Trpc2-Expressing Sensory Neurons in the Mouse Main Olfactory Epithelium of Type B Express the Soluble Guanylate Cyclase Gucy1b2

Molecular and Cellular Neuroscience 65 (2015) 114–124

Contents lists available at ScienceDirect

Molecular and Cellular Neuroscience

journal homepage: www.elsevier.com/locate/ymcne

Trpc2-expressing sensory neurons in the mouse main olfactory epithelium of type B express the soluble guanylate cyclase Gucy1b2

Masayo Omura, Peter Mombaerts ⁎

Max Planck Research Unit for Neurogenetics, Frankfurt, Germany article info abstract

Article history: Chemoreception in the mouse olfactory system occurs primarily at two chemosensory epithelia in the nasal cavity: Received 10 November 2014 the main olfactory epithelium (MOE) and the vomeronasal epithelium. The canonical chemosensory neurons in the Revised 6 February 2015 MOE, the olfactory sensory neurons (OSNs), express the odorant receptor (OR) gene repertoire, and depend on Accepted 17 February 2015 Adcy3 and Cnga2 for chemosensory signal transduction. The canonical chemosensory neurons in the vomeronasal Available online 19 February 2015 epithelium, the vomeronasal sensory neurons (VSNs), express two unrelated vomeronasal receptor (VR) gene rep- Keywords: ertoires, and involve Trpc2 for chemosensory signal transduction. Recently we reported the discovery of two types of Main olfactory epithelium neurons in the mouse MOE that express Trcp2 in addition to Cnga2. These cell types can be distinguished at the Vomeronasal epithelium single-cell level by expression of Adcy3: positive, type A and negative, type B. Some type A cells express OR genes. Cyclic-nucleotide gated channel Thus far there is no specific gene or marker for type B cells, hampering further analyses such as physiological record- Trp channel ings. Here, we show that among MOE cells, type B cells are unique in their expression of the soluble guanylate cy- Guanylate cyclase clase Gucy1b2. We came across Gucy1b2 in an explorative approach based on Long Serial Analysis of Gene Expression (LongSAGE) that we applied to single red-fluorescent cells isolated from whole olfactory mucosa and vomeronasal organ of mice of a novel Trcp2-IRES-taumCherry gene-targeted strain. The generation of a novel Gucy1b2-IRES-tauGFP gene-targeted strain enabled us to visualize coalescence of axons of type B cells into glomeruli in the main olfactory bulb. Our molecular and anatomical analyses define Gucy1b2 as a marker for type B cells within the MOE. The Gucy1b2-IRES-tauGFP strain will be useful for physiological, molecular, cellular, and anatomical studies of this newly described chemosensory subsystem. © 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction third of MOE cells labeled with Olfr68/69 riboprobes are type A cells. We were unable to find ISH evidence of expression of the known Since the discovery of expression of the Trpc2 cation channel in rat chemosensory G-protein coupled receptor genes or signaling components vomeronasal organ (VNO) (Liman et al., 1999), Trpc2 expression was in type B cells. Type A and type B cells appear to share only Trpc2 expres- thought to be restricted to VSNs in mouse. We recently challenged this be- sion with VSNs, and are thus not VSNs that are misplaced in the MOE. lief by immunohistochemistry (IHC) with the Trpc2 antibody that was Here, we describe a novel gene-targeted knockin mutation in the used in rat (Liman et al., 1999) and by in situ hybridization (ISH) Trpc2 locus, designed to coexpress Trpc2 with the red-fluorescent (Omura and Mombaerts, 2014). We also generated a Trpc2-IRES-taulacZ axonal marker taumCherry. We picked single taumCherry+ MOE cells knockin mouse strain (Omura and Mombaerts, 2014). We found that fromthelateralregionoftheMOE(typeBcells)andcarriedoutRT-PCR the mouse MOE actually abounds with Trpc2+ cells, from early stages analyses. We confirm and extend our ISH observations that type B cells in development throughout adulthood. We identified two types of do not express OR or VR genes. Next we applied LongSAGE to single Trpc2+ MOE cells, which we refer to as type A and type B cells. These taumCherry+ cells, and came across the soluble guanylate cyclase cell types can be distinguished at the single-cell level by Adcy3 Gucy1b2.WeshowbyISHandbyIHCwithacustomGucy1b2antibody expression: type A cells express Adcy3, and type B cells do not express that Gucy1b2 expression is specific to type B cells in the MOE. We counted Adcy3. The cell bodies of type A cells form a semicontinuous layer ~16,000 Gucy1b2+ cells in the MOE of C57BL/6 mice at three weeks, and throughout the MOE just below the sustentacular cell layer. The cell bod- found that 97% of these cells are Trpc2+. In mice of a novel gene-targeted ies of type B cells reside within the lateral region of the MOE and are locat- Gucy1b2-IRES-tauGFP knockin strain, GFP+ axons coalesce into a few ed at all positions along the basal-to-apical dimension of the MOE. One glomeruli ventrally and posteriorly in the main olfactory bulb. Our results thus define Gucy1b2 as a marker for type B cells in the MOE. The Gucy1b2-IRES-tauGFP strain will enable physiological experiments in ⁎ Corresponding author at: Max Planck Research Unit for Neurogenetics, Max-von- Laue-Strasse 4, 60438 Frankfurt, Germany. type B cells to determine in which regard these cells differ functionally E-mail address: [email protected] (P. Mombaerts). from type A cells, canonical OSNs, and VSNs.

http://dx.doi.org/10.1016/j.mcn.2015.02.012 1044-7431/© 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124 115

2. Results X-gal histochemistry and IHC with βgalactosidase antibodies, but is less suited to study live, unﬁxed Trpc2+ cells. We therefore generated 2.1. The Trpc2-IRES-taumCherry knockin mouse strain another mouse strain by gene targeting using the red ﬂuorescent protein mCherry (Shaner et al., 2004). The genetic design of the Trpc2- We have previously described a Trpc2-IRES-taulacZ knockin strain, IRES-taumCherry targeted mutation (Fig. 1A) mirrors that of Trpc2- in which Trpc2+ cells coexpress the axonal marker tauβgalactosidase IRES-taulacZ. The IRES sequence allows for cotranslation of intact (Omura and Mombaerts, 2014). This mouse strain lends itself well to Trpc2 polypeptide with the axonal marker taumCherry, and the

A genomic DNA, Chr 7 ex11 ATG ex2 ex3 ex5ex4 ex6 ex8ex7 ex9 ex10 ex12 STOP HindIII HindIII

ex1 ex13 PvuII targeting vector ex11 ex9 ex10 ex12 STOP HindIII HindIII IRES taumCherry ACNF ex13 wild-type allele loxP

PvuII gene-targeted allele after Cre excision 1 kb STOP IRES taumCherry

B mCherry* Trpc2 merged VNO MOE

C MOB ventral view AOB mCherry*

VNO

Fig. 1. Trpc2-IRES-taumCherry gene-targeted strain. (A) Generation of a Trpc2-IRES-taumCherry knockin mutation in the mouse germline. The IRES-taumCherry-ANCF cassette was inserted after the STOP codon of Trpc2 by homologous recombination with a targeting vector in ES cells. The ACNF cassette is a self-excising neo gene that is removed during the transmis- sion of the targeted allele through the male germ line, leaving a single loxP site (red triangle) behind in the locus. The axonal marker taumCherry is a fusion protein between bovine tau and mCherry and is intrinsically red fluorescent. (B) Intrinsic red fluorescence of taumCherry (mCherry*) of sections of the VNO and MOE of homozygous Trpc2-IRES-taumCherry mice at eight weeks, combined with IHC (green) for Trpc2. The fusion of mCherry to tau promotes subcellular localization at dendritic tips and axons compared to cell bodies. (C) Whole mount view of the olfactory system of a homozygous Trpc2-IRES-taumCherry mouse at four weeks, intrinsic red fluorescence (mCherry*). (Left) Axons project from the VNO across the nasal septum in the form of several vomeronasal fascicles. (Middle) Most axons terminate in the accessory olfactory bulb (AOB). (Right) Some axons coalesce into a few glomeruli ventrally in the main olfactory bulb (MOB). The red arrowhead indicates the vomeronasal nerve. Scale bar: 50 μminBtopleft;20μm in B other panels; 500 μm in C left; 200 μm in C middle and right. 116 M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124 endogenous 3′ untranslated sequence of Trpc2 is retained within the Cnga2,andGnao1, very weakly positive for Gnal, and negative for transcripts generated from the mutant allele. This mouse strain is pub- Adcy3 and Gnai2; this gene expression profile is characteristic of type licly available from The Jackson Laboratory. B cells. Next we subjected validated m-cells to degenerate RT-PCR for In a coronal section of the VNO of a homozygous Trpc2-IRES- OR genes: we could not obtain a distinct RT-PCR product from 0/12 taumCherry mouse, the intense red fluorescence reflects the broad and validated m-cells (Fig. 2B). However a strong RT-PCR product was high expression of Trpc2 across VSNs (Fig. 1B). A coronal section of the obtained from o1 and o2, two randomly picked single cells from WOM MOE reveals scattered red-fluorescent cells that are also Trpc2+ by IHC of a heterozygous OMP-YFP gene-targeted mouse; these cells are most (Fig. 1B). There is thus concordance at the cellular level between the likely canonical, OR-expressing OSNs. Indeed, sequencing the PCR intrinsic red fluorescence and the Trpc2 immunoreactive signal, as can products revealed that o1 expressed Olfr1183, and o2 expressed be expected from the IRES design. In whole mounts, red-fluorescent Olfr1607. We did not obtain a band with degenerate primers for Taar cells in the VNO project their axons to the accessory olfactory bulb genes (Liberles and Buck, 2006) from 8 validated m-cells (data not (AOB) and coalesce into a few glomeruli on the ventral aspect of the shown). Next we applied 11 subfamily-specific degenerate primer sets main olfactory bulb (Fig. 1C). The Trpc2-IRES-taumCherry strain mimics fora V1r to V1rk subfamilies covering all Vmn1r members (Roppolo et the expression pattern seen in the Trpc2-IRES-taulacZ strain. al., 2006). Strong PCR products were obtained from 5/6 validated v-cells, but not from 9 validated m-cells with any of these 11 primer 2.2. Single-cell RT-PCR sets. Sequencing the PCR products revealed expression of Vmnr68 in v1 and v5, V1re13/Vmn1r71 in v2, V1rf4/Vmn1r236 in v3, and V1rg3/ We dissected whole olfactory mucosa (WOM) (Khan et al., 2013) Vmn1r80 in v10; an example is given for the V1rg primer set in Fig. 2C. from the lateral region of the MOE of homozygous Trpc2-IRES- It is well established that in basal VSNs, one or more genes of the taumCherry mice at 8 weeks, and dissociated the tissue samples into seven-gene family-C Vmn2r are coexpressed with one family-ABD single cells. The lateral region of the MOE is enriched in type B cells Vmn2r gene (Ishii and Mombaerts, 2008; Ishii and Mombaerts, 2011; (Omura and Mombaerts, 2014), but contains also type A cells, which Silvotti et al., 2011). Using two sets of degenerate RT-PCR primers for are present throughout the MOE. The expression level of Trpc2 in family-C Vmn2r genes, we could amplify a band from 1/2 validated adult mice is higher in type B cells than in type A cells. We thus picked v-cells (v28) with primer set A and 2/2 validated v-cells with primer the brightest mCherry+ cells using micromanipulators under a fluores- set B (v28 and v32), but not from 9 validated m-cells (Fig. 2D). We cence microscope. We carried out RT-PCR with mCherry and Omp performed RT-PCR with degenerate primers for Fpr genes, the third primers on 59 WOM-derived cells (m-cells), as well as on 31 VNO- class of chemosensory G-protein coupled receptor genes expressed in derived cells (v-cells). We identified 24 and 18 cells, respectively, the VNO (Rivière et al., 2009; Liberles et al., 2009). We obtained strong from which both transcripts could be amplified; we call these 42 cells PCR products from v6 and v36, and identified by sequencing expression the validated cells. An example of the results from a validated WOM of Fpr-rs4 expression from v6 and Fpr-rs6 in v36; no PCR products were cell (m37) is given in Fig. 2A. Cell m37 is positive for mCherry, Omp, obtained from 6 validated m-cells (data not shown). A mCherry Omp Adcy3 Cnga2 Gnal Gnai2 Gnao1 m37 OE mut buf m37 OE buf m37 OE buf m37 OE buf m37 OE buf m37 OE buf m37 OE buf 400 300 200 100

OR B m83 m84 m85 m86 m87 buf16 m89 m90 m91 m92 m93 m94 m95 m96 m97 m98 o1 o2 buf4 OE G water 500

C Vmn1r (V1rg) m2 v1 v2 v3 v5 v6 v10 buf1 m31 m33 m34 m37 m41 buf7 m51 m52 m54 buf9 OE VNO G water

500

D Vmn2r (V2R family C) v28 buf10 m62 m66 m67 m71 m73 m82 buf15 VNO G water A B A B A B A B A B A B A B A B A B A B A B A B

500

Fig. 2. Single-cell RT-PCR of red-fluorescent cells from Trpc2-IRES-taumCherry mice. (A) Ethidium-bromide stained agarose gels of RT-PCR products generated from a single red-fluorescent cell (m37) isolated from lateral WOM of a homozygous Trpc2-IRES-taumCherry mouse at eight weeks, in comparison with RT-PCR products of WOM of a WT C57BL/6 mouse at eight weeks (OE), PCR products of genomic DNA (mut) from a homozygous Trpc2-IRES-taumCherry mouse as positive control for mCherry, and buffer (buf) as negative control. (B) Degenerate RT-PCR with primers for OR genes does not reveal OR gene expression in 15 single cells isolated from lateral WOM of a homozygous Trpc2-IRES-taumCherry mouse at eight weeks. We cloned some of the faint bands and found that they did not represent OR genes. A strong RT-PCR product is obtained with o1 and o2, two single cells isolated from WOM of a heterozygous OMP-YFP gene-targeted mouse at three weeks. buf16 is buffer, as negative control. (C) Degenerate RT-PCR for the V1rg family of Vmn1r genes reveals a product in one of six single red- fluorescent cells (v10) isolated from the VNO a homozygous Trpc2-IRES-taumCherry mouse at eight weeks. By contrast, no RT-PCR products are obtained from nine single red-fluorescent cells (such as m2) picked from lateral WOM. Lanes labeled with buf are with buffer, as negative control. (D) RT-PCR for the family-C Vmn2r genes reveals a product in a single red-fluorescent cell (v28) isolated from the VNO a homozygous Trpc2-IRES-taumCherry mouse at eight weeks, but not from six single red-fluorescent cells (such as m62) isolated from lateral WOM of a homozygous Trpc2-IRES-taumCherry mouse at eight weeks. A and B are two distinct primer sets. Lanes labeled with buf are with buffer, as negative control. VNO represents cDNA from whole vomeronasal organ, and Gen represents genomic DNA of a WT C57BL/6 mouse. M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124 117

Thus, our single-cell RT-PCR analyses on 24 type B cells provide mCherry, Gnao,andfamily-C Vmn2r. In LongSAGE, “long” tags another line of negative evidence that these cells do not express known representing 17 bp cDNA segments are concatenated, and the chemosensory G-protein coupled receptor genes. However some of concatemers cloned and sequenced. Examples of nucleotide sequences these genes may not be detectable by the degenerate RT-PCR primers. are shown in Fig. 3A, B. From VNO-derived cell v28, we obtained tags for Vmn2r37 or Vm2nr42 (family-ABD genes) and Vmn2r7 (family-C 2.3. Long Serial Analysis of Gene Expression gene); the Omp gene was also represented in the collection of 5998 tags (Fig. 3C). By contrast, in type B cells m85 and m93, there were no The targeted search for expression of known chemosensory tags for OR or VR genes among the 5195 and 5653 tags, respectively; G-protein coupled receptor genes and components of signaling path- the Omp gene was well represented in both cells (Fig. 3C). We were ways by ISH (Omura and Mombaerts, 2014) and here by single-cell intrigued by the presence of tags for Gucy1b2 in both m85 and m93. RT-PCR has not unveiled any evidence for such expression. In an alter- This soluble guanylate cyclase has been poorly studied, and has not native strategy, we took a non-targeted, discovery-oriented approach been characterized in vertebrate olfactory systems. We decided to by applying a variant of SAGE called LongSAGE (Velculescu et al, 1995; evaluate this gene as a marker for type B cells in the MOE. Saha et al., 2002; Saito et al., 2004; Hu et al., 2007) on three red- ﬂuorescent cells from Trpc2-IRES-taumCherry mice: two type B cells 2.4. Gucy1b2 RNA and Gucy1b2 protein expression in the MOE and on one VNO cell. The type B cells were validated by RT-PCR for expression of Gapdh, Omp, mCherry, Cnga2,andGnao and no expression We performed three-color ISH in the MOE of wild-type C57BL/6 mice of Adcy3, and the VNO cell was validated for expression of Gapdh, Omp, with riboprobes for Trpc2, Gucy1b2,andAdcy3 (Fig. 4A). Type A cells are

sample m85, total 5195 tags sample m93, total 5653 tags sample V28, total 5998 tags C # gene count % # gene count % # gene count % 1 Calmodulin 1 46 0.89 strongly similar to NP_904330.1 1 Thymosin, beta 4, X chromosome 58 0.97 1 39 0.69 2 Creatine kinase, brain 30 0.58 cytochrome c oxidase subunit I 2 V2r in chr 7 (Vmn2r37 or 42) 44 0.73 Glyceraldehyde-3-phosphate 2 Ubiquitin B 36 0.64 strongly similar to NP_904330.1 cytochrome 3 22 0.42 3 31 0.52 dehydrogenase 3 cDNA clone IMAGE:40049146 33 0.58 c oxidase subunit I 4 Stomatin 19 0.37 4 olfactory marker protein 21 0.37 4 Ferritin heavy chain 1 29 0.48 5 Olfactory marker protein 17 0.33 4 Calmodulin 1 21 0.37 5 HRAS like suppressor 3 23 0.38 6 Ferritin heavy chain 1 15 0.29 6 Transmembrane protein 66 19 0.34 6 Calmodulin 1 22 0.37 6 Chromogranin A 15 0.29 6 Stomatin 19 0.34 Glyceraldehyde-3-phosphate Sorting and assembly machinery 6 22 0.37 8 Ribosomal protein S3a 14 0.27 8 18 0.32 dehydrogenase 9 Ubiquitin-conjugating enzyme E2S 12 0.23 component 50 homolog 6 Ubiquitin B 22 0.37 9 Tubulin-specific chaperone c 17 0.30 10 Transmembrane protein 66 11 0.21 Homocysteine-inducible, endoplasmic Glyceraldehyde-3-phosphate 10 Thymosin, beta 4, X chromosome 11 0.21 9 17 0.30 9 reticulum stress-inducible, ubiquitin-lke 21 0.35 dehydrogenase 10 Prothymosin alpha 11 0.21 domain member 1 Gem (nuclear organelle) associated protein 9 Uromodulin-like 1 16 0.28 13 11 0.21 12 Ubiquitin carboxy-terminal hydrolase L1 15 0.27 10 Ribosomal protein L21 18 0.30 7 12 Ferritin heavy chain 1 15 0.27 11 Activating transcription factor 5 15 0.25 ATPase, Na+/K+ transporting, alpha 1 13 11 0.21 14 Heat shock protein 8 13 0.23 11 Peroxiredoxin 2 15 0.25 polypeptide 15 Dynein light chain LC8-type 1 12 0.21 strongly similar to NP_904334.1 cytochrome 15 Ubiquitin B 10 0.19 13 14 0.23 strongly similar to NP_904329.1 NADH c oxidase subunit III moderately similar to NP_904330.1 16 11 0.19 15 10 0.19 dehydrogenase subunit 2 13 Ubiquitin carboxy-terminal hydrolase L1 14 0.23 cytochrome c oxidase subunit I 16 Thymosin, beta 4, X chromosome 11 0.19 15 Acidic ribosomal phosphoprotein P0 13 0.22 Eukaryotic translation elongation factor 1 15 10 0.19 16 Amyloid beta (A4) precursor-like protein 2 11 0.19 15 Calbindin 2 13 0.22 alpha 1 strongly similar to NP_904331.1 15 Ribosomal protein L18A 13 0.22 19 10 0.18 18 S100 calcium binding protein A5 9 0.17 cytochrome c oxidase subunit II 15 Ribosomal protein S11 13 0.22 RNA binding motif and ELMO domain 1 9 0.17 18 19 Tetraspanin 31 10 0.18 15 RIKEN cDNA 2300002D11 gene 13 0.22 18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 9 0.17 19 Hepatitis B virus x interacting protein 10 0.18 moderately similar to NP_904330.1 18 Amyloid beta (A4) precursor-like protein 1 9 0.17 15 13 0.22 strongly similar to NP_058933.2 ubiquitin cytochrome c oxidase subunit I VATPase, H+ transporting, lysosomal V1 22 9 0.16 22 8 0.15 carboxy-terminal hydrolase isozyme L1 21 Ferritin light chain 1 12 0.20 subunit E1 moderately similar to NP_904330.1 21 Fetuin beta 12 0.20 22 Guanylate cyclase 1, soluble, beta 2 8 0.15 22 9 0.16 cytochrome c oxidase subunit I 21 Integral membrane protein 2B 12 0.20 22 Dynein light chain LC8-type 1 8 0.15 22 Guanylate cyclase 1, soluble, beta 2 9 0.16 21 Olfactory marker protein 12 0.20 22 Similar to Ywhaq protein 8 0.15 Proteasome (prosome, macropain) subunit, 22 9 0.16 21 Ribosomal protein 10 12 0.20 22 Aldolase 1, A isoform 8 0.15 alpha type 2 21 Testis enhanced gene transcript 12 0.20 22 Activating transcription factor 5 8 0.15 Heat shock protein 90kDa alpha (cytosolic), 22 9 0.16 guanine nucleotide binding protein (Gprotein) 22 Acidic ribosomal phosphoprotein P0 8 0.15 class B member 1 27 11 0.18 22 Ribosomal protein S7 9 0.16 gamma 8 (Gng8) 22 empty spiracles homolog 1 9 0.16 27 Ribosomal protein L13 11 0.18 22 Amyloid beta (A4) precursor-like protein 1 9 0.16 27 Ribosomal protein L41 11 0.18 22 Activating transcription factor 5 9 0.16 27 RNA binding site for Dazl protein, clone ba2 11 0.18 27 Transcribed locus 11 0.18 ...... 85 Vmn2r7 5 0.08

Fig. 3. Long Serial Analysis of Gene Expression (LongSAGE) of single red-fluorescent cells from Trpc2-IRES-taumCherry mice. (A) Example of nucleotide sequence of a LongSAGE clone recovered from m93, a red-fluorescent cell isolated from WOM in the lateral region of the MOE of a homozygous Trpc2-IRES-taumCherry mouse at eight weeks. The sequence of the tag representing the gene Omp is highlighted in yellow, and the anchoring NlaIII recognition sites CATG are highlighted in red. (B) Example of nucleotide sequence of another LongSAGE clone recovered from m93. The tag representing the gene Gucy1b2 highlighted. The sequence of the tag representing the gene Gucy1b2 is highlighted in yellow, and the anchoring NlaIII recognition sites CATG are highlighted in red. (C) Summary of tags analyzed in cells m85 and m93 (type B cells) and cell v28 (VNO cell). For Gucy1b2,weidentified 8/5195 tags (0.15%) in sample m85, and 9/5653 tags (0.16%) in sample m93, compared to 0/5998 tags in the v28 sample. Sample v28 contains tags for family-ABD Vmn2r and family-C Vmn2r genes: 44 tags (0.73%) for Vmn2r42 or Vmn2r37 (three independent tags were found, however, unfortunately the 17 bp tags are identical in these Vmn2r genes), and 5 tags (0.08%) for Vmn2r7 from family C. 118 M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124

Gucy1b2−, and most type B cells are Gucy1b2+, thus providing the ﬁrst 2.5. Expression of other signaling molecules marker that can distinguish type B cells positively from type A cells at the single-cell level. An occasional Trpc2+cellinthelateralregionofthe Type B cells do not express Adcy3 but express the cyclic nucleotide- MOE, where type B cells are enriched, appears to be Gucy1b2−.Theseoc- gated channel subunit Cnga2 (Fig. 5A). There must thus be a source of casional cells could be type A cells (because this cell type is present cAMP or cGMP, and Gucy1b2 is an enzyme that catalyzes the production throughout the MOE), immature type B cells, or represent another, unrec- of cGMP. We carried out further ISH analyses for other signaling mole- ognized but minor Trpc2+ cell type in the MOE. By two-color ISH in three cules. Cnga4, another cyclic nucleotide-gated channel subunit (Kelliher C57BL/6 mice at three weeks, we counted 16,115 ± 929 (SE) Gucy1b2+ et al., 2003), is not expressed in type B cells but is expressed widely cells in the MOE, of which 15,630 ± 1023 (97.0 ± 1.2%) are Trpc2+. across canonical OSNs (Fig. 5B). Among the phosphodiesterases, Encouraged by the promise of Gucy1b2 as a type B cell marker, we enzymes that catalyze the degradation of cAMP and/or cGMP, we iden- generated a rabbit antiserum against a 22 amino acid sequence near tify expression of Pde1c, Pde4a,andPde6d in type B cells (Fig. 5C–E) but the C-terminus of the Gucy1b2 protein. We performed IHC on coronal not of Pde2a (Fig. 5G), which is expressed in Gucy2d+ cells (Hu et al., sections of the MOE of homozygous Trpc2-IRES-taumCherry mice 2007; Leinders-Zufall et al., 2007). Interestingly, another soluble (Fig. 4B). Consistent with the ISH data, Type A cells are Gucy1b2−, guanylate cyclase, Gucy1b3, is widely expressed in the MOE including and most type B cells are Gucy1b2+. in type B cells (Fig. 5F). Thus, our ISH and IHC studies validate Gucy1b2 as a marker for type B Thus, the gene expression proﬁle of type B cells differs from cells within the MOE. canonical OSNs by the absence of expression of Adcy3 and Cnga4.

A Trpc2 Gucy1b2 Adcy3 Trpc2 Gucy1b2 Trpc2 Gucy1b2 type A cells

Trpc2 Gucy1b2 Adcy3 Trpc2 Gucy1b2 Trpc2 Gucy1b2 type B cells

B Gucy1b2 mCherry* merged type A cells

Gucy1b2 mCherry* merged Trpc2-IRES-taumCherry Trpc2-IRES-taumCherry type B cells

Fig. 4. Gucy1b2 RNA and Gucy1b2 protein expression in type B but not type A Trpc2+ MOE cells. (A) ISH with riboprobes for Trpc2, Gucy1b2,andAdcy3 in coronal sections of the MOE of a wild-type C57BL/6 mouse at eight weeks. Type A cells, which are Adcy3+ and have their cell bodies typically just under the sustentacular layer, are Gucy1b2−.Bycontrast,typeBcells, which are Adcy3− and have their cell bodies at all positions along the basal-to-apical dimension of the MOE, are Gucy1b2+. This section through the lateral region of the MOE, where type B cells are concentrated, also contains one Gucy1b2- Trpc2+ Adcy3+ cell (arrowhead); this could be a type A cell, for which there is no unique marker. (B) IHC with antibodies against Gucy1b2 and intrinsic red ﬂuorescence of taumCherry (mCherry*), in coronal sections of the MOE of a wild-type C57BL/6 mouse at two weeks. Type A cells are not immunoreactive for the Gucy1b2 antibody. By contrast, type B cells are Gucy1b2+. This section through the lateral region of the MOE contains two faintly mCherry* cells that are Gucy1b2− (arrowheads) and could be type A cells. Scale bar, 10 μm. M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124 119

A Gucy1b2 Cnga2 merged

B Gucy1b2 Cnga4 merged

C Gucy1b2 Pde1c Omp merged

D Gucy1b2 Pde4a Omp merged

E Gucy1b2 Pde6d Omp merged

F Gucy1b2 Gucy1b3 Omp merged

G Gucy1b2 Pde2a merged 120 M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124

2.6. The Gucy1b2-IRES-tauGFP knockin mouse strain RT-PCR did not reveal expression of the known chemosensory G-protein coupled receptor gene repertoires (OR, Vmn1r, Vmn2r, Taar, Next we generated an IRES-tauGFP knockin mutation at the Gucy1b2 Fpr) in putative type B cells. But given the size and complexity of locus in the mouse germ line by gene targeting in embryonic stem (ES) these repertoires, some of these genes may not be detectable by the de- cells. The Gucy1b2 gene is located on chromosome 14. The RefSeq generate RT-PCR primers. A definitive assessment of chemosensory re- consists of 17 coding exons with two possible ATG translation initiation ceptor gene expression in type B cells awaits deep RNAseq, ideally of sites, encoding a putative polypeptide of 824 amino acids (Fig. 6A). The many single cells to exclude that a subset of type B cells may express amino acid sequence of this and other soluble guanylate cyclases some of these genes. Our interest in Gucy1b2 was kindled by the unbi- features heme NO binding domains HNOB and HNOBA, and a cyclase ased, non-targeted, exploratory approach of LongSAGE, which is con- homology domain CHD. We inserted an IRES-tauGFP cassette immedi- ceptually a precursor to RNAseq. ISH and IHC with a custom antibody ately after the STOP codon of Gucy1b2 (Fig. 6B), according to the same confirm Gucy1b2 as a marker for type B cells within the MOE. The design as the Trpc2-IRES-taumCherry mutation. This mouse strain is Gucy1b2-IRES-tauGFP knockin strain has been informative with regard publicly available from The Jackson Laboratory. to describing axonal coalescence into glomeruli in the bulb. The initial In coronal MOE sections of a homozygous Gucy1b2-IRES-tauGFP indication that the few ventral glomeruli in the main olfactory bulb of mouse, the intrinsic fluorescence of GFP shows concordance with Trpc2-IRES-taulacZ mice correspond to type B cells (Omura and Gucy1b2 immunoreactivity (Fig. 6C). To reveal the morphology of the Mombaerts, 2014) has now been proven in Gucy1b2-IRES-tauGFP GFP+ cells more clearly, we performed IHC with antibodies against mice. Unambiguous tracing of the axonal projections of type A cells to GFP (Fig. 6D). A variety of cellular morphologies can be discerned the bulb requires a marker for type A cells that is not expressed in among GFP+ cells. In some cells fine apical features resembling either type B cells, canonical OSNs, and VSNs. short cilia or microvilli can be discerned, and a further characterization of these structures awaits super-resolution or electron microscopy. The 3.2. cGMP-mediated signaling Gucy1b2-IRES-tauGFP strain will be useful for molecular, cellular, physiological, and anatomical studies of type B cells. Cnga2 expression in type B cells in the absence of Adcy3 expression raises the question as to which cyclic nucleotide (cAMP or cGMP) is 2.7. Axonal coalescence of type B cell axons into glomeruli available in these cells to activate this cyclic-nucleotide gated cation channel and what enzyme produces it. The disruption of the glomerular The expression level of the Gucy1b2 locus is sufficiently high for pattern of type B cells in Cnga2 knockout mice indicates that Cnga2 is tauGFP translated from the IRES sequence to decorate axonal processes functionally relevant for these cells (Omura and Mombaerts, 2014). of type B cells all the way to the olfactory bulb. In whole mounts of the Gucy1b2 is a plausible candidate for the generation of cGMP, possibly main olfactory bulb (n = 14) of homozygous Gucy1b2-IRES-tauGFP as a heterodimer with type-a soluble guanylate cyclases. We find mice at three weeks, 3.14 ± 0.21 major green-fluorescent glomeruli Gucy1b3 to be expressed in type B cells as well as, interestingly, in are visible on the ventral-posterior aspect (Fig. 7A). At postnatal day 7, canonical OSNs. Further progress in the issue of signaling requires the the Gucy1b2 glomeruli appear to be fully mature. In a mouse double identification of chemosensory stimuli for type B cells that do not act homozygous for Gucy1b2-IRES-tauGFP and Trpc2-IRES-taumCherry, on canonical OSNs and on VSNs. It is tempting to speculate that gases the fluorescent signals overlap (Fig. 7B), corroborating the concordance such as nitrogen oxide and/or oxygen (Gray et al., 2004; Morton, of Gucy1b2 and Trpc2 expression in type B cells seen at the level of the 2004; Zimmer et al., 2009; Scott, 2011) stimulate type B cells via MOE. In coronal sections of the main olfactory bulb of a homozygous Gucy1b2. If that is the case, it remains to be determined if this pathway Gucy1b2-IRES-tauGFP mouse, GFP intrinsic fluorescence overlaps with is the sole or the main chemosensory signaling pathway in these cells. It Omp and Cnga2 immunoreactive signals, and Adcy3 immunoreactivity will be interesting and also challenging to dissect the functional inter- is absent in the GFP+ glomeruli (Fig. 7C). Thus, despite the apparent ab- play between three distinct signaling pathways in type B cells, involving sence of expression of an OR or VR gene, axons of Gucy1b2+ MOE neu- Cnga2, Trpc2, and Gucy1b2. One or more of these signaling pathways rons coalesce into glomeruli that strongly resemble canonical glomeruli, could have a modulating or auxiliary role in chemosensory signal trans- which form in an OR-instructed fashion (Mombaerts et al., 1996; duction, or may be involved in cellular differentiation or axon guidance Mombaerts, 2006). rather than be essential for transduction. It is prudent to keep an open mind when designing and interpreting experiments to understand the 3. Discussion unprecedented coexistence of these three pathways in the same cells. If Trpc2 affects type B cell function one way or the other, the traditional 3.1. Gucy1b2 as a marker for type B cells in the MOE interpretation of the behavioral phenotypes of Trpc2 knockout mice (Leypold et al., 2002; Stowers et al., 2002; Kimchi et al., 2007)will Having established that Trpc2 expression is actually not restricted to become problematic. VSNs in the mouse (Omura and Mombaerts, 2014), we have here char- Thus, for now, Gucy1b2 is merely a marker for type B cells. Func- acterized type B cells molecularly and anatomically. This Trpc2+ cell tional characterization of Gucy1b2 requires appropriate and specific type is confined to the lateral region of the mouse MOE, a region that chemosensory stimuli and Gucy1b2 knockout mice. is similar to that of the most highly expressed OR gene, MOR28/ Olfr1507 (Omura and Mombaerts, 2014). Our previous ISH and IHC 4. Conclusion studies (Omura and Mombaerts, 2014) had not revealed expression of a known chemosensory G-protein coupled receptor gene or component The unexpected discovery that the mouse MOE abounds with of a signaling pathway other than Cnga2, which is required for odorant- Trpc2+ cells (Omura and Mombaerts, 2014) has raised a series of evoked signal transduction in canonical OSNs. The availability of the interesting questions. We have described two types of Trpc2+ MOE Trpc2-IRES-taumCherry knockin strain enabled us here to examine cells: type A(Adcy3+) and type B (Gucy1b2+). The Gucy1b-IRES- live, unfixed cells. Extensive single-cell analyses with degenerate tauGFP mice will be useful for physiological studies of single cells, and

Fig. 5. Expression of other signaling molecules in Gucy1b2+ MOE cells. ISH in coronal sections of the MOE of a wild-type C57BL/6 mouse at 8 weeks. Gucy1b2+ cells are also Cnga2+ (A) but Cnga4− (B). These cells express the phosphodiesterases Pde1c (C) and Pde4a (D), as do canonical OSNs. The cGMP-speciﬁc phosphodiesterase Pde6d (E) and Gucy1b3 (F) are expressed in Gucy1b2+ cells, as well as in all other Omp+OSNs.Gucy1b2+ cells are Pde2a− (G). Scale bar, 10 μm. M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124 121

A genomic DNA, chr 14

altenative ex7 ex9 ex13 ex15 ATG ATG ex3 ex4 ex5 ex6ex8 ex10 ex11 ex12 ex14 ex16 STOP

ex2 ex17 1 kb mRNA alternative ATG ATG STOP

ex1 ex2 ex3 ex4 ex5 ex6 ex7 ex8 ex9 ex10 ex11 ex12 ex13 ex14 ex15 ex16 ex17

HNOB HNOBA CHD protein 0.2 kb

HNOB HNOBA CHD

50 AA B

targeting vector AscI AscI BamHI ex17 EcoRV IRES tauGFP ACNF

STOP wild-type allele loxP 1 kb BamHI EcoRV

STOP gene-targeted allele after Cre excision

BamHI EcoRV IRES tauGFP

STOP

C GFP* Gucy1b2 merged

D GFP DAPI i ii iii vii

vi v iv

Fig. 6. Gucy1b2-IRES-tauGFP gene-targeted strain: main olfactory epithelium. (A) The mouse Gucy1b2 gene is located on chromosome 14 and consists of 17 coding exons. The various domains of the four known soluble guanylate cyclases are HNOB, HNOBA, and CHD. (B) The Gucy1b2-IRES-tauGFP knockin mutation was generated by gene targeting in ES cells. The IRES-tauGFP-ANCF cassette was inserted after the STOP codon of Gucy1b2 by homologous recombination in ES cells. The ACNF cassette, a self-excising neo gene, was removed during trans- mission of the targeted allele through the male germ line, leaving a single loxP site (red triangle) behind in the locus. The IRES sequence allows for the cotranslation of intact Gucy1b2 (regardless of which ATG is used for initiation of translation) with the axonal green-ﬂuorescent marker tauGFP. (C) IHC of a coronal section of the MOE of a homozygous Gucy1b2- IRES-tauGFP mouse at 4 weeks shows concordance of the intrinsic ﬂuorescence of GFP (GFP*) with the immunoreactive signal for Gucy1b2. (D) IHC of a coronal section of the MOE of a homozygous Gucy1b2-IRES-tauGFP mouse at three weeks with antibodies against GFP. The immunoreactive GFP+ cells i through vii exhibit various morphologies and intra-epithelial locations. Nuclear staining is with DAPI. Scale bar, 50 μminC;50μm in D left; 10 μminDi–vii. 122 M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124

A GFP* GFP* GFP* Gucy1b2-GFP

3 wk P7

B GFP* mCherry* merged Gucy1b2-GFP x Trpc2-mCherry x Trpc2-mCherry Gucy1b2-GFP C GFP* Omp merged

GFP* Cnga2 Adcy3 merged

Fig. 7. Gucy1b2-IRES-tauGFP gene-targeted strain: main olfactory bulb. (A) (Left) Ventral view of a whole mount of a homozygous Gucy1b2-IRES-tauGFP mouse at three weeks, showing intrinsic fluorescence of GFP (GFP*). (Middle) High magnification of a ventromedial glomerulus in the right bulb of the same mouse. (Right) At postnatal day 7, GFP+ axons have already coalesced into glomeruli. (B) Whole mount view of a main olfactory bulb of mouse double homozygous for Gucy1b2-IRES-GFP and Trpc2-IRES-taumCherry atfourweeks.Fluorescent axons coalesce into a few glomeruli. The signals with green (GFP*) and red (mCherry*) intrinsic fluorescence overlap precisely. (C) IHC of coronal sections of the glomerular layer in the main olfactory bulb of a homozygous Gucy1b2-IRES-tauGFP at eight weeks. Intrinsic GFP fluorescence (GFP*) overlaps with immunoreactivity for Omp and Cnga2 but not for Adcy3, consistent with expression in type B cells. Scale bar, 500 μm in A left and right; 50 μm in A middle; 200 μminB;50μminC. for molecular, cellular, and anatomical studies of this newly discovered Trpc2 was used for the left homology arm, and a 4.8 kb PvuII–HindIII chemosensory subsystem. The soluble guanylate cyclase Gucy1b2 may fragment containing a part of exon 13 for the right homology arm. A be more than a marker for type B cells, and could be relevant for their PacI–AscI site was generated at the PvuII site located 32 bp after the chemosensory function. In any case, type B cells are not VSNs that are STOP codon of Trpc2. The cassette IRES-taumCherry-loxP-ACNF was misplaced in the MOE, and their gene expression profile suggests that inserted in the newly generated AscI site. The vector was linearized they are physiologically distinct from VSNs, sharing only Trpc2 expres- and electroporated into E14 ES cells. Targeted ES cell clones were sion. Our results serve as further caution against the traditional inter- injected into C57BL/6 blastocysts, and chimeras were bred with wild- pretation of the behavioral phenotypes of Trpc2 knockout mice, as if type C57BL/6 mice. A strain was established from ES clone A75. To only VSNs would be impaired in these mice, and no other neurons or generate the targeting vector for the Gucy1b2-IRES-tauGFP mutation, no other cells in the mouse's body. Specifically, there is no reason to ex- a 4.5 kb BamHI fragment containing a part of exon 17 and intron be- pect that Trpc2+ type B cells respond to pheromones. tween exons 16 and 17 and a 6.7 kb BamHI–EcoRV fragment containing a part of exon 17 and 3′ of Gucy1b2 gene were isolated from bacterial ar- 5. Experimental methods tificial chromosome clone bMQ-312D1 (Source Bioscience). An AscI site was generated immediately downstream of the STOP codon of Gucy1b2. 5.1. Generation of mouse strains with gene-targeted knockin mutations The cassette IRES-tauGFP-loxP-ACNF was inserted in the newly generated AscI site. The vector was linearized and electroporated into E14 cells. To generate the targeting vector for the Trpc2-IRES-taumCherry Targeted ES clones were injected into C57BL/6 blastocysts, and chimeras mutation, a 4.8 kb HindIII–PvuII fragment containing exons 9–13 of were bred with wild-type C57BL/6 mice. A strain was established from ES M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124 123 clone C20. Mice were maintained in specified pathogen-free conditions in 5.3. LongSAGE individually ventilated cages of the Tecniplast green line. Mouse experiments were carried out in accordance with NIH guidelines and the Ger- All steps until the first ampli fication of cDNA were done as described man Animal Welfare Act, European Communities Council Directive for single-cell RT-PCR except for the RT reactions: these were done with 2010/63/EU, and the institutional ethical and animal welfare guidelines biotin anchor-T primer (biotin-TATAGAATTCGCGGCCGCTCGCGA[T]24) of the Max Planck Institute of Biophysics and the Max Planck Research and Superscript III (Invitrogen) for 10 min at 37 °C and 10 min at Unit for Neurogenetics. Approval came from the IACUC of The Rockefel- 50 °C then for 10 min at 65 °C. A biotin-anchor-T primer was used also ler University and the Veterinäramt of the City of Frankfurt. The follow- first amplification step. Amplified PCR products were screened for ing two strains are publicly available from The Jackson Laboratory in expression of Gapdh, Omp, mCherry, Adcy3, Cnga2 and Gnao with a mixed 129 × C57BL/6 background: Trpc2-IRES-taumCherry as gene-specific primers. Samples m85 and m93 from cells (Gapdh, Omp, official strain name B6;129P2-Trpc2btm2MomN/MomJ and JR#6733, mCherry, Cnga2 and Gnao positive, and Adcy3 negative) and v28 and Gucy1b2-IRES-tauGFP as official strain name B6;129P2- (Gapdh, Omp, mCherry,andGnao positive) from the VNO were analyzed Gucy1b2btm3MomN/MomJ and JR#21063. using LongSAGE (Saha et al., 2002) according to the protocol published at http://www.sagenet.org/protocol/index.htm.Briefly, amplified single-cell PCR products were digested with anchoring enzyme NlaIII 5.2. Single-cell RT-PCR (New England BioLabs). Cleaved samples were divided into two fractions and were bound to streptavidin magnetic beads (Dynal), and We dissected out WOM (Khan et al., 2013) from the lateral region linkers were ligated. The ligated DNA was digested with tagging enzyme of the MOE and VNE of Trpc2-IRES-taumCherry homozygous mice at MmeI (NEB). The cleaved tags were ligated to form ditags and amplified 8 weeks and heterozygous OMP-tauYFP mice at 3 or 8 weeks. by PCR. The PCR product was cleaved with anchoring enzyme NlaIII and Tissue samples were dissociated with dispase (Invitrogen), collagenase the ditags were ligated to form concatemers. The concatemers were (Invitrogen) and DNase I (Roche). We picked mCherry+ cells or YFP+ cloned into pZero-1 vector (Invitrogen). Clones were picked and cells picked under an inverted fluorescence microscope (TE200-1, sequenced. Tag sequences were analyzed using SAGE2002 software Nikon) using micromanipulators (N88NEN2, Nikon Narashige) (Fuss (Johns Hopkins University) and NCBI Blast searches. et al., 2013). The isolated cells were washed individually at least three times in separate drops of buffer under mineral oil. The cells were trans- 5.4. In situ hybridization ferred to 0.4 μl of nuclease-free water in each PCR tubes. The samples were immediately snap frozen. Reverse transcription and amplification ISH was performed as described (Ishii et al., 2004). The following of cDNA were conducted as described previously (Saito et al., 2004) riboprobes have been described previously: Omp (Ishii et al., 2004), with modifications. Trpc2, Adcy3,andCnga2 (Omura and Mombaerts, 2014). We used a For single cell RT-PCR, reverse transcription (RT) was performed mix of two riboprobes for Gucy1b2: riboprobe 1, nt 951–2040, and with anchor-T primer (TATAGAATTCGCGGCCGCTCGCGA[T]24) and riboprobe 2, nt 1747–2630 from NM_172810.3. We designed ribo- Superscript III (Invitrogen) for 90 min at 37 °C and 15 min at 50 °C. probes for Cnga4, nt 125–1263 from NM_001033317.3; for Pde1c,nt Reactions were stopped by heating at 70 °C for 10 min. Tailing reaction 1253–2398 from NM_001025568; for Pde2a,nt2361–3358 from NM_ was followed with TdT (Roche), dATP (Roche) and RnaseH (Roche) for 001008548; for Pde4a, nt 2077–2838 from NM_183408; for Pde6d,nt 20 min at 37 °C, then for 10 min at 65 °C. To validate taumCherry expres- 153–908 from NM_008801.2; and for Gucy1b3,nt1901–2835 from sion in the single cells, RT-tailed products were first amplified with NM_017469. Images were collected with a Zeiss LSM 710 confocal mCherry-F1: GGATAACATGGCCATCATCAAGG and Trpc2 3′UTR-R: CATC microscope. TGACTTCCACAGCAGA. Then a second round of PCR was performed with mCherry-F2: CTGTTCCACGATGGTGTAGTCC, and mCherry-R1: CGTAATGC 5.5. Generation of antibodies against mouse Gucy1b2 AGAAGAAGACCATGG. For analysis of expression of other genes, RT- tailed products were first amplified by PCR reaction with EX-Taq HS As antigen for raising antibodies against mouse Gucy1b2 protein, we DNA polymerase (Takara) and anchor-T primer by incubating at 95 °C used the 22 amino-acid peptide RPSALADGKEASTPRNQVKKPR (654– for 2 min, 37 °C for 5 min, 72 °C for 20 min, then 30 cycles of 95 °C for 675 in the Gucy1b2 sequence), which is C-terminal to the predicted cat- 30 s, 67 °C for 1 min, 72 °C for 6 min plus 6 s extension for each cycle, alytic domain CHD. Rabbit antiserum (ImmunoGlobe, Himmelstadt, then 72 °C for 10 min. The second round of PCR was with the following Germany) was raised against KLH-conjugated polypeptide (Schafer-N primers: for Omp,Omp-F:GCACAGTTAGCAGGTTCAGCT,Omp-R:GGTTTG Copenhagen, Denmark). Antibodies were affinity-purified with using CAGTCCTGGCAGC,forGapdh, Gapdh-F: TTAGCCCCCCTGGCCAAGG, affinity columns conjugated with the synthetic peptide. Gapdh-R: CTTACTCCTTGGAGGCCATG, for Cnga2, Cnga2-F: GGAGATCCTG ATGAAGGAAGG, Cnga2-R: AACAGCTGGCTCAGGGGTGT,forAdcy3,Adcy3- 5.6. Immunohistochemistry F: GCATGAACAAAGGAGGGGTTC, Adcy3-R: TCAGGGGTTGTCCACCACTT,for Gnai2,Gnai2-F:GAGCATGAAGCTGTTTGACAGC,Gnai2-R:CTCCTTGGTGTC Mice were anesthetized by injection of ketamine HCl and xylazine TTTGCGC,forGnao1,Gnao-F:CTCCACGAGGACGAAACCAC, Gnao-R: GCCC (210 mg/kg and 10 mg/kg body weight, respectively) and perfused CGGAGATTGTTGGCA, for Gnal (Roppolo et al., 2006). For OR genes, we with ice-cold PBS, followed by 4% PFA in PBS. The mouse heads were used generate RT-PCR primer sets D1–D2 and D4–D6 (Oka et al., 2006), dissected, post-fixed in 4% PFA, and decalcified in 0.45 M EDTA in 1× and P26–P27 (Malnic et al., 1999). For Taar genes, we used Taar-F: PBS overnight at 4 °C. Samples were cryoprotected in 15% and 30% su- TIGAGRGMTGCTGGTAYTTYGG and Taar-R: RGTYTTKGCWGCYTTYCTITC.For crose in 1× PBS at 4 °C, frozen in O.C.T. compound (Tissue-Tek), and sec- Vmn1r genes, we used the 11 primer sets (V1ra-V1rk) as previously de- tioned at 12 μm with a Leica CM3500 cryostat. Sections were washed scribed (Roppolo et al., 2006). For family-C Vmn2r genes, we used for with 1× PBS. Washed sections were blocked with 10% normal goat set A, Family-C-F1: AAGCCATGCAACTGGTCCTG and Family-C-R1: GCATTC serum or normal donkey serum, 0.1% Triton X-100 in 1× PBS for 1 h AAAGATGATCTTTACA, and for set B, Family-C-F1 and Family-C-R2: GACA at room temperature. After the blocking step, sections were incubated AAAGAGATCCAGACAATG.ForFpr genes, we used for set A, Fpr-F1: TTCT in 3% BSA, 0.1% Triton X-100 in 1× PBS for overnight at 4 °C with the fol- TTGTCTGTTGGTTCCC and Fpr-R1: ACATAGAGTATTGGGTTGAG,andforset lowing primary antibodies: rabbit anti-Gucy1b2 (1:500), rabbit anti- B, Fpr-F2: TCTTGACTACAGTGAGAGATG and Fpr-R2: GAGGACACGTAAAGGA Trpc2 (1:500, Liman et al., 1999), goat anti-Omp (1:1000, Wako CG. Primers for Fpr-rs1 were: Fpr-rs1-F, ATCCTGGGGCAACTCTGTTGAG Chemicals), rabbit anti-Adcy3 (1:1000, Santa Cruz Biotechnology), and Fpr-rs1-R: CACAGCCCCCTCCTCATATT. goat anti-Cnga2 (1:100, Santa Cruz Biotechnology), and chicken anti- 124 M. Omura, P. Mombaerts / Molecular and Cellular Neuroscience 65 (2015) 114–124

GFP (1:3000, Aves Labs). After incubation with primary antibodies, sec- Khan, M., Vaes, E., Mombaerts, P., 2013. Temporal patterns of odorant receptor gene expression in adult and aged mice. Mol. Cell. Neurosci. 57, 120–129. tions were incubated at 1.5 h at room temperature with secondary an- Kimchi, T., Xu, J., Dulac, C., 2007. A functional circuit underlying male sexual behaviour in tibodies: goat anti-rabbit IgG-Alexa647 (Molecular Probes) for rabbit the female mouse brain. Nature 448, 1009–1014. anti-Trpc2 in Fig. 1B, goat anti-rabbit IgG-Alexa488 (Molecular Probes) Leinders-Zufall, T., Cockerham, R.E., Michalakis, S., Biel, M., Garbers, D.L., Reed, R.R., Zufall, F., Munger, S.D., 2007. Contribution of the receptor guanylyl cyclase GC-D to for rabbit anti-Gucy1b2 in Figs. 4B, goat anti-rabbit IgG-Alexa546 (Mo- chemosensory function in the olfactory epithelium. Proc. Natl. Acad. Sci. U. S. A. lecular Probes) for rabbit anti-Gucy1b2 in Fig. 6C, goat anti-chicken IgG 104, 14507–14512. Alexa488 (Molecular Probes) in Fig. 6D, donkey anti-rabbit IgG Leypold, B.G., Yu, C.R., Leinders-Zufall, T., Kim, M.M., Zufall, F., Axel, R., 2002. Altered Alexa555 (Molecular Probes) for rabbit anti-Adcy3 in Fig. 7C, donkey sexual and social behaviors in trp2 mutant mice. Proc. Natl. Acad. Sci. U. S. A. 99, 6376–6381. anti-goat IgG Cy5 (Jackson ImmunoResearch) for goat anti-Omp, and Liberles, S.D., Buck, L.B., 2006. A second class of chemosensory receptors in the olfactory goat anti-Cnga2 in Fig. 7C. For sections of the olfactory bulb, nuclear epithelium. Nature 442, 645–650. staining was with DAPI (1:10,000, Molecular Probes) after the washing Liberles, S.D., Horowitz, L.F., Kuang, D., Contos, J.J., Wilson, K.L., Siltberg-Liberles, J., Liberles, D.A., Buck, L.B., 2009. Formyl peptide receptors are candidate chemosensory steps. Sections were analyzed with a Zeiss LSM 710 confocal receptors in the vomeronasal organ. Proc. Natl. Acad. Sci. U. S. A. 106, 9842–9847. microscope. Liman, E.R., Corey, D.P., Dulac, C., 1999. TRP2: a candidate transduction channel for mammalian pheromone sensory signaling. Proc. Natl. Acad. Sci. U. S. A. 96, 5791–5796. Malnic, B., Hirono, J., Sato, T., Buck, L.B., 1999. Combinatorial receptor codes for odors. Cell Acknowledgments 96, 713–723. Mombaerts, P., 2006. Axonal wiring in the olfactory system. Annu. Rev. Cell Dev. Biol. 22, We thank Wei Tang and Zhaodai Bai for injecting ES cells into blas- 713–737. fl Mombaerts, P., Wang, F., Dulac, C., Chao, S.K., Nemes, A., Mendelsohn, M., Edmondson, J., tocysts; Yan Zhu and Manxi Jiang for picking single red- uorescent Axel, R., 1996. Visualizing an olfactory sensory map. Cell 87, 675–686. cells from Trpc2-IRES-taumCherry mice; Hiro Matsunami for sharing Morton, D.B., 2004. Atypical soluble guanylyl cyclases in Drosophila can function as experimental protocols for single-cell RT-PCR and LongSAGE; Tobias molecular oxygen sensors. J. Biol. Chem. 279, 50651–50653. Oka, Y., Katada, S., Omura, M., Suwa, M., Yoshihara, Y., Touhara, K., 2006. Odorant receptor Burbach and Bartos Machert for technical assistance; and Bolek Zapiec map in the mouse olfactory bulb: in vivo sensitivity and specificity of receptor- and Anna Holl for help with SAGE tag analysis. We are grateful to defined glomeruli. Neuron 52, 857– 869. Emily Liman for a gift of a copious quantity of Trpc2 antibodies. We Omura, M., Mombaerts, P., 2014. Trpc2-expressing sensory neurons in the main olfactory – acknowledge Johns Hopkins University for SAGE2002 software and a epithelium of the mouse. Cell Rep. 8, 583 595. Rivière, S., Challet, L., Fluegge, D., Spehr, M., Rodriguez, I., 2009. Formyl peptide receptor- detailed experimental protocol. P.M. received grant support from like proteins are a novel family of vomeronasal chemosensors. Nature 459, 574–577. European Research Council Advanced Grant ORGENECHOICE, and Roppolo, D., Ribaud, V., Jungo, V.P., Lüscher, C., Rodriguez, I., 2006. Projection of the – generous support from the Max Planck Society. Grüneberg ganglion to the mouse olfactory bulb. Eur. J. Neurosci. 23, 2887 2894. Saha, S., Sparks, A.B., Rago, C., Akmaev, V., Wang, C.J., Vogelstein, B., Kinzler, K.W., Velculescu, V., 2002. Using the transcriptome to annotate the genome. Nat. References Biotechnol. 19, 508–512. Saito, H., Kubota, H., Roberts, R.W., Chi, Q., Matsunami, H., 2004. RTP family members Fuss, S.H., Zhu, Y., Mombaerts, P., 2013. Odorant receptor gene choice and axonal wiring induce functional expression of mammalian odorant receptors. Cell 119, 679–691. in mice with deletion mutations in the odorant receptor gene SR1. Mol. Cell. Neurosci. Scott, K., 2011. Out of thin air: sensory detection of oxygen and carbon dioxide. Neuron 56, 212–224. 69, 194–202. Gray, J.M., Karow, D.S., Lu, H., Chang, A.J., Chang, J.S., Ellis, R.E., Marletta, M.A., Bargmann, Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N., Palmer, A.E., Tsien, R.Y., 2004. C.I., 2004. Oxygen sensation and social feeding mediated by a C. elegans guanylate Improved monomeric red, orange, and yellow fluorescent proteins derived from cyclase homologue. Nature 430, 317–322. Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22, 1567–1572. Hu, J., Zhong, C., Ding, C., Chi, Q., Walz, A., Mombaerts, P., Matsunami, H., Luo, M., 2007. Silvotti, L., Cavalca, E., Gatti, R., Percudani, R., Tirindelli, R., 2011. A recent class of

Detection of near-atmospheric concentrations of CO2 by an olfactory subsystem in chemosensory neurons developed in mouse and rat. PLoS ONE 6 (9), e24462. the mouse. Science 317, 953–957. Stowers, L., Holy, T.E., Meister, M., Dulac, C., Koentges, G., 2002. Loss of sex discrimination Ishii, T., Mombaerts, P., 2008. Expression of nonclassical class I major histocompatibility and male–male aggression in mice deficient for TRP2. Science 295, 1493–1500. genes defines a tripartite organization of the mouse vomeronasal system. Velculescu, V.E., Zhang, L., Vogelstein, B., Kinzler, K.W., 1995. Serial analysis of gene J. Neurosci. 28, 2332–2341. expression. Science 270, 484–487. Ishii, T., Mombaerts, P., 2011. Coordinated coexpression of two vomeronasal receptor V2R Zimmer, M., Gray, J.M., Pokala, N., Chang, A.J., Karow, D.S., Marletta, M.A., Hudson, M.L., genes per neuron in the mouse. Mol. Cell. Neurosci. 46, 397–408. Morton, D.B., Chronis, N., Bargmann, C.I., 2009. Neurons detect increases and Ishii, T., Omura, M., Mombaerts, P., 2004. Protocols for two- and three-color fluorescent decreases in oxygen levels using distinct guanylate cyclases. Neuron 61, 865–879. RNA in situ hybridization of the main and accessory olfactory epithelia in mouse. J. Neurocytol. 33, 657–669. Kelliher, K.R., Ziesmann, J., Munger, S.D., Reed, R.R., Zufall, F., 2003. Importance of the CNGA4 channel gene for odor discrimination and adaption in behaving mice. Proc. Natl. Acad. Sci. U. S. A. 100, 4299–4304.