Supplementary Table 1. selected for analysis Expression by SAGE* Expression by EST** (Transcripts/cell+) (Transcripts/cell+) Chromosomal Normal Lung Normal Lung # Symbol Accession # region lung cancer P++ lung cancer P++ 1 S100 calcium binding S100A8 NM_002964 1q21 1593 15 0 21 26 0.33 2 S100 calcium binding protein A2 S100A2 NM_005978 1q21 1498 2 0 19 7 0.09 3 Surfactant, pulmonary-associated protein C SFTPC NM_003018 8p21 734 181 0 1588 133 0 4 ANXA2 NM_004039 15q21-q22 521 136 0 270 263 0.42 5 Secretoglobin, family 1A, member 1 SCGB1A1 NM_003357 11q12.3-q13.1 478 64 0 58 15 0 6 Stratifin SFN NM_006142 1p36.11 350 25 0 26 61 0.01 7 Insulin-like growth factor binding protein 7 IGFBP7 NM_001553 4q12 274 72 0 46 25 0.05 8 Caveolin 1 CAV1 NM_001753 7q31.1 210 10 0 312 68 0 9 Integral membrane protein 2B ITM2B NM_021999 13q14.3 185 62 0 208 51 0 10 Glutathione peroxidase 3 GPX3 NM_002084 5q23 169 8 0 106 78 0.09 11 Laminin, gamma 2 LAMC2 NM_005562 1q25-q31 166 4 0 40 10 0 12 TP53 apoptosis effector PERP NM_022121 6q24 156 36 0 49 43 0.38 13 TYRO protein tyrosine kinase binding protein TYROBP NM_003332 19q13.1 150 33 0 5 5 0.48 14 Endothelial PAS domain protein 1 EPAS1 NM_001430 2p21-p16 132 9 0 226 59 0 15 SH3 domain binding glutamic acid-rich protein SH3BGRL3 NM_031286 1p35-p34.3 129 28 0 35 26 0.25 like 3 16 Ras homolog gene family, member C RHOC NM_175744 1p13.1 117 21 0 42 53 0.22 17 Cystatin A CSTA NM_005213 3q21 115 19 0 5 0 0.22 18 CD52 antigen (CAMPATH-1) antigen CDW52 NM_001803 1p36 109 12 0 23 0 0 19 Receptor (calcitonin) activity modifying protein Ramp2 NM_005854 17q12-q21.1 108 4 0 12 2 0.08 2 20 DAZ associated protein 2 DAZAP2 NM_014764 12q12 106 19 0 161 86 0 21 Guanine nucleotide binding protein , alpha GNAI2 NM_002070 3p21 96 19 0 69 76 0.15 inhibiting activity polypeptide 2 22 Guanine nucleotide binding protein, gamma 11 GNG11 NM_004126 7q31-q32 91 5 0 3 7 0.26 23 Ras homolog gene family, member D RHOD NM_014578 11q14.3 81 13 0 2 2 0.46 24 Cadherin 3, type 1, P-cadherin CDH3 NM_001793 16q22.1 79 11 0 10 16 0.26 25 EGF-containing fibulin-like EFEMP1 NM_004105 2p16 74 13 0 64 25 0 protein 1 26 Integrin, beta 1 ITGB1 NM_002211 10p11.2 70 14 0 140 52 0 27 Transmembrane anchor protein 1 TMAP1 NM_198530 17q25.1 68 11 0 31 2 0 Expression by SAGE* Expression by EST** (Transcripts/cell+) (Transcripts/cell+) Chromosomal Normal Lung Normal Lung # Gene Symbol Accession # region lung cancer P++ lung cancer P++ 28 Dickkopf homolog 3 Dkk3 NM_015881 11p15 68 2 0 31 58 0.02 29 Receptor (calcitonin) activity modifying protein 3 Ramp3 NM_005856 7p13-p12 64 2 0 31 3 0 30 Tissue inhibitor of metalloproteinase 3 TIMP3 NM_000362 22q12.1 64 2 0 169 54 0 31 Gap junction protein, beta 2 GJB2 NM_004004 13q11-q12 64 4 0 8 6 0.4 32 Selenoprotein P, plasma, 1 SEPP1 NM_005410 5q31 64 12 0 208 15 0 33 Amine oxidase, copper containing 3 AOC3 NM_003734 17q21 62 0 0 19 13 0.29 34 Fc fragment of IgG, low affinity IIIa, receptor FCGR3A NM_000569 1q23 53 3 0 44 2 0 35 Cyclin D1 CCND1 NM_053056 11q13 49 8 0 47 37 0.24 36 Caveolin 2 CAV2 NM_001233 7q31.1 47 0 0 35 19 0.07 37 Four and a half LIM domains 1 FHL1 NM_001449 Xq26 47 0 0 144 17 0 38 Cadherin 5, type 2, VE-cadherin CDH5 NM_001795 16q22.1 46 4 0 13 6 0.2 39 Defensin, alpha DEFA1 NM_004084 8p23.2-p23.1 43 0 0 0 0 0 40 Fatty acid binding protein 4, adipocyte FABP4 NM_001442 8q21 41 0 0 36 9 0.01 41 EMP1 Epithelial membrane protein 1 EMP1 NM_001423 12p12.3 40 0 0 96 22 0 42 Laminin, alpha 3 LAMA3 NM_198129 18q11.2 34 0 0 8 9 0.43 43 Aquaporin 4 AQP4 NM_001650 18q11.2-q12.1 33 0 0 29 4 0.01 44 Rhesus blood group, C glycoprotein RHCG NM_016321 15q25 31 0 0 0 0 0 45 Hairy and enhancer of split 2 HES2 NM_019089 1p36.31 30 0 0 2 5 0.34 46 Annexin A8 ANXA8 NM_001630 10q11.2 29 0 0 18 4 0.05 47 Topoisomerase (DNA) II beta TOP2B NM_001068 3p24 26 2 0 61 26 0 48 Superoxide dismutase 1, soluble SOD1 NM_000454 21q22.1 21 28 0.24 123 86 0.01 49 slit homolog 2 SlIT2 NM_004787 4p15.2 0 2 0.36 33 8 0.01 50 zinc finger, MYND-type containing 10 ZMYND10 NM_015896 3p21.3 0 10 0.07 36 4 0 51 RNA binding motif protein 5 H37 AF103802 3p21.3 10 20 0.14 83 33 0 52 Roundabout, axon guidance receptor, homolog 1 DUTT1 NM_002941 3p12 4 0 0.25 17 13 0.38 53 Aminoacylase ACY1 NM_000666 3p21.1 10 6 0.31 8 22 0.06 54 Semaphorin 3B SEMA3B NM_004636 3p21.3 0 2 0.36 13 13 0.42 * SAGE databases included 3 libraries from lung cancer (159,128 tags) and 3 libraries from normal lung tissues (159,917 tags). ** EST databases included 20 libraries from lung cancer (169,722 clones) and 23 libraries from normal lung tissues (102,337 clones). + Expression was normalized based on the estimation that there are ~300,000 transcripts in a cell (Hastie, N. D. & Bishop, J. O.1976, Cell 9, 761-74.) ++ P values were provided by the SAGE and EST DGED analysis programs.

Supplementary Table 2. Genes analyzed for expression after 5’-aza-dC treatment Accession PCR product # Symbol Gene # Forward primer (5'-3') Reverse primer (5'-3') size (bp) 1 S100A2 S100 calcium binding protein A2 NM_005978 TGGGATCAGGTTGAGGCAGG GGTTATGGAACATCACTGAGC 569 2 IGFBP7 Insulin-like growth factor binding protein 7 NM_001553 TGCGTGAAGAGCCGCAAGAG GAGGTTTATAGCTCGGCACC 616 3 CAV1 Caveolin 1 NM_001753 CACAGCCCAGGGAAACCTCCTC GTCACAGACGGTGTGGACGTAG 384 4 ITM2B Integral membrane protein 2B NM_021999 GAAGGTGACGTTCAACTCCG ATCACATAGCACTTATCCAGG 495 5 LAMC2 Laminin, gamma 2 NM_005562 AGGCAGTGT ATCTTTGATC GG CACTGTATTCTGCAGAGCTGC 508 6 PERP TP53 apoptosis effector NM_022121 TGTGGCTTCATCATCCTGGTG GAGTCCATCTCAGCAGCAGCG 382 7 EPAS1 Endothelial PAS domain protein 1 NM_001430 CAGCGACAAT GACAGCTGAC ACTCAGGTTCTCACGAATCTC 452 8 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 NM_031286 ATGAGCG GCCTGCGCGT CTAC TTGGCAGAGCTCTGGCTGATGG 607 9 RHOC Ras homolog gene family, member C NM_175744 ACG GTGTTTGAGC GGTACATGG AGCCAGCTCAGCAGCAGGTC 552 10 CD52 CD52 antigen (CAMPATH-1) antigen NM_001803 AAGCCTCCAGACAGCCCTGAG GGCACTGCTTGGCCCCTACA 431 11 Ramp2 Receptor (calcitonin) activity modifying protein 2 NM_005854 GCTGCACGATGGCCTCGCTCCG CCAACCCTGGCTTCCATTCCCAGC 672 12 DAZAP2 DAZ associated protein 2 NM_014764 AGACCTTGCATCTTCCTCAGG GTTACATTGTGAGAAGTGCTG 501 13 GNAI2 Guanine nucleotide binding protein , alpha inhibiting NM_002070 CCTGCAGATCGACTTTGCCGAC CGGCGTCAAACACGAACTGCAC 749 activity polypeptide 2 14 CDH3 Cadherin 3, type 1, P-cadherin NM_001793 AAGAGCTGAGCGGAACACCGG CTCATACTTGGCAATCTCCTC 618 15 EFEMP1 EGF-containing fibulin-like extracellular matrix NM_004105 ATA ATGAACAGCC TCAGCAGG TGTTGTAGCACTGCTGAGCAC 513 protein 1 16 TMAP1 Transmembrane anchor protein 1 NM_198530 GCGGAGGAGC AGGCGGTGGAG ACAGGAACAGACATGAACATC 430 17 Dkk3 Dickkopf homolog 3 NM_015881 GCG GGAGCGAGCA GATCCAG CAGTCCTCGTCGATGATGCAC 536 18 Ramp3 Receptor (calcitonin) activity modifying protein 3 NM_005856 CGCAGACATG ATGGGCAAGG CAGTAGCTGGAGATTCAGC 412 19 TIMP3 Tissue inhibitor of metalloproteinase 3 NM_000362 GCTCA TCGTGCTCCT GGGCAG CTCGGTACCAGCTGCAGTAGC 572 20 GJB2 Gap junction protein, beta 2 NM_004004 GCTTCCTCCCGACGCAGAG CAGTGACATTCAGCAGGATG 665 21 CCND1 Cyclin D1 NM_053056 TGCGGAAGATCGTCG CCACCTG ACACTTGATCACTCTGGAGAG 350 22 CAV2 Caveolin 2 NM_001233 GGCGGACGTACAGCTCTTCAT GCAATGATAACATCTGTCACAC 525 23 HES2 Hairy and enhancer of split 2 NM_019089 GAATTGGAGAGCCGTCCAGG CACCAAGAGCTTCAACCTGTC 709 24 SOD1 Superoxide dismutase 1, soluble NM_000454 TGCGTCGTAGTCTCCTGCAGC CATGGACCACCAGTGTGCG 445 25 SlIT2 Slit homolog 2 NM_004787 GGCTGGCGCTGCGCAGCGTG ATACACTGAGTGTACAGACC 573 26 TOP2B Topoisomerase (DNA) II beta NM_001068 GAGTGTGAGAAGGATAAGGTA CCAACCACTTACCACCCAAAT 495 27 ZMYND10 Zinc finger, MYND-type containing 10 NM_015896 GCTTAGCACACACAACCTGC CCTTGGCAAAACTTGTGAGG 233 28 H37 RNA binding motif protein 5 AF103802 AGGGATGACCGTGATGAGCG AACTTGTCTGCTCCACATCGG 607 29 Dutt1 Roundabout, axon guidance receptor, homolog 1 NM_002941 ATGATTGCGGAGCCCGCTCA GAGTCACAGGACCTTGTCGA 572 30 ACY1 Aminoacylase NM_000666 ACCAAGGCATGGAGCTGTTGG GAGCAAACTCTAGGGTGACC 465 31 SEMA3B Semaphorin 3B NM_004636 CACCCATTTGCTGGCCTGTGG CTCATTGAGCCAGCGGGAGTCG 293 RASSF1A* Ras association domain family protein 1A BT020047 GGCGTCGTGCGCAAAGGCC GGGTGGCTTCTTGCTGGAGGG 342 GAPDH Glyceraldehyde-3-phosphate dehydrogenase AJ844645 CTCAGACACCATGGGGAAGGTGA ATGATCTTGAGGCTGTTGTCATA 428 * Clinical Cancer Research, 2003, 9: 1441-1445.

Supplementary Table 3. Primers for bisulfite PCR PCR Priming Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’) product site size (bp) RAMP2 Genomic GAGCTGCATGGCTCAGCTCCAGG CCTCTCCCCTCTCCCCTCC 691 Modified GAGTTGTATGGTTTAGTTTTAGG CCTCTCCCCTCTCCCCTCC EFEMP1 Genomic GGAGCTGGCAAGGGAGGGCAAG CTAAGCCTTCTCACATATCTC 862 Modified GGAGTTGGTAAGGGAGGGTAAG CTAAACCTTCTCACATATCTC TIMP3 Genomic GACACCCAGTGGCCCAGGTGG CAGGCTCCAGCTGCCCAGGAGC 688 Modified GATATTTAGTGGTTTAGGTGG CAAACTCCAACTACCCAAAAAC SH3BGRL3 Genomic TGTGTGCGGCTGGAGAGGGAGG CCGTCCTGGGGGTGGGTCC 559 Modified TGTGTGXGGTTGGAGAGGGAGG CCATCCTAAAAATAAATCCC Dutt1 Genomic CAAGTGARGGGAACAAGGGCCCG TGAAG CCACACACCACACACAA 575 Modified TAAGTGATGGGAATAAGGGTTXG TAAAACCACACACCACACACAA HES2 Genomic GCTCCAGTCAGGCAAGGCCTGG CCCAGGACCCTCTGCCCTC 580 Modified GTTTTAGTTAGGTAAGGTTTGG CCCAAAACCCTCTTCCCTC

Supplementary Table 4. Tumor samples for MSP analysis

# Age Sex Diagnosis Staging 1 66 F Large cell tumor IIIA 2 64 M Adenocarcinoma Unknown 3 52 M Colon metastasis Unknown 4 64 F Adenocarcinoma IA 5 52 M Adenocarcinoma IA 6 70 F Adenocarcinoma IA 7 74 M Squamous cell carcinoma IB 8 69 M Adenocarcinoma IB 9 67 F Adenocarcinoma IA 10 79 M Squamous cell carcinoma IB 11 74 M Squamous cell carcinoma IA 12 72 M Adenocarcinoma IA 13 69 F Adenocarcinoma IB 14 59 F Squamous cell carcinoma IA 15 61 M Squamous cell carcinoma IB 16 65 F Adenocarcinoma IB 17 74 F Large cell-neuroendocrine IB 18 83 F Adeno-squamous IB 19 80 F Squamous cell carcinoma IIA 20 74 F NSCLC Unknown 21 69 M Squamous cell carcinoma IB 22 60 F Large cell-neuroendocrine IIIA 23 72 M Large cell tumor IB 24 61 F Adenocarcinoma IB 25 76 F Adenocarcinoma Unknown 26 65 F Adenocarcinoma I 27 69 M Squamous cell carcinoma IIA 28 54 M Adenocarcinoma IIIB 29 66 F Squamous cell carcinoma IIB 30 69 M Adeno-squamous IA 31 72 F NSCLC Unknown 32 64 F Squamous cell carcinoma IA

Supplementary Table 5. RAMP2 expression in 95 lung tumor and 32 matched normal samples RAMP2 RAMP2 expression in # Age Sex Diagnosis Grade expression in matched tumor tissues normal tissues 1 42 M Adenocarcinoma 1 + + 2 60 M Papillary adenocarcinoma 1 + + 3 43 F Papillary adenocarcinoma 1 + + 4 58 M Squamous cell carcinoma 1 - 5 66 F Squamous cell carcinoma 1 - 6 58 M Adenocarcinoma 1 - 7 62 M Papillary adenocarcinoma 1 - 8 45 F Adenocarcinoma 1 + 9 60 M Adenocarcinoma 1 + 10 66 M Mucinous adenocarcinoma 1 - 11 53 F Adenocarcinoma 1 + 12 55 F Mucinous adenocarcinoma 1 + 13 40 M Squamous cell carcinoma 2 - + 14 60 M Squamous cell carcinoma 2 - + 15 58 F Adenocarcinoma 2 - + 16 46 M Adenocarcinoma 2 - + 17 59 M Papillary adenocarcinoma 2 - + 18 32 F Adenocarcinoma 2 - + 19 40 M Squamous cell carcinoma 2 - + 20 57 M Squamous cell carcinoma 2 - + 21 48 M Adenocarcinoma 2 - + 22 46 F Squamous cell carcinoma 2 - 23 70 M Squamous cell carcinoma 2 - 24 61 M Squamous cell carcinoma 2 - 25 58 M Squamous cell carcinoma 2 - 26 67 F Squamous cell carcinoma 2 - 27 53 M Squamous cell carcinoma 2 - 28 65 F Squamous cell carcinoma 2 + 29 78 M Squamous cell carcinoma 2 - 30 49 F Squamous cell carcinoma 2 - 31 59 M Squamous cell carcinoma 2 + 32 62 M Squamous cell carcinoma 2 - 33 72 F Adenocarcinoma 2 + 34 35 F Adenocarcinoma 2 - 35 47 M Adenocarcinoma 2 - 36 54 F Adenocarcinoma 2 + 37 46 F Adenocarcinoma 2 + 38 58 F Adenocarcinoma 2 + 39 47 M Papillary adenocarcinoma 2 + 40 37 F Adenocarcinoma 2 + 41 63 F Adenocarcinoma 2 - 42 53 M Mucinous adenocarcinoma 2 - 43 55 F Mucinous adenocarcinoma 2 + 44 67 F Adenocarcinoma 2 - 45 56 M Squamous cell carcinoma 2 - 46 63 F Adenocarcinoma 2 - 47 64 M Squamous cell carcinoma 3 - - 48 55 M Squamous cell carcinoma 3 - + 49 63 M Squamous cell carcinoma 3 - + 50 62 M Squamous cell carcinoma 3 - + 51 59 M Adenocarcinoma 3 + + 52 65 M Squamous cell carcinoma 3 - - 53 53 M Squamous cell carcinoma 3 - + 54 72 M Squamous cell carcinoma 3 - + 55 46 M Squamous cell carcinoma 3 - + 56 74 M Squamous cell carcinoma 4 - + 57 39 F Squamous cell carcinoma 3 - + 58 54 M Squamous cell carcinoma 3 - - 59 66 M Adenocarcinoma 3 - + 60 54 M Adenocarcinoma 3 - + 61 67 M Adenocarcinoma 3 - + 62 56 F Adenocarcinoma 3 + + 63 58 M Squamous cell carcinoma 3 - + 64 45 M Squamous cell carcinoma 3 - - 65 60 M Squamous cell carcinoma 3 - + 66 73 M Squamous cell carcinoma 3 - - 67 72 M Squamous cell carcinoma 3 - 68 58 M Squamous cell carcinoma 3 - 69 53 M Squamous cell carcinoma 3 - 70 41 M Squamous cell carcinoma 3 - 71 54 M Squamous cell carcinoma 3 - 72 50 M Squamous cell carcinoma 3 - 73 49 F Squamous cell carcinoma 3 - 74 51 M Squamous cell carcinoma 3 - 75 65 M Squamous cell carcinoma 3 - 76 72 M Squamous cell carcinoma 3 - 77 51 M Squamous cell carcinoma 3 - 78 53 M Squamous cell carcinoma 3 - 79 61 M Squamous cell carcinoma 3 - 80 47 F Squamous cell carcinoma 3 - 81 61 M Squamous cell carcinoma 3 - 82 56 M Squamous cell carcinoma 3 - 83 52 M Adenocarcinoma 3 - 84 65 M Adenocarcinoma 3 + 85 49 F Adenocarcinoma 3 - 86 59 M Adenocarcinoma 3 + 87 50 F Adenocarcinoma 3 + 88 35 M Adenocarcinoma 3 - 89 62 M Adenocarcinoma 3 - 90 50 M Squamous cell carcinoma 3 - 91 66 M Squamous cell carcinoma 3 - 92 59 M Squamous cell carcinoma 3 - 93 52 M Squamous cell carcinoma 3 - 94 64 F Adenocarcinoma 3 - 95 66 M Squamous cell carcinoma 3 - * The 17 unmatched normal samples, which were not listed in the Table, were all positive for RAMP2. Supplementary Figure Legend

Supplementary Figure 1. Bisulfite sequencing of the RAMP2 promoter in H1299,

Calu1 and 273T cells.

Bisulfite sequencing region and positions of MSP primers were indicated. If a T peak was 50% or higher compared with a C peak at the same position, the base was considered to be partially methylated.

Supplementary Figure 2. RAMP2-induced apoptosis in lung cancer cells.

A549 and H1299 cells were transfected with RAMP2 or the control pCDNA vector.

Apoptosis at 36 hr after transfection was analyzed by nuclear staining with Hoechst

33258. Example apoptotic cells were indicated by arrows.

Supplementary Figure 3. BrdU incorporation in RAMP2-knockdown lung cancer cells.

H1752 cells were transfected with RAMP2 siRNA or the control scrambled siRNA.

Thirty six hours after transfection, BrdU incorporation was analyzed as described in the

Materials and Methods. Red staining indicated BrdU-positive cell nuclei. Cell nuclei were counterstained by DAPI (blue).

Supplementary Figure 1

RAMP2 exon1exon1 exon2exon 2

H1299

Calu1

273T

CpG site MSP primers Bisulfite sequencing region Translation initiation site Unmethylated CpG Methylated CpG Partially methylated CpG Supplementary Figure 2

pCDNA RAMP2 RAMP2+z-VAD-fmk

A549

H1299 Supplementary Figure 3

BrdU DAPI Merge

Scrambled siRNA

RAMP2 siRNA