DOCSLIB.ORG

And Diagnostic Value of DCTN1, DCTN2, and DCTN4 in Colon Adenocarcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
And Diagnostic Value of DCTN1, DCTN2, and DCTN4 in Colon Adenocarcinoma Journal name: Cancer Management and Research Article Designation: Original Research Year: 2018 Volume: 10 Cancer Management and Research Dovepress Running head verso: Wang et al Running head recto: Prognostic and diagnostic value of dynactin in colon adenocarcinoma open access to scientific and medical research DOI: http://dx.doi.org/10.2147/CMAR.S183062 Open Access Full Text Article ORIGINAL RESEARCH Distinct prognostic value of dynactin subunit 4 (DCTN4) and diagnostic value of DCTN1, DCTN2, and DCTN4 in colon adenocarcinoma Shijun Wang1 Background: Colon adenocarcinoma (COAD) is ranked as the third most commonly diagnosed Qiaoqi Wang2 cancer in both women and men, and it is the most frequently occurring malignant tumor. Dynactin Xiqian Zhang3 is a protein compound based on multiple subunits, including dynactin 1–6 (DCTN1–6), in most Xiwen Liao4 categories of cytoplasmic dynein performance in eukaryotes. Nevertheless, correlations between Guixian Wang1 the DCTN family and the prognosis and diagnosis of COAD remain unidentified. Statistics for DCTN mRNA expression in patients with COAD were acquired from Long Yu5 Methods: The Cancer Genome Atlas. Kaplan–Meier analyses and a Cox regression model were applied Wei Zhang1 to determine overall survival, with computation of HRs and 95% CIs. Several online data 1 Quanbo Zhou portals were used to assess the biological process, and pathway examination was performed 1 Shengyun Hu using the Kyoto Encyclopedia of Genes and Genomes to predict the biological functionality 1 Weitang Yuan of DCTN genes. 1Department of Colorectal and Results: We found that high expression of DCTN4 was linked with satisfactory results for overall Anal Surgery, The First Affiliated survival (P=0.042, HR=0.650, 95% CI 0.429–0.985). The expression of DCTN1, DATN2, and Hospital of Zhengzhou University, Zhengzhou, Henan Province, China; DCTN4 was closely correlated with the frequency of colon tumors (P<0.001, area under the 2Department of Medical Cosmetology, curve [AUC]=0.8811, 95% CI 0.8311–0.9312; P<0.001, AUC=0.870, 96% CI 0.833–0.9071; The Second Affiliated Hospital of and P=0.0051, AUC=0.6317, 95% CI 0.5725–0.6908, respectively). In the enrichment exami- Guangxi Medical University, Nanning, Guangxi Province, China; 3Department nation, the level of gene expression was related to the cell cycle, cell apoptosis, and the cell of Radiotherapy, The First Affiliated metastasis pathway. Hospital of Zhengzhou University, The expression levels of DCTN1, DCTN2, and DCTN4 could allow differentia- Henan Province, China; 4Department Conclusion: of Hepatobiliary Surgery, The First tion between cancer-bearing tissues and paracancerous tissue. These genes can be applied as Affiliated Hospital of Guangxi Medical biomarkers to predict the prognosis and diagnosis of COAD. University, Nanning, Guangxi Province, China; 5Department of Hepatobiliary Keywords: dynactin, colon adenocarcinoma, diagnosis, prognosis, biomarker Surgery, The First Affiliated Hospital of Zhengzhou University, Henan Province, China Introduction Colon adenocarcinoma (COAD) is a type of colorectal cancer (CRC) and is the most frequently occurring malignant tumor. In USA, it is ranked as the third most frequently diagnosed tumor in both males and females.1 Moreover, in 2018, the number of new cases was predicted to be 97,220, and the predicted number of deaths was 50,630.2 Correspondence: Weitang Yuan; Shijun Wang The Surveillance, Epidemiology, and End Results Program (SEER) found that the Department of Colorectal and Anal 5-year survival rate is 64.5% (https://seer.cancer.gov). The risk factors involved in this Surgery, The First Affiliated Hospital disease are old age, male gender, increased level of fat consumption, alcohol, physical of Zhengzhou University, Zhengzhou 450002, Henan Province, China inactivity, smoking, red meat, obesity, and processed food.3,4 Treatment of CRC may Tel +86 371 6796 7141 include combinations of surgery, radiotherapy, chemotherapy, and targeted therapy.5 Email [email protected]; [email protected] Diagnostic methods include colonoscopy, which is referred to as the gold standard submit your manuscript | www.dovepress.com Cancer Management and Research 2018:10 5807–5824 5807 Dovepress © 2018 Wang et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms. php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work http://dx.doi.org/10.2147/CMAR.S183062 you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php). Wang et al Dovepress for diagnosis and can provide a highly accurate diagnosis the gene ontology (GO) functional examination and the and assess the location of the tumor5; capsule endoscopy; Kyoto Encyclopedia of Genes and Genomes (KEGG) path- computed tomography colonography; and biomarkers of way examination. The functional examination based on GO CRC such as Septin-9 (SEPT9).5–7 includes the molecular functionality (MF), biological process Dynactin is a multiple-subunit protein compound (BP), and cellular component (CC). involved in the activation of most forms of cytoplasmic A GO function analysis tool, Biological Networks Gene dynein in eukaryotes.8 Dynactin connects to cytoplasmic Ontology (BiNGO),16 was applied for predicting the func- dynein, dynein cargo adaptors, and microtubules.9 Six tionality of gene based on the results of correlation analysis. subunits of dynactin, DCTN1, DCTN2, DCTN3, DCTN4, A gene function prediction website, Gene Multiple Asso- DCTN5, and DCTN6, have been verified, and all the subunits ciation Network Integration Algorithm (GeneMANIA), was are encoded through their corresponding genes. Previous used to predict DCTN family members.17 The Search Tool research found that the DCTN family is linked with multiple for the Retrieval of Interacting Genes/Proteins (STRING) neurodegenerative diseases.10–12 Nevertheless, after biblio- database which offers a critical evaluation and combination graphic retrieval, it was found that only a few studies stated of protein–protein interactions,18 was employed for assess- the correlation between the DCTN family and the prognosis ing the functional and physical relationships of DCTN4 and and diagnosis of COAD. correlated genes, with a collective score >0.15 being taken In this research, we accessed a public database, The to indicate statistical significance. Cancer Genome Atlas (TCGA), to assess survival-related data and DCTN family expression in patients with COAD, Co-expression matrix of the DCTN family and examined the prognostic and diagnostic value of mRNA in COAD expression levels of individual DCTN genes. Several online Pearson correlation coefficient analysis was used to identify data portals were employed for analyzing the functionality correlations between DCTN family genes in COAD. Results and signaling pathways in a bid to predict the functionality with P<0.01 were considered to be statistically significant. of DCTN genes. Characteristics of gene expression levels Materials and methods We used the Metabolic gEne RApid Visualizer (MERAV) to Data preparation make boxplots of various expression levels of DCTN family Data including mRNA expression and clinical information members in primary colon cancer-bearing tissue and normal that may be linked with COAD, including gender, age, colon tissue.19 Vertical scatterplots were produced based and tumor stage, were extracted from TCGA data portal, on the DCTN gene expression. Furthermore, the high and accessed by the University of California Santa Cruz Xena low expression level groups of DCTN genes were identified (UCSC Xena: https://xena.ucsc.edu/, retrieved June 21, according to the median values of each gene. Patients with 2018). mRNA sequencing was used in 456 patients. The expression values greater than the median values of specific expression data, which include 480 cases of cancer and 42 DCTN genes were identified as the high expression group, non-cancer mRNA sequences, were used for performing and the remaining patients were identified as the low expres- expression-associated examinations. After the cases with sion group. missing medical data and 0-day survival time had been removed, a total of 438 cases were included in the survival Diagnostic prediction examination. Receiver operating characteristics (ROC) curves were drawn to identify the prognostic importance of the DCTN Functional analysis and mRNA co- family in TCGA data portal. Standardized values of expression of the DCTN family diagnosis with P<0.05 were considered to be statistically The relevant degrees of expression of the six DCTN genes significant. in multiple different tissues were created by GTEx Portal.13 The Database for Annotation, Visualization, and Integrated Survival analysis Discovery (DAVID, v.6.8)14,15 was employed to analyze the The log-rank test, together with Kaplan–Meier survival functional enrichment, which includes two terminologies, examination, was applied to calculate the P-value and overall 5808 submit your manuscript | www.dovepress.com Cancer Management and Research 2018:10 Dovepress Dovepress Prognostic and diagnostic value of dynactin in colon adenocarcinoma
Load more

Recommended publications
  • Identifying Novel Disease-Associated Variants and Understanding The
    Identifying Novel Disease-variants and Understanding the Role of the STAT1-STAT4 Locus in SLE A dissertation submitted to the Graduate School of University of Cincinnati In partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Immunology Graduate Program of the College of Medicine by Zubin H. Patel B.S., Worcester Polytechnic Institute, 2009 John B. Harley, M.D., Ph.D. Committee Chair Gurjit Khurana Hershey, M.D., Ph.D Leah C. Kottyan, Ph.D. Harinder Singh, Ph.D. Matthew T. Weirauch, Ph.D. Abstract Systemic Lupus Erythematosus (SLE) or lupus is an autoimmune disorder caused by an overactive immune system with dysregulation of both innate and adaptive immune pathways. It can affect all major organ systems and may lead to inflammation of the serosal and mucosal surfaces. The pathogenesis of lupus is driven by genetic factors, environmental factors, and gene-environment interactions. Heredity accounts for a substantial proportion of SLE risk, and the role of specific genetic risk loci has been well established. Identifying the specific causal genetic variants and the underlying molecular mechanisms has been a major area of investigation. This thesis describes efforts to develop an analytical approach to identify candidate rare variants from trio analyses and a fine-mapping analysis at the STAT1-STAT4 locus, a well-replicated SLE-risk locus. For the STAT1-STAT4 locus, subsequent functional biological studies demonstrated genotype dependent gene expression, transcription factor binding, and DNA regulatory activity. Rare variants are classified as variants across the genome with an allele-frequency less than 1% in ancestral populations.
    [Show full text]
  • Supplementary Information
    Supplementary Information PathwayMatcher: multi-omics pathway mapping and proteoform network generation Luis Francisco Hernández Sánchez1,2,3, Bram Burger4,5, Carlos Horro4,5, Antonio Fabregat3, Stefan Johansson1,2, Pål Rasmus Njølstad1,6, Harald Barsnes4,5, Henning Hermjakob3,7, and Marc Vaudel1,2,* 1 K.G. Jebsen Center for Diabetes Research, Department of Clinical Science, University of Bergen, Norway 2 Center for Medical Genetics and Molecular Medicine, Haukeland University Hospital, Bergen, Norway 3 European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Wellcome Genome Campus, Hinxton, Cambridge, United Kingdom 4 Proteomics Unit, Department of Biomedicine, University of Bergen, Bergen, Norway 5 Computational Biology Unit, Department of Informatics, University of Bergen, Bergen, Norway 6 Department of Pediatrics, Haukeland University Hospital, Bergen, Norway 7 Beijing Proteome Research Center, National Center for Protein Sciences Beijing, Beijing, China * To whom correspondence should be addressed Abstract Mapping biomedical data to functional knowledge is an essential task in biomedicine and can be achieved by querying gene or protein identifiers in pathway knowledgebases. Here, we demonstrate that including fine-granularity information such as post-translational modifications greatly increases the specificity of the analysis. We present PathwayMatcher (github.com/PathwayAnalysisPlatform/PathwayMatcher), a bioinformatic application for mapping multi-omics data to pathways and show how this enables the
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Identification of Potential Proteases for Abdominal Aortic Aneurysm by Weighted Gene Coexpression Network Analysis
    Genome Identification of potential proteases for abdominal aortic aneurysm by weighted gene coexpression network analysis Journal: Genome Manuscript ID gen-2020-0041.R1 Manuscript Type: Article Date Submitted by the 28-Jun-2020 Author: Complete List of Authors: Zhang, Hui; Peking Union Medical College Hospital, Department of Vascular Surgery Yang, Dan; Chinese Academy of Medical Sciences and Peking Union Medical College, Department of Computational Biology and Bioinformatics,Draft Institute of Medicinal Plant Development Chen, Siliang; Peking Union Medical College Hospital, Department of Vascular Surgery Li, Fangda; Peking Union Medical College Hospital, Department of Vascular Surgery Cui, Liqiang; Peking Union Medical College Hospital, Department of Vascular Surgery Liu, Zhili; Peking Union Medical College Hospital, Department of Vascular Surgery Shao, Jiang; Peking Union Medical College Hospital, Department of Vascular Surgery Chen, Yuexin; Peking Union Medical College Hospital, Department of Vascular Surgery Liu, Bao; Peking Union Medical College Hospital, Department of Vascular Surgery Zheng, Yuehong; Peking Union Medical College Hospital, Department of Vascular Surgery Abdominal aortic aneurysm, next-generation sequencing, WGCNA, Keyword: proteases, matrix metalloproteinase Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? : https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 35 Genome 1 Identification of potential proteases for abdominal aortic aneurysm by weighted gene 2 coexpression network analysis 3 Short title: WGCNA identifies crucial proteases in AAA 4 5 Hui Zhang1, Dan Yang2, Siliang Chen1, Fangda Li1, Liqiang Cui1, Zhili Liu1, Jiang Shao1, Yuexin 6 Chen1, Bao Liu1, Yuehong Zheng1. 7 1Department of Vascular Surgery, Peking Union Medical College Hospital, Beijing 100730, PR 8 China; 2Department of Computational Biology and Bioinformatics, Institute of Medicinal Plant 9 Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 10 100730, PR China.
    [Show full text]
  • Physical and Linkage Mapping of Mammary-Derived Expressed Sequence Tags in Cattle
    Genomics 83 (2004) 148–152 www.elsevier.com/locate/ygeno Physical and linkage mapping of mammary-derived expressed sequence tags in cattle E.E. Connor,a,* T.S. Sonstegard,a J.W. Keele,b G.L. Bennett,b J.L. Williams,c R. Papworth,c C.P. Van Tassell,a and M.S. Ashwella a U.S. Beltsville Agricultural Research Center, ARS, U.S. Department of Agriculture, 10300 Baltimore Avenue, Beltsville, MD 20705, USA b U.S. Meat Animal Research Center, ARS, U.S. Department of Agriculture, P.O. Box 166, Clay Center, NE 68933-0166, USA c Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, Scotland, United Kingdom Received 2 June 2003; accepted 5 July 2003 Abstract This study describes the physical and linkage mapping of 42 gene-associated markers developed from mammary gland-derived expressed sequence tags to the cattle genome. Of the markers, 25 were placed on the USDA reference linkage map and 37 were positioned on the Roslin 3000-rad radiation hybrid (RH) map, with 20 assignments shared between the maps. Although no novel regions of conserved synteny between the cattle and the human genomes were identified, the coverage was extended for bovine chromosomes 3, 7, 15, and 29 compared with previously published comparative maps between human and bovine genomes. Overall, these data improve the resolution of the human–bovine comparative maps and will assist future efforts to integrate bovine RH and linkage map data. Crown Copyright D 2003 Published by Elsevier Inc. All rights reserved. Keywords: RH mapping; Linkage mapping; SNP; Cattle; EST Selection of positional candidate genes controlling eco- pig [4,5], and cattle [6], and serve as a resource for nomically important traits in cattle requires a detailed candidate gene identification.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Biological and Prognostic Significance of Chromosome 5Q Deletions in Myeloid Malignancies Aristoteles A.N
    Review Biological and Prognostic Significance of Chromosome 5q Deletions in Myeloid Malignancies Aristoteles A.N. Giagounidis,1Ulrich Germing,2 and Carlo Aul1 Abstract The presence of del(5q), either as the sole karyotypic abnormality or as part of a more complex karyotype, has distinct clinical implications for myelodysplastic syndromes (MDS) and acute myeloid leukemia. The 5qÀ syndrome, a subtype of low-riskMDS, is characterized by an isolated 5q deletion and <5% blasts in the bone marrow and can serve as a useful model for studying the role of 5q deletions in the pathogenesis and prognosis of myeloid malignancies. Recent clinical results with lenalidomide, an oral immunomodulatory drug, have shown durable erythroid responses, including transfusion independence and complete cytogenetic remissions in patients with del(5q) MDS with or without additional chromosomal abnormalities. These results indicate that lenalidomide can overcome the pathogenic effect of 5q deletion in MDS and restore bone marrow balance. The data provide important new insights into the pathobiology of 5q chromo- somal deletions in myeloid malignancies. Cytogenetic abnormalities are detected in the bone marrow of preponderance, refractory macrocytic anemia, normal or high over 50% of patients diagnosed with primary myelodysplastic platelet counts, hypolobulated megakaryocytes, and modest syndromes (MDS) or myeloid leukemias, and up to 80% of leukopenia (11, 14, 17). The prognosis is favorable in 5qÀ patients with secondary or therapy-related MDS (1, 2). These syndrome with relatively low risk of transformation to AML abnormalities can be characterized as being balanced or (11, 18). Although the limits of 5q deletions vary among unbalanced (3, 4). Balanced cytogenetic abnormalities include patients with 5qÀ syndrome, the most frequent deletion is reciprocal translocations, inversions, and insertions (3, 5, 6).
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Mutation Analysis of Genes Within the Dynactin Complex in a Cohort of Hereditary Peripheral Neuropathies
    Clin Genet 2016: 90: 127–133 © 2015 John Wiley & Sons A/S. Printed in Singapore. All rights reserved Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12712 Original Article Mutation analysis of genes within the dynactin complex in a cohort of hereditary peripheral neuropathies a a Tey S., Ahmad-Annuar A., Drew A.P., Shahrizaila N., Nicholson G.A., S. Tey , A. Ahmad-Annuar , Kennerson M.L. Mutation analysis of genes within the dynactin complex in A.P. Drewb, N. Shahrizailac, , a cohort of hereditary peripheral neuropathies. G.A. Nicholsonb d and Clin Genet 2016: 90: 127–133. © John Wiley & Sons A/S. Published by M.L. Kennersonb,d John Wiley & Sons Ltd, 2015 aDepartment of Biomedical Science, The cytoplasmic dynein–dynactin genes are attractive candidates for Faculty of Medicine, University of Malaya, b neurodegenerative disorders given their functional role in retrograde Kuala Lumpur, Malaysia, Northcott transport along neurons. The cytoplasmic dynein heavy chain (DYNC1H1) Neuroscience Laboratory, ANZAC Research Institute, and Sydney Medical gene has been implicated in various neurodegenerative disorders, and School, University of Sydney, Sydney, dynactin 1 (DCTN1) genes have been implicated in a wide spectrum of Australia, cDepartment of Medicine, disorders including motor neuron disease, Parkinson’s disease, spinobulbar Faculty of Medicine, University of Malaya, muscular atrophy and hereditary spastic paraplegia. However, the Kuala Lumpur, Malaysia, and dMolecular involvement of other dynactin genes with inherited peripheral neuropathies Medicine Laboratory, Concord Hospital, (IPN) namely, hereditary sensory neuropathy, hereditary motor neuropathy Sydney, Australia and Charcot–Marie–Tooth disease is under reported. We screened eight genes; DCTN1-6 and ACTR1A and ACTR1B in 136 IPN patients using Key words: Charcot–Marie–Tooth – whole-exome sequencing and high-resolution melt (HRM) analysis.
    [Show full text]
  • ACTR1A (NM 005736) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG200738 ACTR1A (NM_005736) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ACTR1A (NM_005736) Human Tagged ORF Clone Tag: TurboGFP Symbol: ACTR1A Synonyms: ARP1; Arp1A; CTRN1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG200738 representing NM_005736 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCCTACGATGTGATCGCCAACCAGCCTGTCGTGATCGACAACGGATCCGGTGTGATTAAAGCTG GTTTTGCTGGTGATCAGATCCCCAAATACTGCTTTCCAAACTATGTGGGCCGACCCAAGCACGTTCGTGT CATGGCAGGAGCCCTTGAAGGCGACATCTTCATTGGCCCCAAAGCTGAGGAGCACCGAGGGCTGCTTTCA ATCCGCTATCCCATGGAGCATGGCATCGTCAAGGATTGGAACGACATGGAACGCATTTGGCAATATGTCT ATTCTAAGGACCAGCTGCAGACTTTCTCAGAGGAGCATCCTGTGCTCCTGACTGAGGCGCCTTTAAACCC ACGAAAAAACCGGGAACGAGCTGCCGAAGTTTTCTTCGAGACCTTCAATGTGCCCGCTCTTTTCATCTCC ATGCAAGCTGTACTCAGCCTTTACGCTACAGGCAGGACCACAGGGGTGGTGCTGGATTCTGGGGATGGAG TCACCCATGCTGTGCCCATCTATGAGGGCTTTGCCATGCCCCACTCCATCATGCGCATCGACATCGCGGG CCGGGACGTCTCTCGCTTCCTGCGCCTCTACCTGCGTAAGGAGGGCTACGACTTCCACTCATCCTCTGAG TTTGAGATTGTCAAGGCCATAAAAGAAAGAGCCTGTTACCTATCCATAAACCCCCAAAAGGATGAGACGC TAGAGACAGAGAAAGCTCAGTACTACCTGCCTGATGGCAGCACCATTGAGATTGGTCCTTCCCGATTCCG GGCCCCTGAGTTGCTCTTCAGGCCAGATTTGATTGGAGAGGAGAGTGAAGGCATCCACGAGGTCCTGGTG TTCGCCATTCAGAAGTCAGACATGGACCTGCGGCGCACGCTTTTCTCTAACATTGTCCTCTCAGGAGGCT
    [Show full text]
  • FARE2021WINNERS Sorted by Institute
    FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a “cytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p&lt;0.01) and positively correlated with blood viremia (p≤0.01).
    [Show full text]