Plasmid Generation. to Generate the 3 -HGHK Plasmid, a Fragment Spanning Nucleotides 231-613

Plasmid Generation. To generate the 3’-HGHK plasmid, a fragment spanning nucleotides 231-

613 of Eco RI fragment 38 of the VWF gene was amplified by PCR with the 2.32 clone as the template, and the following primers. 5’GCCATATGGGGAGGGTTGAGCCTCCGTGTT-3’

(forward), and 5’GCCATATGGGGTCTGACATGTCCTCTTCTCTATGG3’ (reverse).

Amplified DNA was inserted into the pCR2.1 vector as suggested by the manufacturer

(Invitrogen Carlsbad, CA). pCR2.1 DNA containing the insert was digested with Nde I, and the

VWF containing fragment purified by gel electrophoresis. This fragment was ligated into the

HGHK plasmid digested with Nde I. The resulting plasmid contained intron 51 sequences 213-

613 immediately followed by VWF promoter sequences –487 to +247 and human growth hormone (HGH) gene as shown in Fig.5A. Presence and orientation of the insert were determined using PCR. Sequences of plasmids containing the insert in the sense orientation were verified by sequencing (University of Pittsburgh Core DNA Sequencing Facility).

To generate the plasmids containing the luciferase reporter gene, SV40 promoter, and the wild type as well as mutant VWF 231-613 sequences, first a mutant fragment 231-613 was generated as follows: the wild type 231-613 fragment was cloned into the plasmid pG5Z- (Promega

Madison WI) and ssDNA bacteriophages were isolated using the M13KO7 helper phage according to the manufacturer (Promega, Madison WI). To produce the mutation, the oligonucleotide 5’CTGAGTCTTTCCTCAGGGTTTGTTTTTTTC3’ was used. Plasmids containing the mutation were identified using PCR and verified by DNA sequencing. The mutant insert was liberated from the plasmid by digestion with Nde I and ligated into Nde I digested

HGHK as described above. The resulting plasmid, designated 3’M-HGHK contained mutant intron 51 sequences followed by VWF promoter sequences (-487 to +247) and HGH gene

(Fig…) Plasmids containing the fragment in the sense orientation were identified and sequences verified. To generate the VWF luciferase reporter genes, then VWF sequences 231 to 613 were amplified from the 3’-HGHK and 3’M-HGHK plasmids, respectively, using the oligonucleotides 5’GGAGGGTTGAGCCTCCGTGTT3’ (forward) and

5’GGTCTGACATGTCCTCTTCTCTATGG3’ (reverse) in a PCR reaction. The amplified fragments were ligated into Sma I digested pGL3promoter (pGL3pr) plasmid (Promega, Madison

WI). The resulting plasmids contained intron 51 sequences 213-613 (wild type or mutant) immediately followed by SV40 promoter sequences and luciferase gene as shown in Fig.5A. The presence and orientation of the inserts were determined by PCR and sequences of plasmids containing the insert in the sense orientation were verified.

To generate the plasmids HSS-VWF-LacZ and VWF-LacZ-HSS containing the LacZ reporter gene for generation of transgenic mice following approach was used. For generation of HSS-

VWF-LacZ transgene the fragment spanning nucleotides 231-613 of Eco RI fragment 38 of the

VWF gene (2) was amplified by PCR using 3’-HGH-K plasmid as the template, and the following primers: 5’ CCGTCGACGGTACCGAGGGTTGAGCCTCCGTGTT-3’ (forward), and 5’GCCGTCGAC GGTCTGACATGTCCTCTTCTCTATGG3’ (reverse). The forward primer contains SalI and Asp718 enzyme restriction site followed by intron 51 sequences, while the reverse primer contains the Sal I enzyme restriction site followed by intron 51 sequences. The

PCR fragment generated by these primers were digested with Sal I enzyme and cloned upstream of the plasmid VWF LacZ (10) containing a single Sal I site upstream of the VWF promoter.

Clones containing the intron 51 sequences in the sense orientation were selected and verified by sequence analysis. The resulting plasmids contained intron 51 sequences 213-613 (wild type or mutant) immediately followed by VWF promoter sequences –487 to +247 and LacZ gene as shown in Fig.6A. To generate VWF-LaZ-HSS plasmid the fragment 213-613 of intron 51 generated as described above for generation of plasmid HSS-VWF-LacZ, except that the forward primer contained Asp718 site followed by intron 51 sequences, while the reverse primer contained Asp718 followed by Sal I and intron 51 sequences. The resulting PCR fragment was digested with ASP718 and cloned into the Asp 718 site following the poly adenylation signal at 3’ end of the LacZ gene in the VWF-LacZ plasmid. Clones containing the intron 51 sequences in the sense orientation were selected and verified by sequence analysis. The resulting plasmid contained VWF promoter sequences -487 to +247 followed by LacZ gene and poly A signal and

VWF intron 51 sequences 213-613.