Notch2 0.15 1.11 4.93 2.91 4.8E-03 1.2E-01 Nov -0.45 1.37 5.68 -2.86 5.6E-03 1.3E-01 Npbwr1 -0.67 1.59 1.28 -4.04 1.3E-04 2.0E-02 Npc1 0.15 1.11 6.17 3.08 2.9E-03 9.3E-02 Npr3 -0.50 1.42 2.37 -3.80 2.9E-04 2.9E-02 log2F Av.Exp Gene C FC . t P adj.P Nptx1 -0.25 1.19 7.71 -2.74 7.7E-03 1.6E-01 Npy1r -0.18 1.13 4.39 -2.99 3.8E-03 1.1E-01 Nr4a1 0.29 1.22 6.73 2.68 9.2E-03 1.7E-01 Nr4a2 -0.38 1.30 5.80 -3.74 3.7E-04 2.9E-02 Nrg3 -0.21 1.16 4.92 -3.35 1.3E-03 5.8E-02 Nrip3 -0.19 1.14 6.38 -3.79 3.1E-04 2.9E-02 Nrn1 -0.47 1.38 6.41 -3.80 3.0E-04 2.9E-02 Nt5e 0.24 1.18 4.08 2.59 1.2E-02 1.9E-01 Ntng2 -0.28 1.21 4.69 -2.96 4.1E-03 1.1E-01 Nudt4 -0.14 1.11 7.07 -2.98 3.9E-03 1.1E-01 Nxph3 -0.23 1.17 4.21 -2.64 1.0E-02 1.8E-01 Olfm2 -0.24 1.18 5.56 -2.71 8.5E-03 1.6E-01 Olfm3 -0.24 1.18 5.75 -4.15 8.8E-05 1.7E-02 Olig2 0.20 1.15 4.30 2.91 4.7E-03 1.2E-01 Opcml -0.15 1.11 7.36 -3.18 2.2E-03 8.2E-02 Oprk1 -0.24 1.18 5.68 -4.19 7.7E-05 1.5E-02 Osbpl1a -0.20 1.15 7.74 -3.96 1.7E-04 2.3E-02 Oxr1 -0.28 1.22 7.69 -5.43 7.0E-07 1.1E-03 P4ha1 0.28 1.21 5.99 5.55 4.4E-07 1.1E-03 Padi2 0.17 1.13 5.27 3.26 1.7E-03 7.0E-02 Pak1 -0.18 1.13 8.20 -2.67 9.3E-03 1.7E-01 Pak7 -0.28 1.21 5.39 -4.51 2.4E-05 8.3E-03 Palm2 -0.17 1.12 5.44 -2.94 4.4E-03 1.2E-01 Pamr1 -0.32 1.25 4.47 -3.48 8.5E-04 4.5E-02 Parvb 0.16 1.12 4.68 2.82 6.3E-03 1.4E-01 Pcdhga8 0.30 1.23 3.48 3.16 2.3E-03 8.3E-02 Pcdhgc3 0.14 1.10 6.22 3.63 5.2E-04 3.4E-02 Pcp4l1 0.18 1.13 8.41 3.21 2.0E-03 7.7E-02 Pde1a -0.26 1.19 7.03 -4.23 6.7E-05 1.4E-02 Pde1b 0.18 1.13 10.18 2.82 6.2E-03 1.4E-01 Pdia4 0.22 1.16 5.19 3.67 4.6E-04 3.2E-02 Pdk1 -0.18 1.13 5.87 -3.42 1.0E-03 5.1E-02 Pdk4 0.19 1.14 4.05 2.92 4.7E-03 1.2E-01 Pdzd2 0.19 1.14 7.06 3.33 1.4E-03 6.1E-02 Peg10 0.49 1.40 4.90 3.65 4.9E-04 3.3E-02 Penk 0.33 1.26 9.94 4.42 3.5E-05 1.0E-02 Per2 0.33 1.25 5.58 4.40 3.6E-05 1.0E-02 Pfkfb3 0.25 1.19 5.63 4.71 1.1E-05 5.9E-03 log2F Av.Exp Gene C FC . t P adj.P Pgm2l1 -0.35 1.27 8.55 -6.36 1.6E-08 1.2E-04 Phgdh 0.18 1.13 6.33 4.00 1.5E-04 2.2E-02 Pisd-ps1 -0.31 1.24 8.49 -4.56 2.1E-05 8.1E-03 Pisd-ps2 -0.26 1.20 5.26 -3.54 7.1E-04 4.2E-02 Pla2g4e -0.49 1.41 3.15 -5.18 1.9E-06 2.3E-03 Plcb4 -0.24 1.18 4.81 -3.12 2.6E-03 8.7E-02 Plce1 0.28 1.22 3.91 3.52 7.4E-04 4.3E-02 Plcxd2 -0.23 1.17 6.33 -2.85 5.7E-03 1.3E-01 Plekhg3 0.19 1.14 4.26 2.57 1.2E-02 2.0E-01 Plp1 0.17 1.13 10.76 3.18 2.2E-03 8.1E-02 Pls3 -0.17 1.12 7.09 -3.77 3.3E-04 2.9E-02 Plxna1 -0.20 1.15 6.23 -2.97 4.0E-03 1.1E-01 Plxnb1 0.15 1.11 7.19 3.87 2.3E-04 2.6E-02 Pnpla3 -0.21 1.16 4.15 -2.77 7.1E-03 1.5E-01 Ppap2b 0.15 1.11 8.19 4.73 1.1E-05 5.9E-03 Ppm1e -0.26 1.19 7.20 -3.73 3.8E-04 2.9E-02 Ppp1r16b 0.15 1.11 8.73 3.13 2.5E-03 8.6E-02 Ppp1r1b 0.24 1.18 9.93 3.56 6.6E-04 4.0E-02 Ppp1r3c 0.16 1.12 5.90 3.38 1.2E-03 5.6E-02 Prkaa2 -0.22 1.16 5.68 -3.99 1.6E-04 2.2E-02 Prkar1b -0.17 1.13 9.16 -2.68 9.0E-03 1.7E-01 Prss12 -0.35 1.27 4.20 -3.33 1.4E-03 6.1E-02 Ptpn3 -0.27 1.20 5.26 -3.04 3.3E-03 1.0E-01 Ptpn4 -0.16 1.12 5.89 -2.90 4.9E-03 1.3E-01 Ptpn5 0.20 1.15 9.24 3.44 9.8E-04 5.0E-02 Ptprk -0.27 1.21 5.42 -3.39 1.1E-03 5.5E-02 Ptpro 0.20 1.15 5.16 3.44 9.7E-04 5.0E-02 Pvrl3 -0.35 1.27 3.84 -3.38 1.2E-03 5.6E-02 Rabgap1l -0.16 1.11 7.33 -4.76 9.4E-06 5.9E-03 Rap1gap2 -0.21 1.16 8.08 -4.43 3.3E-05 1.0E-02 Rapgefl1 -0.18 1.13 7.04 -2.93 4.5E-03 1.2E-01 Raph1 -0.16 1.12 5.97 -2.83 6.0E-03 1.4E-01 Rasal1 -0.21 1.16 6.19 -3.02 3.5E-03 1.0E-01 Rasd2 0.21 1.16 9.40 2.77 7.0E-03 1.5E-01 Rasgef1c -0.18 1.13 5.48 -2.85 5.7E-03 1.3E-01 Rasgrf2 -0.30 1.23 6.35 -2.77 7.1E-03 1.5E-01 Rasl11b -0.28 1.21 5.20 -4.27 5.7E-05 1.4E-02 Rassf3 -0.16 1.11 5.35 -3.12 2.6E-03 8.8E-02 log2F Av.Exp Gene C FC . t P adj.P Rbm14 0.18 1.13 4.70 2.75 7.5E-03 1.5E-01 Rbm3 -0.15 1.11 6.49 -2.78 6.8E-03 1.5E-01 Rbms3 0.15 1.11 5.31 2.63 1.0E-02 1.8E-01 Rgag4 0.16 1.12 5.08 2.81 6.4E-03 1.4E-01 Rgs2 0.26 1.20 6.82 3.76 3.4E-04 2.9E-02 Rgs20 0.24 1.18 5.78 5.42 7.5E-07 1.1E-03 Rgs8 0.15 1.11 7.92 2.76 7.2E-03 1.5E-01 Rhbdl3 0.22 1.17 5.28 3.36 1.3E-03 5.8E-02 Rims1 -0.17 1.12 7.31 -3.25 1.8E-03 7.1E-02 Rn45s -0.22 1.16 12.27 -3.39 1.1E-03 5.4E-02 Rnd3 0.28 1.22 4.25 3.14 2.4E-03 8.5E-02 Rnf152 -0.27 1.20 4.02 -3.05 3.2E-03 9.8E-02 Rorb -0.14 1.10 5.49 -2.77 7.1E-03 1.5E-01 Rtn4r -0.37 1.29 5.19 -3.02 3.5E-03 1.0E-01 Rundc1 0.21 1.15 6.03 4.25 6.2E-05 1.4E-02 Rxfp1 -0.43 1.35 2.85 -3.29 1.6E-03 6.6E-02 Rxrg 0.23 1.18 6.86 2.84 5.8E-03 1.4E-01 Ryr2 -0.15 1.11 7.64 -3.83 2.7E-04 2.7E-02 Sall2 0.15 1.11 6.21 3.21 2.0E-03 7.7E-02 Satb1 -0.22 1.16 6.12 -3.96 1.7E-04 2.3E-02 Satb2 -0.48 1.39 4.87 -4.16 8.6E-05 1.7E-02 Sbk1 0.17 1.13 6.97 4.71 1.1E-05 5.9E-03 Scai -0.21 1.15 6.83 -4.73 1.1E-05 5.9E-03 Scn1a -0.15 1.11 7.23 -4.42 3.4E-05 1.0E-02 Scn7a -0.68 1.60 2.10 -3.88 2.3E-04 2.6E-02 Scrt2 0.24 1.18 4.73 3.64 5.1E-04 3.4E-02 Scube1 -0.39 1.31 5.80 -2.98 3.9E-03 1.1E-01 Sdc4 0.15 1.11 5.93 2.76 7.2E-03 1.5E-01 Sdk1 -0.32 1.25 2.99 -3.01 3.6E-03 1.1E-01 Sel1l3 -0.19 1.14 5.32 -2.87 5.3E-03 1.3E-01 Sema6a 0.15 1.11 5.09 2.64 1.0E-02 1.8E-01 Sept6 -0.18 1.13 6.22 -3.67 4.7E-04 3.2E-02 Serpinb8 -0.39 1.31 2.28 -2.72 8.2E-03 1.6E-01 Serpinb9 -0.21 1.16 3.42 -2.57 1.2E-02 2.0E-01 Serpinh1 0.19 1.14 3.94 2.68 9.2E-03 1.7E-01 Serpini1 -0.23 1.17 7.58 -2.79 6.8E-03 1.5E-01 Sestd1 -0.19 1.14 6.49 -3.87 2.4E-04 2.6E-02 Sgsm1 0.14 1.10 6.56 2.84 5.9E-03 1.4E-01 log2F Av.Exp Gene C FC . t P adj.P Sh3gl2 -0.21 1.16 7.82 -3.61 5.6E-04 3.6E-02 Sh3rf2 0.38 1.30 5.46 3.29 1.5E-03 6.5E-02 Shank1 -0.23 1.17 8.65 -3.62 5.3E-04 3.5E-02 Sidt1 -0.37 1.29 4.80 -3.50 8.1E-04 4.4E-02 Sik1 0.32 1.25 4.38 3.62 5.4E-04 3.5E-02 Sik3 0.15 1.11 7.31 3.07 3.0E-03 9.4E-02 Six3 0.25 1.19 4.95 2.81 6.4E-03 1.4E-01 Six3os1 0.31 1.24 3.58 2.86 5.5E-03 1.3E-01 Slc15a4 0.18 1.13 4.23 2.62 1.1E-02 1.8E-01 Slc17a7 -0.35 1.27 9.53 -3.13 2.5E-03 8.6E-02 Slc25a25 0.16 1.11 6.04 2.94 4.4E-03 1.2E-01 Slc30a4 -0.14 1.10 6.57 -3.72 3.9E-04 2.9E-02 Slc32a1 0.21 1.16 7.07 3.30 1.5E-03 6.4E-02 Slc35d3 0.26 1.20 4.86 2.79 6.8E-03 1.5E-01 Slc39a10 -0.18 1.13 8.08 -4.04 1.3E-04 2.0E-02 Slc41a1 0.17 1.12 6.61 3.50 8.1E-04 4.4E-02 Slc4a10 -0.15 1.11 7.83 -4.28 5.5E-05 1.3E-02 Slc4a8 -0.16 1.11 6.79 -3.40 1.1E-03 5.4E-02 Slc6a11 0.18 1.14 7.17 3.68 4.4E-04 3.1E-02 Slc6a7 -0.23 1.17 5.76 -3.23 1.9E-03 7.5E-02 Slc8a1 -0.23 1.17 7.27 -3.53 7.1E-04 4.2E-02 Slit2 -0.27 1.21 4.27 -3.47 8.9E-04 4.7E-02 Slitrk1 -0.27 1.20 5.63 -3.03 3.4E-03 1.0E-01 Smoc2 -0.47 1.38 3.49 -3.16 2.3E-03 8.3E-02 Snai3 0.60 1.51 0.75 2.83 6.1E-03 1.4E-01 Snx33 0.19 1.14 3.58 2.67 9.3E-03 1.7E-01 Soat1 0.15 1.11 4.95 3.14 2.5E-03 8.6E-02 Sorbs1 0.15 1.11 7.61 3.13 2.5E-03 8.6E-02 Sox10 0.20 1.15 5.34 3.51 7.6E-04 4.3E-02 Sox11 0.24 1.18 4.65 3.99 1.5E-04 2.2E-02 Sox2 0.14 1.10 5.00 2.80 6.6E-03 1.5E-01 Sox5 -0.17 1.12 5.11 -2.68 9.2E-03 1.7E-01 Sparc 0.23 1.18 7.78 4.20 7.6E-05 1.5E-02 Sphkap -0.27 1.21 6.58 -2.72 8.1E-03 1.6E-01 Sprn -0.23 1.17 6.84 -3.35 1.3E-03 5.8E-02 Srebf1 0.16 1.12 5.85 3.43 9.8E-04 5.0E-02 Srgap1 0.27 1.21 6.13 3.32 1.4E-03 6.1E-02 Srm 0.19 1.14 5.56 3.06 3.1E-03 9.8E-02 log2F Av.Exp Gene C FC . t P adj.P Srrm4 -0.21 1.16 5.21 -3.76 3.4E-04 2.9E-02 Sstr1 -0.27 1.20 4.21 -2.86 5.5E-03 1.3E-01 St3gal1 -0.25 1.19 4.73 -3.15 2.3E-03 8.4E-02 St6gal2 -0.27 1.21 3.43 -3.17 2.2E-03 8.3E-02 Stac2 -0.22 1.16 6.37 -3.50 8.0E-04 4.4E-02 Stat3 0.14 1.10 5.56 2.90 5.0E-03 1.3E-01 Stmn1 -0.21 1.15 8.60 -3.11 2.7E-03 9.0E-02 Stmn2 -0.18 1.13 7.81 -2.65 9.9E-03 1.8E-01 Strbp -0.21 1.16 8.28 -5.49 5.6E-07 1.1E-03 Stx1a -0.32 1.25 7.39 -3.75 3.5E-04 2.9E-02 Stx3 -0.14 1.10 5.55 -3.50 8.1E-04 4.4E-02 Sv2b -0.26 1.20 8.71 -4.01 1.4E-04 2.1E-02 Syt1 -0.14 1.10 10.28 -3.27 1.6E-03 6.8E-02 Syt16 -0.15 1.11 6.23 -3.41 1.1E-03 5.2E-02 Syt6 0.21 1.16 6.84 2.63 1.1E-02 1.8E-01 Sytl2 -0.26 1.20 5.89 -3.90 2.2E-04 2.5E-02 Tbc1d24 -0.15 1.11 6.77 -3.80 2.9E-04 2.9E-02 Tbc1d4 0.21 1.16 4.66 2.61 1.1E-02 1.9E-01 Tbr1 -0.33 1.26 6.20 -3.73 3.7E-04 2.9E-02 Tcn2 0.24 1.18 4.34 3.83 2.7E-04 2.8E-02 Tenm1 -0.18 1.13 4.51 -2.61 1.1E-02 1.9E-01 Tgfa 0.19 1.14 7.14 2.69 8.9E-03 1.7E-01 Timp3 0.16 1.12 7.24 3.97 1.7E-04 2.3E-02 Tiparp 0.26 1.20 4.64 3.49 8.3E-04 4.5E-02 Tle4 0.19 1.14 6.71 2.90 4.9E-03 1.3E-01 Tmcc3 0.19 1.14 6.06 3.71 4.0E-04 3.0E-02 Tmem132d -0.32 1.25 4.21 -3.61 5.5E-04 3.5E-02 Tmem145 -0.30 1.23 4.22 -3.31 1.5E-03 6.3E-02 Tmem158 0.19 1.14 6.55 3.36 1.2E-03 5.8E-02 Tmem178 -0.27 1.21 5.09 -2.89 5.0E-03 1.3E-01 Tmem181b-ps -0.16 1.12 8.17 -2.71 8.4E-03 1.6E-01 Tmem196 -0.44 1.35 2.36 -2.77 7.1E-03 1.5E-01 Tmem245 -0.23 1.18 5.15 -3.93 1.9E-04 2.4E-02 Tmem44 -0.14 1.10 6.70 -3.97 1.7E-04 2.3E-02 Tmem47 0.16 1.12 7.55 4.12 9.8E-05 1.7E-02 Tmem56 -0.17 1.13 6.53 -3.95 1.8E-04 2.4E-02 Tmem63a 0.18 1.14 5.22 2.91 4.7E-03 1.2E-01 Tmem91 0.19 1.14 4.19 2.70 8.7E-03 1.7E-01 log2F Av.Exp Gene C FC . t P adj.P Tnfaip6 0.27 1.20 3.29 3.23 1.9E-03 7.4E-02 Tns3 0.15 1.11 6.59 4.04 1.3E-04 2.0E-02 Tox -0.40 1.32 3.90 -4.08 1.1E-04 1.9E-02 Tprkb 0.14 1.10 6.27 2.89 5.1E-03 1.3E-01 Trf 0.22 1.17 8.23 3.56 6.5E-04 4.0E-02 Trhde -0.35 1.28 4.32 -4.46 3.0E-05 9.6E-03 Trib2 0.19 1.14 5.68 3.76 3.4E-04 2.9E-02 Trpm4 -0.24 1.18 3.89 -3.33 1.4E-03 6.0E-02 Tshz3 -0.29 1.22 4.45 -2.70 8.7E-03 1.7E-01 Tspan15 0.18 1.13 4.15 2.71 8.5E-03 1.6E-01 Tspan17 -0.26 1.20 4.63 -3.64 5.1E-04 3.4E-02 Ttyh2 0.22 1.16 5.40 3.52 7.5E-04 4.3E-02 Tubb2b 0.18 1.13 6.03 3.84 2.6E-04 2.7E-02 Tut1 0.16 1.12 4.57 2.77 7.1E-03 1.5E-01 Txnrd1 0.17 1.13 6.26 3.93 1.9E-04 2.4E-02 Ubash3b 0.18 1.13 4.35 2.97 4.0E-03 1.1E-01 Ube2l6 -0.27 1.21 3.04 -2.71 8.4E-03 1.6E-01 Uggt2 -0.18 1.13 5.75 -3.72 3.8E-04 2.9E-02 Unc13c 0.26 1.19 7.80 2.83 6.0E-03 1.4E-01 Usp27x 0.24 1.18 3.74 3.33 1.4E-03 6.0E-02 Usp43 -0.58 1.49 1.67 -3.16 2.3E-03 8.3E-02 Utp14b 0.23 1.17 3.49 2.70 8.6E-03 1.6E-01 Uvssa -0.18 1.13 4.45 -2.86 5.5E-03 1.3E-01 Vat1l 0.23 1.17 6.98 2.90 5.0E-03 1.3E-01 Vcan 0.15 1.11 5.45 2.69 8.8E-03 1.7E-01 Vcl 0.17 1.12 5.99 3.83 2.7E-04 2.8E-02 Vgf 0.28 1.21 6.93 3.78 3.2E-04 2.9E-02 Vip -0.52 1.43 4.10 -3.37 1.2E-03 5.7E-02 Vit 0.62 1.54 0.90 2.79 6.7E-03 1.5E-01 Vsnl1 -0.25 1.19 8.01 -3.08 2.9E-03 9.3E-02 Vwa5b2 -0.19 1.14 5.64 -3.12 2.6E-03 8.8E-02 Vwf 0.29 1.23 4.16 3.24 1.8E-03 7.3E-02 Wdfy1 0.28 1.21 5.59 2.61 1.1E-02 1.9E-01 Wfs1 0.35 1.27 6.73 3.47 8.8E-04 4.7E-02 Wipf3 0.25 1.19 7.65 5.62 3.3E-07 1.1E-03 Wnt9a -0.44 1.36 3.31 -3.53 7.3E-04 4.2E-02 Zbtb18 -0.22 1.17 8.00 -3.88 2.3E-04 2.6E-02 Zcchc12 0.19 1.14 6.28 2.72 8.1E-03 1.6E-01 log2F Av.Exp Gene C FC . t P adj.P Zdbf2 0.16 1.11 5.99 2.73 8.0E-03 1.6E-01 Zdhhc14 0.19 1.14 5.54 3.08 2.9E-03 9.3E-02 Zdhhc21 -0.16 1.12 6.35 -4.32 4.8E-05 1.3E-02 Zdhhc8 -0.14 1.11 6.78 -3.32 1.4E-03 6.2E-02 Zfp36l1 0.19 1.14 4.85 3.55 6.8E-04 4.1E-02 Zfp711 -0.22 1.16 3.95 -2.99 3.9E-03 1.1E-01 Zfp810 -0.18 1.14 4.49 -3.17 2.2E-03 8.3E-02 Zfp941 -0.17 1.13 5.09 -3.04 3.3E-03 1.0E-01 Zkscan16 -0.15 1.11 5.68 -2.76 7.4E-03 1.5E-01 Zkscan2 -0.19 1.14 5.13 -3.27 1.6E-03 6.8E-02 Zmat4 -0.20 1.15 5.05 -3.57 6.4E-04 3.9E-02 Zmym1 0.16 1.12 5.49 2.99 3.8E-03 1.1E-01 Table S5: Gene list for the effect of Genotype in the knockout study. Data are presented as differential expression in Cyfip2 N/- mice relative to Cyfip2 N/N mice.

log2F Gene C FC Av.Exp. t P adj.P 1700020114Rik 0.24 1.18 5.97 4.35 4.6E-05 4.3E-02 1700025G04Rik 0.18 1.13 6.26 4.75 1.1E-05 2.0E-02 6430548M08Rik 0.14 1.11 7.70 3.30 1.5E-03 1.3E-01 Actn2 -0.18 1.13 7.03 -3.13 2.5E-03 1.6E-01 Acy1 -0.19 1.14 4.80 -3.47 8.9E-04 1.2E-01 Adamts15 0.37 1.29 1.56 2.98 3.9E-03 1.9E-01 Adcy5 -0.16 1.12 10.40 -3.15 2.4E-03 1.6E-01 Adcy8 0.33 1.25 2.90 3.23 1.9E-03 1.4E-01 Adcyap1 0.74 1.68 0.91 3.25 1.8E-03 1.4E-01 Adra2c -0.18 1.13 5.56 -3.21 2.0E-03 1.4E-01 Akap2 0.14 1.10 5.85 3.85 2.6E-04 7.0E-02 Ankrd34c 0.53 1.44 1.30 3.61 5.7E-04 9.5E-02 Ar 0.24 1.18 2.51 3.07 3.0E-03 1.7E-01 Arfgef3 0.18 1.13 5.65 3.01 3.7E-03 1.8E-01 Asic4 -0.19 1.14 6.94 -3.42 1.1E-03 1.2E-01 Baiap2 -0.14 1.10 9.06 -3.97 1.7E-04 7.0E-02 Bend6 0.14 1.10 6.66 3.67 4.7E-04 8.7E-02 Bhlhe22 0.69 1.62 2.17 3.34 1.4E-03 1.3E-01 Boc 0.32 1.24 2.66 3.30 1.5E-03 1.3E-01 Bri3bp 0.14 1.10 6.53 4.76 1.0E-05 2.0E-02 Brinp3 0.20 1.15 4.21 3.32 1.4E-03 1.3E-01 Btbd11 0.29 1.22 3.41 3.13 2.5E-03 1.6E-01 Btbd3 0.25 1.19 6.24 3.99 1.6E-04 7.0E-02 C130074G19Rik 0.26 1.20 5.32 3.15 2.4E-03 1.6E-01 C530008M17Rik 0.19 1.14 5.16 3.21 2.0E-03 1.4E-01 C77370 0.16 1.11 5.25 3.16 2.3E-03 1.6E-01 Cadps 0.16 1.12 7.23 3.30 1.5E-03 1.3E-01 Camk2d 0.32 1.25 5.52 3.13 2.6E-03 1.6E-01 Car10 0.41 1.33 4.78 3.31 1.5E-03 1.3E-01 Ccdc136 0.20 1.15 4.89 3.07 3.0E-03 1.7E-01 Ccdc85a 0.15 1.11 5.53 4.13 9.8E-05 6.4E-02 Cdh12 0.26 1.20 2.81 3.45 9.6E-04 1.2E-01 Cdk14 0.25 1.19 6.58 3.90 2.2E-04 7.0E-02 Cds1 0.16 1.11 5.82 3.21 2.0E-03 1.4E-01 log2F Gene C FC Av.Exp. t P adj.P Chat -0.22 1.16 4.30 -3.24 1.8E-03 1.4E-01 Chl1 0.15 1.11 6.96 3.13 2.5E-03 1.6E-01 Chrm2 0.33 1.26 2.09 3.19 2.1E-03 1.5E-01 Chrm4 -0.18 1.13 6.85 -3.38 1.2E-03 1.3E-01 Cpne5 -0.14 1.10 8.07 -3.31 1.5E-03 1.3E-01 Crocc -0.20 1.15 7.17 -3.28 1.6E-03 1.4E-01 Cux2 0.29 1.22 4.61 3.14 2.5E-03 1.6E-01 Cyfip2 -0.84 1.79 9.64 -27.15 8.2E-39 1.2E-34 Dkkl1 0.46 1.37 2.00 3.01 3.7E-03 1.8E-01 Dlgap1 0.26 1.20 7.89 4.19 8.0E-05 6.0E-02 Dnajb14 0.21 1.16 4.06 3.50 8.2E-04 1.2E-01 Doc2b -0.15 1.11 6.98 -2.98 4.0E-03 1.9E-01 Dpp10 0.22 1.16 6.42 3.74 3.7E-04 8.0E-02 Drd2 -0.18 1.14 7.42 -3.10 2.8E-03 1.6E-01 Dscam 0.22 1.17 5.03 3.28 1.6E-03 1.4E-01 Efr3a 0.22 1.17 5.94 3.49 8.4E-04 1.2E-01 Elavl2 0.16 1.12 5.56 3.29 1.6E-03 1.3E-01 Elavl4 0.31 1.24 5.38 3.48 8.7E-04 1.2E-01 En2 1.30 2.46 0.84 9.59 2.3E-14 1.7E-10 Epha10 0.29 1.22 4.51 3.38 1.2E-03 1.3E-01 Epha3 0.29 1.22 1.98 3.04 3.4E-03 1.7E-01 Epha5 0.21 1.15 5.63 3.44 9.7E-04 1.2E-01 Erbb4 0.24 1.18 3.78 2.95 4.3E-03 1.9E-01 Exph5 0.31 1.24 3.48 3.20 2.0E-03 1.5E-01 F730043M19Rik 0.35 1.27 1.34 2.98 4.0E-03 1.9E-01 Fam132a -0.14 1.10 4.52 -3.25 1.8E-03 1.4E-01 Fam135b 0.23 1.18 4.18 2.96 4.2E-03 1.9E-01 Fam19a1 0.94 1.91 2.19 4.12 1.0E-04 6.4E-02 Fam19a2 0.41 1.33 4.16 4.33 5.0E-05 4.4E-02 Fam81a 0.31 1.24 6.17 3.86 2.5E-04 7.0E-02 Fgf12 0.20 1.15 6.65 5.05 3.4E-06 1.2E-02 Fhod3 0.32 1.25 4.42 3.10 2.8E-03 1.6E-01 Flrt2 0.15 1.11 5.75 3.45 9.5E-04 1.2E-01 Fmn1 0.29 1.22 3.46 3.03 3.4E-03 1.7E-01 Frmd7 -0.23 1.17 3.39 -2.99 3.9E-03 1.8E-01 Frzb 0.43 1.35 2.48 3.28 1.6E-03 1.4E-01 Gabbr2 0.25 1.19 6.50 3.41 1.1E-03 1.2E-01 Gabra1 0.25 1.19 7.61 5.15 2.3E-06 1.2E-02 log2F Gene C FC Av.Exp. t P adj.P Gabra3 0.27 1.20 6.34 3.48 8.6E-04 1.2E-01 Gabrb2 0.15 1.11 8.02 5.00 4.1E-06 1.2E-02 Gm10493 0.27 1.20 2.50 3.04 3.3E-03 1.7E-01 Gnai1 0.14 1.10 7.25 3.32 1.4E-03 1.3E-01 Gnas 0.17 1.13 9.21 3.01 3.6E-03 1.8E-01 Gng7 -0.18 1.13 10.87 -3.10 2.8E-03 1.6E-01 Gpr22 0.25 1.19 4.74 3.43 1.0E-03 1.2E-01 Gpr26 0.30 1.23 4.57 4.45 3.2E-05 3.7E-02 Grm2 0.51 1.42 2.66 2.95 4.3E-03 1.9E-01 Gucy2g 0.52 1.44 1.15 3.10 2.8E-03 1.6E-01 Hapln4 0.38 1.30 4.61 3.26 1.7E-03 1.4E-01 Hba-a2 -0.31 1.24 3.13 -3.32 1.5E-03 1.3E-01 Hcn1 0.31 1.24 4.77 3.87 2.4E-04 7.0E-02 Hdac9 0.20 1.14 4.19 3.50 8.3E-04 1.2E-01 Hecw1 0.16 1.11 5.83 3.48 8.7E-04 1.2E-01 Herc3 0.17 1.12 6.70 4.00 1.6E-04 7.0E-02 Homer2 0.33 1.26 5.61 3.68 4.5E-04 8.7E-02 Hrh3 -0.15 1.11 7.27 -3.70 4.3E-04 8.6E-02 Igfn1 0.91 1.88 2.38 4.18 8.4E-05 6.0E-02 Il20ra -0.31 1.24 1.87 -3.03 3.4E-03 1.7E-01 Ildr2 0.25 1.19 6.25 3.67 4.7E-04 8.7E-02 Inf2 -0.19 1.14 9.38 -4.05 1.3E-04 6.8E-02 Itga5 -0.18 1.13 5.26 -3.01 3.6E-03 1.8E-01 Kcnab3 0.37 1.30 3.81 3.66 4.8E-04 8.7E-02 Kcnc2 0.32 1.25 5.27 3.08 3.0E-03 1.7E-01 Kcnc4 0.31 1.24 4.61 2.94 4.4E-03 1.9E-01 Kcnh7 0.41 1.33 3.01 3.26 1.7E-03 1.4E-01 Kcnj3 0.38 1.30 3.94 3.89 2.3E-04 7.0E-02 Kcnma1 0.14 1.10 6.24 3.20 2.1E-03 1.5E-01 Klf12 0.16 1.11 4.92 2.93 4.6E-03 2.0E-01 Klhl11 0.21 1.16 4.68 3.82 2.8E-04 7.4E-02 Klhl14 0.57 1.48 0.30 3.43 1.0E-03 1.2E-01 Krt9 -0.19 1.14 5.23 -3.75 3.6E-04 7.9E-02 Lancl2 0.15 1.11 5.88 3.24 1.8E-03 1.4E-01 Lingo2 0.19 1.14 3.88 3.41 1.1E-03 1.2E-01 Lingo3 -0.18 1.13 7.13 -3.48 8.8E-04 1.2E-01 Lmbrd2 0.18 1.13 5.24 3.48 8.6E-04 1.2E-01 Lnpep 0.23 1.17 5.40 3.13 2.5E-03 1.6E-01 log2F Gene C FC Av.Exp. t P adj.P LOC100861633 -0.23 1.17 3.28 -3.33 1.4E-03 1.3E-01 LOC100862004 1.63 3.09 -0.86 3.27 1.7E-03 1.4E-01 Lrrc10b -0.25 1.19 8.13 -3.60 6.0E-04 9.7E-02 Lrrc55 0.24 1.18 3.70 3.45 9.6E-04 1.2E-01 Lsm11 0.33 1.26 3.62 3.76 3.5E-04 7.9E-02 Lzts3 -0.15 1.11 9.23 -3.62 5.6E-04 9.5E-02 Magi1 0.14 1.10 6.30 3.09 2.8E-03 1.6E-01 March1 0.19 1.14 4.36 3.00 3.7E-03 1.8E-01 Mef2c 0.22 1.16 7.74 3.65 5.1E-04 8.8E-02 Megf9 0.17 1.12 5.65 4.07 1.2E-04 6.8E-02 Mesdc1 -0.18 1.14 5.75 -3.49 8.5E-04 1.2E-01 Met 0.75 1.68 0.76 3.08 2.9E-03 1.7E-01 Mfsd4 0.31 1.24 4.55 3.22 1.9E-03 1.4E-01 Mgat5 0.16 1.11 5.01 3.28 1.6E-03 1.4E-01 Mta3 0.16 1.12 4.86 3.65 5.0E-04 8.8E-02 Mturn 0.20 1.15 4.94 3.88 2.4E-04 7.0E-02 Napb 0.16 1.12 8.37 4.05 1.3E-04 6.8E-02 Napepld 0.26 1.19 3.12 3.31 1.5E-03 1.3E-01 Nav3 0.17 1.13 5.64 3.10 2.8E-03 1.6E-01 Ncam2 0.19 1.14 5.87 4.09 1.1E-04 6.8E-02 Ndst4 0.82 1.77 1.53 3.31 1.5E-03 1.3E-01 Necab2 -0.16 1.12 7.76 -3.23 1.9E-03 1.4E-01 Nfatc2 -0.19 1.14 5.11 -3.25 1.8E-03 1.4E-01 Npnt 0.32 1.25 2.37 3.51 7.8E-04 1.1E-01 Npy -0.14 1.10 5.89 -3.69 4.5E-04 8.7E-02 Nrip3 0.24 1.18 5.96 3.23 1.9E-03 1.4E-01 Nrn1 0.50 1.42 5.02 3.53 7.4E-04 1.1E-01 Nrp2 0.38 1.31 3.93 3.12 2.7E-03 1.6E-01 Opcml 0.14 1.10 7.11 3.51 7.9E-04 1.1E-01 Oxr1 0.20 1.15 7.30 3.89 2.3E-04 7.0E-02 Pak1 0.19 1.14 7.81 3.48 8.7E-04 1.2E-01 Pakap 0.14 1.10 5.85 3.85 2.6E-04 7.0E-02 Palm2 0.16 1.12 4.99 3.02 3.6E-03 1.8E-01 Parm1 0.18 1.14 3.94 2.96 4.1E-03 1.9E-01 Parva 0.14 1.10 5.42 3.20 2.0E-03 1.5E-01 Pbx3 -0.15 1.11 5.82 -3.22 2.0E-03 1.4E-01 Pcdhac2 0.17 1.13 4.53 3.30 1.5E-03 1.3E-01 Pcp4l1 -0.16 1.12 8.85 -3.16 2.3E-03 1.6E-01 log2F Gene C FC Av.Exp. t P adj.P Pde1b -0.17 1.12 10.70 -3.25 1.8E-03 1.4E-01 Pdyn -0.22 1.16 4.60 -2.96 4.2E-03 1.9E-01 Penk -0.23 1.17 10.45 -3.79 3.1E-04 7.7E-02 Phactr2 0.27 1.21 4.64 3.94 1.9E-04 7.0E-02 Plcb4 0.24 1.18 4.58 3.40 1.1E-03 1.3E-01 Plcxd2 0.49 1.41 5.09 4.91 5.8E-06 1.4E-02 Plcxd3 0.37 1.29 2.27 3.10 2.8E-03 1.6E-01 Ppfia2 0.16 1.12 6.07 4.47 2.9E-05 3.7E-02 Ppm1e 0.34 1.26 6.81 3.59 6.2E-04 9.7E-02 Ppm1l 0.22 1.16 4.98 4.14 9.7E-05 6.4E-02 Ppp1r1b -0.23 1.17 10.62 -3.86 2.5E-04 7.0E-02 Prdm8 0.70 1.62 1.45 3.78 3.2E-04 7.8E-02 Ptpn3 0.40 1.32 4.60 3.30 1.5E-03 1.3E-01 Ptpn4 0.24 1.18 5.34 4.30 5.5E-05 4.6E-02 Ptpn5 -0.16 1.12 9.63 -3.69 4.4E-04 8.7E-02 Ptprt 0.16 1.12 6.18 3.13 2.6E-03 1.6E-01 Ptprv -0.29 1.23 5.76 -2.98 3.9E-03 1.9E-01 Pvrl3 0.28 1.21 3.07 3.52 7.6E-04 1.1E-01 Ralyl 0.22 1.16 5.15 3.12 2.6E-03 1.6E-01 Rap1gap -0.21 1.16 9.17 -4.63 1.7E-05 2.2E-02 Rap1gap2 0.14 1.10 7.73 3.06 3.2E-03 1.7E-01 Rarb -0.17 1.12 7.07 -3.17 2.3E-03 1.5E-01 Rasd2 -0.18 1.13 9.95 -3.23 1.9E-03 1.4E-01 Rasgrf2 0.38 1.30 5.51 3.32 1.4E-03 1.3E-01 Rasgrp2 -0.19 1.14 7.97 -3.37 1.2E-03 1.3E-01 Rem2 -0.22 1.16 5.66 -3.39 1.2E-03 1.3E-01 Rgs9 -0.20 1.15 9.84 -3.07 3.1E-03 1.7E-01 Rims3 0.20 1.15 4.18 3.78 3.3E-04 7.8E-02 Rnf141 0.20 1.15 2.58 2.94 4.4E-03 1.9E-01 Rnf152 0.34 1.26 3.48 3.47 8.9E-04 1.2E-01 Scube1 0.47 1.39 4.44 3.63 5.3E-04 9.1E-02 Serpina9 -0.19 1.14 5.79 -3.04 3.3E-03 1.7E-01 Serpini1 0.28 1.21 6.98 3.74 3.7E-04 8.0E-02 Sertm1 0.35 1.27 3.35 3.23 1.9E-03 1.4E-01 Sez6 -0.15 1.11 9.35 -3.91 2.1E-04 7.0E-02 Sez6l 0.34 1.27 6.19 3.00 3.8E-03 1.8E-01 Sh2d5 -0.15 1.11 8.01 -4.00 1.6E-04 7.0E-02 Shank1 0.27 1.20 7.60 2.94 4.4E-03 1.9E-01 log2F Gene C FC Av.Exp. t P adj.P Shank2 0.14 1.10 6.77 3.15 2.4E-03 1.6E-01 Shb -0.17 1.12 5.10 -2.94 4.5E-03 1.9E-01 Sidt1 0.40 1.32 3.89 3.08 3.0E-03 1.7E-01 Slc17a8 -0.20 1.15 4.05 -3.26 1.7E-03 1.4E-01 Slc25a18 0.46 1.38 4.12 3.72 3.9E-04 8.2E-02 Slc30a3 0.61 1.53 4.29 3.82 2.8E-04 7.4E-02 Slc35d3 -0.18 1.13 5.35 -3.02 3.5E-03 1.7E-01 Slc8a1 0.35 1.28 6.94 3.21 2.0E-03 1.4E-01 Slitrk1 0.26 1.20 5.35 3.17 2.3E-03 1.5E-01 Slitrk4 0.18 1.13 4.60 3.46 9.3E-04 1.2E-01 Smyd2 0.21 1.16 4.47 3.12 2.6E-03 1.6E-01 Sobp 0.23 1.18 5.01 3.01 3.6E-03 1.8E-01 Sphkap 0.40 1.32 5.88 4.65 1.5E-05 2.2E-02 Sptssb 0.48 1.40 0.05 3.13 2.6E-03 1.6E-01 Sstr3 0.38 1.30 3.34 3.18 2.2E-03 1.5E-01 St8sia1 0.20 1.15 5.11 3.92 2.1E-04 7.0E-02 Syndig1l -0.19 1.14 8.70 -3.04 3.3E-03 1.7E-01 Syt17 0.41 1.33 3.20 2.96 4.2E-03 1.9E-01 Syt6 -0.15 1.11 7.19 -3.38 1.2E-03 1.3E-01 Tac1 -0.23 1.18 7.53 -4.22 7.2E-05 5.7E-02 Tacr1 -0.21 1.15 5.08 -3.50 8.2E-04 1.2E-01 Tbc1d9 0.16 1.12 6.30 3.73 3.8E-04 8.1E-02 Tenm1 0.28 1.21 4.06 3.30 1.5E-03 1.3E-01 Tmem145 0.34 1.26 3.31 3.17 2.3E-03 1.5E-01 Tmem196 0.37 1.29 1.84 2.92 4.7E-03 2.0E-01 Tmem215 0.90 1.87 -0.07 3.77 3.4E-04 7.9E-02 Tpbgl -0.20 1.15 3.62 -3.11 2.7E-03 1.6E-01 Trpc5 0.33 1.26 2.16 2.92 4.7E-03 2.0E-01 Uhmk1 0.20 1.15 5.62 4.40 3.9E-05 4.1E-02 Unc5d 0.35 1.27 4.53 3.88 2.3E-04 7.0E-02 Vamp1 0.23 1.17 5.86 3.19 2.1E-03 1.5E-01 Vip 0.48 1.40 2.74 3.09 2.9E-03 1.7E-01 Vrk1 -0.15 1.11 5.36 -3.15 2.4E-03 1.6E-01 Vsnl1 0.31 1.24 7.62 3.02 3.5E-03 1.7E-01 Vwf -0.22 1.17 4.24 -2.94 4.5E-03 1.9E-01 Wnk4 -0.25 1.19 3.76 -2.95 4.3E-03 1.9E-01 Xkr4 0.29 1.22 3.57 3.17 2.3E-03 1.5E-01 Zmat4 0.23 1.17 4.74 3.95 1.8E-04 7.0E-02

Table S6: Gene list for the effect of Treatment in the knockout study. Data are expressed as differential expression in PF- versus Chow-trained mice.

log2F Gene C FC Av.Exp. t P adj.P 1.1 8.7E- Adamts4 -0.23 8 5.23 -4.22 7.2E-05 02 1.2 7.6E- Adamtsl4 -0.33 6 3.75 -4.38 4.1E-05 02 1.1 1.6E- Arhgap23 -0.14 0 6.96 -3.70 4.2E-04 01 1.1 1.4E- Cnp -0.20 5 9.08 -3.92 2.0E-04 01 1.1 1.4E- Cntn2 -0.15 1 7.70 -3.85 2.6E-04 01 1.1 6.6E- Ddr1 -0.18 3 6.71 -4.62 1.7E-05 02 1.1 1.4E- Elovl7 -0.21 5 4.97 -3.83 2.7E-04 01 1.1 1.4E- Enpp2 -0.18 3 7.91 -3.86 2.5E-04 01 1.1 9.7E- Fgfr2 -0.19 4 6.14 -4.16 9.1E-05 02 1.1 9.9E- Gab1 -0.20 5 5.67 -4.13 9.9E-05 02 1.1 1.7E- Gal3st1 -0.22 6 3.81 -3.67 4.7E-04 01 1.1 1.1E- Galnt6 -0.24 8 4.90 -4.06 1.3E-04 01 1.1 1.5E- Gatm -0.17 2 7.20 -3.76 3.5E-04 01 1.2 1.1E- Gjc2 -0.26 0 4.41 -4.08 1.2E-04 01 1.1 7.7E- Gpr37 -0.24 8 6.65 -4.29 5.6E-05 02 1.1 1.5E- Hapln2 -0.25 9 4.88 -3.76 3.5E-04 01 1.1 1.5E- Itgb4 -0.23 7 4.56 -3.79 3.1E-04 01 1.1 1.4E- Lgi3 -0.17 3 6.69 -3.90 2.2E-04 01 1.1 6.6E- Mag -0.24 8 8.08 -4.50 2.6E-05 02 log2F Gene C FC Av.Exp. t P adj.P 1.1 7.7E- Mcam -0.23 7 5.08 -4.29 5.6E-05 02 1.1 1.8E- Megf10 -0.15 1 5.36 -3.65 5.0E-04 01 1.1 1.5E- Micall1 -0.16 2 6.07 -3.80 3.1E-04 01 1.1 1.6E- Myrf -0.19 4 6.60 -3.72 4.0E-04 01 1.1 1.5E- Olig1 -0.18 3 6.74 -3.81 3.0E-04 01 1.1 1.9E- Padi2 -0.18 3 5.40 -3.60 5.9E-04 01 1.1 7.6E- Phldb1 -0.20 5 7.57 -4.35 4.5E-05 02 1.1 2.0E- Plekhg3 -0.21 6 4.92 -3.59 6.2E-04 01 1.1 1.3E- Plekhh1 -0.22 7 5.89 -3.99 1.6E-04 01 1.1 2.0E- Pllp -0.20 5 6.26 -3.59 6.1E-04 01 1.1 1.2E- Prr18 -0.23 7 6.44 -4.02 1.5E-04 01 1.1 1.4E- S1pr5 -0.24 8 4.17 -3.87 2.4E-04 01 1.1 8.7E- Sema6a -0.22 6 5.20 -4.21 7.5E-05 02 1.1 1.4E- Sept4 -0.19 4 7.78 -3.89 2.3E-04 01 1.1 1.5E- Slc6a9 -0.16 2 5.82 -3.77 3.4E-04 01 1.1 1.6E- Sorbs3 -0.17 2 5.35 -3.73 3.9E-04 01 1.2 1.8E- Sox10 -0.27 0 6.01 -5.30 1.3E-06 02 1.1 7.6E- Tmem63a -0.24 8 5.76 -4.35 4.6E-05 02 1.1 6.6E- Tmem88b -0.22 7 6.80 -4.54 2.3E-05 02 1.1 1.4E- Tprn -0.22 6 4.48 -3.84 2.6E-04 01 1.1 1.7E- Trim59 -0.22 6 5.12 -3.68 4.5E-04 01 log2F Gene C FC Av.Exp. t P adj.P 1.1 1.8E- Unc5b -0.24 8 5.78 -5.14 2.4E-06 02 1.1 1.4E- Wscd1 -0.15 1 6.67 -3.84 2.7E-04 01 Table S7: Gene list for PF versus Chow intake in Cyfip2N/N mice. Data are presented as differential expression in PF- trained mice relative to the Chow-trained mice.

log2F Av.Exp Gene C FC . t P adj.P 3.3E- Adamts4 -0.29 1.22 5.23 -3.72 4.0E-04 01 3.1E- Bcas1 -0.33 1.26 8.00 -4.09 1.2E-04 01 3.3E- Car2 -0.22 1.17 7.84 -3.63 5.5E-04 01 3.3E- Clic4 -0.22 1.17 6.87 -3.72 4.1E-04 01 3.3E- Cnp -0.25 1.19 9.08 -3.59 6.2E-04 01 3.1E- Cryab -0.30 1.23 6.60 -4.03 1.4E-04 01 3.3E- Desi1 -0.17 1.12 7.36 -3.57 6.6E-04 01 3.3E- Edil3 -0.19 1.14 6.98 -3.83 2.8E-04 01 3.3E- Fgfr2 -0.23 1.17 6.14 -3.57 6.5E-04 01 3.3E- Gab1 -0.24 1.18 5.67 -3.53 7.4E-04 01 3.3E- Gal3st1 -0.30 1.23 3.81 -3.51 8.0E-04 01 3.3E- Gatm -0.22 1.17 7.20 -3.52 7.7E-04 01 3.3E- Gfap -0.45 1.36 6.54 -3.51 8.0E-04 01 3.1E- Gpr37 -0.32 1.25 6.65 -4.16 9.1E-05 01 3.6E- Gprc5b -0.18 1.13 7.43 -3.47 9.1E-04 01 3.6E- Igfbp5 -0.27 1.21 7.58 -3.46 9.5E-04 01 3.3E- Kif1c -0.18 1.14 7.31 -3.68 4.7E-04 01 3.3E- Lgi4 -0.18 1.13 5.42 -3.67 4.8E-04 01 3.3E- Mag -0.29 1.22 8.08 -3.76 3.6E-04 01 3.3E- Mcam -0.29 1.23 5.08 -3.92 2.1E-04 01 3.3E- Mir5105 -0.88 1.83 6.12 -3.79 3.2E-04 01 3.3E- Myo6 -0.15 1.11 7.42 -3.52 7.9E-04 01 3.6E- Ndrg1 -0.24 1.18 7.24 -3.46 9.4E-04 01 3.1E- Olig1 -0.27 1.20 6.74 -4.03 1.4E-04 01 3.3E- Prr18 -0.30 1.23 6.44 -3.76 3.6E-04 01 3.3E- S1pr5 -0.32 1.25 4.17 -3.62 5.7E-04 01 3.3E- Scd1 -0.20 1.15 8.07 -3.90 2.2E-04 01 3.3E- Scd2 -0.15 1.11 10.67 -3.69 4.5E-04 01 3.3E- Sema6a -0.27 1.20 5.20 -3.57 6.6E-04 01 3.3E- Sept4 -0.25 1.19 7.78 -3.59 6.2E-04 01 3.3E- Sirt2 -0.15 1.11 7.29 -3.57 6.6E-04 01 3.1E- Sox10 -0.30 1.23 6.01 -4.18 8.7E-05 01 Tmem229 3.3E- a -0.19 1.14 6.27 -3.85 2.6E-04 01 3.6E- Tmem63a -0.27 1.20 5.76 -3.46 9.3E-04 01 3.1E- Tmem88b -0.30 1.23 6.80 -4.35 4.7E-05 01 3.3E- Ugt8a -0.25 1.19 6.73 -3.53 7.6E-04 01 9.4E- Unc5b -0.32 1.25 5.78 -4.90 6.2E-06 02 3.3E- Wscd1 -0.21 1.16 6.67 -3.91 2.1E-04 01 Table S8: 61 combined unique genes from Tables S6 and S7 that were modified by PF consumption and were included in the enrichment analyses for the effect of Treatment.

Adamts4 Adamtsl4 Arhgap23 Bcas1 Car2 Clic4 Cnp Cntn2 Cryab Ddr1 Desi1 Edil3 Elovl7 Enpp2 Fgfr2 Gab1 Gal3st1 Galnt6 Gatm Gfap Gjc2 Gpr37 Gprc5b Hapln2 Igfbp5 Itgb4 Kif1c Lgi3 Lgi4 Mag Mcam Megf10 Micall1 Mir5105 Myo6 Myrf Ndrg1 Olig1 Padi2 Phldb1 Plekhg3 Plekhh1 Pllp Prr18 S1pr5 Scd1 Scd2 Sema6a Sept4 Sirt2 Slc6a9 Sorbs3 Sox10 Tmem229a Tmem63a Tmem88b Tprn Trim59 Ugt8a Unc5b Wscd1 Table S9: 82 genes that were differentially expressed in PF-trained Cyfip2N/- mice relative to Cyfip2N/N mice.

log2F Gene C FC Av.Exp. t P adj.P 1700020114Rik 0.28 1.21 5.97 3.52 7.9E-04 1.7E-01 1700025G04Ri k 0.20 1.15 6.26 3.66 4.9E-04 1.6E-01 Adamts3 -0.36 1.28 6.79 -3.57 6.7E-04 1.7E-01 Adcy1 0.28 1.21 9.15 3.55 7.0E-04 1.7E-01 Adra2c -0.28 1.22 5.56 -3.68 4.6E-04 1.6E-01 Ampd2 -0.17 1.12 6.36 -4.07 1.3E-04 1.6E-01 Ano6 -0.25 1.19 5.30 -3.49 8.4E-04 1.7E-01 Bend6 0.20 1.15 6.66 3.73 4.0E-04 1.6E-01 Ccng1 0.20 1.15 5.93 3.90 2.3E-04 1.6E-01 Ccnyl1 -0.28 1.21 3.95 -3.53 7.6E-04 1.7E-01 Cdk14 0.35 1.27 6.58 3.79 3.2E-04 1.6E-01 Celf3 -0.16 1.12 7.91 -3.46 9.4E-04 1.7E-01 Col11a2 -0.33 1.26 5.53 -3.66 5.0E-04 1.6E-01 Crocc -0.32 1.25 7.17 -3.67 4.7E-04 1.6E-01 Cyfip2 -0.84 1.79 9.64 -18.78 1.5E-28 2.2E-24 Dlgap1 0.34 1.26 7.89 3.81 3.1E-04 1.6E-01 Dnajc6 0.18 1.13 7.99 3.62 5.6E-04 1.6E-01 Dpf1 -0.15 1.11 6.05 -3.60 6.1E-04 1.6E-01 Efr3a 0.31 1.24 5.94 3.47 9.0E-04 1.7E-01 En2 1.24 2.36 0.84 6.32 2.3E-08 1.7E-04 Eps15 0.17 1.12 7.90 4.73 1.2E-05 4.4E-02 Fam132a -0.22 1.17 4.52 -3.70 4.3E-04 1.6E-01 Fam160b2 -0.21 1.15 6.52 -3.58 6.4E-04 1.6E-01 Fam81a 0.43 1.35 6.17 3.81 3.0E-04 1.6E-01 Fcho1 -0.20 1.15 7.22 -4.23 7.1E-05 1.4E-01 Fgf12 0.22 1.17 6.65 4.04 1.4E-04 1.6E-01 Frmd7 -0.39 1.31 3.39 -3.66 5.0E-04 1.6E-01 Gabra1 0.29 1.22 7.61 4.21 7.6E-05 1.4E-01 Gabrg2 0.15 1.11 7.23 3.66 4.9E-04 1.6E-01 Gjb6 0.29 1.22 4.96 3.55 7.1E-04 1.7E-01 Gpm6a 0.14 1.10 10.18 3.72 4.0E-04 1.6E-01 Gpr22 0.35 1.27 4.74 3.48 8.9E-04 1.7E-01 Gpr83 -0.29 1.23 5.55 -3.53 7.5E-04 1.7E-01 Homer2 0.45 1.36 5.61 3.48 8.9E-04 1.7E-01 Hrh3 -0.22 1.16 7.27 -3.81 3.0E-04 1.6E-01 log2F Gene C FC Av.Exp. t P adj.P Inf2 -0.24 1.18 9.38 -3.70 4.3E-04 1.6E-01 Kcnh4 -0.39 1.31 5.97 -3.80 3.2E-04 1.6E-01 Kcnh7 0.61 1.52 3.01 3.63 5.5E-04 1.6E-01 Krt9 -0.25 1.19 5.23 -3.66 5.0E-04 1.6E-01 Lemd2 -0.18 1.13 5.26 -3.82 2.9E-04 1.6E-01 Lingo3 -0.27 1.21 7.13 -3.77 3.4E-04 1.6E-01 Lmtk3 -0.19 1.14 8.16 -3.44 9.9E-04 1.7E-01 Mta3 0.26 1.19 4.86 4.25 6.7E-05 1.4E-01 Mturn 0.29 1.22 4.94 3.90 2.2E-04 1.6E-01 Napb 0.21 1.15 8.37 3.64 5.3E-04 1.6E-01 Nrn1 0.70 1.63 5.02 3.53 7.5E-04 1.7E-01 Nudt4 0.21 1.15 6.78 3.79 3.2E-04 1.6E-01 Parva 0.21 1.16 5.42 3.52 7.7E-04 1.7E-01 Pex5l 0.21 1.16 7.14 3.94 2.0E-04 1.6E-01 Plcxd2 0.56 1.47 5.09 3.87 2.4E-04 1.6E-01 Ptprv -0.51 1.42 5.76 -3.71 4.3E-04 1.6E-01 Radil -0.25 1.19 4.86 -3.46 9.3E-04 1.7E-01 Rap1gap -0.31 1.24 9.17 -4.75 1.1E-05 4.4E-02 Rassf2 0.17 1.12 6.39 3.45 9.6E-04 1.7E-01 Rgs9 -0.32 1.25 9.84 -3.66 5.0E-04 1.6E-01 Rin1 -0.17 1.12 7.11 -3.86 2.6E-04 1.6E-01 Rnf11 0.15 1.11 7.59 3.54 7.2E-04 1.7E-01 Rps15a 0.16 1.12 6.06 3.68 4.6E-04 1.6E-01 Scmh1 -0.21 1.15 6.43 -3.92 2.1E-04 1.6E-01 Serpini1 0.38 1.30 6.98 3.65 5.1E-04 1.6E-01 Sez6 -0.22 1.16 9.35 -4.05 1.3E-04 1.6E-01 Sh2d5 -0.22 1.16 8.01 -4.37 4.3E-05 1.3E-01 Shank3 -0.21 1.16 8.91 -3.76 3.5E-04 1.6E-01 Shkbp1 -0.32 1.25 4.33 -3.49 8.4E-04 1.7E-01 Slc25a18 0.64 1.56 4.12 3.61 5.8E-04 1.6E-01 Slc30a3 0.78 1.72 4.29 3.49 8.6E-04 1.7E-01 Slc9a5 -0.22 1.17 6.25 -3.66 5.0E-04 1.6E-01 Slco1a4 -0.22 1.17 6.43 -3.63 5.4E-04 1.6E-01 Speg -0.19 1.14 7.82 -3.79 3.2E-04 1.6E-01 Sptbn4 -0.17 1.13 8.15 -3.65 5.0E-04 1.6E-01 Srrt -0.21 1.15 7.28 -3.94 2.0E-04 1.6E-01 Strip2 -0.33 1.26 7.54 -3.60 6.1E-04 1.6E-01 Tagln -0.29 1.23 3.48 -3.45 9.6E-04 1.7E-01 log2F Gene C FC Av.Exp. t P adj.P Tmem180 -0.18 1.13 5.36 -3.59 6.1E-04 1.6E-01 Tmem215 1.17 2.25 -0.07 3.50 8.2E-04 1.7E-01 Tmem94 -0.20 1.15 6.87 -3.85 2.7E-04 1.6E-01 Traip -0.60 1.52 5.63 -3.75 3.7E-04 1.6E-01 Trim46 -0.16 1.12 7.14 -3.61 5.8E-04 1.6E-01 Usp28 -0.26 1.20 6.01 -3.52 7.8E-04 1.7E-01 Vrk1 -0.24 1.18 5.36 -3.53 7.4E-04 1.7E-01 Zfp598 -0.20 1.15 5.91 -3.65 5.1E-04 1.6E-01 Zmat4 0.29 1.22 4.74 3.48 8.9E-04 1.7E-01 Table S10: 44 unique genes that were differentially expressed in PF-trained Cyfip2N/- mice relative to Cyfip2N/N mice. Genes were removed from Table S9 that had also been identified in the gene lists comprising the effect of Genotype (Table S5) and the effect of Treatment (Table S8), leaving 44 unique genes that were used for enrichment analysis (see Fig.S9).

log2F Gene C FC Av.Exp. t P adj.P 1700020114Ri 1.7E- k 0.28 1.21 5.97 3.52 7.9E-04 01 1.7E- Adamts3 -0.36 1.28 6.79 -3.57 6.7E-04 01 1.7E- Adcy1 0.28 1.21 9.15 3.55 7.0E-04 01 1.6E- Ampd2 -0.17 1.12 6.36 -4.07 1.3E-04 01 1.7E- Ano6 -0.25 1.19 5.30 -3.49 8.4E-04 01 1.6E- Ccng1 0.20 1.15 5.93 3.90 2.3E-04 01 1.7E- Ccnyl1 -0.28 1.21 3.95 -3.53 7.6E-04 01 1.7E- Celf3 -0.16 1.12 7.91 -3.46 9.4E-04 01 1.6E- Col11a2 -0.33 1.26 5.53 -3.66 5.0E-04 01 1.6E- Dnajc6 0.18 1.13 7.99 3.62 5.6E-04 01 1.6E- Dpf1 -0.15 1.11 6.05 -3.60 6.1E-04 01 4.4E- Eps15 0.17 1.12 7.90 4.73 1.2E-05 02 1.6E- Fam160b2 -0.21 1.15 6.52 -3.58 6.4E-04 01 1.4E- Fcho1 -0.20 1.15 7.22 -4.23 7.1E-05 01 1.6E- Gabrg2 0.15 1.11 7.23 3.66 4.9E-04 01 1.7E- Gjb6 0.29 1.22 4.96 3.55 7.1E-04 01 1.6E- Gpm6a 0.14 1.10 10.18 3.72 4.0E-04 01 Gpr83 -0.29 1.23 5.55 -3.53 7.5E-04 1.7E- 01 1.6E- Kcnh4 -0.39 1.31 5.97 -3.80 3.2E-04 01 1.7E- Lmtk3 -0.19 1.14 8.16 -3.44 9.9E-04 01 1.6E- Mturn 0.29 1.22 4.94 3.90 2.2E-04 01 1.6E- Nudt4 0.21 1.15 6.78 3.79 3.2E-04 01 1.6E- Pex5l 0.21 1.16 7.14 3.94 2.0E-04 01 1.7E- Radil -0.25 1.19 4.86 -3.46 9.3E-04 01 1.7E- Rassf2 0.17 1.12 6.39 3.45 9.6E-04 01 1.6E- Rin1 -0.17 1.12 7.11 -3.86 2.6E-04 01 1.7E- Rnf11 0.15 1.11 7.59 3.54 7.2E-04 01 1.6E- Rps15a 0.16 1.12 6.06 3.68 4.6E-04 01 1.6E- Scmh1 -0.21 1.15 6.43 -3.92 2.1E-04 01 1.6E- Shank3 -0.21 1.16 8.91 -3.76 3.5E-04 01 1.7E- Shkbp1 -0.32 1.25 4.33 -3.49 8.4E-04 01 1.6E- Slc9a5 -0.22 1.17 6.25 -3.66 5.0E-04 01 1.6E- Slco1a4 -0.22 1.17 6.43 -3.63 5.4E-04 01 1.6E- Speg -0.19 1.14 7.82 -3.79 3.2E-04 01 1.6E- Sptbn4 -0.17 1.13 8.15 -3.65 5.0E-04 01 1.6E- Srrt -0.21 1.15 7.28 -3.94 2.0E-04 01 1.6E- Strip2 -0.33 1.26 7.54 -3.60 6.1E-04 01 1.7E- Tagln -0.29 1.23 3.48 -3.45 9.6E-04 01 1.6E- Tmem180 -0.18 1.13 5.36 -3.59 6.1E-04 01 1.6E- Tmem94 -0.20 1.15 6.87 -3.85 2.7E-04 01 1.6E- Traip -0.60 1.52 5.63 -3.75 3.7E-04 01 1.6E- Trim46 -0.16 1.12 7.14 -3.61 5.8E-04 01 1.7E- Usp28 -0.26 1.20 6.01 -3.52 7.8E-04 01 1.6E- Zfp598 -0.20 1.15 5.91 -3.65 5.1E-04 01 Table S11: Enrichment analysis of Cyfip2 genetic variation and binge eating

N/N J/J Table 1A: Enrichment analysis of binge-prone Cyfip2 F2 mice versus binge-resistant Cyfip2 F2 mice GO: Biological Term Overlap P F Z Combined Genes Process D R GO: 0007268 synaptic transmission 60/434 7.5E-21 2. -2.4 90.0 DOC2A;KCNK9;KCNC2;RASGRF2;ABAT;HTR2A 4E ;GLS;GRM2;RIMS1;DLGAP1;UNC13C;SLC32A1; - KCNH7;ACTN2;SLC6A11;ADORA2A;HAP1;STX1 17 A;NAPB;CNP;CHRNA4;ADCY2;ADCY1;ADCY6;N CALD;GNAI1;CACNA1G;RASD2;KCNV1;GRIN2A ;GNG2;NPBWR1;KCNMB4;SLC17A7;NPTX1;DR D2;CAMK2G;CACNG4;GRIA4;KCNJ3;GABRA2; GABBR2;GABRA1;KCNJ6;SYT1;GABRA5;CAV2; KCNIP2;KCNJ9;GAD1;GABRA3;OPRK1;GAD2;G RIN3A;GNAL;PLP1;CNIH3;FGF12;HCN1;KCNK4 GO: 0007610 behavior 49/494 4.1E-12 6. -2.4 45.4 ABAT;ZDHHC8;HTR2A;GLS;CHL1;LRRTM1;SIX 5E 3;FEZF2;SCN1A;MEF2C;DSCAM;STRBP;GAA;N - PY1R;GPRC5B;PRKAR1B;NPC1;ADORA2A;SHA 09 NK1;CNP;PDE1B;CHRNA4;GPR88;ADCY1;RAS D2;NEUROD2;GRIN2A;CUX2;SLITRK1;PENK;P AK7;MYH14;SLC17A7;DRD2;EGR1;WFS1;GABR A5;STAT3;HTR1A;OPRK1;CCK;OXR1;AGT;NR4 A2;ID2;PPP1R1B;BCL2;VIP;FGF12 GO: 0032940 secretion by cell 41/415 2.9E-10 3. -2.4 36.2 NOTCH2;SPARC;NOTCH1;NECAB3;DOC2A;AB 1E AT;DOC2B;GLS;GRM2;RIMS1;PAK1;FLNA;SLC1 - 7A7;STX3;CAMK2G;ABCA1;CAP1;UNC13C;HSP 07 A5;VWF;SYT1;SLC32A1;ACTN2;GAD1;ACTN1;C ADPS;SYT16;GAD2;SLC6A11;PRSS12;AGT;SYT L2;SYT6;BAIAP3;PDIA4;OLFM2;VGF;FKBP1B;H AP1;VCL;STX1A GO: 0007626 locomotory behavior 25/183 3.2E-09 2. -2.3 30.0 CNP;CHRNA4;PDE1B;GPR88;ABAT;ZDHHC8;R 6E ASD2;CHL1;LRRTM1;PENK;PAK7;FEZF2;DRD2; - SCN1A;DSCAM;GAA;NPY1R;OPRK1;OXR1;NR4 06 A2;GPRC5B;NPC1;ADORA2A;ID2;FGF12 GO: 0044708 single-organism behavior 35/362 1.0E-08 6. -2.4 28.6 CNP;PDE1B;CHRNA4;ABAT;ADCY1;HTR2A;NE 6E UROD2;GRIN2A;CUX2;SLITRK1;CHL1;LRRTM1; - PENK;PAK7;MYH14;SLC17A7;DRD2;SCN1A;EG 06 R1;MEF2C;WFS1;GABRA5;STRBP;HTR1A;CCK; OXR1;NR4A2;PRKAR1B;NPC1;ID2;PPP1R1B;B CL2;VIP;FGF12;SHANK1 GO: 0048812 neuron projection 22/175 1.1E-07 5. -2.3 22.4 RTN4R;NTNG2;NOTCH1;DSCAM;CNP;CCK;AD morphogenesis 1E CY1;BHLHE22;BAIAP2;ACTB;NR4A2;PAK1;ADO - RA2A;SLITRK1;NFIB;STMN1;FLOT1;BCL2;PLXN 05 B1;NPTX1;DRD2;SHANK1 GO: 0034762 regulation of transmembrane 31/327 1.1E-07 5. -2.4 23.3 RYR2;CLIC4;KCNK9;KCNC2;RASGRF2;AKAP7; transport 1E CACNA1G;KCNV1;SCN7A;DRD2;CACNG4;KCN - J3;SCN1A;KCNJ6;MEF2C;KCNJ9;KCNIP2;KCNH 05 7;ACTN2;CACNA2D1;CACNA2D2;AGT;FKBP1B; BCL2;HAP1;FGF12;CNIH3;HCN1;PTPN3;KCNK4 ;SHANK1 GO: 0034765 regulation of ion 30/314 1.5E-07 6. -2.3 22.6 RYR2;CLIC4;KCNK9;KCNC2;RASGRF2;AKAP7; transmembrane transport 1E CACNA1G;KCNV1;SCN7A;DRD2;CACNG4;KCN - J3;SCN1A;KCNJ6;MEF2C;KCNJ9;KCNIP2;KCNH 05 7;ACTN2;CACNA2D1;CACNA2D2;AGT;FKBP1B; HAP1;FGF12;CNIH3;HCN1;PTPN3;KCNK4;SHA NK1 GO: 0007188 adenylate cyclase-modulating 18/122 1.9E-07 6. -2.2 21.0 GPR37;NPR3;NPY1R;HTR1A;OPRK1;ADRA1D; GPCR signaling pathway 2E ADCY2;ADCY1;RXFP1;ADCY6;GNAI1;GRM2;GN - G2;GNAL;ADORA2A;GNA12;FLNA;DRD2 05 GO: 0007409 axonogenesis 17/109 2.0E-07 6. -2.2 21.7 RTN4R;NTNG2;NOTCH1;CNP;CCK;ADCY1;BHL 2E HE22;BAIAP2;ACTB;NR4A2;SLITRK1;NFIB;STM - N1;FLOT1;BCL2;NPTX1;DRD2 05

GO: Cellular Term Overlap P F Z Combined Genes Component D R GO: 0044456 synapse part 42/395 1.9E-11 6. -2.4 45.4 CHRM3;DOC2A;KCNK9;CHRNA4;DOC2B;ACTB; 2E GRM2;RIMS1;SEPT6;GRIN2A;SV2B;LRRTM1;D - LGAP1;SLC17A7;DRD2;GRIA4;GABRA2;GABBR 09 2;CADPS2;GABRA1;UNC13C;EPHA7;SYT1;SLC 32A1;GABRA5;GABRA3;GAD2;CCK;PRSS12;SY TL2;SYT6;CNKSR2;CPEB1;PLCB4;GRIN3A;ADO RA2A;TBC1D24;PVRL3;CNIH3;STX1A;CNTNAP 4;SHANK1 GO: 0034702 ion channel complex 31/258 6.5E-10 1. -2.3 36.5 RYR2;CLIC4;NRN1;TTYH2;KCNC2;CHRNA4;CA 1E CNA1G;KCNV1;GRIN2A;KCNT2;KCNMB4;SCN7 - A;CACNG4;GRIA4;KCNJ3;SCN1A;GABRA2;GAB 07 RA1;KCNJ6;KCNIP2;GABRA5;CACNA2D1;GAB RA3;CACNA2D2;OLFM2;OLFM3;GRIN3A;SEST D1;FKBP1B;CNIH3;SHANK1 GO: 1902495 transmembrane transporter 31/286 6.2E-09 6. -2.3 32.4 RYR2;CLIC4;NRN1;TTYH2;KCNC2;CHRNA4;CA complex 8E CNA1G;KCNV1;GRIN2A;KCNT2;KCNMB4;SCN7 - A;CACNG4;GRIA4;KCNJ3;SCN1A;GABRA2;GAB 07 RA1;KCNJ6;KCNIP2;GABRA5;CACNA2D1;GAB RA3;CACNA2D2;OLFM2;OLFM3;GRIN3A;SEST D1;FKBP1B;CNIH3;SHANK1 GO: 1990351 transporter complex 31/291 9.0E-09 7. -2.3 32.3 RYR2;CLIC4;NRN1;TTYH2;KCNC2;CHRNA4;CA 4E CNA1G;KCNV1;GRIN2A;KCNT2;KCNMB4;SCN7 - A;CACNG4;GRIA4;KCNJ3;SCN1A;GABRA2;GAB 07 RA1;KCNJ6;KCNIP2;GABRA5;CACNA2D1;GAB RA3;CACNA2D2;OLFM2;OLFM3;GRIN3A;SEST D1;FKBP1B;CNIH3;SHANK1 GO: 0030425 dendrite 27/236 2.2E-08 1. -2.3 30.4 CHRM3;CHRNA4;ADCY2;PTPRK;RBM3;PAK1;G 4E RIN2A;CHL1;FLNA;APOD;STX3;NCDN;DRD2;G - RIA4;EPHA7;SLC32A1;WFS1;GABRA5;CCK;PR 06 SS12;PLCB4;GRIN3A;ADORA2A;NOV;HCN1;CN TNAP4;SHANK1 GO: 0030424 axon 21/161 1.2E-07 6. -2.1 25.4 GABRA2;NTNG2;SEMA6A;DSCAM;PTPRO;GAD 3E 2;CCK;PTPRK;PRSS12;ACTB;GRM2;PAK1;NOV - ;NFIB;LRRTM1;MYH14;SLC17A7;NCAM2;NCDN; 06 DRD2;HCN1 GO: 0097060 synaptic membrane 24/228 5.4E-07 2. -2.2 23.4 GABRA2;GABBR2;CADPS2;CHRM3;GABRA1;E 5E PHA7;SYT1;GABRA5;CHRNA4;GABRA3;CNKSR - 2;GRM2;RIMS1;CPEB1;GRIN2A;GRIN3A;ADOR 05 A2A;LRRTM1;DLGAP1;PVRL3;CNIH3;GRIA4;CN TNAP4;SHANK1 GO: 0045211 postsynaptic membrane 20/195 6.9E-06 2. -2.2 17.7 GABRA2;CADPS2;GABBR2;GABRA1;CHRM3;E 8E PHA7;GABRA5;CHRNA4;GABRA3;CNKSR2;CP - EB1;GRIN2A;GRIN3A;ADORA2A;LRRTM1;DLGA 04 P1;PVRL3;CNIH3;GRIA4;SHANK1 GO: 0043235 receptor complex 24/272 9.2E-06 3. -2.2 17.7 NOTCH2;GABBR2;CSF1R;GPR37;ITGAM;NRN1; 3E FLT1;NOTCH1;GABRA5;CHRNA4;ITPR2;SORB - S1;GRIN2A;OLFM2;GRIN3A;OLFM3;ERBB3;PLX 04 NA1;MYH9;PLXNB1;CNIH3;CACNG4;GRIA4;SH ANK1 GO: 0034703 cation channel complex 16/147 3.0E-05 9. -2.0 14.0 RYR2;KCNJ6;KCNIP2;KCNC2;CACNA2D1;CAC 7E NA2D2;CACNA1G;KCNV1;KCNT2;SESTD1;FKB - P1B;KCNMB4;SCN7A;CACNG4;KCNJ3;SCN1A 04 GO: 0045202 synapse 21/243 4.4E-05 1. -2.1 13.9 GABRA2;CHRM3;EPHA7;NRN1;SYT1;SLC32A1; 3E CADPS;MYRIP;OLFM2;OLFM3;GRIN3A;ADORA - 2A;FRRS1L;DNAJC6;LRRTM1;TBC1D24;MYH9; 03 SLC17A7;HAP1;GRIA4;SHANK1 GO: 0008328 ionotropic glutamate receptor 9/49 5.0E-05 1. -1.9 12.2 OLFM2;GRIN2A;NRN1;OLFM3;GRIN3A;CNIH3;C complex 4E ACNG4;GRIA4;SHANK1 - 03 GO: 0030672 synaptic vesicle membrane 6/22 1.5E-04 3. -1.9 10.7 SLC32A1;SYT1;GAD2;SLC17A7;DRD2;STX1A 7E - 03

GO: Molecular Term Overlap P F Z Combined Genes Component D R GO: 0022836 gated channel activity 31/323 3.3E-07 2. -2.5 21.3 RYR2;CLIC4;KCNK9;KCNC2;CHRNA4;ITPR2;CA 2E CNA1G;KCNV1;GRIN2A;KCNT2;KCNMB4;SCN7 - A;CACNG4;TRPM4;KCNJ3;SCN1A;GRIA4;GABR 04 A2;GABRA1;KCNJ6;KCNIP2;KCNH7;KCNJ9;GA BRA5;CACNA2D1;GABRA3;CACNA2D2;GRIN3A ;FKBP1B;HCN1;KCNK4 GO: 0015267 channel activity 35/427 1.8E-06 3. -2.6 20.1 RYR2;CLIC4;TTYH2;KCNK9;KCNC2;CHRNA4;IT 9E PR2;CACNA1G;KCNV1;GRIN2A;KCNT2;KCNMB - 4;SCN7A;CACNG4;TRPM4;KCNJ3;SCN1A;GRIA 04 4;GABRA2;GABRA1;KCNJ6;KCNIP2;KCNH7;KC NJ9;GABRA5;CACNA2D1;GABRA3;CACNA2D2; GRIN3A;FKBP1B;BCL2;MAL;FXYD6;HCN1;KCN K4 GO: 0022803 passive transmembrane 35/427 1.8E-06 3. -2.5 20.0 RYR2;CLIC4;TTYH2;KCNK9;KCNC2;CHRNA4;IT transporter activity 9E PR2;CACNA1G;KCNV1;GRIN2A;KCNT2;KCNMB - 4;SCN7A;CACNG4;TRPM4;KCNJ3;SCN1A;GRIA 04 4;GABRA2;GABRA1;KCNJ6;KCNIP2;KCNH7;KC NJ9;GABRA5;CACNA2D1;GABRA3;CACNA2D2; GRIN3A;FKBP1B;BCL2;MAL;FXYD6;HCN1;KCN K4 GO: 0005216 ion channel activity 33/396 2.6E-06 4. -2.5 19.3 RYR2;CLIC4;TTYH2;KCNK9;KCNC2;CHRNA4;IT 2E PR2;CACNA1G;KCNV1;GRIN2A;KCNT2;KCNMB - 4;SCN7A;CACNG4;SCN1A;GRIA4;TRPM4;KCNJ 04 3;GABRA2;GABRA1;KCNJ6;KCNIP2;KCNH7;GA BRA5;KCNJ9;CACNA2D1;GABRA3;CACNA2D2; GRIN3A;FKBP1B;FXYD6;HCN1;KCNK4 GO: 0022838 substrate-specific channel 33/406 4.2E-06 5. -2.5 18.6 RYR2;CLIC4;TTYH2;KCNK9;KCNC2;CHRNA4;IT activity 6E PR2;CACNA1G;KCNV1;GRIN2A;KCNT2;KCNMB - 4;SCN7A;CACNG4;TRPM4;KCNJ3;SCN1A;GRIA 04 4;GABRA2;GABRA1;KCNJ6;KCNIP2;KCNH7;KC NJ9;GABRA5;CACNA2D1;GABRA3;CACNA2D2; GRIN3A;FKBP1B;FXYD6;HCN1;KCNK4 GO: 0005261 cation channel activity 25/285 2.0E-05 1. -2.4 15.2 RYR2;KCNK9;KCNC2;CHRNA4;ITPR2;CACNA1 9E G;KCNV1;GRIN2A;KCNT2;KCNMB4;SCN7A;CA - CNG4;TRPM4;KCNJ3;SCN1A;KCNJ6;KCNIP2;K 03 CNH7;KCNJ9;CACNA2D1;CACNA2D2;GRIN3A;F KBP1B;HCN1;KCNK4 GO: 0046873 metal ion transmembrane 31/400 2.0E-05 1. -2.5 15.6 RYR2;KCNK9;KCNC2;ITPR2;SLC8A1;CACNA1G transporter activity 9E ;KCNV1;GRIN2A;KCNT2;KCNMB4;SCN7A;SLC1 - 7A7;CACNG4;SCN1A;TRPM4;KCNJ3;KCNJ6;SL 03 C32A1;KCNIP2;KCNH7;KCNJ9;CACNA2D1;SLC 30A4;CACNA2D2;SLC39A10;SLC6A11;SLC6A7; GRIN3A;FKBP1B;HCN1;KCNK4 GO: 0022834 ligand-gated channel activity 16/145 5.5E-05 4. -2.2 12.4 GABRA2;RYR2;GABRA1;KCNJ6;GABRA5;KCNH 0E 7;CHRNA4;KCNJ9;GABRA3;ITPR2;GRIN2A;GRI - N3A;FKBP1B;HCN1;GRIA4;KCNJ3 03 GO: 0015276 ligand-gated ion channel 16/145 5.5E-05 4. -2.2 12.3 GABRA2;RYR2;GABRA1;KCNJ6;GABRA5;KCNH activity 0E 7;CHRNA4;KCNJ9;GABRA3;ITPR2;GRIN2A;GRI - N3A;FKBP1B;HCN1;GRIA4;KCNJ3 03 GO: 0005244 voltage-gated ion channel 18/189 1.1E-04 6. -2.3 11.8 KCNJ6;CLIC4;KCNK9;KCNIP2;KCNH7;KCNJ9;K activity 6E CNC2;CACNA2D1;CACNA2D2;CACNA1G;KCNV - 1;KCNT2;SCN7A;CACNG4;HCN1;KCNJ3;SCN1A 03 ;KCNK4

KEGG Overlap P F Z Combined Genes D R hsa04723 retrograde endocannabinoid 21/101 1.1E-10 2. -1.9 33.9 GABRA2;GABRA1;FAAH;KCNJ6;SLC32A1;KCNJ signaling 6E 9;GABRA5;GABRA3;ITPR2;ADCY2;ADCY1;ADC - Y6;GNAI1;RIMS1;MAPK8;GNG2;PLCB4;GNB4;S 08 LC17A7;GRIA4;KCNJ3 hsa04727 GABAergic synapse 19/88 5.2E-10 6. -1.8 30.4 GABRA2;GABBR2;GABRA1;KCNJ6;SLC32A1;G 0E ABRA5;GAD1;GABRA3;GAD2;ADCY2;ABAT;SL - C6A11;ADCY1;ADCY6;GNAI1;GLS;GNG2;GNB4; 08 HAP1 hsa05032 morphine addiction 18/91 5.1E-09 3. -1.8 26.6 GABRA2;GABBR2;GABRA1;KCNJ6;SLC32A1;K 9E CNJ9;GABRA5;PDE1B;PDE1A;GABRA3;ADCY2; - ADCY1;ADCY6;GNAI1;GNG2;ADRBK2;GNB4;KC 07 NJ3 hsa04724 glutamatergic synapse 19/114 2.2E-08 1. -1.9 25.2 PLA2G4E;ITPR2;ADCY2;ADCY1;ADCY6;GNAI1; 3E GLS;GRM2;GRIN2A;GRIN3A;GNG2;PLCB4;ADR - BK2;GNB4;DLGAP1;SLC17A7;GRIA4;SHANK1;K 06 CNJ3 hsa04713 circadian entrainment 17/95 5.1E-08 2. -1.8 23.7 GUCY1A2;RYR2;KCNJ6;KCNJ9;ADCY2;ADCY1; 4E ADCY6;GNAI1;CACNA1G;PER2;GRIN2A;GNG2; - PLCB4;GNB4;CAMK2G;KCNJ3;GRIA4 06 hsa04921 oxytocin signaling pathway 21/158 1.3E-07 5. -1.8 22.4 GUCY1A2;RYR2;KCNJ6;MEF2C;PRKAA2;PLA2 2E G4E;KCNJ9;CACNA2D1;CACNA2D2;ITPR2;ADC - Y2;ADCY1;ADCY6;ACTB;GNAI1;RGS2;PLCB4;C 06 AMK2G;CAMK1G;CACNG4;KCNJ3 hsa05033 nicotine addiction 10/40 2.4E-06 7. -1.6 14.8 GABRA2;GABRA1;GRIN2A;GRIN3A;SLC32A1;G 9E ABRA5;CHRNA4;GABRA3;SLC17A7;GRIA4 - 05 hsa04728 dopaminergic synapse 16/129 9.8E-06 2. -1.7 13.9 KCNJ6;KCNJ9;ITPR2;GNAI1;GRIN2A;MAPK8;G 9E NG2;GNAL;PLCB4;PPP1R1B;GNB4;DRD2;CAM - K2G;SCN1A;GRIA4;KCNJ3 04 hsa04020 calcium signaling pathway 19/180 1.2E-05 3. -1.8 14.2 CHRM3;RYR2;PDE1B;PDE1A;ITPR2;ADCY2;AD 1E RA1D;ADCY1;HTR2A;SLC8A1;CACNA1G;GRIN2 - A;GNAL;PLCB4;EDNRB;ADORA2A;ERBB3;PLC 04 E1;CAMK2G hsa04725 cholinergic synapse 14/111 3.0E-05 7. -1.8 13.1 CHRM3;KCNJ6;CHRNA4;ITPR2;ADCY2;ADCY1; 0E ADCY6;GNAI1;GNG2;PLCB4;GNB4;BCL2;CAMK - 2G;KCNJ3 04 Table 1B: Enrichment analysis of the effect of Genotype (Cyfip2 N/- mice versus Cyfip2 N/N mice) GO: Term Overlap P FDR Z Combined Differentially BIOLOGICAL Expressed PROCESS Genes GO: 0007610 behavior 31/494 1.3E-14 1.3E-11 -2.4 60.5 PDE1B;CHAT;S EZ6;ADCY8;SO BP;ADCY5;RAS D2;CUX2;HRH3; CHL1;SLITRK1; NPY;GNG7;PEN K; TAC1;DRD2;ME F2C;DSCAM;HO MER2;PBX3; TACR1;SEZ6L;O XR1;ADCYAP1; PPP1R1B;ITGA5 ;VIP;FGF12;MET ;SHANK2;SHAN K1 GO: 0044708 single-organism 27/362 1.6E-14 1.3E-11 -2.4 60.3 PDE1B;CHAT;S behavior EZ6;ADCY8;CU X2;HRH3;SLITR K1;CHL1;NPY;G NG7;PENK;TAC 1;DRD2;MEF2C; HOMER2;PBX3; TACR1;SEZ6L;O XR1;ADCYAP1; PPP1R1B;ITGA5 ;VIP;FGF12;MET ;SHANK2; SHANK1 GO: 0007268 synaptic 29/434 2.2E-14 1.3E-11 -2.3 58.8 NAPB;GABRB2; transmission CAMK2D;KCNC 2;RASGRF2; KCNC4;CHAT;A DCY8;GNAI1;AD CY5;RASD2; GRM2;NPY;GNG 7;DLGAP1;TAC1 ;DRD2;KCNJ3; GABBR2;GABR A1;KCNH7;ACT N2;GABRA3; KCNAB3;PDYN; KCNMA1;VAMP 1;FGF12;HCN1 GO: 0030534 adult behavior 14/141 1.7E-09 7.3E-07 -2.3 32.3 HOMER2;CHAT; PBX3;SEZ6;SEZ 6L;OXR1; SLITRK1;CHL1; NPY;DRD2;FGF 12;MET;SHANK2 ; SHANK1 GO: 0007626 locomotory 15/183 4.9E-09 1.7E-06 -2.3 31.0 DSCAM;PDE1B; behavior CHAT;PBX3;SEZ 6;SOBP;SEZ6L; OXR1;ADCY5;R ASD2;CHL1;GN G7;PENK;DRD2; FGF12 GO: 0050890 cognition 15/227 7.2E-08 2.1E-05 -2.3 24.9 MEF2C;PDE1B; TACR1;ADCY8; CUX2;HRH3;CH L1;PPP1R1B;GN AS;ITGA5;TAC1; DRD2;VIP;SHAN K2;SHANK1 GO: 0007187 G-protein 12/153 2.8E-07 7.0E-05 -2.2 21.3 CHRM2;GRM2;G coupled receptor PR26;HRH3;NP signaling Y;CHRM4;GNAS pathway, coupled ;ADCY8;DRD2;S to cyclic STR3;GNAI1;AD nucleotide CY5 second messenger GO: 0007611 learning or 13/198 6.0E-07 1.3E-04 -2.3 20.5 MEF2C;PDE1B; memory TACR1;ADCY8; CUX2;HRH3;PP P1R1B;ITGA5;T AC1;DRD2;VIP;S HANK2;SHANK1 GO: 0045761 regulation of 8/62 9.7E-07 1.9E-04 -2.2 18.7 ADCYAP1;GABB adenylate R2;GRM2;HRH3; cyclase activity GNG7;GNAS; VIP;DRD2 GO: 0031279 regulation of 8/73 3.0E-06 5.2E-04 -2.2 16.4 ADCYAP1;GRM cyclase activity 2;GABBR2;HRH 3;GNG7;GNAS; VIP;DRD2

GO: CELLULAR Term Overlap P FDR Z Combined Genes COMPONENT GO: 0044456 synapse part 23/395 1.4E-10 2.9E-08 -2.4 41.6 CHRM2;GABBR 2;GABRB2;GAB RA1;SLC30A3; HOMER2;CHRM 4;GABRA3;DOC 2B;SYT17;SYT6; GRM2;ADCYAP 1;PLCB4;RIMS3; DLGAP1; SLC17A8;DRD2; PVRL3;SHANK2; LZTS3;PPFIA2; SHANK1 GO: 0043025 neuronal cell 16/270 8.9E-08 8.5E-06 -2.3 26.4 EPHA5;CAMK2D body ;KLHL14;CPNE5; HOMER2; PDE1B;CHAT;S EZ6;SEZ6L;FRM D7;BOC; PPP1R1B;VIP;T AC1;BRINP3;SH ANK2 GO: 0044297 cell body 17/315 1.2E-07 8.5E-06 -2.2 26.1 EPHA5;CAMK2D ;KLHL14;CPNE5; HOMER2;PDE1 B;CHAT;SEZ6;T ACR1;SEZ6L;FR MD7;BOC;PPP1 R1B;TAC1;VIP;B RINP3;SHANK2 GO: 0005887 integral 30/1066 2.1E-06 9.4E-05 -2.1 19.9 CHRM2;GABRB component of 2;TENM1;EPHA1 plasma 0;CHRM4;GPR2 membrane 2;SLC8A1;GRM2 ;ASIC4;HRH3;FL RT2;DRD2; PCDHAC2;OPC ML;EPHA5;GAB BR2;GABRA1; TRPC5;SLC30A 3;DSCAM;KCNH 7;GABRA3; LNPEP;TACR1;A DRA2C;SSTR3; VAMP1;MET; EPHA3;HCN1 GO: 0097060 synaptic 13/228 2.3E-06 9.4E-05 -2.3 20.9 CHRM2;GABBR membrane 2;GABRB2;GAB RA1;HOMER2; CHRM4;GABRA 3;GRM2;DLGAP 1;PVRL3;SHANK 2;LZTS3;SHANK 1 GO: 0045211 postsynaptic 12/195 2.7E-06 9.4E-05 -2.2 20.5 CHRM2;GABBR membrane 2;GABRA1;GAB RB2;HOMER2; CHRM4;GABRA 3;DLGAP1;PVRL 3;SHANK2;LZTS 3;SHANK1 GO: 0030425 dendrite 12/236 1.7E-05 4.6E-04 -2.2 17.1 EPHA5;PAK1;PL CB4;CHL1;HOM ER2;GNAS;SEZ 6;TACR1;DRD2; BRINP3;HCN1;S HANK1 GO: 0030424 axon 10/161 1.8E-05 4.6E-04 -2.1 16.0 GRM2;PAK1;NR P2;DSCAM;CHA T;NCAM2;TAC1; DRD2;HCN1;UH MK1 GO: 0034702 ion channel 12/258 4.0E-05 9.1E-04 -2.1 14.9 GABRB2;GABR complex A1;CAMK2D;TR PC5;NRN1;KCN C2;KCNMA1;KC NC4;GABRA3;S HANK2;KCNJ3; SHANK1 GO: 01902495 transmembrane 12/286 1.0E-04 2.1E-03 -2.1 13.2 GABRB2;GABR transporter A1;CAMK2D;TR complex PC5;NRN1;KCN C2;KCNMA1;KC NC4;GABRA3;S HANK2;KCNJ3; SHANK1

GO: Term Overlap P FDR Z Combined Genes MOLECULAR COMPONENT GO: 0016247 channel regulator 8/102 3.3E-05 6.5E-03 -2.4 12.2 GRM2;CAMK2D; activity NPY;WNK4;KCN AB3;DRD2;FGF1 2;PTPN3 GO: 0035254 glutamate 5/29 3.6E-05 6.5E-03 -2.8 14.3 HOMER2;GNAS; receptor binding DRD2;SHANK2; SHANK1 GO: 0035255 ionotropic 4/17 7.9E-05 7.5E-03 -3.0 14.8 GNAS;DRD2;SH glutamate ANK2;SHANK1 receptor binding GO: 0005249 voltage-gated 7/86 8.3E-05 7.5E-03 -2.2 10.9 KCNC2;KCNH7; potassium KCNC4;KCNMA channel activity 1;KCNAB3;KCNJ 3;HCN1 GO: 0004714 transmembrane 6/65 1.4E-04 1.0E-02 -2.1 9.7 EPHA5;NRP2;E receptor protein PHA10;ERBB4; tyrosine kinase MET;EPHA3 activity GO: 0016917 GABA receptor 4/22 1.9E-04 1.1E-02 -3.0 13.4 GABBR2;GABR activity A1;GABRB2;GA BRA3 GO: 0005184 neuropeptide 4/23 2.2E-04 1.1E-02 -2.8 12.5 ADCYAP1;NPY; hormone activity PENK;VIP GO: 0030594 neurotransmitter 6/74 2.8E-04 1.2E-02 -2.2 9.7 CHRM2;CHRM4; receptor activity GABRA3;TACR1 ;DRD2;SSTR3 GO: 0071855 neuropeptide 4/26 3.3E-04 1.3E-02 -2.6 11.3 ADCYAP1;GNAS receptor binding ;TAC1;SHANK1 GO: 0004016 adenylate 3/11 4.6E-04 1.5E-02 -2.0 8.3 GNAS;ADCY8;A cyclase activity DCY5

KEGG Term Overlap P FDR Z Combined Genes hsa04724 glutamatergic 13/114 3.1E-10 4.2E-08 -1.9 32.9 HOMER2;ADCY synapse 8;GNAI1;ADCY5; GRM2;PLCB4; GNG7;GNAS;DL GAP1;SLC17A8; SHANK2; SHANK1;KCNJ3 hsa05032 morphine 11/91 4.7E-09 3.2E-07 -1.8 27.4 GABBR2;GABR addiction A1;GABRB2;PD E1B;GNG7; GABRA3;GNAS; ADCY8;GNAI1;A DCY5;KCNJ3 hsa04723 retrograde 11/101 1.3E-08 5.8E-07 -1.9 27.1 GABRA1;GABR endocannabinoid B2;PLCB4;GNG7 signaling ;GABRA3; NAPEPLD;SLC1 7A8;ADCY8;GN AI1;ADCY5;KCN J3 hsa04725 cholinergic 10/111 3.2E-07 8.8E-06 -1.9 22.7 CHRM2;CAMK2 synapse D;PLCB4;CHRM 4;GNG7;CHAT; ADCY8;GNAI1;A DCY5;KCNJ3 hsa05030 cocaine addiction 8/49 8.5E-08 2.9E-06 -1.8 22.4 GRM2;PPP1R1B ;GNAS;PDYN;D RD2;RGS9;GNAI 1;ADCY5 hsa04024 cAMP signaling 11/199 7.4E-06 1.3E-04 -1.8 15.8 CHRM2;GABBR pathway 2;PAK1;CAMK2 D;NPY; PPP1R1B;GNAS ;ADCY8;DRD2;G NAI1;ADCY5 hsa04727 GABAergic 8/88 5.0E-06 1.1E-04 -1.7 15.5 GABBR2;GABR synapse A1;GABRB2;GN G7;GABRA3; ADCY8;GNAI1;A DCY5 hsa04713 circadian 8/95 8.4E-06 1.3E-04 -1.7 15.4 CAMK2D;PLCB4 entrainment ;GNG7;GNAS;A DCY8;GNAI1; ADCY5;KCNJ3 hsa04924 renin secretion 7/64 6.6E-06 1.3E-04 -1.7 15.0 ADCYAP1;PLCB 4;PDE1B;KCNM A1;GNAS;GNAI1 ;ADCY5 hsa04015 Rap1 signaling 11/211 1.3E-05 1.6E-04 -1.7 15.0 MAGI1;PLCB4;G pathway NAS;ADCY8;RA SGRP2;DRD2; FGF12;MET;GN AI1;RAP1GAP;A DCY5 hsa04728 dopaminergic 9/129 9.4E-06 1.3E-04 -1.7 14.8 CAMK2D;PLCB4 synapse ;GNG7;PPP1R1 B;GNAS;DRD2; GNAI1;ADCY5;K CNJ3 Table 1C: Enrichment analysis of the effect of Treatment (PF versus Chow) GO: Biological Term Overlap P FDR Z Combined Differentially Process Expressed Genes GO: 0042552 myelination 6/59 6.4E-08 2.6E-05 -2.17 22.8 GAL3ST1;MYRF; LGI4;PLLP;CNT N2; SIRT2 GO: 0008366 axon 6/62 8.5E-08 2.6E-05 -2.17 22.9 GAL3ST1;MYRF; ensheathment PLLP;LGI4;CNT N2; SIRT2 GO: 0007272 ensheathment of 6/62 8.5E-08 2.6E-05 -2.16 22.8 GAL3ST1;MYRF; neurons PLLP;LGI4;CNT N2; SIRT2 GO: 0021762 substantia nigra 4/45 1.9E-05 4.5E-03 -2.26 12.2 MAG;CNP;PADI development 2;SIRT2 GO: 0010001 glial cell 4/61 6.0E-05 9.8E-03 -2.19 10.1 MYRF;CNP;SOX differentiation 10;GFAP GO: 0048857 neural nucleus 4/63 6.7E-05 9.8E-03 -2.16 10.0 MAG;CNP;PADI development 2;SIRT2 GO: 0048709 oligodendrocyte 3/23 8.2E-05 9.8E-03 -2.64 12.2 CNP;MYRF;SOX differentiation 10 GO: 0014013 regulation of 4/67 8.4E-05 9.8E-03 -2.12 9.8 CNTN2;SOX10;S gliogenesis IRT2;GFAP GO: 0007626 locomotory 5/183 3.6E-04 3.8E-02 -2.32 7.6 GPRC5B;CNP;L behavior GI4;MYO6;CNTN 2 GO: 0022010 central nervous 2/9 5.7E-04 4.8E-02 -2.19 6.6 MYRF;CNTN2 system myelination GO: 0032291 axon 2/9 5.7E-04 4.8E-02 -2.17 6.6 MYRF;CNTN2 ensheathment in CNS

GO: Cellular Term Overlap P FDR Z Combined Genes Component GO:0043209 myelin sheath 3/17 3.7E-05 4.1E-03 -2.89 15.9 GJC2;CNTN2;SI RT2 GO:0005902 microvillus 4/61 6.1E-05 4.1E-03 -2.19 12.1 CLIC4;CNP;MYO 6;TPRN GO:0097386 glial cell 2/9 5.8E-04 1.9E-02 -1.96 7.7 SIRT2;GFAP projection GO:0044224 juxtaparanode 2/9 5.8E-04 1.9E-02 -1.67 6.6 CNTN2;SIRT2 region of axon GO:0033270 paranode region 2/11 8.2E-04 2.1E-02 -1.9 7.3 MAG;SIRT2 of axon GO:0043220 Schmidt- 2/12 9.5E-04 2.1E-02 -1.9 7.3 MAG;SIRT2 Lanterman incisure GO:0048471 perinuclear 6/411 2.4E-03 4.5E-02 -2.26 7.0 GALNT6;CLIC4; region of CNP;MYO6;NDR cytoplasm G1; SIRT2

Mamm. Pheno4 Term Overlap P FDR Z Combined Genes

MP0000920 abnormal 9/134 3.6E-10 8.6E-08 -1.9 31.7 MAG;GAL3ST1; myelination GJC2;UGT8A;C NP;LGI4;SOX10; NDRG1;GFAP

MP0002882 abnormal neuron 14/1006 8.3E-07 9.9E-05 -1.3 11.8 GPR37;GAL3ST morphology 1;CNP;UGT8A;L GI4;ITGB4;OLIG 1;SOX10;GFAP; HAPLN2;MYO6; ENPP2;CNTN2;F GFR2

MP0003634 abnormal glial 7/231 7.2E-06 5.7E-04 -1.8 13.5 MAG;CNP;LGI4; cell OLIG1;SOX10;F GFR2;GFAP MP0002066 abnormal motor 14/1482 7.4E-05 4.4E-03 -1.6 8.7 GAL3ST1;GPR3 capabilities 7;CNP;UGT8A;L GI4;SOX10;NDR G1;ADAMTS4;M AG;SLC6A9;MY O6;SCD1;CRYA B;FGFR2 MP0000762 abnormal tongue 4/77 1.1E-04 5.4E-03 -2.0 10.5 ITGB4;GAB1;CR morphology YAB;FGFR2

MP0003690 abnormal glial 3/43 3.9E-04 1.5E-02 -2.0 8.3 LGI4;S1PR5;GF cell AP

MP0002272 abnormal 5/227 7.1E-04 2.1E-02 -1.7 6.7 SLC6A9;UGT8A; nervous system CNP;MYO6;SOX 10 MP0002152 abnormal brain 11/1188 7.2E-04 2.1E-02 -1.3 5.1 GAL3ST1;GJC2; morphology SEMA6A;GPR37 ;CNP;UGT8A;EN PP2;OLIG1;CRY AB;FGFR2;GFA P

MP0003631 nervous system 5/240 9.1E-04 2.3E-02 -1.8 6.8 SLC6A9;LGI4;N phenotype DRG1;HAPLN2; GFAP

MP0001216 abnormal 5/251 1.1E-03 2.3E-02 -1.8 6.7 ITGB4;GAB1;SC epidermal layer D2;SCD1;FGFR2 Kirkpatrick et al. Supplement Kirkpatrick et al. Supplement

Table S12: Primer sequences for qPCR.

Cyfip2 F: ACTGTATCCCTGTGGGGACC Cyfip2 R: AAGACAATGATGGAGCAGCC

Gabra1 F: CCCAAGTCTCCTTCTGGCTC Gabra1 R: CTGGCACTGATACTCAAGGTTGT

Gpr37 F: GGCACCTGATAAGTATGAGTC Gpr37 R: GAGTGGGAATAACTGAGGTCC

Mag F: GGCACCTGATAAGTATGAGTCC Mag R: GAGTGGGAATAACTGAGGTCC

Sox10 F: AGCTCAGCAAGACACTAGGCA Sox10 R: GGATGGTCCTTTTTGTGCTG

Gapdh F: CTTTGTCAAGCTCATTTCCTGG Gapdh R: TCTTGCTCAGTGTCCTTGC

Hprt F: GCTGGTGAAAAGGACCTCT Hprt R: CACAGGACTAGAACACCTGC Kirkpatrick et al. Supplement

Table S13: Correlation between cycle threshold (CT) or delta-CT and normalized read counts. In comparing gene expression values derived from qPCR versus RNA- seq methodologies, there was a significant correlation across individual samples for most of the genes. Results from regression analyses are presented for each gene. The criterion for statistical significance was Bonferroni-corrected for the five genes that were tested (p < 0.01; highlighted in yellow).” Note that lower CT or delta CT values indicate higher expression (5) whereas lower normalized read counts indicate higher expression. Thus, a more negative correlation indicates a greater degree of correspondence between the two measurements.

(A): CT versus normalized read counts Gene r r2 F P Cyfip2 -0.88 0.76 46.2 8.7 E10-6 Gabra1 -0.51 0.26 10.6 0.0028 Gpr37 -0.48 0.23 8.8 0.006 Mag -0.32 0.1 3.5 0.073 Sox10 -0.49 0.24 9.7 0.004 (B): delta-CT versus normalized read counts Gene r r2 F P Cyfip2 -0.81 0.66 26.7 0.00014 Gabra1 -0.36 0.13 4.3 0.046 Gpr37 -0.8 0.64 52.6 4.5 E-08 Mag -0.75 0.57 39.5 6.3 E-07 Sox10 -0.61 0.37 17.8 0.00021 Kirkpatrick et al. Supplement

Figure S1: Binge eating and PF-CPP with different PF diets in outbred CFW mice. We used 20 mg pellets of the 5-TUL diet (TestDiet, St. Louis, MO USA) that consists of 49.6% sucrose (nitrogen-free extract), 17.7% protein, 4.9% fat, 4.8% fiber, and 3.44 kcal/g of energy – the energy portion (calories) consists of 20.6% protein, 12.7% fat, and 66.7% carbohydrates. (A): In considering differences in PF consumption across different dietary compositions and pellet sizes (N=8 per treatment; 4 per sex), there was no significant effect of Treatment (F3,189=2.59; p=0.055), Day (F6,189<1) or interaction (F18,189<1). The slopes of lines for L20, L45, T20, and T45 were all greater than zero (m=0.021-0.038; F1,5=31.26-117.3; p=0.0001-0025; data not shown), indicating an escalation in consumption across all four groups. (B): When the data were collapsed across the four PF diets (N=32), repeated measures ANOVA indicated a main effect of -16 Day (F6,329=19.35; p=2 x 10 ) with a slope value of 0.030 that was greater than zero (F1,5=92.39; p=0.0002), indicating a sharp escalation in PF consumption. (C): In examining PF-CPP as change in time spent on the PF-paired side, there was no significant effect of Treatment (F3,108=2.65, p=0.053), Day (F3,108<1) or interaction (F9,108<1). (D): When considering change in time spent in the food triangle, there was an effect of Treatment (F3,108=3.13; p=0.029) but no effect of Day (F3,108=1.05; p=0.37) and no interaction (F9,108<1). Data are presented as the mean ± S.E.M. Because the L20 diet tended to produce the greatest preference for the PF-paired environment and because the correlation between the final preference on D22 with consumption across training days was the strongest and most reliable with the L20 diet (Table S1), we chose this diet for subsequent studies. Data are presented as the mean ± S.E.M. Because the 5- TUL20 (20 mg) diet produced the greatest PF-CPP and because the correlation between consumption and PF-CPP was the highest and most consistent across training Kirkpatrick et al. Supplement days (Table S1), we chose the 5-TUL20 diet (herein described as PF) for studies described below. Kirkpatrick et al. Supplement

Figure S2: Binge eating in B6NJ mice is specific for palatable food. To demonstrate the specificity of binge eating for PF, we used a control Chow-like 20 mg pellet diet that was custom-made by TestDiet to resemble their home cage diet which was Harlan 2918. These “Chow” pellets consisted of 18.6% protein, 6.2% fat, and an energy density of 3.1 kcal/g (13.0 kJ/g). The energy portion (calories) consisted of 24% protein, 18% fat, 58% carbohydrates. The most significant difference between the 5- TUL pellet and the Chow pellet was the lack of sucrose. (A): In comparing escalation in consumption of PF (N=15; 8 females, 7 males) versus Chow (N=15; 8 females, 7 males) in the binge-prone B6NJ strain, there was an effect of Treatment (F2,162=47.22; -10 p=1.3 x 10 ) but no effect of Day (F5,162=0.67; p=0.65) and no interaction (F5,162=2.09; p=0.07). PF-trained B6NJ mice showed significantly greater consumption than chow- trained mice on D2, D9, D16 and D18 (D2 t17-29=3.49-4.8; p<0.0083; Bonferroni- corrected p-value for six time point comparisons). (B): In quantifying treatment differences in escalation of consumption across food training days, PF-trained B6NJ mice showed a steeper slope than chow-trained B6NJ mice (F1,8=24.5; p=0.001), indicating a more rapid escalation. (C, D): In examining PF-CPP for the food side or the food triangle, there was no effect of Treatment (F2,152=2.54, 2.98; p=0.08, 0.05), Day (F3,152<1) or interaction (F6,152<1). Data are presented as the mean ± S.E.M. Kirkpatrick et al. Supplement

Figure S3: Binge eating in B6J x B6NJ-F1 mice. F1 mice (N=29; 14 females, 15 males) were bred in-house and trained in the binge protocol. (A): Changes in consumption across PF training days are shown. The inset represents the summed PF consumed across training days (%BW). (B): The slope in escalation in consumption (m=0.013) was significantly greater than zero (p=0.0014). Both consumption and the slope of escalation were more similar to the B6NJ parental strain (Fig.1C,D), suggesting an overall semi-dominant inheritance of the B6NJ allele with regard to binge eating. Non-genetic factors could contribute to the overall results because F1 mice were bred in house and tested separately from the parental B6J and B6NJ strains (Fig.1C) that were purchased from The Jackson Laboratory. Thus, the data are presented separately from Fig.1C. Data are presented as the mean ± S.E.M. Kirkpatrick et al. Supplement

Figure S4: Sex differences in binge eating and EPM behaviors in B6J x B6NJ-F 2 mice. (A): In examining sex differences in the escalation of PF consumption across -16 training days in F2 mice, there was a main effect of Sex (F1,1071=84.58; p<2 x 10 ), Day -10 (F6,1071=9.64; p=2.3 x 10 ), and a Sex x Day interaction (F6,1071=2.38; p=0.03). Female F2 mice showed significantly greater PF consumption on D4, D11, D16, D18, and D23 (t136-151= 2.73-4.78; p<0.0071; Bonferroni-corrected for seven comparisons). (B): Slope analysis indicated a steeper escalation in PF consumption in female F2 mice (m=0.018 ± Kirkpatrick et al. Supplement

0.001) than male F2 male mice (slope =0.009 ± 0.001; F1,10=49.2, p<0.0001). (C,D): In examining PF-CPP via change in time spent on the PF-paired side or in the PF triangle, there was no effect of Sex (F1,612=0.04, 2.56; p=0.85, 0.11), an effect of Day (F3,612=7.46, -5 -5 7.88; p=6.51 x 10 , 3.6 x 10 ), but no interaction (F3,612=0.94, 1.08; p=0.42, 0.36). (E,F): In examining sex differences in anxiety-like behavior in the elevated plus maze (EPM) on D24 (24 h after the final PF training session), there was no difference in percent time spent in the open arms (E: t146=1.20; p=0.24). However, there was a significant increase in the number of freezing episodes in the open arms in females (*t153=2.28; p=0.024). Kirkpatrick et al. Supplement

Figure S5: Generation of Cyfip2 N/- mice and anxiety-like behavior in experimentally naive Cyfip2 N/- versus Cyfip2 N/N wild-type littermates. (A): Schematic of the knockout first allele for generating Cyfip2 N/- mice. Mice containing floxed alleles flanking exon 6 were generated from embryonic stem cells on a C57BL/6N background by the International Knockout Mouse Consortium (1) and were crossed to global Cre-expressing mice, yielding offspring heterozygous for a deletion in exon 6. We derived mice heterozygous for the null deletion on a C57BL/6N background using sperm obtained from The Jackson Laboratory. Mice were genotyped as previously described (2) using multiplexing of two primer sets. The first set contained 1S (AGCCTCATGCTTCCTTAGGCCTCCCACAGCTTCAGG) and 1AS (AATGCGGCCACTGGGGTAACTGGGGTAATGTATGCC) which generated a 1.2 kb band in Cyfip2N/N mice. The second set contained 3S (TGGAGTGCTGGGTCACTTAGTGAATGCACC) and 3AS (AGACCTTGGGACCACCTCATCAGAAGCAGG) and 1S/1AS which generated a faint 1.2KB band, a 719bp band and a 650bp band in Cyfip2N/- mice. Power Analysis: To determine the appropriate sample size, we used the means and standard deviations of N/N J/J the summed % body weight (BW) consumed from Cyfip2 F2 mice versus Cyfip2 F2 mice. The effect size (Cohen’s d=0.93) indicated that a sample size of N=20 was required to achieve 80% power (p<0.05; two-tailed test). Thus, we employed a sample size of N=22-30 per genotype per treatment. (B): In assessing PF-CPP in the in Chow- versus PF-trained Cyfip2N/N and Cyfip2 N/- mice (see Fig. 3), there was an effect of Kirkpatrick et al. Supplement

-5 Treatment (F1,416=17.90; p=2.9 x 10 ) and a Genotype x Treatment interaction (F1,416=7.13; p=0.008) that was driven primarily by an effect of random treatment assignment that resulted in a statistically significant greater initial preference on D1 in N/- Chow-assigned versus PF-assigned Cyfip mice (t55=2.33; p=0.02). (C): The effect of random treatment assignment was also observed when considering the food triangle -5 where there was an effect of Treatment (F1,426= 15.64; p=8.97 x 10 ) that was driven by N/- D1 differences in chow-assigned versus PF-assigned Cyfip2 mice (t47=2.41; p=0.02) N/N and a trend toward the same difference in Cyfip2 mice (t43=1.88; p=0.07). (D, E): To adjust for the effect of random treatment assignment on initial preference on D1, we used subtraction analysis to represent PF-CPP as a repeated measure (D8-D1, D15- D1, and D22-D1) and did not observe any effect of Genotype (F1,312=2.66, 2.57; p=0.10, 0.11), Treatment (F1,312=0.48; 1.60; p =0.49, 0.21), Day (F2,312=0.28, 1.22; p=0.76, 0.30), or any interactions (p>0.05). We conclude that there were no reliable effects of Genotype or Treatment on changes in preference for the food-paired side. Kirkpatrick et al. Supplement

Figure S6: Female versus male analysis of summed PF consumed (% BW) in Cyfip2 N/- mice. We ran two cohorts of mice that were balanced for Genotype, Treatment, and Sex. In examining summed PF consumed (% BW), we first ran a three-way ANOVA (Genotype, Treatment, Cohort) and found no main effect of Cohort or interaction with Genotype, Treatment, or any three-way interaction (F1,101<1). We also ran another three- way ANOVA that included Genotype, Treatment, and Sex and although there was a N/- main effect of Sex (F1,101= 4.19; p=0.043). When analyzing female and male Cyfip2 mice separately for binge eating, we obtained similar results. (A): For females, there was a main effect of Genotype (F1,49=7.82; p=0.0074), Treatment (F1,49=48.46; p=7.6 x -9 N/N 10 ) and a Genotype by Treatment interaction (F1,49=6.18; p=0.016). Both Cyfip2 and N/- # N/N Cyfip2 mice consumed more PF than Chow (t13-14=6.16, 3.58; p<0.0125) and Cyfip2 N/- ate more PF than Cyfip2 mice (t19=3.18; *p<0.0125). (B): For males, there was a main effect of Genotype (F1,52=4.83; p=0.032) and Treatment (F1,52=15.23; p=0.00028), but no N/N significant interaction (F1,52=2.45; p = 0.12). Cyfip2 mice ate more PF than Chow N/- (t15=3.81; p<0.0125) whereas Cyfp2 mice did not (t17=2.48; p>0.0125). Data are presented as the mean ± S.E.M. Kirkpatrick et al. Supplement

N/N J/J Figure S7: Behavioral analysis of F2 mice (Cyfip2 , Cyfip2 ) and heterozygous knockout mice (Cyfip2 N/-, Cyfip2 N/N) chosen for transcriptome analysis. (A): We N/ chose a subset of binge-prone F2 mice ( Cyfip2 ; N=4 females, 4 males; 69-100 days J/J old on D24 of training protocol) and a subset of binge-resistant F2 mice (Cyfip2 ; 4 females, 4 males; 69-100 days old on D24 of training protocol) based on their genotype and their initial PF consumption (%BW) on D2 – a training day that produced one of the most robust QTL signals at the Cyfip2 locus (Fig.2C), in particular with females (Fig.2E). In examining PF consumption on D2, there was a highly significant increase in N/N J/J consumption of PF on D2 in Cyfip2 F2 mice versus Cyfip2 F2 mice (t7 = 6.18; p = 0.00035). (B): We chose a subset of mice from each of the four groups from the 2 x 2 knockout design that were tested for compulsive-like binge eating (see Fig. 3) for transcriptome analysis via RNA-seq (N=8 mice per genotype per treatment; 4 females, 4 males; 82-84 days old on D24 of training protocol). We selected mice whose individual values in PF consumption were nearest the group average. Analysis of these subgroups reflected similar results as the complete analysis shown in Fig. 3D. Specifically, there was still a main effect of Genotype (F1,28=5.79; p=0.02) but no effect of Training Treatment (F1,28=1.13; p=0.3), and no significant interaction (F1,28=2.36; p=0.14). The effect of Genotype was explained by a significant increase in PF N/N N/- consumption in PF-trained Cyfip2 versus Cyfip2 mice (t10=3.16; p<0.0125). Data are presented as the mean ± S.E.M. Kirkpatrick et al. Supplement

Figure S8: Correlation of 102 overlapping, differentially expressed genes between the F2 study and knockout studies (Effect of Genotype) when no fold-change cut- N/N off is employed. Differential gene expression (log2 fold-change) is indicated in Cyfip2 J/J N/N N/- mice relative to Cyfip2 mice (F2; x-axis) versus Cyfip2 mice relative to Cyfip2 mice (knockout study; y-axis). Regression analysis indicated that the correlation was highly 2 -22 significant (r=0.78; r =0.62; F1,100=160.3; p=1.7 x 10 ) which is nearly identical to the results obtained with the 84 genes reaching the 1.1-fold change cut-off criterion for differential expression (see Fig.4B). Kirkpatrick et al. Supplement

Figure S9: Top IPA gene network for PF consumption in Cyfip2N/- versus PF consumption in Cyfip2N/N mice. To conduct enrichment analysis on interactive genes that depended both on Genotype and PF Treatment, we considered the subset of 44 out of 82 differentially expressed in PF-trained Cyfip2 N/- versus PF-trained Cyfip2N/N mice that were not contained within the gene lists comprising the main effect of Genotype or Treatment (Table S9,S10). Once again, TCF7L2 was identified as one of Kirkpatrick et al. Supplement the top two upstream regulators (p =2.96 x 10-3) and was associated with differential expression of Ccnyl1, Eps15, Nudt4, and Pex5l. (A): Using these same 44 uniquely identified differentially expressed genes that were extracted from the gene list for PF- trained Cyfip2N/- versus Cyfip2N/N mice (≥1.1-fold change, FDR<0.2; Table S9), a single IPA network was identified with an Enrichment Score of 32 that included 14 out of 44 genes total. Differential gene expression is indicated for the direction of Cyfip2N/- mice relative to Cyfip2N/N mice. Red = increased gene expression in Cyfip2N/- mice associated with reduced binge eating (or i.e., decreased gene expression in Cyfip2N/N mice associated with increased binge eating). Green = decreased expression in Cyfip2N/- mice associated with reduced binge eating (or i.e., increased expression in Cyfip2N/N mice associated with increased binge eating. (B): List of experimentally identified genes within the network, including fold-change log2 fold-change (FC), FC, p-value, and false discovery rate (FDR). Kirkpatrick et al. Supplement

Figure S10: Validation of a subset of differentially expressed genes from the transcriptome dataset via qPCR. A subset of genes were chosen for validation based on high expression and overlap of the F2 gene list with the list comprising the effect of Genotype (Cyfip2 and Gabra1) or the list comprising the main effect of Treatment (Gpr37, Mag, and Sox10). Primer sequences are provided in Table S11. Oligo-dT primers were used to synthesize cDNA from total RNA to examine mRNA expression as previously described(6). Differential gene expression was reported as the fold-change in N/N J/J N/- expression in Cyfip2 mice relative to Cyfip2 mice (F2 study) or in Cyfip2 mice N/N -(∆∆C ) relative to Cyfip2 mice using the 2 T method(5). Forward and reverse primers spanned exon junctions near, but not including the 3’ UTR. We used either Gapdh (Cyfip2, Gabra1) or Hprt (Gpr37, Mag, Sox10) as housekeeping genes based on average expression levels observed in the RNA-seq dataset. (A,B): Cyfip2 and Gabra1 were highly expressed genes that overlapped in the gene set from the F 2 analysis and the knockout analysis comprising the main effect of Genotype (Fig.4A) and thus, we chose these representative genes for qPCR validation in the same samples used for RNA-seq. Based on the hypothesized direction of change in gene expression from the RNA-seq dataset relative to Cyfip2N/N mice, we used a one-tailed Welch’s t-test and found a significant decrease in Cyfip2 expression in Cyfip2N/- mice (N=10) relative to Cyfip2N/N mice (N=6) and a trend toward an increase in Gabra1 expression in Cyfip2N/- mice (N=16) relative to the Cyfip2N/N genotype (N=16). Both of these results match the Kirkpatrick et al. Supplement direction of expression obtained from RNA-seq (Table S4,S5). (C-E): Gpr37, Mag, and Sox10 were highly expressed genes that overlapped in the gene lists comprising the F2 analysis and the knockout analysis comprising the main effect of Treatment (Fig.4A) and thus, were chosen for qPCR validation. All three genes showed a decrease in gene expression in PF-trained mice (N=16) relative to Chow-trained mice (N=16) which matches the direction of change in the RNA-seq results (Tables S6,S7). None of these genes reached statistical significance (p<0.05). Data are presented as the mean ± S.E.M. See Table S12 for results obtained from regression analysis of correlation in gene expression of individual samples between qPCR and RNA-seq technologies for each gene. Kirkpatrick et al. Supplement

Supplemental References 1. Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, Iyer V, et al (2011): A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474:337-342. 2. Kumar V, Kim K, Joseph C, Kourrich S, Yoo SH, Huang HC, et al (2013): C57BL/6N mutation in Cytoplasmic FMRP interacting protein 2 regulates cocaine response. Science 342:1508- 1512. 3. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al (2015): limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43:e47. 4. Keane TM, Goodstadt L, Danecek P, White MA, Wong K, Yalcin B, et al (2011): Mouse genomic variation and its effect on phenotypes and gene regulation. Nature 477:289-294. 5. Schmittgen TD, Livak KJ (2008): Analyzing real-time PCR data by the comparative C(T) method. Nature protocols 3:1101-8. 6. Yazdani N, Parker CC, Shen Y, Reed ER, Guido MA, Kole LA, et al (2015): Hnrnph1 Is A Quantitative Trait Gene for Methamphetamine Sensitivity. PLoS Genet 11:e1005713.

Recommended publications