University of Central Florida STARS
Electronic Theses and Dissertations, 2020-
2021
Transcriptomic Analyses Reveal Distinct Responses of Differentiated and Poorly-differentiated Intestinal Epithelial Cells to Lipid Peroxides
Nisreen Faizo University of Central Florida
Part of the Cell and Developmental Biology Commons Find similar works at: https://stars.library.ucf.edu/etd2020 University of Central Florida Libraries http://library.ucf.edu
This Doctoral Dissertation (Open Access) is brought to you for free and open access by STARS. It has been accepted for inclusion in Electronic Theses and Dissertations, 2020- by an authorized administrator of STARS. For more information, please contact [email protected].
STARS Citation Faizo, Nisreen, "Transcriptomic Analyses Reveal Distinct Responses of Differentiated and Poorly- differentiated Intestinal Epithelial Cells to Lipid Peroxides" (2021). Electronic Theses and Dissertations, 2020-. 677. https://stars.library.ucf.edu/etd2020/677 TRANSCRIPTOMIC ANALYSES REVEAL DISTINCT RESPONSES OF DIFFERENTIATED AND POORLY-DIFFERENTIATED INTESTINAL EPITHELIAL CELLS TO LIPID PEROXIDES
by
NISREEN LUTFI FAIZO B.A. Medicine and Surgery, King Abdulaziz University, 2010. M.S. Biotechnology, Florida Institute of Technology, 2017.
A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Burnett School of Biomedical Sciences in the College of Medicine at the University of Central Florida Orlando, Florida
Summer Term 2021
Major Professor: Shibu Yooseph
© 2021 Nisreen Lutfi Faizo
ii ABSTRACT
Lipid peroxides (LOOHs) abound in processed food and have been implicated in the pathology of diverse diseases including gut, cardiovascular, and cancer diseases. However, the molecular mechanisms by which LOOHs contribute to disease have not been fully characterized.
Caco-2 cells have been widely used to model human intestinal epithelium in metabolic studies.
As differentiated (Diff) and poorly-differentiated (PDiff) Caco-2 cells represent good models of human enterocytes and intestinal tumor cells, respectively, we investigated the cellular response of Diff and PDiff Caco-2 cells to the most common dietary LOOH, 13- hydroperoxyoctadecadienoic acid (13-HPODE), in terms of differential gene expression, gene ontology and pathway analysis using transcriptomic profiling. This dissertation demonstrates the work conducted on Diff and PDiff Caco-2 cells in order to understand how LOOHs might contribute to disease in the intestinal epithelium. We also compare between the responses of Diff and PDiff cells to LOOHs as Diff cells resemble mature-like enterocytes (have brush borders) and PDiff cells model intestinal cancer cells or crypt cells (lack brush borders). To characterize gene expression and pathway dysregulation upon exposure to peroxidized linoleic acid, we incubated Diff and PDiff intestinal epithelial cells (Caco-2) with 100µM of 13- hydroperoxyoctadecadienoic acid (13-HPODE), linoleic acid (LA) or hydrogen peroxide (H2O2) for 24h. Total RNA was extracted for library preparation and Illumina HiSeq sequencing.
This dissertation demonstrates that the Diff and PDiff Caco-2 cells, which differ in their phenotype, behavior and gene expression, show significant differences in their response to the most common dietary lipid peroxide, 13-HPODE, although some similarities in the enriched processes of both cell types were observed. Both cell types showed enrichment of PPAR iii signaling, cytochrome P450, oxidative phosphorylation and membrane transporters which support previous studies reported the effect of 13-HPODE on these processes. In addition, 13-
HPODE treatment had a significant effect on steroid hormone biosynthesis, RNA processing and ribosome biogenesis in both types of cells. On the other hand, Diff cells showed enrichment of bile conjugation upon 13-HPODE treatment which could provide a link between 13-HPODE’s detergent activity and cell phenotype. The significant impact of 13-HPODE on cell cycle and
DNA replication/repair in Diff cells might indicate an effect on cellular differentiation and apoptosis. In PDiff cells, more defense mechanisms were triggered by 13-HPODE than in Diff cells. In addition to cytochrome P450, retinol metabolism and peroxisomal pathway were enriched in PDiff cells indicating a stronger defense mechanism was triggered in PDiff than Diff cells. Moreover, phospholipid biosynthesis, amino acid and glycogen metabolism enrichment in
PDiff cells, but not in Diff cells, upon 13-HPODE treatment was an indication of tumorigenic environment and malignant transformation.
This research using Caco-2 cells provides insights into the physiological changes that might occur in the intestinal epithelial cells upon exposure to 13-HPODE and the possible mechanisms by which it contributes to disease development or progression in intestinal epithelium. Our results also support that Diff and PDiff Caco-2 cells differ in their response to
13-HPODE.
iv
Dedication
To my husband, Eyad Attar, who stood by me throughout the Ph.D. process. Thank you for your
support, encouragement, understanding and for being an amazing father to our three beautiful
boys while I was busy with my studies.
To my parents, Lutfi Faizo and Seham Miski, and to my brothers and sisters, Ziyad, Ahmad,
Nahla, Hala and Hadeel. Thank you for all of your support, for loving and caring for me, and for
encouraging me to never give up.
v ACKNOWLEDGEMENTS
I would like to begin by thanking my mentor, Dr. Shibu Yooseph for all of his support, advice, encouragement, and teachings which helped me achieve my goals. Thank you for guiding me and providing me valuable feedback in order to succeed with my studies. I would also like to thank my committee members, Dr. Saleh Naser, Dr. Shadab Siddiqi, and Dr. Anna Forsman.
Thank you all for your guidance, support and thoughtful advice on my work which helped improve my research. In addition, I would like to thank Dr. Chandrakala Aluganti Narasimhulu for her contribution to different aspects of this work, and to thank Dr. Saleh Naser’s laboratory for the use of their NanoDrop spectrophotometer. I would also like to show my great appreciation to Dr. Sampath Parthasarathy, who was a wonderful committee member before he passed away in December 2020. Thank you for your continuous support, encouraging words and for the knowledge that you provided me.
I could never have made it through graduate studies without the support of my husband and the love of my family although we were thousands of miles apart. Thank you to my children
Aws, Hamza and Fadl, who despite their young age, they could understand why their mommy could not spend a lot of time with them. Thank you to my parents for your unconditional love, and for your continuous prayers and support to reach for my dreams.
vi TABLE OF CONTENTS
LIST OF FIGURES ...... ix LIST OF TABLES ...... xi LIST OF ABBREVIATIONS ...... xii CHAPTER ONE: INTRODUCTION ...... 1 Polyunsaturated Fatty Acids (PUFAs) ...... 1 Linoleic Acid (LA) ...... 2 Lipid Peroxidation ...... 4 Caco-2 Cells ...... 6 RNA sequencing ...... 7 CHAPTER TWO: LITERATURE REVIEW ...... 10 CHAPTER THREE: METHODOLOGY ...... 17 Caco-2 Cell Culture ...... 17 Preparation of Lipid Peroxide ...... 17 Total RNA Extraction ...... 18 Turbo DNA-free RNA Clean Up ...... 19 Library Preparation ...... 20 mRNA Magnetic Isolation ...... 20 First and Second Strand cDNA Synthesis ...... 20 Adaptor Ligation and PCR Enrichment ...... 21 DNA Library Quality Assessment ...... 21 Library Quantification ...... 22 cDNA Pooling and Hi-seq ...... 22 RNA-seq Data Processing...... 23 Differential Gene Expression ...... 23 Gene Ontology ...... 25 Pathway Enrichment Analysis ...... 26 Validation via Quantitative RT-PCR ...... 26 CHAPTER FOUR: FINDINGS ...... 29 Differentiated Caco-2 Cells ...... 32 13-HPODE-treated Cells ...... 32 LA-treated Cells ...... 38 Differential Gene Expression Between H2O2-treated and Untreated Control Cells ...... 44 Poorly-differentiated Caco-2 Cells ...... 47 vii 13-HPODE-treated Cells ...... 47 LA-treated Cells ...... 53 H2O2-treated Cells ...... 59 Validation of RNA-seq Results via qRT-PCR...... 64 Differentiated Caco-2 Cells ...... 64 Poorly-differentiated Caco-2 Cells ...... 68 CHAPTER FIVE: DISCUSSION ...... 74 Differentiated Caco-2 Cells ...... 75 Poorly-differentiated Caco-2 Cells ...... 85 CHAPTER SIX: CONCLUSIONS ...... 101 APPENDIX A: DIAGRAMS OF DYSREGULATED KEGG PATHWAYS ...... 105 APPENDIX B: TABLES OF DEGS AND ENRICHED GO TERMS ...... 126 LIST OF REFERENCES ...... 128
viii LIST OF FIGURES
Figure 1: Linoleic acid (LA) metabolic pathway...... 3 Figure 2: Lipid peroxidation process...... 5 Figure 3: RNA sequencing (RNA-seq) workflow...... 9 Figure 4: Experimental design of Caco-2 cell treatment groups used in the transcriptomic analysis...... 16 Figure 5: cDNA library quality...... 23 Figure 6: RNA-seq analysis pipeline...... 24 Figure 7: Per base quality...... 24 Figure 8: Principal component analysis (PCA)...... 30 Figure 9: Log ratio vs. mean average (MA) plots of differentially expressed genes (DEGs) between untreated and treated Caco-2 cells...... 31 Figure 10: Differential gene expression between 13-HPODE-treated Diff cells and untreated control cells...... 34 Figure 11: Gene ontology (GO) analysis in Diff Caco-2 cells treated with 13-HPODE...... 36 Figure 12: Differential gene expression between linoleic acid (LA)-treated Diff cells and untreated control cells...... 40 Figure 13: Gene ontology (GO) analysis in Diff Caco-2 cells treated with LA...... 42 Figure 14: Differential gene expression between H2O2-treated Diff cells and untreated control cells...... 46 Figure 15: Differential gene expression in 13-HPODE-treated PDiff Caco-2 cells compared to untreated cells...... 49 Figure 16: Gene ontology (GO) analysis in PDiff Caco-2 cells treated with 13-HPODE...... 52 Figure 17: Differential gene expression in LA-treated PDiff Caco-2 cells compared to untreated cells...... 55 Figure 18: Gene Ontology (GO) analysis in LA-treated PDiff Caco-2 cells...... 57 Figure 19: Differential gene expression in H2O2-treated PDiff Caco-2 cells compared to untreated cells...... 60 Figure 20: Gene Ontology (GO) analysis in H2O2-treated PDiff Caco-2 cells...... 63 Figure 21: Quantitative RT-PCR validation of RNA-seq data in 13-HPODE-treated Diff Caco-2 cells...... 67 Figure 22: Quantitative RT-PCR validation of RNA-seq data in LA- and H2O2-treated Diff Caco- 2 cells...... 68 Figure 23: Quantitative RT-PCR validation of RNA-seq data in 13-HPODE-treated PDiff Caco-2 cells...... 71 Figure 24: Quantitative RT-PCR validation of RNA-seq data in LA-treated PDiff Caco-2 cells.72 Figure 25: Quantitative RT-PCR validation of RNA-seq data in H2O2-treated PDiff Caco-2 cells...... 73 Figure A1: Dysregulated KEGG pathways in 13-HPODE-treated Diff Caco-2 cells...... 109 Figure A2: Dysregulated KEGG pathways in LA-treated Diff Caco-2 cells...... 113 Figure A3: Dysregulated KEGG pathways in 13-HPODE-treated PDiff Caco-2 cells...... 118 Figure A4: Dysregulated KEGG pathways in LA-treated PDiff Caco-2 cells...... 121 ix Figure A5: Dysregulated KEGG pathways in H2O2-treated PDiff Caco-2 cells...... 125
x LIST OF TABLES
Table 1: Polyunsaturated fatty acids (PUFAs)...... 2 Table 2: Sample data...... 25 Table 3: Primer sequences...... 27 Table 4: Pathway enrichment analysis in 13-HPODE-treated Caco-2 cells...... 38 Table 5: Pathway enrichment analysis in LA-treated Caco-2 cells...... 44 Table 6: Pathway enrichment analysis in 13-HPODE-treated PDiff Caco-2 cells...... 53 Table 7: Pathway enrichment analysis in LA-treated PDiff Caco-2 cells...... 58 Table 8: Pathway enrichment analysis in H2O2-treated PDiff Caco-2 cells...... 64 Table 9: Comparative gene expression in Diff cells...... 84 Table 10: Comparative gene expression in PDiff cells...... 99
xi LIST OF ABBREVIATIONS
13-HPODE …………………… 13-hydroperoxyoctadecadienoic acid 4-HNE ………………………... 4-hydroxynonenal AA ……………………………. arachidonic acid ALA ………………………….. alpha-linolenic acid AMPK …………………………AMP-activated protein kinase AP-1 ………………………….. activator protein-1 ApoA1 ………………………... apolipoprotein A1 ApoB …………………………. apolipoprotein B ATCC ………………………… American Type Culture Collection bp ...…………………………… base pairs Caco-2 ………………………... colorectal adenocarcinoma CAMs ………………………… cell adhesion molecules cDNA ………………………… complementary DNA CRC ………………………….. colorectal cancer DEGs …………………………. differentially expressed genes DGLA ………………………… dihomo-gamma-linoleic acid DHA ………………………….. docosahexaenoic acid Diff …………………………… differentiated DMEM ……………………….. Dulbecco’s modified Eagle’s medium EPA …………………………... eicosapentaenoic acid FAs …………………………… fatty acids FBS …………………………… fetal bovine serum FFAs ………………………….. free fatty acids GAGE ………………………… Generally Applicable Gene-set Enrichment GLA …………………………... gamma-linoleic acid GO ……………………………. gene ontology GRCh38 ……………………… Genome Reference Consortium Human Build 38 GSH ………………………….. glutathione H2O2 ………………………….. hydrogen peroxide HAECs ……………………….. human aortic endothelial cells HODE ………………………… hydroxyoctadecadienoic acid KEGG ………………………… Kyoto Encyclopedia of Genes and Genomes LA ……………………………. linoleic acid LMB ………………………….. leucomethylene blue LOOHs ……………………….. lipid hydroperoxides MA …………………………… mean average MDA …………………………. malondialdehyde MTTP ………………………… microsomal triglyceride transfer protein NGS ………………………….. next-generation sequencing NO …………………………… nitric oxide NR2F1 ……………………….. nuclear receptor 2 family 1
xii Nrf2 ………………………….. nuclear factor erythroid 2-related factor 2 ONA …………………………. oxononanoic acid PAP ………………………….. phosphoadenosine phosphate PBS ………………………….. phosphate-buffered saline PCA …………………………. principal component analysis PDiff ………………………… poorly differentiated PPAR ………………………... peroxisome proliferator-activated receptor PUFAs ………………………. Polyunsaturated fatty acids RNA-seq …………………….. RNA sequencing ROS …………………………. reactive oxygen species SFAs ………………………… saturated fatty acids SLC …………………………. solute carrier TG …………………………… triglyceride TLR …………………………. Toll-like receptor TP …………………………… tocopherol TQ …………………………… tocopheryl quinone TQH …………………………. tocopheryl hydroquinone
xiii CHAPTER ONE: INTRODUCTION
Polyunsaturated Fatty Acids (PUFAs)
Polyunsaturated fatty acids (PUFAs) are fatty acids (FAs) that have more than one double bond in their backbone such as omega-3 and omega-6 fatty acids (Ander et al., 2003). These essential fatty acids cannot be synthesized by the human body; thus, they must be delivered with diet. They can be further classified in various groups due to their chemical structure. The position of the first double bond determines the classification of omega fatty acids (Calder &
Grimble, 2002). The two main groups of essential PUFAs are the omega-3 and omega-6 families which are known to prevent deficiency symptoms (Benatti et al., 2004) (Table 1). In omega-3
PUFAs, the first double bond occurs at the third carbon away from the terminal methyl group of the chain, while in omega-6 PUFAs, the first double bond occurs at the sixth carbon away from the terminal methyl group of the chain (Sokoła-Wysoczańska et al., 2018). The most common omega-3 fatty acids are alpha-linolenic acid (ALA), which can be obtained from nuts, seeds and vegetable oils, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), which can be obtained from fish and fish oil. Since ALA is a precursor of omega-3 PUFA group and cannot be synthesized by the human body, it must be obtained from dietary sources (Stark et al., 2008).
Omega-3 FAs are absorbed by intestinal epithelial cells then incorporated to membrane phospholipids including plasma and mitochondrial membranes. They have a role in cell membrane viscosity and possess anti-inflammatory properties which are essential for healthy aging (Swanson et al., 2012). The western diet is rich in saturated fatty acids (SFAs) and omega-
6 PUFAs, and low in omega-3 (de Lorgeril & Salen, 2012; Patterson et al., 2012). Arachidonic acid (AA), which is a well-known omega-6 PUFA that has an important role in cell membrane 1 and cellular signaling and is a precursor of inflammatory mediators, is derived from the most common dietary omega-6 PUFA, linoleic acid (LA) (Innes & Calder, 2018). The most important dietary plant sources of omega-6 PUFAs are sunflower, corn, and soybean oil, as well as nuts, including almonds and hazelnuts (Sokoła-Wysoczańska et al., 2018). Omega-6 PUFAs can also be obtained from animal sources including turkey, pork fat and butter (Meyer et al., 2003).
Table 1: Polyunsaturated fatty acids (PUFAs). The most common dietary PUFAs, their precursor, structure, sources and characteristics. Feature Omega-3 PUFAs Omega-6 PUFAs Precursor Alpha-linolenic acid (ALA) Linoleic acid (LA) Structure n-3 n-6 Sources Oily fish, green leafy veggies, Corn, sunflower, sesame, walnuts, seeds and canola oil walnut and soybean oils, nuts, pork fat and butter Characteristics Anti-inflammatory Pro-inflammatory (If too Lower risk of heart disease much consumed) Support mental health Lower risk of heart disease Support bone health Improve blood pressure Reduce liver fat Support bone health
Linoleic Acid (LA)
LA, the major essential omega-6 PUFA in most western diets, cannot be produced by the human body and needs to be obtained from diet. Once linoleic acid is ingested, it is converted in a few steps into arachidonic acid (AA; 20:4, n-6). LA metabolism involves desaturation of LA to form gamma-linoleic acid (GLA; 18:3, n-6), then elongation to form dihomo-gamma-linoleic acid (DGLA; 20:3, n-6), and desaturation to form AA which can be further metabolized to other omega-6 PUFAs (Figure 1) (Whelan, 2008). There are four main fates of LA upon intake. It can be used as a source of energy. It can be esterified to form triacylglycerols, phospholipids and
2 cholesterol esters. LA functions to preserve a certain level of cellular membrane fluidity. When
LA is released from membrane phospholipids, it might be enzymatically oxidized to a number of metabolites involved in cell signaling including 13-hydroperoxyoctadecadienoic acid (13-
HPODE) (Whelan & Fritsche, 2013).
Linoleic acid (LA)
Delta-6 desaturase
Gamma-linoleic acid (GLA)
Elongase
Dihomo-gamma linoleic acid (DGLA)
Delta-5 desaturase
Arachidonic acid (AA)
Cyclooxygenase, lipoxygenase
Eicosanoids (prostaglandins, leukotrienes, thromboxane)
Figure 1: Linoleic acid (LA) metabolic pathway. LA is converted to gamma-linoleic acid (GLA; 18:3, n-6) via delta-6 desaturase, then converted to dihomo-gamma-linoleic acid (DGLA; 20:3, n-6) via elongase. DGLA is converted to arachidonic acid (AA) via delta-5 desaturase. AA is further metabolized by cyclooxygenases and lipoxygenases to eicosanoids.
3 Lipid Peroxidation
The imbalance between free radical production and degradation rate due to impaired activity of the antioxidant defense systems results in oxidative stress. Reactive oxygen species
(ROS) represent a variety of free radicals, which are generated from molecular oxygen metabolism, including superoxide, which is a precursor of most other ROS and of non-enzymatic reactions with other free radicals such as nitric oxide (NO) and a mediator of oxidative chain reaction. Lipids including cholesterol and PUFAs are major targets of attack by oxygen radicals which results in the formation of lipid peroxidation products such as hydroperoxides (Sies,
1997). Dietary PUFAs are highly susceptible to lipid peroxidation during deep frying and overcooking which make peroxidized lipids available for human ingestion. The generation of dietary lipid hydroperoxides (LOOHs) occurs as a result of bad habits of food processing which lead to pre- or auto-oxidation of PUFAs. Peroxidation of dietary PUFAs causes deterioration of food quality and loss of nutritional value. The process of PUFA peroxidation normally consists of three major steps. The first step is initiation which includes allylic hydrogen removal by prooxidants radical generating PUFA radical. The second step is the propagation phase in which
PUFA radical reacts with oxygen forming PUFA peroxy-radical which removes a hydrogen from another PUFA molecule generating a new PUFA radical which promotes a chain reaction and
LOOH formation. A well-known LOOH is the primary lipid peroxidation product, 13- hydroperoxyoctadecadienoic acid (13-HPODE). The third step is termination in which common antioxidants such as tocopherols donate a hydrogen atom to detoxify peroxy-radicals (Ayala et al., 2014). However, 13-HPODE could be rapidly decomposed by cells into aldehydes and carboxylic acids (Bergstrom, 1945; Raghavamenon et al., 2009) including malondialdehyde
4 (MDA), 4-hydroxynonenal (4-HNE) and oxononanoic acid (ONA), which are cytotoxic and cause generation of ROS in case of impairment of antioxidant defense system (Figure 2).
Dietary PUFAs
+ Radical*
PUFA radical*
+ O2
PUFA peroxy-radical*
+ H+
Lipid hydroperoxide
Fragmentation Endoperoxide to aldehyde
Malondialdehyde (MDA)
MDA-Protein/DNA adducts
Figure 2: Lipid peroxidation process. When dietary PUFA is exposed to high temperatures, it is attacked by radicals that convert PUFA to PUFA radical which reacts with oxygen to form PUFA peroxy-radical which abstracts a hydrogen from another PUFA to generate lipid hydroperoxide (LOOH). LOOH is fragmented to produce aldehydes.
The resulting carbonyl compounds, which are frequently generated in biological systems, have properties that differ from free radicals. Due to the uncharged structure of aldehydes, they are able to move far away from the production site as they can migrate easily through
5 hydrophobic membranes and hydrophilic cytosol (Negre-Salvayre et al., 2010). Therefore, these carbonyl compounds may have more destructive effects than ROS and more damaging effects on cellular components including membranes and macromolecules such as proteins and DNA which results in non-enzymatic, damaging and irreversible modifications (Leonarduzzi et al., 2005;
Negre-Salvayre et al., 2008; Schaur, 2003). Ingested dietary LOOHs are broken down in the gut, resulting in the production of other lipid peroxidation products, such as epoxy ketones, and the release of peroxidized fatty acids that reach the enterocytes where they get absorbed
(Penumetcha et al., 2000). It has been demonstrated that dietary LOOHs from overheated oils contribute to the presence of peroxidized FAs in the lipoproteins (Staprans et al., 1993), which indicates that even though dietary LOOHs undergo a set of enzymatic digestion, peroxidized FAs reach the intestine and get absorbed. LOOHs have been implicated in various diseases including atherosclerosis (Penumetcha et al., 2000; Penumetcha et al., 2002), neurodegenerative disease
(Shichiri, 2014; Sultana et al., 2013), rheumatoid arthritis (Hitchon & El-Gabalawy, 2004), inflammatory bowel disease (Bhaskar et al., 2019; Keewan et al., 2020) and colorectal cancer
(CRC) (Skrzydlewska et al., 2001).
Caco-2 Cells
Intestinal epithelial Caco-2 cells were originated from human colorectal adenocarcinoma.
Caco-2 cells have the ability to differentiate within 14-21 days after confluence, under standard culture conditions, acquiring functional characteristics that resemble small bowel enterocytes.
These cells start to polarize as they reach confluence acquiring brush border structures with microvilli. In addition to formation of tight junctions between cells, not only they express enzyme activities such as lactase and sucrase-isomaltase which are typical of enterocytes but also 6 express markers of colonic cells (Lea, 2015). Poorly differentiated (PDiff; 4-Day post confluence) Caco-2 cells, which are cancerous and lack brush borders, are used in cancer studies because their gene expression profile resembles that of human colon cancer cells (Sääf et al.,
2007), and might also model other subpopulation cell types in the human colon (e.g. crypt cells)
(Proquin et al., 2019). Although differentiated (Diff; 14-Day post confluence) Caco-2 cells express structural and functional characteristics that resemble those of enterocytes, studies have shown variations between intestinal epithelial cell lines and in vivo intestinal epithelial cells in terms of gene expression (Bourgine et al., 2012). This difference is not unexpected as normal intestinal epithelium consists of several cell types including enterocytes, goblet cells and Paneth cells. Caco-2 cell line has been widely used in studies involving cellular uptake, transport, and metabolism of drugs and food molecules, including lipids (Hussain, 2014; Penumetcha et al.,
2000; Penumetcha et al., 2002). The results of experiments using Caco-2 cell line might not exactly reflect in vivo conditions; however, using this cell line to study lipid transport and metabolism is less challenging than using in vivo animal models (Nauli & Whittimore, 2015).
The simplicity and reproducibility of using Caco-2 cell line provide advantages as it supports inter-laboratory comparison of experimental results. Moreover, studying the effect of a food bioactive using Caco-2 cell model opens for studies of a variety of molecular mechanisms which could be more challenging to address in vivo.
RNA sequencing
High-throughput next-generation sequencing (NGS) technologies have revolutionized transcriptomic profiling. This development of transcriptomic technology offered many advantages over old technologies such as hybridization-based microarray and Sanger sequencing 7 methods that have been previously used to study gene expression. RNA sequencing (RNA-seq) has been used in the past decade for analyzing differential gene expression. RNA-Seq provides information on the cellular content of RNAs including mRNA, tRNA and rRNA, a deep profiling of gene expression and a comprehensive view of alternative splicing as well as allele-specific expression (Kukurba & Montgomery, 2015). Among the most common applications of RNA-seq are transcriptional profiling, RNA editing and SNP identification. The basic steps of RNA-seq experiment include isolation of total RNA, selection of mRNA (poly-A enrichment), synthesis of complementary DNA (cDNA), inserting indexed adaptors and preparing the library for sequencing on an NGS platform (Figure 3). Then, data processing includes read quality check, trimming of poor quality bases, mapping reads to a reference genome, counting reads mapped to a specific gene/exon and identifying differentially expressed genes. Typical bioinformatic data analysis consists of differential gene expression, gene ontology and pathway enrichment analysis. These advances in RNA-seq workflow have offered deep transcriptomic profiling and provided insights into altered physiological processes and possible resulting pathological conditions.
8 Total RNA extraction
mRNA isolation and fragmentation
cDNA synthesis
Adaptor ligation & library construction
PCR amplification and sequencing
Figure 3: RNA sequencing (RNA-seq) workflow. After total RNA extraction, mRNA is isolated then fragmented. cDNA is synthesized from the fragmented mRNA. Adaptor ligation and library construction follow. Then, libraries are amplified using PCR enrichment and sequenced using high-throughput sequencing.
Depending on the study goals, experimental details such as the use of technical and biological replicates, sequencing depth and coverage must be considered prior to conducting
RNA-Seq. Hence, researchers should design their experiments carefully, taking into consideration the generation of high-quality results within the required time and available budget.
9 CHAPTER TWO: LITERATURE REVIEW
Dietary lipids, including vegetable oils, contain different quantities of the most common dietary polyunsaturated fatty acid (PUFA), linoleic acid (LA), in the form of triglycerides, which are hydrolyzed by bile and lipases. This process releases large amounts of free fatty acids
(FFAs), often in millimolar quantities, that are absorbed by intestinal cells (Pan & Hussain,
2012). Of note, the human intestinal epithelium is exposed to different chemicals that we ingest with food; among those chemicals are lipid hydroperoxides (LOOHs). Depending on processing
(e.g. deep frying or overcooking), the ingested lipids may contain varying quantities of peroxidized PUFAs and their decomposition products (Halvorsen & Blomhoff, 2011). Oxidation of LA, the most abundant dietary PUFA in mammals and plants, results in the formation of 13- hydroperoxyoctadecadienoic acid (13-HPODE) which is rapidly decomposed by cells into toxic aldehydes and carboxylic acids (Bergstrom, 1945; Raghavamenon et al., 2009). Dietary LOOHs, which are by-products of pre- or auto-oxidation of PUFAs, are broken down in the gut, resulting in the production of other lipid peroxidation products, such as epoxy ketones, and the release of peroxidized fatty acids (FAs) that reach the enterocytes, where they get absorbed (Penumetcha et al., 2000). It has been demonstrated that dietary LOOHs from overheated oils contribute to the presence of peroxidized FAs in the lipoproteins (Staprans et al., 1993), which indicates that even though dietary LOOHs undergo a set of enzymatic digestion, peroxidized FAs reach the intestine and get absorbed.
It has been shown that the absorption of LA, the most common dietary PUFA, by differentiated (Diff; 14-Day) and poorly differentiated (PDiff; 4-Day) Caco-2 cells was comparable; while the absorption of peroxidized LA, 13-HPODE, by the fully Diff cells was
10 more efficient than PDiff Caco-2 cells (Penumetcha et al., 2000; Staprans et al., 1993). In addition, it has been demonstrated that the uptake of oxidized FAs by Diff Caco-2 cells is dependent on the presence of brush borders and is comparable to the uptake of unoxidized FAs in Diff Caco-2 cells (Penumetcha et al., 2000). Intestinal epithelial lipid transport by apolipoprotein B (ApoB) during differentiation depends on microsomal triglyceride transfer protein (MTTP) which is suppressed by nuclear receptor 2 family 1 (NR2F1) in PDiff Caco-2 cells (Dai et al., 2010). It has been demonstrated that MTTP overexpression in PDiff Caco-2 cells increases triglyceride (TG) transfer activity and cholesterol esterification indicating the essential role of MTTP in lipid absorption (Iqbal et al., 2008).
LOOHs have been implicated in various diseases including atherosclerosis (Penumetcha et al., 2000; Penumetcha et al., 2002), neurodegenerative disease (Shichiri, 2014; Sultana et al.,
2013), rheumatoid arthritis (Hitchon & El-Gabalawy, 2004), inflammatory bowel disease
(Bhaskar et al., 2019; Keewan et al., 2020) and colorectal cancer (CRC) (Skrzydlewska et al.,
2001). Moreover, lipid peroxidation products including malondialdehyde (MDA) and 4- hydroxynonenal (4-HNE) have shown to modulate gene expression and contribute to CRC
(Perše, 2013). In addition, frying oil has shown to worsen the inflammatory condition and tumorigenesis in the colon (Zhang et al., 2019). 13-hydroperoxyoctadecadienoic acid (13-
HPODE) is decomposed by cells rapidly into aldehydes, including 4-HNE and oxononanoic acid
(ONA), which are cytotoxic and cause the generation of reactive oxygen species (ROS).
Previous studies have shown that LOOHs caused oxidative stress and the loss of cellular integrity in the intestinal epithelium (Wijeratne & Cuppett, 2006). Peroxidized fat consumption has also been reported to cause pro-inflammatory changes in the intestine (Bhaskar et al., 2019;
11 Rohr et al., 2020). Iron/ascorbate mediated production of LOOH in Caco-2 cells has been shown to result in activation of NF-κB, which regulates inflammatory processes (Bernotti et al., 2003).
Dietary LOOHs have also been strongly implicated in cardiovascular (Penumetcha et al., 2000;
Staprans et al., 2005). Previous studies showed that peroxidized fat was carried in the chylomicrons (Staprãns et al., 1994), which was correlated with the peroxidized fat content in the diet (Staprans et al., 1996); these are believed to be re-packaged and distributed in the lipoproteins. The presence of peroxidized fat in the chylomicrons has been shown to increase the atherogenicity of dietary cholesterol (Khan-Merchant et al., 2002) and promote the absorption of cholesterol (Penumetcha et al., 2002).
The Caco-2 cell line, which is a human intestinal epithelial cell line that is derived from human colorectal adenocarcinoma (Stierum et al., 2003), has been widely used to study intestinal metabolism of molecules and drugs (Delie & Rubas, 1997; Sun et al., 2008). Under certain cultivation conditions, Caco-2 cells differentiate into a cell monolayer that acquires mature enterocyte-like structural and functional characteristics including absorptive features and brush borders which make it a suitable model to study lipid peroxidation (Bernotti et al., 2003; Deiana et al., 2010; Engle et al., 1998; Faizo et al., 2021; Peng & Kuo, 2003; Taha et al., 2010; Wingler et al., 2000). This cell line has been used in studies involving cellular uptake, transport, and metabolism of drugs and food molecules, including lipids (Hussain, 2014; Penumetcha et al.,
2000; Penumetcha et al., 2002). Using the Caco-2 cell line to study lipid transport and metabolism by intestinal epithelium is less challenging than using in vivo animal models (Nauli
& Whittimore, 2015). The poorly-differentiated (PDiff; 4-Day) type of Caco-2 cells mimics in vivo intestinal cancer cells and could model intestinal crypt cells, as they share the proliferative
12 phenotype and lack of microvilli cells (Sääf et al., 2007; Tadjali et al., 2002), which might be exposed to dietary LOOHs and contribute to disease. A recently published study demonstrated similar gene expression results of inflammatory cytokines between Caco-2 cells treated with 13-
HPODE and mice fed with 13-HPODE (Keewan et al., 2020), which suggests that treatment of
Caco-2 cells with 13-HPODE is a suitable model of dietary LOOH intake.
Effects of linoleic acid on cells range from production of nitric oxide (NO) and reactive oxygen species (ROS) to protection against oxidative stress (Beeharry et al., 2003; Saraswathi et al., 2004). In addition, dietary PUFAs are highly susceptible to peroxidation which has been implicated in the development of colon cancer (Perše, 2013). Moreover, oral consumption of frying oil, which is expected to contain LOOHs, in mice has shown to aggravate colon tumorigenicity (Zhang et al., 2019). Previous research has revealed that sub-cytotoxic levels of
LOOHs cause significant injury and mitogenic changes to Caco-2 cells, whereas higher concentrations of LOOHs promote cell death (Cepinskas et al., 1994; Wang et al., 2000).
LOOHs have also been suggested to induce redox imbalance and disruption of intestinal epithelial turnover (Gotoh et al., 2002). Accordingly, the response of Caco-2 cells to LOOHs depends on the amount of LOOHs to which intestinal cells are exposed. In addition, LOOHs reduced cell membrane fluidity and increased permeability in intestinal epithelial cells (Rohr et al., 2020); the latter of which is a reported effect in patients with IBD (DeMeo et al., 2002).
Changes in membrane fluidity and dynamics could affect several cellular processes (Spector &
Yorek, 1985), including lipid absorption by enterocytes and secretion into lacteals (Wang et al.,
2016). In addition, LOOHs appeared to induce DNA damage as well (Wijeratne & Cuppett,
2006). A recent study demonstrated alterations in the expression of inflammatory genes as well
13 as changes in cell viability in both Diff and PDiff Caco-2 cells when treated with peroxidized
LA, 13-HPODE (Keewan et al., 2020). Despite these studies, the effects of dietary LOOHs on intestinal epithelial Caco-2 cells and the molecular mechanisms by which LOOHs contribute to disease have not been characterized fully.
In this research, we used Caco-2 cells to investigate the effects of 13-HPODE, the most common dietary lipid peroxide, on the metabolic processes, cellular pathways, and phenotype of the intestinal epithelium. The study involved both types of Caco-2 cells, the differentiated and poorly differentiated to compare between both cell type responses. Differentiated Caco-2 cells are good model to study lipid metabolism and LOOHs as these cells have functional and structural characteristics that resemble human mature enterocytes. Poorly differentiated Caco-2 cells have been used in cancer studies because their gene expression profile resembles that of human colon cancer cells (Sääf et al., 2007), and might also reflect other subpopulation cell types in the human colon (Proquin et al., 2019) such as crypt cells which might also be exposed to dietary LOOHs. Of note, intestinal proliferative crypt cells might undergo programmed cell death, under stressful conditions, to remove damaged cells and protect from tumorigenesis
(Johnson, 2002) suggesting that crypt cells could initiate gut pathology. In addition, studying
PDiff Caco-2 cells allows us to look at a heterogeneous population of Caco-2 cells before differentiation, thus having broader plasticity in the cellular physiology and response to stress, as compared to Diff cells. We generated gene expression profiles using mRNA sequencing (RNA- seq) to gain insights into how each type of Caco-2 cells respond to 13-HPODE. We used these data to identify molecular mechanisms that may explain the contribution of lipid peroxidation to health conditions and their potential role in gut pathology. Here, we conducted mRNA
14 sequencing of Caco-2 cells treated with a specific LOOH, 13-HPODE, a lipoxidase-derived product from LA, since LA is the most abundant dietary PUFA (Whelan & Fritsche, 2013).
Bioinformatic analyses of the generated RNA-seq data provided valuable information on dysregulated genes and disrupted pathways in Caco-2 cells in response to 13-HPODE, the most common dietary LOOH. We compared our results obtained from 13-HPODE-treated cells with the transcriptomic changes of Caco-2 cells treated with LA, which represented non-peroxidized lipids. Treatment of Caco-2 cells with LA mimics the intake of vegetable oils such as soybean and canola oils and nuts as LA is the most common omega-6 PUFA in vegetable oils and in the
Western diet (Dinicolantonio & O’Keefe, 2018). In addition, comparable results were seen when intestinal culture cells were treated with pure linoleic acid or lipase-digested sesame oil (Salerno
& Smith, 1991) which suggests that treating Caco-2 cells with LA is a suitable approach to study non-peroxidized vegetable oil. We also obtained gene expression profile from cells treated with hydrogen peroxide (H2O2) which is another source of oxidative stress and similar antioxidant response between 13-HPODE and H2O2 treatments was observed in smooth muscle cells
(Meilhac et al., 2000). Figure 4 shows our experimental design of the treatment groups.
Validation of RNA-seq results was carried out using quantitative RT-PCR analysis, which showed consistent results with our RNA-seq data. The overall goal of this study was to understand how the transcriptomic profiles of Diff and PDiff Caco-2 cells change in response to the most common dietary lipid peroxide, 13-HPODE, and how the responses differ between Diff and PDiff cells. These changes in gene expression and pathway regulation could provide hypotheses by which LOOHs might be implicated in the development or progression of disease in the intestinal epithelium. In future works, these investigations could provide potential
15 therapeutic strategies to treat diseases associated with the consumption of peroxidized linoleic acid including inflammatory bowel disease, cardiovascular disease and cancer.
Caco-2 Cells
Differentiated (14-Day) Poorly-differentiated (4-Day)
Untreated 13-HPODE LA H2O2 Untreated 13-HPODE LA H2O2
Figure 4: Experimental design of Caco-2 cell treatment groups used in the transcriptomic analysis. Four groups of treatment were prepared for differentiated and poorly-differentiated Caco-2 cells: control (untreated), 13-hydroperoxyoctadecadienoic acid-treated (13-HPODE), linoleic acid-treated (LA) and hydrogen peroxide-treated (H2O2). Experiments were run in triplicate.
16 CHAPTER THREE: METHODOLOGY
Caco-2 Cell Culture
Caco-2 cells were purchased from American Type Culture Collection (ATCC)
(Rockville, MD, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM;
Invitrogen, Carlsbad, USA) supplemented with 15% fetal bovine serum (FBS; Invitrogen,
Carlsbad, USA), 2 mM L-glutamine (Invitrogen, Carlsbad, USA), and 1% penicillin- streptomycin (Invitrogen, Carlsbad, USA). After attaining confluence, cells were cultured in the same medium supplemented with 7.5% FBS and the same concentration of other constituents.
Confluent cells were trypsinized using 0.25% Trypsin-EDTA solution (Thermo Fisher Scientific,
Waltham, USA). Caco-2 cells were seeded in 6-well plates and experiments were carried out on days 4 (poorly differentiated cells; PDiff) and 14 (fully differentiated cells; Diff) after each passage. To ensure confluence on day 4, Caco-2 cells were seeded at high density.
Preparation of Lipid Peroxide
Stock solution of linoleic acid (LA) (Sigma #W338001-25G, St. Louis, USA) was prepared in ethanol, and LA (200 μM) in phosphate-buffered saline (PBS; Invitrogen, Carlsbad,
USA) was prepared for LA treatment of cells. 13-hydroperoxyoctadecadienoic acid (13-HPODE) was freshly prepared in PBS. Briefly, LA (200 μM) in PBS (pH 7.4) was oxidized with the addition of 10 U soybean lipoxygenase (Sigma #L6632-1MU), which can be easily miscible with the medium. Conjugated diene formation during oxidation was monitored by scanning the absorption between 200 nm and 300 nm using a spectrophotometer (Uvikon XL, Biotek
Instruments, El Cajon, CA, USA), using PBS as the reference. The conversion of linoleic acid 17 into its oxidized form was observed as an increase in the optical density at 234 nm. Peroxide content was determined by a leucomethylene blue (LMB) assay (Auerbach et al., 1992) using
Bio-Rad plate reader (Bio-Rad Benchmark Plus). The whole solution of the freshly prepared 13-
HPODE was filter-sterilized to reduce the risk of contamination and used for the cell culture experiments within 2 h of preparation to minimize spontaneous peroxide decomposition.
Caco-2 Cell Treatment
Poorly differentiated and fully differentiated Caco-2 cells were seeded at an initial density of 2 × 104 cells per well. Experiments were conducted on day 4 for poorly differentiated
Caco-2 cells, and on day 14 for fully differentiated cells. The differentiation of cells was determined by measuring the expression of intestinal alkaline phosphatase (ALPI). Caco-2 cells were starved in serum-free medium for three hours prior to treatments. Cells were treated with
100 µM of either 13-HPODE, LA, or H2O2 for 24 h. This concentration was used as it resulted in the significant differences between 13-HPODE-treated and untreated Caco-2 cells in our previous study (Keewan et al., 2020). Control (untreated) cells were maintained in PBS. After 24 h incubation, cells were rinsed with PBS and harvested into TRIzol for total RNA isolation. Cell culture and treatment experiments were run in triplicate.
Total RNA Extraction
Cells were lysed directly in the 6-well culture plates using TRIzol reagent (Invitrogen,
15596026). Cell lysate was transferred to new tubes and chloroform was added. The samples were vortexed and incubated at room temperature for 3 min then centrifuged at 12,400 × g for 15 min. The upper aqueous phase, containing RNA, was transferred into fresh tubes. Isopropyl 18 alcohol was added to the samples which were centrifuged for 10 min at 12,000 × g to precipitate
RNA from the aqueous phase. Total RNA was washed with ethanol at 7,500 × g for 5 min and air-dried for 2–3 min.
RNA was resuspended in RNase-free water, then sample concentration, purity, and quality were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific,
Waltham, USA). After completing the blank measurement, 1 µl of total RNA was applied onto lower measurement pedestal. Measurement surfaces were cleaned with RNase-sprayed kimwipes after measuring each sample. Results showed absorbance ratios of 1.8–2 at 260 nm and 280 nm.
RNA integrity was determined using High Sensitivity RNA ScreenTape analysis (Agilent
Technologies, Santa Clara, USA).
Turbo DNA-free RNA Clean Up
Any co-extracted DNA was removed from RNA samples using the Turbo DNA-free kit
(Invitrogen, AM1907, Carlsbad, USA). The volume of 5 µg of each total RNA sample was brought up to 30 µl with nuclease-free water. 3 µl of Turbo DNase buffer was added to the total
RNA sample followed by 1 µl Turbo DNase enzyme. Samples were incubated in a thermocycler for 30 min at 37°C. DNase inactivation reagent (3.5 µl) was added and the samples were incubated for 5 min at room temperature then centrifuged for 1.5 min at 10,000 × g. RNA supernatant was carefully transferred to fresh tubes.
19 Library Preparation
mRNA Magnetic Isolation
We isolated mRNA from total RNA samples using the NEBNext Poly(A) mRNA
Magnetic Isolation Module (New England Biolabs, E7490S, Ipswich, USA) with an approximate input of 500 ng of total RNA per sample. The sample volume was brought up to 50 µl with nuclease-free water. RNA-seq libraries were prepared from mRNA samples using the NEBNext
Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs, E7760S) according to the manufacturer’s instructions. 50 µl of Oligo dT beads was added to each sample to capture mRNA and wash away other types of RNA. Samples were incubated in the thermocycler at 65°C for 5 min.
First and Second Strand cDNA Synthesis
A mixture of 8 µl of NEBNext first strand synthesis reaction buffer, 2 µl of NEBNext random primers and 10 µl of nuclease-free water was made. 11.5 µl of the first strand synthesis reaction buffer and random primer mix was added to each sample and the samples were incubated in a thermocycler at 94°C for 15 min (Fragmentation step) to achieve a target fragment size of 200 base pairs (bp). First strand cDNA was synthesized by adding 8 µl of NEBNext strand specificity reagent and 2 µl of first strand synthesis enzyme mix to each fragmented mRNA sample. The samples were incubated in a thermocycler for 10 min at 25°C, 15 min at
42°C and 15 min at 70°C. Then on ice, 8 µl of NEBNext second strand synthesis reaction buffer with dUTP Mix, 4 µl of second strand synthesis enzyme mix and 48 µl of nuclease-free water were added to each sample and the samples were incubated in a thermocycler at 16 C for 1 h.
20 NEBNext sample purification beads were used to remove unincorporated primers. 7 µl of
NEBNext ultra II end prep reaction buffer and 3 µl of end prep enzyme mix to each sample, then samples were incubated in a thermocycler at 20°C for 30 min and at 65°C for 30 min.
Adaptor Ligation and PCR Enrichment
Indexed adaptors for Illumina sequencing (New England Biolabs, E7710, E7730) were ligated to libraries through 8 cycles of PCR. 2.5 µl of diluted adaptor, 1 µl of ligation enhancer and 30 µl of ligation master mix were added to each end prepped DNA sample. The samples were incubated in a thermocycler at 20°C for 15 min. Then, 3 µl of USER enzyme was added to the samples which were incubated a thermocycler at 37°C for 15 min. NEBNext sample purification beads were used to remove unincorporated adaptors. 25 µl of NEBNext ultra II Q5 master mix, 5 µl of universal primer and 5 µl of index primer were added to each sample.
Samples were incubated in a thermocycler for 30 sec at 98°C (initial denaturation), 10 sec at
98°C (denaturation), 75 sec at 65°C (annealing/extension), and 5 min at 65°C (final extension); the reaction was set up for 8 cycles. PCR reactions were purified using NEBNext sample purification beads.
DNA Library Quality Assessment
Library quality was assessed using High Sensitivity D1000 reagents (Agilent
Technologies, 5067-5585, Santa Clara, USA) on a TapeStation 2200 instrument (Agilent
Technologies, Santa Clara, USA). To run a ladder, 2 µl of high sensitivity D1000 sample buffer was mixed with 2 µl of high sensitivity D1000 ladder. Samples were prepared by mixing 2 µl of sample buffer with 2 µl of DNA library. The ladder and samples were vortexed in IKA vortexer
21 and adaptor at 2000 rpm for 1 min then were loaded into TapeStation 2200 instrument which provides information on DNA fragment size, concentration and presence of adaptor dimers.
Library Quantification
Library concentrations were determined using the NEBNext Library Quant Kit for
Illumina (New England Biolabs, E7630S) following the manufacturer’s instructions. Three dilutions of each library were prepared: 1:1000, 1:10,000, 1:100,000. 16 µl of NEBNext library quant master mix (with primers) was mixed with 4 µl of library dilution or manufacturer- supplied DNA standards for a total reaction of 20 µl. No template control reactions were added as well by mixing 16 µl of library quant master mix with 4 µl of library dilution buffer.
Reactions were plated in duplicate on a 96-well qPCR plate. The qPCR instrument (BioRad
CFX96) was set up as 95°C for 1 min (initial denaturation), 35 cycles of 95°C for 15 sec
(denaturation), and 63°C for 45 sec (extension). The qPCR data (Cq values) and fragment size were used to calculate the concentration (nM) of each library via NEBioCalculator
(https://nebiocalculator.neb.com/#!/qPCRlibQnt).
cDNA Pooling and Hi-seq
Concentration data were used to ensure equimolar pooling across libraries for multiplexing. The final library pool was checked for quality using the High Sensitivity D1000
ScreenTape assay, which showed good quality with a maximum peak at 337 bp, which matches the acceptable size range of 250-350 bp (Figure 5). Then, library pool was sent to GENEWIZ
(South Plainfield, NJ, USA) for sequencing (HiSeq4000 2 × 150 bp).
22
Figure 5: cDNA library quality. Using the TapeStation, cDNA library pool showed good quality (no adaptor dimers) with a maximum peak at 337 bp.
RNA-seq Data Processing
Differential Gene Expression
The number of sequencing reads per library ranged between 31 and 71 million reads
(Table 2). The pipeline we used to identify differentially expressed genes (DEGs) between untreated and treated groups is shown in Figure 6. We used FastQC (version v0.11.7) to check the quality of reads (Andrews, 2010). FastQC provides information on sequence quality, GC content, adaptor content and overrepresented sequences. The quality scores across all bases were of good quality (Figure 7a). Trimmomatic (version 0.36) was used to remove adapters and poor- quality bases (Figure 7b) (Bolger et al., 2014). Hisat2 (version 2.1.0) was used to align the reads to a human reference genome (Ensembl/Genome Reference Consortium Human Build 38,
GRCh38) (Kim et al., 2015). All samples showed overall read alignment rates > 90%. Then, featureCounts (version 1.5.0) was run to count the number of fragments mapped to a specific gene/exon (Liao et al., 2014). We used DESeq2 (version 1.30.0), an R-package which uses 23 negative binomial distribution to model read counts, to identify DEGs (adjusted p < 0.05) between different groups (Love et al., 2014). Gene symbols were used from the Ensembl database. One sample of the LA-treated PDiff cell group (4D-LA3) was excluded as its differential gene expression did not correlate with the other samples (4D-LA1 and 4D-LA2).
(FastQC) (Hisat2) (DESeq2) (Trimmomatic) (featureCounts) Differentially Quality scores > Alignment rate Expressed 30 > 90% Genes
Figure 6: RNA-seq analysis pipeline. Raw sequence data quality was checked using FastQC. Trimmomatic was used to trim poor quality bases. Hisat2 was used to align reads to a human reference genome. FeatureCounts was used to identify the number of reads mapped to a specific gene. DESeq2 was used to identify differentially expressed genes.
(a) (b)
Figure 7: Per base quality. FastQC shows per base quality before (a) and after (b) trimming.
24 Table 2: Sample data. This table shows the conditions used in each cell type, sample IDs and the number of sequencing reads which ranged between 31 and 71 million reads.
Condition Caco-2 cell type Sample ID Number of reads Untreated (control) PDiff 4D-C1 34,785,840 Untreated (control) PDiff 4D-C2 40,444,280 Untreated (control) PDiff 4D-C3 42,129,973 13-HPODE-treated PDiff 4D-H1 49,634,736 13-HPODE-treated PDiff 4D-H2 39,648,563 13-HPODE-treated PDiff 4D-H3 52,271,786 LA-treated PDiff 4D-LA1 39,541,349 LA-treated PDiff 4D-LA2 58,268,069 H2O2-treated PDiff 4D-H2O2-1 60,074,373 H2O2-treated PDiff 4D-H2O2-2 36,912,824 H2O2-treated PDiff 4D-H2O2-3 31,508,599 Untreated (control) Diff 14D-C1 54,883,184 Untreated (control) Diff 14D-C2 45,618,950 Untreated (control) Diff 14D-C3 48,575,467 13-HPODE-treated Diff 14D-H1 56,539,654 13-HPODE-treated Diff 14D-H2 59,010,823 13-HPODE-treated Diff 14D-H3 60,322,610 LA-treated Diff 14D-LA1 63,964,690 LA-treated Diff 14D-LA2 51,463,437 LA-treated Diff 14D-LA3 71,490,270 H2O2-treated Diff 14D-H2O2-1 42,903,672 H2O2-treated Diff 14D-H2O2-2 50,608,699 H2O2-treated Diff 14D-H2O2-3 57,622,781
Gene Ontology
Differentially expressed genes were further evaluated to obtain gene ontology (GO) analysis using the clusterProfiler (version 3.18.0) R-package (Yu et al., 2012). Gene ontology analysis was carried out by running the enrichGO function on the list of DEGs (adjusted p <
0.05) from DESeq2 results in the treated cell groups to identify enriched GO terms including biological processes, molecular functions, and cellular components.
25
Pathway Enrichment Analysis
Pathway enrichment analysis was run using Generally Applicable Gene-set Enrichment
(GAGE, version 2.40.0) R-package (Luo et al., 2009). Enrichment analysis was conducted by running the gage function on the list of DEGs and their log2 fold change scores. This generated a list of dysregulated pathways based on the Kyoto Encyclopedia of Genes and Genomes (KEGG), their p values, and their direction (downregulated or upregulated) upon exposure to treatment.
Validation via Quantitative RT-PCR
RNA-seq results were confirmed via qRT-PCR. Genes to be tested were selected based on differential gene expression and pathway analysis. Fourteen representative DEGs were chosen to perform qRT-PCR for 13-HPODE-treated Diff cells, eleven genes for LA-treated cells and three genes for H2O2-treated group. Eighteen genes were chosen for 13-HPODE-treated PDiff group, twelve genes for LA-treated group and eleven genes for H2O2-treated group.
SsoAdvancedTM Universal SYBR Green Supermix (BioRad, 1725271), 2.5 μM of primer
(forward and reverse each), and 0.1 ng of cDNA was used in a 10 μL PCR reaction. The protocol was set as 95 C for 30 sec (initial denaturation), and 40 cycles of 95 C for 15 sec (denaturation) and 60 C for 30 sec (annealing/extension). GAPDH was used as a housekeeping gene. Relative mRNA expression levels were determined using the ∆∆Ct method. A t-test was used to determine the statistical differences between the treated and untreated groups and the data were presented as means ± SD. Primer sequences are provided in Table 3.
26
Table 3: Primer sequences. Forward and reverse primer sequences used in the study.
Gene Forward Primer Reverse Primer CPT1A AATCATCAAGAAATGTCGCACGA AGGCAGAAGAGGTGACGATCG PLIN2 GTGAGATGGCAGAGAACGGTGTG TGCCCCTTTGGTCTTGTCCA TOMM5 CGGAACTTTCTCATCTACGTGGC ACCGTTCAGCTCAGTTCGAAGG CREB3L3 ATCTCCTGTTTGACCGGCAG GTCGTCAGAGTCGGGGTTTG PDK4 TGGAGCATTTCTCGCGCTAC ACAGGCAATTCTTGTCGCAAA ODC1 CCAAAGCAGTCTGTCGTCTCAG CAGAGATTGCCTGCACGAAGGT INSIG1 TTTTCTCAGGAGGCGTCACGGT TCCTTGCTCTCAGAATCGGTGG CEACAM6 GCCTCAATAGGACCACAGTCAC AGGGCTGCTATATCAGAGCGAC DKK1 GATCATAGCACCTTGGATGGG GGCACAGTCTGATGACCGG VIL1 GGCCAGCCAAGATGAAATTA CTCAAAGGCCTTGGTGTTGT PCK1 GCTGGTGTCCCTCTAGTCTATG GGTATTTGCCGAAGTTGTAG RGCC TCTCTGCCACTGTCACTCCTCA GATGAAAGGACCCAGAACTTCTTG DUSP4 TACTCGGCGGTCATCGTCTACG CGGAGGAAAACCTCTCATAGCC BAAT GAGGCTGCCAACTTTCTCCTGA CGTGGCTGTGACTTGCTTTAGG CYP2B6 ATGGGGCACTGAAAAAGACTGA AGAGGCGGGGACACTGAATGAC NOX1 GTACAAATTCCAGTGTGCAGACCAC CAGACTGGAATATCGGTGACAGCA CYP2C9 CAATGGATTTGCCTCTGTGCC AGGCCATCTGCTCTTCTTCAG AKR1C2 GCCGTCAAATTGGCAATAGAAG AACCTGCTCCTCATTATTGTAAAC COL7A1 GTTGGAGAGAAAGGTGACGAGG TGGTCTCCCTTTTCACCCACAG FABP1 GGAGGAATGTGAGCTGGAGACA TATGTCGCCGTTGAGTTCGGTC RPP40 CCAAGCACAGTGGTGGCAAAAG CATGGAGCTAACTTCGGTTCATC UGT2B4 CTTTAGGACTCAATACTCGGCTG CTCATAGATGCCATTGGCTCCAC GAPDH CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT HMGCS2 CGTCCCGTCTAAAGGTGTTCT CGCTAGAGATGGCTCCTCAC DDIT4 GTCGTCCACCTCCTCTTC TGTTCATCCTCAGGGTCAC RDH10 GGCATCACCTTCTGGAATGTCC CCAGCATCGTAGGAAGAAAAGCC AKR1C3 AGTAAAGCTTTGGAGGTCACA ACTCTGGTCGATGAAAAGTGG
27 Gene Forward Primer Reverse Primer PEX6 CCTTGGTGTCTGAACTCTGTGC GCAGCAACTACTGTGGTCTTCC CAT AGCTTAGCGTTCATCCGTGT TCCAATCATCCGTCAAAACA CROT CGGATACGTTTATTCAGCTTGC CCACCTCACTGCTTCAACTG TTN CTGCTGACTACACCTTTGTGGC GCTCGCTTCTTCTCCAGTACCT COX20 TCTGTTGTGGCTGGCTTTGGAC CTTCTCTGGCAATTCTTTCCTGG STX7 CGAGTAAGAGCCAGTTCCAGAG TGAATAAGACGGAGGTCATCCTC CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG GBE1 GCCTTGACTTACCTCATGTTGGC AGCACAGAGCTGGCATTCCTGA CHAC1 GTGGTGACGCTCCTTGAAGATC GAAGGTGACCTCCTTGGTATCG CEBPB AGAAGACCGTGGACAAGCACAG CTCCAGGACCTTGTGCTGCGT IL18 GATAGCCAGCCTAGAGGTATGG CCTTGATGTTATCAGGAGGATTCA GSTA4 ACAGACCCGAAGCATTCTCCAC AGTTCCAGCAGATCCAGTGTCC MVK GGAAAGTGGACCTCAGCTTACC GCTTCTCCACTTGCTCTGAGGT
28 CHAPTER FOUR: FINDINGS
We incubated Diff and PDiff Caco-2 cells with 100 µM of 13-HPODE, LA or H2O2 for
24 h. We chose this concentration as the proximal intestine is exposed to millimolar concentrations of FA and preliminary results showed little or no cytotoxicity (Penumetcha et al.,
2000; Penumetcha et al., 2002). The control (untreated) group was maintained in PBS.
Experiments were run in triplicate. Following RNA extraction, processing, and sequencing, differential gene expression and enrichment analyses were carried out. The sequencing reads ranged between 31 and 71 million reads with mean quality score > 37. Principal component analysis (PCA; Figure 8) showed that samples from each group were closely similar in gene expression with respect to treatment and that untreated and treated cell groups were well separated. Genes with large mean expression across all cell groups are likely to call for significance based on the fold change as demonstrated in log ratio vs. mean average (MA) plots
(red dots; Figure 9).
29 Diff Cells PDiff Cells
(a) (d)
(b) (e)
(c) (f)
Figure 8: Principal component analysis (PCA). PCA shows distances between untreated Diff and 13-HPODE-treated Diff (a), LA-treated Diff (b) or H2O2-treated Diff (c); and between untreated PDiff and 13-HPODE-treated PDiff (d), LA-treated PDiff (e) or H2O2-treated PDiff (f) Caco-2 samples showing similarity based on treatment and good separation between untreated and treated groups. 30
(a) (d)
(b) (e)
(c) (f)
Figure 9: Log ratio vs. mean average (MA) plots of differentially expressed genes (DEGs) between untreated and treated Caco-2 cells. MA plots show DEGs (red dots; adjusted p-value < 0.05) between untreated Caco-2 cells and 13-HPODE-treated Diff (a), LA-treated Diff (b), H2O2-treated Diff (c), 13-HPODE-treated PDiff (d), LA-treated PDiff (e) or H2O2-treated PDiff (f) Caco-2 cells. x-axis represents the mean expression across untreated and treated cell groups, y-axis represents the log2 fold change between untreated and treated groups.
31 Differentiated Caco-2 Cells
The content below was published in the following manuscript in 2021: Faizo, N.; Narasimhulu, C.A.; Forsman, A.; Yooseph, S.; Parthasarathy, S. Peroxidized Linoleic Acid, 13-HPODE, Alters Gene Expression Profile in Intestinal Epithelial Cells. Foods 2021, 10, 314. Published by MDPI.
© Faizo, N., Narasimhulu, C.A., Forsman, A., Yooseph, S., Parthasarathy, S.
13-HPODE-treated Cells
Differential Gene Expression
Using DESeq2, we identified 3094 DEGs (adjusted p < 0.05) between 13-HPODE- treated cells and untreated cells (Table A1); 1692 genes were downregulated and 1402 genes were upregulated in 13-HPODE-treated cells relative to untreated cells. Among the upregulated genes were genes involved in lipid metabolism such as PLIN2, FABP1, CPT1A, and PCK1, which are involved in PPAR signaling, which on one hand has shown to exert anti-inflammatory effects in obesity, diabetes, and cardiovascular disease (Wahli & Michalik, 2012), but on the other hand, could have both anti-proliferative and carcinogenic effects (Pazienza et al., 2012).
CPT1A and ACADVL, which are involved in mitochondrial beta-oxidation of fatty acids, and
PDK4 and PCK1, which have a role in lipid and glucose metabolism, were upregulated.
Induction of these genes may promote both fat metabolism and gluconeogenesis. Genes involved in stress response, such as CREB3L3 and NDRG1, were also induced. Although we observed reduced expression of glutathione peroxidases GPX1 and GPX7, there was upregulation of
GCLC, which is essential for glutathione (GSH) synthesis, which might indicate increased GSH contents. Reduced glutathione peroxidase activity has been linked with colon cancer (Zińczuk et al., 2019), cardiovascular disease (Espinola-Klein et al., 2007), obesity, and insulin resistance
32 (Kobayashi et al., 2009). We also observed upregulation of some nuclear factor erythroid 2- related factor 2 (Nrf2) target genes that play a role in the antioxidant defense systems such as
HMOX1, CAT, UGT2B4, and TXNRD1. Several solute carrier (SLC) transporters were upregulated, such as SLC26A3, a chloride transporter; SLC38A4, an amino acid transporter; and
SLC5A3, a myo-inositol transporter, indicating changes in substrate transport across the cell membrane. In addition, SLC transporters have been implicated in various diseases, including
IBD and metabolic diseases (Schumann et al., 2020; Wojtal et al., 2009). Other upregulated genes included COL7A1, which forms fibrils between epithelial cell basement membrane and extracellular matrix, and PDZK1, which regulates epithelial cell surface proteins and is involved in cholesterol metabolism. Among the downregulated genes were ODC1 and POLD2, which are important for polyamine synthesis and DNA replication, respectively. GPCPD1, which is involved in glycerophospholipid biosynthesis, and PTGES2, which is involved in prostaglandin
E synthesis, were also downregulated. 13-HPODE treatment also caused the reduction of NOX1, a NADPH oxidase that generates ROS, as well as DKK1, which is an inhibitor of Wnt signaling
(Stelzer et al., 2016). Figure 10 shows the top 50 DEGs in 13-HPODE-treated Caco-2 cells compared to untreated cells.
33
Figure 10: Differential gene expression between 13-HPODE-treated Diff cells and untreated control cells. Heatmap shows the top 50 differentially expressed genes (DEGs; adjusted p < 0.05) in 13-HPODE-treated Caco-2 cells (14D.H1, 14D.H2, and 14D.H3) compared to untreated control cells (14D.C1, 14D.C2, and 14D.C3). Green, upregulated; red, downregulated.
Gene Ontology
Gene ontology analysis was performed using the enrichGO function of the clusterProfiler
R-package. The results revealed the enrichment of diverse biological processes (adjusted p <
0.05) involved in translation, ribosome biogenesis, RNA processing, response to hypoxia and oxidative stress, mitochondrial translation, and gene expression. Purine nucleoside monophosphate, alcohol, and amino acid metabolic processes (Figure 11a), as well as
34 carbohydrate and lipid metabolic processes (Table A2), were also enriched due to 13-HPODE treatment.
Among the enriched molecular functions in Caco-2 cells treated with 13-HPODE were
ATPase, oxidoreductase, antioxidant, electron transfer, RNA polymerase I, and helicase activities. Additionally, coenzyme, carboxylic acid, heat shock protein, and cadherin and chaperone binding functions were enriched (Figure 11b; Table A3).
The enriched cellular components included the mitochondrial inner membrane, matrix, ribosome, and protein complex, as well as ribosomal subunits, the spliceosomal complex, focal adhesion, and the cell-substrate adherens junction (Figure 11c). The brush border and apical plasma membrane were also enriched (Table A4).
(a)
35 GO Molecular Functions
ATPase activity
monosaccharide binding
coenzyme binding
carboxylic acid binding
organic acid binding
tRNA binding
oxidoreductase activity, acting on a sulfur group of donors
RNA polymerase I activity
disulfide oxidoreductase activity
ATPase activity, coupled
DNA helicase activity
antioxidant activity
ligase activity p.adjust
catalytic activity, acting on DNA 0.002 oxidoreductase activity, acting on the CH−CH group of donors
helicase activity 0.004
catalytic activity, acting on RNA 0.006 protein C−terminus binding
cofactor transmembrane transporter activity
single−stranded DNA binding
magnesium ion binding
electron transfer activity
heat shock protein binding
cadherin binding
protein disulfide oxidoreductase activity
telomerase RNA binding
chaperone binding
oxidoreductase activity, acting on the CH−CH group of donors, NAD or NADP as acceptor
snoRNA binding
ribonucleoprotein complex binding 0 25 50 75 100
(b)
GO Cellular Components
mitochondrial matrix
mitochondrial inner membrane
mitochondrial protein complex
preribosome
nucleolar part
nuclear envelope
preribosome, large subunit precursor
U12−type spliceosomal complex
organellar large ribosomal subunit
mitochondrial large ribosomal subunit
chaperone complex
mitochondrial intermembrane space
organelle envelope lumen p.adjust
spliceosomal complex
methylosome 2e−04
organellar ribosome 4e−04 mitochondrial ribosome 6e−04 telomerase holoenzyme complex
RNA polymerase I complex
large ribosomal subunit
vesicle lumen
preribosome, small subunit precursor
focal adhesion
U2−type precatalytic spliceosome
transferase complex, transferring phosphorus−containing groups
cell−substrate junction
cytoplasmic vesicle lumen
organelle outer membrane
cell−substrate adherens junction
precatalytic spliceosome 0 50 100
(c) Figure 11: Gene ontology (GO) analysis in Diff Caco-2 cells treated with 13-HPODE. Top enriched biological processes (a), molecular functions (b) and cellular components (c) in 13- HPODE-treated Diff Caco-2 cells relative to untreated control cells (adjusted p < 0.05).
36 Pathway Enrichment Analysis
We used the gage R-package to perform pathway enrichment analysis (Table 4). Among the top upregulated KEGG pathways (p < 0.05) in 13-HPODE-treated cells, relative to untreated cells, were steroid hormone biosynthesis, bile secretion, and protein digestion and absorption.
We also observed upregulation of importantly relevant pathways such as metabolism of xenobiotics by cytochrome P450, focal adhesion, and PPAR signaling, but with slightly higher p values.
Among the downregulated pathways observed for 13-HPODE-treated cells, relative to untreated cells, were spliceosome, ribosome biogenesis, RNA transport pathways, as well as purine and pyrimidine metabolism. Oxidative stress can cause base modification and DNA damage (Marnett, 2002). Pathways of cell cycle, DNA replication, and excision repair appeared to be suppressed as well. The proteasomal pathway involved in proteolytic degradation of intracellular protein was also downregulated. The results also showed a reduction in the oxidative phosphorylation pathway. The diagrams of dysregulated KEGG pathways – generated by GAGE analysis – which highlight the upregulated and downregulated genes involved in the pathways are shown in Figure A1a-n.
37 Table 4: Pathway enrichment analysis in 13-HPODE-treated Diff Caco-2 cells. Pathway enrichment demonstrates upregulated and downregulated Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways in 13-HPODE-treated Caco-2 differentiated cells relative to untreated cells. KEGG Pathway (Upregulated) p-Value hsa00140 Steroid hormone biosynthesis 0.018 hsa04976 Bile secretion 0.029 hsa04974 Protein digestion and absorption 0.029 hsa00980 Metabolism of xenobiotics by cytochrome P450 0.062 hsa04510 Focal adhesion 0.069 hsa03320 PPAR signaling pathway 0.199 KEGG Pathway (Downregulated) p-Value hsa03040 Spliceosome 0.0001 hsa00240 Pyrimidine metabolism 0.0004 hsa03008 Ribosome biogenesis in eukaryotes 0.0005 hsa03013 RNA transport 0.002 hsa00190 Oxidative phosphorylation 0.003 hsa04110 Cell cycle 0.004 hsa00230 Purine metabolism 0.006 hsa03420 Nucleotide excision repair 0.009 hsa03020 RNA polymerase 0.009 hsa03050 Proteasome 0.014 hsa03030 DNA replication 0.018 hsa04120 Ubiquitin-mediated proteolysis 0.030 hsa03410 Base excision repair 0.031 hsa03010 Ribosome 0.034
LA-treated Cells
Differential Gene Expression
We identified 2862 DEGs (adjusted p < 0.05) in LA-treated cells compared to untreated cells (Table A5); 1179 genes were upregulated and 1683 genes were downregulated in LA- treated cells. As in 13-HPODE-treated cells, PDZK1 was induced. TTN, which has been reported as a key component of intestinal epithelial brush borders (Eilertsen et al., 1994a), was also upregulated. Among the downregulated genes in LA-treated cells were RGCC, a cell cycle regulator; CYTOR, a long non-coding RNA that enhances proliferation; and CEACAM6, which is 38 a cell adhesion molecule that promotes tumor progression. HMGCS1, involved in cholesterol biosynthesis; DDX47, involved in spliceosome and ribosomal RNA processing; EIF5A, a translation elongation factor; and ODC1 were suppressed as well. Reduction in the expression of these genes may indicate reduced cell proliferation upon LA treatment. Genes involved in the regulation of metabolic pathways were also downregulated, such as INSIG1, which regulates lipid synthesis and glucose homeostasis, and the RPIA gene, involved in carbohydrate metabolism. In addition, genes that are involved in the regulation of cellular fate and processes were suppressed, such as JUN, a transcription factor that regulates gene expression; DUSP4, dual specificity phosphatase of mitogen-activated protein kinase; and DKK1. Other downregulated genes included PI3, a peptidase inhibitor (antimicrobial); SLC2A1, a glucose transporter; and
SLC20A1, a phosphate transporter (Stelzer et al., 2016). Figure 12 illustrates the top 50 DEGs in
LA-treated Diff Caco-2 cells compared to untreated cells.
39
Figure 12: Differential gene expression between linoleic acid (LA)-treated Diff cells and untreated control cells. Heatmap shows the top 50 DEGs (adjusted p < 0.05) in LA-treated Caco-2 cells (14D.LA1, 14D.LA2, and 14D.LA3) compared to untreated control cells (14D.C1, 14D.C2, and 14D.C3). Green, upregulated; red, downregulated.
Gene Ontology
Among the enriched biological processes in LA-treated cells relative to untreated cells were ribosome biogenesis; rRNA and ncRNA processing; small molecule, amino acid, and coenzyme metabolic processes; ribonucleoprotein complex assembly; and mitochondrial translation and gene expression. In addition, the response to decreased oxygen levels, purine nucleotide biosynthesis, DNA duplex unwinding, anion transport, and carbohydrate metabolic processes were enriched in LA-treated cells (Figure 13a; Table A6).
40 Molecular functions enriched in LA-treated Diff Caco-2 cells included organic acid transmembrane transporter activity, helicase, ligase, RNA polymerase, and ATPase activities.
Moreover, ribonucleoprotein complex, cadherin, ATPase, coenzyme, organic acid, cell adhesion molecule, and RNA binding were also enriched (Figure 13b; Table A7).
Among the enriched cellular components in LA-treated cells relative to untreated cells were preribosome, and organellar and mitochondrial ribosomes. Mitochondrial outer/inner membrane and matrix, cellular and organellar outer membrane, and envelop lumen components were also enriched. In addition, complexes such as proteasome, spliceosome, and endopeptidase complexes were enriched in LA-treated cells, as well as focal adhesion and adherens junctions
(Figure 13c). The brush border and apical plasma membrane were also enriched (Table A8).
(a)
41 GO Molecular Functions
catalytic activity, acting on RNA
organic acid transmembrane transporter activity
carboxylic acid transmembrane transporter activity
helicase activity
snoRNA binding
ribonucleoprotein complex binding
cadherin binding
organic anion transmembrane transporter activity
tRNA binding
DNA helicase activity
carboxylic acid binding
organic acid binding
transferase activity, transferring pentosyl groups p.adjust
RNA helicase activity 0.004 coenzyme binding
RNA polymerase I activity 0.008
ATPase binding 0.012
5'−3' RNA polymerase activity 0.016 RNA polymerase activity
ligase activity
cell adhesion molecule binding
nucleotidyltransferase activity
magnesium ion binding
ribosomal small subunit binding
ATPase activity
catalytic activity, acting on DNA
DNA−directed 5'−3' RNA polymerase activity
amino acid transmembrane transporter activity
double−stranded RNA binding
translation factor activity, RNA binding 0 25 50 75 100
(b)
GO Cellular Components
preribosome
nucleolar part
mitochondrial inner membrane
mitochondrial matrix
mitochondrial protein complex
organelle outer membrane
outer membrane
preribosome, large subunit precursor
proteasome complex
mitochondrial outer membrane
endopeptidase complex
fibrillar center
organellar large ribosomal subunit p.adjust
mitochondrial large ribosomal subunit
organellar ribosome 1e−05
mitochondrial ribosome 2e−05 organelle envelope lumen 3e−05 large ribosomal subunit
precatalytic spliceosome
ribosomal subunit
nuclear envelope
mitochondrial intermembrane space
focal adhesion
U2−type precatalytic spliceosome
peptidase complex
cell−substrate adherens junction
cell−substrate junction
cytoplasmic exosome (RNase complex)
U12−type spliceosomal complex
spliceosomal complex 0 30 60 90 120
(c) Figure 13: Gene ontology (GO) analysis in Diff Caco-2 cells treated with LA. Top enriched biological processes (a), molecular functions (b) and cellular components (c) in LA-treated Diff Caco-2 cells relative to untreated control cells (adjusted p < 0.05).
42 Pathway Enrichment Analysis
Linoleic acid treatment of Diff Caco-2 caused upregulation of metabolic processes including retinol, xenobiotic, and drug metabolism by cytochrome P450, relative to untreated cells. The protein digestion/absorption pathway was also upregulated. In addition, adherens junction and focal adhesion pathways were upregulated which might suggest promoted cellular differentiation.
Among the pathways downregulated in LA-treated cells, relative to untreated cells, were ribosome biogenesis, spliceosome, RNA transport, and RNA polymerase pathways. As in 13-
HPODE-treated cells, purine and pyrimidine metabolism, oxidative phosphorylation, proteasome, cell cycle, and excision repair pathways were also suppressed in LA-treated cells.
Toll-like receptor signaling, which activates innate immunity, was downregulated (Table 5). The diagrams of dysregulated pathways and related genes are shown in Figure A2a-o.
43 Table 5: Pathway enrichment analysis in LA-treated Diff Caco-2 cells. Pathway enrichment demonstrates upregulated and downregulated KEGG pathways in LA-treated Caco-2 differentiated cells relative to untreated cells. KEGG Pathway (Upregulated) p-Value hsa00830 Retinol metabolism 0.010 hsa00980 Metabolism of xenobiotics by cytochrome P450 0.017 hsa00982 Drug metabolism – cytochrome P450 0.039 hsa04974 Protein digestion and absorption 0.047 hsa04520 Adherens junction 0.056 hsa04510 Focal adhesion 0.06 KEGG Pathway (Downregulated) p-Value hsa03008 Ribosome biogenesis in eukaryotes 0.0001 hsa03040 Spliceosome 0.0004 hsa03013 RNA transport 0.0007 hsa00240 Pyrimidine metabolism 0.0009 hsa00190 Oxidative phosphorylation 0.016 hsa03020 RNA polymerase 0.017 hsa03050 Proteasome 0.020 hsa00230 Purine metabolism 0.037 hsa04110 Cell cycle 0.038 hsa03420 Nucleotide excision repair 0.043 hsa04620 Toll-like receptor signaling pathway 0.045
Differential Gene Expression Between H2O2-treated and Untreated Control Cells
We identified 145 DEGs between H2O2-treated differentiated Caco-2 cells and untreated cells; the top 50 DEGs are shown in Figure 14 (For full list, please refer to Table A9). DDIT4 and DDIT3, which are pro-apoptotic DNA damage inducible transcripts involved in stress response, were upregulated in H2O2-treated cells. Both genes were also upregulated in 13-
HPODE-treated cells. NFAT5, which is a transcription factor activated during osmotic stress
(Stelzer et al., 2016), and DKK1were downregulated in H2O2-treated cells relative to untreated cells. SPINK1, a serine protease inhibitor which may have a role in regulation of redox homeostasis (Guo et al., 2019), and genes that exhibit antioxidant activity including PRDX2 and
GSTP1 were induced (Stelzer et al., 2016). Regulators of cytoskeleton such as ROCK2, MKLN1, 44 FGD6, and BRWD3 were also downregulated in H2O2-treated cells as compared to untreated cells. Disruption of actin cytoskeleton upon treatment of cells with H2O2 has been previously reported (RAO et al., 2002). RIF1 and SMCHD1 involved in DNA repair were also downregulated. In addition, multiple solute carrier transporters were suppressed including
SLC38A2, amino acid transporter, SLC20A1, phosphate transporter, and SLC5A3, myo-inositol transporter. Regulators of cell cycle and cell growth, CDK and RICTOR, respectively, were reduced as well as CHD1 involved in chromatin modification and AGO2 involved in RNA interference (Stelzer et al., 2016). These data indicate H2O2-induced alteration of cellular response could be either protective or detrimental.
45
Figure 14: Differential gene expression between H2O2-treated Diff cells and untreated control cells. Heatmap shows the top 50 DEGs (adjusted p < 0.05) in H2O2-treated Caco-2 cells (14D.h2o2.1, 14D.h2o2.2 & 14D.h2o2.3) compared to untreated control cells (14D.C1, 14D.C2 & 14D.C3). Green, upregulated; red, downregulated.
46 Poorly-differentiated Caco-2 Cells
The content below was published in the following manuscript in 2021: Faizo, N.; Narasimhulu, C.A.; Forsman, A.; Yooseph, S.; Parthasarathy, S. Effect of 13-Hydroperoxyoctadecadienoic Acid (13-HPODE) Treatment on the Transcriptomic Profile of Poorly-Differentiated Caco-2 Cells. Appl. Sci. 2021, 11, 2678. Published by MDPI.
© Faizo, N., Narasimhulu, C.A., Forsman, A., Yooseph, S., Parthasarathy, S.
13-HPODE-treated Cells
Differential Gene Expression
We identified 6,648 differentially expressed genes (DEGs; adjusted p < 0.05) between untreated and 13-HPODE-treated PDiff Caco-2 cells using DESeq2 (Table A10). 3,345 genes were upregulated and 3,303 genes were downregulated upon treating the cells with 13-HPODE.
Figure 15 demonstrated a heatmap and hierarchical clustering of the top 50 DEGs in 13-HPODE- treated cell groups.
Treating PDiff Caco-2 cells with 13-HPODE caused upregulation of genes involved in peroxisome proliferator-activated receptor (PPAR) signaling which has been implicated in metabolic syndrome and cancer (Vitale et al., 2016). Among those genes were HMGCS2, which initiates the first step of ketogenesis, CPT1A, which facilitates fatty acid uptake for mitochondrial beta-oxidation, PLIN2, which coats the surface of intracellular lipid droplets, and
FABP1, which is involved in fatty acid uptake and transport. Genes that play a role in biosynthesis of phospholipids such as CHKA and ETNK1 were upregulated indicating phospholipid metabolic alterations. Other genes involved in lipid metabolism and uptake were induced such as A1CF, a complementation factor of apolipoprotein B mRNA editing enzyme involved triglyceride uptake, CREB3L3, which is triggered by endoplasmic reticulum stress and
47 involved in acute inflammatory response and triglyceride metabolism and LRP2, which is endocytic glycoprotein receptor involved in uptake of sterols and lipoproteins. Genes involved in amino acid metabolism such as PHGDH and GPT2 were upregulated; the latter also plays a role in gluconeogenesis. These results suggest significant metabolic alterations in response to 13-
HPODE treatment.
Genes involved in the regulation of cellular processes were upregulated such as
CEBPA/PB, which inhibit proliferation, promote differentiation and mediate acute phase response (Gheorghiu et al., 2001), ADM2, which regulates cardiovascular and intestinal activities and ameliorates intestinal inflammation and protects epithelial barrier (Ashizuka et al., 2009) and
ANK3, which links integral membrane proteins to cytoskeleton and regulates cellular activities.
The latter’s expression has shown to be increased during Caco-2 polarization (Halbleib et al.,
2007). In addition, TTN, which is a key component of stress fibers and brush borders (Eilertsen et al., 1994b), was upregulated. On the other hand, CCN1/N2, CYTOR and PIM1, which promote cell proliferation, and ODC1, which is important for polyamine biosynthesis, were downregulated. Alterations of the previously mentioned genes indicate low proliferative potential and possible shift towards differentiation. Expression of DDIT4 was increased upon 13-
HPODE treatment, which inhibits mTORC1 and regulates cellular processes in response to stress. Upregulated expression of AKR1C1/C2/C3 genes, which have detoxifying activity and reduce aldehydes to alcohols, may indicate conversion of 13-HPODE to aldehydes in the cells.
IDH1, which generates NADPH which is an important cofactor in drug metabolism, antioxidant response and inhibition of ROS production, was also upregulated. Among downregulated genes were transporters of small molecules such as glucose transporters - SLC2A1/A3 - which suggest
48 altered transport of substances across biological membranes by 13-HPODE. Genes involved in inflammation such as CXCL1/L3, chemotactic factors, and CCL20, inflammatory chemokine, were downregulated which may indicate an anti-inflammatory effect of 13-HPODE.
Color Key
−1 0 1 Row Z−Score
ANKRD1 SLC20A1 SLC38A2 PIM1 GPCPD1 SCML1 CYTOR EIF5A2 AASS SAMD5 ENC1 PPFIBP1 GPRC5A EPHA2 ALPP CXCL1 SLC2A3 CCN1 DKK1 ALPG CCN2 RGCC EIF1 ODC1 SLC2A1 PRNP PREP TRIB1 PTGS2 TAF1D SAT1 EDN1 YBX3 CHKA AKR1C3 GPT2 CPT1A PLIN2 ANK3 SRC DDIT4 A1CF FURIN HSDL2 SLC1A3 ETNK1 TTN HMGCS2 PHGDH
MGAT4B
2 3 1 1 2 3
H H H C C C
......
D D D D D D
4 4 4 4 4 4
Figure 15: Differential gene expression in 13-HPODE-treated PDiff Caco-2 cells compared to untreated cells. Heatmap shows the top differentially expressed genes (DEGs; adjusted p < 0.05) in 13-HPODE-treated (4D.H1, 4D.H2 & 4D.H3) compared to untreated control cells (4D.C1, 4D.C2 & 4D.C3). Green, upregulated; red, downregulated.
Gene Ontology
Biological processes that were enriched upon 13-HPODE treatment included ribosomal biogenesis, translation, RNA processing and transport, and protein targeting. In addition, DNA
49 metabolic process, response to endoplasmic reticulum stress and response to unfolded protein were also enriched. Intrinsic apoptotic signaling pathway and response to oxidative stress were also enriched. This suggests that a significant stress was brought to the cells by 13-HPODE.
Biological processes involved in metabolism were affected as well, such as lipid catabolic process, steroid metabolic processes, regulation of carbohydrate metabolism and cellular aldehyde metabolic process. Peroxisome organization and establishment of cell polarity were also enriched (Figure 16a; Table A11).
Among molecular functions enriched in 13-HPODE-treated cells were cadherin binding, cell adhesion molecule binding, protein serine/threonine kinase activity, coenzyme binding,
GTPase binding. Also, ligase activity, ribonucleoprotein complex binding, transcription coactivator activity, protein kinase regulator activity, methyltransferase activity and helicase activity were enriched (Figure 16b; Table A12).
Among enriched cellular components in 13-HPODE-treated Caco-2 cells were focal adhesion, cell-substrate junction, cell-cell junction, spindle and cell-leading edge. Also, ribosomal subunit, nuclear envelop/membrane/speck, and spliceosomal complex were enriched.
In addition, outer membrane, organelle outer membrane, mitochondrial outer membrane, mitochondrial matrix, ubiquitin ligase complex. Brush border and peroxisome were enriched as well (Figure 16c; Table A13).
50 ribonucleoprotein complex biogenesis ncRNA metabolic process protein targeting ncRNA processing RNA catabolic process ribosome biogenesis mRNA catabolic process Count establishment of protein localization to membrane in utero embryonic development 100 response to endoplasmic reticulum stress nucleobase-containing compound transport 150 rRNA metabolic process 200 rRNA processing RNA localization nuclear-transcribed mRNA catabolic process protein targeting to membrane p.adjust viral gene expression translational initiation viral transcription 3e-10 establishment of RNA localization nucleic acid transport 6e-10 RNA transport protein localization to endoplasmic reticulum 9e-10 response to unfolded protein establishment of protein localization to endoplasmic reticulum protein targeting to ER nuclear-transcribed mRNA catabolic process, nonsense-mediated decay cotranslational protein targeting to membrane SRP-dependent cotranslational protein targeting to membrane ribosomal large subunit biogenesis 0.01 0.02 0.03 0.04 GeneRatio (a)
cell adhesion molecule binding protein serine/threonine kinase activity small GTPase binding Ras GTPase binding catalytic activity, acting on RNA cadherin binding p.adjust DNA-binding transcription factor binding nucleoside-triphosphatase regulator activity transcription coactivator activity 0.0005 coenzyme binding ubiquitin-like protein ligase binding 0.0010 ubiquitin protein ligase binding 0.0015 RNA polymerase II-specific DNA-binding transcription factor binding transferase activity, transferring one-carbon groups 0.0020 methyltransferase activity structural constituent of ribosome protein C-terminus binding Count protein kinase regulator activity Rho GTPase binding 50 helicase activity ligase activity 100 ribonucleoprotein complex binding 150 translation regulator activity single-stranded DNA binding 200 chaperone binding DNA-dependent ATPase activity DNA helicase activity protein kinase activator activity tRNA binding ligase activity, forming carbon-nitrogen bonds 0.01 0.02 0.03 0.04 GeneRatio (b)
51 nuclear envelope cell-substrate junction focal adhesion mitochondrial matrix nuclear speck cell leading edge Count spindle integral component of organelle membrane 50 nuclear membrane chromosomal region 100 ubiquitin ligase complex 150 ribosome outer membrane 200 organelle outer membrane ribosomal subunit spliceosomal complex midbody p.adjust mitochondrial outer membrane fibrillar center 5.0e-06 cytosolic ribosome large ribosomal subunit 1.0e-05 apical junction complex nuclear periphery 1.5e-05 nuclear matrix preribosome 2.0e-05 nuclear pore cytosolic large ribosomal subunit polysome polysomal ribosome preribosome, large subunit precursor 0.01 0.02 0.03 0.04 GeneRatio (c)
Figure 16: Gene ontology (GO) analysis in PDiff Caco-2 cells treated with 13-HPODE. Top enriched biological processes (a), molecular functions (b) and cellular components (c) in 13- HPODE-treated PDiff Caco-2 cells relative to untreated control cells (adjusted p < 0.05).
Pathway Enrichment Analysis
We found that treating PDiff Caco-2 cells with 13-HPODE lead to upregulation of retinol metabolism which could be a counter-regulatory defense mechanism against 13-HPODE which is considered a xenobiotic. Consistent with previous reports (Vangaveti et al., 2016), 13-HPODE induced steroid hormone biosynthesis which has a role in maintaining intestinal barrier (Boivin et al., 2007). Also, starch and sucrose metabolism as well as amino acid metabolism were upregulated. Other pathways that were enriched with slightly higher p values included PPAR signaling as well as peroxisome pathway and metabolism of xenobiotics by cytochrome P450 suggesting that 13-HPODE could trigger detoxification mechanisms. On the other hand, ribosome, RNA polymerase, spliceosome and pyrimidine metabolic pathways were suppressed due to 13-HPODE treatment. Phagosome degradation pathway was also downregulated.
52 Moreover, 13-HPODE treatment caused downregulation of oxidative phosphorylation indicating possible impaired mitochondrial function (Table 6). The dysregulated KEGG pathways and their related genes are shown in Figure A3a-m.
Table 6: Pathway enrichment analysis in 13-HPODE-treated PDiff Caco-2 cells. Pathway analysis demonstrates upregulated and downregulated Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways in 13-HPODE-treated cells relative to untreated (control) cells. KEGG Pathway (Upregulated) p-Value hsa00830 Retinol metabolism 0.002 hsa00140 Steroid hormone biosynthesis 0.005 hsa00500 Starch and sucrose metabolism 0.038 hsa00260 Glycine, serine and threonine metabolism 0.059 hsa03320 PPAR signaling pathway 0.059 hsa04146 Peroxisome 0.063 hsa00980 Metabolism of xenobiotics by cytochrome P450 0.068 KEGG Pathway (Downregulated) p-Value hsa03010 Ribosome 0.0002 hsa03040 Spliceosome 0.001 hsa00240 Pyrimidine metabolism 0.004 hsa04145 Phagosome 0.016 hsa03020 RNA polymerase 0.024 hsa03060 Protein export 0.032 hsa00190 Oxidative phosphorylation 0.036
LA-treated Cells
Differential Gene Expression
We identified 4,225 differentially expressed genes (adjusted p < 0.05) between untreated and LA-treated PDiff Caco-2 cells. 2,080 genes were upregulated and 2,145 genes were downregulated in LA-treated cells compared to untreated cells (Table A14). As in 13-HPODE- treated cells, genes involved in lipid uptake and metabolism such as FABP1 and HMGCS2 were also induced upon LA treatment. APOL6, which has a role in lipid transport in the cytosol, was also upregulated. On the contrary, other genes of lipid metabolism were downregulated including 53 MGLL, which hydrolyzes monoacylglycerol to fatty acid and glycerol, and OLR1, which promotes internalization of oxidized LDL. PCK2 involved in glucose production was upregulated as well. DDIT4 and CHAC1, which have a role in stress and unfolded protein response, were upregulated. CEBPB, which have shown to inhibit proliferation, promote differentiation and mediate acute phase response (Gheorghiu et al., 2001), and IHH, that regulates proliferation and promotes differentiation (Kosinski et al., 2010), were also upregulated. On the other hand, similar to 13-HPODE-treated cells, RGCC, CCN1/N2, PIM1, and CYTOR were downregulated in LA-treated cells which may indicate reduced proliferative potential and enhanced differentiation of PDiff cells by both treatments. While some small molecule transporters such as SLC7A11, an anionic amino acid transporter, were upregulated; others were downregulated such as SLC20A1, a sodium-phosphate symporter, suggesting altered membrane transport of substrates by LA. Reduced expression of CXCL1 and CCL20 chemotactic factors was also seen indicating anti-inflammatory effect of LA. Top 50 DEGs upon LA treatment are shown in Figure 17.
54 Color Key
−1 0 1 Row Z−Score
DMPK CHKA CEBPB TPRN CHAC1 PHGDH SRC ADM2 PCK2 IHH DDIT4 EGR1 SLC7A11 TIMP3 DUSP4 CXCL1 PTGS2 PIM1 GABARAPL1 CYTOR GPCPD1 OLR1 PI3 ALPG EPHA2 ALPP EDN1 SAT1 TM4SF1 CCL20 ANXA1 CCN1 DKK1 RGCC CCN2 SLC2A3 H1−2 PRNP SLC2A1 CRYBG2 RIMKLB AASS GPRC5A PPFIBP1 EIF5A2 SCML1 SLC38A2 TRIB1 ANKRD1
SLC20A1
1 2 1 2 3
A A
C C C
. . .
L L
. .
D D D
D D
4 4 4 4 4
Figure 17: Differential gene expression in LA-treated PDiff Caco-2 cells compared to untreated cells. Heatmap shows the top differentially expressed genes (DEGs; adjusted p < 0.05) in LA-treated (4D.LA1 & 4D.LA2) compared to untreated control cells (4D.C1, 4D.C2 & 4D.C3). Green, upregulated; red, downregulated.
Gene Ontology
Among enriched biological processes upon treating PDiff Caco-2 cells with LA were coenzyme metabolic process, regulation of catabolic process, response to insulin and autophagy.
Nucleobase-containing compound transport, ribonucleotide and nucleotide biosynthetic processes were also enriched. Similar to 13-HPODE-treated cells, we observed enrichment of response to endoplasmic reticulum stress and intrinsic apoptotic signaling pathway in LA-treated
55 cells. Furthermore, alcohol, lipid and glucose metabolic processes were enriched indicating significant impact of LA on cellular metabolism (Figure 18a; Table A15).
LA caused enrichment of molecular functions such as cadherin binding, cell adhesion molecule binding, ligase activity and GTPase binding which were also enriched upon 13-
HPODE treatment. In addition, phosphatase activity, tRNA binding, and phospholipid binding were enriched in LA-treated cells (Figure 18b; Table A16).
As in 13-HPODE-treated cells, cellular, organelle, and mitochondrial outer membranes, nuclear envelop/speck/pore, focal adhesion, cell-substrate junction, cell leading edge and spindle were among the enriched cellular components in LA-treated cells. Endoplasmic reticulum lumen, vacuolar membrane - that store nutrients or waste products - and lysosomal membrane were enriched as well as peroxisomal part (Figure 18c; Table A17).
autophagy process utilizing autophagic mechanism purine-containing compound metabolic process ribose phosphate metabolic process positive regulation of catabolic process p.adjust ribonucleotide metabolic process purine nucleotide metabolic process response to peptide hormone cofactor metabolic process 2e-06 regulation of small molecule metabolic process purine ribonucleotide metabolic process 4e-06 negative regulation of protein phosphorylation regulation of apoptotic signaling pathway regulation of protein catabolic process 6e-06 positive regulation of cellular catabolic process regulation of intracellular transport sulfur compound metabolic process Count cellular response to external stimulus 70 response to endoplasmic reticulum stress intrinsic apoptotic signaling pathway 90 macroautophagy 110 coenzyme metabolic process response to insulin 130 nucleobase-containing compound transport cellular response to nutrient levels 150 RNA localization cellular response to insulin stimulus response to topologically incorrect protein establishment of RNA localization response to starvation 0.020 0.025 0.030 0.035 0.040 GeneRatio (a)
56 cell adhesion molecule binding small GTPase binding Ras GTPase binding phospholipid binding cadherin binding phosphoric ester hydrolase activity ubiquitin-like protein ligase binding Count phosphatase activity molecular adaptor activity 50 protein-macromolecule adaptor activity 100 kinase regulator activity protein C-terminus binding 150 ligase activity Rho GTPase binding phosphoprotein phosphatase activity protein kinase regulator activity p.adjust growth factor binding catalytic activity, acting on a tRNA 0.01 single-stranded DNA binding protein N-terminus binding 0.02 protein tyrosine phosphatase activity tRNA binding 0.03 aminoacyl-tRNA ligase activity 0.04 ligase activity, forming carbon-oxygen bonds ligase activity, forming carbon-nitrogen bonds carbohydrate derivative transmembrane transporter activity nucleobase-containing compound transmembrane transporter activity neutral amino acid transmembrane transporter activity snoRNA binding Lys63-specific deubiquitinase activity 0.01 0.02 0.03 0.04 GeneRatio (b)
(c)
Figure 18: Gene Ontology (GO) analysis in LA-treated PDiff Caco-2 cells. Top enriched biological processes (a) molecular functions (b) and cellular components (c) in LA-treated cells relative to untreated (control) cells (adjusted p < 0.05).
57 Pathway Enrichment Analysis
Pathway analysis revealed that most significantly enriched pathways in LA-treated cells were downregulated. Although ribosome biogenesis was downregulated, aminoacyl-tRNA biosynthesis pathway, which is essential for protein synthesis, was marginally upregulated in
LA-treated cells. Starch and sucrose metabolism and peroxisome pathway were also upregulated, with slightly higher p values, upon treating cells with LA. On the other hand, phagosome and lysosome pathways were downregulated. In addition, spliceosome and pyrimidine metabolism were downregulated. NOD-like receptor signaling involved in immune response was also suppressed (Table 7). The dysregulated pathways upon LA treatment and related genes are shown in Figure A4a-i.
Table 7: Pathway enrichment analysis in LA-treated PDiff Caco-2 cells. Pathway analysis demonstrates upregulated and downregulated KEGG pathways in LA-treated cells relative to untreated (control) cells.
KEGG Pathway (Upregulated) p-value hsa00970 Aminoacyl-tRNA biosynthesis 0.079 hsa00500 Starch and sucrose metabolism 0.111 hsa04146 Peroxisome 0.163 KEGG Pathway (Downregulated) p-value hsa04145 Phagosome 0.005 hsa03008 Ribosome biogenesis in eukaryotes 0.012 hsa03040 Spliceosome 0.013 hsa04621 NOD-like receptor signaling pathway 0.015 hsa00240 Pyrimidine metabolism 0.018 hsa04142 Lysosome 0.021
58 H2O2-treated Cells
Differential Gene Expression
We identified 5,639 DEGs (adjusted p < 0.05) between untreated and H2O2-treated PDiff
Caco-2 cells. 2,743 genes were upregulated and 2,896 were downregulated upon treatment of cells with H2O2 (Table A18). Similar to 13-HPODE-treated cells, we observed downregulation of PIM1, CCN1/N2 and CYTOR in H2O2-treated cells suggesting reduced cellular proliferation.
SLC38A2, an amino acid transporter, SLC20A1, a phosphate transporter, and EPHA2 (ECK), which has a role in intestinal homeostasis and barrier function (Rosenberg et al., 1997), were suppressed which might suggest impairment of molecule transport and intestinal barrier upon treating the cells with H2O2. In addition, DKK1, a Wnt signaling inhibitor, DUSP6/P4, which dephosphorylate and inactivate MAP/ERK kinase, FAT1, which has a role in cell polarization, and JAG1, which is involved in notch signaling, were downregulated which may also suggest disrupted intestinal homeostasis. Tumor suppressor genes such as KLF6 and MAFF which also has a role in stress response (Simile et al., 2018), were downregulated. H2O2 may affect lipid metabolism as it induced the expression of HMGCS2, A1CF and HSDL2, which may have a role in fatty acid metabolism (Lund et al., 2018), while suppressed other genes such as PTGS2 and
OLR1. H2O2 treatment caused upregulation of antioxidant genes such as BPNT1, which has a detoxifying effect by preventing accumulation of phosphoadenosine phosphate (PAP) (Hudson
& York, 2014), CAT, which has a protective effect against H2O2, and IDH1, which is involved in
NADPH production and reduces the production of ROS (Al-Khallaf, 2017). Top 50 DEGs upon treating PDiff cells with H2O2 are shown in Figure 19.
59 Color Key
−1 0 1 Row Z−Score
P2RY6 HMGCS2 HSDL2 IDH1 SAMD5 ENC1 SLC16A1 ITGA2 JAG1 ITGA6 CCL20 KITLG CCNL1 NEAT1 PIM1 OLR1 CYTOR USP54 PPFIBP1 FAT1 EIF5A2 SLC38A2 PCAT2 MBNL2 RAB3B AMOTL2 CLIC5 ALPP CXCL1 FGFR1 PTGS2 PRSS35 ALPG CCN2 DKK1 CCN1 EPHA2 EIF1 SLC2A3 PRNP PPP1R15A MAFF UBASH3B BCL2L1 DUSP4 DUSP6 KLF6 TIMP3 TRIB1
SLC20A1
3
1
2
1
2
3
.
.
.
C
C
C
2
2
2
.
.
.
o
o
o
D
D
D
2
2
2
4
4
4
h
h
h
.
.
.
D
D
D
4 4 4
Figure 19: Differential gene expression in H2O2-treated PDiff Caco-2 cells compared to untreated cells. Heatmap shows the top differentially expressed genes (DEGs; adjusted p < 0.05) in H2O2-treated (4D.h2o2.1, 4D.h2o2.2 & 4D.h2o2.3) compared to untreated control cells (4D.C1, 4D.C2 & 4D.C3). Green, upregulated; red, downregulated.
Gene Ontology
H2O2 treatment caused enrichment of mRNA catabolic process and rRNA processing, ribosome biogenesis and translation initiation as well as processes involved in protein localization and targeting to membrane and ER, which were also enriched by 13-HPODE treatment. Consistent with previous studies (Driessens et al., 2009; Valverde et al., 2018;
Wijeratne et al., 2005), H2O2 lead to enrichment of double-strand break repair. Similar to 13-
HPODE, we also observed enrichment of apoptotic signaling pathway and response to oxidative
60 stress due to H2O2 treatment. Among other enriched biological processes were autophagy, carboxylic acid catabolic process and cholesterol biosynthetic process (Figure 20a; Table A19).
Among enriched molecular functions upon H2O2 treatment were cadherin binding, cell adhesion molecule binding and GTPase binding which was also seen in 13-HPODE treatment.
Ribonucleoprotein complex binding, RNA binding, nuclear hormone receptor binding and ubiquitin protein ligase binding were also enriched upon H2O2 treatment. Enriched activities included helicase, transcription coactivator, translation factor, protein serine/threonine kinase, and protein tyrosine phosphatase. In addition, coenzyme binding and retinoic acid receptor binding were enriched by H2O2 (Figure 20b; Table A20).
There was a relative similarity in the enriched cellular components between 13-HPODE and H2O2. Among enriched cellular components upon H2O2 treatment were focal adhesion, cell- cell junction, cell leading edge, cell cortex and ruffle. Components involved in cell division such as midbody and spindle, nuclear components such as nuclear envelope, speck, and transcription factor complex were also enriched. Other enriched components included vacuolar membrane, lysosomal membrane, mitochondrial matrix. H2O2 also caused enrichment of peroxisome, chromosome and kinetochore (Figure 20c; Table A21).
61 protein targeting ribonucleoprotein complex biogenesis negative regulation of phosphorylation RNA catabolic process mRNA catabolic process establishment of protein localization to membrane Count in utero embryonic development ncRNA processing 50 ribosome biogenesis nuclear transport 100 positive regulation of cellular protein localization 150 intrinsic apoptotic signaling pathway signal transduction by p53 class mediator 200 nuclear-transcribed mRNA catabolic process translational initiation nucleobase-containing compound transport regulation of intracellular protein transport p.adjust protein targeting to membrane rRNA metabolic process 2.5e-09 rRNA processing viral gene expression 5.0e-09 viral transcription protein localization to endoplasmic reticulum 7.5e-09 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay establishment of protein localization to endoplasmic reticulum 1.0e-08 protein targeting to ER cotranslational protein targeting to membrane SRP-dependent cotranslational protein targeting to membrane cytoplasmic translation ribosomal large subunit biogenesis 0.01 0.02 0.03 0.04 GeneRatio (a)
cell adhesion molecule binding small GTPase binding Ras GTPase binding ATPase activity protein serine/threonine kinase activity cadherin binding Count catalytic activity, acting on RNA DNA-binding transcription factor binding 50 ubiquitin-like protein ligase binding transcription coactivator activity 100 ubiquitin protein ligase binding 150 coenzyme binding RNA polymerase II-specific DNA-binding transcription factor binding 200 structural constituent of ribosome magnesium ion binding helicase activity ribonucleoprotein complex binding p.adjust translation regulator activity nuclear hormone receptor binding 0.002 single-stranded DNA binding DNA-dependent ATPase activity 0.004 protein tyrosine phosphatase activity translation factor activity, RNA binding 0.006 DNA helicase activity rRNA binding 0.008 transcription cofactor binding snoRNA binding retinoic acid receptor binding H4 histone acetyltransferase activity cadherin binding involved in cell-cell adhesion 0.01 0.02 0.03 0.04 GeneRatio (b)
62 cell-substrate junction focal adhesion mitochondrial matrix nuclear envelope cell leading edge vacuolar membrane p.adjust transcription regulator complex cell-cell junction nuclear speck lysosomal membrane 5e-06 lytic vacuole membrane spindle cell cortex 1e-05 ribosome transferase complex, transferring phosphorus-containing groups ribosomal subunit midbody Count lamellipodium cytosolic ribosome 50 ruffle RNA polymerase II transcription regulator complex 100 large ribosomal subunit 150 cytosolic large ribosomal subunit preribosome 200 polysome adherens junction small ribosomal subunit cytosolic small ribosomal subunit polysomal ribosome preribosome, large subunit precursor 0.01 0.02 0.03 0.04 GeneRatio (c)
Figure 20: Gene Ontology (GO) analysis in H2O2-treated PDiff Caco-2 cells. Top enriched biological processes (a) molecular functions (b) and cellular components (c) in H2O2-treated cells relative to untreated (control) cells (adjusted p < 0.05).
Pathway Enrichment Analysis
H2O2 treatment of PDiff Caco-2 cells lead to upregulation of steroid and steroid hormone biosynthesis. It also promoted detoxifying pathways including peroxisome and cytochrome
P450, which were also upregulated in 13-HPODE-treated cells, as well as glutathione metabolism. Consistent with a previous report that showed increased lipid uptake by ROS (Seo et al., 2019), fat digestion and absorption as well as propanoate metabolic pathways appeared to be upregulated by H2O2. Metabolism of amino acids was also affected by H2O2.
Similar to what we observed in 13-HPODE-treated cells, pathways involved in RNA processing and translation such as ribosome, RNA transport, and spliceosome were downregulated in upon treatment with H2O2. Pathways involved in cell adhesion were also downregulated including cell adhesion molecules (CAMs), adherens junction and tight junction
63 suggesting significant disruption of epithelial barrier (Table 8). Figure A5a-n shows the dysregulated KEGG pathways and the related DEGs.
Table 8: Pathway enrichment analysis in H2O2-treated PDiff Caco-2 cells. Pathway analysis demonstrates upregulated and downregulated KEGG pathways in H2O2-treated cells relative to untreated (control) cells. KEGG Pathway (Upregulated) p-value hsa00280 Valine, leucine and isoleucine degradation 0.001 hsa04975 Fat digestion and absorption 0.015 hsa00140 Steroid hormone biosynthesis 0.016 hsa04146 Peroxisome 0.020 hsa00982 Drug metabolism - cytochrome P450 0.022 hsa00100 Steroid biosynthesis 0.031 hsa00260 Glycine, serine and threonine metabolism 0.043 hsa00640 Propanoate metabolism 0.049 hsa00480 Glutathione metabolism 0.062 KEGG Pathway (Downregulated) p value hsa03010 Ribosome 0.0001 hsa04145 Phagosome 0.004 hsa03013 RNA transport 0.011 hsa03040 Spliceosome 0.018 hsa00240 Pyrimidine metabolism 0.020 hsa04514 Cell adhesion molecules (CAMs) 0.029 hsa04520 Adherens junction 0.034 hsa04530 Tight junction 0.045
Validation of RNA-seq Results via qRT-PCR
Differentiated Caco-2 Cells
RNA-seq results were verified via qRT-PCR. Fourteen representative DEGs were chosen, based on differential gene expression and pathway analysis, to perform qRT-PCR for 13-
HPODE-treated cells, eleven DEGs for LA-treated cells and three for H2O2-treated cells. Genes involved in PPAR signaling as well as mitochondrial beta oxidation, such as PLIN2, FABP1, and
CPT1A, were upregulated in 13-HPODE-treated cells relative to untreated cells (Figure 21a-c). 64 PDK4 and PCK1 genes, which play a role in the regulation of lipid and glucose metabolism, were also upregulated in 13-HPODE-treated cells suggesting enhanced gluconeogenesis in these cells relative to untreated cells (Figure 21d and 21e). CREB3L3, inflammatory response gene and
BAAT, involved in bile acid synthesis, were upregulated by 13-HPODE compared to untreated cells (Figure 21f and 21g). 13-HPODE treatment was associated with increased expression of
COL7A1, a collagen type VII alpha 1 chain, and VIL1 genes (Figure 21h and 21i), involved in focal adhesion and brush border cytoskeleton, respectively, which might indicate enhanced cell differentiation. Aldo/keto reductase AKR1C2 which is involved in steroid hormone and bile acid synthesis was induced by 13-HPODE (Figure 21j). CYP2B6 was also upregulated in 13-HPODE- treated cells (Figure 21k). 13-HPODE reduced the expression of NADPH oxidase NOX1 (Figure
21l). Other genes with reduced expression when treated with 13-HPODE treatment included
DKK1 and RPP40, which are involved in Wnt signaling and rRNA processing, respectively
(Figure 21m and 21n).
Relative expression of PCK1 and DKK1 in LA-treated cells was similar to that of 13-
HPODE-treated cells when both were compared to untreated cells (Figure 22a and 22b). In addition, CYP2C9, a cytochrome P450 mono-oxygenase, and UGT2B4, a detoxifying UDP glucuronosyltransferase, and COL7A1 were upregulated in LA-treated cells relative to untreated cells (Figure 22c-e). Reduced expression of RGCC and ODC1 could be attributable to reduced proliferative potential and enhanced differentiation (Figure 22f and 22g). LA treatment lead to downregulation of INSIG1 and TOMM5 genes which might affect metabolic processes and mitochondrial function (Figure 22h and 22i). DUSP4 as well as cell adhesion molecule
CEACAM6 was reduced in LA-treated cells as well which could be a protective response against
65 tumor progression (Figure 22j and 22k). H2O2 treatment of Caco-2 cells caused alteration of expression of DKK1, NFAT5 and DDIT4 genes (Figure 22l-n). These results are consistent with
RNA-seq data.
PLIN2 FABP1 CPT1A PDK4
2.5 * 2.5 3 6 * * 2 2 2.5 * 2 4 1.5 1.5 1.5 1 1 1 2 0.5 0.5 0.5
0 0 0 0
Relative ExpressionRelative mRNA
Relative Expression mRNA Relative Relative ExpressionRelative mRNA Relative ExpressionRelative mRNA control HPODE Control HPODE control HPODE control HPODE Treatment Treatment Treatment Treatment
(a) (b) (c) (d)
PCK1 CREB3L3 BAAT COL7A1
1.8 2.5 3 2.5 * 1.6 * 2.5 * 2 1.4 2 * 2 1.2 1.5 1.5 1 1.5 0.8 1 1 1 0.6 0.4 0.5 0.5 0.5
0.2
Relative Expression mRNA Relative Relative ExpressionRelative mRNA Relative Relative mRNA Expression 0 Relative mRNA Expression 0 0 0 control HPODE control HPODE control HPODE Control HPODE Treatment Treatment Treatment Treatment
(e) (f) (g) (h)
VIL1 AKR1C2 CYP2B6 NOX1
2 2 3.5 * 1.2 * * 3 1 1.5 1.5 2.5 0.8 2 * 1 1 0.6 1.5 0.4 0.5 0.5 1
0.5 0.2
Relative ExpressionRelative mRNA
Relative ExpressionRelative mRNA ExpressionRelative mRNA 0 0 Expression mRNA Relative 0 0 control HPODE Control HPODE control HPODE control HPODE Treatment Treatment Treatment Treatment
(i) (j) (k) (l)
66 DKK1 RPP40
1.4 1.2 1.2 1 1 0.8 * 0.8 0.6 0.6 * 0.4 0.4
0.2 0.2 Relative Expression mRNA Relative Relative ExpressionRelative mRNA 0 0 control HPODE Control HPODE Treatment Treatment
(m) (n)
Figure 21: Quantitative RT-PCR validation of RNA-seq data in 13-HPODE-treated Diff Caco-2 cells. qRT-PCR of representative DEGs from RNA-seq data. Relative mRNA expression of genes is presented in 13-HPODE-treated (HPODE) Caco-2 cells with statistical significance of *p < 0.05 compared to untreated (control) cells. Results were normalized to GAPDH.
PCK1 DKK1 CYP2C9 UGT2B4
1.6 1.4 3 2 * 1.4 * 1.2 2.5 * 1.2 1.5 1 2 1 0.8 0.8 1.5 1 0.6 * 0.6 1 0.4 0.4 0.5 0.5
0.2 0.2
Relative Expression mRNA Relative
Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA 0 0 0 0 control LA control LA control LA Control LA Treatment Treatment Treatment Treatment
(a) (b) (c) (d)
COL7A1 RGCC ODC1 INSIG1
2.5 1.2 1.4 1.2 * 1.2 2 1 1 1 0.8 0.8 1.5 0.8 0.6 * 0.6 * 1 * 0.6 0.4 0.4 0.4 0.5
0.2 0.2 0.2
Relative Relative mRNA Expression
Relative Expression mRNA Relative Relative ExpressionRelative mRNA 0 ExpressionRelative mRNA 0 0 0 Control LA control LA control LA control LA Treatment Treatment Treatment Treatment
(e) (f) (g) (h)
67 TOMM5 DUSP4 CEACAM6 DKK1
1.4 1.6 1.2 1.4 1.2 1.4 1 1.2 1 1.2 1 0.8 0.8 1 * 0.8 * * 0.8 0.6 0.6 0.6 0.6 * 0.4 0.4 0.4 0.4 0.2
0.2 0.2 0.2
Relative Expression mRNA Relative Relative ExpressionRelative mRNA ExpressionRelative mRNA 0 Relative mRNA Expression 0 0 0 control LA control LA control LA Control H2O2 Treatment Treatment Treatment Treatment
(i) (j) (k) (l)
NFAT5 DDIT4
1.2 2 1 * 1.5 0.8 * 0.6 1 0.4 0.5
0.2 Relative Expression mRNA Relative Relative ExpressionRelative mRNA 0 0 Control H2O2 Control H2O2 Treatment Treatment
(m) (n)
Figure 22: Quantitative RT-PCR validation of RNA-seq data in LA- and H2O2-treated Diff Caco-2 cells. qRT-PCR of representative DEGs from RNA-seq data. Relative mRNA expression of genes is presented in LA-treated (LA) and H2O2-treated (H2O2) Caco-2 cells with statistical significance of *p < 0.05 compared to untreated (control) cells. Results were normalized to GAPDH.
Poorly-differentiated Caco-2 Cells
To validate RNA-seq results using qRT-PCR, we selected three different sets of representative genes based on differential gene expression and pathway enrichment results in each treatment. We investigated eighteen genes in 13-HPODE-treated cells, twelve genes in LA- treated cells and eleven genes in H2O2-treated PDiff Caco-2 cells.
Genes of PPAR signaling that regulate lipid and glucose metabolism including PLIN2,
HMGCS2, CPT1A, FABP1, and PCK1 were upregulated in 13-HPODE-treated cells (Figure 23a- 68 e). We also tested key genes involved in stress response, detoxification and peroxisome such as
CREB3L3, DDIT4, RDH10, AKR1C3, PEX6, CAT and CROT which were upregulated in 13-
HPODE-treated cells (Figure 23f-l). We observed upregulation of the brush border component
TTN, and downregulation of RGCC and ODC1 indicating reduced proliferation and shift toward differentiation (Figure 23m-o). Among downregulated genes in 13-HPODE-treated cells were
COX20, STX7 and CXCL1 involved in oxidative phosphorylation, phagosome and inflammation, respectively (Figure 23p-r).
In LA-treated PDiff cells, we tested genes of lipid metabolism FABP1 and HMGCS2, glycogen branching enzyme GBE1, peroxisome-related genes PEX6 and CROT, and stress response genes DDIT4 and CHAC1, which showed increased expression due to LA treatment
(Figure 24a-g). Upregulation of CEBPB and downregulation of RGCC and DUSP4 was observed indicating altered proliferative phenotype and physiological processes (Figure 24h-j).
Inflammatory genes IL18 and CXCL1 were also downregulated upon LA treatment suggesting anti-inflammatory effect of LA on PDiff cells (Figure 24k and 24l).
In H2O2-treated PDiff cells, we tested genes of detoxification including peroxisome genes
CROT and CAT, glutathione transferase GSTA4, and aldo/keto reductase AKR1C3 which were upregulated upon H2O2 treatment (Figure 25a-d). In addition, DDIT4, involved in DNA damage stress response, was upregulated (Figure 25e). Genes of cholesterol synthesis and lipid metabolism were also upregulated due to H2O2 treatment including MVK, HMGCS2, FABP1
(Figure 25f-h). Among downregulated genes were STX7, CXCL1 and DKK1 involved in phagosome, inflammation and intestinal homeostasis, respectively (Figure 25i-k). The results of qRT-PCR were consistent with RNA-seq data.
69
PLIN2 HMGCS2 CPT1A FABP1
3.5 6 3.5 2.5 * * * 3 * 3 5 2 2.5 4 2.5 2 2 1.5 3 1.5 1.5 1 1 2 1 0.5 0.5 1 0.5
0 0 0 0
Relative ExpressionRelative mRNA
Relative Expression mRNARelative Relative ExpressionRelative mRNA Control HPODE ExpressionRelative mRNA Control HPODE Control HPODE Control HPODE Treatment Treatment Treatment Treatment
(a) (b) (c) (d)
PCK1 CREB3L3 DDIT4 RDH10
7 * 3.5 * 3 2 * * 6 3 2.5 1.5 5 2.5 2 4 2 1.5 1 3 1.5 1 2 1 0.5 1 0.5 0.5
0 0 0 0
Relative ExpressionRelative mRNA
Relative ExpressionRelative mRNA Relative Expression mRNARelative Control HPODE Control HPODE Control HPODE ExpressionRelative mRNA Control HPODE Treatment Treatment Treatment Treatment
(e) (f) (g) (h)
AKR1C3 PEX6 CAT CROT * 2 2 1.5 3 * * * 2.5 1.5 1.5 1 2 1.5 1 1 1 0.5 0.5 0.5 0.5 0
0 0 0 Control HPODE
Relative Relative ExpressionmRNA
Relative Expression mRNARelative Relative ExpressionRelative mRNA Relative ExpressionRelative mRNA Control HPODE Control HPODE Control HPODE Treatment Treatment Treatment Treatment
(i) (j) (k) (l)
70 TTN RGCC ODC1 COX20
3 1.2 1.2 1.2 2.5 * 1 1 1 2 0.8 0.8 0.8 * * 1.5 0.6 0.6 0.6 1 0.4 0.4 0.4 * 0.5 0.2 0.2 0.2
0 0 0 0
Relative Expression mRNARelative Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA Control HPODE Control HPODE Control HPODE Control HPODE Treatment Treatment Treatment Treatment
(m) (n) (o) (p)
STX7 CXCL1
1.4 1.4 1.2 1.2 1 * 1 0.8 0.8 0.6 0.6 0.4 0.4 * 0.2 0.2
0 0 Relative Relative ExpressionmRNA Relative Relative ExpressionmRNA Control HPODE Control HPODE Treatment Treatment
(q) (r)
Figure 23: Quantitative RT-PCR validation of RNA-seq data in 13-HPODE-treated PDiff Caco-2 cells. qRT-PCR of DEGs from RNA-seq data. Relative mRNA expression levels in 13- HPODE-treated (HPODE) cells are presented with statistical significance of *p < 0.05 relative to untreated (control) cells. Results were normalized to GAPDH.
71
FABP1 HMGCS2 GBE1 PEX6 3 2.5 2.5 1.5 * * * * 2.5 2 2 2 1 1.5 1.5 1.5 1 1 1 0.5 0.5 0.5 0.5
0 0 0 0
Relative Expression mRNARelative Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA Control LA Control LA Control LA Control LA Treatment Treatment Treatment Treatment
(a) (b) (c) (d)
CROT DDIT4 CHAC1 CEBPB * 2 4 * 4 * 2.5 * 1.5 3 3 2 1.5 1 2 2 1 0.5 1 1 0.5
0 0 0 0
Relative Expression mRNARelative Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA Control LA Control LA Control LA Control LA Treatment Treatment Treatment Treatment
(e) (f) (g) (h)
RGCC DUSP4 IL18 CXCL1 1.2 1.2 1.2 1.5 * 1 1 1 0.8 0.8 0.8 1 0.6 0.6 0.6 0.4 0.4 0.4 0.5 * * * 0.2 0.2 0.2
0 0 0 0
Relative Expression mRNARelative
Relative ExpressionRelative mRNA ExpressionRelative mRNA Control LA Control LA Control LA ExpressionRelative mRNA Control LA Treatment Treatment Treatment Treatment
(i) (j) (k) (l)
Figure 24: Quantitative RT-PCR validation of RNA-seq data in LA-treated PDiff Caco-2 cells. qRT-PCR of DEGs from RNA-seq data. Relative mRNA expression levels in LA-treated (LA) cells are presented with statistical significance of *p < 0.05 relative to untreated (control) cells. Results were normalized to GAPDH.
72 CROT CAT GSTA4 AKR1C3 * 3 * 2 * 2 * 2 2.5 1.5 1.5 1.5 2 1.5 1 1 1 1 0.5 0.5 0.5 0.5
0 0 0 0
Relative Expression mRNARelative Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA Control H2O2 Control H2O2 Control H2O2 Control H2O2 Treatment Treatment Treatment Treatment
(a) (b) (c) (d)
DDIT4 MVK HMGCS2 FABP1
1.5 * 2 4 2 * * * 1.5 3 1.5 1 1 2 1 0.5 0.5 1 0.5
0 0 0 0
Relative Expression mRNARelative Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA Control H2O2 Control H2O2 Control H2O2 Control H2O2 Treatment Treatment Treatment Treatment
(e) (f) (g) (h)
STX7 CXCL1 DKK1 1.5 1.5 1.5
1 * 1 1 * 0.5 0.5 0.5 *
0 0 0
Relative ExpressionRelative mRNA ExpressionRelative mRNA Relative ExpressionRelative mRNA Control H2O2 Control H2O2 Control H2O2 Treatment Treatment Treatment
(i) (j) (k)
Figure 25: Quantitative RT-PCR validation of RNA-seq data in H2O2-treated PDiff Caco-2 cells. qRT-PCR of DEGs from RNA-seq data. Relative mRNA expression levels in H2O2-treated (H2O2) cells are presented with statistical significance of *p < 0.05 relative to untreated (control) cells. Results were normalized to GAPDH.
73 CHAPTER FIVE: DISCUSSION
Linoleic acid (LA), the most common essential PUFA consumed through the human diet, is an important cellular component. It is a precursor of lipid peroxides (LOOHs) including hydroxyoctadecadienoic acid (HODE), the reduced form of 13-HPODE (Reinaud et al., 1989).
LA can be ingested in the peroxidized form when vegetable oil is overheated such as in fried food. Hence, Western diet is a major source of LOOHs, and dietary peroxides are absorbed, transported, and incorporated into lipoproteins that carry these lipids into cells and tissues.
Studies have reported both harmful and possibly beneficial effects of LOOHs. DNA damage has been observed upon treating Caco-2 cells with subcytotoxic levels of LOOHs (Gotoh et al.,
2002). Peroxidized LA has also shown to exert pro-inflammatory effects and cause cell death in both Diff and PDiff Caco-2 cells (Keewan et al., 2020). Moreover, LOOHs have been strongly linked to atherogenesis (Epstein et al., 1989; Esterbauer et al., 1992), inflammatory disease
(Sottero et al., 2018), degenerative disease (Ramana et al., 2013), aging (Spiteller, 2001), and cancer (Barrera, 2012). On the other hand, a protective effect of LOOHs that promotes apolipoprotein A1 (ApoA1) production, in Diff and PDiff Caco-2 cells, which reduces atherosclerosis has been reported (Plump et al., 1994; Rong et al., 2002). Of note, oxidized metabolites of LA are known to be ligands of PPARs, which are important for intestinal cell differentiation and play a role in lipid metabolism (Bull et al., 2003). We used transcriptomic analysis to investigate how the most common dietary LOOH, 13-HPODE, modulates the gene expression profile in Diff Caco-2 cells. Treating Diff Caco-2 cells with 13-HPODE significantly alters metabolic and signaling pathways, as well as different cellular processes. We also demonstrate that the response of Diff Caco-2 cells differs from the response of PDiff Caco-2
74 cells to 13-HPODE, which may reflect the effects of dietary LOOHs on in vivo intestinal crypt or tumor cells. Our results could provide insights into changes in the physiological processes of cells and the mechanisms by which 13-HPODE may contribute to disease. We also compare the effects of 13-HPODE on Caco-2 cells with the effects of unoxidized LA as well as H2O2, which is another source of oxidative stress.
Differentiated Caco-2 Cells
We have demonstrated that 13-HPODE increased the expression of aldo/keto reductases, such as AKR1C2, that are essential for steroid hormone synthesis. Studies have reported the ability of the intestine to synthesize steroid hormones (Cima et al., 2004; Sidler et al., 2011).
Steroid hormones have been shown in a previous study to play a role in maintaining the intestinal epithelial barrier (Boivin et al., 2007); on the other hand, they may not only cause inhibition of
T-cell response (Cima et al., 2004), but may also promote immune function (Wilckens & De
Rijk, 1997), which might contribute to inflammatory disease. It has been reported previously that oxidized LA can induce steroid hormone synthesis in rat and human adrenal cells (Bruder et al.,
2006; Bruder et al., 2003). Upregulated aldo/keto reductases might indicate that 13-HPODE could be converted to aldehydic products in intestinal epithelial cells and promote the detoxification of reactive carbonyl species and the reduction of 4-HNE, which may enhance adaptive response (Singh et al., 2015). In addition, oxidized LA metabolites have been linked to obesity and shown to induce synthesis of steroids (Vangaveti et al., 2016). Oxidized LA may possess bile acid activity and the ability to form mixed micelles with fat, which increases cholesterol solubilization and absorption (Penumetcha et al., 2002). Although bile secretion
75 occurs in the liver, our pathway analysis showed that this pathway was enriched in Caco-2 cells treated with 13-HPODE. We found that the BAAT gene, which is responsible for bile acid conjugation that enhances fat solubility, was upregulated in 13-HPODE-treated cells. This could propose another mechanism by which 13-HPODE increases lipid solubilization. A previous study demonstrated that bile secretion in response to a high-fat diet could injure the intestinal epithelium and that secondary bile acids produced by intestinal flora may induce tumor formation (Márquez-Ruiz et al., 2008); this might be studied as an indirect mechanism by which
LOOH could contribute to malignancy. On the other hand, the BAAT gene was not differentially expressed in LA-treated cells relative to untreated cells. It is also worth mentioning that both 13-
HPODE and LA treatments enhanced the expression of APOB, apolipoprotein B, which is a major component of chylomicron and LDL, along with A1CF, a complementation factor of
ApoB mRNA editing enzyme complex essential for the generation of ApoB48, which promotes dietary fat absorption (Chester, 2003).
Although upregulation of the PPAR signaling pathway upon treating cells with 13-
HPODE had a slightly higher p-value of 0.1, several downstream genes involved in fatty acid and lipid homeostasis were among the top differentially upregulated genes (adjusted p < 0.05) in
13-HPODE-treated cells relative to untreated cells. Among those were PLIN2, which forms the lipid droplet coat, and FABP1, which may promote cholesterol uptake and protect against oxidative stress caused by LOOH (Wang et al., 2015). HMGCS2, which is involved in ketogenesis and has been found to promote cellular differentiation of Caco-2 cells (Wang et al.,
2017), was also upregulated. CPT1A and PCK1 were also among the differentially upregulated genes of PPAR signaling which may indicate promoted fatty acid oxidation, as well as
76 gluconeogenesis. As oxidized LA is considered a ligand that activates PPAR signaling, which plays multiple roles ranging between metabolism, anti-inflammatory, and anti- and pro- carcinogenic effects, PPAR signaling should be considered a powerful form of crosstalk between
13-HPODE and peroxidized lipid-related diseases and should be studied further. Moreover,
CREB3L3, a transcription factor that works with PPAR훼 in an auto-loop manner (Nakagawa et al., 2016) and is involved in unfolded stress response and lipid metabolism, was upregulated in
13-HPODE-treated cells. Although we observed upregulation of several genes involved in PPAR signaling and FA oxidation, including PLIN2, PCK1, and CPT1A in LA-treated cells, the expression of these genes appeared to be higher in 13-HPODE-treated cells compared to LA- treated cells. This suggests that 13-HPODE may have a more powerful effect on PPAR signaling and FA oxidation than unoxidized LA, although both oxidized and unoxidized LA have been shown in previous studies to activate PPARs (Rong et al., 2002; Suh et al., 2008). We also observed higher expression of G6PD, required for FA and cholesterol biosynthesis, and a lower expression of atheroprotective APOH in 13-HPODE-treated cells compared to LA-treated cells, which could propose a mechanism by which LOOHs contribute to the development of cardiovascular disease.
Our results indicate that 13-HPODE may enhance detoxification by cytochrome P450 enzymes, which play a role in the metabolism of ingested drugs and toxins, and in the synthesis of steroid hormones, bile acids, and some other fats (Chang & Kam, 1999; McDonnell & Dang,
2013). Upregulated CYP1B1/2C9/2B6 may be a protective response against 13-HPODE treatment as it is considered a harmful metabolite of oxidized LA. in addition to aldo/keto reductases’ function in steroid hormone synthesis, they are also involved in xenobiotic
77 metabolism by cytochrome P450, as well as bile acid synthesis and transport (Barski et al., 2008;
Zeng et al., 2017). In the current study, we observed increases in the expression of genes involved in defense mechanisms in 13-HPODE-treated relative to LA-treated cells. Among these were CREB3L3; ABCG2, which is a xenobiotic transporter that extrudes toxins from cells; and
CYP2B6 and AKR1B1, which metabolize xenobiotics and aldehydes. Nevertheless, LA induced cytochrome P450 enzymes, including CYP2C9. Moreover, LA treatment resulted in higher expression of alcohol and aldehyde dehydrogenases ADH6 and ALDH6A1 in LA-treated cells compared to 13-HPODE-treated cells, which could indicate a protective effect of LA against lipid peroxidation products, including aldehydes. This may also suggest that LA could undergo oxidation in the intestinal cells to which the cells respond by enhancing the detoxification mechanism.
As 13-HPODE comes in contact with the cell membrane, we could expect oxidation of vitamin E (Tocopherol; TP) and the formation of tocopheryl quinone (TQ), which is anti- androgenic (Fajardo et al., 2016) and has an apoptotic effect that has been reported to inhibit colon cancer cell growth (Dolfi et al., 2013). Moreover, since we observed that 13-HPODE caused downregulation of glutathione peroxidases GPX1 and GPX7 and upregulation of the catalytic subunit of glutamate-cysteine ligase, GCLC, essential for glutathione (GSH) synthesis, the cells could accumulate GSH. The latter has previously shown to convert the tocopheroxyl radical back to TP to maintain its scavenging effect on reactive oxygen species (ROS) via oxidation of vitamin E, thus preventing further lipid oxidation and inhibiting cell proliferation
(Blokhina, 2003). TP regeneration has been also linked to thioredoxin reductase (Nordberg &
Arnér, 2001), which was upregulated in 13-HPODE-treated cells. TP has been shown to reduce
78 chemokines in human aortic endothelial cells (HAECs) (Wu et al., 1999), and has been shown to reduce expression of the chemokine CXCL1 (Morel et al., 2011). In our study, we observed downregulation of CXCL1, CXCL8 (IL-8), and CCL20 chemokines in 13-HPODE-treated cells.
It has been suggested that tocopheryl hydroquinone (TQH) is a more powerful antioxidant than
TQ (Bindoli et al., 1985; Shi et al., 1999). In our study, upregulation of cytochrome p450 oxidoreductase (POR gene) (Shi et al., 1999), which is reported to catalyze the formation of
TQH, was observed in 13-HPODE-treated cells. TQ has been shown to induce apoptosis via activation of the caspase 3 cascade and to reduce anti-apoptotic Bcl-2 (Calviello, 2003). In this context, we observed upregulation of CASP3 and a number of Bcl family members that have apoptotic activity, such as BMF, BCL2L11, and BNIP5 (this gene has not been studied yet), and downregulation of the anti-apoptotic BAG1 gene in 13-HPODE cells. This is consistent with a recently published study (Keewan et al., 2020) which demonstrated reduced cell viability on annexin V staining of Caco-2 cells treated with 100 μM 13-HPODE.
Although we did not observe expression changes in members of activator protein-1 (AP-
1) or NFE2L2 (Nrf2), we did observe upregulation of some target genes that play a role in the antioxidant defense systems, including HMOX1, CAT, UGT2B4, and TXNRD1, as well as downregulation of SOD1 in 13-HPODE-treated cells. This indicates that a degree of the antioxidant protective response was enhanced by 13-HPODE. Moreover, we observed increased expression of FOXO3 and FOXO4 transcription factors, by which 13-HPODE could modulate insulin signaling and the antioxidant response and could trigger apoptosis (Kwon et al., 2020). In addition to CAT, another FOXO-regulated gene, CDKN1A (p21), which inhibits cell proliferation in response to DNA damage, was also upregulated in 13-HPODE-treated cells.
79 13-HPODE treatment caused the downregulation of events that have been reported to be reduced during Caco-2 cell differentiation (Mariadason et al., 2002). Among the pathways downregulated due to 13-HPODE treatment were RNA transport, spliceosome, and translation machinery. In parallel with this, events of the cell cycle, DNA replication and repair, and protein degradation, including the proteasomal pathway, were also suppressed. Under culture conditions,
Caco-2 cells undergo extensive genetic reprogramming during differentiation and lose their tumorigenic phenotype (Stierum et al., 2003). This genetic reprogramming includes downregulation of genes involved in cell cycle progression, DNA replication/repair, as well as genes involved in RNA splicing/transport and protein degradation, which indicates reduced proliferation; this was reported by Mariadason et al. (Mariadason et al., 2002). Hence, downregulation of these events upon treating the cells with 13-HPODE or LA, as we observed in the current study, may suggest a further reduction in the proliferative potential and a shift towards differentiation. Among downregulated genes in both 13-HPODE-treated and LA-treated cells were POLD2, MCM7, and PCNA, which are involved in DNA replication; CDC25A, which is important for cell cycle progression; and RPP40 and EIF5A, which are involved in RNA processing and translation. On the other hand, tumor suppressor genes including APC, KLF4, and FOXO4 were upregulated in 13-HPODE-treated cells. In LA-treated cells, we observed downregulation of the proto-oncogene, JUN, and upregulation of the tumor suppressor genes
KLF7 and FOXO4. Interestingly, LA treatment caused a reduction in the expression of cell adhesion molecules CEACAM1/M5/M6, which are considered biomarkers of tumor progression
(Beauchemin & Arabzadeh, 2013); this may also indicate reduced proliferation. LOOH-derived oxidative stress can cause base modification and DNA damage (Marnett, 2002) due to the
80 formation of DNA adducts via interaction between nucleotides and malondialdehyde (MDA), hence the protective response of DNA synthesis reduction was required to prevent further DNA damage by LOOH end-products (Marnett, 1999). Despite the various studies on LOOH-induced
DNA damage, the mechanism by which LOOHs reduce DNA synthesis needs to be further investigated.
In support of shifting towards differentiation, the focal adhesion pathway, which is involved in cell motility, differentiation, and other processes, was enhanced (p-value 0.06) in 13-
HPODE-treated cells relative to untreated cells. Among the related induced genes was COL7A1.
In the intestine, this pathway plays a role in epithelial barrier homeostasis and repair and tight junction organization (Ma et al., 2013). This may indicate enhanced cellular differentiation, which promotes the development of brush borders, as evidenced by the upregulated VIL1 gene in
13-HPODE-treated cells. In addition to the upregulation of VIL1, the sucrase-isomaltase gene, SI, which is another marker of intestinal differentiation (Beaulieu & Quaroni, 1991) showed elevated expression in LA-treated cells compared to 13-HPODE-treated cells, indicating enhanced cellular differentiation. Furthermore, we observed upregulation of retinol metabolism in LA-treated cells, relative to untreated cells, which has been shown to play a role in intestinal epithelial cell processes including growth and differentiation (Thomas et al., 2005). In addition,
UGT2B4, a detoxifying enzyme that plays a role in the retinol metabolic pathway, was detected and upregulated in LA-treated cells.
Our results showed a reduction in the oxidative phosphorylation pathway in both 13-
HPODE- and LA-treated cells relative to untreated cells. Disrupted oxidative phosphorylation has been previously reported in mice fed with oxidized linoleic acid (Schuster et al., 2018).
81 Moreover, mitochondrial components including membranes and matrix were among the top enriched GO terms in both 13-HPODE- and LA-treated cells, relative to untreated cells, which indicates the significant effect of 13-HPODE and LA on mitochondrial function. The TOMM5 gene, which is a translocase of the outer mitochondrial membrane, was downregulated in both treatments. It has been reported that PUFAs can cause a change in mitochondrial membrane composition and organization that leads to increased production of ROS, which in turn causes peroxidation of membrane phospholipids and mitochondrial dysfunction (Sullivan et al., 2018).
Toll-like receptor (TLR) signaling was downregulated in LA-treated Caco-2 cells relative to untreated cells, which supports the previously reported inhibitory effect of PUFAs on TLR activation and inflammatory gene expression (Lee & Hwang, 2006). Specifically, n-3 PUFAs appeared to be more powerful inhibitors of TLR signaling than n-6 PUFAs (Lee et al., 2003).
There was a relative similarity in the data results between LA- and 13-HPODE-treated cells, suggesting the possibility of LA being oxidized in the intestinal epithelium, which has been previously reported (Kamitani et al., 1998).
Neither NFE2L2 nor AP-1 elements were differentially expressed in H2O2-treated cells.
However, we observed increased expression of peroxiredoxin, PRDX2, which decomposes H2O2, and glutathione-S-transferase, GSTP1, which is involved in detoxification by GSH, in H2O2- treated cells which could be a protective response against apoptosis triggered by H2O2 (Laborde,
2010; Olahova et al., 2008). On the other hand, DDIT4 (also called RTP801), which is a pro- apoptotic DNA damage inducible transcript, was upregulated in H2O2-treated cells, compared to untreated cells, which might be a protective cellular response to oxidative stress - anti or proapoptotic response (Bateman, 2019). DDIT4 could mediate the protective cellular response
82 via inhibiting ROS generation (Shoshani et al., 2002). In addition, DDIT3 (also called CHOP), which is also pro-apoptotic and plays a role in endoplasmic reticulum stress response (Pallepati
& Averill-Bates, 2011), was also upregulated. As we observed increased expression of DDIT3 and DDIT4 as well as PRKAG1 (a component of AMP-activated protein kinase; AMPK) in
H2O2-treated cells, we propose that H2O2 might use EIF2AK3-mediated signaling which leads to upregulation of DDIT3 and DDIT4 genes which, in turn, cause inhibition of MTORC1 and promote cell death. DDIT3 could also induce AMPK involved in endoplasmic reticulum stress response and autophagy (Rashid et al., 2015). NFAT5, which showed reduced expression in
H2O2-treated cells, could be involved in cellular differentiation via regulation of Wnt signaling
(Wang et al., 2013). In addition, reduced levels of NFAT5 have been linked to autoimmune disease and has been reported in intestinal samples of patients with active IBD (Boland et al.,
2015). On the other hand, reduced DKK1 expression may promote proliferative activity and wound repair after intestinal injury (Koch et al., 2011). Increased SPINK1 gene expression, which was demonstrated in H2O2-treated cells, has been seen in several types of cancers including breast and colorectal cancer (Tiwari et al., 2015). These data indicate H2O2-induced alteration of cellular response could be either defensive or detrimental. A rigorous study to investigate the difference between the effects of endogenously generated H2O2, using different oxidative stimuli, and the exogenously administered H2O2 should be considered for future work.
Table 9 shows comparative differential expression of selected genes between the three treatment groups of Diff Caco-2 cells.
83 Table 9: Comparative gene expression in Diff cells. Comparison of expression of selected genes between cells treated with peroxidized linoleic acid (13-HPODE), non-peroxidized linoleic acid (LA), or hydrogen peroxide (H2O2) treatments ( upregulated; downregulated).
Gene 13-HPODE-treated LA-treated H2O2-treated DKK1 3 2 CPT1A 3 2 n 1 PLIN2 n ODC1 n CREB3L3 n FABP1 PDK4 n PCK1 n COL7A1 n NOX1 n AKR1C2 n SOS1 n BAAT n n CYP2B6 n CYP2C9 n INSIG1 n n DDIT4 DUSP4 n UGT2B4 n NFAT5 n n TXNRD1 n n HMOX1 n n PRDX2 n n GSTP1 n CXCL1 n GPX1 n FOXO4 n CEACAM6 n POLD2 n ADH6 n n 1 not differentially expressed gene (adjusted p > 0.05); 2 differentially expressed gene (DEG; adjusted p < 0.05); 3 DEG with more pronounced effect compared to the other treatments.
84 Poorly-differentiated Caco-2 Cells
We demonstrate that 13-HPODE treatment of PDiff Caco-2 cells caused upregulation of mechanisms that help cells in detoxification as PDiff cells are more sensitive to xenobiotics than
Diff cells (Bourgine et al., 2012; Bruder et al., 2006; Gotoh et al., 2002). Among the upregulated pathways were retinol metabolism, peroxisome, and cytochrome P450. Upregulation of these pathway suggests that there is a need for induction of antioxidant defense response against 13-
HPODE-derived oxidative stress to prevent cellular damage. Upregulated retinol metabolism, which was not seen in Diff cells treated with 13-HPODE, might be a protective mechanism as retinol is considered as a non-enzymatic antioxidant (Jakubczyk et al., 2020). Products of peroxidized lipids have significantly shown to affect retinoid metabolism (Lee et al., 2008). We observed upregulation of beta-carotene oxygenase, BCO1, and retinol dehydrogenase, RDH10, in
13-HPODE-treated cells. The expression levels of these two genes have shown to be low in cirrhotic rat intestine, which indicates retinol’s link to disrupted intestinal epithelial homeostasis
(Natarajan et al., 2009). In addition to its role in triglyceride and cholesterol metabolism
(D’Ambrosio et al., 2011), retinol is important for cellular growth, proliferation, and differentiation of intestinal epithelium and presents in higher amounts in intestinal crypts than villus cells (Thomas et al., 2005); therefore, enhancement of retinol could be a benefit of 13-
HPODE.
Unlike Diff cells, PDiff cells showed upregulation of peroxisomal pathway upon treatment with 13-HPODE-treated cells, which metabolizes lipids, detoxifies radicals, and maintains redox homeostasis. PEX6 gene involved in peroxisome biosynthesis and protein import to peroxisomes was upregulated as well as the detoxifying CAT in 13-HPODE-treated 85 cells. Increased peroxisome proliferation and activity has been reported when PPAR ligands such as fatty acids were used (Schrader & Fahimi, 2006). CROT, IDH1, and ABCD1 genes were also upregulated enhancing peroxisomal lipid metabolism, a mechanism that some cancer cell types use to maintain tumorigenicity and survival through fatty acid oxidation (Kim, 2020). Of note, peroxisomes involved in lipid metabolism and redox balance play an essential role in maintaining intestinal epithelial homeostasis. Hence, upregulation of this pathway might indicate that 13-HPODE could help PDiff Caco-2 cells to battle stress. We observed marginal induction of peroxisomal pathway as well as upregulation of PEX6, ACOX2, and CROT genes in LA- treated cells. This supports studies reported induction of PPAR by LA (Suh et al., 2008) and induction of peroxisomal acyl-CoA oxidase, which is associated with increase peroxisome number, in LA-treated cultured rat hepatocytes (Intrasuksri et al., 1998). We also showed that
13-HPODE upregulated the metabolism by cytochrome P450 in PDiff cells, which allows the cells to oxidize and metabolize lipids, and clear xenobiotic compounds including dietary LOOHs and their metabolites such as 4-HNE (Ayala et al., 2014). Among upregulated genes were
UGT2B4, CYP2B6, MAOB, and SULT2A1. These results suggest that exposure of intestinal epithelial cells to 13-HPODE may promote pre-systemic metabolism and reduced bioavailability of xenobiotics as they pass through the intestinal epithelium. Although peroxisomes and cytochrome P450 have a role in detoxifying substrates and protecting cells from oxidative stress, they can also produce ROS and lipid peroxidation, which might form adducts creating an environment for development of carcinogenesis and disease progression (Schrader & Fahimi,
2006; Veith & Moorthy, 2018). In addition, peroxisomal proliferation has been linked to tumor
86 development, and induction of intestinal cytochrome P450 has been linked to gastrointestinal cancer (Kaminsky & Fasco, 1992; Reddy & Qureshi, 1979; Reddy et al., 1983).
Similar to what we observed in Diff cells, treatment of PDiff Caco-2 cells with 13-
HPODE caused upregulation of STS, CYP17A1, and AKR1C2/C3 genes involved in steroid hormone biosynthesis, which has been shown to affect intestinal function and transport of nutrients (Pfaffl et al., 2003). Aldo/keto reductases, AKR1Cs, also play a role in bile acid binding and detoxification by reducing lipid peroxide product, 4-HNE, to battle oxidative stress- related injury (Singh et al., 2015). Thus, upregulated expression of AKR1Cs might be an indicative of increase intracellular toxic aldehydes. In addition, AKR1C3 has been studied as a marker for progression of colorectal and prostate cancers in which aldehyde levels appear to be elevated (Nakarai et al., 2015; Skrzydlewska et al., 2001; Tian et al., 2014). Therefore, AKR1Cs may provide a potential therapeutic strategy to treat aldehyde-related pathologies. Of note, increased expression of AKR1Cs has been implicated in the resistance of anti-colon cancer therapies (Matsunaga et al., 2013), which proposes a mechanism by which dietary LOOHs could promote drug resistance through upregulation of the detoxifying AKR1Cs.
ROS have been strongly linked to the initiation and progression of colorectal cancer
(CRC) (Carini et al., 2017). In addition, not only LOOHs have been implicated in the pathogenesis of CRC (Demeyer et al., 2016) but also levels of lipid peroxidation products due to oxidative stress have shown to be elevated in CRC tissue compared to normal colon mucosa
(Skrzydlewska et al., 2005). Moreover, increased antioxidant enzyme activity in CRC has been reported which enhances adaptive response that enables cells to battle stress (Skrzydlewska et al., 2005). This is consistent with our results showing increased expression of genes involved in
87 antioxidant defense mechanisms. Within this context, we observed upregulation of several Nrf2- regulated genes involved in antioxidant defense mechanisms in 13-HPODE-treated cells. Among those were genes involved in glutathione (GSH) antioxidant system such as SLC7A11, which facilitates cystine essential for GSH synthesis, GCLC, that regulates the rate-limiting step of
GSH synthesis, GSR, which maintains high levels of reduced GSH, and GSTA2, that detoxifies compounds by conjugating them to GSH. We also observed upregulation of quinone reductase,
NQO1, and CAT, which also have a role in detoxification of ROS and xenobiotics. This is consistent with previous studies demonstrated activation of Nrf2-mediated antioxidant response via oxidized lipids (Akazawa-Ogawa et al., 2015; Ishii et al., 2004). Moreover, cytochrome p450 oxidoreductase, POR, which catalyzes formation of tocopheryl hydroquinone, which is a powerful antioxidant, was upregulated in 13-HPODE-treated cells. This antioxidant response could be triggered by 13-HPODE exposure, disturbed redox status, oxidative stress, or a combination of them. In LA-treated cells, there was upregulation of some Nrf2-targeted antioxidant genes including SLC7A11, GCLC, GSR, and CAT; however, 13-HPODE triggered a more powerful antioxidant response than LA. It is worth to mention that none of the lipoxygenase genes were differentially expressed in either 13-HPODE- or LA-treated cells.
However, PTGS2 (also called COX2), which has been shown to be overexpressed in some cancers including CRC (Koehne & Dubois, 2004), appeared to be downregulated in both 13-
HPODE- and LA-treated cells. This is consistent with a previous study reported that 13-HPODE inhibited prostaglandin synthesis by inhibiting cyclooxygenase activity (Fujimoto et al., 2008).
Additionally, several unsaturated FAs including LA have been previously reported as COX-2 inhibitors (Ringbom et al., 2001). Our results implicate that dietary peroxidized LA may promote
88 a strong antioxidant response in the proliferative intestinal tumor or crypt cells to battle the stress derived from the exposure to LOOHs. Of note, the ability of PDiff Caco-2 cells, which are considered cancerous, to induce antioxidant response upon 13-HPODE treatment might lead to progression of disease as it enables cancer cells to survive under stress, which has been implicated in anti-cancer drug resistance (Ozdemirler et al., 1998). In normal intestinal epithelial cells, antioxidant response might help in preventing cellular damage that can be caused by oxidative stress and lead to disease. However, Wistar rats treated with repeatedly heated cooking oil, which contains high levels of LOOHs, have shown abnormal colonic epithelium (polyp formation) with aberrant crypts despite the increased antioxidant enzyme activity (Venkata &
Subramanyam, 2016). Taken together, these observations warrant further studies to determine the role of LOOH-induced antioxidant response in protecting cells or induction of mutagenic changes.
We showed that 13-HPODE enhanced PPAR signaling in PDiff cells, and Diff cells as we reported earlier, consisting with the studies reported oxidized LA as a PPAR ligand (Bull et al., 2003; Delerive et al., 2000; Rong et al., 2002). This might suggest the ability of PDiff cells to uptake 13-HPODE and induce PPAR signaling despite the lack of brush borders. Induction of
PPAR signaling leads to activation of downstream genes involved in glucose and lipid metabolism including beta-oxidation. We observed upregulation of PPARA gene and some of its downstream genes including HMGCS2, FABP1, and CPT1A genes involved in ketogenesis, uptake of FA, and mitochondrial beta-oxidation, respectively, as well as PLIN2 that coats lipid droplets. We also observed upregulation of FGF21, which is required for activation of FA oxidation and ketogenic pathways and expression of PPARA target genes (Pawlak et al., 2015).
89 PCK1 and AQP7 were also upregulated suggesting that gluconeogenesis might be enhanced by
13-HPODE. Activation of PPAR could also be a protective anti-inflammatory response against
13-HPODE (Necela & Thompson, 2008) as we also observed downregulation of proinflammatory genes including IL18, CCL20, and CXCL1/L3/L8. Previous studies have shown reduced expression of chemokines CXCL1/L8 when expression level of PPARα was increased indicating anti-inflammatory activity (Escudero et al., 2015; Jiao et al., 2014). We reported similar anti-inflammatory effect of 13-HPODE of Diff cells as CXCL1/L8 and CCL20 were also downregulated. Another study has shown reduced expression of IL18 in mice treated with
PPARα agonist, Wy14643 (Stienstra et al., 2007). Moreover, it has been reported that fenofibrate, another PPARα agonist, also reduced expression of chemokines, including CCL20, in HT-29 cells (Lee et al., 2007). Although we also observed upregulation of PPAR signaling in
Diff cells which regulates lipid metabolism, previous reports suggested that PPAR activation in the intestinal stem cells may have pro-tumorigenic effect, which indicates that exposure of intestinal crypt cells or tumor cells to 13-HPODE might contribute to the development or progression of cancer (Beyaz & Yilmaz, 2016). It is worth to note that 13-HPODE caused upregulation of SRC proto-oncogene, which has shown to be upregulated in CRC (Jin, 2020).
Additionally, increased expression of PLIN2 might indicate increased lipid droplets, which have shown to play a role in colon cancer progression (Koizume & Miyagi, 2016). Other reports suggested that PPAR signaling induces cell differentiation or apoptosis (Tachibana et al., 2008) and reduces proliferation through downregulation of MYC proto-oncogene (Cerbone et al., 2007;
Grabacka & Reiss, 2008), which we observed, in our study, in 13-HPODE-treated cells. These conflicting studies and our results might indicate dual effects of 13-HPODE-derived PPAR
90 signaling on PDiff cells although the role of PPARs in tumor development requires further investigations.
As seen in our study, starch and sucrose metabolic pathway was enhanced by 13-HPODE treatment of PDiff Caco-2 cells. GYS2 and GBE1 genes, involved in glycogen synthesis and solubility, AGL and PYGM, involved in glycogen degradation, appeared to be upregulated suggesting alteration of cellular glycogen contents. In addition, glycogen metabolism has shown to play an essential role in cancer cell survival (Zois & Harris, 2016). We also observed upregulation of amino acid metabolism in 13-HPODE-treated cells, in particular glycine, serine, and threonine metabolism, which also plays a role in sustaining cancer cell survival. We also observed upregulation of PHGDH involved in serine biosynthesis, which has also shown to maintain survival (Amelio et al., 2014). The significant impact of 13-HPODE on glycogen and amino acid metabolism of PDiff cells, which was not seen in Diff cells treated with 13-HPODE, proposes a mechanism by which dietary LOOHs may alter the metabolic processes of intestinal crypt or tumor cells to create an environment that initiates or promotes gut disease. Of note, intestinal crypt cells have the ability to initiate tumors especially if exposed to oxidative stress
(Oberreuther-Moschner et al., 2005).
Components involved in physiological processes such as cell growth, differentiation, and motility were enriched in all three treatment groups. Among those were focal adhesion, cell– substrate junction, cell–cell junction, and cell leading edge. Previous reports indicated that oxidative stress including oxidized lipids could affect cellular barrier function through alteration of focal adhesion, adherens junction, and cell cytoskeleton (Rao, 2008; Usatyuk & Natarajan,
2012). We also observed downregulation of CLDN1, which is a barrier-forming tight junction
91 gene and upregulation of the pore-forming CLDN2 in 13-HPODE-treated cells, a characteristic of IBD (Ahmad et al., 2017). In addition, it has been reported that LA and its oxidized metabolite could modulate cellular differentiation of Caco-2 cells (Barron et al., 2017; Laprise et al., 2002;
Levy et al., 1998).
PDiff Caco-2 cells showed downregulation of pathways involved in RNA processing and translation including ribosome and spliceosome as well as pyrimidine metabolism in the three treatment groups. This alteration might indicate reduced proliferation as these pathways have shown to be downregulated when Caco-2 cells lose their proliferative potential and shift towards differentiation (Mariadason et al., 2002). In addition, induction of intestinal cell differentiation by 13-HPODE or LA has been previously reported (LLOR, 2003; Rong et al., 2002).
Alternatively, downregulation of the translation machinery could be due to oxidative damage to the ribosomes to which the cells needed a feedback inhibition of ribosome biogenesis to prevent translation errors and further ribosomal damage (Shcherbik & Pestov, 2019). Of note, oxidative stress-induced modification of RNA has been linked to age-related diseases including neurodegenerative disorders (Shcherbik & Pestov, 2019). Pathway analysis showed that, in addition to downregulation of ribosome, spliceosome and pyrimidine metabolism, 13-HPODE had also a downregulating effect on cell cycle and DNA replication/repair in Diff but not in
PDiff cells which could indicate more pronounced effect of LOOHs on cellular proliferation and differentiation in Diff cells. We observed increased expression of pro-apoptotic genes such as
DDIT4, BMF, BNIP3L, and BCL2L14 and decreased expression of anti-apoptotic BCL2L1 in both 13-HPODE- and LA-treated PDiff cells suggesting reduced cell viability. This is consistent with previous studies reported that 13-HPODE increases cell death (Keewan et al., 2020) and
92 that LA induces apoptosis and cell differentiation (LLOR, 2003) in Caco-2 cells. In addition, our results at the gene expression level showed downregulation of several genes involved in proliferation such as CDK10, PIM1, CCN1/N2, and CYTOR in both 13-HPODE- and LA-treated cells, which suggests reduced proliferation. Although our results suggest, in part, that 13-
HPODE promotes cell death in PDiff cells, they may also indicate that 13-HPODE could trigger antioxidant response and modulate metabolic processes in a way that creates a carcinogenic environment and renders cells fight stress which could explain the resistance of some cancer types to anticancer therapies.
Similar to what we observed in Diff cells, 13-HPODE treatment of PDiff Caco-2 cells caused downregulation of oxidative phosphorylation. We observed downregulation of genes involved in electron transport chain complexes including complex I, III, IV, and V in 13-
HPODE-treated cells. Our results support studies that demonstrated that oxidized LA products can damage the mitochondria and interfere with oxidative phosphorylation as these products can incorporate into mitochondrial membrane lipids and produce more radicals (Schuster et al., 2018;
Sullivan et al., 2018). In addition, PUFAs have shown to increase mitochondrial β-oxidation and
ROS production, which might cause mitochondrial dysfunction (Sullivan et al., 2018). Of note, lipid peroxidation-related mitochondrial dysfunction has been linked to several pathologies including non-alcoholic steatohepatitis, ischemic cardiac reperfusion, and IBD (Begriche et al.,
2006; Lucas & Szweda, 1998; Novak & Mollen, 2015).
We observed downregulation of the cellular phagosomal pathway in PDiff Caco-2 cells for all treatment groups; this pathway was not affected by 13-HPODE in Diff cells. Among downregulated genes were those that encode subunits of vacuolar-ATPase involved in organelle
93 acidification, such as ATP6V1D/V0B. Intestinal epithelial cells are considered non-professional phagocytic cells and this effect of reduced phagosomal pathway could be attributed to the reduction of oxidative phosphorylation, particularly in 13-HPODE-treated cells, as phagocytosis is known to be an energy-dependent process (Günther & Seyfert, 2018; Mapother & Songer,
1984). It has been demonstrated that modification of photoreceptor outer segments by lipid peroxidation products causes impairment of lysosomal degradation (Kaemmerer et al., 2007), suggesting the negative regulation of lysosomal/phagosomal degradation by LOOH adducts. Of note, impaired intestinal epithelial autophagy has been implicated in the pathology of IBD (Wu et al., 2018), and impaired intestinal epithelial phagosomal function may affect the ability of epithelial cells, the first line of defense in the gut, to clear the pathogens they encounter (Günther
& Seyfert, 2018). Thus, disruption of both oxidative phosphorylation and phagosomal pathway could propose a mechanism by which dietary LOOHs contribute to IBD and/or IBD-related carcinogenesis in intestinal crypt or tumor cells.
On the other hand, PDiff Caco-2 cells showed an anti-inflammatory response to either treatment evidenced by downregulation of inflammatory chemokines, CXCL1/L3 and CCL20, and NOD-like receptor signaling. We demonstrated that upregulation of PPAR signaling by 13-
HPODE might exert an anti-inflammatory response, which is consistent with a previous study reported the protective anti-inflammatory effect of PPAR against lipopolysaccharide (Delerive et al., 1999). Furthermore, PPAR ligands have shown to reduce expression of TNFα as well as chemokine receptors and chemokines (Bochkov & Leitinger, 2003) including CXCL1
(Keshamouni et al., 2005). Previous studies also reported anti-inflammatory properties of PUFAs
(Li et al., 2015; Radzikowska et al., 2019; Virtanen et al., 2018) consisting with our results.
94 H2O2 is a source of oxidative stress that can be found in food preservatives, dental care products, and in some beverages consumed daily such as coffee and tea, and might predispose the intestinal epithelium to oxidative stress (Halliwell et al., 2000). To evaluate whether H2O2 has a similar impact of 13-HPODE on the transcriptomic profile of Caco-2 cells, we treated
PDiff cells with 100 μM H2O2. A previous study reported that PDiff Caco-2 cells maintained
95% viability when treated with 100 μM of H2O2 and that cellular and DNA damage was observed at 150 μM H2O2 or higher (Wijeratne et al., 2005). H2O2 is normally detoxified by peroxisomal catalase and glutathione defense mechanism (Rao, 2008). Similar to what we observed in 13-HPODE-treated cells, H2O2-treated cells showed upregulation of multiple pathways involved in detoxification such as peroxisome, cytochrome P450, and glutathione metabolism suggesting disrupted redox status in both treatment groups. We observed upregulation of CAT, PEX6, and PEX11A, as well as peroxisomal lipid metabolism genes including IDH1, ABCD1, and CROT in H2O2-treated cells. It has been reported that H2O2 may cause peroxisomal proliferation supporting the antioxidant role of peroxisome against ROS
(Schrader & Fahimi, 2006). Upregulated genes also included alcohol dehydrogenases ADH5/6, and UGT2B4 involved in metabolism of toxic compounds and xenobiotics. Nrf2-mediated antioxidant response was also promoted by H2O2 evidenced by upregulation of MGST3 and
GSTA4/A2/M4 involved in glutathione metabolism indicating disrupted redox status and promoted defense against oxidative stress. On the other hand, cellular cytoskeleton and integrity were disturbed by H2O2 as cell adhesion molecules, adherens/tight junction, and focal adhesion pathways were downregulated. This is consistent with previous studies reported Caco-2 cells’ injury and barrier dysfunction in response to oxidative stress, which contributes to IBD (Katsube
95 et al., 2007; Zhao et al., 2018). In addition, intestinal crypt cells have the ability to initiate tumors if exposed to oxidative stress (Oberreuther-Moschner et al., 2005).
We demonstrated that H2O2 treatment upregulated lipid uptake and metabolism as we observed upregulation of FABP1, MTTP, and DGAT2. We also observed that H2O2 induced steroid hormone and steroid biosynthesis, which has been observed in studies of liver cells treated with H2O2 (Giudetti et al., 2013; Seo et al., 2019). LSS, DHCR24, and MSMO1 involved in steroid biosynthesis were upregulated in H2O2-treated cells. Upregulation of steroid biosynthesis might suggest sustained tumorigenicity as cholesterol synthesis is considered a hallmark feature of cancer (Huang et al., 2020). Steroid biosynthesis was not affected by 13-
HPODE treatment; in fact, it has been previously reported that oxidized lipids could inhibit cholesterol synthesis by binding to SREBPs and suppressing their nuclear localization
(Leonarduzzi et al., 2002). We observed that H2O2 caused alteration of amino acids metabolism including upregulation of valine, leucine and isoleucine degradation pathway, which have also shown to be upregulated in MCF-7 cells treated with H2O2; this pathway has been linked to volatile organic compounds, which are biomarkers for cancer (Liu et al., 2019). Our findings suggest that H2O2 might have a significant impact on intestinal tumor or crypt cells, which alters redox status and modifies lipid and amino acid metabolism as well as cell cytoskeleton affecting cellular physiology, integrity, and survival fates.
Table 10 demonstrates comparative differential expression of selected genes between the three treatment groups. Collectively, our results indicated that 13-HPODE, LA and H2O2 upregulated the peroxisomal pathway and peroxisome-related genes including PEX6 and CROT.
Although we observed upregulation of genes involved in PPAR signaling in both 13-HPODE-
96 and LA-treated cells including PLIN2 and HMGCS2, the upregulation effect was more pronounced in 13-HPODE-treated cells. This may suggest that 13-HPODE is a more potent activator of PPAR signaling than LA although both oxidized and unoxidized LA have previously shown to activate PPARs (Rong et al., 2002; Suh et al., 2008). Moreover, gene expression and pathway analysis indicated that 13-HPODE and H2O2 promoted a powerful antioxidant response in PDiff cells compared to LA treatment. This was evidenced by upregulation of genes involved in cytochrome P450, Nrf2-mediated response, and glutathione metabolism, including CAT and
GSTA2, which might promote adaptive response. In addition, amino acid metabolism upregulation observed in 13-HPODE- and H2O2-treated cells, but not in LA-treated cells, might suggest that these two treatments could promote a tumorigenic environment as amino acid metabolism including serine biosynthesis has a role in cell survival (Amelio et al., 2014). 13-
HPODE caused significant downregulation of oxidative phosphorylation, which was not seen in
LA or H2O2 treatments indicating the damaging effect might be caused by 13-HPODE on mitochondrial function as reported by previous studies (Schuster et al., 2018; Sullivan et al.,
2018). As we mentioned earlier, all three treatments caused downregulation of ribosome biogenesis, spliceosome, and pyrimidine synthesis. Downregulation of these pathways and some proliferation-related genes such as ODC1 and RGCC might indicate reduced proliferative potential as well as possible oxidative damage to ribosomes to which the cells responded by downregulating ribosome biogenesis in order to prevent translation errors. Despite the downregulation of some inflammatory genes including CXCL1 and IL18 in all three treatments, the phagosomal pathway also appeared to be downregulated, which has been implicated in the pathology of bowel disease (Wu et al., 2018). Gene ontology analysis showed enrichment of
97 focal adhesion and cellular junctions in all three treatments, however, pathway analysis showed significant downregulation of cell adhesion molecules, adherens junction, and focal adhesion in
H2O2-treated cells indicating damaging effect of H2O2 on cellular cytoskeleton and junctions, which might affect barrier function (Katsube et al., 2007; Zhao et al., 2018).
98 Table 10: Comparative gene expression in PDiff cells. Comparison of expression of selected genes between cells treated with peroxidized linoleic acid (13-HPODE), non-peroxidized linoleic acid (LA), or hydrogen peroxide (H2O2) treatments ( upregulated; downregulated).
Gene 13-HPODE-treated LA-treated H2O2-treated PLIN2 3 2 n 1 HMGCS2 3 CPT1A n FABP1 PCK1 CREB3L3 n n DDIT4 AKR1C3 PEX6 CAT CROT TTN RGCC 3 2 ODC1 COX20 CXCL1 IL18 STX7 GBE1 CHAC1 CEBPB DUSP4 3 ACOX2 n BMF BCL2L1 UGT2B4 GSTA2 n GSTA4 n n ADH6 n n NQO1 n n DKK1 1 not differentially expressed gene (adjusted p > 0.05); 2 differentially expressed gene (DEG; adjusted p < 0.05); 3 DEG with more pronounced effect compared to the other treatments.
99 Although we observed some similarities in the enriched process of Diff and PDiff Caco-2 cells upon 13-HPODE treatment, our results demonstrated that the two Caco-2 cell types, which differ in their phenotype, behavior and gene expression, show significant differences in their response to the most common dietary lipid peroxide, 13-HPODE. As we discussed earlier, among the top similarities were enrichment of PPAR signaling, cytochrome P450, oxidative phosphorylation and membrane transporters which support previous studies reported the effect of
13-HPODE on these processes (Bull et al., 2003; Delerive et al., 2000; König & Eder, 2006;
Rohr et al., 2020; Rong et al., 2002; Schuster et al., 2018; Sullivan et al., 2018). We also showed that 13-HPODE had a significant effect on steroid hormone biosynthesis, RNA processing and ribosome biogenesis in both types of cells. On the other hand, Diff cells showed enrichment of bile conjugation upon 13-HPODE treatment which is considered a detergent. We also showed that 13-HPODE had a significant impact on cell cycle and DNA replication/repair in Diff cells indicating an effect on cellular differentiation and apoptosis. In PDiff cells, more defense mechanisms were triggered by 13-HPODE than in Diff cells. In addition to cytochrome P450, retinol metabolism and peroxisomal pathway were enriched in PDiff cells indicating a stronger defense mechanism was triggered in PDiff than Diff cells. Moreover, amino acid and glycogen metabolism enrichment in PDiff cells upon 13-HPODE treatment was an indication of tumorigenic environment. We also showed that 13-HPODE enhances phospholipid biosynthesis in PDiff but not Diff cells, which is also an indication of malignant transformation (Dobrzyńska et al., 2005). 13-HPODE also affected phagosomal pathway in PDiff cells which could link
LOOHs to inflammation-related tumors.
100 CHAPTER SIX: CONCLUSIONS
The results of our transcriptomic profiling of Caco-2 cells carried out under standard in vitro conditions shed light on the response of intestinal epithelial cells to 13-HPODE, LA or
H2O2 in terms of differential gene expression, gene ontology and pathway enrichment. This research was conducted on Diff and PDiff Caco-2 cells in order to compare between their responses to LOOHs as Diff cells resemble mature-like enterocytes (have brush borders) and
PDiff cells model intestinal cancer cells or crypt cells (lack brush borders). The results presented in this research suggest that the most common dietary peroxidized lipid, 13-HPODE, may, on the one hand, enhance bile acid conjugation in Diff cells, which alters lipid uptake and might contribute to intestinal injury. On the other hand, 13-HPODE may affect multiple pathways of lipid metabolism including steroid hormone synthesis, which might affect intestinal barrier and immune function, and PPAR signaling which alters fatty acid and glucose metabolism, energy production, and mitochondrial function leading to alteration of gut physiology. In addition, 13-
HPODE as well as LA may have the ability to promote the antioxidant response and detoxification by cytochrome P450 in intestinal epithelial cells. Moreover, both treatments could reduce proliferative potential and could play a role in the absorptive cell differentiation and survival fates in Diff cells as they might suppress pathways involved in the cell cycle, DNA synthesis/repair, and enhance focal adhesion pathway. Studying the effects of H2O2 on Diff cells revealed induction of pro-apoptotic as well as antioxidant response.
We demonstrate how PDiff Caco-2 cells respond to peroxidized linoleic acid, 13-HPODE which might reflect the response of in vivo intestinal tumor or crypt cells exposed to dietary
LOOHs. The stress brought to PDiff cells by 13-HPODE caused the cells to upregulate genes
101 and pathways involved in detoxification as rigorous activation of antioxidant response was required to maintain cellular function and prevent damage. Induction of peroxisomal pathway and cytochrome P450 may, on the one hand, metabolize lipids, detoxify radicals, and maintain redox homeostasis, but on the other hand, can increase ROS production and lipid peroxidation and contribute to the development or progression of disease including gastrointestinal cancer.
Moreover, enhanced peroxisomal fatty acid oxidation due to either treatment might favor carcinogenesis. This could propose a mechanism by which 13-HPODE contributes to tumor progression or resistance to anticancer therapy. While induction of PPAR signaling by 13-
HPODE promoted FA oxidation and lipid metabolism and might have anti-inflammatory and anti-proliferative effects on PDiff Caco-2 cells, it may maintain the tumorigenic phenotype of the cells. Moreover, upregulated glycogen metabolism by either 13-HPODE or LA and upregulated amino acid metabolism by 13-HPODE or H2O2 may promote cell survival. Although our results, in part, indicate reduced proliferation in PDiff cells, the overall changes in cellular response to
13-HPODE and H2O2 may provide a carcinogenic environment. The negative impact we observed of 13-HPODE on electron transport chain and phago-lysosomal degradation pathways might link LOOHs to different intestinal pathologies including IBD and cancer, which could be initiated by intestinal crypt cells. These results present insights of how 13-HPODE creates different environments in Diff and PDiff Caco-2 cells. Compared to 13-HPODE, H2O2 treatment not only enhanced antioxidant adaptive response, which protects against cytotoxicity, but also upregulated steroid biosynthesis, which is a hallmark of tumor development. Our results suggest that dietary LOOHs, such as 13-HPODE, could trigger a strong antioxidant mechanism in intestinal tumor or epithelial crypt cells, which provides a defensive response to stress. The
102 results also indicate that dietary LOOHs may modify metabolic processes and alter energy production and degradation processes in PDiff Caco-2 cells creating an environment that renders these proliferative cells to initiate or progress disease.
This dissertation demonstrates that the Diff and PDiff Caco-2 cells, which differ in their phenotype, behavior and gene expression, show significant differences in their response to the most common dietary lipid peroxide, 13-HPODE, although some similarities in the enriched processes of both cell types were observed. Both cell types showed enrichment of PPAR signaling, cytochrome P450, oxidative phosphorylation and membrane transporters which support previous studies reported the effect of 13-HPODE on these processes (Bull et al., 2003;
Delerive et al., 2000; König & Eder, 2006; Rohr et al., 2020; Rong et al., 2002; Schuster et al.,
2018; Sullivan et al., 2018). In addition, 13-HPODE treatment had a significant effect on steroid hormone biosynthesis, RNA processing and ribosome biogenesis in both types of cells. On the other hand, Diff cells showed enrichment of bile conjugation upon 13-HPODE treatment which could provide a link between its detergent activity and cell phenotype. The significant impact of
13-HPODE on cell cycle and DNA replication/repair in Diff cells might indicate an effect on cellular differentiation and apoptosis. In PDiff cells, more defense mechanisms were triggered by
13-HPODE than in Diff cells. In addition to cytochrome P450, retinol metabolism and peroxisomal pathway were enriched in PDiff cells indicating a stronger defense mechanism was triggered in PDiff than Diff cells. Moreover, phospholipid biosynthesis, amino acid and glycogen metabolism enrichment in PDiff cells, but not in Diff cells, upon 13-HPODE treatment was an indication of tumorigenic environment and malignant transformation.
103 In conclusion, this research using Caco-2 cells provides insights into the physiological changes that might occur in the intestinal epithelial cells upon exposure to 13-HPODE and the possible mechanisms by which it contributes to disease development or progression in intestinal epithelium. Our results also support that Diff and PDiff Caco-2 cells differ in their response to
13-HPODE. Future directions of this research include studying the response of Caco-2 cells to
LOOHs using an experimental setting that simulates in vivo intestinal environment, such as the
INFOGEST method (Brodkorb et al., 2019). The hypotheses generated by our RNA-seq study can be further investigated using directed biomolecular experiments.
104 APPENDIX A: DIAGRAMS OF DYSREGULATED KEGG PATHWAYS
105
(a) (b)
(c) (d)
106
(e) (f)
(g) (h)
107
(i) (j)
(k) (l)
108
(m) (n)
Figure 26: Dysregulated KEGG pathways in 13-HPODE-treated Diff Caco-2 cells. Upregulated pathways (a-f) in Diff cells upon 13-HPODE treatment include steroid hormone biosynthesis, bile secretion, protein digestion and absorption, metabolism of xenobiotics by cytochrome P450, focal adhesion and PPAR signaling pathway. Downregulated pathways (g-n) include spliceosome, ribosome biogenesis in eukaryotes, RNA transport, pyrimidine metabolism, cell cycle, nucleotide excision repair, proteasome and oxidative phosphorylation. Each pathway highlights the upregulated and downregulated differentially expressed genes (DEGs) due to 13- HPODE treatment.
109
(a) (b)
(c) (d)
110
(e) (f)
(g) (h)
111
(i) (j)
(k) (l)
112
(m) (n)
(o)
Figure A27: Dysregulated KEGG pathways in LA-treated Diff Caco-2 cells. Upregulated pathways (a-f) in Diff cells upon LA treatment include retinol metabolism in animals, metabolism of xenobiotics by cytochrome P450, drug metabolism-cytochrome P450, protein digestion and absorption, adherens junction and focal adhesion. Downregulated pathways (g-o) include ribosome biogenesis in eukaryotes, spliceosome, RNA transport, pyrimidine metabolism, oxidative phosphorylation, proteasome, cell cycle, nucleotide excision repair, and Toll-like
113 receptor signaling pathway. Each pathway highlights the upregulated and downregulated DEGs due to LA treatment.
114
(a) (b)
(c) (d)
115
(e) (f)
(g) (h)
116
(i) (j)
(k) (l)
117
(m)
Figure A3: Dysregulated KEGG pathways in 13-HPODE-treated PDiff Caco-2 cells. Upregulated pathways (a-g) in PDiff cells upon 13-HPODE treatment include retinol metabolism in animals, steroid hormone biosynthesis, starch and sucrose metabolism, glycine, serine and threonine metabolism, PPAR signaling pathway, peroxisome and metabolism of xenobiotics by cytochrome P450. Downregulated pathways (h-m) include ribosome, RNA polymerase, spliceosome, pyrimidine metabolism, phagosome and oxidative phosphorylation. Each pathway highlights the upregulated and downregulated DEGs due to 13-HPODE treatment.
118
(a) (b)
(c) (d)
119
(e) (f)
(g) (h)
120
(i)
Figure A4: Dysregulated KEGG pathways in LA-treated PDiff Caco-2 cells. Upregulated pathways (a-c) in PDiff cells upon LA treatment include aminoacyl-tRNA biosynthesis, starch and sucrose metabolism and peroxisome. Downregulated pathways (d-i) include ribosome biogenesis in eukaryotes, phagosome, lysosome, spliceosome, pyrimidine metabolism and NOD- like receptor signaling pathway. Each pathway highlights the upregulated and downregulated DEGs due to LA treatment.
121
(a) (b)
(c) (d)
122
(e) (f)
(g) (h)
123
(i) (j)
(k) (l)
124
(m) (n)
Figure A5: Dysregulated KEGG pathways in H2O2-treated PDiff Caco-2 cells. Upregulated pathways (a-h) in PDiff cells upon H2O2 treatment include steroid biosynthesis, steroid hormone biosynthesis, peroxisome, drug metabolism-cytochrome P450, glutathione metabolism, fat digestion and absorption, propanoate metabolism and valine, leucine and isoleucine degradation. Downregulated pathways (i-n) include ribosome, RNA transport, spliceosome, cell adhesion molecules, adherens junction and tight junction. Each pathway highlights the upregulated and downregulated DEGs due to H2O2 treatment.
125 APPENDIX B: TABLES OF DEGS AND ENRICHED GO TERMS
126 Available in supplementary file Appendix B.
Table A1: Differential gene expression in 13-HPODE-treated Diff Caco-2 cells. Table A2: Gene Ontology analysis (biological processes) in 13-HPODE-treated Diff Caco-2 cells. Table A3: Gene Ontology analysis (molecular functions) in 13-HPODE-treated Diff Caco-2 cells. Table A4: Gene Ontology analysis (cellular components) in 13-HPODE-treated Diff Caco-2 cells. Table A5: Differential gene expression in LA-treated Diff Caco-2 cells. Table A6: Gene Ontology analysis (biological processes) in LA-treated Diff Caco-2 cells. Table A7: Gene Ontology analysis (molecular functions) in LA-treated Diff Caco-2 cells. Table A8: Gene Ontology analysis (cellular components) in LA-treated Diff Caco-2 cells. Table A9: Differential gene expression in H2O2-treated Diff Caco-2 cells. Table A10: Differential gene expression in 13-HPODE-treated PDiff Caco-2 cells. Table A11: Gene Ontology analysis (biological processes) in 13-HPODE-treated PDiff Caco-2 cells. Table A12: Gene Ontology analysis (molecular functions) in 13-HPODE-treated PDiff Caco-2 cells. Table A13: Gene Ontology analysis (cellular components) in 13-HPODE-treated PDiff Caco-2 cells. Table A14: Differential gene expression in LA-treated PDiff Caco-2 cells. Table A15: Gene Ontology analysis (biological processes) in LA-treated PDiff Caco-2 cells. Table A16: Gene Ontology analysis (molecular functions) in LA-treated PDiff Caco-2 cells. Table A17: Gene Ontology analysis (cellular components) in LA-treated PDiff Caco-2 cells. Table A18: Differential gene expression in H2O2-treated PDiff Caco-2 cells. Table A19: Gene Ontology analysis (biological processes) in H2O2-treated PDiff Caco-2 cells. Table A20: Gene Ontology analysis (molecular functions) in H2O2-treated PDiff Caco-2 cells. Table A21: Gene Ontology analysis (cellular components) in H2O2-treated PDiff Caco-2 cells.
127 LIST OF REFERENCES
Ahmad, R., Rah, B., Bastola, D., Dhawan, P., & Singh, A. B. (2017). Obesity-induces Organ and
Tissue Specific Tight Junction Restructuring and Barrier Deregulation by Claudin
Switching. Scientific Reports, 7(1), 5125. https://doi.org/10.1038/s41598-017-04989-8
Akazawa-Ogawa, Y., Shichiri, M., Nishio, K., Yoshida, Y., Niki, E., & Hagihara, Y. (2015).
Singlet-oxygen-derived products from linoleate activate Nrf2 signaling in skin cells. Free
Radical Biology and Medicine, 79, 164–175.
https://doi.org/10.1016/j.freeradbiomed.2014.12.004
Al-Khallaf, H. (2017). Isocitrate dehydrogenases in physiology and cancer: biochemical and
molecular insight. Cell & Bioscience, 7(1), 37. https://doi.org/10.1186/s13578-017-0165-3
Amelio, I., Cutruzzolá, F., Antonov, A., Agostini, M., & Melino, G. (2014). Serine and glycine
metabolism in cancer. Trends in Biochemical Sciences, 39(4), 191–198.
https://doi.org/10.1016/j.tibs.2014.02.004
Ander, B. P., Dupasquier, C. M. C., Prociuk, M. A., & Pierce, G. N. (2003). Polyunsaturated
fatty acids and their effects on cardiovascular disease. Experimental and Clinical
Cardiology, 8(4), 164–172.
Andrews, S. (2010). FastQC - A quality control tool for high throughput sequence data.
http://www.bioinformatics.babraham.ac.uk/projects/fastqc/. In Babraham Bioinformatics.
https://doi.org/citeulike-article-id:11583827
Ashizuka, S., Inagaki-Ohara, K., Kuwasako, K., Kato, J., Inatsu, H., & Kitamura, K. (2009).
Adrenomedullin treatment reduces intestinal inflammation and maintains epithelial barrier
function in mice administered dextran sulphate sodium. Microbiology and Immunology,
128 53(10), 573–581. https://doi.org/10.1111/j.1348-0421.2009.00159.x
Auerbach, B. J., Kiely, J. S., & Cornicelli, J. A. (1992). A spectrophotometric microtiter-based
assay for the detection of hydroperoxy derivatives of linoleic acid. Analytical Biochemistry,
201(2), 375–380. https://doi.org/10.1016/0003-2697(92)90354-A
Ayala, A., Muñoz, M. F., & Argüelles, S. (2014). Lipid Peroxidation: Production, Metabolism,
and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxidative
Medicine and Cellular Longevity, 2014, 1–31. https://doi.org/10.1155/2014/360438
Barrera, G. (2012). Oxidative stress and lipid peroxidation products in cancer progression and
therapy. ISRN Oncology, 2012, 137289. https://doi.org/10.5402/2012/137289
Barron, L., Sun, R. C., Aladegbami, B., Erwin, C. R., Warner, B. W., & Guo, J. (2017). Intestinal
Epithelial-Specific mTORC1 Activation Enhances Intestinal Adaptation After Small Bowel
Resection. Cellular and Molecular Gastroenterology and Hepatology, 3(2), 231–244.
https://doi.org/10.1016/j.jcmgh.2016.10.006
Barski, O. A., Tipparaju, S. M., & Bhatnagar, A. (2008). The aldo-keto reductase superfamily
and its role in drug metabolism and detoxification. Drug Metabolism Reviews, 40(4), 553–
624. https://doi.org/10.1080/03602530802431439
Bateman, A. (2019). UniProt: a worldwide hub of protein knowledge. Nucleic Acids Research,
47(D1), D506–D515. https://doi.org/10.1093/nar/gky1049
Beauchemin, N., & Arabzadeh, A. (2013). Carcinoembryonic antigen-related cell adhesion
molecules (CEACAMs) in cancer progression and metastasis. Cancer and Metastasis
Reviews, 32(3–4), 643–671. https://doi.org/10.1007/s10555-013-9444-6
Beaulieu, J. F., & Quaroni, A. (1991). Clonal analysis of sucrase-isomaltase expression in the
129 human colon adenocarcinoma Caco-2 cells. Biochemical Journal, 280(3), 599–608.
https://doi.org/10.1042/bj2800599
Beeharry, N., Lowe, J. E., Hernandez, A. R., Chambers, J. A., Fucassi, F., Cragg, P. J., Green,
M. H. ., & Green, I. C. (2003). Linoleic acid and antioxidants protect against DNA damage
and apoptosis induced by palmitic acid. Mutation Research/Fundamental and Molecular
Mechanisms of Mutagenesis, 530(1–2), 27–33. https://doi.org/10.1016/S0027-
5107(03)00134-9
Begriche, K., Igoudjil, A., Pessayre, D., & Fromenty, B. (2006). Mitochondrial dysfunction in
NASH: Causes, consequences and possible means to prevent it. Mitochondrion, 6(1), 1–28.
https://doi.org/10.1016/j.mito.2005.10.004
Benatti, P., Peluso, G., Nicolai, R., & Calvani, M. (2004). Polyunsaturated fatty acids:
biochemical, nutritional and epigenetic properties. Journal of the American College of
Nutrition, 23(4), 281–302. https://doi.org/10.1080/07315724.2004.10719371
Bergström, S. (1945). Autoxidation of Linoleic Acid. Nature, 156(3972), 717–718.
https://doi.org/10.1038/156717b0
Bernotti, S., Seidman, E., Sinnett, D., Brunet, S., Dionne, S., Delvin, E., & Levy, E. (2003).
Inflammatory reaction without endogenous antioxidant response in Caco-2 cells exposed to
iron/ascorbate-mediated lipid peroxidation. American Journal of Physiology-
Gastrointestinal and Liver Physiology, 285(5), G898–G906.
https://doi.org/10.1152/ajpgi.00042.2003
Beyaz, S., & Yilmaz, Ö. H. (2016). Molecular Pathways: Dietary Regulation of Stemness and
Tumor Initiation by the PPAR-δ Pathway. Clinical Cancer Research, 22(23), 5636–5641.
130 https://doi.org/10.1158/1078-0432.CCR-16-0775
Bhaskar, N., Narasimhulu, C. A., Keewan, E., Rohr, M., & Parthasarathy, S. (2019).
Proinflammatory Properties of Peroxidized Fat May Contribute to the Etiology of Crohn’s
Disease. Journal of Medicinal Food, 22(2), 162–169. https://doi.org/10.1089/jmf.2018.0132
Bindoli, A., Valente, M., & Cavallini, L. (1985). Inhibition of lipid peroxidation by alpha-
tocopherolquinone and alpha-tocopherolhydroquinone. Biochemistry International, 10(5),
753–761.
Blokhina, O. (2003). Antioxidants, Oxidative Damage and Oxygen Deprivation Stress: a
Review. Annals of Botany, 91(2), 179–194. https://doi.org/10.1093/aob/mcf118
Bochkov, V. N., & Leitinger, N. (2003). Anti-inflammatory properties of lipid oxidation
products. Journal of Molecular Medicine, 81(10), 613–626. https://doi.org/10.1007/s00109-
003-0467-2
Boivin, M. A., Ye, D., Kennedy, J. C., Al-Sadi, R., Shepela, C., & Ma, T. Y. (2007). Mechanism
of glucocorticoid regulation of the intestinal tight junction barrier. American Journal of
Physiology-Gastrointestinal and Liver Physiology, 292(2), G590–G598.
https://doi.org/10.1152/ajpgi.00252.2006
Boland, B. S., Widjaja, C. E., Banno, A., Zhang, B., Kim, S. H., Stoven, S., Peterson, M. R.,
Jones, M. C., Su, H. I., Crowe, S. E., Bui, J. D., Ho, S. B., Okugawa, Y., Goel, A., Marietta,
E. V., Khosroheidari, M., Jepsen, K., Aramburu, J., López-Rodríguez, C., … Chang, J. T.
(2015). Immunodeficiency and Autoimmune Enterocolopathy Linked to NFAT5
Haploinsufficiency. The Journal of Immunology, 194(6), 2551–2560.
https://doi.org/10.4049/jimmunol.1401463
131 Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina
sequence data. Bioinformatics, 30(15), 2114–2120.
https://doi.org/10.1093/bioinformatics/btu170
Bourgine, J., Billaut-Laden, I., Happillon, M., Lo-Guidice, J.-M., Maunoury, V., Imbenotte, M.,
& Broly, F. (2012). Gene expression profiling of systems involved in the metabolism and
the disposition of xenobiotics: comparison between human intestinal biopsy samples and
colon cell lines. Drug Metabolism and Disposition: The Biological Fate of Chemicals,
40(4), 694–705. https://doi.org/10.1124/dmd.111.042465
Brodkorb, A., Egger, L., Alminger, M., Alvito, P., Assunção, R., Ballance, S., Bohn, T.,
Bourlieu-Lacanal, C., Boutrou, R., Carrière, F., Clemente, A., Corredig, M., Dupont, D.,
Dufour, C., Edwards, C., Golding, M., Karakaya, S., Kirkhus, B., Le Feunteun, S., …
Recio, I. (2019). INFOGEST static in vitro simulation of gastrointestinal food digestion.
Nature Protocols, 14(4), 991–1014. https://doi.org/10.1038/s41596-018-0119-1
Bruder, E. D., Ball, D. L., Goodfriend, T. L., & Raff, H. (2003). An oxidized metabolite of
linoleic acid stimulates corticosterone production by rat adrenal cells. American Journal of
Physiology-Regulatory, Integrative and Comparative Physiology, 284(6), R1631–R1635.
https://doi.org/10.1152/ajpregu.00753.2002
Bruder, E., Raff, H., & Goodfriend, T. (2006). An Oxidized Derivative of Linoleic Acid
Stimulates Dehydroepiandrosterone Production by Human Adrenal Cells. Hormone and
Metabolic Research, 38(12), 803–806. https://doi.org/10.1055/s-2006-956182
Bull, A. W., Steffensen, K. R., Leers, J., & Rafter, J. J. (2003). Activation of PPAR γ in colon
tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR γ.
132 Carcinogenesis, 24(11), 1717–1722. https://doi.org/10.1093/carcin/bgg131
Calder, P., & Grimble, R. (2002). Polyunsaturated fatty acids, inflammation and immunity.
European Journal of Clinical Nutrition, 56(S3), S14–S19.
https://doi.org/10.1038/sj.ejcn.1601478
Calviello, G. (2003). gamma-Tocopheryl quinone induces apoptosis in cancer cells via caspase-9
activation and cytochrome c release. Carcinogenesis, 24(3), 427–433.
https://doi.org/10.1093/carcin/24.3.427
Carini, F., Mazzola, M., Rappa, F., Jurjus, A., Geagea, A. G., Al Kattar, S., Bou-Assi, T., Jurjus,
R., Damiani, P., Leone, A., & Tomasello, G. (2017). Colorectal Carcinogenesis: Role of
Oxidative Stress and Antioxidants. Anticancer Research, 37(9), 4759–4766.
https://doi.org/10.21873/anticanres.11882
Cepinskas, G., Kvietys, P. R., & Aw, T. Y. (1994). ω3-Lipid peroxides injure CaCo-2 cells:
Relationship to the development of reduced glutathione antioxidant systems.
Gastroenterology, 107(1), 80–86. https://doi.org/10.1016/0016-5085(94)90063-9
Cerbone, A., Toaldo, C., Laurora, S., Briatore, F., Pizzimenti, S., Dianzani, M. U., Ferretti, C., &
Barrera, G. (2007). 4-Hydroxynonenal and PPARgamma ligands affect proliferation,
differentiation, and apoptosis in colon cancer cells. Free Radical Biology & Medicine,
42(11), 1661–1670. https://doi.org/10.1016/j.freeradbiomed.2007.02.009
Chang, G. W. M., & Kam, P. C. A. (1999). The physiological and pharmacological roles of
cytochrome P450 isoenzymes. Anaesthesia, 54(1), 42–50. https://doi.org/10.1046/j.1365-
2044.1999.00602.x
Chester, A. (2003). The apolipoprotein B mRNA editing complex performs a multifunctional
133 cycle and suppresses nonsense-mediated decay. The EMBO Journal, 22(15), 3971–3982.
https://doi.org/10.1093/emboj/cdg369
Cima, I., Corazza, N., Dick, B., Fuhrer, A., Herren, S., Jakob, S., Ayuni, E., Mueller, C., &
Brunner, T. (2004). Intestinal Epithelial Cells Synthesize Glucocorticoids and Regulate T
Cell Activation. Journal of Experimental Medicine, 200(12), 1635–1646.
https://doi.org/10.1084/jem.20031958
D’Ambrosio, D. N., Clugston, R. D., & Blaner, W. S. (2011). Vitamin A Metabolism: An
Update. Nutrients, 3(1), 63–103. https://doi.org/10.3390/nu3010063
Dai, K., Khatun, I., & Hussain, M. M. (2010). NR2F1 and IRE1β Suppress Microsomal
Triglyceride Transfer Protein Expression and Lipoprotein Assembly in Undifferentiated
Intestinal Epithelial Cells. Arteriosclerosis, Thrombosis, and Vascular Biology, 30(3), 568–
574. https://doi.org/10.1161/ATVBAHA.109.198135 de Lorgeril, M., & Salen, P. (2012). New insights into the health effects of dietary saturated and
omega-6 and omega-3 polyunsaturated fatty acids. BMC Medicine, 10, 50.
https://doi.org/10.1186/1741-7015-10-50
Deiana, M., Corona, G., Incani, A., Loru, D., Rosa, A., Atzeri, A., Paola Melis, M., & Assunta
Dessì, M. (2010). Protective effect of simple phenols from extravirgin olive oil against lipid
peroxidation in intestinal Caco-2 cells. Food and Chemical Toxicology, 48(10), 3008–3016.
https://doi.org/10.1016/j.fct.2010.07.041
Delerive, P., De Bosscher, K., Besnard, S., Vanden Berghe, W., Peters, J. M., Gonzalez, F. J.,
Fruchart, J.-C., Tedgui, A., Haegeman, G., & Staels, B. (1999). Peroxisome Proliferator-
activated Receptor α Negatively Regulates the Vascular Inflammatory Gene Response by
134 Negative Cross-talk with Transcription Factors NF-κB and AP-1. Journal of Biological
Chemistry, 274(45), 32048–32054. https://doi.org/10.1074/jbc.274.45.32048
Delerive, P., Furman, C., Teissier, E., Fruchart, J.-C., Duriez, P., & Staels, B. (2000). Oxidized
phospholipids activate PPARα in a phospholipase A2-dependent manner. FEBS Letters,
471(1), 34–38. https://doi.org/10.1016/S0014-5793(00)01364-8
Delie, F., & Rubas, W. (1997). A Human Colonic Cell Line Sharing Similarities With
Enterocytes as a Model to Examine Oral Absorption: Advantages and Limitations of the
Caco-2 Model. Critical ReviewsTM in Therapeutic Drug Carrier Systems, 14(3), 66.
https://doi.org/10.1615/CritRevTherDrugCarrierSyst.v14.i3.20
DeMeo, M. T., Mutlu, E. A., Keshavarzian, A., & Tobin, M. C. (2002). Intestinal Permeation
and Gastrointestinal Disease. Journal of Clinical Gastroenterology, 34(4), 385–396.
https://doi.org/10.1097/00004836-200204000-00003
Demeyer, D., Mertens, B., De Smet, S., & Ulens, M. (2016). Mechanisms Linking Colorectal
Cancer to the Consumption of (Processed) Red Meat: A Review. Critical Reviews in Food
Science and Nutrition, 56(16), 2747–2766. https://doi.org/10.1080/10408398.2013.873886
Dinicolantonio, J. J., & O’Keefe, J. H. (2018). Omega-6 vegetable oils as a driver of coronary
heart disease: The oxidized linoleic acid hypothesis. In Open Heart (Vol. 5, Issue 2, p.
e000898). https://doi.org/10.1136/openhrt-2018-000898
Dobrzyńska, I., Szachowicz-Petelska, B., Sulkowski, S., & Figaszewski, Z. (2005). Changes in
electric charge and phospholipids composition in human colorectal cancer cells. Molecular
and Cellular Biochemistry, 276(1–2), 113–119. https://doi.org/10.1007/s11010-005-3557-3
Dolfi, S. C., Yang, Z., Lee, M.-J., Guan, F., Hong, J., & Yang, C. S. (2013). Inhibitory Effects of
135 Different Forms of Tocopherols, Tocopherol Phosphates, and Tocopherol Quinones on
Growth of Colon Cancer Cells. Journal of Agricultural and Food Chemistry, 61(36), 8533–
8540. https://doi.org/10.1021/jf401076g
Driessens, N., Versteyhe, S., Ghaddhab, C., Burniat, A., De Deken, X., Van Sande, J., Dumont,
J.-E., Miot, F., & Corvilain, B. (2009). Hydrogen peroxide induces DNA single- and
double-strand breaks in thyroid cells and is therefore a potential mutagen for this organ.
Endocrine-Related Cancer, 16(3), 845–856. https://doi.org/10.1677/ERC-09-0020
Eilertsen, K. J., Kazmierski, S. T., & Keller, T. C. S. (1994a). Cellular titin localization in stress
fibers and interaction with myosin II filaments in vitro. Journal of Cell Biology, 126(5),
1201–1210. https://doi.org/10.1083/jcb.126.5.1201
Eilertsen, K. J., Kazmierski, S. T., & Keller, T. C. S. (1994b). Cellular titin localization in stress
fibers and interaction with myosin II filaments in vitro. The Journal of Cell Biology, 126(5),
1201–1210. https://doi.org/10.1083/jcb.126.5.1201
Engle, M. J., Goetz, G. S., & Alpers, D. H. (1998). Caco-2 cells express a combination of
colonocyte and enterocyte phenotypes. Journal of Cellular Physiology, 174(3), 362–369.
https://doi.org/10.1002/(SICI)1097-4652(199803)174:3<362::AID-JCP10>3.0.CO;2-B
Epstein, F. H., Steinberg, D., Parthasarathy, S., Carew, T. E., Khoo, J. C., & Witztum, J. L.
(1989). Beyond Cholesterol. New England Journal of Medicine, 320(14), 915–924.
https://doi.org/10.1056/NEJM198904063201407
Escudero, P., Martinez de Marañón, A., Collado, A., Gonzalez-Navarro, H., Hermenegildo, C.,
Peiró, C., Piqueras, L., & Sanz, M.-J. (2015). Combined Sub-Optimal Doses of
Rosuvastatin and Bexarotene Impair Angiotensin II-Induced Arterial Mononuclear Cell
136 Adhesion Through Inhibition of Nox5 Signaling Pathways and Increased RXR/PPARα and
RXR/PPARγ Interactions. Antioxidants & Redox Signaling, 22(11), 901–920.
https://doi.org/10.1089/ars.2014.5969
Espinola-Klein, C., Rupprecht, H. J., Bickel, C., Schnabel, R., Genth-Zotz, S., Torzewski, M.,
Lackner, K., Munzel, T., & Blankenberg, S. (2007). Glutathione Peroxidase-1 Activity,
Atherosclerotic Burden, and Cardiovascular Prognosis. The American Journal of
Cardiology, 99(6), 808–812. https://doi.org/10.1016/j.amjcard.2006.10.041
Esterbauer, H., Gebicki, J., Puhl, H., & Jürgens, G. (1992). The role of lipid peroxidation and
antioxidants in oxidative modification of LDL. Free Radical Biology & Medicine, 13(4),
341–390. https://doi.org/10.1016/0891-5849(92)90181-f
Faizo, N., Narasimhulu, C. A., Forsman, A., Yooseph, S., & Parthasarathy, S. (2021).
Peroxidized Linoleic Acid, 13-HPODE, Alters Gene Expression Profile in Intestinal
Epithelial Cells. Foods, 10(2), 314. https://doi.org/10.3390/foods10020314
Fajardo, A. M., MacKenzie, D. A., Olguin, S. L., Scariano, J. K., Rabinowitz, I., & Thompson,
T. A. (2016). Antioxidants Abrogate Alpha-Tocopherylquinone-Mediated Down-
Regulation of the Androgen Receptor in Androgen-Responsive Prostate Cancer Cells.
PLOS ONE, 11(3), e0151525. https://doi.org/10.1371/journal.pone.0151525
Fujimoto, Y., Yonemura, T., & Sakuma, S. (2008). Role of Linoleic Acid Hydroperoxide
Preformed by Cyclooxygenase-1 or -2 on the Regulation of Prostaglandin Formation from
Arachidonic Acid by the Respective Enzyme. Journal of Clinical Biochemistry and
Nutrition, 43(2), 65–68. https://doi.org/10.3164/jcbn.2008047
Gerloff, K., Pereira, D. I. A., Faria, N., Boots, A. W., Kolling, J., Förster, I., Albrecht, C.,
137 Powell, J. J., & Schins, R. P. F. (2013). Influence of simulated gastrointestinal conditions on
particle-induced cytotoxicity and interleukin-8 regulation in differentiated and
undifferentiated Caco-2 cells. Nanotoxicology, 7(4), 353–366.
https://doi.org/10.3109/17435390.2012.662249
Gheorghiu, I., Deschênes, C., Blais, M., Boudreau, F., Rivard, N., & Asselin, C. (2001). Role of
Specific CCAAT/Enhancer-binding Protein Isoforms in Intestinal Epithelial Cells. Journal
of Biological Chemistry, 276(47), 44331–44337. https://doi.org/10.1074/jbc.M107591200
Giudetti, A. M., Damiano, F., Gnoni, G. V., & Siculella, L. (2013). Low level of hydrogen
peroxide induces lipid synthesis in BRL-3A cells through a CAP-independent SREBP-1a
activation. The International Journal of Biochemistry & Cell Biology, 45(7), 1419–1426.
https://doi.org/10.1016/j.biocel.2013.04.004
Gotoh, Y., Noda, T., Iwakiri, R., Fujimoto, K., Rhoads, C. A., & Aw, T. Y. (2002). Lipid
peroxide-induced redox imbalance differentially mediates CaCo-2 cell proliferation and
growth arrest. Cell Proliferation, 35(4), 221–235. https://doi.org/10.1046/j.1365-
2184.2002.00241.x
Grabacka, M., & Reiss, K. (2008). Anticancer Properties of PPAR α -Effects on Cellular
Metabolism and Inflammation. PPAR Research, 2008, 1–9.
https://doi.org/10.1155/2008/930705
Günther, J., & Seyfert, H.-M. (2018). The first line of defence: insights into mechanisms and
relevance of phagocytosis in epithelial cells. Seminars in Immunopathology, 40(6), 555–
565. https://doi.org/10.1007/s00281-018-0701-1
Guo, M., Zhou, X., Han, X., Zhang, Y., & Jiang, L. (2019). SPINK1 is a prognosis predicting
138 factor of non‑small cell lung cancer and regulates redox homeostasis. Oncology Letters.
https://doi.org/10.3892/ol.2019.11005
Halbleib, J. M., Sääf, A. M., Brown, P. O., & Nelson, W. J. (2007). Transcriptional Modulation
of Genes Encoding Structural Characteristics of Differentiating Enterocytes During
Development of a Polarized Epithelium In Vitro. Molecular Biology of the Cell, 18(11),
4261–4278. https://doi.org/10.1091/mbc.e07-04-0308
Halliwell, B., Clement, M. V., & Long, L. H. (2000). Hydrogen peroxide in the human body.
FEBS Letters, 486(1), 10–13. https://doi.org/10.1016/S0014-5793(00)02197-9
Hitchon, C. A., & El-Gabalawy, H. S. (2004). Oxidation in rheumatoid arthritis. Arthritis
Research & Therapy, 6(6), 265–278. https://doi.org/10.1186/ar1447
Huang, B., Song, B., & Xu, C. (2020). Cholesterol metabolism in cancer: mechanisms and
therapeutic opportunities. Nature Metabolism, 2(2), 132–141.
https://doi.org/10.1038/s42255-020-0174-0
Hudson, B. H., & York, J. D. (2014). Tissue-specific regulation of 3′-nucleotide hydrolysis and
nucleolar architecture. Advances in Biological Regulation, 54, 208–213.
https://doi.org/10.1016/j.jbior.2013.11.002
Hussain, M. M. (2014). Intestinal lipid absorption and lipoprotein formation. Current Opinion in
Lipidology, 25(3), 200–206. https://doi.org/10.1097/MOL.0000000000000084
Innes, J. K., & Calder, P. C. (2018). Omega-6 fatty acids and inflammation. Prostaglandins,
Leukotrienes and Essential Fatty Acids, 132, 41–48.
https://doi.org/10.1016/j.plefa.2018.03.004
Intrasuksri, U., Rangwala, S. M., O’Brien, M., Noonan, D. J., & Feller, D. R. (1998).
139 Mechanisms of peroxisome proliferation by perfluorooctanoic acid and endogenous fatty
acids. General Pharmacology, 31(2), 187–197. https://doi.org/10.1016/s0306-
3623(98)00029-9
Iqbal, J., Rudel, L. L., & Hussain, M. M. (2008). Microsomal Triglyceride Transfer Protein
Enhances Cellular Cholesteryl Esterification by Relieving Product Inhibition. Journal of
Biological Chemistry, 283(29), 19967–19980. https://doi.org/10.1074/jbc.M800398200
Ishii, T., Itoh, K., Ruiz, E., Leake, D. S., Unoki, H., Yamamoto, M., & Mann, G. E. (2004). Role
of Nrf2 in the Regulation of CD36 and Stress Protein Expression in Murine Macrophages.
Circulation Research, 94(5), 609–616.
https://doi.org/10.1161/01.RES.0000119171.44657.45
Jakubczyk, K., Kałduńska, J., Dec, K., Kawczuga, D., & Janda, K. (2020). Antioxidant
properties of small-molecule non-enzymatic compounds. Polski Merkuriusz Lekarski :
Organ Polskiego Towarzystwa Lekarskiego, 48(284), 128–132.
Jiao, M., Ren, F., Zhou, L., Zhang, X., Zhang, L., Wen, T., Wei, L., Wang, X., Shi, H., Bai, L.,
Zhang, X., Zheng, S., Zhang, J., Chen, Y., Han, Y., Zhao, C., & Duan, Z. (2014).
Peroxisome proliferator-activated receptor α activation attenuates the inflammatory
response to protect the liver from acute failure by promoting the autophagy pathway. Cell
Death & Disease, 5(8), e1397. https://doi.org/10.1038/cddis.2014.361
Jin, W. (2020). Regulation of Src Family Kinases during Colorectal Cancer Development and Its
Clinical Implications. Cancers, 12(5), 1339. https://doi.org/10.3390/cancers12051339
Johnson, I. T. (2002). Anticarcinogenic effects of diet-related apoptosis in the colorectal mucosa.
Food and Chemical Toxicology, 40(8), 1171–1178. https://doi.org/10.1016/S0278-
140 6915(02)00051-0
Kaemmerer, E., Schutt, F., Krohne, T. U., Holz, F. G., & Kopitz, J. (2007). Effects of Lipid
Peroxidation-Related Protein Modifications on RPE Lysosomal Functions and POS
Phagocytosis. Investigative Opthalmology & Visual Science, 48(3), 1342.
https://doi.org/10.1167/iovs.06-0549
Kaminsky, L. S., & Fasco, M. J. (1992). Small Intestinal Cytochromes P450. Critical Reviews in
Toxicology, 21(6), 407–422. https://doi.org/10.3109/10408449209089881
Kamitani, H., Geller, M., & Eling, T. (1998). Expression of 15-Lipoxygenase by Human
Colorectal Carcinoma Caco-2 Cells during Apoptosis and Cell Differentiation. Journal of
Biological Chemistry, 273(34), 21569–21577. https://doi.org/10.1074/jbc.273.34.21569
Katsube, T., Tsuji, H., & Onoda, M. (2007). Nitric oxide attenuates hydrogen peroxide-induced
barrier disruption and protein tyrosine phosphorylation in monolayers of intestinal epithelial
cell. Biochimica et Biophysica Acta, 1773(6), 794–803.
https://doi.org/10.1016/j.bbamcr.2007.03.002
Keewan, E., Narasimhulu, C. A., Rohr, M., Hamid, S., & Parthasarathy, S. (2020). Are fried
foods unhealthy? The dietary peroxidized fatty acid, 13-hpode, induces intestinal
inflammation in vitro and in vivo. Antioxidants, 9(10), 1–17.
https://doi.org/10.3390/antiox9100926
Keshamouni, V. G., Arenberg, D. A., Reddy, R. C., Newstead, M. J., Anthwal, S., & Standiford,
T. J. (2005). PPAR-γ activation inhibits angiogenesis by blocking ELR+CXC chemokine
production in non-small cell lung cancer. Neoplasia, 7(3), 294–301.
https://doi.org/10.1593/neo.04601
141 Khan-Merchant, N., Penumetcha, M., Meilhac, O., & Parthasarathy, S. (2002). Oxidized Fatty
Acids Promote Atherosclerosis Only in the Presence of Dietary Cholesterol in Low-Density
Lipoprotein Receptor Knockout Mice. The Journal of Nutrition, 132(11), 3256–3262.
https://doi.org/10.1093/jn/132.11.3256
Kim, D., Langmead, B., & Salzberg, S. L. (2015). HISAT: a fast spliced aligner with low
memory requirements. Nature Methods, 12(4), 357–360.
https://doi.org/10.1038/nmeth.3317
Kim, J.-A. (2020). Peroxisome Metabolism in Cancer. Cells, 9(7), 1692.
https://doi.org/10.3390/cells9071692
Kobayashi, H., Matsuda, M., Fukuhara, A., Komuro, R., & Shimomura, I. (2009). Dysregulated
glutathione metabolism links to impaired insulin action in adipocytes. American Journal of
Physiology-Endocrinology and Metabolism, 296(6), E1326–E1334.
https://doi.org/10.1152/ajpendo.90921.2008
Koch, S., Nava, P., Addis, C., Kim, W., Denning, T. L., Li, L., Parkos, C. A., & Nusrat, A.
(2011). The Wnt Antagonist Dkk1 Regulates Intestinal Epithelial Homeostasis and Wound
Repair. Gastroenterology, 141(1), 259-268.e8. https://doi.org/10.1053/j.gastro.2011.03.043
Koehne, C.-H., & Dubois, R. N. (2004). COX-2 inhibition and colorectal cancer. Seminars in
Oncology, 31(2 Suppl 7), 12–21. https://doi.org/10.1053/j.seminoncol.2004.03.041
Koizume, S., & Miyagi, Y. (2016). Lipid Droplets: A Key Cellular Organelle Associated with
Cancer Cell Survival under Normoxia and Hypoxia. International Journal of Molecular
Sciences, 17(9), 1430. https://doi.org/10.3390/ijms17091430
König, B., & Eder, K. (2006). Differential action of 13-HPODE on PPARalpha downstream
142 genes in rat Fao and human HepG2 hepatoma cell lines. The Journal of Nutritional
Biochemistry, 17(6), 410–418. https://doi.org/10.1016/j.jnutbio.2005.08.011
Kosinski, C., Stange, D. E., Xu, C., Chan, A. S., Ho, C., Yuen, S. T., Mifflin, R. C., Powell, D.
W., Clevers, H., Leung, S. Y., & Chen, X. (2010). Indian hedgehog regulates intestinal stem
cell fate through epithelial-mesenchymal interactions during development.
Gastroenterology, 139(3), 893–903. https://doi.org/10.1053/j.gastro.2010.06.014
Kukurba, K. R., & Montgomery, S. B. (2015). RNA sequencing and analysis. Cold Spring
Harbor Protocols. https://doi.org/10.1101/pdb.top084970
Kwon, S. Y., Massey, K., Watson, M. A., Hussain, T., Volpe, G., Buckley, C. D., Nicolaou, A.,
& Badenhorst, P. (2020). Oxidised metabolites of the omega-6 fatty acid linoleic acid
activate dFOXO. Life Science Alliance, 3(2), e201900356.
https://doi.org/10.26508/lsa.201900356
Laborde, E. (2010). Glutathione transferases as mediators of signaling pathways involved in cell
proliferation and cell death. Cell Death & Differentiation, 17(9), 1373–1380.
https://doi.org/10.1038/cdd.2010.80
Laprise, P., Chailler, P., Houde, M., Beaulieu, J.-F., Boucher, M.-J., & Rivard, N. (2002).
Phosphatidylinositol 3-Kinase Controls Human Intestinal Epithelial Cell Differentiation by
Promoting Adherens Junction Assembly and p38 MAPK Activation. Journal of Biological
Chemistry, 277(10), 8226–8234. https://doi.org/10.1074/jbc.M110235200
Lea, T. (2015). Caco-2 Cell Line. In The Impact of Food Bioactives on Health: in vitro and ex
vivo models. Springer International Publishing. https://doi.org/10.1007/978-3-319-16104-
4_10
143 Lee, J. W., Bajwa, P. J., Carson, M. J., Jeske, D. R., Cong, Y., Elson, C. O., Lytle, C., & Straus,
D. S. (2007). Fenofibrate Represses Interleukin-17 and Interferon-γ Expression and
Improves Colitis in Interleukin-10–Deficient Mice. Gastroenterology, 133(1), 108–123.
https://doi.org/10.1053/j.gastro.2007.03.113
Lee, J. Y., & Hwang, D. H. (2006). The modulation of inflammatory gene expression by lipids:
mediation through Toll-like receptors. Molecules and Cells, 21(2), 174–185.
Lee, J. Y., Plakidas, A., Lee, W. H., Heikkinen, A., Chanmugam, P., Bray, G., & Hwang, D. H.
(2003). Differential modulation of Toll-like receptors by fatty acids. Journal of Lipid
Research, 44(3), 479–486. https://doi.org/10.1194/jlr.M200361-JLR200
Lee, S.-A., Belyaeva, O. V., & Kedishvili, N. Y. (2008). Effect of lipid peroxidation products on
the activity of human retinol dehydrogenase 12 (RDH12) and retinoid metabolism.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1782(6), 421–425.
https://doi.org/10.1016/j.bbadis.2008.03.004
Leonarduzzi, G., Chiarpotto, E., Biasi, F., & Poli, G. (2005). 4-Hydroxynonenal and cholesterol
oxidation products in atherosclerosis. Molecular Nutrition and Food Research.
https://doi.org/10.1002/mnfr.200500090
Leonarduzzi, G., Sottero, B., & Poli, G. (2002). Oxidized products of cholesterol: dietary and
metabolic origin, and proatherosclerotic effects (review). The Journal of Nutritional
Biochemistry, 13(12), 700–710. https://doi.org/10.1016/S0955-2863(02)00222-X
Li, X., Xu, M., Liu, M., Ji, Y., & Li, Z. (2015). TNF-alpha and IL-6 inhibit apolipoprotein A-IV
production induced by linoleic acid in human intestinal Caco2 cells. Journal of
Inflammation, 12(1), 22. https://doi.org/10.1186/s12950-015-0069-0
144 Liao, Y., Smyth, G. K., & Shi, W. (2014). featureCounts: an efficient general purpose program
for assigning sequence reads to genomic features. Bioinformatics, 30(7), 923–930.
https://doi.org/10.1093/bioinformatics/btt656
Halvorsen, B. L., & Blomhoff, R. (2011). Determination of lipid oxidation products in vegetable
oils and marine omega-3 supplements. Food & Nutrition Research, 55(1), 5792.
https://doi.org/10.3402/fnr.v55i0.5792
Liu, Y., Li, W., & Duan, Y. (2019). Effect of H2O2 induced oxidative stress (OS) on volatile
organic compounds (VOCs) and intracellular metabolism in MCF-7 breast cancer cells.
Journal of Breath Research, 13(3), 036005. https://doi.org/10.1088/1752-7163/ab14a5
Llor, X. (2003). The effects of fish oil, olive oil, oleic acid and linoleic acid on colorectal
neoplastic processes. Clinical Nutrition, 22(1), 71–79.
https://doi.org/10.1054/clnu.2002.0627
Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and
dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550.
https://doi.org/10.1186/s13059-014-0550-8
Lucas, D. T., & Szweda, L. I. (1998). Cardiac reperfusion injury: Aging, lipid peroxidation, and
mitochondrial dysfunction. Proceedings of the National Academy of Sciences, 95(2), 510–
514. https://doi.org/10.1073/pnas.95.2.510
Lund, I., El Kertaoui, N., Izquierdo, M. S., Dominguez, D., Hansen, B. W., & Kestemont, P.
(2018). The importance of phospholipids combined with long-chain PUFA in formulated
diets for pikeperch ( Sander lucioperca ) larvae. British Journal of Nutrition, 120(6), 628–
644. https://doi.org/10.1017/S0007114518001794
145 Luo, W., Friedman, M. S., Shedden, K., Hankenson, K. D., & Woolf, P. J. (2009). GAGE:
generally applicable gene set enrichment for pathway analysis. BMC Bioinformatics, 10(1),
161. https://doi.org/10.1186/1471-2105-10-161
Lévy, P., Robin, H., Kornprobst, M., Capeau, J., & Cherqui, G. (1998). Enterocytic
differentiation of the human Caco-2 cell line correlates with alterations in integrin signaling.
Journal of Cellular Physiology, 177(4), 618–627. https://doi.org/10.1002/(SICI)1097-
4652(199812)177:4<618::AID-JCP12>3.0.CO;2-R
Ma, Y., Semba, S., Khan, M. R. I., Bochimoto, H., Watanabe, T., Fujiya, M., Kohgo, Y., Liu, Y.,
& Taniguchi, T. (2013). Focal adhesion kinase regulates intestinal epithelial barrier function
via redistribution of tight junction. Biochimica et Biophysica Acta (BBA) - Molecular Basis
of Disease, 1832(1), 151–159. https://doi.org/10.1016/j.bbadis.2012.10.006
Mapother, M. E., & Songer, J. G. (1984). In vitro interaction of Mycobacterium avium with
intestinal epithelial cells. Infection and Immunity, 45(1), 67–73.
https://doi.org/10.1128/iai.45.1.67-73.1984
Mariadason, J. M., Arango, D., Corner, G. A., Arañes, M. J., Hotchkiss, K. A., Yang, W., &
Augenlicht, L. H. (2002). A gene expression profile that defines colon cell maturation in
vitro. Cancer Research, 62(16), 4791–4804.
Marnett, L. J. (1999). Lipid peroxidation—DNA damage by malondialdehyde. Mutation
Research/Fundamental and Molecular Mechanisms of Mutagenesis, 424(1–2), 83–95.
https://doi.org/10.1016/S0027-5107(99)00010-X
Marnett, L. J. (2002). Oxy radicals, lipid peroxidation and DNA damage. Toxicology, 181–182,
219–222. https://doi.org/10.1016/S0300-483X(02)00448-1
146 Márquez-Ruiz, G., García-Martínez, M. C., & Holgado, F. (2008). Changes and Effects of
Dietary Oxidized Lipids in the Gastrointestinal Tract. Lipid Insights, 2, LPI.S904.
https://doi.org/10.4137/LPI.S904
Matsunaga, T., Hojo, A., Yamane, Y., Endo, S., El-Kabbani, O., & Hara, A. (2013).
Pathophysiological roles of aldo–keto reductases (AKR1C1 and AKR1C3) in development
of cisplatin resistance in human colon cancers. Chemico-Biological Interactions, 202(1–3),
234–242. https://doi.org/10.1016/j.cbi.2012.09.024
McDonnell, A. M., & Dang, C. H. (2013). Basic review of the cytochrome p450 system. Journal
of the Advanced Practitioner in Oncology, 4(4), 263–268.
https://doi.org/10.6004/jadpro.2013.4.4.7
Meilhac, O., Zhou, M., Santanara, N., & Parthasarathy, S. (2000). Lipid peroxides induce
expression of catalase in cultured vascular cells. Journal of Lipid Research, 41, 1205–1213.
Meyer, B. J., Mann, N. J., Lewis, J. L., Milligan, G. C., Sinclair, A. J., & Howe, P. R. C. (2003).
Dietary intakes and food sources of omega-6 and omega-3 polyunsaturated fatty acids.
Lipids, 38(4), 391–398. https://doi.org/10.1007/s11745-003-1074-0
Morel, S., Didierlaurent, A., Bourguignon, P., Delhaye, S., Baras, B., Jacob, V., Planty, C.,
Elouahabi, A., Harvengt, P., & Carlsen, H. (2011). Adjuvant System AS03 containing α-
tocopherol modulates innate immune response and leads to improved adaptive immunity.
Vaccine, 29(13), 2461–2473. https://doi.org/10.1016/j.vaccine.2011.01.011
Nakagawa, Y., Satoh, A., Tezuka, H., Han, S., Takei, K., Iwasaki, H., Yatoh, S., Yahagi, N.,
Suzuki, H., Iwasaki, Y., Sone, H., Matsuzaka, T., Yamada, N., & Shimano, H. (2016).
CREB3L3 controls fatty acid oxidation and ketogenesis in synergy with PPARα. Scientific
147 Reports, 6(1), 39182. https://doi.org/10.1038/srep39182
Nakarai, C., Osawa, K., Akiyama, M., Matsubara, N., Ikeuchi, H., Yamano, T., Hirota, S.,
Tomita, N., Usami, M., & Kido, Y. (2015). Expression of AKR1C3 and CNN3 as markers
for detection of lymph node metastases in colorectal cancer. Clinical and Experimental
Medicine, 15(3), 333–341. https://doi.org/10.1007/s10238-014-0298-1
Natarajan, S. K., Amirtharaj, G. J., Ramachandran, A., Pulimood, A. B., & Balasubramanian, K.
A. (2009). Retinoid metabolism in the small intestine during development of liver cirrhosis.
Journal of Gastroenterology and Hepatology, 24(5), 821–829.
https://doi.org/10.1111/j.1440-1746.2008.05771.x
Nauli, A. M., & Whittimore, J. D. (2015). Using caco-2 cells to study lipid transport by the
intestine. Journal of Visualized Experiments, 2015(102), 1–8. https://doi.org/10.3791/53086
Necela, B. M., & Thompson, E. A. (2008). Pathophysiological Roles of PPAR in
Gastrointestinal Epithelial Cells. PPAR Research, 2008, 1–8.
https://doi.org/10.1155/2008/148687
Negre-Salvayre, A., Coatrieux, C., Ingueneau, C., & Salvayre, R. (2008). Advanced lipid
peroxidation end products in oxidative damage to proteins. Potential role in diseases and
therapeutic prospects for the inhibitors. British Journal of Pharmacology, 153(1), 6–20.
https://doi.org/10.1038/sj.bjp.0707395
Negre-Salvayre, A., Auge, N., Ayala, V., Basaga, H., Boada, J., Brenke, R., Chapple, S., Cohen,
G., Feher, J., Grune, T., Lengyel, G., Mann, G. E., Pamplona, R., Poli, G., Portero-Otin, M.,
Riahi, Y., Salvayre, R., Sasson, S., Serrano, J., … Zarkovic, N. (2010). Pathological aspects
of lipid peroxidation. In Free Radical Research.
148 https://doi.org/10.3109/10715762.2010.498478
Nordberg, J., & Arnér, E. S. J. (2001). Reactive oxygen species, antioxidants, and the
mammalian thioredoxin system1 1This review is based on the licentiate thesis “Thioredoxin
reductase—interactions with the redox active compounds 1-chloro-2,4-dinitrobenzene and
lipoic acid” by Jonas Nordberg,. Free Radical Biology and Medicine, 31(11), 1287–1312.
https://doi.org/10.1016/S0891-5849(01)00724-9
Novak, E. A., & Mollen, K. P. (2015). Mitochondrial dysfunction in inflammatory bowel
disease. Frontiers in Cell and Developmental Biology, 3, 62.
https://doi.org/10.3389/fcell.2015.00062
Oberreuther-Moschner, D. L., Rechkemmer, G., & Pool-Zobel, B. L. (2005). Basal colon crypt
cells are more sensitive than surface cells toward hydrogen peroxide, a factor of oxidative
stress. Toxicology Letters, 159(3), 212–218. https://doi.org/10.1016/j.toxlet.2005.05.008
Olahova, M., Taylor, S. R., Khazaipoul, S., Wang, J., Morgan, B. A., Matsumoto, K., Blackwell,
T. K., & Veal, E. A. (2008). A redox-sensitive peroxiredoxin that is important for longevity
has tissue- and stress-specific roles in stress resistance. Proceedings of the National
Academy of Sciences, 105(50), 19839–19844. https://doi.org/10.1073/pnas.0805507105
Ozdemirler, G., Pabuççuoglu, H., Bulut, T., Bugra, D., Uysal, M., & Toker, G. (1998). Increased
lipoperoxide levels and antioxidant system in colorectal cancer. Journal of Cancer Research
and Clinical Oncology, 124(10), 555–559. https://doi.org/10.1007/s004320050214
Pallepati, P., & Averill-Bates, D. A. (2011). Activation of ER stress and apoptosis by hydrogen
peroxide in HeLa cells: Protective role of mild heat preconditioning at 40°C. Biochimica et
Biophysica Acta (BBA) - Molecular Cell Research, 1813(12), 1987–1999.
149 https://doi.org/10.1016/j.bbamcr.2011.07.021
Pan, X., & Hussain, M. M. (2012). Gut triglyceride production. Biochimica et Biophysica Acta
(BBA) - Molecular and Cell Biology of Lipids, 1821(5), 727–735.
https://doi.org/10.1016/j.bbalip.2011.09.013
Patterson, E., Wall, R., Fitzgerald, G. F., Ross, R. P., & Stanton, C. (2012). Health Implications
of High Dietary Omega-6 Polyunsaturated Fatty Acids. Journal of Nutrition and
Metabolism, 2012, 1–16. https://doi.org/10.1155/2012/539426
Pawlak, M., Lefebvre, P., & Staels, B. (2015). Molecular mechanism of PPARα action and its
impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease.
Journal of Hepatology, 62(3), 720–733. https://doi.org/10.1016/j.jhep.2014.10.039
Pazienza, V., Vinciguerra, M., & Mazzoccoli, G. (2012). PPARs Signaling and Cancer in the
Gastrointestinal System. PPAR Research, 2012, 1–10. https://doi.org/10.1155/2012/560846
Peng, I.-W., & Kuo, S.-M. (2003). Research Communication: Flavonoid Structure Affects the
Inhibition of Lipid Peroxidation in Caco-2 Intestinal Cells at Physiological Concentrations.
The Journal of Nutrition, 133(7), 2184–2187. https://doi.org/10.1093/jn/133.7.2184
Penumetcha, M., Khan, N., & Parthasarathy, S. (2000). Dietary oxidized fatty acids: an
atherogenic risk? Journal of Lipid Research, 41(9), 1473–1480.
Penumetcha, M., Khan-Merchant, N., & Parthasarathy, S. (2002). Enhanced solubilization and
intestinal absorption of cholesterol by oxidized linoleic acid. Journal of Lipid Research,
43(6), 895–903.
Perše, M. (2013). Oxidative Stress in the Pathogenesis of Colorectal Cancer: Cause or
Consequence? BioMed Research International, 2013, 1–9.
150 https://doi.org/10.1155/2013/725710
Venkata, R. P., & Subramanyam, R. (2016). Evaluation of the deleterious health effects of
consumption of repeatedly heated vegetable oil. Toxicology Reports, 3, 636–643.
https://doi.org/10.1016/j.toxrep.2016.08.003
Pfaffl, M. W., Lange, I. G., & Meyer, H. H. D. (2003). The gastrointestinal tract as target of
steroid hormone action: Quantification of steroid receptor mRNA expression (AR, ERα,
ERβ and PR) in 10 bovine gastrointestinal tract compartments by kinetic RT-PCR. The
Journal of Steroid Biochemistry and Molecular Biology, 84(2–3), 159–166.
https://doi.org/10.1016/S0960-0760(03)00025-6
Plump, A. S., Scott, C. J., & Breslow, J. L. (1994). Human apolipoprotein A-I gene expression
increases high density lipoprotein and suppresses atherosclerosis in the apolipoprotein E-
deficient mouse. Proceedings of the National Academy of Sciences, 91(20), 9607–9611.
https://doi.org/10.1073/pnas.91.20.9607
Proquin, H., Jonkhout, M. C. M., Jetten, M. J., van Loveren, H., de Kok, T. M., & Briedé, J. J.
(2019). Transcriptome changes in undifferentiated Caco-2 cells exposed to food-grade
titanium dioxide (E171): contribution of the nano- and micro- sized particles. Scientific
Reports, 9(1), 18287. https://doi.org/10.1038/s41598-019-54675-0
Radzikowska, U., Rinaldi, A. O., Çelebi Sözener, Z., Karaguzel, D., Wojcik, M., Cypryk, K.,
Akdis, M., Akdis, C. A., & Sokolowska, M. (2019). The Influence of Dietary Fatty Acids
on Immune Responses. Nutrients, 11(12), 2990. https://doi.org/10.3390/nu11122990
Raghavamenon, A., Garelnabi, M., Babu, S., Aldrich, A., Litvinov, D., & Parthasarathy, S.
(2009). α-Tocopherol Is Ineffective in Preventing the Decomposition of Preformed Lipid
151 Peroxides and May Promote the Accumulation of Toxic Aldehydes: A Potential
Explanation for the Failure of Antioxidants to Affect Human Atherosclerosis. Antioxidants
& Redox Signaling, 11(6), 1237–1248. https://doi.org/10.1089/ars.2008.2248
Ramana, K. V., Srivastava, S., & Singhal, S. S. (2013). Lipid Peroxidation Products in Human
Health and Disease. Oxidative Medicine and Cellular Longevity, 2013, 583438.
https://doi.org/10.1155/2013/583438
Rao, R. (2008). Oxidative stress-induced disruption of epithelial and endothelial tight junctions.
Frontiers in Bioscience : A Journal and Virtual Library, 13, 7210–7226.
https://doi.org/10.2741/3223
Rao, R. K., Basuroy, S., Rao, V. U., Karnaky, K. J., & Gupta, A. (2002). Tyrosine
phosphorylation and dissociation of occludin–ZO-1 and E-cadherin–β-catenin complexes
from the cytoskeleton by oxidative stress. Biochemical Journal, 368(2), 471–481.
https://doi.org/10.1042/bj20011804
Rashid, H.-O., Yadav, R. K., Kim, H.-R., & Chae, H.-J. (2015). ER stress: Autophagy induction,
inhibition and selection. Autophagy, 11(11), 1956–1977.
https://doi.org/10.1080/15548627.2015.1091141
Reddy, J. K., & Qureshi, S. A. (1979). Tumorigenicity of the hypolipidaemic peroxisome
proliferator ethyl-α-p-chlorophenoxyisobutyrate (clofibrate) in rats. British Journal of
Cancer, 40(3), 476–482. https://doi.org/10.1038/bjc.1979.203
Reddy, J. K., Lalvvai, N. D., & Farber, E. (1983). Carcinogenesis by Hepatic Peroxisome
Proliferators: Evaluation of the Risk of Hypolipidemic Drugs and Industrial Plasticizers to
Humans. CRC Critical Reviews in Toxicology, 12(1), 1–58.
152 https://doi.org/10.3109/10408448309029317
Reinaud, O., Delaforge, M., Boucher, J. L., Rocchiccioli, F., & Mansuy, D. (1989). Oxidative
metabolism of linoleic acid by human leukocytes. Biochemical and Biophysical Research
Communications, 161(2), 883–891. https://doi.org/10.1016/0006-291X(89)92682-X
Ringbom, T., Huss, U., Stenholm, Å., Flock, S., Skattebøl, L., Perera, P., & Bohlin, L. (2001).
COX-2 inhibitory effects of naturally occurring and modified fatty acids. Journal of Natural
Products. https://doi.org/10.1021/np000620d
Rohr, M., Narasimhulu, C. A., Keewan, E., Hamid, S., & Parthasarathy, S. (2020). The dietary
peroxidized lipid, 13-HPODE, promotes intestinal inflammation by mediating granzyme B
secretion from natural killer cells. Food and Function, 11(11), 9526–9534.
https://doi.org/10.1039/d0fo02328k
Rohr, M. W., Narasimhulu, C. A., Rudeski-Rohr, T. A., & Parthasarathy, S. (2020). Negative
Effects of a High-Fat Diet on Intestinal Permeability: A Review. In Advances in Nutrition
(Vol. 11, Issue 1, pp. 77–91). https://doi.org/10.1093/advances/nmz061
Rong, R., Ramachandran, S., Penumetcha, M., Khan, N., & Parthasarathy, S. (2002). Dietary
oxidized fatty acids may enhance intestinal apolipoprotein A-I production. Journal of Lipid
Research, 43(4), 557–564.
Rosenberg, I. M., Göke, M., Kanai, M., Reinecker, H. C., & Podolsky, D. K. (1997). Epithelial
cell kinase-B61: an autocrine loop modulating intestinal epithelial migration and barrier
function. The American Journal of Physiology, 273(4), G824-32.
https://doi.org/10.1152/ajpgi.1997.273.4.G824
Sääf, A. M., Halbleib, J. M., Chen, X., Yuen, S. T., Leung, S. Y., Nelson, W. J., & Brown, P. O.
153 (2007). Parallels between Global Transcriptional Programs of Polarizing Caco-2 Intestinal
Epithelial Cells In Vitro and Gene Expression Programs in Normal Colon and Colon
Cancer. Molecular Biology of the Cell, 18(11), 4245–4260.
https://doi.org/10.1091/mbc.e07-04-0309
Salerno, J. W., & Smith, D. E. (1991). The use of sesame oil and other vegetable oils in the
inhibition of human colon cancer growth in vitro. Anticancer Research, 11(1), 209–215.
Saraswathi, V., Wu, G., Toborek, M., & Hennig, B. (2004). Linoleic acid-induced endothelial
activation. Journal of Lipid Research, 45(5), 794–804. https://doi.org/10.1194/jlr.M300497-
JLR200
Schaur, R. J. (2003). Basic aspects of the biochemical reactivity of 4-hydroxynonenal. Molecular
Aspects of Medicine, 24(4–5), 149–159. https://doi.org/10.1016/S0098-2997(03)00009-8
Schrader, M., & Fahimi, H. D. (2006). Peroxisomes and oxidative stress. Biochimica et
Biophysica Acta (BBA) - Molecular Cell Research, 1763(12), 1755–1766.
https://doi.org/10.1016/j.bbamcr.2006.09.006
Schumann, T., König, J., Henke, C., Willmes, D. M., Bornstein, S. R., Jordan, J., Fromm, M. F.,
& Birkenfeld, A. L. (2020). Solute Carrier Transporters as Potential Targets for the
Treatment of Metabolic Disease. Pharmacological Reviews, 72(1), 343–379.
https://doi.org/10.1124/pr.118.015735
Schuster, S., Johnson, C. D., Hennebelle, M., Holtmann, T., Taha, A. Y., Kirpich, I. A., Eguchi,
A., Ramsden, C. E., Papouchado, B. G., McClain, C. J., & Feldstein, A. E. (2018). Oxidized
linoleic acid metabolites induce liver mitochondrial dysfunction, apoptosis, and NLRP3
activation in mice. Journal of Lipid Research, 59(9), 1597–1609.
154 https://doi.org/10.1194/jlr.M083741
Seo, E., Kang, H., Choi, H., Choi, W., & Jun, H.-S. (2019). Reactive oxygen species-induced
changes in glucose and lipid metabolism contribute to the accumulation of cholesterol in the
liver during aging. Aging Cell, 18(2), e12895. https://doi.org/10.1111/acel.12895
Shcherbik, N., & Pestov, D. G. (2019). The Impact of Oxidative Stress on Ribosomes: From
Injury to Regulation. Cells, 8(11), 1379. https://doi.org/10.3390/cells8111379
Shi, H., Noguchi, N., & Niki, E. (1999). Comparative study on dynamics of antioxidative action
of α-tocopheryl hydroquinone, ubiquinol, and α-tocopherol against lipid peroxidation. Free
Radical Biology and Medicine, 27(3–4), 334–346. https://doi.org/10.1016/S0891-
5849(99)00053-2
Shichiri, M. (2014). The role of lipid peroxidation in neurological disorders. Journal of Clinical
Biochemistry and Nutrition, 54(3), 151–160. https://doi.org/10.3164/jcbn.14-10
Shoshani, T., Faerman, A., Mett, I., Zelin, E., Tenne, T., Gorodin, S., Moshel, Y., Elbaz, S.,
Budanov, A., Chajut, A., Kalinski, H., Kamer, I., Rozen, A., Mor, O., Keshet, E.,
Leshkowitz, D., Einat, P., Skaliter, R., & Feinstein, E. (2002). Identification of a Novel
Hypoxia-Inducible Factor 1-Responsive Gene, RTP801, Involved in Apoptosis. Molecular
and Cellular Biology, 22(7), 2283–2293. https://doi.org/10.1128/MCB.22.7.2283-
2293.2002
Sidler, D., Renzulli, P., Schnoz, C., Berger, B., Schneider-Jakob, S., Flück, C., Inderbitzin, D.,
Corazza, N., Candinas, D., & Brunner, T. (2011). Colon cancer cells produce
immunoregulatory glucocorticoids. Oncogene, 30(21), 2411–2419.
https://doi.org/10.1038/onc.2010.629
155 Sies, H. (1997). Oxidative stress: oxidants and antioxidants. Experimental Physiology, 82(2),
291–295. https://doi.org/10.1113/expphysiol.1997.sp004024
Simile, M. M., Latte, G., & Pascale, R. M. (2018). MAF proteins: a family of regulating and
regulated molecules. Digestive Medicine Research, 1, 22–22.
https://doi.org/10.21037/dmr.2018.10.02
Singh, M., Kapoor, A., & Bhatnagar, A. (2015). Oxidative and reductive metabolism of lipid-
peroxidation derived carbonyls. Chemico-Biological Interactions, 234, 261–273.
https://doi.org/10.1016/j.cbi.2014.12.028
Skrzydlewska, E., Stankiewicz, A., Sulkowska, M., Sulkowski, S., & Kasacka, I. (2001).
Antioxidant Status and Lipid Peroxidation in Colorectal Cancer. Journal of Toxicology and
Environmental Health, Part A, 64(3), 213–222.
https://doi.org/10.1080/15287390152543690
Skrzydlewska, E., Sulkowski, S., Koda, M., Zalewski, B., Kanczuga-Koda, L., & Sulkowska, M.
(2005). Lipid peroxidation and antioxidant status in colorectal cancer. World Journal of
Gastroenterology, 11(3), 403–406. https://doi.org/10.3748/wjg.v11.i3.403
Sokoła-Wysoczańska, E., Wysoczański, T., Wagner, J., Czyż, K., Bodkowski, R., Lochyński, S.,
& Patkowska-Sokoła, B. (2018). Polyunsaturated Fatty Acids and Their Potential
Therapeutic Role in Cardiovascular System Disorders—A Review. Nutrients, 10(10), 1561.
https://doi.org/10.3390/nu10101561
Sottero, B., Rossin, D., Poli, G., & Biasi, F. (2018). Lipid Oxidation Products in the
Pathogenesis of Inflammation-related Gut Diseases. Current Medicinal Chemistry, 25(11),
1311–1326. https://doi.org/10.2174/0929867324666170619104105
156 Spector, A. A., & Yorek, M. A. (1985). Membrane lipid composition and cellular function.
Journal of Lipid Research, 26(9), 1015–1035.
Spiteller, G. (2001). Lipid peroxidation in aging and age-dependent diseases. Experimental
Gerontology, 36(9), 1425–1457. https://doi.org/10.1016/s0531-5565(01)00131-0
Staprans, I., Pan, X. M., Miller, M., & Rapp, J. H. (1993). Effect of dietary lipid peroxides on
metabolism of serum chylomicrons in rats. American Journal of Physiology-
Gastrointestinal and Liver Physiology, 264(3), G561–G568.
https://doi.org/10.1152/ajpgi.1993.264.3.G561
Staprans, I., Rapp, J. H., Pan, X. M., & Feingold, K. R. (1993). The effect of oxidized lipids in
the diet on serum lipoprotein peroxides in control and diabetic rats. Journal of Clinical
Investigation, 92(2), 638–643. https://doi.org/10.1172/JCI116632
Staprãns, I., Rapp, J. H., Pan, X. M., Kim, K. Y., & Feingold, K. R. (1994). Oxidized lipids in
the diet are a source of oxidized lipid in chylomicrons of human serum. Arteriosclerosis and
Thrombosis: A Journal of Vascular Biology, 14(12), 1900–1905.
https://doi.org/10.1161/01.ATV.14.12.1900
Staprans, I., Pan, X.-M., Rapp, J. H., & Feingold, K. R. (2005). The role of dietary oxidized
cholesterol and oxidized fatty acids in the development of atherosclerosis. Molecular
Nutrition & Food Research, 49(11), 1075–1082. https://doi.org/10.1002/mnfr.200500063
Staprans, I., Rapp, J. H., Pan, X. M., & Feingold, K. R. (1996). Oxidized lipids in the diet are
incorporated by the liver into very low density lipoprotein in rats. Journal of Lipid
Research, 37(2), 420–430. https://doi.org/10.1016/s0022-2275(20)37628-8
Stark, A. H., Crawford, M. A., & Reifen, R. (2008). Update on alpha-linolenic acid. Nutrition
157 Reviews, 66(6), 326–332. https://doi.org/10.1111/j.1753-4887.2008.00040.x
Stelzer, G., Rosen, N., Plaschkes, I., Zimmerman, S., Twik, M., Fishilevich, S., Iny Stein, T.,
Nudel, R., Lieder, I., Mazor, Y., Kaplan, S., Dahary, D., Warshawsky, D., Guan-Golan, Y.,
Kohn, A., Rappaport, N., Safran, M., & Lancet, D. (2016). The GeneCards suite: From gene
data mining to disease genome sequence analyses. Current Protocols in Bioinformatics.
https://doi.org/10.1002/cpbi.5
Stelzer, G., Rosen, N., Plaschkes, I., Zimmerman, S., Twik, M., Fishilevich, S., Stein, T. I.,
Nudel, R., Lieder, I., Mazor, Y., Kaplan, S., Dahary, D., Warshawsky, D., Guan-Golan, Y.,
Kohn, A., Rappaport, N., Safran, M., & Lancet, D. (2016). The GeneCards Suite: From
Gene Data Mining to Disease Genome Sequence Analyses. Current Protocols in
Bioinformatics, 54(1), 1.30.1-1.30.33. https://doi.org/10.1002/cpbi.5
Stienstra, R., Mandard, S., Tan, N. S., Wahli, W., Trautwein, C., Richardson, T. A., Lichtenauer-
Kaligis, E., Kersten, S., & Müller, M. (2007). The Interleukin-1 receptor antagonist is a
direct target gene of PPARα in liver. Journal of Hepatology.
https://doi.org/10.1016/j.jhep.2006.11.019
Stierum, R., Gaspari, M., Dommels, Y., Ouatas, T., Pluk, H., Jespersen, S., Vogels, J.,
Verhoeckx, K., Groten, J., & Ommen, B. van. (2003). Proteome analysis reveals novel
proteins associated with proliferation and differentiation of the colorectal cancer cell line
Caco-2. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics, 1650(1–2), 73–
91. https://doi.org/10.1016/S1570-9639(03)00204-8
Suh, H. N., Huong, H. T., Song, C. H., Lee, J. H., & Han, H. J. (2008). Linoleic acid stimulates
gluconeogenesis via Ca 2+ /PLC, cPLA 2 , and PPAR pathways through GPR40 in primary
158 cultured chicken hepatocytes. American Journal of Physiology-Cell Physiology, 295(6),
C1518–C1527. https://doi.org/10.1152/ajpcell.00368.2008
Sullivan, E. M., Pennington, E. R., Green, W. D., Beck, M. A., Brown, D. A., & Shaikh, S. R.
(2018). Mechanisms by Which Dietary Fatty Acids Regulate Mitochondrial Structure-
Function in Health and Disease. Advances in Nutrition, 9(3), 247–262.
https://doi.org/10.1093/advances/nmy007
Sultana, R., Perluigi, M., & Butterfield, D. A. (2013). Lipid peroxidation triggers
neurodegeneration: A redox proteomics view into the Alzheimer disease brain. Free
Radical Biology and Medicine, 62(0891–5849), 157–169.
https://doi.org/10.1016/j.freeradbiomed.2012.09.027
Sun, H., Chow, E. C. Y., Liu, S., Du, Y., & Pang, K. S. (2008). The Caco-2 cell monolayer:
usefulness and limitations. Expert Opinion on Drug Metabolism & Toxicology, 4(4), 395–
411. https://doi.org/10.1517/17425255.4.4.395
Swanson, D., Block, R., & Mousa, S. A. (2012). Omega-3 fatty acids EPA and DHA: health
benefits throughout life. Advances in Nutrition (Bethesda, Md.), 3(1), 1–7.
https://doi.org/10.3945/an.111.000893
Tachibana, K., Yamasaki, D., Ishimoto, K., & Doi, T. (2008). The Role of PPARs in Cancer.
PPAR Research, 2008, 1–15. https://doi.org/10.1155/2008/102737
Tadjali, M., Seidelin, J. B., Olsen, J., & Troelsen, J. T. (2002). Transcriptome changes during
intestinal cell differentiation. Biochimica et Biophysica Acta (BBA) - Molecular Cell
Research, 1589(2), 160–167. https://doi.org/10.1016/S0167-4889(02)00170-2
Taha, R., Seidman, E., Mailhot, G., Boudreau, F., Gendron, F. P., Beaulieu, J. F., Ménard, D.,
159 Delvin, E., Amre, D., & Levy, E. (2010). Oxidative stress and mitochondrial functions in
the intestinal Caco-2/15 Cell Line. PLoS ONE, 5(7), 1–10.
https://doi.org/10.1371/journal.pone.0011817
Thomas, S., Prabhu, R., & Balasubramanian, K. A. (2005). Retinoid metabolism in the rat small
intestine. British Journal of Nutrition, 93(1), 59–63. https://doi.org/10.1079/BJN20041306
Tian, Y., Zhao, L., Zhang, H., Liu, X., Zhao, L., Zhao, X., Li, Y., & Li, J. (2014). AKR1C3
overexpression may serve as a promising biomarker for prostate cancer progression.
Diagnostic Pathology, 9(1), 42. https://doi.org/10.1186/1746-1596-9-42
Tiwari, R., Pandey, S. K., Goel, S., Bhatia, V., Shukla, S., Jing, X., Dhanasekaran, S. M., &
Ateeq, B. (2015). SPINK1 promotes colorectal cancer progression by downregulating
Metallothioneins expression. Oncogenesis, 4(8), e162–e162.
https://doi.org/10.1038/oncsis.2015.23
Usatyuk, P. V., & Natarajan, V. (2012). Hydroxyalkenals and oxidized phospholipids
modulation of endothelial cytoskeleton, focal adhesion and adherens junction proteins in
regulating endothelial barrier function. Microvascular Research, 83(1), 45–55.
https://doi.org/10.1016/j.mvr.2011.04.012
Valverde, M., Lozano-Salgado, J., Fortini, P., Rodriguez-Sastre, M. A., Rojas, E., & Dogliotti, E.
(2018). Hydrogen Peroxide-Induced DNA Damage and Repair through the Differentiation
of Human Adipose-Derived Mesenchymal Stem Cells. Stem Cells International, 2018, 1–
10. https://doi.org/10.1155/2018/1615497
Vangaveti, V. N., Jansen, H., Kennedy, R. L., & Malabu, U. H. (2016). Hydroxyoctadecadienoic
acids: Oxidised derivatives of linoleic acid and their role in inflammation associated with
160 metabolic syndrome and cancer. European Journal of Pharmacology, 785, 70–76.
https://doi.org/10.1016/j.ejphar.2015.03.096
Veith, A., & Moorthy, B. (2018). Role of cytochrome P450s in the generation and metabolism of
reactive oxygen species. Current Opinion in Toxicology, 7, 44–51.
https://doi.org/10.1016/j.cotox.2017.10.003
Virtanen, J. K., Mursu, J., Voutilainen, S., & Tuomainen, T.-P. (2018). The associations of
serum n-6 polyunsaturated fatty acids with serum C-reactive protein in men: the Kuopio
Ischaemic Heart Disease Risk Factor Study. European Journal of Clinical Nutrition, 72(3),
342–348. https://doi.org/10.1038/s41430-017-0009-6
Vitale, S. G., Laganà, A. S., Nigro, A., La Rosa, V. L., Rossetti, P., Rapisarda, A. M. C., La
Vignera, S., Condorelli, R. A., Corrado, F., Buscema, M., & D’Anna, R. (2016).
Peroxisome Proliferator-Activated Receptor Modulation during Metabolic Diseases and
Cancers: Master and Minions. PPAR Research, 2016, 1–9.
https://doi.org/10.1155/2016/6517313
Wahli, W., & Michalik, L. (2012). PPARs at the crossroads of lipid signaling and inflammation.
Trends in Endocrinology & Metabolism, 23(7), 351–363.
https://doi.org/10.1016/j.tem.2012.05.001
Wang, B., Rong, X., Duerr, M. A., Hermanson, D. J., Hedde, P. N., Wong, J. S., de Aguiar
Vallim, T. Q., Cravatt, B. F., Gratton, E., Ford, D. A., & Tontonoz, P. (2016). Intestinal
Phospholipid Remodeling Is Required for Dietary-Lipid Uptake and Survival on a High-Fat
Diet. Cell Metabolism, 23(3), 492–504. https://doi.org/10.1016/j.cmet.2016.01.001
Wang, G., Bonkovsky, H. L., de Lemos, A., & Burczynski, F. J. (2015). Recent insights into the
161 biological functions of liver fatty acid binding protein 1. Journal of Lipid Research, 56(12),
2238–2247. https://doi.org/10.1194/jlr.R056705
Wang, Q., Zhou, Y., Rychahou, P., Liu, C., Weiss, H. L., & Evers, B. M. (2013). NFAT5
represses canonical Wnt signaling via inhibition of β -catenin acetylation and participates in
regulating intestinal cell differentiation. Cell Death & Disease, 4(6), e671–e671.
https://doi.org/10.1038/cddis.2013.202
Wang, Q., Zhou, Y., Rychahou, P., Fan, T. W. M., Lane, A. N., Weiss, H. L., & Evers, B. M.
(2017). Ketogenesis contributes to intestinal cell differentiation. Cell Death &
Differentiation, 24(3), 458–468. https://doi.org/10.1038/cdd.2016.142
Wang, T.-G., Gotoh, Y., Jennings, M. H., Rhoads, C. A., & Aw, T. Y. (2000). Lipid
hydroperoxide-induced apoptosis in human colonic CaCo-2 cells is associated with an early
loss of cellular redox balance. The FASEB Journal, 14(11), 1567–1576.
https://doi.org/10.1096/fj.99-0799com
Whelan, J. (2008). The health implications of changing linoleic acid intakes. Prostaglandins,
Leukotrienes and Essential Fatty Acids, 79(3–5), 165–167.
https://doi.org/10.1016/j.plefa.2008.09.013
Whelan, J., & Fritsche, K. (2013). Linoleic Acid. Advances in Nutrition, 4(3), 311–312.
https://doi.org/10.3945/an.113.003772
Wijeratne, S. S. K., & Cuppett, S. L. (2006). Lipid Hydroperoxide Induced Oxidative Stress
Damage and Antioxidant Enzyme Response in Caco-2 Human Colon Cells. Journal of
Agricultural and Food Chemistry, 54(12), 4476–4481. https://doi.org/10.1021/jf060475v
Wijeratne, S. S. K., Cuppett, S. L., & Schlegel, V. (2005). Hydrogen Peroxide Induced Oxidative
162 Stress Damage and Antioxidant Enzyme Response in Caco-2 Human Colon Cells. Journal
of Agricultural and Food Chemistry, 53(22), 8768–8774. https://doi.org/10.1021/jf0512003
Wilckens, T., & De Rijk, R. (1997). Glucocorticoids and immune function: unknown dimensions
and new frontiers. Immunology Today, 18(9), 418–424. https://doi.org/10.1016/S0167-
5699(97)01111-0
Wingler, K., Müller, C., Schmehl, K., Florian, S., & Brigelius-Flohé, R. (2000). Gastrointestinal
glutathione peroxidase prevents transport of lipid hydroperoxides in CaCo-2 cells.
Gastroenterology, 119(2), 420–430. https://doi.org/10.1053/gast.2000.9521
Wojtal, K. A., Eloranta, J. J., Hruz, P., Gutmann, H., Drewe, J., Staumann, A., Beglinger, C.,
Fried, M., Kullak-Ublick, G. A., & Vavricka, S. R. (2009). Changes in mRNA Expression
Levels of Solute Carrier Transporters in Inflammatory Bowel Disease Patients. Drug
Metabolism and Disposition, 37(9), 1871–1877. https://doi.org/10.1124/dmd.109.027367
Wu, D., Koga, T., Martin, K. R., & Meydani, M. (1999). Effect of vitamin E on human aortic
endothelial cell production of chemokines and adhesion to monocytes. Atherosclerosis,
147(2), 297–307. https://doi.org/10.1016/S0021-9150(99)00199-9
Wu, Y., Yao, J., Xie, J., Liu, Z., Zhou, Y., Pan, H., & Han, W. (2018). The role of autophagy in
colitis-associated colorectal cancer. Signal Transduction and Targeted Therapy, 3(1), 31.
https://doi.org/10.1038/s41392-018-0031-8
Yu, G., Wang, L.-G., Han, Y., & He, Q.-Y. (2012). clusterProfiler: an R Package for Comparing
Biological Themes Among Gene Clusters. OMICS: A Journal of Integrative Biology, 16(5),
284–287. https://doi.org/10.1089/omi.2011.0118
Zeng, C.-M., Chang, L.-L., Ying, M.-D., Cao, J., He, Q.-J., Zhu, H., & Yang, B. (2017). Aldo–
163 Keto Reductase AKR1C1–AKR1C4: Functions, Regulation, and Intervention for Anti-
cancer Therapy. Frontiers in Pharmacology, 8, 119.
https://doi.org/10.3389/fphar.2017.00119
Zhang, J., Chen, X., Yang, R., Ma, Q., Qi, W., Sanidad, K. Z., Park, Y., Kim, D., Decker, E. A.,
& Zhang, G. (2019). Thermally Processed Oil Exaggerates Colonic Inflammation and
Colitis-Associated Colon Tumorigenesis in Mice. Cancer Prevention Research
(Philadelphia, Pa.), 12(11), 741–750. https://doi.org/10.1158/1940-6207.CAPR-19-0226
Zhao, M., Tang, S., Xin, J., Wei, Y., & Liu, D. (2018). Reactive oxygen species induce injury of
the intestinal epithelium during hyperoxia. International Journal of Molecular Medicine,
41(1), 322–330. https://doi.org/10.3892/ijmm.2017.3247
Zińczuk, J., Maciejczyk, M., Zaręba, K., Romaniuk, W., Markowski, A., Kędra, B., Zalewska,
A., Pryczynicz, A., Matowicka-Karna, J., & Guzińska-Ustymowicz, K. (2019). Antioxidant
Barrier, Redox Status, and Oxidative Damage to Biomolecules in Patients with Colorectal
Cancer. Can Malondialdehyde and Catalase Be Markers of Colorectal Cancer
Advancement? Biomolecules, 9(10), 637. https://doi.org/10.3390/biom9100637
Zois, C. E., & Harris, A. L. (2016). Glycogen metabolism has a key role in the cancer
microenvironment and provides new targets for cancer therapy. Journal of Molecular
Medicine (Berlin, Germany), 94(2), 137–154. https://doi.org/10.1007/s00109-015-1377-9
164