Supplemental Information s5
Total Page：16
File Type：pdf, Size：1020Kb
Supplemental Information
Receptor tyrosine kinases and TLR/IL1Rs unexpectedly activate myeloid cell PI3K, a single convergent point promoting tumor inflammation and progression
Michael C. Schmid, Christie J. Avraamides, Holly C. Dippold, Irene Franco, Philippe
Foubert, Lesley G. Ellies, Lissette M. Acevedo, Joan R.E. Manglicmot, Xiaodan Song,
Wolfgang Wrasidlo, Sara L. Blair, Mark H. Ginsberg, David A. Cheresh, Emilio Hirsch,
Seth J. Field, and Judith A. Varner
1 2 Figure S1, related to Figure 1: Characterization of myeloid cell mobilization and recruitment to the tumor. (A) Cryosections of normal pancreas and lung and orthotopic lung and pancreatic carcinomas were immunostained to detect CD11b+ cells (red, arrowheads) and counterstained to detect nuclei (blue), scale bars, 40µm. (B) Images, Normal dorsal skin (d0) and subcutaneous LLC tumors (d7-21) were immunostained to detect CD11b+ (red) myeloid cells and CD31+ endothelial cells (green), scale bars, 40µm. Graphs, (left) quantification of CD11b+ and CD31+ cells by immunohistochemical (IHC) staining expressed as pixels/field; (right) fold-increase in CD11b and CD31 gene expression over time as determined by qPCR. (n=3). *p<0.05. (C) Quantification of total Gr1+CD11b+ cells in bone marrow (BM), peripheral blood (PB) and in tumors over time in mice bearing LLC tumors, *p<0.05. (D) Hematological profile of white blood cell distribution in peripheral blood from normal and tumor bearing mice (values represent percent of total white blood cells) (n=6). (E) Quantification of adoptively transferred, fluorescently labeled Gr1+CD11b+ cell populations isolated from BM of normal or tumor-bearing mice (total Gr1+CD11b+ cells as well as Gr1lo/negCD11b+ and Gr1hiCD11b+ subpopulations) that are found in LLC tumors 2 hours after adoptive transfer (n=3). (F) SDF-1α and IL-1β gene expression over time in subcutaneous LLC tumors in vivo (n=3). *p<0.01. (Similar results observed for Panc02 tumors). All error bars indicate s.e.m. Statistical significance was determined by two-tailed Student’s t- test.
3 4 Figure S2, related to Figure 2: Integrin 4 is critical for CD11b+ myeloid cell adhesion to endothelium and VCAM-1. (A) Adhesion to endothelial cells and murine VCAM-1 of sorted CD11b+ cell populations (Gr1+CD11b+ cells as well as Gr1lo/negCD11b+ and Gr1hiCD11b+ subpopulations) from BM of normal or LLC tumor-bearing mice upon stimulation with SDF-1, IL-1 and VEGF-A, expressed as fluorescence units (F.U.) (n=3). (B) Adhesion of murine CD11b+ cells isolated from normal mice to murine VCAM-1 in the absence (Control) or presence of isotype control (IgG), anti-4 or anti-M inhibitory antibodies or small molecule inhibitor of integrin (ELN476063). (n=3) *p<0.01 vs. Control. (C) Adhesion of human CD11b+ myeloid cells to HUVEC monolayers or human VCAM-1 coated plates in the absence (Control) or presence of isotype control (IgG) or anti-4 (HP2/1) inhibitory antibodies (n=3) *p<0.01 vs. Control. (D) Graphs: adhesion of WT, 4Y991A and M-/- CD11b+ myeloid cells to murine ICAM-1 coated plates or to murine endothelial cell monolayers (n=3) *p<0.01 vs. WT. (E) Facs plot: Flow cytometry profiles of ICAM-1 and VCAM-1 expression in cultured murine endothelial cells used for adhesion assays indicate murine endothelial cells express cell surface ICAM-1 and VCAM-1. (F) Integrin expression on CD11b+ cells from Tie2Cre(-) or Tie2Cre(+) α4loxp/loxp bone marrow cells was quantified by FACs. The percentage of CD11b+4+ cells in bone marrow of Cre+ and Cre- animals is indicated. CD11b+ cells from Tie2 - animals are 100% positive for integrin 4 expression, while the CD11b+ cell population from Tie2Cre+ cells is only 54% positive. (G) Adhesion to murine VCAM-1 of WT, 4Y991A, M-/-, and 4-/- CD11b+ cells. Integrin 4-/- CD11b+ cells were isolated by FACs sorting from Tie2Cre- or Tie2Cre+ 4loxp/loxp mice. (n=3) *P<0.01 vs. WT. (H) Adhesion to murine VCAM-1 of non-silencing, itga4 and itgam siRNA transfected CD11b+ cells isolated from normal mice (n=3). *p<0.01 vs. Control. (I) Validation of siRNA mediated knockdown of integrin 4 and M in CD11b+ cells by qPCR (left) and flow cytometry (right). (J) Fibronectin and VCAM-1 expression in chemoattractant-stimulated endothelial cells as detected by immunoblotting. Immunoblots represent at least three similar experiments. All error bars indicate s.e.m. Statistical significance was determined by two-tailed Student’s t-test.
5 6 Figure S3, related to Figure 3: Effect of PI3-kinase inhibitors on myeloid cell adhesion.
(A) Effect of signaling inhibitors (10µM) on SDF-1 or IL-1 stimulated murine myeloid cell adhesion to endothelium; for a description of inhibitors see Supplemental Experimental Procedures. (B) Integrin 4 expression in BM cells from WT and p110-/- mice (n=3). (C) Validation of siRNA mediated knockdown of PI3K isoforms in CD11b+ cells by Western blotting and RT-PCR. Blots of p110 and were exposed for 5 min; blots for p110 and were exposed for 30 min. (D) Chemical structure of TG100-115 (Doukas et al., 2006; Palanki et al., 2007). (E) IC50 values of several PI3kinase inhibitors tested in in vitro kinase assays. Two PI3-kinase selective inhibitors, TG100-115 (Doukas et al., 2006; Palanki et al., 2007) and AS605240 (Camps et al., 2005), a p110 selective inhibitor (PI3K2, Hayakawa, M. et al. 2006) and a p110 selective inhibitor (TGX221, Jackson et al., 2006) were used extensively in these studies. (F) PI3-kinase activity assay in myeloid cells: anti-pAkt, and anti-Akt immunoblots of lysates of WT CD11b+ cells that were stimulated for 3 min with SDF-1 or IL-1 in the absence (-) or presence (+) of 1 µM PI3K inhibitor TG100-115. (G) IC50 values for TG100-115 and AS605240 in in vitro and in vivo biological assays. (H) HUTS21 antibody binding to unstimulated or SDF-1 stimulated human CD11b+ cells in the presence of no inhibitor (Ctrl), PI3Kinhibitor TG100-115, PI3K inhibitor 2 (PI3K2) or Mn2+ (n=3), *p<0.01 vs control.
7 Figure S4, related to Figure 4: PI3-kinase regulatory subunit expression in myeloid cells. (A) p85 PI3-kinase regulatory subunit expression in myeloid cells, lymphocytes or LLC tumor cells determined by Western blotting. (B) p87 and p101 PI3-kinase regulatory subunit expression in myeloid cells, lymphocytes or LLC tumor cells determined by RT- PCR.
8 Figure S5, related to Figure 5: Regulation of p110 and integrin α4 activation.
(A) siRNA mediated knockdown of G1 and G2 detected by qPCR (n=3). (B) VEGFR1 immunoprecipitates from myeloid cells immunoblotted to detect associated p110, , and isoforms and VEGFR1. (C) Membrane and cytosolic fractions from unstimulated (basal) and 200ng/ml SDF-1α, IL-1β and VEGF-A stimulated myeloid cells were immunoblotted to detect p110γ, and , integrin α4, and the loading control GAPDH. (D) siRNA mediated knockdown of p87, p101 and N/K ras detected by qPCR (n=3). All error bars indicate s.e.m. Statistical significance was determined by two-tailed Student’s t-test. *p<0.01, non-silencing siRNA values were set to 1.
9 Figure S6, related to Figure 6: Ras regulates tumor inflammation. (A) Lysates of CD11b+ myeloid cells transfected with non silencing, H-ras and N+K-ras siRNA transfected were immunoblotted to detect Ras and actin. (B) siRNA mediated knockdown of Raf and MEK detected by qPCR (n=3), *p<0.01, non-silencing siRNA values were set to 1. (C) Adhesion to VCAM-1 of chemoattractant stimulated myeloid cells treated with basal medium, 10 µM Sorafenib (Raf inhibitor), or 10 µM PD98059 (MEK inhibitor). (D) Left, adhesion to VCAM-1 of p110-/- myeloid cells transfected with full-length p110 or p110 Ras-binding domain deletion mutant (∆RBD). Right, Western blotting to detect expression of GAPDH and Myc-tagged p110 in p110-/- myeloid cells transfected with full-length or Ras-binding domain (∆RBD) deletion mutant constructs. Immunoblots represent at least three similar experiments. All error bars indicate s.e.m. Statistical significance was determined by two-tailed Student’s t-test.
10 11 Figure S7, related to Figure 7: Tumor inflammation, angiogenesis and metastasis in p110-/- mice. (A) Gr1+CD11b+ cell quantification by flow cytometry or immunohistochemistry in LLC tumors from WT and p110-/- mice; scale bars, 40 µm. (B) CD31+ immunostaining in LLC, B16 and Panc02 tumors from WT and p110-/- mice; scale bars, 40 µm. (C) Images, liver metastasis in WT and p110-/- mice, scale bars, 40 µm. Graph: Quantification of liver and diaphragm metastases in WT and p110-/- mice. (D) Genotyping for intact p110 in BM from WT mice transplanted with p110 and WT BM. Although equal numbers of BM cells were used as starting material, no p110 was detected in myeloid cells isolated from p110-/- BM transplanted mice, indicating that engraftment was successful. (E) Micrographs of CD31+ blood vessels in tumor sections from WT mice transplanted with WT and p110-/- BM and from p110-/- mice transplanted with p110-/- BM; scale bars, 40 µm. Graph: CD31+ pixels per field, *p<0.05. (F) Genotyping to detect relative WTp110p110 DNA levels in peripheral blood leukocytes from WT mice, WT/p110 kinase-dead heterozygous mice and kinase dead homozygous mice and from WT mice transplanted with p110KD or WT BM. Mice transplanted with p110KD BM expressed no detectable WT p110 DNA but all mice expressed equivalent levels of p110. (G) PCR genotyping to detect genomic integrin WT and YA integrin in BM cells isolated from WT mice transplanted with Y991A and WT BM. Mice transplanted with Y991A BM exhibited a 520bp mutant integrin band in BM, and mice transplanted with WT BM exhibited a 381bp wildtype band in BM, indicating that engraftment was successful. (H) Graphs: Tumor mass, percent Gr1+CD11b+ cells and CD31+ pixels/field over time in LLC tumors implanted in BM transplanted animals, *p<0.05. Images: Cryosections of LLC tumors from BM transplanted animals immunostained to detect CD31 (green) or CD11b (red) and nuclei (blue) (n=6); scale bars, 40µm. (I) Graphs: Tumor mass, percent Gr1+CD11b+ cells, and CD31+ pixels/field in LLC, Panc02 and B16 melanoma tumors from WT and YA mice, *p<0.05, **p<0.001 vs WT. Images: CD11b+ myeloid cells and CD31+ blood vessels in LLC, Panc02 and B16 melanoma sections from wildtype and Y991A animals; scale bars, 40 µm.
12 Table S1, related to Figure 7: Hematological profile of normal and LLC tumor- bearing WT, PI3K-/- and Y991A mice.
Segmented WBC Monocytes Granulocytes Neutrophils [x103/l] [l-, (% in WBC)] [l-, (% in WBC) [l-, (% in WBC)]
Normal mice (n=6-8) WT 4.8+2.2 568+126 (10) 198+78 (4) 595+55 (12) PI3K-/- 4.7+1.3 632+68 (12) 187+75 (4) 677+48 (14) 4Y991A 4.5+1.6 545+113 (10) 159+65 (3) 643+102 (14)
Tumor bearing mice (n=6-8) WT 9.0+1.3 2,533+1,302 (27) 689+157 (7) 2,914 (32) PI3K-/- 10.6+1.5 2,618+836 (25) 617+132 (6) 2,855 (28) 4Y991A 9.4+2.9 2,187+1,112 (24) 611+98 (6) 2,651 (27)
Total cell numbers/microliter of white blood cells, segmented neutrophils, monocytes and granulocytes were quantified in peripheral blood from WT, PI3K-/- and Y991A mice. The percentages of each myeloid cell type in total WBCs are indicated in parentheses. No significant differences are observed in cell numbers or percentages in normal or tumor-bearing mice between WT and mutant animals. Note that the percentages of myeloid cell subtypes increase in peripheral blood from tumor-bearing mice.
13 14 Figure S8, related to Figure 8: Suppression of spontaneous tumor growth in p110-/- and PI3-kinase inhibitor treated mice. (A) In vitro proliferation of LLC tumor cells after 24h in the presence of DMSO (Control), 10 µM TG100-115 or a pan-PI3-kinase inhibitor (n=4), *p<0.001. Error bars indicate s.e.m. (B) Graph: percent inhibition of myeloid cell adhesion to VCAM-1 at 0, 1, 2, 4, 6 or 12 hours after i.v. injection of 2.5 mg/kg of TG100-115. *p<0.01 vs control (one-way ANOVA). Blot: pAkt and Akt levels in SDF-1 stimulated myeloid cells at similar time points after i.v. injection of 2.5 mg/kg of TG100-115. (C) Weight (n=10) of LLC tumors in mice treated for 3 weeks with daily doses of 5 mg/kg inert control, 0.05, 0.5 or 5 mg/kg TG100-115 or 5 mg/kg AS605240, *p<0.01 vs control. (D) Weight of LLC tumors grown in WT or p110-/- mice and treated with daily doses of 5 mg/kg control or TG100-115 (n= 9 for p110-/- mice treated with TG100-115; n=13 for all other groups). (E) Graph: F4/80 pixels/field +/- s.e.m in mammary glands of 9 week old normal FVB female mice (P-), 6 and 9 week old PyMT+ FVB female mice, 9 week old PyMT p110-/- mice and 9 week old PyMT+FVB female mice treated with control or TG100-115 (n=10), *p<0.01. Images: F4/80+ macrophages in cryosections from these mice, scale bars, 40 µm. (F) Immunoblot analyses to detect expression of p110, p110 and GAPDH in PyMT tumors from p110+/+, p110-/- and p110+/- mice and in tumor-derived CD11b myeloid cells and PyMT tumor cells. (G) Immunostaining of cryosections of mammary gland tumors from p110+/+ and p110-/-mice to detect F4/80+ macrophages (green) and p110 (red), scale bars, 40 µm. Inset, macrophages but not tumor cells express p110. (H) In vitro proliferation of PyMT+ tumor cells after 24h in the presence of DMSO (Control), TG100-115 or a pan-PI3-kinase inhibitor (n=4), *p<0.001. Error bars indicate s.e.m. (I) Quantitative PCR analysis of gene expression of pro-angiogenic and inflammatory factors in LLC tumors from WT, YA and p110-/- animals, expressed as a percent of WT gene expression, *p<0.01. Error bars indicate s.e.m.
15 Table S2, related to Figure 8: Blockade of myeloid cell trafficking suppresses breast tumor progression.
Normal Carcinoma Hyperplasia WT 37.1±8.4 35.8±3.2 27.0±8.1 p110-/- 77.6±5.0 11.1±5.9 11.2±1.0
Control 38.0±3.1 28.5±6.5 33.2±7.7 TG100-115 67.2±3.1 6.2±1.3 27.0±5.0
WT 28.7±6.6 69.2±7.4 2.4±1.1 4Y991A 53.9±6.3 34.7±6.9 11.4±2.3
Percent area of normal, hyperplastic and carcinoma tissue in whole mounts of mammary glands from 9 week old FVB PyMT+ female wildtype (p110+/+) and p110-/- mice, in 9 week old FVB PyMT female mice treated b.i.d. with 2.5 mg/kg TG100-115 or 2.5 mg/kg inert chemically matched control compound from 6-9 weeks, and 9 week old FVB PyMT+ female wildtype (+/+) and YA/YA mice (n=10). p values for Control vs TG100-115: p= 0.001 carcinoma, p=0.01 normal tissue and p=0.45 hyperplasia. p values for p110+/+ vs p110-/-: p=0.012 carcinoma, p=0.0007 normal tissue, p=0.034 hyperplasia. p values for +/+ vs YA: p= 0.012 normal tissues, p=0.003 hyperplasia, p=0.003 carcinoma.
16 Experimental procedures
Purification of myeloid cells from BM or buffy coat Human CD11b+ cells were purified from human buffy coats from the San Diego Blood Bank. Murine CD11b+ or Gr1+ cells were purified from murine BM or PB by anti- CD11b or Gr1+ magnetic bead affinity chromatography according to manufacturer’s directions (Miltenyi Biotec) or by fluorescence activated cell sorting. To assess the purity of the CD11b+ or Gr1+ cell population, allophycocyanin (APC) labelled anti-CD11b or Gr1 antibodies were added together with the magnetic beads and flow cytometry was performed.
Purification of lymphocytes from spleen Murine lymphocytes were purified from splenocyte cell suspensions by gradient centrifugation using Histopaque 1083 (Sigma Aldrich). The percentage of T- or B-cells was measured by flow cytometry using anti-CD3-FITC (145-2C11, eBioscience) and anti-B220-APC (RA3-6B2, eBioscience). Purified cells from spleens contained 41+/- 1.1% CD3+ T cells and 55+/- 0.5% B220+ B cells. Only 4+/-0.6 % of the cells were non- lymphocytic CD3-B220- cells. siRNA and plasmid transfections Purified CD11b+ cells were transfected with 100 nM of siRNA or with plasmids + pGFPMax using an AMAXA Mouse Macrophage Nucleofection Kit (for exact details, see Supplementary Methods). After transfection, cells were cultured for 36-48 h in media containing 20% serum. Each siRNA was tested individually for efficient knockdown of protein expression and for inhibition of adhesion. Human PI3K-Myc- pcDNA3 and p110-Myc RBD-pcDNA3 (with a deletion of amino acids 220-331 in the Ras binding domain) were kindly provided by R. Wetzker (Friedrich Schiller University, Jena, Germany).
Transgenic and other animals Male PyMT mice on an FVB background were randomly bred with FVB females lacking the PyMT transgene to obtain female mice heterozygous for the PyMT transgene. Female mice heterozygous for the PyMT transgene were compared to wild type FVB female mice. All PyMT females exhibit hyperplasias by 6 weeks of age and the majority exhibit adenomas/ early carcinomas by 9 weeks of age and lymph node and lung metastases by 12-15 weeks of age as described (Davie et al., 2007). Integrin Y991A mice in the C57BL/6 background were derived as previously described (Feral
17 et al., 2006). Integrin Y991A mice were backcrossed for 8 generations into the FVB lineage and then crossed with FVB PyMT males to achieve PyMT+Y991A/Y991 female mice for breast tumor development studies. Additionally, male Tie2Cre+ mice were crossed with female integrin loxp/loxp mice (Scott et al., 2003) to generate Tie2Cre+ loxp/+ mice, which were then crossed to with loxp/loxp mice to obtain sibling Tie2Cre- loxp/loxp and Tie2Cre+ loxp/loxp mice for studies. PI3-kinase -/- (p110-/-) mice (Sasaki et al., 2000) were obtained from Dr. Joseph Penninger of the Institute of Molecular Biotechnology, Vienna, Austria. PI3-kinase kinase dead (p110KD) mice (Patrucco et al., 2004) and PI3-kinase CAAX knockin mice (murine PI3K with a C- terminal CAAX motif derived from human K-Ras) (Costa et al., 2007), were developed and maintained in the laboratory of Dr. Emilo Hirsch, Institute of Molecular Biotechnology Center, University of Torino, Italy. C57BL/6 mice were obtained from Charles River. Tie2Cre mice and CD11b-/- mice were from Jackson Laboratories.
Tumor studies C57BL/6 LLC cells and B16 cells were obtained from the American Type Culture Collection (ATCC) and C57BL/6 Panc02 pancreatic ductal carcinoma cells were obtained from the NCI DCTDC Tumor Repository. All cells were cultured in antibiotic- and fungicide-free DMEM media containing 10% serum and tested negative for mycoplasma using the Mycoplasma Plus PCR primer set from Stratagene (La Jolla, CA). Orthotopic pancreatic tumors were initiated by implanting 1 X 106 Panc02 pancreatic carcinoma cells into the pancreas of syngeneic mice. The abdominal cavities of immunocompetent C57BL/6 mice, integrin Y991A mice and p110-/- were opened and the tails of the pancreata were exteriorized. One million Panc02 cells were injected into the pancreatic tail, the pancreas was placed back into the abdominal cavity, and the incision was closed. Pancreata were excised and cryopreserved after 30 days. Lymph nodes and other organs with visible metastases were also cryopreserved. Tumor weight, angiogenesis and CD11b/Gr1/F4/80 content were quantified as described. Studies were performed twice with n=6-9. LLC lung carcinoma and B16 melanoma studies were performed as follows: 5X105 LLC cells or B16 cells were injected subcutaneously into syngeneic (C57BL/6) 6- to 8- week old wildtype (WT), integrin Y991A, PI3-kinase -/- (p110-/-) or p110kinase dead (p110KD/KD) mice. Tumors dimensions were recorded regular intervals for 21 days. Tumors were excised at 14 or 21 days, as noted in individual experiments. Tumor weights were obtained at each time point. Tumors were cryopreserved in O.C.T., homogenized in RNA stabilizing solution for RNA purification or collagenase-digested for flow cytometric analysis of CD11b and Gr1 expression as detailed below. Angiogenesis was measured by CD31 immunostaining. For orthotopic lung carcinomas, 5X105 LLC cells were injected in the tail vein and lungs were harvested after 12 days. Subcutaneous LLC tumor studies in WT versus Y991A and p110-/- animals were performed three times (n=6-8). LLC tumor studies in WT versus
18 p110KD animals were performed once (n=10 per group). B16 studies in WT versus Y991A and p110-/- animals were performed once (n=8).
Drug treatment of tumors
PI3-kinase inhibitor studies: WT and p110-/- C57BL/6 mice were subcutaneously implanted on d1 with 5X105 LLC or B16 melanoma cells. Mice were treated by i.p. injection with 2.5mg/kg of PI3-kinase inhibitor (TG100-115) (Palanki et al., 2007; Doukas, et al., 2006) or with a chemically similar inert control (n=10) twice daily for fourteen days for a total daily dose of 5mg/kg. In additional studies, C57BL/6 mice were subcutaneously implanted on d1 with 5X105 LLC and were treated by i.p. injection with 2.5mg/kg, 0.25 mg/kg, or 0.025 mg/kg of PI3-kinase inhibitor (TG100- 115), with 2.5 mg/kg of AS605240 or with a chemically similar inert control (n=10) twice daily for twenty-one days for a total daily dose of 5mg/kg. Tumor volumes, weights and blood vessel densities, as well as myeloid cell densities were measured. 6 week old PyMT+ female mice (with spontaneous breast tumors), were treated by i.p. injection with 2.5mg/kg PI3-kinase inhibitor (TG100-115) or inert control twice daily for three weeks (n=10). Tumors were excised, weighed and analyzed after 3 weeks. These studies were performed twice. Alternatively, 6 week old FVB PyMT+ female mice were implanted with Alzet mini-osmotic pumps with a 0.25µl/h release rate containing 4.6 mg in 200µl of TG100-115 or chemically similar, inert control (n=10). Mice were sacrificed at 9 weeks of age. Thus, tumors were excised, weighed and analyzed after 3 weeks. In vivo activity of TG100-115 in C57BL6 mice was measured by evaluating pAkt/Akt levels in peripheral blood cells in response to SDF-1 stimulation at 0, 1, 2, 4, 6, and 12 hour intervals. 2.5mg/kg TG100-115 was injected intravenously into 2 mice each at t=0. Blood was collected by retro-orbital bleeding from mice 0, 1, 2, 4, 6 and 12 hours later, and myeloid were purified as described above. Cells were stimulated with SDF-1 for 3 minutes, lysed and immunoblotted for pAkt and total Akt. In addition, the in vivo effect of TG100-115 on myeloid cell adhesion was assessed by measurement of SDF-1 stimulated myeloid cell adhesion to VCAM-1 coated plates at each of the above described time points.
Mammary gland whole mounts Inguinal mammary glands were fixed in Carnoy’s fixative, dehydrated through a graded series of ethanol solutions and defatted in xylene. Following rehydration, the mammary epithelium was stained with carmine stain (Sigma Chemical, St Louis, MO) for 30 min. After removing excess stain by washing in water, samples were dehydrated and stored in methyl salicylate (Sigma Chemical, St Louis, MO) as described in Davies, et al., 2007.
19 Clinical specimens Patients at the Moores UCSD Cancer Center in La Jolla, CA, underwent planned procedures for breast surgical treatment. All surgeries were performed at the University of California, San Diego and standard techniques were used for resection of breast tissue. Normal tissue was also obtained from patients undergoing breast reduction or prophylactic mastectomy. Specimens were removed, sent to the UCSD Medical Center pathology laboratory for analysis, and reviewed by a pathologist to assess the surgical margin tissue. A sample of tissue was placed on dry ice and stored at -80C. Tissues not needed for diagnosis were embedded in O.C.T. for cryosectioning. 10 invasive ductal carcinomas and 10 normal tissues were evaluated for the presence of CD11b+ cells by immunostaining of frozen sections.
Quantification of myeloid cells and blood vessels in tissues by immunohistochemistry Mammary fat pads from three month-old PyMT mice bearing spontaneous mouse breast carcinomas, LLC tumors grown orthotopically in lung for 12 days or subcutaneously in skin for 21 days (with an average mass of 1.5g), and orthotopic Panc02 tumors grown in the pancreas for 30 days (with an average mass of 1.5g) were cryopreserved in O.C.T., cryosectioned and immunostained for CD11b using M1/70 (BD Bioscience), for F4/80+ using BM8 (eBioscience), for CD31 using MEC13.3 (BD Bioscience) or for p110. Slides were counterstained with DAPI or TOPRO-3 (Invitrogen). Tissues were analyzed using Metamorph image capture and analysis software (Version 6.3r5, Molecular Devices). Haematoxylin and eosin staining was performed by the Moores UCSD Cancer Centre Histology Shared Resource. Metastases were quantified by immunostaining with Alexa488-conjugated murine anti- pan-cytokeratin (anti-cytokeratins 5, 6, 8, 10, 13, and 18, Clone C11) from Cell Signaling Technology or by H&E staining. All experiments were performed 3 times. Data were analyzed for statistical significance with an unpaired two-tailed Student’s t-test or analysis of variance (ANOVA) coupled with posthoc Tukey’s test for multiple pairwise comparisons. P<0.05 was considered to be significant. Myeloid cells were quantified by immunohistochemical methods rather than by flow cytometry when insufficient material was available for quantification by flow cytometry. Normal human mammary gland and invasive ductal breast carcinoma (n=10), 9 week old WT FVB and 9 week PyMT+ FVB mouse mammary glands (n=6), normal mouse pancreata and d30 orthotopic Panc02 pancreatic tumors (n=6), normal mouse lungs and d12 orthotopic LLC carcinoma lung tumors (n=6), and normal mouse skin and d21 subcutaneous LLC tumors (n=6) were immunostained to detect CD11b+ cells using M1/70 (BD Bioscience).
Quantification of myeloid cells in tissues by flow cytometry
20 To quantify myeloid cells in tissues, tumors were excised, minced and digested to single cell suspensions for 2h at 37°C in 10ml of Hanks Balanced Salt Solution (HBSS, GIBCO) containing 1 mg/ml Collagenase type IV (Sigma), 10 µg/ml Hyaluronidase type V (Sigma) and 20 units/ml DNase type IV (Sigma). Red blood cells were solubilized with RBC Lysis Buffer (eBioscience) and then cells were incubated in FC-blocking reagent (BD Bioscience), followed by anti-CD11b-APC (M1/70, eBioscience) and anti-Gr1-FITC (RB6-8C5, eBioscience) or with antibodies to CD11b, Gr1, F4/80, CD14, cKit, Tie2, MHCII, LY6C, and Ly6G. To exclude dead cells, 0.5µg/ml propidium iodide (PI) was added before data acquisition by FACs Calibur (BD Bioscience). To quantify myeloid cells in murine peripheral blood, blood was collected from naïve or tumor-bearing mice by retro-orbital bleeding into heparin-coated Vacutainer tubes (BD Bioscience), incubated in red blood cell lysis buffer and stained with anti- CD11b-APC/Gr1-FITC/PI. CD11b+Gr1+ myeloid cells from bone marrow or tumor tissue were further characterized by immunostaining to detect F4/80 (BM8-APC and -FITC), CD14 (Sa2-8- APC), cKit (ACK2-APC) and Tie2 (TEK4-PE) from eBioscience, as well as MHC-II (AF6 120.1), Ly6C (AL-21-FITC) and Ly6G (1A8-PE) both from BD Pharmingen. Data was acquired with a FACs Calibur instrument (BD Bioscience).
Gene and protein expression Total RNA was isolated from normal tissue, LLC tumors, Panc02 tumors, LLC and Panc02 cells as well as myeloid cells using ISOGEN (Nippon Gene). cDNA was prepared from 1µg RNA from each sample and qPCR was performed using primers for Pi3ka, Pi3kb, Pi3kg, Pi3kd, Gapdh, Sdf-1, Il-1, TnfA, Il-6, Itgam (Cd11b), Itga4 and Cd31 from Qiagen (QuantiTect Primer Assay). qPCR for VegfA expression was performed with sense primers: 5’GCTGTGCAGGCTGCTCTAAC3’ and anti-sense primers: 5’CGCATGATCTGCATGGTGAT3’. Relative expression levels were normalized to gapdh expression according to the formula <2^- (Ct gene of interest – Ct gapdh)> (Schmittgen et al., 2008). Values were multiplied by 100 for presentation purposes. Fold increase in expression levels were calculated by comparative Ct method <2^- (ddCt)> (Schmittgen et al., 2008). Values for Panc02 were compared to normal pancreas and LLC to total cells isolated from subcutaneous implanted Growth Factor-depleted Matrigel. SDF-1α and IL-1β protein levels were determined in RIPA lysates of cultured tumor cells, whole tumors or CD11b+ and Cd11- cells purified from tumors, using Quantikine mouse SDF-1α and IL-1β ELISA kits (R&D Systems).
Immunoblotting
PI3K isoforms, integrin and loading controls were detected with antibodies against p110 (4255, Cell Signaling Technology), p110 (C33D44, Cell Signaling
21 Technology and H-198, Santa Cruz Biotechnology), p110 (4252, Cell Signaling Technology), p110 (100-401-862, Rockland), p85 (sc1637, Santa Cruz Biotechnology) integrin (EPR1355Y, Epitomics) and GAPDH (G9545, Sigma Aldrich).
Adhesion assays 1 X 105 calcein-AM labelled human CD11b+ cells isolated from buffy coats from the San Diego Blood Bank or murine CD11b+ cells isolated from naïve (non-tumor bearing) or tumor-bearing mice were incubated on HUVEC monolayers or on plastic plates coated with 5 µg/ml recombinant soluble VCAM-1 or ICAM-1 (R&D Systems) for 30 minutes at 37ºC with humidity in the presence of LLC Tumor Conditioned Medium (TCM) or DMEM containing 200ng/ml SDF1, IL1, IL6, TNF or VEGF-A (R&D Systems). (SDF-1 and IL-1were initially titrated to determine the minimum dose required to achieve near maximal stimulation of adhesion). TCM was prepared by incubating LLC cells in serum-free media for 18 h and filtering through 0.22µm filters. After washing three times with warmed medium, adherent cells were quantified using a plate fluorimeter (GeniosPro, TECAN). In some adhesion assays, cells were also incubated in 25 µg/ml function-blocking anti-integrin (rat anti-murine, PS2 or mouse anti-human, HP2/1, gifts from Biogen- Idec), rat-anti-M (anti-CD11b, M1/70) and isotype control antibodies (rat IgG2b or mouse IgG1) or with 0.1 nM-10 µM doses of the small molecule inhibitor of integrin , ELN476063 (IC50=10 nM), a gift from Elan (Konradi et al., 2006). Additionally, labelled cells were incubated with HUVEC and rsVCAM-1 coated plates in the presence of 200ng/ml IL-1 or SDF-1 and 1-10 µM inhibitors: pan-PI3 kinase inhibitors (LY2942002, wortmannin, TG00020), PI3-kinase inhibitors (PI3Kalpha2, PI103), PI3-kinase inhibitor (TGX221), PI3-kinase inhibitors (TG100- 115, AS605240, AS604850), inert PI3-kinase control, PLC inhibitor (U73122), geranylgeranyltransferase (Rap1-selective) inhibitors (GGTI-2147 and GGTI-298) or farnesyltransferase (Ras-selective) inhibitor (FTI-277), Raf inhibitor (Sorafinib), Akt inhibitors (Inhibitor X and peptide 18), mTOR inhibitor (rapamycin), ROCK inhibitor (Y27632), MEK inhibitor (PD98059), p38 inhibitor (SB202190), tyrosine kinase inhibitor (genestein) and PKA inhibitors (H89, KT5720). LY294002, wortmannin, genestein, U73122, GGTI-2147, GGTI-298, FTI-277, Y27632, PD98059, SB202190, H89 and KT5720 were from Calbiochem. Sorafinib was from ChemiTek, Indianapolis, IN. PI3Kalpha2, PI103, AS605240, AS604850 and TGX221 were from Echelon. TG100-115 from Targegen/Sanofi-Aventis, a PI3K inhibitor that has been previously evaluated in human myocardial infarction clinical trials, was prepared as described (Doukas et al., 2006; Palanki et al., 2007). To titrate the effect of various signalling protein inhibitors on myeloid cell adhesion stimulated by IL-1 or SDF-1, cells were incubated in 1nm to 100 µM PI3-kinase inhibitors TG00020 (a pan-PI3-kinase inhibitor), PI3-kinase inhibitor (PI3K2) PI3-kinase inhibitor (TGX221), PI3-kinase inhibitors (TG100-115, AS605240), an inert chemically-matched control, farnesyltransferase inhibitors and geranylgeranyltransferase inhibitors. IC50s for GGTI and FTI were 1 µM. For adhesion
22 assays with plasmid-transfected cells, cells were serum starved for 4h, and then incubated for 20 min on chamber-slides coated with 5µg/ml rsVCAM-1. Adherent GFP+ cells were automatically quantified using a plate fluorimeter (GeniosPro, TECAN).
Additionally, CD11b+ myeloid cells from WT, Y991A, -/- (Tie2Creloxp/loxp), p110CAAX, p110KD/KD and p110mice (in the C57BL6 background) were stimulated with chemoattractants and incubated with HUVEC- or VCAM-1-coated plates. Gr1+ myeloid cells from M-/- (Cd11b-/-) and WT mice were also stimulated and incubated with HUVECs and VCAM-1 coated plates. No differences were observed in the degree of adhesion of Gr1+ and CD11b+ myeloid cells or in the degree of adhesion of cells isolated from normal or LLC tumor-bearing WT mice.
Sorting of integrin alpha 4-/- bone marrow cells. Bone marrow derived cells were isolated from Tie2Cre- and Tie2Cre+ integrin loxp/loxp mice and incubated with anti-CD11b-APC, anti-CD49d-FITC and 0.5 µg/ml propidium iodide. CD11b+CD49d+PI- and CD11b+CD49-PI- cells were collected using Aria FACs sorting at the Moores Cancer Center Shared Resource. Cells were used in adhesion and in vivo homing assays.
Ligand (VCAM-1) binding assay
5x105 CD11b+ cells isolated from WT, Y991A, or PI3-kinase -/- normal or tumor-bearing mice were incubated with 200ng/ml IL-1, SDF-1, IL-6, TNF, VEGF-A or medium together with 1 mg/ml mouseVCAM-1/humanFc fusion protein (R&D Systems) for 3 min. Cells were washed twice and incubated with donkey anti-human- FC-PE antibody (Jackson Immunoresearch) then analysed by FACs Calibur. Mean fluorescence intensity of treated cells was compared to that of unstimulated cells (basal). These ligand-binding assays were also performed on CD11b+ cells transfected with GFP/RapV12 or GFP/RasV12 or siRNAs and on CD11b+ cells that were treated with 1µM FTI, GGTI or inhibitors of PI3-kinase or for 30min at 37C.
Analysis of integrin expression and activation
Expression levels of murine integrin on CD11b+ cells were determined by flow cytometry to detect PE-conjugated R1/2 (rat anti-CD49d antibody, eBioscience). Integrin levels on human CD11b+ cells were determined by flow cytometry to detect bound HP2/1 (anti-human antibody, a gift from Biogen Idec).
The activation state of integrins (CD29) on human CD11b+ cells was quantified by flow cytometry using HUTS-21 (an anti- integrin activation induced epitope antibody, BD Bioscience) and total integrin levels were assessed using P4C10 antibodies (Chemicon) as follows. 2.5 X 106 freshly isolated human myeloid
23 cells/ml were incubated in culture medium containing 10µg/ml normal human immunoglobulin (12000C, Caltag) for 45 min on ice. These cells were then incubated in 200 ng/ml SDF-1, IL-1, IL-6 or 1mM Mn2+ plus 2.5µg HUTS21, P4C10, or IgG2 control for 10min at 37°C, followed by Alexa 488 goat-anti mouse antibodies for 20min on ice.
Isolation of bone marrow derived cells for bone marrow transplantation Bone marrow derived cells (BMDCs) were aseptically harvested from 6-8 week- old female mice by flushing leg bones of euthanized mice with phosphate buffered saline (PBS) containing 0.5% BSA and 2mM EDTA, incubating cells in red cell lysis buffer (155 mM NH4Cl, 10 mM NaHCO3 and 0.1 mM EDTA) and centrifuging over Histopaque 1083. Approximately 5X107 BMDC were purified by gradient centrifugation from the femurs and tibias of a single mouse. Two million cells were intravenously injected into tail veins of each lethally irradiated (1000 rad) 6 week old syngeneic recipient mouse. After 4 weeks of recovery, tumor cells were injected in BM transplanted animals. LLC (n=8, 3 experiments) and Panc02 (n=8, 2 experiments) tumor growth was compared in C57BL/6 and Y991A mice transplanted with BM from Y991A or WT. In addition, LLC tumor studies were performed in WT and p110-/- mice transplanted with BM from WT and p110mice (n=10) and in WT mice transplanted with BM from WT and p110KD mice (n=10). Successful engraftment of mutant bone marrow was assessed by isolating genomic DNA of peripheral blood cells from fully recovered bone marrow-transplanted mice. Engraftment of p110-/- BM was assessed by amplifying PCR products specific for Pi3Kcg (WT or for the deleted gene (p110-/-) and separating them by agarose gel electrophoresis. PCR products specific for Pi3Kcg-WT were exclusively detected in mice carrying WT bone marrow, while PCR products specific for Pi3Kcg depletion (p110-/-) were only detected in mice transplanted with p110 BM.
Engraftment of p110 kinase dead bone marrow was assessed by real time PCR on genomic DNA extracted from peripheral blood cells of transplanted mice. The ratio of wild type Pi3Kcg (p110) to Pi3kcb (p110) genomic DNA was determined; relative values were normalized to those of non-irradiated WT mice.
Engraftment of Y991A bone marrow was assessed by genomic DNA PCR on bone marrow derived mononuclear cells isolated from transplanted mice. PCR products specific for Itga4 WT (WT or the a4Y991A knockin mutation (YA) were separated by agarose gel electrophoresis. PCR products specific for Itga4-WT (381 bp) were exclusively detected in mice transplanted with WT BM, while PCR products specific for Y991A knockin mutation (520 bp) were only detected in mice transplanted with YA BM.
PI3-kinase activity in myeloid cells
24 CD11b+ cells from C57BL/6 mice or PI3-kinase -/- mice were freshly isolated under serum free-conditions and were incubated for 30 min in serum-free media in the presence or absence of 1 µM TG100-115. CD11b+ cells were then stimulated with 200ng/ml various cytokines and chemokines (R&D Systems) for 1-3 minutes and cells were solubilized with RIPA buffer. Lysates were electrophoresed and electrophoretically transferred to PVDF membranes. Akt phosphorylation was evaluated by immunoblotting with anti-phosphoThr308-Akt antibody (C31E5E, Cell Signalling). Blots were stripped and reprobed with anti-Akt (#9272, Cell Signaling). Films were scanned and quantified by densitometry. Films were scanned and quantified by densitometry. All antibodies were from Cell Signaling Technology.
PI3-kinase activity in tumor cells To test effects of TG100-115 on tumor cells, LLC and the PyMT+ derived mammary cancer cell line were cultured in complete culture media and treated with TG100-115 or a pan-PI3K inhibitor (TG00020) for 30 min. Cells were solubilized with RIPA buffer. Lysates were electrophoresed and electrophoretically transferred to PVDF membranes. Protein phosphorylation was evaluated by immunoblotting with anti- phosphoThr308 Akt specific antibody (C31E5E). Blots were stripped and reprobed with anti-Akt (#9272). Films were scanned and quantified by densitometry. All antibodies were from Cell Signaling Technology.
Ras activity assays
To measure Ras activity, BM cells were incubated for 30 min at 37C in serum free media in the presence or absence of 100ng/ml Pertussis Toxin (Sigma Aldrich), followed by stimulation with basal medium or medium containing 200ng/ml IL-1, IL-6, SDF-1VEGF-A, TNF, CSF-1, IL-8 (R&D Systems). Cells were lysed and activated Ras was pulled down from 1 mg cell lysate after addition of Raf1-RBD Ras-binding domain-GST fusion proteins and glutathione-conjugated beads. Beads were boiled in SDS sample buffer and electrophoresed on SDS gels. Activated (pulled down) Ras was detected by immunoblotting with anti-Ras antibodies (from Active GTPase pulldown assay kit, Thermo Scientific). siRNA mediated knockdown Freshly isolated CD11b+ cells from mouse BM were transfected using an AMAXA Mouse Macrophage Nucleofection Kit with 100 nM of siRNA for Nras (Mm_Nras_2 & Mm_Nras_3), Hras (Mn_Hras1_1 & Mm_Hras1_2), Kras (Mm_Kras2_1 & MmKras2_3), PI3K (Mm_pik3ca_1 and Mm_pik3ca_3), PI3K (Mm_pik3cb_2 and Mm_pik3cb_4), PI3k (Mm_pik3cg_1 and Mm_pik3cg_2), PI3K (Mm_pik3cd_1 and Mm_pik3cd_2), itga4 (Mm_itga4_1 & Mm_itga4_2) itgam (Mm_itgam_1 & Mm_itgam_5), p87 (Mm_BB220380_2 & Mm_BB220380_3), p101 (Mm_Pik3r5_1 &
25 Mm_Pik3r5_2), Gb1 (Mm_Gnb1_1 & Mm_Gnb1_2), Gg2 (Mm_Gng2_1 & Mm_Gng2_2), Raf (Mm_Raf1_1 & Mm_Raf1_4), MEK Mm_Map2k1_1 & Mm_Map2k1_5), or non-silencing siRNA (Ctrl_AllStars_1) purchased from Qiagen. After transfection, cells were cultured for 36-48 h in media containing 20% serum. Each siRNA was tested individually for efficient knockdown of protein expression and for inhibition of adhesion. qPCR Primers used to validate mRNA levels included Mm_pik3ca_1_SG, Mm_pik3cb_1_SG, Mm_pik3cg_1_SG, Mm_pik3cd_1_SG, Mm_ita4_1_SG, and Mm_itam_1_SG, Mm_Pik3r5_1_SG, Mm_Pik3r6_2_SG, Gnb1_1_SG, Gng2_1_SG, Map2k1_1, Raf1_1, and Mm_Apbb1ip_1_SG from Qiagen. Antibodies used to validate protein levels included PI3K alpha (#42550), beta (#3011), gamma (#4252) from Cell Signaling. To validate integrin expression, cells were analyzed by flow cytometry using anti-4 (R1-2) and anti-M (M1/70) antibodies from eBioscience. Similar results were achieved for each siRNA oligo listed above. Results are presented for Mm_Nras_2, Mm_Kras2_1, Mm_pik3ca_1, Mm_pik3b_2, Mm_pik3cg_1, Mm_pik3cd_1, Mm_itga4_1, and Mm_itgam_1, p87 (Mm_BB220380_2), p101 (Mm_Pik3r5_1), Gb1 (Mm_Gnb1_1), Gg2 (Mm_Gng2_1), Raf (Mm_Raf1_1), and MEK Mm_Map2k1_1).
Plasmid transfections Plasmids expressing constitutively active Ras (pRasV12, pRasV12C40, pRasV12S35) (Serban et al., 2008) were co-transfected with pGFPMax (Lonza) into WT and PI3-kinase -/- CD11b+ cells using AMAXA Mouse Macrophage Nucleofection Kits and were cultured for 36h in media + 20% serum. Transfection efficiency was around 30-40% as determined by GFP-FACs. Constructs were tested for ability to induce adhesion in the absence of stimulation and in the presence of TG100-115 (1µM). Additionally, cells were co-transfected with constitutively active Ras (pRasV12) and siRNAs directed against PI3K isoforms or integrin . pcDNA3 Myc-tagged plasmids expressing full length p110 and p110 with a deletion of the ras binding domain (RBD, ∆bp 657 to 996) were co-transfected with pGFPMax (Lonza) into p110-/- CD11b+ cells using an AMAXA Mouse Macrophage Nucleofection Kit. Human PI3K-Myc-pcDNA3 and PI3K deletion fragment PI3K-Myc DRBD-pcDNA3 (lacking amino acids 220-331) were kindly provided by R. Wetzker (Friedrich Schiller University, Jena, Germany). Expression was evaluated by immunoblotting with anti-Myc-tag antibodies from Invitrogen.
Preparation of subcellular fractions from myeloid cells Mouse myeloid cells were either unstimulated or were stimulated with 200ng/ml IL-1b, SDF-1a, or VEGF-A for 3 minutes and suspended in ice-cold buffer (20mM HEPES-NaOH at pH 7.2, 4 C, 0.2 M sucrose, 0.13 M NaCl, 5 mM EGTA, 1 mM MgCl2, and protease inhibitor cocktail. Cells were disrupted by Dounce homogenization. Nuclei were sedimented by centrifugation in a microfuge at 5,000 X g for 10 min. at 4°C. Supernatants were ultracentrifuged at 100,000 X g for 30 min at 4°C to yield cytosolic
26 and membrane fractions. Membranes were washed and solubilized in RIPA buffer and aliquots of cytosolic and membrane fractions were immunoblotted with antibodies against p110 (4255, Cell Signaling Technology), p110 (C33D44, Cell Signaling Technology), p110 (4252, Cell Signaling Technology), p110 monoclonal antibody (Hirsch, et. al., 2000) p110 (100-401-862, Rockland), integrin (EPR1355Y, Epitomics) and GAPDH (G9545, Sigma Aldrich).
Immunoprecipitation of p110, VEGFR1 and CXCR4
BM cells mice were treated with either basal media, SDF-1, or VEGF-A for 3 min at 37°C, rinsed with cold PBS and lysed in Tris-buffered saline containing 1% CHAPS, 20mM β-glycerophosphate, 1mM Na3VO4, 5mM NaF, 100ng/ml microcystin-LR, and protease inhibitor cocktail. After centrifugation, VEGFR1- or CXCR4 in cell lysates were immunoprecipitated as follows: 1mg total protein was precleared with 10μl protein G conjugated Dynabeads (Invitrogen) for 1hr at 4°C with rotation. Cleared lysates were incubated with 5μg of rat anti-mouse VEGFR1 (MF1, ImClone System New York, NY) and rabbit anti-mouse CXCR4 antibody (SC-9046, Santa Cruz), respectively, at 4°C for 2h, then with 30μl of protein G conjugated Dynabeads for 2h with rotation. Beads were washed three times with 1ml cold PBS containing protease inhibitor cocktail. Protein precipitates were electrophoresed on 10% SDS-PAGE gels and immunoblotted with rat anti-mouse VEGFR1 (#141522, R&D Systems), rat anti-mouse CXCR4 (2B11, eBioscience) or anti- p110γ (4252, Cell Signaling Technology). p110γ was immunoprecipitated from membranes and immunoblotted with anti-p110γ (4252, Cell Signaling Technology), anti-p87 (PIK3R6, HPA023077, Sigma), and anti-p101 (07-281, Upstate) antibodies were used.
Quantification GFP-AKT-PH1 translocation. Freshly isolated BM-derived murine CD11b+ cells were transfected with AKT-PH- EGFP expression plasmid (Luo et al., 2005) by electroporation using the Amaxa system. Cells were imaged live using an Olympus IX81-ZDC spinning disc confocal microscope controlled by Slidebook software. Cells in suspension were seeded onto a glass bottom dish contained within a 37C, 5% CO2 chamber above a heated 37C 60x 1.4 NA objective. Confocal GFP images were collected every 2 seconds before and after addition of 200 ng/ml IKL-1b, SDF-1a, VEGF-A, or basal media. The ratio of plasma membrane to cytosolic intensity was measured using Cell Profiler software.
In vivo myeloid cell trafficking studies
5x106 CFSE labelled CD11b+ cells from C57BL/6 WT, Y991A, and p110-/- mice were injected intravenously into WT mice bearing subcutaneous d14 LLC tumors. Additionally, WT CD11b+ cells were treated for 1h with 1 µM PI3-kinase inhibitor
27 (PI3K2), PI3-kinase inhibitor (TGX221), PI3-kinase inhibitor (TG100-115) and an inert control or with 10 µM inhibitors of farnesyltransferase (FTI-277) and then injected intravenously into mice bearing subcutaneous d14 LLC tumors. Non-silencing, N-, K- and H-Ras, PI3K, PI3K, PI3K, PI3K, integrin and integrin M siRNA transfected CD11b+ cells were also injected in d14 LLC tumor bearing mice. Fluorescent cells accumulating in tumors and spleens were quantified at 2h and 24h after inoculation by flow cytometry of single cell preparations of tumors. No differences were observed between untreated and non-silencing siRNA treated cells.
In vivo Angiogenesis Assays Growth Factor-depleted Matrigel (BD Bioscience) containing 400ng bFGF (R&D Systems) or saline was injected subcutaneously into C57BL/6 WT or PI3-kinase -/- mice. After 5 days, mice were injected intravenously with 20µg FITC-conjugated Bandeira simplicifolia lectin-I (Vector Laboratories). Matrigel plugs were removed and homogenized. Fluorescence was quantified at 520 nm using a fluorimeter (Tecan).
Cell proliferation assay. Two thousand LLC or PyMT breast carcinoma cells were seeded into 96 well plate wells in the presence or absence of 0.1-10µM Pan-PI3-kinase inhibitor (TG00020), PI3-kinase inhibitor (TG100-115) or inert control. Cell proliferation was measured after 24h, 48h, and 72h according to the manufacturer’s protocol (WST-1 cell proliferation reagent, Roche).
28 Supplemental References Davie, S.A., Maglione, J.E., Manner, C.K., Young, D., Cardiff, R.D., MacLeod, C.L., and Ellies, L.G. (2007) Effects of FVB/NJ and C57Bl/6J strain backgrounds on mammary tumor phenotype in inducible nitric oxide synthase deficient mice. Transgenic Res. 16,193-201 (2007).
Hayakawa, M., Kaizawa, H., Kawaguchi, K., Ishikawa, N., Koizumi, T., Ohishi, T., Yamano, M., Okada, M., Ohta M., Tsukamoto, S., et al. (2006) Synthesis and biological evaluation of 4-morpholino-2-phenyl quinazolines and related derivatives as novel PI3- kinase p110 inhibitors. Bioorg. Med. Chem. 14, 6847-6858.
Jackson, S.P., Schoenwaelder, S.M., Goncalves, I., Nesbitt, W.S., Yap, C.L., Wright C.E., Kenche, V., Anderson, K.E., Dopheide, S.M., Yuan, Y., et al. (2005) PI3-kinase p110: a new target for antithrombotic therapy. Nat Med. 11, 507-514.
Schmittgen, T.D. and Livak, K.J. (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3, 1101-1108.
29