+The role of exchange protein directly activated by cAMP
(Epac) in cardiac remodeling
Mona Aflaki
Department of Pharmacology and Therapeutics
McGill University, Montreal
August, 2014
A thesis submitted to McGill University in partial fulfillment of the requirements of
the degree of Doctor of Philosophy
Mona Aflaki, 2014
1
This thesis is dedicated to:
My dear husband Amir for his continuous love and unwavering support. My
wonderful parents and my lovely sister Saba for their endless encouragement,
and understanding over the years.
1
Abstract
Cardiac arrhythmias remain a leading cause of mortality for patients
afflicted by cardiac diseases, such as heart failure (HF). Sudden cardiac death is
implicated in ~50% of deaths in HF, and remodeling of ion channels further leads
to lethal arrhythmias. Neurohormonal activation plays a significant role in cardiac
remodeling and progression of the disease. In this thesis, I investigated the role
of exchange protein directly activated by cAMP (Epac) in cardiac remodeling.
HF is associated with an increase in adrenergic drive, with plasma
norepinephrine concentrations predictive of mortality outcomes. Reduction in the
slowly activating delayed-rectifier potassium current (IKs) is commonly observed
in HF-related remodeling and plays a role in arrhythmogenesis. I sought to identify the underlying mechanisms of IKs downregulation via sustained β -
adrenergic stimulation. Using an in vitro guinea pig model, I identified a signaling pathway that proceeded through β 1-adrenergic receptors and involved the activation of Epac1 protein. Epac1 increased intracellular calcium activation of the calcineurin/nuclear factor of activated T cell (NFAT) pathway to transcriptionally down-regulate the expression of KCNE1 subunits of IKs.
Adenovirus-mediated knockdown of Epac1 in vitro demonstrated the central role
of Epac 1 in regulating IKs in guinea pigs.
2
In vivo administration of isoproterenol and a specific Epac activator
significantly increased action potential duration, indicating repolarization
abnormalities, while IKs, L-type calcium current (ICaL), and inward rectifier current
(IK1) were significantly decreased. The signaling pathway identified in our in vivo
study will assist in devising more effective approaches to prevent arrhythmias.
HF is associated with fibrotic remodeling that creates a substrate for atrial
fibrillation (AF). Fibroblasts regulate extracellular matrix (ECM) production and
excess ECM deposition leads to fibrosis. Fibrosis is more prominent in the atrium
and atrial fibroblasts are more responsive to fibrotic stimuli. I sought to determine
the role of Epac in the fibrotic response. Epac1 expression was decreased in an
experimental model of tachypacing-induced HF with AF. Incubation of atrial
fibroblasts with a specific Epac activator decreased collagen mRNA expression.
Profibrotic stimuli such as norepinephrine and TGF β 1 decreased Epac1
expression in atrial fibroblasts. Sustained β-adrenergic stimulation modulated
collagen expression through activation of Epac1 via β2-adrenergic receptors.
These findings demonstrated the different roles of Epac in cardiomyocytes versus fibroblasts in cardiac remodeling in the heart.
3
Résumé
Les arythmies cardiaques demeurent la principale cause de mortalité pour de nombreuses maladies cardiaques notamment l'insuffisance cardiaque (IC). La mort subite cardiaque est impliquée dans environ 50% des décès.
Le remodelage ionique arythmogène provoque une altération des canaux ioniques qui participe de façon significative à l’apparition d'une arythmie fatale.
L'activation neuro-hormonale joue aussi un rôle important dans le remodelage cardiaque et de la progression des maladies cardiovasculaires. Dans cette thèse de doctorat, nous avons étudié le rôle des protéines Epac dans le remodelage cardiaque au niveau du cœur.
L’IC est associée à une activation du système nerveux sympathique et conséquemment à une stimulation adrénergique. Le taux de noradrénaline plasmatique est un excellent index pronostique, indépendant de la fraction d'éjection. La réduction du courant potassique cardiaque à rectification retardée
(IKs) est couramment observé dans le remodelage liés à l’IC et joue un rôle dans l’arythmogénèse. Ainsi, l’objectif de ce projet était d’identifier les mécanismes sous-jacents impliqués dans la diminution d’IKs via la stimulation β-adrénergique soutenue. Les résultats obtenus avec un modèle in vitro ont révélé une voie de signalisation qui implique l'activation des récepteurs β1-adrénergiques et une protéine clé: l’Epac 1. L’Epac 1 augment l’activation du calcium intracellulaire de
4
la voie calcineurine/NFAT pour réguler négativement l'expression de sous-unités
KCNE1 d’IKs. In vitro, l’abolition de l’expression de l’Epac 1 par les adénovirus a démontré le rôle primordial d’Epac 1 dans la régulation d’IKs chez les cobayes. In
vivo, l’administration de l'isoprotérénol et un activateur spécifique d’Epac ont
considérablement augmenté la durée du potentielle d'action, indiquant des
anomalies au niveau de la repolarization, tandis que l’IKs, le courant calcique de
type L (ICaL) et le courant potassique à rectification entrante (IK1) ont diminué de façon significative. Les voies de signalisations identifiées dans cette étude aideront à élaborer des approches plus efficaces pour prévenir les troubles de rythmes cardiaques.
L’IC est aussi associée à un remodelage fibrotique qui crée un substrat pour la fibrillation auriculaire (FA). Les fibroblastes cardiaques régulent la production et le dépôt de la matrice extracellulaire (MEC) et l’excès conduit à une fibrose. La fibrose est plus important dans les oreillettes et les fibroblastes auriculaires sont plus sensibles aux stimuli fibrotiques. Nous avons donc essayé de déterminer le rôle d’Epac dans la réponse fibrotique. L’expression d’Epac 1 est diminuée dans un modèle expérimental d’IC avec FA induit par une tachystimulation. L’incubation avec un activateur spécifique d’Epac diminue l'expression d'ARNm du collagène. De plus, les stimuli profibrotiques telles que la noradrénaline et le TGFβ1 diminuent l'expression d’Epac1 dans les
5
fibroblastes auriculaires. La stimulation soutenue du système adrénergique module l'expression du collagène par l'activation de l’Epac1 via les récepteurs
β2-adrénergiques. Ces résultats démontrent les différents rôles d’Epac dans les cardiomyocytes versus les fibroblastes dans le remodelage cardiaque.
6
Table of Contents
ABSTRACT………………………………………………………………………………………………….2
RÉSUMÉ…………………………………………………………………………………………………….4
TABLE OF CONTENTS ...... 7
LIST OF FIGURES AND TABLES ...... 11
ACKNOWLEGEMENTS………………………………………………………………………………….15
STATEMENT OF CONTRIBUTION OF AUTHORS ...... 16
STATEMENT OF ORIGINALITY ...... 19
LIST OF ABBREVIATIONS ...... 23
CHAPTER 1. INTRODUCTION ...... 27
1. Cardiac action potential ...... 28 1.1. Electrocardiogram ...... 33
1.2. Myocardial remodeling ...... 35 1.2.1. Arrhythmogenic ionic remodeling in HF ...... 36 1.2.2. Alterations in repolarizing K+ currents in HF ...... 37
1.2.2.1. Transient outward K+ current (Ito) ...... 38
1.2.2.2. Delayed-rectifier potassium currents (IKs and IKr) ...... 40
1.2.2.3. Inward rectifier potassium current (IK1) ...... 42 1.2.2.4. Alterations in inward currents in HF ...... 45 1.2.3. Arrhythmic consequences of alterations in K+ current ...... 46 1.2.4. Activation of neurohormonal systems in HF ...... 49 1.2.4.1. Inhibition of neurohormonal activation in HF ...... 51 1.2.5. Arrhythmogenic ionic remodeling in AF ...... 52
1.3. Role of Epac in cardiovascular signal transduction ...... 56
7
1.3.1. cAMP signaling and identification of Epac proteins ...... 56 1.3.2. Epac protein structure and mechanism of action ...... 57 1.3.3. Epac-selective agonists and antagonists ...... 59
1.4. Epac functions in the myocardium ...... 61 1.4.1. Role of Epac in calcium handling ...... 61 1.4.1.1. Calcium-induced calcium release ...... 61 1.4.2.2. Epac effects on calcium handling ...... 64 1.4.2.3. Aberrant Ca2+ signaling and arrhythmogenesis ...... 68 1.4.2. Role of Epac in cardiac hypertrophy ...... 69 1.4.2.1. Pathological and physiological hypertrophy ...... 69 1.4.2.2. Epac and cardiac hypertrophy ...... 72 1.4.3. Role of Epac in cardiac electrophysiology ...... 75 1.4.4. Role of Epac in cardiac fibrosis ...... 76 1.4.4.1. Fibrosis ...... 76 1.4.4.2. Clinical relationship between fibrosis and AF ...... 78 1.4.4.3. Mechanisms of fibrosis ...... 82 1.4.4.4. Profibrotic signals...... 82 1.4.4.5. Epac expression modulates fibrosis ...... 84
1.5. Rationale for thesis ...... 86
CHAPTER 2. EPAC MEDIATES SLOW DELAYED-RECTIFIER POTASSIUM CURRENT REMODELING BY SUSTAINED ΒETA-ADRENERGIC ACTIVATION IN GUINEA PIG HEARTS (IN VITRO MODEL) ...... 89
2.1. Introduction ...... 90
2.2. Methods ...... 91
2.3. Results ...... 101
2.4. Discussion ...... 108
2.5. Figure Legends ...... 117
2.6. Tables and Figures ...... 126
8
CHAPTER 3. IN VIVO MODEL OF SUSTAINED ΒETA-ADRENERGIC AND EPAC STIMULATION IN THE GUINEA PIG ...... 147
3.1. Introduction ...... 148
3.2. Methods ...... 150
3.3. Results ...... 157
3.4. Discussion ...... 159
3.5. Figure Legends ...... 162
3.6. Figures and Tables ...... 166
CHAPTER 4. EPAC AND ADRENERGIC EFFECT ON FIBROBLASTS ...... 177
4.1. Introduction ...... 178
4.2. Methods ...... 180
4.3. Results ...... 184
4.4. Discussion ...... 186
4.5. Figure legends...... 193
4.6. Figures and Tables ...... 196
CHAPTER 5. GENERAL DISCUSSION ...... 202
5.1. Novel findings and potential limitations ...... 203
5.1.1. Epac-mediated regulation of IKs in ventricular cardiomyoctes ...... 203 5.1.2. Epac and adrenergic effects on fibroblasts ...... 209
5.2. Selective Epac inhibition/activation as a new therapeutic approach ...... 210
5.3. Future directions ...... 211 5.3.1. Nuclear Ca2+ and Epac signal transduction ...... 211 5.3.2. Nuclear β-adrenergic receptors...... 213 5.3.3. Mechanism of adrenergic induced changes in Epac and collagen expression ...... 215
9
5.4. Concluding remarks ...... 216
REFERENCES...... 218
APPENDIX……………………………………………………………………………………………….259
10
List of Figures and Tables
Chapter 1. Introduction
Figure 1: Conduction system of the heart and action potentials and ion currents ...... 32
Figure 2: Normal ECG and relationship between APD and QT ...... 35
Figure 3: Toplogy of repolarizing potassium channels in the heart ...... 44
Figure 4:.Repolarization impairment and arrhythmogenesis in the heart...... 48
Figure 5:.Epac protein structure ...... 59
Figure 6: Epac and calcium signaling in cardiomyocytes ...... 63
Figure 7: Physiological and pathological hypertrophic pathways ...... 71
Figure 8: Normal AP conduction and re-entrant arrhythmias ...... 81
Figure 9: Fibrotic.pathways activated in atrial fibroblasts…………………………………………….85
Table 1: Summary of electrical remodeling observed from cells obtained from animal models and human samples of heart failure and atrial fibrillation...... 55
Table 2: Epac and Ca2+ handling in the heart...... 67
Table 3: Studies showing the involvement of Epac in cardiac hypertrophy...... 74
Table 4: Studies identifying the role of Epac in cardiac electrophysiology...... 76
Chapter 2. Epac mediates slow delayed rectifier potassium current remodeling by sustained β-adrenergic activation in guinea pig hearts (in vitro model)
Figure I. Viral construct designed for Epac1 knockdown and efficiency of virus ...... 127
11
Figure 1. Stability of IKs in long term culture ...... 128
Figure 2. Isoproterenol mediated changes in cell size, leucine incorporation and T-tubule density ...... 129
Figure 3. In vitro isoproterenol effects on IKs ...... 130
Figure 4. Effects of in vitro isoproterenol treatment on IKs properties (kinetics) ...... 131
Figure 5. Effects of β-adrenergic receptor blockade, cAMP and PKA inhibition on IKs ...... 132 Figure 5. Effects of β-adrenergic receptor stimulation on cell area ...... 133
Figure 6. Effects of acute isoproterenol and PKI treatment on IKs ...... 134
Figure 7. Effect of in vitro 8-pCPT treatment and Epac1 knock down on IKs ...... 135
Figure 8. Epac1 and Epac2 mRNA expression following isoproterenol treatment ...... 136
Figure 9. Epac1, Epac2, KCNE1, KCNQ1 mRNA expression after adenovirus mediated knockdown of Epac1 ...... 137
Figure 10. Epac1 and Epac2 mRNA expression in cells treated with scrambled virus ...... 138
Figure 11. Effect of BAPTA (Ca2+ chelator) and cyclosporine (calcineurin inhibitor) on IKs ...... 139
Figure 12. Role of NFAT in isoproterenol effects ...... 140
Figure 13. Effects of Epac knock down on isoproterenol-induced NFAT localization changes .. 141
Figure 14. Isoproterenol mediated changes in KCNE1 mRNA and protein ...... 142
Figure 15. Putative NFAT binding sites for KCNE1 promoter (guinea pig) ...... 143
Figure 16. Effects of Rap1 (GGTI), PLC (U-73122), and CaMKII (KN93) inhibition on IKs following isoprotetenol treatment ...... 144
Figure 17. Effects of Rap1 and CaMKII inhibition on IKs ...... 145
12
Figure 18. Schematic representation of the pathway involved in regulating IKs following sustained β-adrenergic stimulation ...... 146
Table I. SYBR Geen primer sequences ...... 126
Chapter 3. In vivo model of sustained β-adrenergic and Epac stimulation in the guinea pig
Figure 1. In vivo isoproterenol effects on IKs ...... 166
Figure 2. Isoproterenol effects on IKs properties (kinetics) ...... 167
Figure 3. Epac1 and Epac2 mRNA expression following isoproterenol treatment ...... 168
Figure 4. In vivo sp-8-pCPT (Epac activator) effects on IKs ...... 169
Figure 5. Isproterenol and sp-8-pCPT effects on KCNE1 mRNA and protein ...... 170
Figure 6. Isoproterenol effects on ICaL and IK1 ...... 171
Figure 7. sp-8-pCPT effects on hypertrophy, ICaL and IK1 ...... 172
Table 1. Summary of studies that have adminitered isoproterenol in vivo...... 148
Table I. General and echocardiographic indices of left ventricular structural remodeling ...... 173
Table II. Echocardiographic indices of left ventricular systolic function ...... 174
Table III. Echocardiographic indices of left ventricular diastolic function ...... 175
Table IV. Echocardiographic indices of left ventricular myocardial performance ...... 176
Chapter 4. Epac and adrenergic effect on fibroblasts
13
Figure 1. Epac1 expression in fibroblasts and cardiomyocytes from the atria and ventricles of VTP-HF model ...... 197
Figure 2. 8-pCPT (Epac activation) treatment and collagen and fibronectin expression in atrial fibroblasts ...... 198
Figure 3. Profibrotic stimuli and Epac1 mRNA expression ...... 198
Figure 4. Epac regulation via α- and β-adrenergic receptors in atrial fibroblasts ...... 200
Figure 5. Isoproterenol and β-adrenergic receptor blockers effects on collagen and fibronectin mRNA expression in atrial fibroblasts ...... 201
Table I. Taqman probe and SYBR Geen primer sequences……………………………………….195
14
Acknowledgements
Thank you to Dr. Stanley Nattel for his continuous help, guidance and support
throughout my PhD studies. Special thanks to my thesis advisory committee: Dr.
McKinney, Dr. Hebert, Dr. Padjen and Dr. Allen for their helpful feedback, and
encouragement.
Many thanks to my wonderful lab colleagues; I could not have survived without you. My close friends Kristin Dawson, Ling Xiao, Georghia Michael, Artak
Tadevosyan, XiaoYan Qi, Yolanda Chen, Balazs Ordog, Sirirat Surinkaew, I greatly appreciate all your help and support throughout the years. Thanks to my
previous friends and colleagues Sammy Mackary, Begonia Benito, Reza Wakili,
Takeshi Kato, Carlos Vargas and Ange Maguy for your constant encouragement
and support. Thanks to Patrice Naud, Patrick Vigneault and Hai, the list of all the
wonderful and helpful people is so long that I apologize if I have forgotten any
names.
A special thank you to Nathalie L’Heureux and Chantal St-Cyr for brilliant
technical assistance, as well as France Thériault, Roxanne Gallery and Jennifer
Bacchi for great secretarial help. Thank you to Tina Tremblay and Hélène
Duplessis for their help throughout the years.
15
Statement of Contribution of Authors
The McGill Faculty of Graduate and Postdoctoral Studies guidelines state that,
“In the case of collaborative work presented in either a standard format or manuscript-based thesis, there must be an explicit statement of the contributions of all parties, including the Student, in the Preface of the thesis.”
This thesis is written in traditional style format, containing data published in one manuscript (Chapters 2 and 3) and a second manuscript (Chapter 4) that is currently in preparation. The published paper can be found in the Appendix.
Chapters 2 and 3
Exchange Protein Directly Activated by cAMP Mediates Slow Delayed-Rectifier
Current Remodeling by Sustained β-Adrenergic Activation in Guinea Pig Hearts
Mona Aflaki, Xiao-Yan Qi, Ling Xiao, Balazs Ordog, Artavazd Tadevosyan,
Xiaobin Luo, Ange Maguy, Yanfen Shi, Jean Claude Tardif, Stanley Nattel
Circ Res. 2014 Mar 14;114(6):993–1003
Mona Aflaki: I performed all the cardiomyocyte cell isolations and long-term cell culture. I performed all the patch-clamp work ( in vitro and IKs recordings from the in vivo animals), qPCRs, immunostaining and immunoblots. I created the two in vivo models and prepared the animals for echocardiography. I designed the
16
experiments and wrote the manuscript. My contribution accounts for 90% of the experiments performed in this paper.
Dr. Qi: Provided patch-clamp data for IKs, ICaL, IK1 (supplemental Figure), and
action potential recordings from the in vivo model (Figure 1I and Figure 3H).
Dr. Xiao: Provided additional samples for qPCR (Figure 6A).
Dr. Ordog: Generated adenoviruses for the knockdown of Epac1 in guinea pig
cardiomyocytes and helped with troubleshooting qPCR experiments.
Artavazd Tadevosyan: Acquired images for immunostaining experiments and assisted with data analysis.
Dr. Luo: Identified putative NFAT binding sites on the KCNE1 guinea pig
promoter.
Dr. Maguy: I prepared the cells and added the dye for T-tubule staining. Dr.
Maguy acquired the images and analyzed the data.
Dr. Shi and Dr. Tardif: Performed echocardiographies for in vivo experiments and
provided results with analysis.
Dr. Nattel: Proposed the initial idea, supervised the project by providing
intellectual input and extensively editing the final manuscript.
Chapter 4.
Epac and Adrenergic Effects on Fibroblasts
17
Mona Aflaki: I plated the cells and performed all the cell culture and qPCR experiments.
Dr. Surinkaew: Provided additional samples by plating fibroblasts for culture and provided RNA samples from the ventricular tachypacing (VTP) time course.
Dr. Qi and Dr. Huang: Performed fibroblast isolation.
Dr. Nattel: Supervised the project and provided intellectual input.
18
Statement of Originality
The McGill Faculty of Graduate and Postdoctoral Studies guidelines state that:
“The Preface of a Doctoral thesis must also include a statement clearly indicating
those elements of the thesis that are considered original scholarship and distinct
contributions to knowledge.”
Chapter 2
Chronic adrenergic hyperactivity characterizes a variety of arrhythmic conditions,
including HF. Although the acute arrhythmogenic effects of adrenergic
stimulation are well defined, the effects of chronic adrenergic stimulation on the
electrophysiological determinants of arrhythmia are less clear. Sustained
adrenergic activation has been shown to down-regulate the slowly activating
delayed-rectifier (K+) current, IKs. However, the molecular mechanisms are poorly
defined. Understanding the underlying mechanisms of IKs regulation are crucial,
as reduced IKs density impairs repolarization reserve and creates a substrate for
the generation of lethal arrhythmias.
The novel findings in this Chapter are as follows:
• Sustained β-adrenergic stimulation via isoproterenol reduced IKs in the
guinea pig cardiomyocytes in vitro by transcriptional downregulation of
KCNE1 (β subunit).
19
• Detailed mechanistic pathway analysis revealed that the effects of
isoproterenol were mediated through increased activation of Epac1 protein,
but not Epac2, in culture. Adenoviral-mediated shRNA knockdown of
Epac1 in guinea pigs further confirmed our findings.
• Decrease in IKs density was mediated through β1-adrenergic receptors,
but not β2, and was dependent on increased cAMP signaling.
• Epac acts by initiating Ca2+-calmodulin/calcineurin/NFAT signaling
pathway to regulate IKs.
• Translocation of NFAT transcription factors to the nucleus suppresses
KCNE1. Putative NFAT binding sites were shown on the guinea pig
KCNE1 promoter.
• Rap1 and CaMKII, which are downstream effectors of Epac1, were shown
to regulate IKs following sustained adrenergic stimulation.
• Chronic stimulation with isoproterenol or agents that mimic its signaling
like 8-Br-cAMP (cAMP analogue), and 8-pCPT (Epac activator) change
(accelerate) the activation kinetics of IKs.
Chapter 3.
Following our detailed in vitro studies, I developed an in vivo model with chronic
β -adrenergic (isoproterenol), and direct Epac (via sp-8-pCPT) activation in
20
guinea pigs. Isoproterenol and sp-8-pCPT treatment induced significant ion channel remodeling.
The novel findings in this Chapter are as follows:
• Chronic daily injections of isoproterenol over 13 weeks decreased IKs
density and accelerated activation kinetics, similar to our in vitro data.
• Chronic Epac stimulation with sp-8pCPT via osmotic minipumps over 6
weeks significantly decreased IKs density, similar to the data obtained in
vitro.
• Chronic Epac and isoproterenol stimulation decreased IK1 and ICaL.
• Ion channel remodeling in vivo affected outward K+ current (60 %
decrease in IKs) more than inward Ca2+ current (45% reduction).
• Action potential duration increased in ventricular cardiomyocytes from
both in vivo Epac and isoproterenol-treated animals.
• Chronic Epac and isoproterenol stimulation decreased KCNE1 protein and
mRNA in ventricular cardiomyocytes.
Chapter 4.
I investigated the effect of Epac and adrenergic stimulation on fibroblasts.
Although, cAMP signaling has been shown to have antifibrotic effects in the heart; the role of Epac in disease models remains to be elucidated.
21
The novel findings in this Chapter are as follows:
• Epac1 expression was significantly decreased in atrial (but not ventricular)
fibroblasts from the canine in vivo ventricular tachypacing model (VTP).
• Epac1 expression was significantly increased in atrial and ventricular
cardiomyocytes in the VTP model, further emphasizing the different role of
Epac proteins in fibroblasts versus cardiomyocytes.
• Chronic norepinephrine stimulation significantly decreased Epac1
expression in atrial fibroblasts in vitro. Decrease in Epac1 expression may
contribute to the fibrotic response in the heart.
• Sustained β-adrenergic stimulation of atrial fibroblasts increased Epac1
expression (but not Epac2), which contributed to the decrease in collagen
expression through the activity of β2-adrenergic receptors.
22
List of Abbreviations
ACE : angiotensin-converting enzyme
AF: atrial fibrillation
ANF: atrial natriuretic factor
AngII: angiotensin II
APD: action potential duration
ATP: adenosine triphosphate
AV Node: Atrioventricular Node
BAPTA: 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetate
BSA: bovine serum albumin
CaMKII: Ca2+/calmodulin-dependent protein kinase II
CGP-20712A: 1-[2-((3-Carbamoyl-4-hydroxy)phenoxy)ethylamino]-3-[4-(1- methyl-4-trifluoromethyl-2-imidazolyl)phenoxy]-2-propanol dihydrochloride
HF: heart failure
EAD: early after depolarization
EC: excitation-contraction
EF: ejection fraction
ERK: extracellular signal–regulated kinase
ERP: effective refractory period
HF: heart failure
23
CMV: cytomegalovirus
CN: calcineurin
CTL: control
CV: conduction velocity
DAD: delayed after depolarization
Epac: exchange protein directly activated by cAMP
Forskolin: 7β-Acetoxy-8,13-epoxy-1α,6β,9α-trihydroxylabd-14-en-11-one
FS: fractional shortening
GFP: green fluorescent protein
GGTI 298: N-[4-[2(R)-Amino-3-mercaptopropyl]amino-2-(1- naphthalenyl)benzoyl]-L-leucine methyl ester trifluoroacetate salt
GPCR: G protein–coupled receptor
HDAC: histone deacetylase
HPRT: hypoxanthine-guanine phosphoribosyltransferase
ICI-118,551: (±)-1-[2,3-(Dihydro-7-methyl-1H-inden-4-yl)oxy]-3-[(1- methylethyl)amino]-2-butanol hydrochloride
ICaL: L-type calcium current
IGF: insulin-like growth factor
IK1: Inward rectifier current
IKATP: adenosine triphosphate–sensitive potassium current
24
IKs: slowly activating delayed-rectifier potassium current
INCA6: Inhibitor of NFAT-Calcineurin Association
IP3: inositol 1,4,5-trisphosphate
IP3-R: inositol 1,4,5-trisphosphate receptor
ISS: steady-state potassium current
KCNE1: potassium voltage-gated channel subfamily E member 1
KCNQ1: potassium voltage-gated channel, KQT-like subfamily, member 1
KN93: N-[2-[N-(4-Chlorocinnamyl)-N-methylaminomethyl]phenyl]-N-(2- hydroxyethyl)-4-methoxybenzenesulfonamide phosphate salt
LV: left ventricle or left ventricular
LQT: long QT
MEF2: myocyte enhancer factor-2
NDS: normal donkey serum
NFAT: nuclear factor of activated T cells
NFκB: nuclear factor kappa-light-chain-enhancer of activated B cells
NRVC: neonatal rat ventricular cardiomyocyte
PBS: phosphate-buffered saline
PKA: protein kinase A
PKB: protein kinase B
PLC: phospholipase C
25
8-pCPT: 8-pCPT-2′-O-Me-cAMP
PKI: protein kinase A inhibitor peptide
PVDF: polyvinylidene fluoride
Rap1: Ras-related protein 1
RyR: ryanodine receptor
SA: sinoatrial
Scr: scrambled virus
SDS-PAGE: sodium dodecylsulfate polyacrylamide gel electrophoresis shRNAmir: miRNA-embedded shRNA
SNS: sympathetic nervous system
TdP: torsade de pointes
TGFβ1: transforming growth factor β1
U73122 hydrate: 1-[6-[((17β)-3-Methoxyestra-1,3,5[10]-trien-17-yl)amino]hexyl]-
1H-pyrrole-2,5-dione
26
Chapter 1
Introduction
27
1. Cardiac action potential
Normal cardiac function depends on the appropriate timing and sequential contraction of the various regions of the heart. Contraction is initiated by spontaneous firing of pacemaker cells in the sinoatrial (SA) node, which is propagated throughout the atria. Subsequently, a wave of excitation travels to the atrioventricular (AV) node, and after a brief pause, spreads in the conducting
Purkinje fibers to the working ventricular myocardium. In each of these cardiac regions, excitation results in the generation of characteristic action potentials
(APs, Figure 1.).
A distinctive feature of any excitable tissue is its AP profile. Myocardial cells possess characteristically long APs (200–300 ms in duration) that can be divided into two categories—fast depolarizing cells and slow depolarizing cells.
Slow cell APs are seen in pacemaker cells of the AV and SA nodes. Fast cell
APs (very rapid depolarization) are found in the working myocardium (atria and ventricles) and the Purkinje conducting system. APs in the various regions of the heart are shaped by the coordinated activity of the underlying ionic currents and transporters, and represent changes in cardiac transmembrane potential over time. In fast depolarizing cells, the AP occurs in five distinct phases (0–4). The resting membrane potential is determined by the high resting potassium (K+) conductance that is due to the high K+ permeability of the inward rectifier
28
potassium channel (IK1). The resting K+ conductance of IK1 stabilizes the cell
membrane potential at around the equilibrium potential of K+, which lies between
-80 and -90 mV. Upon stimulation, rapid entry of sodium (Na+) through voltage-
gated sodium channels (INa) depolarizes the cell membrane to more positive
potentials (phase 0). Once the cell reaches threshold potential (~ -65 mV),
sufficient voltage-gated Na+ channels are activated to initiate a self-regenerating process. The outcome is a very large fast Na+ current that creates a rapid
upstroke. This is followed by rapid removal of K+ from the cells through the
rapidly activating and inactivating transient outward K+ channel (Ito) and the ultra- rapidly delayed-rectifier K+ channel (IKur) in atrial cells (phase 2). This transient
repolarization (notch) is very prominent in both ventricular and Purkinje cells.
Meanwhile, depolarization of the membrane causes slow activation of voltage- gated L-type Ca2+ channels (ICaL). This creates a long-lasting depolarized plateau
phase (phase 2) in which there is a balance between inward late INa and ICaL and
the outward K+ currents. Late/persistent INa is a slowly inactivating component of
INa (1%) that contributes to the duration of ventricular APs.1 The plateau phase
generally lasts over 100 ms and clearly distinguishes cardiac cells from neuronal
or skeletal muscle cells. It prevents rapid repolarization, and in addition, permits
sustained Ca2+ entry that allows efficient contraction of cardiomyocytes. The
plateau is terminated in phase 3 by the inactivation of ICaL and repolarization
29
through the progressive activation (increase in conductance) of delayed-rectifier
K+ channels of which the rapidly activating delayed-rectifier K+ current (IKr) is the most prominent. Three different K+ currents—IKr, the slowly activated delayed-
rectifier (IKs), and IK1—mainly contribute to phase 3 repolarization. In the last
stage (phase 4) of the AP, IK1 restores the membrane to its resting membrane
potential. In addition to the ion channels already discussed, the Na+/Ca2+
exchanger (NCX) plays an important role throughout the duration of the AP. It is
electrogenic and may carry inward or outward current depending on the
depolarized state of the membrane. When the membrane is more repolarized, as
is the case during phases 3 and 4, NCX extrudes Ca2+ and brings Na+ in. During
more depolarized phases (0–2), NCX works in reverse mode and contributes to
Ca2+ entry during the plateau phase.
In slow AP cells, the resting membrane potential is more positive (-50
to -60 mV) due to a decreased density of IK1 as compared to the working
myocardium. Nodal cells have a slow phase 0 depolarization and show
spontaneous automaticity largely through the activity of a nonselective funny
current (If), and ICaL. Furthermore, nodal APs lack a plateau phase and show a
more gradual repolarization as compared to the working myocardium.
The waveform of APs is distinct in the different regions of the heart. The ventricular myocardium consists of three cell types: the endocardium (inner
30
layer), midmyocardium (M cells, middle layer) and the epicardium (outer layer).
Epicardial APs possess a prominent notch between phase 1 and phase 2. The
notch gradually disappears towards the endocardial cells.2 This is due to a decrease in Ito in the endocardium. M cells exhibit properties of both myocardial
and conducting cells (Purkinje cells), and display the longest APs when
stimulated at slower rates (exaggerated prolongation of AP duration [APD]).2-4
The differences in the expression of the underlying ionic currents (namely,
voltage-gated K+ channels [Kv], such as Ito and IKs) contribute to the normal
propagation of the AP through the myocardium.5,6 The wave of excitation
spreads in the myocardium from the endocardium to the epicardium; however,
epicardial cells repolarize faster due to more prominent repolarizing currents and
endocardial cells repolarize last. This contributes to the normal unidirectional flow
of excitation and the generation of normal cardiac rhythm.2,6
31
Figure 1: A, Schematic of the conduction system of the heart. Cardiac impulse is generated at the sinoatrial (SA) node in the right atrium (RA), which spreads across to the left atrium (LA) and initiates atrial contraction. The excitation then passes through the atrioventricular (AV) node and travels through the interventricular septum and Purkinje fibers to activate the right (RV) and left ventricle. B, Cardiac AP from fast depolarizing cells (atria and ventricles) and slow depolarizing (nodal) cells. Schematic of APs represent temporal sequence of propagation from the endocardium (Endo) to the midmyocardium (Mid) and epicardium (Epi) in the ventricles C, Cardiac AP with the various phases and the
32
principal corresponding ionic currents. Ion conductances (g) correspond with the activity of different channels. Ionic currents: Inward rectifier current (IK1), fast Na+
current (INa), L-type Ca2+ current (ICaL), transient outward K+ current (Ito), rapidly
activating (IKr) and slowly activating (IKs) components of delayed-rectifier K+
current, sodium/calcium exchanger (INCX).
1.1. Electrocardiogram
The electrical currents generated with each depolarization and
repolarization spread throughout the body (conducted through body fluids) and
are detectable by the use of surface electrodes. The sequential activation of the
different regions in the heart creates a time-dependent electrical potential, which
is recorded as the electrocardiogram (ECG). The ECG is a valuable diagnostic
tool that can detect abnormalities in heart rhythm, abnormalities in the conduction
system, and damage to heart muscles. A normal ECG has three distinct
waveforms: the P wave, QRS complex, and T wave (Figure 2). The P wave
occurs when the atria depolarize and usually lasts 80–100 ms (in humans). Note
that firing of the SA node does not generate sufficient electrical activity to reach the body surface to be recorded on the ECG. Ventricular depolarization is
represented by the QRS complex. Atrial repolarization occurs simultaneously;
however, it is masked by the much larger electrical activity generated by
depolarization of the ventricles. Ventricular depolarization occurs very rapidly and
lasts 60–100 ms. The ST segment represents the plateau phase of the AP and
33
coincides with ventricular contraction. The T wave represents ventricular repolarization, where muscles stop contracting to allow the ventricles to refill with
blood. The QT interval represents the time required for both ventricular
depolarization and repolarization, and is an approximation of the length of an
average AP. As such, changes in duration of the QT interval can be indicative of
susceptibility to arrhythmias.
The effective refractory period (ERP) in cardiomyocytes spans phases 0,
1, 2, and the first part of phase 3 when the membrane potential is > -60 mV. Na+
channels are inactivated at this stage and no stimulus of any size can initiate
another AP. However, when repolarization returns the membrane potential to
below the threshold potential, but not to the resting membrane potential, a
sufficiently large stimulus can generate another AP. This interval occurs around
the latter stages of phase 3 and is referred to as the relative refractory period
(RRP). The ERP acts as a protective mechanism in the heart by limiting the rate
of depolarization and preventing multiple APs from being initiated. The discrete
length of the ERP in cardiomyocytes is essential for maintaining proper
contraction and relaxation of the heart, and the prevention of lethal arrhythmias.
34
Figure 2: Schematic of a surface electrocardiogram (ECG). P wave represents atrial depolarization. QRS reflects ventricular depolarization and T wave represent ventricular repolarization. The QRS is produced by the upstroke (phase 0) of the AP. Phase 2 of the AP corresponds with the ST segment of ECG. The ECG reflects the net electrical activity of all heart cells and has some rough parallels to AP properties in individual heart cells. The QT interval is described as the duration between ventricular depolarization and repolarization and is a reflection of ventricular APD. The effective refractory period (ERP) spans the beginning of the QRS complex to the peak of T wave.
1.2. Myocardial remodeling
Myocardial remodeling is initially an adaptive response to functional (eg,
hypertension or altered electrical activity) or structural (eg, myocardial injury)
stressors to the heart. This process initiates a complex signaling pathway that
35
may become maladaptive over time. Myocardial remodeling leads to changes in gene expression of the molecules responsible for maintaining the electrophysiological and contractile integrity of the heart.7 Myocardial structural
remodeling can lead to hypertrophy or result in increased collagen deposition in
the heart. Electrical remodeling is defined as any persistent change in the
electrophysiological properties of the heart that can affect ion channels or Ca2+
handling processes that regulate AP and cardiac rhythm. The remodeling process can affect both the atria and ventricles. Atrial electrical remodeling has
been linked to arrhythmias such as AF, whereas remodeling in the ventricles
produces a substrate that triggers potentially lethal ventricular arrhythmias in
HF.8 Understanding the cellular and molecular mechanisms of electrical
remodeling is important in elucidating potential therapeutic targets designed to
alter arrhythmogenic remodeling.
1.2.1. Arrhythmogenic ionic remodeling in HF
HF is a progressive disorder that is a common endpoint of many
cardiovascular diseases, such as hypertension, myocardial infarction, valve
disease, and congenital heart disease.9 It is characterized as a complex
syndrome that leads to significant impairment in cardiac function such that the
heart fails to supply sufficient amounts of blood flow to the peripheral organs. The
prognosis of HF is poor and up to 50 % of HF patients die from sudden death.10
36
Indeed, the incidence of sudden death is 6–9 times higher in HF patients as
compared to the general public.11 The significant electrical remodeling that
occurs in HF creates a substrate for malignant ventricular tachyarrhythmias. Most of the arrhythmic consequences in HF are due to disease-induced changes in ion
channels and transporters. The focus of this section will be mainly on ionic
current remodeling in the ventricles in HF.
1.2.2. Alterations in repolarizing K+ currents in HF
AP prolongation is a hallmark of HF and is a consistent feature in ventricular cells isolated from human and animal models of HF.9,12-15 Regardless
of the etiology of HF, APD prolongation is seen in numerous studies involving
animal models of ischemia/infarction, pressure or volume overload, genetic
(Syrian hamster hereditary cardiomyopathy),16 and chronic tachypacing
models.17 Electrical heterogeneity in APs from the ventricular wall is an important
determinant of normal cardiac function in both animal18 and human hearts.19,20
The heterogeneous prolongation of APD in HF can lead to exaggeration of the
physiological heterogeneity of AP in the ventricles.13,18 AP prolongation is
indicative of repolarization abnormalities, which are primarily due to
downregulation of K+ currents.
37
1.2.2.1. Transient outward K+ current (Ito)
The rapidly activating and inactivating transient outward K+ currents were
first observed in sheep Purkinje fibers and were thought to conduct Cl- currents.21
Subsequent work revealed that the major component of Ito is blocked by 4-
aminopyridine (4-AP) and carried by K+.22 This component of Ito, which is Ca2+
insensitive, is present in most species. In the adult mouse ventricular
cardiomyocytes, Ito is divided into two distinct forms based on voltage-dependent
kinetics of recovery from inactivation—Ito slow and Ito fast. 23,24 Additionally, there is
differential sensitivity to Heteropoda toxins, which blocks Ito fast and not Ito slow.25 Ito fast is composed of Kv4.2 (KCND2) and/or Kv4.3 (KCND3) alpha pore-forming
voltage-gated subunits, while Ito slow is composed of Kv1.4 (KCNA4) subunits.26 In
rodents, Kv4.2 is the major alpha subunit that constitutes Ito fast, whereas in larger
mammals such as dog and man, Kv4.3 is the primary alpha subunit for Ito fast.27
Kv channel alpha subunits compromise six transmembrane spanning domains
that coassemble as tetramers to form functional K+ selective Kv channels.28 The ancillary or beta subunits of Kv Ito channels include the cytoplasmic Kvβ subunits
and K+ channel interacting proteins (KChIPs) that act as critical modulatory proteins for Kv4.x channels (Figure 3).29 KChIPs promote surface expression of
alpha subunits and slow Kv4 inactivation.30,31 KChIP2 (KChIP1–4 isoforms) has
been shown to be an integral subunit in the ventricular wall and its expression
38
pattern is similar to the heterogeneous gradient observed in Ito.32,33 Although Ito is
a prominent repolarizing current in atrial and ventricular cardiomyocytes in most
species;6 Ito has not been detected in the guinea pig.34 In humans and dogs,
similar to the mouse, two distinct Kv currents have been described in the ventricles.6,35,36 In rabbits, Ito is mainly carried by Kv1.4 channels and has
different properties such that it inactivates slowly and recovers from inactivation
very slowly.34,37,38
Despite significant differences in the density and biophysical properties of
Ito in different cell types and species, Ca2+-independent Ito downregulation is the
most consistent (and reproducible) finding in both animal models and cells
isolated from terminally failing human hearts.9,14,39 At the molecular level, many
studies show a reduction in both mRNA and protein for Ito Kv4.3 subunits
followed by discrepant changes for the beta subunit KChIP2 in HF.9 However, Ito
is a transient current that is responsible for early repolarization of the AP, and
may not directly result in large effects on APD in HF in the larger mammalian
hearts. Ito changes most likely influence the activity of currents activated later in
the AP.7,17
39
1.2.2.2. Delayed-rectifier potassium currents (IKs and IKr)
Delayed-rectifier K+ currents (IK) were first described by Noble and Tsien in sheep Purkinje cells.40 These are the major outward currents responsible for phase 3 of the AP. 41 IK activates slowly and is composed of two distinct K+
components: IKr (rapid) and IKs (slow). IKr activates rapidly (positive to -40 mV)
and inactivates rapidly with a prominent inward rectification. The inward
rectification is caused by rapid voltage-dependent inactivation.42 IKr activates fast
in response to depolarization; however the channel deactivates even faster
during the plateau phase to limit K+ efflux. Therefore, IKr amplitude decreases as
the membrane depolarizes. This process helps to maintain the plateau phase of
the AP, which allows for efficient contraction. The channels recover rapidly from
inactivation towards the end of the plateau phase as the voltage becomes less
positive, and this leads to a progressive increase in IKr amplitude and contribution
to phase 3 repolarization. IKr can be blocked by E-4031, sotalol, and dofetilide.43,44 On the other hand, IKs activates very slowly in response to
depolarization and gradually increases during the plateau phase of AP. IKs also
deactivates slowly (barely inactivates), which allows IKs to build up slowly and become one of the key K+ conductances in phase 3 repolarization (under
conditions such as reduced repolarization reserve).45 The slow deactivation
properties of IKs allow for rate-dependent shortening of APs in the heart.46
40
Furthermore, IKs can be blocked by chromanol 293B and HMR-1556.47,48 Both IKr
and IKs are expressed heterogeneously in cardiomyocytes from human and various animal models, such as guinea pigs, rabbits and canines.49 However, the
expression of IKr and IKs is negligible in rodent cardiomyocytes. There are three
other forms of non- or slowly inactivating Kv currents, namely IK, IK late, and
steady- state K+ current (Iss) in rats,50 and IK,slow1, IK,slow2, and Iss in mice.51,52 At the molecular level, IKs is composed of Kv7.1 (KCNQ1) in a complex with the β
subunit KCNE1 (also called minK or IsK).53 The KCNE1 subunit is responsible for
the slow activation kinetics and large amplitude of IKs.53 IKr is composed of
Kv11.1 (KCNH2), also known as ERG1 or the human variant, hERG.54 Kv11.1
can exist in several splice variants and may interact with KCNE1 and KCNE2 as accessory subunits.6
Due to the important role of IKr and IKs in repolarization, remodeling of
these currents can significantly contribute to APD prolongation in HF. Numerous studies have shown a consistent decrease in IKs in animal models of HF and
hypertrophy.9 IKs is also downregulated in human ventricular cells from HF
patients.55 However, HF-induced changes in IKr are less clear, with most studies showing no change in IKr.9 This is consistent with no change in the ERG subunit
at the molecular level. However, HF-induced changes in KCNQ1 and minK are more variable, with studies showing both increases and decreases in these
41
subunits.9 Therefore, posttranslational and posttranscriptional mechanisms must
be important in regulating HF-induced downregulation of IKs.
1.2.2.3. Inward rectifier potassium current (IK1)
IK1, the inward rectifier K+ current, contributes to late-phase 3 repolarization, and plays an important role in maintaining the resting membrane potential.56 IK1 channels are indirectly voltage sensitive and show marked inward
rectification. At membrane potentials more positive than -20 mV, IK1 channels do
not conduct K+ and are blocked by intracellular magnesium (Mg2+), Ca2+, or
polyamines (spermine).57 Removal or depletion of intracellular Mg2+ or
polyamines eliminates the inward rectification properties of the channels. During
membrane repolarization (around -40 mV), IK1 channels are released from
Mg2+/spermine inhibition and contribute to late-phase repolarization. Additionally,
IK1 channels can be blocked by extracellular barium (Ba2+) and cesium (Cs2+).57
Inward rectifier channels (Kir) are encoded by the Kir2.x family of alpha subunits:
Kir2.1 (KCNJ2), Kir2.2 (KCNJ12), Kir2.3 (KCNJ4), and Kir2.4 (KCNJ14).58 The structure of IK1 subunits is illustrated in Figure 3. Quantitatively Kir 2.1 subunits are the most important subunit underlying IK1 and these subunits are most
abundant in ventricular tissue.59 Mutations in KCNJ2 gene encoding Kir 2.1 have been linked to Anderson-Tawil Syndrome, an inherited disorder that often leads to lethal ventricular arrhythmias. 60
42
Most studies using ventricular cardiomyocytes show a decrease in IK1 in
HF. However, the results are variable and depend on disease etiology and
severity of cardiac dysfunction.9 In ventricular cardiomyocytes from terminal HF
patients, IK1 is significantly reduced.14 However, the underlying basis of IK1
downregulation is unclear. Borlak et al showed a decrease in Kir 2.1 mRNA from ventricular tissue in HF,61 whereas two other studies found no change in Kir2.1
mRNA in isolated ventricular tissue from HF patients.59,62 Recent studies suggest
that posttranslational mechanisms may be involved in Kir 2.1 channel
regulation.63
43
Figure 3: Topology of the major cardiac repolarizing K+ channels in the heart. A,
IKs, B, IKr, and C, Ito consist of six transmembrane domains with a helical structure. The pore region is the intervening loop inserted between segments 5 (S5) and 6 (S6), which is responsible for ion conductance and selectivity. The highly conserved S4 segment acts as a voltage sensor with numerous positively
44
charged amino acids. D, inward rectifier channels (IK1) contain only two transmembrane segments. These subunits lack the typical voltage-gating
properties of other channels. Kv alpha subunits and Kir alpha subunits assemble as tetramers to form functional K+ channels.
1.2.2.4. Alterations in inward currents in HF
APD prolongation in HF also occurs as a result of changes in inward
currents. Multiple studies have demonstrated reductions in INa9 and an increase
in late INa in ventricular cardiomyocytes from HF patients.64 A fraction of Na+
channels remain consistently open (slow inactivation) after phase 0 and carry a
small but important current during the plateau phase of the AP. The amplitude of
late INa is approximately 1% of peak INa, and is sufficient to prolong APD.65
Alterations in ICaL are more discrepant, with most studies showing no change in
ICaL.17 The NCX transporter is upregulated in HF,9 which works to extrude
cytoplasmic Ca2+ by electrogenically exchanging it for extracellular Na+ (forward mode). Changes in NCX affect repolarization and AP dynamics due to increased
Na+ entry into the cell during the late phases of AP.66,67 An overall increase in the
forward mode NCX exchange rate and changes in the decay rate of ICaL prolong
AP.68 A summary of electrical remodeling in HF and the effects on depolarizing
and repolarizing currents can be found in Table 1.
45
1.2.3. Arrhythmic consequences of alterations in K+ current
To ensure proper cardiac electrical signaling, multiple K+ currents with
overlapping functions contribute to repolarization in the heart. Late repolarization
in the ventricles is driven by three main K+ currents, IKr, IKs, and IK1, with some
degree of redundancy. This concept is known as repolarization reserve and was first introduced by Roden in 1998.69 Repolarization reserve acts as a safety net
that allows cardiomyocytes to compensate for a loss of an outward current
(caused by drug actions, an ion channel mutation, or acquired diseases) by recruiting another repolarizing current. Repolarization reserve is significantly reduced in HF, which is evident from the downregulation of multiple K+ currents
and APD prolongation. A reduction in repolarization reserve or increase in APD
can lead to the generation of early afterdepolarizations (EADs), which can lead to
triggered activity and ventricular tachyarrhythmias,12 including torsade de pointes
(TdP, Figure 4).70 EADs are frequently observed in cells isolated from human and
animal models of HF.18,55,71 EADs are voltage oscillations that occur during phase 2 or 3 of the AP, before repolarization is completed. EAD initiation has been classically attributed to recovery of ICa L from inactivation (window voltage
region) during the prolonged plateau phase of AP.72 When an EAD is of sufficient
amplitude, a triggered AP is generated. Delayed after depolarizations (DADs) are
generally triggered by abnormal diastolic Ca2+ release and increased activity of
46
NCX.73 To compensate for Ca2+ handling abnormalities in HF, the NCX
transporter extrudes one Ca2+ ion in exchange for three Na+ ions. This increases
the net depolarizing current in the cells, which can be arrhythmogenic.
Furthermore, reductions in IK1 can lead to triggered activity and the generation of
DADs (also EADs). Under normal resting conditions, the K+ conductance through
IK1 is high, which is correlated with a low membrane resistance (bear in mind that
conductance is the inverse of resistance). This means that K+ ions can easily
move through the membrane. However, when IK1 is reduced in HF, membrane
resistance increases and leads to a bigger change in voltage for a given quantity
of depolarizing current. This process makes it easier for cells to reach threshold
potential and fire an AP.9,66,74
The clinical significance of EADs lies in their capacity to initiate TdP. TdP or “twisting of the points” is a lethal form of polymorphic ventricular tachycardia
(VT) with characteristic twisting of QRS complexes around the isoelectric baseline of the ECG. TdP is closely linked to abnormalities in repolarization and
QT prolongation.75 Conditions that cause an excessive increase in the QT interval such as long QT syndrome (acquired or inherited), IKr blocking drugs,
electrolyte imbalance (hypokalemia and hypomagnesaemia) and HF increase the
risk of TdP (Figure 4).76,77
47
Long QT (LQT) syndrome refers to a group of channelopathies that affect
cardiac ion channels. The congenital form is mainly caused by mutations in
genes encoding for K+, Na+, and Ca2+ voltage-gated channels. To date, more than ten types of LQT syndrome have been identified (LQT1–LQT13).78-80 For
example, LQT1 (most common form of LQT syndrome) and LQT5 are the result
of abnormalities in IKs channels, with mutations occurring in KCNQ1 and
KCNE1/minK genes, respectively.78 LQT2 (KCNH2) and LQT6 (KCNE2/MiRP1)
are induced by mutations in the subunits of IKr. The final outcome of these
mutations is a reduction in repolarizing currents and an increase in APD.
Consequently, EADs that are often triggered by an increase in sympathetic tone
increase the risk for TdP or ventricular fibrillation in LQT syndrome.78
Figure 4: Repolarization impairment and arrhythmogenesis in HF. A reduction in repolarizing K+ currents (IK1,IKs, IKr, Ito) and an increase in late INa prolong the AP and QT interval (on ECG trace), which leads to the generation of EADs. When an
48
EAD reaches a critical threshold, it can generate ectopic beats (triggered activity) that can lead to the lethal ventricular tachyarrhythmia, torsade de pointes (TdP).81 Figure adapted from reference 81
1.2.4. Activation of neurohormonal systems in HF
The neurohormonal system is activated in HF to compensate for the
reduction in cardiac output. A decrease in cardiac output is detected by baroreceptors located on the carotid sinus and aortic arch. These receptors decrease their firing in proportion to the fall in blood pressure. The resultant signal is transmitted to the medulla, which subsequently increases sympathetic nervous system (SNS) activity in the heart and the peripheral circulation. This process increases the heart rate and the force of contraction, leading to
vasoconstriction of the systemic veins and arteries. Vasoconstriction aims to
increase blood return to the heart and increase preload to maintain cardiac
output.82 SNS activation mediates its effects through the release of
catecholamines, norepinephrine (predominantly from sympathetic nerve terminals) and epinephrine (primarily from the adrenal medulla).83,84 High levels
of norepinephrine are seen in the plasma of patients with HF.85 Moreover,
plasma norepinephrine levels correlate with the clinical severity of HF and are
associated with mortality in patients with advanced HF.86,87
49
The renin-angiotensin-aldosterone system (RAAS) is also activated in HF
patients, with the adrenergic system being an important stimulus for RAAS
activation.86 Initiation of RAAS begins with the release of renin from the kidneys.
Renin is released as a result of decreased renal artery perfusion, or from
reduced plasma levels of Na+ and Cl-. Angiotensin II (AngII), which is the primary
effector of this pathway, is a potent vasoconstrictor that increases peripheral
resistance to maintain systemic blood pressure. Furthermore, AngII mediates salt
and water retention to augment intravascular volume. Initially, the activation of
SNS and RAAS is beneficial to maintain cardiac output; however, chronic
activation leads to progressive cardiac dysfunction, structural remodeling, and
electrical remodeling.
The effects of catecholamines are principally mediated through β1-, β2-,
and α1-adrenergic receptors.88 The α1-adrenoceptors are coupled by G proteins
to phospholipase C (PLC), which alters intracellular Ca2+ load. In contrast, β1-and
β2-adrenoceptors are coupled to stimulatory G proteins and increase intracellular
cyclic adenosine 3’,5’-monophosphate (cAMP) levels. Norepinephrine is
cardiotoxic at the levels found in the failing heart, and its cytotoxicity is mediated through β-adrenergic receptors.89,90 In a study by Engelhardt et al (1999), β1- adrenergic receptor overexpressing mice developed cardiomyopathy and HF at a young age.91 The observed changes were similar to chronic catecholamine
50
stimulation.91 On the other hand, β2-adrenergic receptor overexpression in mice
resulted in increased contractility but with minimal pathology.92 These data
reinforce the view that an increase in β 1 signaling is detrimental to cardiac
function.
Signaling via α- and β-adrenoceptors can acutely modulate the function of
a number of ion channels and transporters in the heart. For instance, β-
adrenergic stimulation increases IKs and ICaL.93 Sustained β -adrenergic
stimulation decreases IKs and IK1, similar to changes observed in HF.94 In rat hearts, α1-adrenergic stimulation inhibits Ito, IK1, and IK with a net effect that
leads to AP prolongation.95 AngII and aldosterone prolong AP by increasing INa96
and ICaL,97 and by reducing Ito98,99 and IK1.100,101 Most importantly, enhanced
sympathetic activity can trigger malignant arrhythmias and the generation of
afterdepolarizations (DADs and, EADs). 102,103
1.2.4.1. Inhibition of neurohormonal activation in HF
Therapeutic approaches, targeting neurohormonal activation such as
angiotensin-converting enzyme (ACE) inhibitors that aim to inhibit RAAS or β-
blockers, have been shown to significantly improve mortality and even reverse cardiac remodeling in HF.104 In contrast to ACE inhibitors, β-blockers have a
greater impact on preventing sudden death.105 A recent systemic review of several large randomized control trials revealed that β-blockers reduced sudden
51
death in HF patients by 31%.106 Additionally, β-blockers improve cardiac function
and contractility and prevent apoptosis.107 β-Blockers play a role in reducing abnormal Ca2+ release from the leaky ryanodine receptor (RyR).108 (See further
details in section 1.4.1.1.) Therefore, these studies suggest that preventing
abnormal Ca2+ handling and protecting repolarization reserve from sympathetic
overdrive could prevent the generation of lethal arrhythmias.
1.2.5. Arrhythmogenic ionic remodeling in AF
AF is the most common sustained arrhythmia in clinical practice.109 The
prevalence of AF increases with age and the presence of other underlying disease conditions such as hypertension, HF, and valvular heart disease.109 Lone
AF occurs in the absence of any underlying heart disease. Initially, AF is paroxysmal with spontaneous termination occurring within 7 days. However, over time it can progressively degenerate to persistent AF, which requires medical intervention.110 AF leads to significant electrical remodeling in ion channel expression and function in a way that promotes and favors AF occurrence.111,112
The primary factor occurring in AF that leads to ionic remodeling is the rapid and
irregular beating of the atria. Consequent changes in the electrophysiology of the
atria may explain why AF becomes more persistent over time.
Table 1 summarizes AF-induced ionic remodeling. AF significantly
reduces APD and ERP, which is primarily due to a decrease in ICaL.113-115
52
Additionally, Ito is reduced in human and in animal models of AF.116-118 However,
repolarizing currents such as IKr and IKs do not change in animal models that use
atrial tachypacing to mimic the rapid atrial rate of AF. Evidence from the literature indicates that IK1 increases, which contributes to abbreviation of the AP.119
Reduced INa has been reported in AF, and as a consequence, reduces
conduction velocity (CV). Additional factors affect CV, such as connexins that
contribute to the formation of gap junctions. Gap junctions are membrane
structures which form cell-to-cell connections, and allow the movement of ions
between cardiomyocytes. A reduction in the number of connexins or
redistribution to lateral cell boundaries (lateralization) cause slowing of CV.120,121
Overall, reduction of ERP following changes in ICaL, Ito, IK1, and CV slowing
caused by a reduction in INa and connexins in AF, creates a substrate for re- entrant arrhythmias. Re-entrant arrhythmias occur when a propagating signal fails to terminate after normal excitation of the heart and persists to re-excite the heart after the refractory period has ended.9 Abnormalities in Ca2+ handling and
increased diastolic Ca2+ leak lead to the generation of DADs. Subsequently,
DADs act as triggers for the re-entry substrate, leading to the initiation of AF.
In addition, AF induces structural remodeling by increasing the fibrous
tissue content in the heart or causing ultrastructural alterations (e.g. myocyte
53
loss); such factors are able to promote re-entrant arrhythmias. Structural remodeling in AF will be further discussed in section 1.4.4.
54
Table 1: Summary of electrical remodeling observed from cells obtained from animal models and human samples of HF and AF.
Gene/protein Property HF mRNA /protein AF mRNA /protein HF AF APD ↑* ↓* and ↓
ERP
KCND3/ KCNIP2 Ito ↓* ↓KV4.3 mRNA and ↓* ↓KV4.3 mRNA
(Kv4.3/ KChIP2) protein
KCNQ1/ KCNE1 IKs ↓* ↔ or↓ KvLQT1, minK ↔ ↓,↑ KvLQT1 and minK (KvLQT1/ minK) mRNA and protein
KCNH2/ KCNE2 IKr ↔ or↓ ↔ ERG mRNA ↔ ↓HERG mRNA and (HERG/MiRP-1) protein
Repolarizing currents KCNJ2 (Kir 2.x) IK1 ↓ ↔ or ↓Kir2.1 mRNA and ↑ ↑Kir2.1 mRNA and protein protein
CACNA1C (CaV1.2) ICaL ↔ or ↓ ↔ or ↓ CaV1.2 mRNA ↓* ↓ CaV1.2 mRNA
SCN5A (NaV1.5) INa ↓ and ↑ ↓Nav1.5 protein ↔ or ↓ ↔ or ↓Nav1.5 mRNA
Late INa
SLC8A1 INCX ↑ ↑NCX mRNA and ↔ or ↑ ↔ NCX mRNA ↑ protein Depolarizing (NCX 1.1) protein
Asterisks (red) show the most consistent findings in heart failure (HF) and atrial fibrillation (AF). Arrows show: ↑, increase; ↓, decrease; ↔, no
change.
55
1.3. Role of Epac in cardiovascular signal-transduction
1.3.1. cAMP signaling and identification of Epac proteins
cAMP is a universal second messenger produced by the activity of adenylyl cyclase (AC) following G protein–coupled receptor (GPCR) stimulation.
In the heart, cAMP regulates many physiological processes, such as cardiac contractility, relaxation, and automaticity122. Until 1998, protein kinase A (PKA) and cyclic nucleotide – gated (CNG) cation channels were the only known effectors of cAMP signaling. However, the central dogma around PKA/cAMP activation has since changed with the discovery of a family of novel cAMP sensor proteins. These proteins named Exchange protein directly activated by cAMP
(Epac) are activated by cAMP and function in a PKA-independent manner. Epac proteins are guanine nucleotide exchange factors (GEFs) for the Ras family of small guanosine triphosphate (GTP)-ases, Rap1 and Rap 2.123,124 The G proteins, Rap1 and Rap2 act as molecular switches that cycle between guanosine diphosphate (GDP)–bound inactive and GTP–bound active states
(Figure. 5).125 Therefore, Epac controls cellular responses initiated by the activation of Rap via cAMP. Although Epac signals through its canonical GEF activity to Rap1 and Rap2, it can also activate mitogen-activated family member c-Jun N-terminal kinase (JNK)126, phospholipase D127, and the small GTPase
56
Rit128, as well as promote microtubule growth129 in a Rap–GEF-independent manner.
1.3.2. Epac protein structure and mechanism of action
To date, two isoforms of Epac—Epac1 and Epac2—have been identified, and are encoded by two distinct genes, RapGEF3 and RapGEF4. 124,130
RapGEF3 encodes Epac1, while RapGEF4 encodes Epac2A (long form) and its splice variant Epac2B isoform (short form).131 Epac1 mRNA is ubiquitously expressed with higher expression in the kidneys, heart, ovaries and thyroid glands.124,130 Epac2 mRNA is mainly expressed in the central nervous system
(Epac 2A), adrenal glands (Epac 2B), and pancreas.131
Epac1 and Epac2 are multi-domain proteins that share high sequence homology. They are composed of a regulatory region and a catalytic domain
(Figure 5). The regulatory region of Epac contains a dishevelled–Egl-10–
Pleckstrin (DEP) domain, which is responsible for membrane association and is required for the translocation of Epac to the plasma membrane. This domain is adjacent to a high-affinity cAMP-binding domain (CNB-B). However, Epac2A has an additional cyclic nucleotide-binding domain, which has low affinity (~20-fold lower affinity than CNB-B) for cAMP (CNB-A).132 The function of this domain is unclear and does not seem to be essential for Epac2 regulation by cAMP.133,134
The C-terminal catalytic region consists of Ras-exchange motif (REM) domain, a
57
Ras-association domain, and a cell division cycle 25 (CDC25) homology GEF domain responsible for Epac GDP/GTP exchange activity on Rap GTPases.135
The Ras-association domain is responsible for stabilizing the GEF domain.123
Crystallography studies of Epac2 have shown that without cAMP, the N-terminal region acts as an autoinhibitory domain, which sterically hinders the access of
Rap proteins to the catalytic region.136 Binding of cAMP to Epac induces large conformational changes that release the autoinhibitory effect of the N-terminal region and permit the activation of Rap.
Initially, it was thought that the concentration of cAMP required to activate
Epac in vitro was approximately 10-fold higher than PKA.137 However, more recent studies demonstrate that PKA and Epac have the same affinity for cAMP, indicating that both proteins are activated in response to physiologically relevant cAMP concentrations.138
58
Figure 5: A, Domain structure of Epac protein, autoinhibitory N-terminal regulatory region contains a Dishevelled, Egl-10, and Pleckstrin (DEP) domain and a high-affinity cAMP-binding domain for all Epac isoforms. The catalytic region consists of a Ras-exchange motif (REM) domain, and a Ras-association (RA) domain as well as a CDC25-homology domain (CDC25-HD), which catalyzes the exchange of GDP for GTP on Rap 1 and Rap 2 isoforms. B, Hypothetic model of Epac activation with cAMP. The equilibrium shifts from the inactive cAMP-unbound state to the active cAMP-bound state. Figure 1B adapted from reference 139
1.3.3. Epac-selective agonists and antagonists
Much of our understanding of the role of Epac in the cardiovascular system has come from the use Epac activators in vivo and in vitro. The
59
development of cAMP analogues that are cell-permeable and specific for Epac was an important advance in the functional characterization of Epac. 8-pCPT-2’-
O-Me-cAMP (8pCPT) is the most commonly used Epac agonist and has high- affinity for Epac (dissociation constant [Kd] 2.2 µM for Epac1) as well as low affinity for PKA (Kd 200–300 µM).137 Furthermore, 8-pCPT is 10-fold more efficient than cAMP in activating Epac1 in vitro; Kd of 8-pCPT is 2.9 μM, as compared to a Kd of 45 μM for cAMP. However, intracellularly, Epac-selective analogues may be metabolized into bioactive products (phosphodiesterases,
PDE5, PDE10) with off-target effects.140 Most importantly, 8-pCPT and the nonhydrolyzable form sp-8pCPT have been shown to inhibit several PDEs
(PDE1, PDE2, and PDE6), which can lead to an increase in intracellular cAMP and cyclic guanosine monophosphate (cGMP). Consequently, this activates the cAMP/PKA or cGMP/protein kinase G (PKG) signaling pathways.140 Epac knockdown technology may therefore be needed to confirm Epac specific effects.
Until recently, specific antagonists of Epac were unavailable. Development of a high-throughput screening assay has assisted in the identification of new Epac antagonists with differential selectivity for Epac 1 versus Epac2 isoforms.141 The selective Epac2 antagonist, ESI-05, and the nonselective Epac1 and Epac2 antagonist, ESI-09 are some of the new compounds that have been developed.142,143
60
1.4. Epac functions in the myocardium
Epac proteins regulate a wide variety of biological responses through interactions with a plethora of signaling molecules. Given the importance of cAMP and Ca2+ signaling in cardiac physiology, most studies have looked at the role of Epac in excitation – contraction (EC) coupling and Ca2+ handling.
Alterations in Epac expression/function play an important role in cardiac disease and will be reviewed briefly in the following sections.
1.4.1. Role of Epac in calcium handling
1.4.1.1. Calcium-induced calcium release
Depolarization of the cardiomyocte membrane results in the activation of voltage-gated Ca2+ channels. The resulting inward ICaL increases local Ca2+ at the dyadic cleft and leads to the activation of RyRs. RyRs, which are located on the sarcoplasmic reticulum (SR), release additional Ca2+ from the SR to the cytosol and further amplify the initial Ca2+ signal (~1 µM). The resulting transient increase in intracellular Ca2+ (Ca2+ transients) activates myofilament proteins and initiates cardiomyocyte contraction. This coordinated process is known as Ca2+-induced
Ca2+ release (CICR).144 Clearance of Ca2+ from the cytosol, leading to intracellular Ca2+ concentrations of ~100 nM and its dissociation from myofibrils, allows for relaxation of cardiomyocytes. Cytosolic Ca2+ is mainly decreased by
Ca2+ reuptake into the SR by sarcoplasmic/endoplasmic reticulum Ca2+-
61
adenosine triphosphatase (SERCA) and extrusion from the cell via NCX. PKA influences the phosphorylation and activity of several proteins that are involved in
EC coupling, such as L-type Ca2+ channels, RyR (by phosphorylation at Ser
2809), phospholamban (PLB, phosphorylation at Ser 16), and troponin I.145
Unphosphorylated PLB is an inhibitor of SERCA that reduces Ca2+ uptake into the SR. PKA phosphorylation at Ser 16 relieves this inhibition and improves muscle relaxation. Epac protein activates Rap and PLC epsilon (PLCɛ), and the downstream kinases, protein kinase C epsilon (PKCɛ) and Ca2+/calmodulin- dependent protein kinase II (CaMKII). Activation of these intracellular messengers subsequently phosphorylates RyR (Ser 2815), and PLB (Thr 17), and potentiates cardiomyocyte contraction (Figure 6).
In HF, abnormal Ca2+ handling leads to hyperphosphorylation of RyR by
PKA (or CaMKII) and induces spontaneous Ca2+ release from the SR.9
Additionally, impaired SERCA function further reduces SR Ca2+ content.9
Increased diastolic Ca2+ leak through RyR induces triggered activity and the generation of DADs.9 Enhanced diastolic Ca2+ leak has been observed in atrial cardiomyocytes from AF patients.146
62
Figure 6: Epac mediates CICR through the activation of the Rap/ PLCɛ/PKCɛ/CaMKII pathway. Subsequently, CaMKII phosphorylates PLB (Thr 17) and RyR (Ser 2815). Epac-mediated activation of CaMKII directly phosphorylates cardiac troponin I (cTNI) and cardiac myosin-binding protein (cMyBPC), which increases myofilament Ca2+ sensitivity and potentiates force of contraction. PKA is classically activated downstream of adenylyl cyclase (AC), which phosphorylates PLB (Ser 16) and RyR (Ser 2809), and LTCC (L-type Ca2+ channels) and participates in excitation–contraction coupling. Epac stimulation also enhances accumulation of connexin 43 at cell–cell contacts.147 Connexin 43 is the most common form of connexin in the human ventricles, contributing to the formation of gap junctions.148,149
63
1.4.2.2. Epac effects on calcium handling
The role of Epac in stimulating CICR was initially observed in pancreatic cells following activation with the specific Epac analogue, 8-pCPT.150 Numerous studies have since looked at the effect of Epac activation on Ca2+ handling.
Oestreich et al (2007) demonstrated that β-adrenergic stimulation in mouse cardiomyocytes regulates SR Ca2+ release (increase Ca2+ transients) through the activation of the Epac/Rap/PLC-ε/PKCε/CaMKII pathway. This subsequently leads to phosphorylation of RyR and PLB at CaMKII-dependent sites.151,152
Conversely, in rat ventricular cardiomyocytes, Epac activation leads to a decrease in SR Ca2+ load, causing spontaneous Ca2+ leakage, and decreased
Ca2+ transients. Regardless, the process still leads to CaMKII-dependent phosphorylation of RyR. Although these studies report an identical CaMKII- dependent phosphorylation site on RyR2 (Ser 2815), the net outcome on Ca2+ transients remains controversial. This discrepancy on Ca2+ transients could be explained through the opposing results of PLB and RyR phosphorylation via
Epac. Short-term Epac stimulation (60 sec) likely increases PLB phosphorylation, increasing Ca2+ uptake in to the SR, thereby increasing Ca2+ transients. On the other hand, 2-5 min Epac stimulation increases RyR phosphorylation, reducing
SR Ca2+ stores leading to decreased Ca2+ transients (Table 2). Additionally, imbalance between increased Ca2+ release without increasing Ca2+ entry could
64
rapidly deplete the SR. Furthermore, acute Epac stimulation leads to phosphorylation of sarcomeric proteins, such as cardiac troponin I (cTNI) and cardiac myosin-binding protein C (cMyBPC), which increases force of contractions. This process is also dependent on PLC, PKC, and CaMKII.153
Chronic Epac activation has been shown to increase Ca2+ transients and SR
Ca2+ load in a process that is dependent on CaMKII and calcineurin.154
Furthermore, calmodulin has been identified as an important downstream protein in Epac sustained actions. Calcineurin is a protein phosphatase that activates transcription factors such as nuclear factor of activated T cell (NFAT), through dephosphorylation. Calmodulin is a ubiquitous Ca2+ binding protein that interacts with many proteins inside the cell (e.g. calcineurin and CaMKII). When Ca2+ bound, it undergoes a conformational change and binds to the regulatory domain of CaMKII, which removes the inhibition of the autoinhibitory domain.155
In summary, numerous reports show the involvement of Epac (acute effect) in Ca2+ regulation. Its actions are mediated mainly through Ca2+ release from the SR via RyR without alterations in L-type Ca2+ current or changes in Ca2+ clearance from the cell (as summarized in Table 2).151,152,156,157 However, the final outcome of RyR phosphorylation is unclear. Pereira et al (2007), demonstrated inhibition of Ca2+ release (depletion of Ca2+ stores) from the SR as a result of increased spontaneous activity and Ca2+ leakage.156 Other studies by Morel et al
65
(2005) and Hothi et al (2008) demonstrated increased spontaneous activity in the absence of altered Ca2+ transient amplitude.157,158 Despite the discrepancies, these studies identified the role of Epac in cardiac Ca2+ handling and EC coupling, and identify PLC, CaMKII, and PKC as the major Epac effectors (Figure
6). Further investigation is required to understand the underlying mechanisms of acute and chronic Epac activation.
66
Table 2: Epac and Ca2+ handling in the heart
Cell type Duration of 8pCPT Effect on Ca2+handling Pathways activated Reference exposure Neonatal rat cardiomyocytes Perfusion with 8-pCPT Increased bursts of Ca2+ Epac/Rac and calcineurin 158 at physiological external transients Morel et al 2005 [Ca2+] concentration No change in amplitude
Mouse ventricular ~60 sec Increased Ca2+ transients Epac/Rap/PLCɛ 151 cardiomyocytes Oestreich et al 2007
Rat ventricular ~2-5 min Decreased Ca2+ CaMKII 156 cardiomyocytes transients Pereira et al 2007
Mouse ventricular ~3 min No change in Epac/CaMKII mediated VT 157 cardiomyocytes Ca2+ transients Hothi et al 2008
Mouse ventricular ~60 sec Increased Ca2+ transients Epac/PLCɛ/PKCɛ/ 152 cardiomyocytes CaMKII Oestreich et al 2009
Rat ventricular Max effect after ~5min Decreased Ca2+ Epac/PKC/CaMKII 153 cardiomyocytes transients Phosphorylation of Cazorla et al 2009 sarcomeric proteins
Rat ventricular 4 week administration Increased Ca2+ transients Epac/CaMKII and Calcineurin 154 cardiomyocytes via osmotic minipumps Ruiz-Hurtado et al 2012
In interpreting the results, duration of exposure, species and methodological approaches (frequency of stimulation) should be considered. Ca2+, calcium; CaMKII, Ca2+/calmodulin-dependent protein kinase; PLCɛ, phospholipase C epsilon; PKCɛ, protein kinase C epsilon; 8-pCPT, 8-pCPT-2’- O-Me-cAMP; Rac, small GTPase; Rap, Ras-related protein 1; VT, ventricular tachycardia
67
1.4.2.3. Aberrant Ca2+ signaling and arrhythmogenesis
Ventricular arrhythmogenesis was first demonstrated by Hothi et al (2008) in mouse hearts. Perfusion with 8-pCPT increased triggered activity and episodes of spontaneous VT without any change in APD or alteration in ventricular refractory period.157 In isolated cardiomyocytes, spontaneous Ca2+ waves and triggered activity occurred due to CaMKII-dependent aberrant Ca2+ release from the SR (Table 1). Chronic Epac activation also promoted arrhythmogenic Ca2+ release in rat ventricular cardiomyocytes.154 The increase in
ICaL window current in this model could potentially create fluctuations in membrane voltage during the repolarization phase of the AP, thus leading to the generation of EADs.159 However, these studies did not investigate specific isoforms of Epac responsible for arrhythmogenesis. Pereira et al (2013) demonstrated that SR Ca2+ leak induced by 8-pCPT in wild-type mice was prevented in Epac2-knockout and double-knockout mice, but remained unaltered in Epac1-knockout mice.160 In contrast, Okumura et al (2014) showed that Epac1, but not Epac2 knockout, was protective against isoproterenol-induced arrhythmogenic activity.161 Although additional studies are necessary to elucidate the pathway that leads to aberrant Ca2+ release from the SR, current evidence presents a novel therapeutic target for the prevention of ventricular arrhythmias.
68
1.4.2. Role of Epac in cardiac hypertrophy
1.4.2.1. Pathological and physiological hypertrophy
Cardiac hypertrophy is broadly defined as an increase in heart mass and has traditionally been classified into physiological or pathological hypertrophy.
Physiological hypertrophy is the beneficial, adaptive response of the heart to maintain or enhance cardiac function. It occurs following postnatal growth and is induced by pregnancy and exercise training (reversible). Under these conditions, cardiomyocytes increase in cell size and mass to handle the increased load on the heart. This allows the heart to maintain normal cardiac function. Pathological hypertrophy occurs as a result of chronic pressure or volume overload as consequence of genetic dispositions or disease states, such as hypertension, myocardial infarction, and valve disease. Pathological hypertrophy is the hallmark of structural remodeling and predicts a poor prognosis.162 At the cellular level it is associated with non-mitotic growth, fetal gene expression (atrial natriuretic peptide [ANP] and brain natriuretic peptide [BNP]), increase in cell mass and protein synthesis, and new sarcomere formation. Chronic cardiac hypertrophy is associated with increased risk of HF, fibrotic replacement, increased apoptosis, sudden death, and arrhythmia.163,164
Different molecular pathways are activated in pathological versus physiological hypertrophy (Figure 7). In physiological hypertrophy, there is an
69
increased activation of the insulin-like growth factor (IGF)-1 (IGF1) – phosphoinositide 3-kinase (PI3K [p110α])–Akt pathway. IGF1 activates the IGF receptor, a tyrosine kinase receptor that activates downstream PI3Ks.
Pathological hypertrophy is activated in response to pathological stimuli, such as pressure overload and/or neurohormonal factors, such as angiotensin II, endothelin 1, or catecholamines (norepinephrine, and noradrenaline). These ligands bind to GPCRs and lead to the dissociation of Gαq/11, the heteromeric G protein subunit. G α q/11 dissociation leads to the activation of PLC. Other downstream signaling molecules such as PKC, protein kinase D (PKD), mitogen- activated protein kinases (MAPKs), and calcineurin are activated by processes leading to pathological hypertrophy (Figure 7B).
Mechanical stress is another factor that activates signaling pathways that lead to hypertrophy and cardiac remodeling. Mechanical stress such as hemodynamic overload leads to reactivation of fetal genes and an increase in protein synthesis. Stretching of cardiomyoctes in vitro has similar effects which are independent of neurohormonal factors.165 Mechanical stress can activate pathways such as MAPK, PLC, PLC, and PI3K/Akt that regulate gene expression. Additionally, mechanical stressors can induce the secretion of growth factors166. Furthermore, mechanical stretch can modulate electrical remodeling
70
(increase IK1 and shorten APD) 167 and increase apoptosis under pathological conditions.168
Figure 7: A, Pathological hypertrophy is mediated through the activation of
GqPCRs and acts through PLC to activate hypertrophic transcription factors. B, Physiological stimuli such as growth factors activate tyrosine kinase receptors that signal through the PI3K pathway. C, Epac-mediated hypertrophy involves the Ca2+-dependent activation of Rac and H-Ras, which result in the activation of Ca2+-sensitive kinase, CaMKII, and the phosphatase calcineurin. Epac effector Rap does not seem to be involved in the hypertrophic response. Moreover, Epac induces NFAT transcription factor activation through Rap/Rac/calcineurin and it induces myocyte enhancer factor (MEF) activation through the Rap/Ras/CaMKII pathway.
71
1.4.2.2. Epac and cardiac hypertrophy
The direct involvement of Epac in pathological cardiac hypertrophy was first observed in studies on neonatal rat ventricular cardiomyocytes (NRVCs).
Incubation of NRVCs with 8-pCPT or overexpression of Epac1 in vitro significantly increased cell-surface area, protein synthesis, and atrial natriuretic factor (ANF) expression.158,169 This process was found to be dependent on the
Ca2+-sensitive small GTPase, Rac (independent of PKA). Inhibition of calcineurin or Rac inhibited the hypertrophic response associated with Epac activation.158 A separate study by Metrich et al (2008) showed the involvement of Ras and the calcineurin/NFAT pathway in Epac-mediated hypertrophy (Figure 7C).169 Chronic
β-adrenergic stimulation induced hypertrophy through Epac activation, whereas shRNA-mediated knockdown of Epac prevented this effect in NRVCs.169 A similar hypertrophic response to Epac1 has also been demonstrated in adult rat ventricular cardiomyocytes.169 Furthermore, it has been strongly suggested that
Epac1 plays a role in cardiac hypertrophy based on its increased expression in samples from both end-stage HF patients and various in vivo models of hypertrophy. Pressure overload – induced hypertrophy increased Epac1 expression in the LVs in rat and mouse.169,170 Interestingly, chronic β-adrenergic stimulation increased both Epac1 and Epac2 mRNA expression in the LV.170
However, Epac1 and Epac2 knockdown did not attenuate hypertrophy in a recent
72
study utilizing a model of pressure overload–induced hypertrophy. The authors suggest that Epac plays a significant role in Ca2+ handling and does not contribute to initial stages of hypertrophy.160 In rat neonatal ventriculocytes, Epac can inhibit the hypertrophic extracellular signal – regulated kinase (ERK)- 5 pathway by a mechanism involving Rap1.171 This is in contrast to the previous data of Morel and Metrich et al showing that Epac induces hypertrophy through a
Rap1-independent pathway. Regulation of cardiac hypertrophy via Epac could depend on multiple factors, such as spatiotemporal dynamics of Epac signaling, species, differentiation stage, and hypertrophic stimuli. Spatiotemporal dynamics of Epac signaling determines the binding partners of Epac, which leads to activation of specific effectors and the functional effects of Epac.139,172 A summary of these studies can be found in Table 3.
73
Table 3: Studies showing the involvement of Epac in cardiac hypertrophy.
In vitro and in vivo models of hypertrophy Epac expression Pathway Reference
Neonatal rat cardiomyocytes (NRVCs) Activation of Epac via 8- Rac/calcineurin/NFAT 158 pCPT induces hypertrophy PKA-independent Morel et al 2005
Adult rat ventricular cardiomyocytes Activation of Epac via 8p- Ras/CaMKII/Calcineurin/NFAT 169
CPT or overexpression with Rap1-independent Métrich et al 2008 adenovirus (Ad.Epac1) PKA-independent
induces hypertrophy Patients; end-stage HF; LV Increase in Epac 1 mRNA 169
and protein Métrich et al 2008 Pressure overload–induced hypertrophy; rats; LV Increase in Epac 1 169
expression Métrich et al 2008 Chronic isoprenaline infusion; mice; LV Increase in Epac 1 and 170
Epac 2 mRNA Ulucan et al 2007 Pressure overload– induced hypertrophy; mice; LV Increase in Epac 1 mRNA 170
Ulucan et al 2007 H9C2 Increase in Epac 1 mRNA ERK1/2 170
cardiac myogenic cell line and protein Ulucan et al 2007 FCS stimulation
Pressure overload– induced hypertrophy; mice Epac-knock out does not 160 attenuate hypertrophy Pereira et al 2013
CaMKII,Ca2+/calmodulin-dependent kinase, ERK1/2, extracellular signal–regulated kinases 1/2 (subfamily of MAPKs), FCS, fetal calf serum; H9C2, cardiac myoblast cells; isoprenaline, β-adrenergic receptor agonist; NFAT, nuclear factor of activated T cells; 8-pCPT, 8-pCPT-2’-O-Me-cAMP; PKA, protein kinase A; Rac, small GTPase; Rap1, Ras-related protein 1.
74
1.4.3. Role of Epac in cardiac electrophysiology
Very little is known regarding the role of Epac in cardiac electrophysiology.
Previous studies have mainly investigated the effect of acute Epac activation on
ICaL. No change was observed in ICaL or APD.152,156 However, a recent study has shown that a more permeable acetoxymethyl ester form (8-CPT-AM) of an Epac analogue (8-pCPT) significantly increased APD (note that acetoxymethyl group increases hydrophilic properties of 8-CPT-AM, making it highly membrane permeant).173 Prolongation of APD was due to inhibition of steady-state K+ current in rat ventricular cardiomyocytes. Hurtado et al (2012), studied the effect of Epac activation more chronically (~5 h) and found an increase in ICaL window current.154 The effect of Epac on other ionic currents in cardiomyocytes has not been investigated.
In non-cardiac cells, Epac activation increases activity of Ca2+ sensitive big K+ channel in neurons.174 Epac activation decreased adenosine triphosphate
(ATP) sensitive K+ current (IKATP) in chromaffin (pancreas) and vascular cells.150,175 Inhibition of IKATP is Ca2+ dependent and Epac directly binds to sulfonylurea receptor 1 (SUR1), a subunit of ATP-sensitive K+ channels.175-177
Additionally, 8-pCPT increased recruitment and expression of Cav3 T-type Ca2+ channels in adrenal chromaffin cells.178 Table 4 provides a summary of studies that have utilized Epac on cardiac cells.
75
Table 4: Studies identifying the role of Epac in cardiac electrophysiology.
Cell type Epac activation Modifications in ionic Reference currents
Rat ventricular 2–5 min 8-pCPT No change in ICaL 156 cardiomyocytes exposure No change in APD Pereira et al 2007
Mouse ventricular Acute stimulation No change in ICaL 152 cardiomyocytes via 8-pCPT Oestreich et al 2009
Rat ventricular 5 hour 8-pCPT Increase in ICaL 154 cardiomyocytes treatment Ruiz-Hurtado et al 2012
Rat ventricular 8-CPT-AM No change in ICaL 179 cardiomyocytes perfusion APD prolongation Brette et al 2013 PKA-independent
Decrease in ISS
APD, action potential duration; 8-CPT-AM, 8-(4-Chlorophenylthio)-2′-O-methyl-cAMP acetoxy- methyl ester; potency of 8-CPT-AM is 100 to 1000-fold greater than that of 8-pCPT;173,180 Iss,: steady-state potassium current.
1.4.4. Role of Epac in cardiac fibrosis
1.4.4.1. Fibrosis
The myocardium is composed of different cell types, such as cardiomyocytes, fibroblasts, smooth muscle, and endothelial cells. Of these cell types, fibroblasts represent the largest number of cells (approximately two- thirds), while cardiomyocytes occupy two-thirds of the cell volume.181 Fibroblasts are involved in many aspects of cardiac function, such as remodeling of the cardiac extracellular matrix (ECM), and production of growth factors and cytokines.182 The ECM is predominantly composed of fibrillar collagens type I
76
(85%), and type III (11%). The remainder is composed of collagen types IV, V, and VI.183 The ECM also includes fibronectin, laminin, elastin, fibrillin, proteoglycans, and glycosaminoglycans. A number of cell-surface markers have been developed to identify fibroblasts, of which vimentin (present in other cell types) has been the most widely used.184
Cardiac fibrosis is a hallmark of heart disease and results from the excess deposition of ECM, mainly fibrillar collagens, in the heart. This process can be part of the normal physiology of the heart (aging) or initiated following an injury.
Cardiac fibrosis impedes the normal function of the heart and can have severe consequences, such as impaired diastolic and systolic function.185
Fibrosis is classified as either reparative or reactive. In reparative
(replacement) fibrosis, myocytes that are lost either through necrosis or apoptosis are replaced with fibrotic tissue to maintain the structural integrity of the heart. This process increases myocardial stiffness and can lead to the creation of scars. Fibrosis serves to fill in the gaps between the surviving cardiomyocytes and is a key adaptive biological function.186 When ECM homeostasis is dysregulated reactive fibrosis ensues. Reactive fibrosis, which can occur concurrently with reparative fibrosis, causes interstitial tissue expansion between cardiomyocytes, but it is not directly associated with cardiomyocyte death187. Profibrotic stimuli initiate reactive fibrosis that becomes
77
more extensive over time (diffuse pattern). The resulting deposition of a dense array of disorganized collagen fibrils between cardiomyocytes creates a barrier for impulse propagation. Pathologically induced reactive fibrosis changes the ratios of fibrillar collagen subtypes compared to the normal myocardium.188,189
Animal models of fibrosis indicate regional differences in fibrosis; the atria are more sensitive to fibrotic remodeling than the ventricles.190
1.4.4.2. Clinical relationship between fibrosis and AF
The mechanisms underlying AF have long been debated and studied.109
Electrical and structural remodeling, autonomic nervous system changes and
Ca2+ handling abnormalities have been shown to contribute to AF.109 Structural remodeling is characterized by atrial enlargement and fibrosis.186 Atrial fibrosis is a hallmark of arrhythmogenic structural remodeling and is a common clinical feature of AF.186 Increased collagen deposition has been seen in patients without any evident heart disease (lone AF) compared to normal (control) subjects in sinus rhythm.191 The same pattern was observed in patients with AF following mitral valve disease versus normal sinus rhythm controls.192 There also appears to be a significant correlation between ECM volume and AF persistence in patients.188 Apart from the data provided from patient samples, experimental evidence provides a link between atrial fibrosis and AF. Ventricular tachypacing
(VTP) in dogs induces HF by causing tachycardiomyopathy and produces
78
interstitial fibrosis similar to that observed in patients with AF.193,194 The increase in ECM gene expression follows a time course that is similar to the development of fibrosis and AF.195,196 Electrical burst pacing induced sustained AF in mice with selective fibrosis.197 Selective fibrosis was created by overexpression of transforming growth factor- β 1 ([TGF β 1]-transgenic mice), which results in interstitial fibrosis in the atrial myocardium but not in the ventricles. In the absence of fibrosis (control mice), burst pacing rarely induced AF, and when initiated, the arrhythmia self-terminated rapidly.197 It is interesting to note that there were no changes in electrophysiological parameters such as ERP or APD, indicating that atrial fibrosis in itself was sufficient to increase susceptibility to AF
Overall, fibrosis plays an important role in cardiac arrhythmias both at the atrial and ventricular level. Increased collagen deposition uncouples cardiomyocytes and leads to local conduction abnormalities.120 Conduction abnormalities provide a basis for re-entrant arrhythmias.
Re-entry requires a vulnerable substrate that is created by altered electrical properties (changes in refractory period) or fixed structural changes, including anatomical block, such as fibrosis.109 Re-entry is usually initiated by an ectopic beat. DADs are the most common source of ectopic activity in AF.109
Once the trigger is initiated the activation travels around an inexcitable obstacle.
Figure 8 A illustrates normal AP propagation in a cardiomyocyte bundle that splits
79
into two branches. In anatomical re-entry, once the depolarization meets an obstacle (eg, fibrosis), conduction is slowed. If CV is sufficiently slowed, then pathway A recovers from refractoriness and signals traveling along pathway B can re-excite pathway A at point C (Figure 8A). Depolarization then enters pathway A (in the opposite direction) and creates a circuit that can sustain itself.
The initiation and maintenance of re-entry depends on CV and refractory period.
Unlike other types of re-entrant arrhythmias, anatomical re-entry follows a fixed path around the physical obstacle. This type of circus movement re-entry was first described by Mines.198 Two other theories also explain re-entrant arrhythmias (functional re-entry): the leading circle and the spiral wave.199
Electrical coupling between fibroblasts and cardiomyocytes184 has been shown to induce spontaneous ectopic activity and promote re-entry in co-culture
(fibroblast–cardiomyocyte) systems.200 Fibroblasts are inexcitable and have a resting membrane potential around -30 mV, whereas atrial cells have a resting membrane potential of -80 mV. At the resting stage, current flows from fibroblasts to any cardiomyocyte to which they are coupled. This can depolarize cardiomyocytes and lead to spontaneous phase 0 depolarization if the threshold is reached. However, when cardiomyocytes are depolarized and the membrane potential is positive to -30 mV, current will start to flow from cardiomyocytes to
80
fibroblasts. This process continues during phases 1 and 2 of the AP, and can accelerate repolarization and shorten APD, thus favoring re-entry.
A Normal conduction Anatomical re-entry Cardiomyocyte bundles
myofibroblasts A B Pathway A
Pathway B
Fibrosis
C C Conduction slowing
APD↓
B Ectopic firing AF-maintaining substrate
Figure 8: A, Normal conduction: Depolarizing wave of APs cancel each other out and proceed in one direction at point C due to inexcitibiliy of the refractory tissue. Anatomical re-entry: In pathway B extracellular matrix deposition by myofibroblasts interrupts cardiac muscle continuity and leads to conduction
81
slowing. Once AP reaches point C it can re-excite pathway A due to dissipation of the refractory period. This process initiates re-entry where the wavefront travels around the fibrotic tissue. Myofibroblasts can electrically couple to cardiomyocytes, and because they are less polarized, can depolarize cardiomyocytes and induce spontaneous ectopic firing. Myofibroblasts slow conduction and shorten APD favoring re-entrant arrhythmias. B, Structural re-entry substrate induced by fibrosis in the atria. Ectopic firing from the pulmonary sleeves can initiate re-entry.
1.4.4.3. Mechanisms of fibrosis
Increased ECM deposition is responsible for structural remodeling. The
ECM is in a constant state of equilibrium between deposition and degradation.
Fibroblasts are primarily responsible for secreting and maintaining the ECM. In response to profibrotic stimuli, cardiac fibroblasts differentiate into myofibroblasts, which are more mobile, more contractile, and produce additional ECM proteins.201 Profibrotic signaling pathways are activated following cardiac injury, and in addition to their individual effects, they often act synergistically.202
1.4.4.4. Profibrotic signals
Angiotensin II
AngII mediates cardiac fibrosis in a variety of cardiac pathologies such as
HF and hypertension. It also plays a central role in AF.203 Increased AngII production in transgenic mice results in focal fibrosis and AF.204 AngII mediates its effects by acting on two different GPCRs: AT1-R and AT2-R. Most of the
82
profibrotic effects of AngII are related to AT1-R activation. AT1-R signaling activates Shc/Grb2/son of sevenless (SOS) adapter-protein complex, which activates the small GTPase protein, Ras. In turn Ras initiates MAPK phosphorylation.205 AT1-R also activates PLC, which leads to activation of PKC through diacylglycerol (DAG) and causes intracellular Ca2+ increase through inositol trisphosphate (IP3). Additionally, AngII activates the Janus kinase
(JAK)/signal transducers and activators of transcription (STAT) pathway that activates transcription factors, such as activating protein–1 (AP-1) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), which promote cardiomyocyte remodeling (Figure 9).205 However, AT2-R signaling has generally opposite effects to AT1-R signaling and counteracts MAPK activation through dephosphorylation.
Transforming Growth Factor β1
TGFβ1 is an important profibrotic mediator that is secreted from both fibroblasts and cardiomyocytes. 206 TGFβ1 acts as a primary mediator of AngII in both a paracrine and autocrine manner. AngII increases the synthesis of TGFβ1, which reciprocally increases AngII and other profibrotic mediators.207 TGFβ1 acts on the constitutively active TGFβ1 receptor II on fibroblasts, which subsequently activates the TGFβ1 receptor I. This ultimately results in the phosphorylation of
Smad(2/3) proteins, which form a transcriptional complex with Smad4 to
83
modulate transcription responses.208,209 TGFβ1 increases fibroblast activation and increases fibrosis through the Smad signaling pathway (Figure 9).210 Cardiac overexpression of TGF β 1 (constitutively active) causes atrial fibrosis and promotes AF.197 Recent studies indicate that AF is associated with increased
TGFβ 1 levels in serum,211 and TGFβ1 levels increase in the atria (not ventricle) with the development of HF in the VTP model.190
Platelet-derived growth factor (PDGF) activates tyrosine kinase receptors,
JAK/STAT, and PLC pathways that are also activated by TGFβ1 and AngII.
Connective tissue growth factor (CTGF) is a major downstream effector of TGFβ
1. Expression of CTGF is upregulated by TGFβ1 and AngII, leading to fibroblast activation.212,213
1.4.4.5. Epac expression modulates fibrosis
Recent studies have demonstrated the role of Epac in the regulation of cardiac fibrosis. Yokoyama et al (2008) were first to show that profibrotic signals such as TGFβ1 decrease Epac1 expression in fibroblasts from the heart, lung, and skin of rats.214 Simultaneous overexpression of Epac1 and TGF β 1 stimulation inhibited TGFβ1-induced collagen synthesis, indicating the potential involvement of Epac1 (decreased expression) in the profibrotic response.
Additionally, treatment of rat atrial fibroblasts with 8-pCPT significantly decreased collagen I and III expression.214 Following myocardial infarction, decreased
84
Epac1 expression was detected around the border zone, which correlated with high levels of TGFβ1.
The effect of adenosine agonists to inhibit AngII-mediated collagen synthesis was similarly found to be Epac related.215 Interestingly, Epac-mediated the expression of the profibrotic cytokine, interleukin 6 (IL-6), via activation of the
PKC and MAPK pathway in neonatal mouse fibroblasts216. Together, these studies indicate that activation of Epac1 can regulate profibrotic responses and therapeutic approaches that aim to increase cAMP/Epac signaling could potentially decrease tissue fibrosis (Figure 9).217
85
Figure 9: Fibrotic pathways involved in atrial fibrosis. TGFβ acts through RII and RI receptors and increases collagen expression through the Smad signaling pathway. Angiotensin II (AngII) activates multiple pathways in fibroblasts. AT1-R signaling activates src homologous and collagen protein (Shc)/growth factor receptor binding protein 2 (Grb2)/son of sevenless (SOS) protein, which leads to the activation of mitogen-activated protein kinase (MAPK) pathway. AngII signaling also activates the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) pathway further increasing collagen synthesis. AngII increases the synthesis of TGFβ1 (dashed line). Increased intracellular cAMP signaling inhibits profibrotic responses in fibroblasts (potentially through Smad inhibition).217 Increased Epac activation decreases collagen expression. A-R, adrenergic receptor; Iso, isoproterenol (β-adrenergic agonist).
1.5. Rationale for thesis
Cardiac arrhythmias remain a leading cause of death for many cardiac diseases, such as HF, that are associated with a sustained increase in SNS adrenergic drive. It is important to know the molecular mechanisms by which arrhythmias occur to devise more effective preventive approaches. The mechanisms by which a transient increase in adrenergic stimulation causes arrhythmias are well known. However, the mechanism by which sustained adrenergic hyperactivity alters cardiac electrical function to make the heart vulnerable to dangerous rhythm disturbances is poorly understood. Acutely, β- adrenergic stimulation increases IKs density through a macromolecular complex that produces PKA-dependent phosphorylation of KCNQ1 on Ser-27
86
residue.218,219 However, chronically sustained β-adrenergic stimulation decreases
IKs in a long-term guinea pig ventricular cell culture system.94 This chronic effect is potentially proarrhythmic and could lead to the generation of EADs that contribute to sudden death in HF. The signaling pathway that downregulates IKs is unknown and elucidating the underlying mechanisms could help in developing strategies to prevent it. My preliminary data indicated that Epac may be involved in the regulation of IKs caused by chronic adrenergic stimulation in guinea pig ventricular cardiomyocytes. Therefore, I first sought to confirm this and to investigate the detailed mechanism of this IKs regulation via Epac in vitro (results presented in Chapter 2). Next, I determined the effect of chronic β-adrenergic and Epac stimulation by developing an in vivo guinea pig model to verify the functional in vivo applicability of this system. My results implicated a specific pathway mediated by Epac, which increases intracellular Ca2+ activation of calcineurin/NFAT signaling to down-regulate KCNE1 at the mRNA-level.
Having identified Epac as an important mediator of ventricular electrical remodeling, I next looked at the potential role it may play in atrial remodeling, specifically the atrial fibrosis that often underlies AF. A prior study had indicated the involvement of Epac in collagen synthesis in fibroblasts.214 I therefore examined the changes in Epac expression in an in vivo dog model of AF- promoting fibrosis and investigated the potential mechanisms (Chapter 4).
87
Furthermore, I examined the effect of chronic adrenergic stimulation on Epac expression in fibroblasts and related effects on collagen synthesis.
88
Chapter 2
Epac mediates slow delayed-rectifier potassium current
remodeling by sustained β-adrenergic activation in guinea
pig hearts (in vitro model)
Figures from this Chapter are published in Circulation Research
Exchange protein directly activated by cAMP mediates slow delayed-rectifier current remodeling by sustained β-adrenergic activation in guinea pig hearts. Aflaki M, Qi XY, Xiao L, Ordog B, Tadevosyan A, Luo X, Maguy A, Shi Y, Tardif JC, Nattel S. Circ Res. 2014 Mar 14; 114(6):993-1003
For published paper refer to Appendix
As previously discussed in Chapter 1, delayed-rectifier currents are the major outward currents responsible for phase 3 of the AP. Reductions in IKs impair repolarization reserve and create a substrate for the generation of EADs.
Chronic adrenergic stimulation decreases IKs through an unknown mechanism. In this Chapter I investigated the potential involvement of Epac in the adrenergic regulation of IKs. Epac plays a significant role in Ca2+ mobilization, excitation- contraction coupling and hypertrophy. However, not much is known regarding the role it plays in cardiac electrophysiology. The experiments presented here demonstrate the detailed signaling pathways involved in the downregulation of IKs through the sustained activation of β-adrenergic receptors via isoproterenol.
89
2.1. Introduction
HF remains a leading cause of mortality, with arrhythmic sudden death implicated in ~50% of deaths. AP prolongation is a consistent finding in patients and animal models with HF.9,14,15 Elevation of plasma norepinephrine concentration predicts outcomes in HF,87 and β-blockers reduce HF mortality.220
Reduced IKs is a particularly common and important finding in HF-related remodeling.9,221 Reduced IKs impairs repolarization and promotes arrhythmogenesis, as classically seen with mutations of the underlying subunits of the voltage-gated potassium channel, KCNE1 and KCNQ1, in long QT syndrome.222
It was previously shown by Zhang et al 2002, that sustained β-adrenergic stimulation decreases IKs density in the guinea pig,94 but the underlying molecular basis remains poorly understood. β-Adrenergic stimulation causes cardiac remodeling via cAMP, classically mediated by PKA; however, the novel protein family, Epac has been shown to mediate β-adrenoceptor actions.123,169
Little is known about the involvement of Epac in cardiac remodeling, particularly at the electrophysiological level. The present study aimed to clarify the molecular mechanisms underlying β-adrenergic downregulation of IKs, with a particular focus on the potential role of Epac.
90
2.2. Methods
Guinea Pig Ventricular Cardiomyocyte Isolation
Animal care and handling procedures complied with the guidelines established in the National Institutes of Health Guide for the Care and Use of Laboratory
Animals, and were approved by the ethics committee of the Montreal Heart
Institute. Guinea pigs weighing 350–450 g were injected with heparin (1.0 units/kg) and euthanized by stunning-induced coma with loss of all reflex- responses, followed by cardiac excision. The heart was quickly excised and transferred to ice-cold oxygenated Tyrode solution (mmol/L: NaCl 136, KCl 5.4,
MgCl2 1, HEPES 5, Na2H2PO4 0.33; pH adjusted to 7.35). The heart was retrogradely perfused via the aorta with 200-µmol/L Ca2+-containing Tyrode solution. When clear, the perfusate was changed to Ca2+-free Tyrode solution and the heart was digested with the addition of 280-U/mg collagenase type II
(Worthington; 25 mg in 50 mL Tyrode solution) and 1% bovine serum albumin
(Bioshop). Cells were obtained by trituration and stored in Kraftbrühe (KB) solution containing (mmol/L): KCl 20, KH2PO4 10, glucose 10, mannitol 40, albumin 0.1%, L-glutamic acid 70, β-hydroxybutyric 10, taurine 20, EGTA 10; the pH was adjusted to 7.35. Cells were concentrated and allowed to settle by gravity. After 1 hour, half of the KB solution was removed, and after the Ca2+ reintroduction step cells were allowed to settle by gravity again. At the last stage
91
the pellet was kept for cell culture.
Cell Culture and Drug Treatment
Cardiomyocytes were reintroduced to Ca2+ by a stepwise addition of cell culture medium (Hyclone M199+Earle’s salts and L-glutamine) to the cells resuspended in KB (successively 200, 500, 1000, and 1800 μmol/L). The medium was supplemented with Na-penicillin and streptomycin (Hyclone, 1-µg/mL) and insulin-transferrin-selenium-X (GIBCO-1%). Cells were plated at low density
(~104 cells/cm2) on glass coverslips and culture dishes coated with laminin
(Sigma, 20-µg/mL) and maintained at 37°C in a humidified, 5% CO2-enriched atmosphere. After 2 hours, dead cells were removed. Fresh medium was added and supplemented with 1-µmol/L isoproterenol (Iso, Sigma) in drug treatment groups. Cells were kept in culture for an additional 30 hours. In some experiments, CGP-20712A (Sigma, 300-nmol/L), ICI-118551 (Sigma, 500- nmol/L), 8-Br-cAMP (Sigma, 1-mmol/L), forskolin (Calbiochem, 10-μmol/L), 8- pCPT (Sigma, 6-µmol/L), INCA-6 (Calbiochem, 1- µmol/L), cyclosporine (Sigma,
0.8-µmol/L), BAPTA-AM (Santa Cruz, 10-µmol/L), myristoylated (cell-permeable)
PKI (Invitrogen, 1-µmol/L), U-73122 hydrate (Sigma, 1-µmol/L ), KN93
(Calbiochem, 500-nmol/L), KN92 (Calbiochem, 500-nmol/L), or GGTI 298 trifuoroacetate salt hydrate (Sigma, 1-μmol/L) were added to cultured cardiomyocytes along with isoproterenol (1-µmol/L) and compared to the
92
appropriate control and isoproterenol-only groups. In all experiments studying the effects of blockers on isoproterenol action, cells from the same isolates were exposed in parallel to isoproterenol as an internal control.
Electrophysiology
Cell culture: After 30 hours of exposure to interventions in culture, cardiomyocytes were washed with Tyrode solution. Isoproterenol-treated cells were washed with 1-µmol/L propranolol (Sigma) to block any potential acute effects of residual isoproterenol bound to the membrane. All experiments were performed at 36 ± 1ºC. The whole-cell patch-clamp technique was used to record currents in voltage-clamp mode. Borosilicate glass electrodes were filled with pipette solution containing (mmol/L): GTP 0.1, K-aspartate 110, KCl 20, MgCl2 1,
Mg2-ATP 5, HEPES 10, Na2-phosphocreatine 5, and EGTA 10; pH adjusted to
7.2 with KOH, and attached to a patch-clamp amplifier (Axopatch 200A).
Electrodes had a tip resistances of 2‒4 MΩ when filled. To record IKs, coverslips with cultured cardiomyocytes were placed in the bath and superfused with
Tyrode solution containing 1-mmol/L Ca2+, CdCl2 (200-µmol/L, to inhibit L-type
Ca2+ current) and dofetilide (1-µmol/L, to inhibit IKr).
Cell capacitance was 104 ± 4 pF for control (CTL) and 106 ± 4 pF for isoproterenol-treated cells in culture.
Protein Extraction and Immunoblots
93
Protein extraction: Membrane protein fractions were isolated with extraction buffer containing: 25-mmol/L Tris-HCl (pH 7.34), 5-mmol/L EGTA, 5-mmol/L
EDTA, 150-mmol/L NaCl, 0.2 mmol/L Na3VO4, 0.1 AEBSF, 20 mmol/L glycerol-
2-phosphate, 10-µg/mL aprotinine, 10-µg/mL leuptenin, 1-µmol/L microcystin, 1- and µg/mL pepstatin (pH 7.4); followed by homogenization. After centrifugation at
3000 rpm at 4ºC for 10 minutes, the supernatant containing the cell membranes was centrifuged at 48,000 rpm for 1 hour. Membrane pellets were resuspended in extraction buffer supplemented with 1% Triton X-100 and stored at -20°C.
Western blots: Protein concentration was determined with the Bradford method.
Membrane protein (10–20 µg) was denatured and fractionated on 8% SDS- polyacrylamide gels, then proteins were transferred electrophoretically to
Immobilon-P polyvinylidene fluoride (PVDF) membranes (Millipore) in 25-mmol/L
Tris-base, 192-mmol/L glycine, and 20% ethanol at 0.3 A for 1 hour. Membranes were blocked in phosphate-buffered saline (PBS, mmol/L: 137 NaCl, 10 phosphate, 2.7 KCl; pH adjusted to 7.4 with NaOH) with 5% nonfat dry milk for 1 hour and incubated with primary antibodies (rabbit anti-KCNE1 1:1000, as kindly provided by Dr. Jacques Barhanin) overnight at 4°C. After washing and reblocking, membranes were incubated with donkey anti-rabbit (1:10,000,
Jackson Immunolabs) secondary antibodies. Antibody was detected with
Western-Lightning Chemiluminescence Reagent Plus 3 (Perkin-Elmer Life
94
Sciences). Later, the same membranes were also probed with anti-GAPDH at room temperature for 1 hour in order to control for equal protein loading.
Secondary antibody was horseradish peroxidase‒conjugated goat anti-mouse
IgG (1:10,000, Jackson Immunolabs).
Confocal Microscopy
After 30 hours of exposure to interventions or control (vehicle) in culture, cardiomyocytes were washed with PBS and then fixed with 2%-formaldehyde (20 min, Sigma). Cells were blocked and permeabilized with 2% normal donkey serum (NDS, Jackson), and 0.2% TritonX-100 (Sigma) for 1 hour. Cells were then incubated overnight at 4°C with primary antibodies for KCNE1 (1:200 rabbit polyclonal), NFATc3 (1:200, mouse monoclonal, Santa Cruz) and NFATc4
(1:200, rabbit polyclonal, Santa Cruz) in PBS containing 1% NDS, 1% BSA, and
0.05% Triton. This was followed by three washes and incubation with secondary antibody (donkey-anti-mouse Alexa-555 and donkey-anti-rabbit Alexa-488,
Jackson) at room temperature for 1 hour. Additionally, cells were incubated with
ToPro3 (1-µmol/L, Invitrogen) for 30 minutes at room temperature. Confocal microscopy was performed with the Olympus Fluoview FV1000 system. Control experiments with secondary antibodies revealed very low-level or absent background staining. Signals were analyzed with Fluoview Olympus software.
Nuclear and cytosolic densities of NFATc3 and NFATc4 staining were
95
determined as the sum of the intensities of pixels within nuclear or cytosolic regions normalized to the corresponding nuclear or cytosolic areas. Phalloidin was used as a cardiomyocyte marker.
RNA Isolation/Real-time PCR
Guinea pig ventricular cardiomyocytes were collected after 30-hr culture in intervention- or CTL-medium, or after isolation following isoproterenol or sp-
8pCPT treatment. Total RNA was extracted with NucleoSpin RNA II (Macherey-
Nagel) kit. Cells were homogenized in TRIzol Reagent (Invitrogen), and mixed with an equal amount of 70% ethanol. The lysate was loaded on to a NucleoSpin
RNA II column and centrifuged for 30 s at 11,000 g to ensure RNA-binding. MDB
(Membrane Desalting Buffer) was added to the columns to prepare the membrane for subsequent DNase reaction. To eliminate genomic DNA, RNA was treated with a DNase reaction mixture (room temperature, 30 min). The silica membrane was washed with Buffer RA2 (wash buffer) and RA3 (wash buffer concentrate) and then dried. RNA was eluted with 40 µL of RNase-free water
(HyClone®, Thermo) and centrifuged at 11,000 g for 1 min. RNA was quantified spectrophotometrically at 260-nm and sample integrity was confirmed by agarose gel electrophoresis. One microgram of each RNA sample was reverse transcribed with the High Capacity cDNA Archive Kit (Applied Biosystems). Real-
96
time PCR was performed with SYBR Green (Power Syber Green master mix,
Applied Biosystems). Primer sequences are shown in Table I.
Each cDNA sample was run in duplicate on the Stratagene Mx3000P qPCR platform. Primer specificity was verified with dissociation curve analyses and gel electrophoresis of the PCR products. Gene expression levels were normalized to the geometric average of multiple reference genes (18-S rRNA, GAPDH, β-actin and HPRT [hypoxanthine-guanine phosphoribosyltransferase]) according to
Vandesompele et al.223
Construction of Epac-1 Knockdown Adenoviral Vectors
To attenuate Epac1 expression in guinea pig cardiomyocytes, an E1-E3-deleted adenoviral vector, over-expressing a microRNA-embedded shRNA (shRNAmir) sequence targeted to Epac1 mRNA (Ensembl Gene ID:ENSCPOG00000006002) was developed. First, we created an adenoviral shuttle plasmid that carries a
CMV promoter-driven GFP expression cassette and the microRNA-context sequence in the 3`untranslated region of GFP with unique restriction sites for cloning of shRNAmirs (Figure IA). The turbo GFP cDNA was PCR amplified from pGIPZ (Open Biosystems) with the following primers: 5`
GGTAGTCGACCACCGACTCTACTAGAGGAT (sense) and 5`
TGCGGCCGCGGCCGCTACTTGTACATTAT (antisense). The PCR product was cloned in pAdTrack-CMV (generously gifted by Bert Vogelstein, Addgene plasmid
97
#16405) at SalI – NotI sites, generating the AdS-GFP plasmid. Two XbaI fragments of AdS-GFP between positions 1612 and 3298 were deleted using the dam-, dcm- E. coli strain ER2925 (New England Biolabs), resulting in AdS-GFP-
ΔXbaI. Finally, the microRNA-context sequence was PCR amplified from pGIPZ with 5` TAGCGGCCGCTTGTTTGAATGAGGCTTCAG sense and 5`
TGCAAGCTTCGCATTAGTCTTCCAATTGAA antisense primers and the PCR product was cloned in AdS-GFP-ΔXbaI between NotI and HindIII sites, constructing the AdS-empty plasmid. The Epac1-targeted shRNAmir sequence was cloned in AdS-empty (Figure IB) following previously published protocols.224
Briefly, the shRNAmir sequence was designed with the web-based ‘shRNA retriever’ tool available on the homepage of Ravi Sachidanandam’s laboratory
(http://katahdin.cshl.org/, Cold Spring Harbor Laboratory, NY, USA). The 97-bp long synthetic oligonucleotides (Epac1: 5`
TGCTGTTGACAGTGAGCGAACAGAGACATTCCTCAGTGACTAGTGAAGCCACAGAT
GTAGTCACTGAGGAATGTCTCTGTCTGCCTACTGCCTCGGA, scrambled:
5`TGCTGTTGACAGTGAGCGAACGTAAGCAAAGCGGTGATCATAGTGAAGCCACAG
ATGTATGATCACCGCTTTGCTTACGTCTGCCTACTGCCTCGGA, with the 22-bp mature siRNA sequences italicized) were PCR amplified with 5`
CAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG sense and 5`
CTAAAGTAGCCCCTTGAATTCCGAGGCAGTAGGCA antisense primers and the
PCR products cloned in AdS-empty at XhoI and EcoRI sites. Recombinant
98
adenoviral genomes and initial virus cultures were generated by employing the
Adeasy system (Johns Hopkins
University, http://www.coloncancer.org/adeasy.htm); according to previously published protocols.225 Recombinant adenoviruses were amplified in Hek293 cells (ATCC) and were purified with the Adenovirus Standard Purification
ViraKit™ (Virapur LLC). Functional titers of the final virus preparations were determined by infecting Hek293T/17 cells with limiting dilutions of the virus.
Guinea pig ventricular cardiomyocytes were transduced with the Epac1-KD and scrambled virus and kept in culture for 72 hr with the appropriate controls.
Adenoviruses require 72 hours in culture to ensure efficient Epac1 knockdown.
The infection efficiency of the virus was close to 100% of viable cardiomyocytes
(Figure IC).
Cardiomyocyte T-tubule Network Analysis
Freshly isolated ventricular cardiomyocytes were plated on laminin-coated Petri dishes. Cell membranes were stained with 2-μmol/L di-4-ANEPPS in Kraft-Bruhe
(KB) solution. Samples were excited with an argon (488 nm) laser and fluorescence collected at 515-nm emission wavelength with an LSM 710 confocal microscope. Z-series were acquired every 300 nm from top to bottom of each cardiomyocyte. Fluorescent latex beads (170 nm) were used to determine the point spread function (PSF) of the imaging system. Acquired Z-series were
99
further deconvolved with Huygens Professional 4.4.0 software using maximum likelihood estimation with a Richardson-Lucy algorithm. The 20 most central Z- slices, corresponding to a 6-μm thickness, were used to build maximum intensity projections with MIP rendering. The extent of the T-tubule network was determined using the Image Pro Plus 6.0 software (Media Cybernetics). Briefly, the sum of the pixel intensity associated with the total membrane network was first quantified (a). In a second step, the peripheral membrane region was excluded, considering exclusively the inner membrane network (i.e., T-tubules), and the corresponding sum of the pixel intensity quantified as (b). The extent of
T-tubule network within cardiomyocytes (y) was expressed as a percentage of the total membrane network and determined as follows: y = (b x 100)/a.
Incorporation of [3H]-Leucine
To examine the effect of isoproterenol on protein synthesis, the incorporation of radioactive-labeled [H]-leucine was quantified in cardiomyocytes. Cultured guinea pig ventricular cardiomyocytes were stabilized in culture and treated with vehicle
(CTL) or isoproterenol (1-μmol/L) in the presence of [3H]-leucine (1-μCi/mL) for
30h. The cells were washed with PBS and then treated with 10%-trichloroacetic acid at 4°C for 30 min to precipitate protein content. The precipitates were then dissolved in NaOH (0.25 N). Aliquots were counted by liquid scintillation counting.
Data Analysis
100
Clampfit 9.2 (Axon) and GraphPad Prism 5.01 were used for data analysis.
Group comparisons were performed with unpaired Student t-tests (for single comparisons between two groups) or one-way analysis of variance (ANOVA) with
Bonferroni-corrected t-tests (for multiple-group comparisons). Patch-clamp data were analyzed with two-way ANOVA and Bonferroni-corrected t-tests. A two- tailed P<0.05 indicated statistical significance. Data are expressed as mean ±
SEM.
2.3. Results
Sustained β-Adrenergic Stimulation Decreases IKs
I first established the stability of the guinea pig cell culture system in vitro
(Figure 1). IKs density, as well as protein expression of the underlying KCNQ1 and KCNE1 subunits, was stable in the absence of isoproterenol. Isoproterenol treatment increased cell area by ≈50% (Figure 2A), did not affect cell capacitance (Figure 2B), and increased leucine incorporation (index of protein synthesis, Figure 2C). These observations are consistent with cellular hypertrophy following chronic β -adrenergic stimulation. T-tubule density decreased in culture, with significantly greater decreases in isoproterenol-treated cells versus parallel controls (Figure 2D and 2E), potentially accounting for unchanged capacitance in isoproterenol-treated cells, despite increased cell size
101
(104 ± 4 pF for CTL and 106 ± 4 pF for isoproterenol-treated cells). T-tubule density did not change in CTL versus isoproterenol-treated animals (no culture) and cell capacitance was increased significantly (199 ± 11 pF for CTL and 252 ±
16 pF for in vivo isoproterenol-treated animals, P<0.05). The in vivo isoproterenol model will be discussed further in Chapter 3.
IKs recordings from control and isoproterenol (1 μmol/L)-treated cells are shown in Figure 3A and 3B. Figure 3C and 3D shows overall current density/voltage relations, indicating a significant decrease (by ≈60%) in isoproterenol-treated cells. Current densities normalized to maximum values in each cell (Figure 4A and 4B) superimposed, indicating that isoproterenol treatment did not affect voltage dependence. Half-activation voltages (Boltzmann fit) averaged +34.6 ± 1.3 and +33.2 ± 2.5 mV in control (n=13) and isoproterenol- treated (n=8) cells, respectively (P=NS). Isoproterenol exposure accelerated IKs activation by reducing the slow phase time constant (Figure 4C and 4D).
Involvement of β1-Adrenoceptors and cAMP Signaling
In order to find out the mechanisms that lead to a decrease in IKs density, cells were treated with various blockers and activators with or without isoproterenol to verify the involvement of potential participants in this pathway.
Isoproterenol is a mixed β1- and β2-adrenergic-receptor agonist. To determine which receptor is involved in mediating the effects on delayed-rectifier
102
potassium channels, ventricular cells were incubated with isoproterenol and highly selective β1 (CGP-20712A) or β2 (ICI-118551) antagonists and were compared with parallel control and isoproterenol-alone groups. Figure 5A shows representative IKs recordings. Corresponding current density/voltage relationships (Figure 5B) indicate that concomitant treatment with the β1-blocker
CGP-20712A abolished the isoproterenol effect. The β2-blocker ICI-118551 failed to alter isoproterenol action, confirming that the isoproterenol effect is mediated through β1-adrenergic receptors. β1-Receptor blockade also prevented increase in cell size associated with isoproterenol treatment, indicating the importance of β
1- receptors in mediating cardiac remodeling (Figure 5I and 5J).
After β1-adrenoceptor activation, the trimeric G protein complex releases
Gαs, which activates AC, increasing intracellular cAMP levels.226 Sustained exposure to the cell-permeable cAMP agonist 8-bromo-cAMP reduced IKs (Figure
5C), mimicking isoproterenol effects (Figure 5D). Similar changes were observed with forskolin, which increases intracellular cAMP levels by directly activating AC
(Figure 5E and 5F). Acute IKs enhancement caused by β-adrenergic stimulation is mediated by PKA activation/phosphorylation of KCNQ1 on Ser-27.218 To evaluate the role of PKA in IKs downregulation, cardiomyocytes were exposed for
30 hours to isoproterenol in the presence of the N-myristoylated (cell-permeable) form of the peptide PKA-inhibitor PKI (1 μmol/L). PKI did not suppress
103
isoproterenol-induced IKs downregulation (Figure 5G and 5H). In contrast, PKI blunted IKs enhancement resulting from acute isoproterenol exposure (Figure 6A and 6B), indicating that the persistent chronic isoproterenol effect in the presence of PKI is not because of inactivity of PKI. In addition, chronic treatment of cells with 8-Br-cAMP plus PKI suppressed IKs, further excluding the involvement of
PKA (Figure 5E and 5F).
Involvement of Epac
To assess the involvement of Epac, I treated cardiomyocytes with 6-
μmol/L 8-pCPT-2′-O-Me-cAMP (8-pCPT), a highly selective Epac activator.227
Sustained Epac activation with 8-pCPT reduced IKs densities to values comparable with those in a parallel isoproterenol-treated group (Figure 7A; eg, at
+50 mV, from 3.3 ± 0.4 pA/pF in control to 1.7 ± 0.2 pA/pF in isoproterenol and
1.4 ± 0.2 pA/pF in 8-pCPT).
Figure 7A and 7B shows that Epac stimulation can mimic the effect of isoproterenol, but to establish the role of Epac as a mediator of isoproterenol- induced IKs downregulation, it is necessary to assess the effects of Epac inhibition on isoproterenol action. In the absence of a specific pharmacological inhibitor, we turned to genetic knockdown. Two isoforms of Epac (Epac1 and
Epac2) are encoded by distinct genes (RAPGEF3 and RAPGEF4).124 Epac1 is highly expressed in the heart, kidneys, ovaries, and thyroid glands, whereas
104
Epac2 is predominant in the brain and pituitary.130 Furthermore, isoproterenol treatment enhanced the expression of Epac1 in our in vitro system (Figure 8A) and not that of Epac2 (Figure 8B) and increased the Epac1/2 expression ratio
(Figure 8C). Based on these data, we decided to target Epac1 and designed a specific shRNA (Figure I), along with a scrambled-control sequence, each inserted in bicistronic adenoviral delivery vectors incorporating green fluorescent protein. Incubation with the Epac1 knockdown-virus attenuated Epac1 expression after isoproterenol exposure (Figure 9A), whereas Epac2 expression was unaffected (Figure 9B). The scrambled virus did not alter Epac expression in the presence of isoproterenol (Figure 9A), and isoproterenol significantly increased
Epac1 expression in the presence of scrambled virus versus scrambled virus- incubation alone (Figure 10A), with no change in Epac2 expression (Figure
10B). Figure 7C shows representative IKs recordings in cells treated with isoproterenol in the presence of the scrambled-control virus, knockdown-virus, and virus noninfected control, respectively. Epac1 knockdown suppressed isoproterenol-induced downregulation of IKs, as compared with isoproterenol- alone and scrambled sequence (Figure 7D and 7E). These data are strong evidence for a central role of Epac1 in isoproterenol-induced IKs downregulation.
Role of Ca2+/Calcineurin/NFAT
105
Epac action is commonly transduced by increased intracellular Ca2+ levels.172 To determine the role of cell Ca2+ in mediating effects of Epac in our system, I used a cell-permeable calcium chelator (BAPTA-AM, 10-μmol/L).
Cardiomyocytes incubated with isoproterenol and BAPTA-AM did not show a reduction in IKs current density on isoproterenol exposure (Figure 11A), whereas cells from the same isolates exposed to isoproterenol showed typical IKs suppression.
We then turned our attention to potential downstream Ca2+-dependent mediators of Epac action. Calcineurin is a Ca2+-activated phosphatase that is known to mediate Epac-induced cardiac hypertrophy.169 To assess the role of calcineurin, cardiomyocytes were treated with the calcineurin blocker cyclosporine A (0.8 μmol/L). Cyclosporine prevented the isoproterenol-induced downregulation of IKs (Figure 11B). A major mediator of calcineurin action is the nuclear factor of activated T-lymphocytes (NFAT), which is dephosphorylated by calcineurin, allowing increased transport into the nucleus and enhanced transcription factor action.228 Figure 12A shows enhanced nuclear localization of
NFATc4 (red) and NFATc3 (green) following isoproterenol exposure. Overall nuclear localization was increased for both NFATc3 (by ≈61%; P<0.01) and
NFATc4 (≈42%; P<0.05) by isoproterenol incubation (Figure 12B). To assess the functional role of NFAT in IKs downregulation, I treated cardiomyocytes with a
106
cell-permeable NFAT blocker (inhibitor of NFAT-calcineurin association-6; 1-
μmol/L), which prevented IKs downregulation by isoproterenol (Figure 12C and 12D). Epac1 knockdown suppressed β-adrenergically mediated translocation of NFATc3 and c4 into the nucleus, confirming NFAT translocation as an event downstream to isoproterenol-induced Epac activation (Figure 13).
Molecular Basis of Isoproterenol/Epac Effect on IKs
To further address the mechanisms underlying IKs downregulation, I assessed mRNA expression for the IKs subunits KCNQ1 and KCNE1. KCNQ1 mRNA expression was not significantly altered (Figure 12E), but KCNE1 mRNA expression was clearly reduced, by ≈45% (Figures 12F and 14A). These results suggest KCNE1 as the downstream target of the Epac1-stimulated
Ca2+/calcineurin/NFAT system. Numerous NFAT binding sites are located on the
5′-upstream region of the guinea pig transcriptional start site for KCNE1, including one within 300 bp (Figure 15). The NFAT blocker, inhibitor of NFAT- calcineurin association-6 (INCA6) suppressed KCNE1 downregulation (Figure
12F), without altering KCNQ1 expression (Figure 12E), consistent with NFAT- mediated regulation. Representative KCNE1 immunoblots are shown, along with mean data, in Figure 14A. Isoproterenol incubation reduced KCNE1 protein expression significantly, by 56%. The protein expression changes were further confirmed via immunostaining (Figure 14B), which showed reduced membrane
107
expression of KCNE1 protein (by ≈82%; P<0.01) in response to sustained in vitro isoproterenol exposure.
The results above indicated an important role for Ca2+/calcineurin/NFAT signaling but do not exclude the involvement of other molecular pathways. Ras- related protein 1 (Rap1) is known to be activated after Epac activation.124 Its potential role was assessed by incubating cells with GGTI (a Rap1 blocker).
GGTI prevented isoproterenol-induced IKs reduction (Figure 16A and 16B).
Phospholipase C (PLC) is another downstream effector of some Epac1 effects.152
Concomitant treatment of cells with isoproterenol and U-73122 (a PLC inhibitor) did not prevent isoproterenol-induced reductions in IKs density (Figure 16C and
16D). Ca2+/Calmodulin-dependent kinase type II (CaMKII) is known to be activated by β1-adrenergic stimulation.229 Concomitant stimulation of cells with isoproterenol and KN93 (a CaMKII blocker) prevented reductions in IKs density, whereas the inactive congener KN92 was ineffective (Figure 16E and 16F), indicating the necessity for intact CaMKII activity for the isoproterenol effect. In the absence of adrenergic stimulation, neither GGTI nor KN93 altered IKs (Figure
17).
2.4. Discussion
In this study, I found that chronic β-adrenergic stimulation decreases IKs density in vitro while downregulating KCNE1 subunits. Detailed
108
characterization in vitro showed that this effect is mediated via Epac signaling through the Ca2+/calcineurin/NFAT pathway. A summary of our experimental observations and the mechanistic model they suggest is provided in Figure18.
Remodeling of Delayed-Rectifier K+ Currents
The delayed-rectifier K+ current system is crucial for cardiac repolarization in mammals. IKs downregulation occurs in patients with terminal CHF14 and in both rabbit and canine models of pacing induced HF.18,230 Numerous studies have found that CHF decreases IKs in ventricular and atrial cells from different animal models.9,18,55,230-234 Animal models of hypertrophy also show reduced
IKs.235 Atrioventricular block–induced remodeling also decreases IKs in ventricular cardiomyocytes.236,237 Less is known about the signal-transduction mechanisms that lead to IKs downregulation and the underlying changes in IKs subunits. Prior studies have provided discrepant results. Tsuji et al230 showed a decrease in both
KCNQ1 and KCNE1 subunits in rabbits with tachypacing-induced HF, with a corresponding change in the protein. However, other studies of tachypacing- induced CHF in dogs221 and rabbits234 did not show changes in KCNQ1 and
KCNE1 mRNA or protein expression. Borlak et al61 reported an increase in
KCNQ1 and KCNE1 subunit mRNA in heart samples from humans with end- stage CHF. Some of the discrepancies may be because of differences in the severity and duration of CHF, as well as species and drug therapy conditions.
109
The QT interval prolongation associated with K+-channel downregulation is a significant predictor of sudden cardiac death in patients with CHF.238
Epac Signaling in Cardiac Remodeling
cAMP, the universal second messenger that is produced via AC after β- receptor activation, plays an important role in cardiovascular physiology.
Although PKA is recognized as the primary effector of cAMP, other more recently identified proteins, such as Epac, represent important signaling mechanisms downstream to cAMP. Here, we report that chronic in vitro stimulation of β1- adrenergic receptors activates Epac1 (but not Epac2), which decreases IKs density independently of PKA. These data are consistent with known distribution of Epac isoforms, with Epac1 (RAPGEF3) mRNA highly expressed in the heart.239 Myocardial Epac1 expression increases in rats with pressure overload induced by aortic constriction and in rat ventricular cardiomyocytes treated with isoproterenol.169 Epac1 and Epac2 are also upregulated in the hearts of mice subjected to chronic isoproterenol infusion.170 Epac1 expression is increased ≈2- fold in ventricular cardiomyocytes from patients with CHF, with no change in
Epac2 expression.169 Thus, cardiac Epac expression increases under cardiac- load and adrenergic stimulation conditions that cause hypertrophy and remodeling. There is extensive evidence for a causative role of Epac in cardiac hypertrophy.172 Little is known about the role of Epac in cardiac
110
electrophysiology. Epac activation inhibits ATP-sensitive K+-channels in pancreatic β-cells176 and Epac1 coimmunoprecipitates with SUR1, a subunit of the KATP-channel. Exposure of rat chromaffin cells to 8-pCPT increases T-type
Ca2+-current and Cav3.1-subunit expression.178 Acute perfusion of rat and mouse cardiomyocytes with 8-pCPT does not affect L-type Ca2+ current,156,229 but the
Epac activator 8-4-(chlorophenylthio)-2'-O-methyladenosine-3',5' monophosphate
(cpTOME) strongly enhances Ca2+-induced Ca2+ release in mouse cardiomyocytes.152 Acute Epac activation failed to induce any changes in APD in two studies;156,157 however, a more recent investigation showed APD increases in rats after acute 8-CPT-acetoxymethyl-ester (more permeable form) perfusion.179
The discrepancy in the results may be due to the short-term perfusion (acute effect) conditions of the less permeable form used to study Epac actions.
Epac activation increases Ca2+ sparks via CaMKII phosphorylation of
RyRs in rat cardiomyocytes.156 A recent elegant study showed that in vivo infusion of an Epac activator to rats elicits a PKA-independent positive inotropic response, increases cardiomyocyte Ca2+ transients, enhances SR Ca2+ stores and Ca2+ transients, and promotes Ca2+-dependent arrhythmic activity.154
Inhibition of calcineurin or CaMKII prevented Epac-induced Ca2+ responses.
The present study is the first to implicate Epac in IKs remodeling. The Epac dependence of adrenergically induced IKs downregulation was established by the
111
ability of direct Epac activation to mimic adrenergic effects, the lack of change with PKA inhibition, and the suppression of adrenergic effects on IKs and KCNE1 expression when Epac was knocked down. Signaling was Ca2+ dependent (as evidenced by the effect of BAPTA) and required intact calcineurin action (shown by suppression with cyclosporine A). NFAT translocation was a central event: blockade of calcineurin-induced NFAT dephosphorylation with INCA6 prevented
IKs and KCNE1 downregulation, and the suppression of isoproterenol-induced IKs downregulation by Epac knockdown was accompanied by the prevention of
NFAT translocation to the nucleus. The signaling system that we uncovered is consistent with prior studies of Epac effects in the heart. Calcineurin activity is increased in cells treated with 8-pCPT,169 and Epac activation is known to significantly increase NFAT nuclear translocation,158 which is important for the induction of cardiac hypertrophy.
Relationship to Other Signaling Systems in K+ Channel Remodeling
Recognizing the importance of K+-channel remodeling in heart disease, a variety of studies have addressed the underlying mechanisms. Rossow et al240 have shown spatial heterogeneity of NFATc3-dependent Ito downregulation, causing a loss of the normal transmural gradient in mouse ventricular cardiomyocytes after chronic in vivo isoproterenol infusion. β-Adrenergic stimulation increased intracellular Ca2+, calcineurin, and NFAT activity, which
112
reduced Kv4.2 expression and Ito density.240 The upstream pathway was not identified. In mice with myocardial infarction, downregulation of Ito and IKslow1,2
was prevented by calcineurin inhibition or NFATc3 knockout.241 Although calcineurin/NFAT signaling suppresses Ito transcription in most studies,242,243 Ito
upregulation occurs in neonatal rat cardiomyocytes.244 Cav1.2 is downregulated via the same pathway in canine cardiomyocytes.245 NFAT is an important downstream mediator of responses to changes in intracellular Ca2+;246 our data are the first showing a role in downregulating delayed-rectifier K+-currents.
I also identified the involvement of other signaling molecules, such as
CaMKII and Rap1, in IKs regulation. Previous studies have identified a role for
CaMKII in Ito downregulation in tachycardia remodeling of canine ventricular cardiomyocytes.243 Interestingly, in that work, like the present study, the primary signaling system involved was the Ca2+/calcineurin/NFAT system, but intact
CaMKII function was necessary for K+ current downregulation. CaMKII activation also suppresses delayed-rectifier K+ currents in neurons.247 Transgenic
CaMKIIδc overexpression reduces Kir2.1 expression and IK1 in mice.248 CaMKII expression is increased in calcineurin-transgenic mice; CaMKII-inhibitory drugs improve left ventricular function and prevent arrhythmias.249 Less is known about the role of Rap1 in cardiac electrophysiology. Rap1, along with PLC, participates in Ca2+-induced Ca2+-release after β-adrenergic stimulation and Epac
113
activation.152 It is possible that CaMKII and Rap1 contribute to Ca2+ liberation, which I found was essential for IKs downregulation. Prior studies have demonstrated a role for Rap1 and CaMKII in Epac-induced increases of murine
Ca2+-induced Ca2+ release, although intact PLC was also needed.152 Additional work will be needed to clarify the detailed molecular signaling associated with these molecules.
Novel Findings and Potential Significance
Our study is the first to define the mechanisms underlying IKs downregulation induced by chronic β-adrenergic stimulation. It is also the first to show a central role of Epac signaling in the control of K+ channel expression. Our findings may be relevant to the prevention of malignant arrhythmias in a variety of contexts. Sympatho-adrenergic activation is an important contributor to arrhythmic risk in patients with CHF,87 as well as in animal models.250 It may become possible to target Epac-mediated electric remodeling to prevent potentially lethal arrhythmic events. β-Adrenoceptor blockers are the mainstay of therapy to prevent arrhythmic events in long QT syndrome patients.251 Their protective action is reasonably attributed to the suppression of acute electrophysiological effects of adrenergic stimulation; however, they may also act to maintain repolarization reserve that might otherwise be suppressed by downregulation of IKs through chronically elevated background adrenergic tone.
114
The Epac system was described relatively recently,124 and our knowledge about its role in cardiac pathophysiology is rather limited.134,172 Our study is the first to implicate Epac in cardiac ion channel remodeling and to detail the associated signaling pathway. More work is needed to establish the role of Epac signaling in other aspects of cardiac electric remodeling.
One potentially interesting and novel aspect of the remodeling we observed was a change in the kinetics of IKs with chronic exposure to isoproterenol or agents that mimicked its signaling like 8-bromo-cAMP and 8- pCPT. All of these interventions accelerated current activation while reducing its density. The KCNE1 subunit is known to contribute importantly to the formation of
IKs channels, slowing activation and enhancing current density.252 The kinetic changes that we observed may therefore be caused by selective downregulation of KCNE1, with consequent changes in KCNE1:KCNQ1 stoichiometry.
Potential Limitations
I used an in vitro primary culture system of adult ventricular cardiomyocytes, with an animal system that, unlike mouse and rat models, has important delayed-rectifier K+ currents of the type important for human cardiac repolarization. The use of this in vitro system allowed the exploration of detailed mechanisms with probes not readily applicable in vivo. Changes in cardiomyocyte properties over time in culture are a potential problem, but we
115
established the stability of IKs density and associated subunits in culture. In addition, the density of IKs sometimes varied among different sets of cells. I therefore included internal controls (generally, cells cultured in vehicle and isoproterenol) for each set of experiments. Thus, each data set shown consists of simultaneously cultured/studied cells from each isolate. There are important differences in IKs properties among species.253,254 Caution is therefore needed in extrapolating our results to other species, especially humans.
I observed cellular hypertrophy after chronic isoproterenol exposure in terms of increased cell dimensions, but not capacitance. The discrepancy is likely related to the detubulation that occurs in cultured cardiomyocytes,255 which was exaggerated by isoproterenol and reduces the effective cell membrane surface area (Figure 2). Chronic in vivo isoproterenol stimulation (discussed further in
Chapter 3) produced similar changes in IKs and KCNE1 expression to those seen with in vitro treatment, despite no evidence of detubulation and a significant increase in cell capacitance.
116
2.5. Figure Legends
Table I. primer sequences.
Figure I. A: Schematic illustrating the adenoviral viral construct designed to knockdown Epac 1 expression in primary culture. CMV=cytomegalovirus promoter GFP=green fluorescent protein B: Complementary siRNA sequence that was used to knockdown Epac1 and corresponding guinea pig Epac1 mRNA sequence. C: Transmission and corresponding fluorescent mode images of adenovirus-infected ventricular cardiomyocytes.
Figure 1. Stability of IKs in cell culture. A: Mean ± SEM IKs density-voltage relations at baseline and after 30-hr culture in vehicle-control medium (CTL). B:
Mean ± SEM expression levels for KCNE1 protein following normalization to
GAPDH band intensities on the same lanes (n=3). C: Mean ± SEM expression levels for KCNQ1 protein normalized to GAPDH (n=3). Samples were obtained from membrane protein extracts. (N=number of independent experiments).
Figure 2. Effects of isoproterenol on cell size and T-tubule density. A, B: Cell size
(cell area, µm2) and cell capacitance (pF) for vehicle (CTL) and isoproterenol- treated cells. C: [3H]-leucine incorporation in cells incubated with vehicle (CTL) or
117
isoproterenol for 30 hours. D: Di-4-ANEPPS T-tubule staining in freshly isolated cardiomyocytes and 30-hour cultured cardiomyocytes in CTL and isoproterenol- containing conditions. E: The extent of T-tubule network within cardiomyocytes analyzed as percentage of the total membrane network (**P<0.01, ***P<0.001,
N=number of cells) F: Di-4-ANEPPS T-tubule staining in freshly isolated cardiomyocytes from CTL and isoproterenol-treated animals. G: The extent of T- tubule network within cardiomyocytes analyzed as percentage of the total membrane network (N= number of cells).
Figure 3. Effects of isoproterenol (Iso) on slow delayed-rectifier potassium current. A and B, Original recordings in cells incubated with control and isoproterenol-containing medium, respectively. Voltage protocol (4-s depolarizing pulses at 0.1 Hz, followed by 3 seconds at −30 mV to observe tail currents). C,
IKstep density–voltage relations for cells cultured in the presence of Iso or vehicle
(CTL). D, Tail current (IKTAIL) density–voltage relations.
Figure 4. Effects of in vitro isoproterenol treatment (for 30 hours) on IKs properties: A: IKSTEP normalized to maximum values in each cell. B: IKTAIL normalized to maximum value in each cell. Curves are fits to experimental data by Boltzmann function.*P<0.05, **P<0.01, ***P<0.001 vs CTL at the same test
118
potential (TP). (N=number of cells) C: Time constant (τ) of activation as determined with biexponential fits. Isoproterenol significantly accelerated the slow phase time constant. D: Results at + 60 mV.
Figure 5. Relationship between isoproterenol (Iso) effects and β-receptor subtype, cAMP and protein kinase A inhibitor peptide (PKI). Left, IKs recordings
(+50 mV) and right, mean ± SEM data; under vehicle-culture (CTL) and (A and B)
Iso, β1-adrenoceptor antagonist (CGP-201712A) and β2-adrenoceptor antagonist
(ICI-18551) (***P<0.001, Iso vs CTL; ###P<0.001, Iso + β1-blocker vs Iso-alone);
C and D: 8-bromo-cAMP (8-Br-cAMP) (***P<0.001, Iso vs CTL; ###P<0.001, 8-Br- cAMP vs CTL); E and F: forskolin, 8-Br-cAMP + PKI (***P<0.001, forskolin vs
CTL; ###P<0.001, 8-Br-cAMP + PKI vs CTL). G and H: PKI (***P<0.001, Iso vs
CTL; ##P<0.01, ###P<0.001, PKI + Iso vs CTL). Voltage protocol at top right.
Treatment duration for all drugs including isoproterenol was 30 hours. n indicates number of cells; TP, test potential.
I. A: Transmission mode image of ventricular guinea pig cardiomyocytes under
CTL, isoproterenol treatment and isoproterenol + CGP ( β 1-blocker). B. β 1- adrenergic receptor blockade prevented isoproterenol-induced increase in cell size. (***P<0.001) n= number of cells.
119
Figure 6. Acute PKA effect. A: IKs recordings for control cells and cells acutely perfused with 1-μmol/L isoproterenol, alone or along with PKI. B: Mean±SEM IKs density‒voltage relations for corresponding conditions. *P<0.05, ***P<0.001, versus control (CTL).
Figure 7. Effects of isoproterenol (Iso), exchange protein directly activated by cAMP (Epac) activation and Epac knockdown. A to E: In vitro studies. A: IKs recordings at +50 mV under vehicle-control (CTL), Iso, and 8-pCPT. B:
Mean ± SEM IKs density–voltage relations. C: IKs recordings for cells infected with scrambled construct (Scr + Iso)-virus, or Epac knockdown probe
(Epac1KD + Iso), and cells cultured in the presence of Iso. D: Mean ± SEM IKs density–voltage relations **P<0.01, ***P<0.001 vs CTL; ##P<0.01, ###P<0.001 vs
Iso-alone. E, Mean ± SEM IKs densities at +60 mV. **P<0.01, ***P<0.001 for comparison shown.
Figure 8. Epac expression and chronic β-adrenergic stimulation. A‒C. In vitro isoproterenol (30-hour exposure in culture) effect on Epac1 and 2 expression. A:
B: Mean ± SEM normalized results for Epac1 (N=11) and Epac2 (N=10) mRNA expression in vehicle (CTL) and isoproterenol-treated cells. C: Mean ± SEM,
Epac1/Epac2 ratio in CTL and isoproterenol-treated cells.
120
Figure 9. Mean ± SEM normalized results for Epac1 and Epac2 expression in the presence of GFP-carrying adenovirus in a bicistronic vector with a scrambled construct (Scr + Iso), GFP-carrying adenovirus in a bicistronic vector with an
Epac knockdown probe (KD + Iso), and Iso-alone (Iso). Cells were exposed to isoproterenol for 30 hours at the end of a 72-hour period virus-incubation period.
***P<0.001. C, D: Mean ± SEM normalized results for KCNE1 and KCNQ1 mRNA expression in the presence of Scr + isoproterenol, KD + isoproterenol and
Iso-alone. *P<0.05
Figure 10. A, B: Mean ± SEM normalized results for Epac1 and Epac2 mRNA expression in scrambled construct (Scr) and Scr + isoproterenol (Iso)-treated cells. Cells were exposed to isoproterenol or vehicle for 30 hours at the end of a
72-hour period virus-incubation period. *P<0.05.
Figure 11. Effects of intracellular Ca2+buffering and calcineurin inhibition. A: Left,
IKs recordings (at +50 mV) after culture in vehicle-control (CTL), isoproterenol
(Iso) or BAPTA-AM plus Iso (BAPTA-AM + Iso). Right: Corresponding mean ± SEM IKs density–voltage relations. B: IKs recordings at +50 mV after culture in CTL, Iso, and cyclosporine A plus Iso (Cyclo + Iso) media. Right:
121
Corresponding mean ± SEM IKs density–voltage relationship. *P<0.05,
***P<0.001 vs CTL. n indicates number of cells; TP, test potential.
Figure 12. Role of nuclear factor of activated T cells (NFAT) in isoproterenol effects. A: Immunolocalization of NFATc3 and NFATc4 in cardiomyocytes cultured in vehicle-control (CTL) or isoproterenol-containing (Iso) medium.
ToProIII was used to label nuclei. B: Mean ± SEM nuclear/cytosolic NFATc3 and
NFATc4 fluorescence-intensity ratios. *P<0.05, ***P<0.001 vs CTL. C,:
IKs recordings (at +50 mV) from cells cultured under CTL, Iso, and Iso + INCA6 (1
μmol/L) conditions. Voltage protocol as in Figure 1. D: Mean ± SEM IKs density– voltage relations in CTL, Iso, and inhibitor of NFAT-calcineurin association-6
(INCA6; 1 μmol/L) + Iso. *P<0.05, ***P<0.001 vs CTL. E and F: Mean ± SEM
KCNQ1 and KCNE1 mRNA expression in cells cultured with control-vehicle, isoproterenol-alone, and isoproterenol in the presence of INCA6 (1 or 5 μmol/L).
*P<0.05, ***P<0.001 for comparison shown (for E and F, number [n] of independent quantitative polymerase chain reaction analyses, each with RNA from cultured cells from two hearts). N indicates number of cells; TP, test potential.
122
Figure 13. Effects of Epac knockdown on isoproterenol-induced NFAT- localization changes. Immunolocalization of NFATc3 and NFATc4 viral gene- transfer cells in isoproterenol-cultured cardiomyocytes for scrambled (Scr + Iso) or Epac1 knockdown (KD + Iso) virus. Top: Representative images. Bottom:
Mean ± SEM ratios of nuclear/cytosolic NFATc3 (**P<0.01) and NFATc4
(*P<0.05) fluorescence-intensity ratios. N=number of cells. Because of the limited number of cells in each heart, the fact that cells were divided for different conditions, and the substantial death rate of cells in prolonged culture with viral infection, a very limited number of healthy surviving cells was available after immunostaining for each condition. I therefore analyzed only one cell per experiment, and the Ns shown are the number of experiments. Cells were exposed to isoproterenol for 30 hours at the end of a 72-hour period virus- incubation period.
Figure 14. KCNE1 expression changes. A and B: In vitro studies. A, Top: Crude membrane protein extracts and RNA extracts were obtained from cells cultured in control-vehicle (CTL) and isoproterenol medium (Iso). KCNE1 bands were seen on immunoblot at the expected molecular mass of ≈20 kDa. Bottom:
Mean ± SEM expression levels for KCNE1 protein relative to GAPDH bands on
123
the same lanes (*P<0.05), and mRNA expression (***P<0.001). B,
Immunostaining for KCNE1 and mean ± SEM membrane fluorescence-intensity.
Figure 15. Putative NFAT binding sites for KCNE1 promoter in guinea pig. 5000 bp-length sequence upstream of the transcription start site (in yellow highlight) of guinea pig KCNE1 promoter. Gene analyzed by MatInspector (Genomatix, www.genomatix.de).
Figure 16. Rap 1 and CaMKII regulate IKs. Left: IKs recordings (step to +50 mV) and Right: Mean ± SEM, IKs density‒voltage relations in cultured cells for: A, B:
CTL cardiomyocytes versus isoproterenol (1-μmol/L, 30-hr) treated cardiomyocytes versus GGTI + isoproterenol-treated cells. Rap1 inhibition prevented isoproterenol-induced decrease in IKs density. C, D: CTL cardiomyocytes versus isoproterenol-only versus U73122 + isoproterenol exposed cardiomyocytes. PLC inhibition did not prevent isoproterenol-induced decrease in IKs density. E, F: CTL cardiomyocytes versus isoproterenol-treated cells, isoproterenol + KN93-treated cells and isoproterenol + KN92-treated treated cells. All exposures were for 30 hours during culture. CaMKII inhibition prevented isoproterenol-mediated reduction in IKs density. *P<0.05, **P<0.01,
***P<0.001, versus control at same voltage (n= number of cells).
124
Figure 17. A: IKs recordings (step to +50 mV) and B: Mean ± SEM, IKs density‒ voltage relations in cultured cells treated with Rap1 inhibitor (GGTI) or CaMKII inhibitor (KN93), or vehicle, in the absence of adrenergic stimulation.
Figure 18. Schematic representation of the mechanisms involved in slow delayed-rectifier K+ current (IKs) downregulation by sustained β-adrenergic stimulation. Blockers (red) and activators (blue) were used to probe specific components of the pathway. 8-pCPT, Epac activator; AC, adenylyl cyclase;
BAPTA-AM, Ca2+ chelator; CaMKII, Ca2+/calmodulin-dependent protein kinase type II (blocked by KN93); CGP-20712A (β1-blocker);CN, calcineurin (blocked by cyclosporine A); Epac, exchange protein directly activated by cAMP; INCA6, inhibitor of NFAT-calcineurin Association-6; NFAT, nuclear factor of activated T cell; PKI, protein kinase A inhibitor peptide; and Rap1, Ras-related protein 1
(blocked by GGTI 298).
125
2.6. Tables and Figures
Table I.
Gene name: Primer sequence Gene Bank no/ID
RAPGEF3 For 5` GATGTGGAAGCGAAGACCAT ENSCPOG 00000006002 (Epac1) Rev 5` TCATGAGCACTGGAATCTGG
RAPGEF4 For 5` GAGCTGGTGGACTGGATGCT ENSCPOG 00000010605 (Epac2) Rev 5` TGGTTGAGGACACCGTCTTCT
KCNE1 For 5` TCGCACGACCCGTT NT_176273.1
Rev 5` TCAATGACGCAACACGATCTG
KCNQ1 For 5` TCAGGCGCATGCAGTACTTT NT_176377.1
Rev 5` GATTCGCACCATGAGGTTGA
HPRT1256 For 5` AGGTGTTTATCCCTCATGGACTAATT ENSCPOG00000002512
Rev 5` CCTCCCATCTCCTTCATCACAT
β-actin257 For 5` ACTCTCCACCTTCCAGCAGA NM_031144
Rev 5` AGGGTGTAACGCAGCAAAGT
GAPDH 258 For 5` TACGACAAGTCCCTCAAGATTG NT_176312.1
Rev 5` TCTGGGTGGCAGTGATGG
18S For 5` ACGGCTACCACATCCAAGGA NT_176398.1
Rev 5` CCAATTACAGGGCCTCGAAA
126
Figure I.
127
Figure 1.
128
Figure 2.
129
Figure 3.
130
Figure 4.
131
Figure 5.
132
Figure 5.
133
Figure 6.
134
Figure 7.
135
Figure 8.
136
Figure 9.
137
Figure 10.
138
Figure 11.
139
Figure 12.
140
Figure 13.
141
Figure 14.
142
Figure 15.
Predicted NFAT binding sites within the 5kb KCNE1 guinea pig promoter
-4749 GCTCAACTAT TTCAAGGAAA GAGACATTAT GGTAGCTACT GTTATATCAG NFAT binding site ……………………………………………………………………………………………………………………………………………… -4549 ATCAGGTGAT AAAACACTGT GGAAAGAAGA AGAGGTACTG AGAACAGGAG NFAT binding site ……………………………………………………………………………………………………………………………………………… -4299 TCGAATCTAG TATTTTGTAT TTTCACTTAA GTCAGAAACT CTTTCCTAAA NFAT binding site
-4249 ATGTTCTGGG TGCCGGAGTG GGGACAAAAG GTGAACAAGA GAATCTCTAA ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… -3499 CTGGAAGGCT CTGGTGGCCT CAGTTGGCTT ATTTCCTGAT AAGAGGTAAA NFAT binding site
-3449 TAGCATATGT GTCCAGAATT TGGACAGAGG GTTGTAAGAA AGATGAAAAC -3399 AACAGAGAAT TGCTTCCAAG ACAAACTGAC TCATCGGATT CTTGACTCAA -3349 TTAGGATCAT TCACCCAAAT TAAGCTTCTA CATAATTGGT TTTACCCTAG -3299 TGCTGTTTCC TAAAACAAAT AATGCCAAAT GATTTCAAGA CTGCATCTTT NFAT binding site ……………………………………………………………………………………………………………………………………………… -3099 GGCTGTGACC TGCCCATCGG CCCTGGCTGC CCCAGAATAT CCCCCTCCTG -3049 GAGGAAATCT GGGCATCAAC ACAAAAAGCC TTGCCCAGGC AGTAAGCACA NFAT binding site
-2999 TAAGGAAAGG CAAAAGTTGC CAGTGCTAGG AAAGCTGCTG TTTTGGAAGC NFAT binding site
-2949 TTCCGGGCTG TTATCAGTGC TGATAGGTGA GCCAACTGGA GCAGACACTA ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… ………………………………………………………………………………………………………………………………………………
-349 AGACATCTGA GAGCCATGGT CCACCAGGGG ACAGCCCACT CTAAAACCCT -299 ACAACCTCAA ATCCTTGGGC TACAATTTCT TAACTAGGTG GAAAAACCAA NFAT binding site
-249 TAAAGTCATC CTGGAACCAC AGAATGTGCG CCTGCTATGT CCTGTCTGCC -199 TGCAAGATCA GTGATATTGC CTATTCTCCA AAAAGGAAAT GACGCAGAAG -149 AGAAGGCTCA CTTCTGTCAC CTGGGCCTCT GTGCGTGTGT GTGTGTGTGT -99 GTGCGTGTGT GTGAGTGTGT GTGTGTGTGT GTGTGTGTGT GTGTGTGTGT
TSS (+1) -49 AATTTAGCCA ATGTGCACTT CTGATTTCAG GCTGCATCTT TCTTTTCGGC +2 AGCTTGCCTG GGACGTTCAC TCTCCCACCG TGGAAGCTTG CAGCCCAGGA +52 TGATCTTGCC TAATTCCACA GCTGTGATGC CCTTCCTGAC CACCGTGTGG Translation Start Site
+102 CAGGGGACAG TTCAACCCA
143
Figure 16.
144
Figure 17.
145
Figure 18.
146
Chapter 3
In vivo model of sustained β-adrenergic and Epac
stimulation in the guinea pig
Figures from this Chapter are published in Circulation Research
Exchange protein directly activated by cAMP mediates slow delayed-rectifier current remodeling by sustained β-adrenergic activation in guinea pig hearts. Aflaki M, Qi XY, Xiao L, Ordog B, Tadevosyan A, Luo X, Maguy A, Shi Y, Tardif JC, Nattel S. Circ Res. 2014 Mar 14;114(6):993-1003
For published paper and supplemental figures refer to Appendix
In Chapter 2, I demonstrated the involvement of Epac in regulating IKs through the activation of Ca2+/calcineurin/NFAT signaling pathway. To determine whether the in vitro observations are relevant to more complex and clinically relevant in vivo systems, I evaluated the role of chronic β-adrenergic and Epac stimulation in an in vivo guinea pig model. After consulting the literature, I developed a method to produce and study cardiac remodeling by sustained β- adrenergic stimulation in guinea pigs. I then followed this up with studies more specifically targeting the Epac system with a highly selective agonist administered via osmotic infusion pump.
147
3.1. Introduction
As discussed previously increased susceptibility to arrhythmias in HF has been linked to ventricular repolarization abnormalities, such as increased APD, impaired rate adaptation and abnormal spatial repolarization gradients.12
However, it is unclear how these changes are related to sustained β-adrenergic signaling in vivo. Previous models of chronic adrenergic stimulation have mainly focused on structural remodeling observed with either short-term (24 hr, 7 days or 14 days)259-262 or single high-dose isoproterenol injections.263,264 Most of these studies were performed in mice or rats where ventricular repolarization is different from that observed in the human heart. Table 1 shows a summary of the studies that have administrated isoproterenol in vivo.
To further understand the electrical remodeling associated with chronic β- adrenergic stimulation, I created two in vivo models of isoproterenol (13 weeks) and Epac stimulation (6 weeks) in the guinea pigs. As demonstrated previously in detail in Chapter 2, chronic stimulation of ventricular cardiomyocytes with isoproterenol decreases IKs density through an Epac-mediated pathway. There was a significant reduction in KCNE1 mRNA and protein, which significantly accelerated activation kinetics of IKs. Given the importance of IKs in repolarization, I looked at APD from freshly isolated cells from our in vivo models.
148
Table 1: Summary of animal studies that have administrated isoproterenol in vivo
Animal Amount and duration of Outcome Reference model exposure
Rat 150 mg/kg isoproterenol- LV dilation, hypertrophy, cardiomyocyte necrosis, 263
single dose injection increase in fibronectin and laminin expression, mild Grimm et al HF
Rat 1 mg/kg/day isoproterenol Hypertrophy, APD25 and APD75 prolongation in 265
injection -7 days subepicardial (Epi) cardiomyocytes Shipsey et al
Rat 170 mg/kg/day isoproterenol- QT interval prolongation, widening of QRS 266
2 injections 24 h apart complex, decreased cardiac output, interstitial Krandycheva et fibrosis al
Rat 5 mg/kg/day isoproterenol Hypertrophy, APD25 and APD95 prolongation, 267
injection- 7 days DADs Meszaros et al
Rat 85, 170, or 340 mg/kg/day Hypertrophy, LV dilation, dose-dependent diffuse 264
isoproterenol- 2 injections 24 myocardial necrosis Teerlink et al h apart
Rat 2.4 mg/day isoproterenol- Increased ANF, fibronectin and TGFβ1 expression, 268
osmotic minipump-26 days decreased SERCA gene expression Boluyt et al (1–26 days, time course)
Rat 5 mg/kg/day isoproterenol- Hypertrophy, fibrosis, decreased fatty acid and 261
osmotic minipumps- 7days glucose metabolism, systolic dysfunction Heather et al mouse 30 μg/g/day isoproterenol, iNOS upregulation, increased NO and myocardial 259
osmotic minipumps- 14 days apoptosis Hu et al mouse 5 mg/kg/day isoproterenol, Decreased conscious HR, hypertrophy, fibrosis, 269
daily injections- 12 weeks reduced EF Li et al mouse 15 mg/kg/day isoproterenol; Hypertrophy, interstitial fibrosis, reduced FS 262
osmotic minipumps-7 days Oudit et al
Guinea Final dose of 1 mg/kg Hypertrophy, LV dilatation, reduced FS, QT 270 pig isoproterenol-daily injections- prolongation, APD90 prolongation Soltysinska et 12 weeks al
EF, ejection fraction; FS, fractional shortening; HR, heart rhythm; iNOS, inducible nitric–oxide synthase
149
Additionally, the effect of sustained β-adrenergic and Epac stimulation on
IK1 and ICaL were assessed. The aim of this study was to further verify the results obtained in vitro.
3.2. Methods
In vivo Chronic β-Adrenergic Stimulation Model
Animal care and handling procedures complied with the guidelines established in the National Institutes of Health Guide for the Care and Use of Laboratory
Animals, and were approved by the ethics committee of the Montreal Heart
Institute. Male Hartley guinea pigs weighing 300‒350 g were acclimated to the new environment for a period of one week. Guinea pigs received daily i.p. injections of isoproterenol (Sigma, dissolved in 0.9% saline solution) for the treatment group and vehicle (0.9% saline solution) for the control group.
Isoproterenol was injected at an initial dose of 50 μg•kg-1/day and after the first week the dose was increased to 100 μg•kg-1/day and every week after it was increased by 100 μg•kg-1/day over 13 weeks, to a final dose of 1.4 mg•kg-1/day for the last week. On the last day, guinea pigs were anaesthetized with isoflurane
(2-3%) and subjected to echocardiography.
In vivo Chronic Epac Stimulation
Guinea pigs weighing 250‒300 g were anaesthetized with isoflurane and osmotic minipumps (model 2006, Alzet, Cupertino, CA) were implanted subcutaneously in
150
the neck. The minipumps were filled with sp-8-pCPT (Axxora, nonhydrolyzable form of 8-pCPT, dissolved in sterile water), and used to provide constant delivery at 16 μg/day over 6 weeks. Guinea pigs implanted with vehicle-filled minipumps
(water) were used as parallel controls.
Echocardiography
Transthoracic echocardiographic studies were performed in animals sedated with isoflurane at baseline 13 weeks after injection, using a phased-array probe 10S
(4.5-11.5 Megahertz) in a Vivid 7 dimension system (GE Healthcare Ultrasound,
Horten, Norway).
M-mode echocardiograms were used to measure left ventricular (LV) dimensions at both end cardiac diastole (LVDd) and systole (LVDs), LV fractional shortening
(FS) was calculated as (LVDd – LVDs) / LVDd X 100%, and LV ejection fraction
(EF) was obtained by the formula packed in Vivid 7 dimension system suggested by the American Society of Echocardiography. The thickness of the LV anterior wall and that of the LV posterior wall were also measured in LV M-mode spectrum; LV mass was calculated using formula suggested by Reffelmann et al for small animals.271 LV mass /body weight (BW), LVDd/BW, and LV mass/LVDd ratio were calculated to evaluate LV structural remodeling.
Pulsed-wave Doppler was used to study trans mitral flow (TMF), left lower and upper pulmonary venous flow (PVF), and trans aortic flow (TAF). Peak velocity in
151
early filling E wave, time interval from mitral valve (MV) closing to opening
(MVco) were measured in TMF. Velocity of systolic flow (S) and that of diastolic flow (D) were measured, and S/D ratio was calculated in PVF. LV ejection time
(ET) was measured in TAF. LV global myocardial performance index (MPI) was calculated as (MVco-LVET)/ LVET X 100%.
Mitral annulus movement was recorded by tissue Doppler imaging. Lateral and septal mitral annulus moving velocities in systole (S lateral, S septal), early and atrial diastole (e’, a’) were measured and time intervals from the end of a’ to the beginning of e’(b), and from the beginning to the end of S (a) were measured. LV regional MPI was calculated by (b-a) / a X 100%, and E/e’ was calculated for both lateral wall and septum.
Guinea Pig Ventricular Cardiomyocyte Isolation
Animal care and handling procedures complied with the guidelines established in the National Institutes of Health Guide for the Care and Use of Laboratory
Animals, and were approved by the ethics committee of the Montreal Heart
Institute. Guinea pigs with a final weight of ~1 kg (initial weight: 300‒350g) for isoproterenol group and ~700 g (initial weight: 250‒300g) for sp-8pCPT group were injected with heparin (1.0 units/kg) and anesthetized with a mixture of ketamine (75 mg/kg) and xylazine (15 mg/kg). With the loss of all reflexes the heart was quickly excised and transferred to ice-cold oxygenated Tyrode solution
152
(mmol/L: NaCl 136, KCl 5.4, MgCl2 1, HEPES 5, Na2H2PO4 0.33; pH adjusted to
7.35). The heart was retrogradely perfused via the aorta with 200-µmol/L Ca2+- containing Tyrode solution. When clear, the perfusate was changed to Ca2+-free
Tyrode solution and digested with the addition of 280-U/mg collagenase type II
(Worthington; 35 mg in 50 mL Tyrode solution) and 1% BSA (Bioshop). Cells were obtained by trituration and stored in KB solution containing (mmol/L): KCl
20, KH2PO4 10, glucose 10, mannitol 40, albumin 0.1%, L-glutamic acid 70, β- hydroxybutyric 10, taurine 20, EGTA 10; (pH 7.35). Cells were concentrated and allowed to settle by gravity. The pellet was kept for patch-clamp experiments.
Electrophysiology
Freshly isolated cells after in vivo treatment:
Cells were studied within 8 hours of isolation. To record K+ current, borosilicate glass electrodes were filled with pipette solution containing (mmol/L): GTP 0.1, K- aspartate 110, KCl 20, MgCl2 1, Mg2-ATP 5, HEPES 10, Na2-phosphocreatine 5, and EGTA 10; pH adjusted to 7.2 with KOH, and attached to a patch-clamp amplifier (Axopatch 200A). Electrodes had tip resistance of 2‒4 MΩ when filled.
Tight-seal whole-cell patch-clamp technique was used to record currents in voltage-clamp mode.
For IKs recording, the extracellular solution was modified to (mmol/L): N- methylglucamine (NMG) 140; KCl 5.4; MgCl2 1; glucose 5; HEPES 10 (pH 7.4,
153
HCl). Cardiomyocytes were placed in the bath and superfused with Tyrode solution containing 1-mmol/L Ca2+, CdCl2 (200-µmol/L, to inhibit L-type Ca2+ current) and dofetilide (1-µmol/L, to inhibit IKr).
To record IK1, ventricular cardiomyocytes were perfused with Tyrode solution containing 1-mmol/L Ca2+, CdCl2 (200-µmol/L, to inhibit L-type Ca2+-current) and dofetilide (1-µmol/L, to inhibit IKr). IK1 was defined on the basis of current sensitive to Ba2+ (1-mmol/L).
To record ICaL, the external solution contained (mmol/L): tetraethylammonium- chloride 136, CsCl 5.4, MgCl2 1, CaCl2 2, NaH2PO4 0.33, dextrose 10, and
HEPES 5 (pH 7.4, CsOH). Niflumic acid (50 μmol/L) and 4-aminopyridine (2- mmol/L) were added to inhibit Ca2+-dependent Cl- current and transient outward
K+ current respectively. The pipette solution contained (mmol/L) CsCl 120, tetraethylammonium-chloride 20, MgCl2 1, EGTA 10, MgATP 5, HEPES 10, and
Li-GTP 0.1 (pH 7.4, CsOH). Electrodes had tip resistance of 2–4 MΩ when filled.
The whole-cell perforated-patch technique was used to record APs in current- clamp mode. Junction potentials averaged 10.5 mV and were corrected for APs only. The pipette solution for AP recordings contained (mmol/L): GTP 0.1, K- aspartate 110, KCl 20, MgCl2 1, Mg2-ATP 5, HEPES 10, Na2-phosphocreatine 5, and low EGTA 0.005. The external solution contained (Tyrode solution: mmol/L:
154
1.8 CaCl2, NaCl 136, KCl 5.4, MgCl2 1, HEPES 5, Na2H2PO4 0.33; pH adjusted to 7.35).
Cell capacitance was 199 ± 11 pF for CTL and 252 ± 16 pF for in vivo isoproterenol-treated animals (P<0.05). Cell capacitance was 146 ± 9 pF for CTL and 180 ± 11 pF for in vivo sp-8p-CPT treated animals (P<0.05).
Protein Extraction:
Membrane protein fractions were isolated with extraction buffer containing: 25- mmol/L Tris-HCl (pH 7.34), 5-mmol/L EGTA, 5-mmol/L EDTA, 150-mmol/L NaCl,
0.2 mmol/L Na3VO4, 0.1 AEBSF, 20 mmol/L glycerol-2-phosphate, 10-µg/mL aprotinine, 10-µg/mL leuptenin, 1-µmol/L microcystin, and 1-µg/mL pepstatin (pH
7.4); followed by homogenization. After centrifugation at 3000 rpm and 4ºC for 10 minutes, the supernatant containing the cell membranes was centrifuged at
48,000 rpm for one hour. Membrane pellets were resuspended in extraction buffer supplemented with 1% Triton X-100 and stored at -20°C.
Immunoblots:
Protein concentration was determined with the Bradford method. Membrane protein (10-20 µg) was denatured and fractionated on 8% SDS-polyacrylamide gels, then proteins were transferred electrophoretically to Immobilon-P PVDF membranes (Millipore) in 25-mmol/L Tris-base, 192-mmol/L glycine and 20%- ethanol at 0.3 A for 1 hour. Membranes were blocked in PBS (mmol/L: 137 NaCl,
155
10 phosphate, 2.7 KCl; pH 7.4, NaOH) with 5% nonfat dry milk for 1 hour and incubated with primary antibodies (rabbit anti-KCNE1 1:1000, as kindly provided by Dr. Jacques Barhanin) overnight at 4°C. After washing and reblocking, membranes were incubated with donkey anti-rabbit (1:10,000, Jackson
Immunolabs) secondary antibodies. Antibody was detected with Western-
Lightning Chemiluminescence Reagent Plus 3 (Perkin-Elmer Life Sciences).
Later, the same membranes were also probed with anti-GAPDH at room temperature for 1 hour in order to control for equal protein loading. Secondary antibody was horseradish peroxidase-conjugated goat anti-mouse IgG (1:10,000,
Jackson Immunolabs).
Data Analysis
Clampfit 9.2 (Axon) and GraphPad Prism 5.01 were used for data analysis.
Group comparisons were performed with unpaired Student t-tests (for single comparisons between two groups) or one-way ANOVA with Bonferroni-corrected t-tests (for multiple-group comparisons). Patch-clamp data were analyzed with two-way ANOVA and Bonferroni-corrected t-tests. A two-tailed P<0.05 indicated statistical significance. Data are expressed as mean ± SEM.
156
3.3. Results
Sustained beta adrenergic stimulation induces structural and ionic current remodeling in the ventricles
After creating the chronic in vivo β-adrenergic stimulation model; guinea pigs that had received i.p. injections of isoproterenol for 13 weeks were subjected to echocardiography to assess structural and functional changes in the heart.
Chronic isoproterenol stimulation increased LV diameter (wall thickness),
LV mass and LV mass/BW ratio, indicating cardiac hypertrophy (Table I).
Echocardiography showed significant impairments in LV ejection fraction (EF) and fractional shortening ([FS], Table II). EF refers to the percentage of blood that is pumped out of the ventricles following each contraction and FS is an estimate of cardiac contractility. These indices are used to measure systolic performance.
Figure 1A and 1B shows representative IKs recordings from control and isoproterenol-treated animals. IKs density was significantly reduced, by ≈65%
(Figure 1C and 1D). In vivo isoproterenol administration did not alter IKs voltage dependence (Figure 2A and 2B) but significantly accelerated IKs activation
(Figure 2C and 2D), similar to the effect observed in vitro. Of note, in vivo isoproterenol administration did not cause detubulation (Figure 2F and 2G
Chapter 2). APD was significantly increased in isoproterenol-treated animals
157
(Figure 1E and 1F). The expression of both Epac1 and Epac2 mRNA was increased (Figure 3A and 3B), but the increase in Epac2 was larger than Epac1, decreasing the Epac1/Epac2 expression ratio (Figure 3F).
Sustained Epac stimulation induces ionic current remodeling in the ventricles
In vivo administration of the Epac activator sp-8-pCPT via osmotic minipumps for 6 weeks decreased IKs by ≈64%, reproducing the effect of isoproterenol (Figure 4A and 4B). APD was significantly prolonged in sp-8-pCPT– treated animals (Figure 4C). I then proceeded to evaluate KCNE1 expression from ventricular cells obtained from isoproterenol and sp-8-pCPT treated guinea pigs. Protein expression levels are shown in immunoblots in Figure 5A and B.
KCNE1 protein and mRNA expression were significantly decreased after in vivo isoproterenol administration (Figure 5C). Similar changes were seen with in vivo sp-8-pCPT infusion (Figure 5D).
In vivo isoproterenol treatment also remodeled other ionic currents, reducing ICaL density by ≈45% and IK1 by ≈47% (Figure 6). Representative ICaL
current recordings are shown in Figure 6A and representative current recordings for IK1 are shown in Figure 6C. As was the case for isoproterenol, ICaL and IK1 were reduced (by ≈30% each) in sp-8-pCPT–treated animals (Figure 7). Sp-8- pCPT treatment also significantly increased heart weight/ body weight ratio and capacitance (Figure 7A and 7B) indicating cardiac hypertrophy. APs were not
158
recorded in vitro due to significant downregulation of inward rectifier potassium channels.
3.4. Discussion
Chronic sympathetic stimulation has been shown to significantly deteriorate cardiac function and induce detrimental structural and contractile changes.263,272 Previous studies have mainly looked at the effect of chronic β- adrenergic stimulation in rodents. Rodents have shorter APD (triangular shape) than larger mammals due to their extremely faster heart rates. Ito is the major repolarizing current in these species and the contribution of IK and IK1 remains subtle.235 The guinea pig ventricular AP is more similar to humans and therefore studying repolarization abnormalities in this model will likely be more useful in unraveling the underlying mechanisms. In this study, I found that both sustained
β-adrenergic stimulation and Epac stimulation decrease IKs density and prolong
APD. This was followed by a reduction in KCNE1 mRNA and protein. The importance of K+ channel remodeling and relationship to previous studies has been discussed in Chapter 2.
The electrophysiological consequences of background adrenergic tone in vivo reflect the chronic ion channel remodeling effects plus any additional changes because of ongoing (acute) adrenergic signaling. The ion channel remodeling we observed affected adrenergically enhanced outward K+ current
159
(60% decrease in IKs) more than inward Ca2+ current (45% reduction). Thus, any acute adrenergic effects would be expected to increase inward current more than outward and to further delay repolarization. Additional work is needed to define the mechanisms of adrenergic regulation of ion channels other than IKs, to determine the systems effects of chronically elevated adrenergic tone in vivo and to assess their specific role in disease-state paradigms like CHF.
I performed in vivo experiments to determine whether the phenomena I observed under cell culture conditions in vitro also pertain to the effects of sustained β-adrenergic stimulation in vivo. I based our in vivo study conditions for isoproterenol on previous studies in the guinea pig, which showed that significant changes in cardiac structure/function/electrophysiology required 3 months of incremental i.p. therapy.270 In the same study, Solltysinka et al. demonstrated that administration of isoproterenol via osmotic minipumps causes substantial β- adrenergic receptor desensitization and does not lead to significant cardiomyopathy.270 I based the Epac regimen on prior studies in rats, which used continuous infusion for 4 weeks,154 but I increased the duration of therapy to 6 weeks, the maximum duration possible with our osmotic minipumps, because of anticipated potential species differences. In view of differences in exposure period and dose, etc, the different series I performed can only be compared qualitatively: in vivo isoproterenol and sp-8-pCPT produced similar effects to
160
each other, with changes consistent with our in vitro observations. The in vitro model allowed us to perform extensive detailed mechanistic studies that could not be practically executed in vivo, whereas the in vivo studies allowed us to confirm that the phenomena I observed in vitro are similar to in vivo conditions. I used sp-8-pCPT as an Epac-selective agonist, as have many prior studies,152,154,156-158,169,172,176,179,227,239 but sp-8-pCPT products can have effects on other signaling systems.140 I confirmed the role of Epac signaling in vitro with adenoviral-mediated knockdown; however, we were unable to apply gene knockdown in vivo; this is a potential limitation that should be considered in interpreting our results.
161
3.5. Figure Legends
Figure 1. Sustained β-adrenergic stimulation decreases IKs. A and B: Original recordings from control and isoproterenol-treated animals, respectively. C: IKSTEP density–voltage relations in freshly isolated ventricular cardiomyocytes from isoproterenol-treated and CTL animals. D: Tail current (IKTAIL) density–voltage relations. E: Representative AP recordings (1 Hz) from guinea pigs treated with isoproterenol and CTL animals. F: AP duration (APD) at 50% (APD50) and 90%
(APD90) repolarization. **P<0.01, ***P<0.001 vs CTL at the same test potential
(TP). Group data are mean ± SEM. n indicates number of cells.
Figure 2. Effects of in vivo isoproterenol treatment (progressively increasing doses over 13 weeks) on IKs properties. A: IKSTEP normalized to maximum values in each cell. B: IKTAIL normalized to maximum value in each cell. Curves are fits to experimental data by Boltzmann function. C: Time constant (τ) of activation as determined with biexponential fits. Isoproterenol significantly accelerated the slow phase time constant. D: Results at +60 mV, *P<0.05, **P<0.01, ***P<0.001
(N=number of cells).
Figure 3. A–C. In vivo isoproterenol effect (progressively increasing doses over
13 weeks) on Epac1 and Epac2 expression. A, B: Mean ± SEM normalized
162
results for Epac1 and Epac2 mRNA expression in CTL (N=5) and isoproterenol
(N=7) treated animals. C: Mean ± SEM, Epac1/Epac2 ratio in CTL and isoproterenol-treated cells
Figure 4. Effects of in vivo administration on IKs and APD. A: IKs recordings from animals treated with sp-8-pCPT and vehicle (CTL). B: Mean ± SEM tail current
(IKTAIL) density–voltage relations. C: Representative AP recordings (1 Hz) from sp-8-pCPT–treated animals and CTL (left); APD at 50% (APD50) and 90%
(APD90) repolarization (right). n indicates number of cells; TP, test potential.
Figure 5. Isoproterenol and Epac in vivo effects on KCNE1. A: Top, Immunoblots for membrane KCNE1 protein in cardiomyocytes from animals treated with isoproterenol or vehicle (CTL). Bottom, Left, Mean ± SEM protein expression levels (*P<0.05); right, mRNA expression. B: Top, Immunoblots for membrane
KCNE1 protein for animals treated with sp-8-pCPT or vehicle. Bottom, Left,
Mean ± SEM protein expression levels; Right, mRNA expression (*P<0.05,
***P<0.001). N indicates numbers of independent experiments, each from one heart.
163
Figure 6. Effects of in vivo isoproterenol administration (progressively increasing doses over 13 weeks) on cellular electrophysiological properties. A:
Representative ICaL recordings from CTL and isoproterenol-treated animals. B:
Mean ± SEM ICaL density *P<0.05, **P<0.01, ***P<0.001 (n=number of cells) C:
Representative IK1 recordings from CTL and isoproterenol-treated animals D:
Mean ± SEM IK1 density–voltage relations, recorded as Ba2+-sensitive current, with ramp protocol in insert. Please note different scales for CTL versus Iso recordings in C. *P<0.05, **P<0.01, ***P<0.001 (n=number of cells).
Figure 7. Effects of in vivo sp-8-pCPT administration on cellular electrophysiological properties. Guinea pigs were treated with 16 μg/day sp-8- pCPT or vehicle for 6 weeks, after which cardiomyocytes were isolated and subjected to patch-clamp study. A: cell capacitance in CTL and sp-8-pCPT condition (pF) (*P<0.05, n=number of cells). B: HW/BW ratio in CTL and sp-8- pCPT treated animals (n=number of animals). C: Representative ICaL recordings from CTL and sp-8-pCPT treated animals. D: Mean ± SEM ICaL density, *P<0.05.
E: Representative IK1 recordings from CTL and sp-8-pCPT treated animals, recorded as Ba2+-sensitive current, with ramp protocol in insert. F: Mean ± SEM
IK1 density–voltage relations *P<0.05, ***P<0.001 (n=number of cells).
164
Table I. General and Echocardiographic Indices of Left Ventricular Structural
Remodeling
Table II. Echocardiographic Indices of Left Ventricular Systolic Function
Table III. Echocardiographic Indices of Left Ventricular Diastolic Function
Table IV. Echocardiographic Indices of Left Ventricular Myocardial Performance
165
3.6. Figures and Tables
Figure 1.
166
Figure 2.
167
Figure 3.
168
Figure 4.
169
Figure 5.
170
Figure 6.
171
Figure 7.
172
Table I.
173
Table II.
174
Table III.
175
Table IV.
176
Chapter 4
Epac and adrenergic effect on fibroblasts
In Chapter 2 and Chapter 3, I demonstrated the importance of Epac signaling in ventricular ionic current remodeling. Increased Epac expression in guinea pig ventricular cardiomyocytes significantly decreased IKs (in vivo and in vitro), creating a potentially arrhythmogenic substrate. Next, I sought to investigate the potential role of Epac proteins in regulating atrial fibroblast function. I studied atrial fibroblasts isolated from a VTP-induced HF model that produces atrial fibrosis and an AF substrate in dogs. Prior studies had indicated the involvement of Epac signaling in ECM regulation in fibroblasts.214 I first looked at the effect of HF on Epac expression in atrial fibroblasts. Then, with the use of an in vitro culture system of atrial fibroblasts, I investigated the effects of sustained adrenergic signaling on fibroblast Epac expression and sought to determine the potential role of adrenergic receptors in altering collagen expression through Epac signaling.
177
4.1. Introduction
After extensive studies on the role of Epac proteins in cardiomyocytes, we focused our attention on the consequence of changes in Epac expression in fibroblasts (FBs). Cardiac FBs play an important role in adverse remodeling in the heart in many conditions, such as hypertension, myocardial infarction, and
HF.186 They play a particularly important role in AF, in which FB-driven fibrosis contributes importantly to the proarrhythmic substrate.2
Increased adrenergic drive, as seen in HF, not only leads to detrimental arrhythmogenic ionic remodeling in cardiomyocytes but also influences FB behavior and function. This effect is mediated through the activation of α- and β- adrenergic receptors. FBs express β 2, β 1 (low expression), β 3 and the α- adrenergic receptor family.183,273,274 FBs express functional GPCRs that are coupled to Gq or Gs, with little or no coupling to Gi. 275
Previous studies have shown that isoproterenol injection to create a rat model of myocardial injury increases α-smooth muscle actin expression in FBs, with increased numbers of myofibroblasts at the border of the injury site.276
Increased α-smooth muscle actin expression is an indicator of FB transformation to myofibroblasts, which are much more active than FBs in secreting collagen and producing fibrosis.2 In vivo isoproterenol injection increases FB proliferation277 and in vitro isoproterenol treatment indicates that proliferation is
178
mediated through the β 2-adrenergic pathway.183 Prolonged activation of FBs induces fibroblast to myofibroblast transformation, enhancing proliferation, migration, and ECM synthesis; all of which contribute to adverse remodeling. The observation that β-blockers reduce fibrosis in HF animal models initially was interpreted as indicating that increased β-adrenergic stimulation directly leads to increased ECM deposition by FBs.278,279 However, in vitro studies indicate that β- adrenergic stimulation can actually decrease collagen synthesis in adult rat
FBs.280-282 Epac proteins are also expressed in FBs. It was previously shown that increased Epac1 expression decreases collagens Iα1, IIIα1, and Iα2 mRNA, effects that had previously been attributed to increased PKA activity.214
Profibrotic factors that are increased during disease, such as TGFβ1 and AngII, can decrease Epac1 expression (but not Epac 2) both in vitro and at injury sites in the ventricles following myocardial infarction.214 This work emphasizes the importance of Epac in the regulation of cardiac fibrosis. In this study, I examined
Epac1 expression in a canine model of HF that induces a fibrotic atrial substrate for AF,186 and looked at the effect of sustained adrenergic signaling on Epac and
ECM gene expression.
179
4.2. Methods
Canine Model
All animal handling procedures were approved by the Animals Research Ethics
Committee of the Montreal Heart Institute and followed National Institute of
Health Guidelines. Dogs with VTP-induced CHF were prepared as previously described.283 In brief, adult mongrel dogs (weight 22–36kg) were divided into four experimental groups of control (CTL), 24-hr VTP, 1-week VTP and 2-week VTP.
CHF dogs were anaesthetized with diazepam (0.25 mg/kg i.v.)/ketamine (5.0 mg/kg i.v.)/halothane (1%–2%) for unipolar lead implantation. The ventricles were then paced at 240 bpm for the times indicated. Following the preparation period, dogs were anesthetized with morphine (2 mg/kg) and alpha-chloralose (120 mg/kg).
The heart was excised by median thoracotomy and placed in oxygenated Tyrode solution containing 2-mmol/L Ca2+ (as described in Chapter 2) for further cell isolation.
Fibroblast and Cardiomyocyte Isolation
After dissection of the atrial tissue the left circumflex coronary artery was perfused with oxygen-saturated 2-mmol/L Tyrode solution (37ºC). When the effluent was clear, the tissue was perfused with Ca2+-free Tyrode solution (~
180
10 min) and then with Ca2+-free Tyrode solution containing collagenase type II
(150 U/mL, Worthington) and 1% BSA.284 Once the tissue was well digested and softened, cells were harvested by gentle trituration. To separate cardiomyocytes from fibroblasts, tissue debris was first removed by filtration (500-µm nanomesh), then centrifuged at 800 rpm for 5 min to remove cardiomyocytes. This was followed by centrifugation at 2,000 rpm for 10 min to pellet fibroblasts. The supernatant was thoroughly removed after centrifugation. Trizol (500 µL) was added to the pellet of cardiomyocytes and fibroblasts separately. Samples were snap-frozen using liquid nitrogen and stored at -80 ºC to be used for further experimentation (RNA extraction). For experiments involving fibroblast culture, the supernatant was removed after the centrifugation step (2,000 rpm) and the same process was repeated two more times to remove debris. The pellet was then resuspended in Dulbecco's Modified Eagle's medium (DMEM) medium
(Invitrogen) supplemented with 10% fetal bovine serum (GIBCO) and 1% penicillin-streptomycin for fibroblast culture.
Fibroblast Culture and Drug Treatment
Left atrial fibroblasts resuspended in DMEM with 10% FBS and 1% penicillin– streptomycin were plated in T-25 flasks to reach confluence (5–7 days) in the incubator (5% CO2/95%-humidified air at 37 C). Subsequently, the cells were
181
trypsinized, counted, and plated in 12-well plates at 100,000 cells/well. After 24 hours to allow fibroblasts to adhere to the plates, the cell culture medium was removed and fibroblasts were serum starved for 24 hours with DMEM medium containing 1% penicillin–streptomycin. Following serum starvation, fibroblasts were treated with various drugs and vehicle for 48 hours in 0% serum – supplemented DMEM. The following drugs were used in various experiments and were added to the cell culture medium: 8pCPT (33-µmol/L, Sigma), isoproterenol
(10-µmol/L, Sigma), inhibitor of Smad3 (SIS3, 1-and 3-µM, Santa Cruz
Biotechnology), (norepinephrine 1- and10-µM, Sigma), CGP-20712A (2-µmol/L,
Sigma), ICI-118551 (2-µmol/L, Sigma), salbutamol (10-µM, Sigma) TGFβ1 (10- ng/mL, Sigma). Fibroblasts were pretreated with SIS3 inhibitor for one hour before the addition of TGFβ1.285
The cell culture medium was removed at the end of drug treatment period.
Samples were collected in Trizol and frozen in liquid nitrogen for RNA extraction.
RNA Extraction and qPCR
RNA extraction was performed with Trizol according to the manufacturer’s protocol (Ambion Life Technologies). At the last stage, RNA was resuspended in nuclease free water and RNA content was measured by nanodrop. cDNA was synthesized from 500-ng to 1-µg RNA via the High Capacity cDNA Reverse
182
Transcription Kit (Applied Biosystems Foster City, CA). qPCR was performed with custom made SYBR Green primers for Epac1 and Epac2 primers and
TaqMan probes for ECM genes (collagens Iα1, Iα2, IIIα1, and fibronectin) and internal control genes (HPRT and B2M). Each gene was detected in duplicate and the delta CT method was used for analysis. The sequence for the primers
(Applied Biosystems) used can be found in Table I.
Data Analysis
Group comparisons were performed with unpaired Student t-tests (for single comparisons between two groups), one-way ANOVA with Bonferroni-corrected t- tests (for multiple-group comparisons), or Dunnett’s multiple comparison test for the in vivo VTP time course.
183
4.3. Results
Epac expression differences in cardiomyocytes versus fibroblasts from HF dogs
Figure 1 shows Epac1 expression in fibroblasts and cardiomyocytes. In fibroblasts, Epac1 expression is significantly decreased in the atrial cells at all time points studied (Figure 1A). However, Epac1 expression does not change in ventricular fibroblasts (Figure 1B). The difference may be due to the more responsive nature of atrial fibroblasts to profibrotic stimuli. Conversely, in cardiomyocytes, Epac1 expression increased significantly after 2 weeks (Figure
1C) in the atrium and increase after 24-hr VTP (Figure 1D) in the ventricles.
Epac Regulates Collagen Expression in Canine Fibroblasts in Vitro
I then investigated the effect of Epac stimulation on collagen expression in vitro. Epac stimulation via 8-pCPT (33-µM) in canine atrial fibroblasts significantly decreased collagen Iα1 (Figure 2A) and collagen IIIα 1 (Figure 2B) expression, thus indicating the ability of Epac1 to regulate collagen expression. Collagen Iα2 also appeared to be affected (Figure 2C), but the decrease was not statistically significant. Fibronectin was not affected (Figure 2D).
TGF β1 and Norepinephrine Decrease Epac1 Expression
TGFβ1 is a powerful cytokine that is an important mediator of fibrosis both in the kidneys and the heart.186,286,287 Figure 3A shows a significant reduction in
Epac1 expression in atrial FBs cultured in the presence of 10-ng/mL TGFβ1 for a
184
48-hour period. In contrast, 8-pCPT at 33-µM significantly increased Epac1 expression. Smad3 is a mediator of TFGβ1 signaling in many systems. Smad3 inhibition with a Smad3 blocker (SIS3) prevented the TGFβ1 mediated decrease in Epac1 expression (Figure 3B). These data indicate the involvement of Smad3 in the downstream signaling mechanisms in Epac1 regulation.
I next investigated the effect of norepinephrine on Epac1 expression in atrial FBs. Previous studies have shown that intravenous norepinephrine injections to rats increased collagen gene expression.288 In canine atrial fibroblasts, sustained norepinephrine exposure significantly decreased Epac1 expression (Figure 3C).
Isoproterenol Regulates Collagen Expression Through β2-adrenergic Receptors in Fibroblasts.
Norephinephrine stimulates both α- and β-adrenergic receptors. To look at the effect of α- versus β-adrenergic receptors more specifically, I used various adrenergic receptor blockers and activators. Concomitant treatment of atrial FBs with norepinephrine and α -adrenergic receptor blocker prazosin prevented norepinephrine induced decrease in Epac1 expression (4A). Isoproterenol (β- adrenergic agonist) significantly increased Epac1 expression (4B), with no change in Epac2 expression (Figure 4C). Salbutamol a β 2-receptor agonist similarly increased Epac1 expression. Concomitant treatment of FBs with
185
isoproterenol and β 2-receptor blocker, ICI-118551 prevented the increase in
Epac1 expression (Figure 4B). Isoproterenol treatment significantly decreased collagen I α 1 expression (Figure 5A). The decrease was mimicked by salbutamol, prevented by ICI-118551, and not affected by the β 1-adrenergic receptor blocker CGP-20712A.
These data indicate that isoproterenol effects to reduce collagen expression are mediated through β2-adrenergic receptors in FBs.
4.4. Discussion
I show here for the first time that Epac1 expression is significantly decreased in atrial FBs in a canine model of HF-associated AF-promoting atrial fibrosis. I also found that Epac1 stimulation suppresses atrial FB collagen expression, implicating HF-induced Epac downregulation as a potential contributor to the profibrotic response. TGFβ1 expression increases in the atria of VTP dogs.195 My finding that Epac1 expression was decreased by TGFβ1 in atrial FBs through the
Smad3 signaling pathway suggests that Epac1 may be acting as a mediator of the TGFβ1 profibrotic response in this model. In addition, norepinephrine plasma and myocardial concentrations increase in HF,87 so norepinephrine induced reductions in Epac1 expression may also contribute to profibrotic responses.
Figure 3D summarizes the potential signaling pathways suggested by the data in
Figure 3A-C. In contrast to the effects of norepinephrine, isoproterenol increased
186
Epac1 expression, pointing to complex receptor subtype-dependent adrenergic effects on Epac1 signaling. Figure 4C summarizes the possible receptor subtype- specific mediation of adrenergic effects on Epac. Isoproterenol acts via β1- and β
2-adrenergic receptors. Our results regarding isoproterenol effects on collagen synthesis (Figure 5) suggest that the compound’s action to enhance Epac1 expression (Figure 4B) is mediated via β2-adrenergic receptors. Norepinephrine’s effect to suppress Epac1 expression is mediated via α -adrenergic receptors. In addition, the effect of norepinephrine on collagen expression in FBs remains to be confirmed—an increase would be expected based on its ability to decrease
Epac expression. Furthermore, these data emphasize the differences in Epac1 signaling in FBs versus cardiomyocytes. In cardiomyocytes isoproterenol enhances Epac signaling via β 1-adrenergic receptors; in FBs isoproterenol suppresses Epac expression, via β2-adrenergic receptors. cAMP/ Epac Signaling and Collagen Expression
cAMP signaling is an important regulator of FB function. Increased cAMP signaling prevents FB to myofibroblast transformation.289 Numerous studies have shown antifibrotic effects of cAMP signaling in a wide range of tissues.217
However, the mechanisms that lead to these changes are currently not well known. PKA, the classic effector of cAMP signaling, inhibits collagen synthesis,214,217,290 with Epac showing similar effects on ECM gene expression in
187
my work. Our data are consistent with previous studies demonstrating that Epac activation decreases collagen expression in the heart.214,215 PKA and Epac have opposing actions on fibroblast migration. PKA inhibits migration and Epac promotes migration through Rap1. This process is necessary for the entry of FBs to the sites of tissue injury.214 The identification of Epac as a novel contributor to regulation of collagen synthesis and functional activities of FBs may provide an additional strategy to combat fibrosis.
Regulation of Epac Expression by Profibrotic Stimuli
Profibrotic stimuli such as TGFβ1 and norepinephrine decreased Epac1 expression in atrial FBs in vitro. Further investigation is required to elucidate the mechanisms that cause a reduction in Epac1 expression following norepinephrine/TGFβ1 administration. It is interesting to note that norepinephrine treatment in neonatal rat cardiomyocytes increases TGFβ1 and TGFβ2 secretion by up to three fold.291 Additionally, norepinephrine potentiates the effect of TGFβ
1, and further increases FB proliferation and ECM expression in neonatal rat
FBs.292 In cardiomyocytes, the induction of TGF β 1 was dependent on α - adrenergic receptors.293 Paracrine stimulation of cardiac FBs with TGF β 1 originating in cardiomyocytes could potentially be decreasing Epac1 expression. It would be interesting to determine whether norepinephrine increases TGFβ1 expression in atrial FBs and whether Smad3 inhibition blocks
188
norepinephrine effects on Epac1 expression—these findings would point to TGFβ
1 as a mediator of norephinephrine’s actions. On the other hand, isoproterenol treatment has been shown to decrease TGFβ1 signaling and inhibit Smad- mediated recruitment of transcription factors.281 Furthermore, isoproterenol signaling through β 2-adrenergic receptors and Epac (independent of PKA) increases IL-6 production in neonatal rat mouse fibroblasts.216 IL-6 is a proinflammatory cytokine that can induce fibroblast proliferation, decrease collagen synthesis, and increase ECM degradation. These findings are consistent with our data that show increased Epac1 expression and decrease in collagen Iα1 mRNA levels in FBs treated with isoproterenol.
Smad3 plays a critical role in mediating fibrosis. Smad3 knock out mice show a 60% decrease in myocardial fibrosis due to pressure overload.294
Disruption of TGFβ signaling in Smad3-null mice also provides protection against renal fibrosis.295 Loss of Smad3 diminishes recruitment of inflammatory cells to injury sites (chemotaxis) and attenuates TGFβ autoinduction.296 High levels of
TGF β recruit FBs, which produce further TGF β production that increases collagen production. Numerous studies using animal models of fibrosis report that loss of Smad3 diminishes the fibrotic response and that most of the profibrotic activities of TGFβ are mediated through Smad3.297 In this Chapter I demonstrated that TGFβ induced Epac1 expression changes are regulated
189
through Smad3 in FBs, providing novel potential insights into the mechanisms by which Smad3 contributes to pathological fibrosis.
β2-Adrenergic Receptor Signaling in Fibroblasts
β 2-Adrenergic receptors play a major role in mediating the effects of catecholamines on FBs. β2-Adrenergic receptors are involved in many processes in FBs, such as proliferation (many species),274 autophagy,298 cytokine secretion, and growth factor secretion.183 Epac activation is involved in IL6 production,216 and collagen synthesis regulation214,215 in FBs. Our results indicate that the antifibrotic effects of isoproterenol may be mediated through β 2-adrenergic receptor-mediated Epac activation. This is in accordance with the predominant activity of β2 receptors in FBs compared to β1 receptors in cardiomyocytes.
Considerations of the Model
In the clinical setting, HF and AF often occur together. The structural changes that occur in HF, such as increased fibrosis and dilated cardiomyopathy create a substrate for promotion and maintenance of AF. The VTP model mimics these conditions in vivo and creates local conduction abnormalities as a result of increased atrial fibrosis.299,300 Although there are no changes in APD, there is significant ion channel remodeling with decreased Ito, ICaL, IKs, and NCX.232
Tachypacing (240 bpm) leads to tachycardiomyopathy, which induces structural remodeling (increased collagen and fibronectin expression) that occur early and
190
is not reversible.120,195,301,302 However, ion channel changes tend to recover once pacing is stopped and animals are allowed to recover. AF susceptibility parallels fibrosis and not ion channel changes.120 The use of this model allowed me to evaluate signaling mechanisms of potential clinical significance. However, the model is complex and even if Epac signaling is involved in the fibrotic response, it is likely only one of a number of factors that play a role. In addition, while the model is widely used and relevant to AF pathophysiology, it does not mimic many clinical contexts in which AF occurs and the results need to be extrapolated with great caution.
Limitations of This Study
Further in vitro experiments are required to delineate the signaling pathway that regulates Epac and collagen expression via norepinephrine and isoproterenol stimulation. It would be helpful to measure norepinephrine in the plasma or atrial tissue of VTP dogs to relate the levels with the progression of the disease.
Adenoviral-mediated knockdown of Epac1 would be very helpful to determine the specific role of Epac1 in regulating collagen expression in culture.
Simultaneous Epac 1 knock-down and isoproterenol stimulation would provide additional information regarding the mediation of antifbrotic actions of increased cAMP signaling in FBs. To directly assess the role of Epac1 in regulating
191
collagen expression in an animal model, additional in vivo experiments would be required. For example, adenoviral mediated overexpression of Epac1 in HF dog atria or TGFβ1 overexpressing mice would provide additional insight into the role of decreased Epac1 expression in mediating AF-promoting profibrotic effects on the heart.
192
4.5. Figure legends
Table 1. List of TaqMan probes and SYBR Green primers
Figure 1. Epac1 expression during VTP time course. A: Epac1 expression in atrial FBs during VTP time course at 12-hr, 24-hr, 1-week, and 2-week VTP.
Epac1 expression is significantly decreased at all time points (***P<0.001,
**P<0.01, *P<0.05) B: Epac1 expression in ventricular FBs during VTP time course. C. Epac1 expression is significantly increased in atrial cardiomyocytes at the 2-week VTP time point (*P<0.05). D: Epac1 expression is significantly increased in ventricular cardiomyocytes at the 24-hr VTP time point (*P<0.05).
N= number of dogs
Figure 2. Epac activation via 8-pCPT decreases collagen expression in atrial FB culture. Cells were incubated with 8-pCPT for 48 hours in 0% serum following 24 hr serum starvation. A: Collagen Iα1 decreased significantly following treatment with 33-µM 8-pCPT (*P<0.05). B: Collagen IIIα1 decreased significantly following treatment with 33-µM 8-pCPT (*P<0.05). C: Collagen I α 2, D: Fibronectin expression did not change significantly with 8-pCPT incubation. N= number of dogs.
193
Figure 3. Epac expression and profibrotic stimuli. A: Incubation with 10-ng/mL
TGFβ1 significantly decreases Epac1 expression in atrial FBs culture (*P<0.05).
Incubation of atrial FBs via 8-pCPT (33- μ M) significantly increased Epac1 expression (*P<0.05). B: Concomitant treatment with 3-µM Smad3 inhibitor
(SIS3) and TGFβ1 (10-ng/mL) prevented TGFβ1-induced decrease in Epac1 expression. Atrial FBs were pretreated with SIS3 for 1 hour before the addition of
TGFβ1. C: 1-µM Norepinephrine (NE) treatment significantly decreased Epac1 expression in atrial FBs in culture. (N = number of dogs; treatment duration was
48 hours for all experiments) D: Profibrotic stimuli and decreased Epac 1 expression in the in vivo VTP model, which contributes to the fibrotic response in the heart.
Figure 4. Epac expression regulation in fibroblasts. A, NE treatment significantly decreased Epac1 expression (*P<0.05). Concomitant treatment with NE and prazosin (α-adrenergic receptor blocker) prevented NE induced decrease in
Epac1 expression. B: 10-µM isoproterenol treatment increased Epac1 expression
(*P<0.05) , 10-µM salbutamol treatment significantly increased Epac1 expression
(*P<0.05). Concomitant treatment with isoproterenol and ICI-118551 prevented isoproterenol-induced increase in Epac1 expression. C Isoproterenol does not change Epac2 expression in atrial FBs (N = number of dogs). D: Isoproterenol
194
activates β1- and β2-adrenergic receptors in FBs. Collagen expression is reduced through the activation of the predominant β2 receptor type. NE activates β1- and
α-adrenergic receptors and decreases Epac1 expression through α-adrenergic receptors
Figure 5. β2-Adrenergic receptors modulate collagen expression in atrial FBs. A:
Isoproterenol treatment (10-µM for 48hr) significantly decreases collagen Iα1 expression in vitro (*P<0.05). Concomitant treatment of atrial FBs with isoproterenol and CGP-20712A ( β 1-blocker) did not prevent isoproterenol- induced collagen Iα1 reduction in culture. B,C,D: Isoproterenol treatment did not significantly alter the expression of collagen IIIα1, collagen Iα2, or fibronectin.
Collagen 1α1 and collagen IIIα1 are the major fibrillar collagens that compromise
80% and 10 % of the ECM. (N = number of dogs).
195
4.6. Figures and Tables
Table I.
Gene name: Primer sequence Gene Bank no/ID
RAPGEF3 For 5` GATGTGGAAGCAAGACCAT NC_006609.3 (Epac1) Rev 5` ATCACCGTATACCGGTTCGT RAPGEF4 For 5` TGGTGTTATGGAAACGGGCT NC_006618.3 (Epac2) Rev 5` GAAGGGACCTTGGTAATGGTGT
Gene name Applied Biosystems assay ID
HPRT1 Cf02626258_m1 B2M Cf02659077_m1 Collagen Iα1 Cf02623126_m1 Collagen IIIα1 Cf02631369_m1 Collagen Iα2 Cf02622948_m1 Fibronectin Cf02675603_m1
196
Figure 1.
197
Figure 2.
198
Figure 3.
199
Figure 4.
200
Figure 5.
201
Chapter 5
General Discussion
202
5.1. Novel findings and potential limitations
5.1.1. Epac-mediated regulation of IKs in ventricular cardiomyoctes
IKs plays an important role in phase 3 repolarization of the AP in cardiomyocytes.9 Reduction in IKs due to HF-related remodeling significantly impairs repolarization reserve and creates a substrate for the generation of triggered activity (EADs) and ventricular tachyarrhythmias.9 Numerous studies have shown a consistent decrease in IKs from animal models of HF, and ventricular cells from HF patients.9 However, the molecular mechanisms of these changes are poorly understood. Acutely, increased β-adrenergic stimulation increases IKs and ICaL. The ICaL increase enhances heart rate and force of contractions.303 The IKs increase prevents excess APD prolongation and EADs that would otherwise result from ICaL enhancements. However, chronic β - adrenergic stimulation induces arrhythmogenic ionic remodeling by decreasing
IKs. 94
In this thesis I identified a previously unknown role for Epac proteins in regulating IKs in ventricular cardiomyocytes. Our study is the first to demonstrate the signal-transduction mechanisms that lead to IKs downregulation and changes in the underlying subunits (Chapter 2). Chronic β -adrenergic stimulation decreased IKs through an Epac-mediated pathway. A summary of our experimental observations is depicted in Figure 18 of Chapter 2. Isoproterenol
203
increased Epac 1 expression and decreased expression of the KCNE1 subunit
(auxiliary subunit) of IKs through the activation of β 1-adrenoceptor/Ca2+- calmodulin/calcineurin/NFAT signaling pathway. Incubation with 8-pCPT decreased IKs to a similar extent as isoproterenol treatment in ventricular cardiomyocytes. Adenoviral shRNA-mediated knockdown of Epac1 prevented isoproterenol-induced IKs downregulation, further confirming the central role of
Epac1 in regulating IKs. KCNE1 mRNA was ultimately decreased by the translocation of NFATc3 and c4 to the nucleus. Furthermore, knockdown of
Epac1 prevented isoproterenol-mediated translocation of NFAT to the nucleus.
These data are the first to show that NFAT supresses IKs expression.
Concomitant incubation of cells with isoproterenol and INCA6 (NFAT inhibitor) prevented the decrease in KCNE1 mRNA levels. Our results demonstrate that
NFAT is an important downstream mediator of responses to changes in intracellular Ca2+ induced by Epac activation. These data add to the growing number of studies that show that NFAT translocation plays a central/convergent role in regulating ion channel expression.304 Previously, it was shown that
NFATc3 signaling downregulates Ito in mice and canine cardiomyocytes.240-243
Furthermore, Cav1.2 was downregulated via the same pathway in canine atrial cardiomyocytes after tachypacing.245 At the same time, Epac activation
204
significantly increases calcineurin activity169 and NFAT translocation to the nucleus, which are in accordance with the results obtained in our study.158
Epac proteins have been shown to play an extensive role in mediating cellular hypertrophy, Ca2+ mobilization, and activation of EC coupling in cardiomyocytes.139,305,306 Acutely, Epac contributes to Ca2+ release from the SR through a Rap/PLC/CaMKII pathway.305 Additionally, Epac activation increases spontaneous Ca2+ release through CaMKII-dependent phosphorylation of RyR.305
In our study I identified the involvement of these known mediators of Epac proteins, Rap1 and CaMKII, in the regulation of IKs. PLC did not contribute to IKs suppression via isoproterenol. Prior studies have shown that acute AngII- dependent potentiation of IKs was mediated by PLC and PKC activation.307
GqPCRs (Gq/G11) regulate IKs in a biphasic manner, where PKC results in channel activation, and PLC substrates result in IKs inhibition.308 These modulatory effects appear to be mediated by phosphorylation of KCNE1 subunits. Isoproterenol regulated KCNE1 subunits through β1-GαsPCRs, which could account for the differences observed in PLC-dependent modulation of IKs. I demonstrated for the first time that CaMKII inhibition prevents isoproterenol- induced suppression of IKs. This is similar to previous findings demonstrating that
CaMKII plays a role in downregulating Ito in tachycardia remodeling in canine ventricular cardiomyocytes.243 Chronic inhibition of CaMKII in a mouse model
205
decreased APD through an increase in Ito and IK1.309 On the other hand, CaMKII activation suppresses delayed-rectifier K+ currents in neurons.247 These observations are in line with the ability of CaMKII inhibitors to improve LV function and prevent arrhythmias.249 Previous studies have shown the existence of cross-talk between CaMKII and calcineurin signaling, whereby, CaMKII inhibition prevented increased activity of calcineurin. 243 Furthermore, CaMKII expression is increased in calcineurin-overexpressing mice.249 These data suggest that CaMKII can regulate ion channel expression through the modulation of the calcineurin/NFAT signaling pathway. It can be further speculated that increased Epac activation increases CaMKII and Rap1-mediated Ca2+ release, a process that I found was essential for IKs downregulation. Additional studies are required to further clarify the signaling pathway associated with these Epac effectors.
Chronic isoproterenol administration in vivo over 13 weeks decreased IKs and increased APD in guinea pigs. Epac1 and Epac2 mRNA were significantly increased compared with parallel vehicle-treated guinea pigs. In addition to decreased IKs, consistent with our in vitro work, our findings indicated a decrease in ICaL and IK1 in isoproterenol-treated animals. Sustained in vivo adrenergic stimulation clearly produces complex electrophysiological changes that require
206
further investigation. Echocardiography data revealed significant hypertrophy and a reduction in EF.
Little is known regarding the role of Epac proteins in electrical remodeling in the heart. A search of the literature revealed that only one study had investigated the effect of chronic Epac activation, performed over four weeks in rats.154 Ruiz-Hurtado et al (2012), demonstrated an increase in ICaL with no change in APD.154 My study is the first to characterize ionic current changes with sustained Epac activation, and I demonstrated a decrease in IKs, ICaL, and IK1 followed by a significant increase in APD. The differences between our observations and those of Ruiz-Hurtado et al could be explained by species differences and duration of sp-8-pCPT treatment. It would be particularly interesting to identify the mechanisms that lead to decreased ICaL and IK1 density following increased Epac activation. Ion channel regulation may occur via mechanisms involving other Ca2+-activated transcription factors, such as cAMP response element-binding protein (CREB), myocyte enhancer factor-2 (MEF2),310 or the hypertrophic transcription factor GATA-4.311 These transcription factors could potentially be activated in the Epac signaling pathway, since interactions between GATA4 and NFAT with isoproterenol stimulation have been reported.312
Overall, our in vivo studies confirmed that the phenomena observed in vitro also apply to chronic Epac and isoproterenol stimulation conditions in vivo.
207
Additionally, chronic treatment with isoproterenol and sp-8-pCPT induces remodeling of the ion channels, increases APD, and creates a substrate for the generation of arrhythmias. One potential limitation of our study was the lack of total specificity of pharmacological probes and our inability to apply knockdown technology in guinea pigs. Epac1 and Epac2 knockout mice are not useful for assessing the role of these proteins in IKs regulation due to the differences in delayed-rectifier K+ channels between mice and guinea pigs.
Another novel finding of our study was the faster activation kinetics of IKs with sustained exposure to isoproterenol (in vivo and in vitro) and cAMP- elevating agents. KCNE1 mRNA was selectively downregulated with no change observed in the KCNQ1 subunit. The KCNE1 subunit slows down activation/deactivation kinetics of KCNQ1 channels and additionally enhances current amplitude.53,313,314 Loss of KCNE1 could potentially alter the stoichiometry of the IKs channel. Studies in the literature report that IKs channels are composed of KCNQ1/KCNE1 complexes with a 4:1,315 4:2,316,317 4:4,315 or variable stoichiometry.318,319 Studies demonstrating variable stoichiometry of IKs channels suggest that KCNE1 subunits act as allosteric modulators.320 In these models, stoichiometry is dependent on the relative densities of KCNQ1 and KCNE1 subunits in the membrane. This work indicates that when more KCNE1 subunits are available, the channel could incorporate up to four KCNE1 subunits to form
208
IKs.319 However, these data are generally from coexpression studies in Xenopus oocytes and the stoichiometry in cardiomyocytes in vivo remains unknown. If the stoichiometry of IKs is variable, changes in the relative expression of KCNE1 and
KCNQ1 could be critical in regulating normal heart rhythm.315 Furthermore, data obtained from several tissue types demonstrate that KCNQ1 transcripts are constitutively expressed, whereas KCNE1 subunits are subject to modulation by regulatory factors.321 These findings are similar to our observation of selective changes in KCNE1 expression, which could potentially alter IKs stoichiometry following isoproterenol stimulation.
5.1.2. Epac and adrenergic effects on fibroblasts
In Chapter 4, I demonstrated for the first time that Epac expression is significantly decreased in atrial fibroblasts in a canine HF model of AF associated atrial fibrosis. This decrease in Epac expression and related increase in fibrillar collagen expression creates a substrate for the generation of AF. Profibrotic stimuli decrease Epac expression to modulate collagen expression in activated fibroblasts. TGF β 1 signaling decreased Epac through Smad3 as shown previously in rat fibroblasts.322 Our study identified norepinephrine as a regulator of Epac expression. Chronic incubation with norepinephrine (activates both α and
β-adrenergic receptors) significantly decreased Epac expression in fibroblasts.
However, stimulation of β-adrenergic receptors via isoproterenol increased Epac
209
expression (p=0.06), decreasing collagen expression through a β2-adrenergic receptor–mediated pathway. Further studies are required to delineate the effect of α- versus β-adrenergic receptor subtypes on Epac expression in fibroblasts.
5.2. Selective Epac inhibition/activation as a new therapeutic approach
Difference in arrhythmogenic consequences of Epac expression in cardiomyocytes versus fibroblasts were demonstrated in Chapters 2 – 4.
Increased cAMP signaling, and consequently Epac expression, in cardiomyocytes is arrhythmogenic and targeting Epac-mediated electrical remodeling could prevent lethal arrhythmias. Inhibition of Epac in cardiomyocytes could be beneficial by preventing IKs suppression (repolarization abnormalities) or abnormal Ca2+ release from the SR. Our in vitro studies demonstrated that Epac1 is the isoform responsible for IKs regulation. The development of specific Epac1 inhibitors will facilitate further investigations of the role of Epac in cardiac electrical remodeling. Interestingly, studies conducted with Epac1 and Epac 2 knockout mice have shown discrepant results in terms of Epac1 versus Epac 2 involvement in spontaneous SR Ca2+ release.160,161 More work is required to determine the isoform-specific effects of Epac proteins.
In fibroblasts, decreased Epac expression as a result of increased adrenergic activation (norepinephrine) contributes to the collagen expression response. Therefore, new therapeutic agents have to be tailored to the specific
210
cell type they target. It is not yet possible to selectively target Epac in fibroblasts or cardiomyocytes. One potential new approach is using targeted gene-transfer or selective expression of signaling components involved in regulating cAMP levels. AC, the enzyme that produces cAMP from ATP, has different isoforms, with AC6 proving to be a promising target. AC6 adenovirus or fibroblast-targeted
AC6 have been shown to increase cAMP levels; thus increasing antifibrotic activity in cardiac and pulmonary fibroblasts.289,323 Identification of GPCRs that regulate cAMP and are selectively expressed in fibroblasts could provide a potentially new therapeutic tool for the prevention of fibrosis.217,324
5.3. Future directions
5.3.1. Nuclear Ca2+ and Epac signal-transduction
As discussed previously, Ca2+ handling abnormalities play an important role in HF and AF. Ca2+ is a pivotal signaling molecule and its intracellular concentration is tightly regulated. There are several major intracellular Ca2+ pools in cardiomyocytes. One is the SR Ca2+ store, which is regulated by ICaL, RyR, and SERCA. Ca2+ release from the SR participates in EC coupling and fluctuations in Ca2+ release further activate the Ca2+-CaM-calcineurin-NFAT pathway.325 Another intracellular pool is the nuclear Ca2+ store in which Ca2+ mobilization is initiated through IP-3 receptor (IP3-R)/ Ca2+ release channels.
PLC (activated by GPCRs) liberates IP3 from phosphatidylinositol 4,5-
211
bisphosphate( PIP2). IP3 diffuses through the cytosol and binds to IP3-R located on SR and the nuclear envelope.326-328 IP3 can be generated from the activity of the GPCRs located on the nuclear envelope. The nuclear envelope consists of an inner and outer membrane that both express IP3-R.329 The presence of this putative Ca2+ store can activate and sustain signals to Ca2+-dependent transcription factors.328 Elevated nuclear Ca2+ activates CaMKII and promotes histone deacetylase (HDAC) phosphorylation.330 This leads to the activation of transcription factors, like MEF2. The expression of IP-3R is augmented in AF331 and various studies implicate a shift towards more IP3-R-mediated Ca2+ release in HF.332,333 Furthermore, PLC-IP3 and associated Ca2+ release have been shown to be enhanced in cardiac hypertrophy.331 Intriguingly, acute Epac activation not only increases diastolic Ca2+, but also increases nuclear Ca2+ in adult rat cardiomyocytes.334 The effect of Epac activation appears to be proportionally stronger on nuclear Ca2+ than cytosolic Ca2+. This has been explained though a higher density of IP3-R on the nuclear envelope and preferential perinuclear localization of endogenous Epac.334 A similar finding was observed with chronic Epac activation in rats.154 The Epac-dependent increase in nuclear Ca2+ was blocked by an IP3-R blocker (2APB) and a CaMKII blocker
(KN93).334 Additionally, Epac activation increases HDAC5334 (which increases
MEF2 activity) and HDAC4335 translocation out of the nucleus.
212
These findings indicate that Epac actions on nuclear Ca2+ could have important functional consequences. It will be interesting to assess the role of intranuclear events on ion channel remodeling and regulation of subunits such as
KCNE1. Complementary studies can be performed by measuring nuclear Ca2+ transients in intact cardiomyocytes. Fluorescent Ca2+ sensitive dyes such as Fluo
3AM/Fluo 4AM154 can be used to initially measure the effect of chronic Epac stimulation on Ca2+ transients. The role of Epac in increasing nuclear Ca2+ can be more directly assessed by measuring Ca2+ transients from isolated nuclei
(ventricular cardiomyocytes). If the effect of Epac is mediated through IP3-Rs, concomitant treatment of cells with 8-pCPT and IP3-R blocker, 2APB, will provide additional insight in to the extent of nuclear Ca2+ signaling involvement in KCNE1 regulation in our model.
5.3.2. Nuclear β-adrenergic receptors
Recent evidence indicates that functional β-adrenergic receptors are not only found on the plasma membrane but also exist on the nuclear membrane.336,337 Nuclear GPCRs lead to the activation of the same second messenger signaling molecules, such as AC, PKA, and phospholipases.336
Nuclear GPCRs have been shown to increase nuclear Ca2+ and many studies have shown the activation of multiple pathways such as, PKC, p38 MAPK, ERK, and protein kinase B (PKB). Nuclear GPCRs play a role in initiation/repression of
213
transcription although most of the target genes are currently unknown.337,338
Ligands that activate these GPCRs are either produced intracellularly, or go through a specific or nonspecific uptake mechanism. Incubation of NRVCs with radiolabeled [3H]-norepinephrine, allowed for the detection of norepinephrine in different cellular compartments. More than 80% of norepinephrine that was taken up was recovered in the nuclear fraction.339 Given the ability of isolated nuclear β
-adrenergic receptors to repress nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) mRNA,338 it would be interesting to assess the role of nuclear GPCRs in regulation of ion channel transcripts. The NFκB family of transcription factors participate in cardiac hypertrophy and apoptosis.340,341 A recent study demonstrated interdependence between NFAT and NFκB signaling in mediating hypertrophic gene expression and ventricular remodeling in mice. 342
Further studies are required to determine whether nuclear β-adrenergic receptors act in parallel to cell-surface β-adrenergic (β1) receptors to mediate ion channel regulation. The development of caged receptor ligands allows for the selective activation of nuclear GPCRs. The “cages” protect these compounds and allow for free passage through the plasma membrane. The protecting cages can then be removed by UV light with no structural modifications.343 Incubation of intact cardiomyocytes with caged isoproterenol (ZCS-1-67) and inhibition of surface β- adrenergic receptors with an impermeable alkylating agent (EEDQ)343 will provide
214
additional insight into the role of nuclear β-adrenergic receptors on KCNE1 gene regulation.
5.3.3. Mechanism of adrenergic induced changes in Epac and collagen expression
Our data demonstrated significant differences in Epac1 expression in atrial versus ventricular fibroblasts in an animal model of AF-promoting, HF-related structural remodeling. Excess deposition of collagen (interstitial fibrosis) interrupts cell–cell connections and prevents coordinated contraction of the heart.
Given the importance of Epac proteins in regulating collagen expression in fibroblasts, it would be interesting to elucidate the underlying mechanisms. Some of the downstream mediators of Epac include Rap1, PI3K-PKB, ERK1/2, phospholipase D,344 and PLC/PKC.345 In a study by Villarreal et al (2009), the authors demonstrated that the inhibitory effects of adenosine on collagen expression were mediated through an Epac/PI3K/PKB pathway that was independent of PKA.215 ERK1/2 was not involved in regulating collagen expression in this pathway. In pulmonary fibroblasts anti-proliferative effects are mediated via Epac, and cAMP-elevating agents decrease collagen expression.346
By using various blockers for the aforementioned mediators of Epac, it would be interesting to identify the potential participants in ECM regulation in atrial fibroblasts.
215
Fibrotic stimuli such as TGF β 1 and norepinephrine decrease Epac expression in canine atrial fibroblasts. TGF β 1 decreases Epac expression through Smad3, however, at this point it is unclear how norepinephrine decreases Epac expression. It can be speculated that α-adrenergic receptors are involved in this process. Incubation of cells with norepinephrine and prazosin (α- adrenergic receptor blocker) is necessary to help determine the role of α- receptors in regulating Epac expression. Identification of the potential players in regulating Epac and collagen expression will provide new therapeutic targets for the prevention of cardiac structural remodeling.
To directly assess the antifibrotic effects of increased Epac expression, in vivo experiments are required. Adenoviral-mediated overexpression of Epac1 in transgenic mice with selective atrial fibrosis caused by overexpression of TGFβ
1197 will provide additional insight in to the role of Epac proteins in regulating collagen expression.
5.4. Concluding remarks
The findings presented in this thesis highlighted the importance of the
Epac proteins in cardiac remodeling. Our detailed in vitro study of IKs regulation via chronic β-adrenergic stimulation has contributed to our understanding of ion channel regulation. In cardiomyocytes, the effects of increased Epac expression are mediated through activation of the β 1-Ca2+-calcineurin/NFAT signaling
216
pathway independent of PKA. CaMKII and Rap1 further participate in regulating
IKs channels. Activation of the NFAT signaling pathway leads to an ultimate reduction in KCNE1 auxiliary subunit. Downregulation of IKs impairs repolarization reserve, prolongs APD, and increases susceptibility to ventricular tachyarrhythmias such as TdP. In contrast, Epac expression decreases in fibroblasts and creates an arrhythmogenic substrate by increasing collagen deposition. Profibrotic stimuli, such as norepinephrine and TGFβ1, which are increased in HF conditions, decrease collagen expression and further worsen outcomes. Overall, Epac plays an essential role in cardiac remodeling under sustained adrenergic stimulation, initially allowing the heart to adapt to stressful conditions. However, long-term effects are potentially arrhythmogenic. The generation of compounds that can selectivity activate or inhibit Epac expression might provide novel therapeutics for the treatment of cardiovascular diseases.
Selective inhibition of Epac in cardiomyocytes could prevent arrhythmogenic electrical remodeling, whereas activation of Epac in fibroblasts could prevent adverse structural remodeling in the heart.
217
References
1. Saint DA. The cardiac persistent sodium current: An appealing therapeutic target? British journal of pharmacology. 2008;153:1133-1142 2. Lukas A. Electrophysiology of myocardial cells in the epicardial, midmyocardial, and endocardial layers of the ventricle. Journal of cardiovascular pharmacology and therapeutics. 1997;2:61-72 3. Antzelevitch C, Sicouri S, Litovsky SH, Lukas A, Krishnan SC, Di Diego JM, Gintant GA, Liu DW. Heterogeneity within the ventricular wall. Electrophysiology and pharmacology of epicardial, endocardial, and m cells. Circulation research. 1991;69:1427-1449 4. Sicouri S, Antzelevitch C. A subpopulation of cells with unique electrophysiological properties in the deep subepicardium of the canine ventricle. The m cell. Circulation research. 1991;68:1729-1741 5. Nerbonne JM, Guo W. Heterogeneous expression of voltage-gated potassium channels in the heart: Roles in normal excitation and arrhythmias. Journal of cardiovascular electrophysiology. 2002;13:406-409 6. Nerbonne JM, Kass RS. Molecular physiology of cardiac repolarization. Physiological reviews. 2005;85:1205-1253 7. Cutler MJ, Rosenbaum DS, Dunlap ME. Structural and electrical remodeling as therapeutic targets in heart failure. Journal of electrocardiology. 2007;40:S1-7 8. Cutler MJ, Jeyaraj D, Rosenbaum DS. Cardiac electrical remodeling in health and disease. Trends in pharmacological sciences. 2011;32:174-180 9. Nattel S, Maguy A, Le Bouter S, Yeh YH. Arrhythmogenic ion-channel remodeling in the heart: Heart failure, myocardial infarction, and atrial fibrillation. Physiological reviews. 2007;87:425-456 10. Kjekshus J. Arrhythmias and mortality in congestive heart failure. The American journal of cardiology. 1990;65:42I-48I
218
11. Aiba T, Tomaselli GF. Electrical remodeling in the failing heart. Current opinion in cardiology. 2010;25:29-36 12. Janse MJ. Electrophysiological changes in heart failure and their relationship to arrhythmogenesis. Cardiovascular research. 2004;61:208- 217 13. Akar FG, Rosenbaum DS. Transmural electrophysiological heterogeneities underlying arrhythmogenesis in heart failure. Circulation research. 2003;93:638-645 14. Beuckelmann DJ, Nabauer M, Erdmann E. Alterations of K+ currents in isolated human ventricular myocytes from patients with terminal heart failure. Circulation research. 1993;73:379-385 15. Kaab S, Nuss HB, Chiamvimonvat N, O'Rourke B, Pak PH, Kass DA, Marban E, Tomaselli GF. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart failure. Circulation research. 1996;78:262-273 16. Thuringer D, Deroubaix E, Coulombe A, Coraboeuf E, Mercadier JJ. Ionic basis of the action potential prolongation in ventricular myocytes from syrian hamsters with dilated cardiomyopathy. Cardiovascular research. 1996;31:747-757 17. Tomaselli GF, Marban E. Electrophysiological remodeling in hypertrophy and heart failure. Cardiovascular research. 1999;42:270-283 18. Li GR, Lau CP, Ducharme A, Tardif JC, Nattel S. Transmural action potential and ionic current remodeling in ventricles of failing canine hearts. American journal of physiology. Heart and circulatory physiology. 2002;283:H1031-1041 19. Drouin E, Charpentier F, Gauthier C, Laurent K, Le Marec H. Electrophysiologic characteristics of cells spanning the left ventricular wall of human heart: Evidence for presence of M cells. Journal of the American College of Cardiology. 1995;26:185-192
219
20. Li GR, Feng J, Yue L, Carrier M. Transmural heterogeneity of action potentials and Ito1 in myocytes isolated from the human right ventricle. The American journal of physiology. 1998;275:H369-377 21. Dudel J, Peper K, Rudel R, Trautwein W. The dynamic chloride component of membrane current in Purkinje fibers. Pflugers Archiv fur die gesamte Physiologie des Menschen und der Tiere. 1967;295:197-212 22. Kenyon JL, Gibbons WR. 4-Aminopyridine and the early outward current of sheep cardiac Purkinje fibers. The Journal of general physiology. 1979;73:139-157 23. Brahmajothi MV, Campbell DL, Rasmusson RL, Morales MJ, Trimmer JS, Nerbonne JM, Strauss HC. Distinct transient outward potassium current (Ito) phenotypes and distribution of fast-inactivating potassium channel alpha subunits in ferret left ventricular myocytes. The Journal of general physiology. 1999;113:581-600 24. Campbell DL, Qu Y, Rasmusson RL, Strauss HC. The calcium- independent transient outward potassium current in isolated ferret right ventricular myocytes. II. Closed state reverse use-dependent block by 4- aminopyridine. The Journal of general physiology. 1993;101:603-626 25. Sanguinetti MC, Johnson JH, Hammerland LG, Kelbaugh PR, Volkmann RA, Saccomano NA, Mueller AL. Heteropodatoxins: Peptides isolated from spider venom that block Kv4.2 potassium channels. Molecular pharmacology. 1997;51:491-498 26. Oudit GY, Kassiri Z, Sah R, Ramirez RJ, Zobel C, Backx PH. The molecular physiology of the cardiac transient outward potassium current (I(to)) in normal and diseased myocardium. Journal of molecular and cellular cardiology. 2001;33:851-872 27. Nerbonne JM. Molecular basis of functional voltage-gated K+ channel diversity in the mammalian myocardium. The Journal of physiology. 2000;525 Pt 2:285-298
220
28. Snyders DJ. Structure and function of cardiac potassium channels. Cardiovascular research. 1999;42:377-390 29. Birnbaum SG, Varga AW, Yuan LL, Anderson AE, Sweatt JD, Schrader LA. Structure and function of Kv4-family transient potassium channels. Physiological reviews. 2004;84:803-833 30. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, Rhodes KJ. Modulation of a-type potassium channels by a family of calcium sensors. Nature. 2000;403:553- 556 31. Pongs O, Schwarz JR. Ancillary subunits associated with voltage- dependent K+ channels. Physiological reviews. 2010;90:755-796 32. Deschenes I, DiSilvestre D, Juang GJ, Wu RC, An WF, Tomaselli GF. Regulation of Kv4.3 current by KChIP2 splice variants: A component of native cardiac I(to)? Circulation. 2002;106:423-429 33. Rosati B, Grau F, Rodriguez S, Li H, Nerbonne JM, McKinnon D. Concordant expression of KChIP2 mRNA, protein and transient outward current throughout the canine ventricle. The Journal of physiology. 2003;548:815-822 34. Patel SP, Campbell DL. Transient outward potassium current, 'Ito', phenotypes in the mammalian left ventricle: Underlying molecular, cellular and biophysical mechanisms. The Journal of physiology. 2005;569:7-39 35. Tseng GN, Hoffman BF. Two components of transient outward current in canine ventricular myocytes. Circulation research. 1989;64:633-647 36. Wettwer E, Amos GJ, Posival H, Ravens U. Transient outward current in human ventricular myocytes of subepicardial and subendocardial origin. Circulation research. 1994;75:473-482 37. Fermini B, Wang Z, Duan D, Nattel S. Differences in rate dependence of transient outward current in rabbit and human atrium. The American journal of physiology. 1992;263:H1747-1754
221
38. Wang Z, Feng J, Shi H, Pond A, Nerbonne JM, Nattel S. Potential molecular basis of different physiological properties of the transient outward K+ current in rabbit and human atrial myocytes. Circulation research. 1999;84:551-561 39. Nabauer M, Beuckelmann DJ, Uberfuhr P, Steinbeck G. Regional differences in current density and rate-dependent properties of the transient outward current in subepicardial and subendocardial myocytes of human left ventricle. Circulation. 1996;93:168-177 40. Noble D, Tsien RW. Outward membrane currents activated in the plateau range of potentials in cardiac Purkinje fibres. The Journal of physiology. 1969;200:205-231 41. Grant AO. Cardiac ion channels. Circulation. Arrhythmia and electrophysiology. 2009;2:185-194 42. Spector PS, Curran ME, Zou A, Keating MT, Sanguinetti MC. Fast inactivation causes rectification of the Ikr channel. The Journal of general physiology. 1996;107:611-619 43. Sanguinetti MC, Jurkiewicz NK. Delayed rectifier outward K+ current is composed of two currents in guinea pig atrial cells. The American journal of physiology. 1991;260:H393-399 44. Sanguinetti MC, Jurkiewicz NK. Two components of cardiac delayed rectifier K+ current. Differential sensitivity to block by class III antiarrhythmic agents. The Journal of general physiology. 1990;96:195- 215 45. Mitcheson JS, Sanguinetti MC. Biophysical properties and molecular basis of cardiac rapid and slow delayed rectifier potassium channels. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 1999;9:201-216 46. Jurkiewicz NK, Sanguinetti MC. Rate-dependent prolongation of cardiac action potentials by a methanesulfonanilide class III antiarrhythmic agent.
222
Specific block of rapidly activating delayed rectifier K+ current by dofetilide. Circulation research. 1993;72:75-83 47. Busch AE, Suessbrich H, Waldegger S, Sailer E, Greger R, Lang H, Lang F, Gibson KJ, Maylie JG. Inhibition of IKs in guinea pig cardiac myocytes and guinea pig IsK channels by the chromanol 293B. Pflugers Archiv : European journal of physiology. 1996;432:1094-1096 48. Thomas GP, Gerlach U, Antzelevitch C. HMR 1556, a potent and selective blocker of slowly activating delayed rectifier potassium current. Journal of cardiovascular pharmacology. 2003;41:140-147 49. Cheng J, Kamiya K, Liu W, Tsuji Y, Toyama J, Kodama I. Heterogeneous distribution of the two components of delayed rectifier K+ current: A potential mechanism of the proarrhythmic effects of methanesulfonanilideclass III agents. Cardiovascular research. 1999;43:135-147 50. Apkon M, Nerbonne JM. Characterization of two distinct depolarization- activated K+ currents in isolated adult rat ventricular myocytes. The Journal of general physiology. 1991;97:973-1011 51. Guo W, Xu H, London B, Nerbonne JM. Molecular basis of transient outward K+ current diversity in mouse ventricular myocytes. The Journal of physiology. 1999;521 Pt 3:587-599 52. Fiset C, Clark RB, Larsen TS, Giles WR. A rapidly activating sustained K+ current modulates repolarization and excitation-contraction coupling in adult mouse ventricle. The Journal of physiology. 1997;504 ( Pt 3):557- 563 53. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G. K(v)LQT1 and IsK (minK) proteins associate to form the I(Ks) cardiac potassium current. Nature. 1996;384:78-80 54. Tseng GN. I(Kr): The hERG channel. Journal of molecular and cellular cardiology. 2001;33:835-849
223
55. Li GR, Lau CP, Leung TK, Nattel S. Ionic current abnormalities associated with prolonged action potentials in cardiomyocytes from diseased human right ventricles. Heart rhythm : the official journal of the Heart Rhythm Society. 2004;1:460-468 56. Anumonwo JM, Lopatin AN. Cardiac strong inward rectifier potassium channels. Journal of molecular and cellular cardiology. 2010;48:45-54 57. Lopatin AN, Nichols CG. Inward rectifiers in the heart: An update on I(K1). Journal of molecular and cellular cardiology. 2001;33:625-638 58. Dhamoon AS, Pandit SV, Sarmast F, Parisian KR, Guha P, Li Y, Bagwe S, Taffet SM, Anumonwo JM. Unique Kir2.X properties determine regional and species differences in the cardiac inward rectifier K+ current. Circulation research. 2004;94:1332-1339 59. Wang Z, Yue L, White M, Pelletier G, Nattel S. Differential distribution of inward rectifier potassium channel transcripts in human atrium versus ventricle. Circulation. 1998;98:2422-2428 60. Tristani-Firouzi M, Etheridge SP. Kir 2.1 channelopathies: The Andersen- Tawil syndrome. Pflugers Archiv : European journal of physiology. 2010;460:289-294 61. Borlak J, Thum T. Hallmarks of ion channel gene expression in end-stage heart failure. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2003;17:1592-1608 62. Kaab S, Dixon J, Duc J, Ashen D, Nabauer M, Beuckelmann DJ, Steinbeck G, McKinnon D, Tomaselli GF. Molecular basis of transient outward potassium current downregulation in human heart failure: A decrease in Kv4.3 mRNA correlates with a reduction in current density. Circulation. 1998;98:1383-1393 63. Luo X, Pan Z, Shan H, Xiao J, Sun X, Wang N, Lin H, Xiao L, Maguy A, Qi XY, Li Y, Gao X, Dong D, Zhang Y, Bai Y, Ai J, Sun L, Lu H, Luo XY, Wang Z, Lu Y, Yang B, Nattel S. MicroRNA-26 governs profibrillatory
224
inward-rectifier potassium current changes in atrial fibrillation. The Journal of clinical investigation. 2013;123:1939-1951 64. Valdivia CR, Chu WW, Pu J, Foell JD, Haworth RA, Wolff MR, Kamp TJ, Makielski JC. Increased late sodium current in myocytes from a canine heart failure model and from failing human heart. Journal of molecular and cellular cardiology. 2005;38:475-483 65. Saint DA, Ju YK, Gage PW. A persistent sodium current in rat ventricular myocytes. The Journal of physiology. 1992;453:219-231 66. Michael G, Xiao L, Qi XY, Dobrev D, Nattel S. Remodelling of cardiac repolarization: How homeostatic responses can lead to arrhythmogenesis. Cardiovascular research. 2009;81:491-499 67. Armoundas AA, Hobai IA, Tomaselli GF, Winslow RL, O'Rourke B. Role of sodium-calcium exchanger in modulating the action potential of ventricular myocytes from normal and failing hearts. Circulation research. 2003;93:46-53 68. Greenstein JL, Wu R, Po S, Tomaselli GF, Winslow RL. Role of the calcium-independent transient outward current I(to1) in shaping action potential morphology and duration. Circulation research. 2000;87:1026- 1033 69. Roden DM. Taking the "idio" out of "idiosyncratic": Predicting torsades de pointes. Pacing and clinical electrophysiology : PACE. 1998;21:1029-1034 70. el-Sherif N, Turitto G. The long QT syndrome and torsade de pointes. Pacing and clinical electrophysiology : PACE. 1999;22:91-110 71. Jones DL, Petrie JP, Li HG. Spontaneous, electrically, and cesium chloride induced arrhythmia and afterdepolarizations in the rapidly paced dog heart. Pacing and clinical electrophysiology : PACE. 2001;24:474-485 72. Zeng J, Rudy Y. Early afterdepolarizations in cardiac myocytes: Mechanism and rate dependence. Biophysical journal. 1995;68:949-964
225
73. Bers DM, Pogwizd SM, Schlotthauer K. Upregulated Na/Ca exchange is involved in both contractile dysfunction and arrhythmogenesis in heart failure. Basic research in cardiology. 2002;97 Suppl 1:I36-42 74. Pogwizd SM, Schlotthauer K, Li L, Yuan W, Bers DM. Arrhythmogenesis and contractile dysfunction in heart failure: Roles of sodium-calcium exchange, inward rectifier potassium current, and residual beta-adrenergic responsiveness. Circulation research. 2001;88:1159-1167 75. Antzelevitch C. Ionic, molecular, and cellular bases of QT-interval prolongation and torsade de pointes. Europace : European pacing, arrhythmias, and cardiac electrophysiology : journal of the working groups on cardiac pacing, arrhythmias, and cardiac cellular electrophysiology of the European Society of Cardiology. 2007;9 Suppl 4:iv4-15 76. Wolbrette DL. Drugs that cause torsades de pointes and increase the risk of sudden cardiac death. Current cardiology reports. 2004;6:379-384 77. Vos MA, van Opstal JM, Leunissen JD, Verduyn SC. Electrophysiologic parameters and predisposing factors in the generation of drug-induced torsade de pointes arrhythmias. Pharmacology & therapeutics. 2001;92:109-122 78. Levine E, Rosero SZ, Budzikowski AS, Moss AJ, Zareba W, Daubert JP. Congenital long qt syndrome: Considerations for primary care physicians. Cleveland Clinic journal of medicine. 2008;75:591-600 79. Beckmann BM, Wilde AA, Kaab S. Clinical utility gene card for: Long-QT syndrome (types 1-13). European journal of human genetics : EJHG. 2013;21 80. Modell SM, Bradley DJ, Lehmann MH. Genetic testing for long QT syndrome and the category of cardiac ion channelopathies. PLoS currents. 2012:e4f9995f9969e9996c9997 81. Kannankeril P, Roden DM, Darbar D. Drug-induced long QT syndrome. Pharmacological reviews. 2010;62:760-781
226
82. Hirsch AT, Dzau VJ, Creager MA. Baroreceptor function in congestive heart failure: Effect on neurohumoral activation and regional vascular resistance. Circulation. 1987;75:IV36-48 83. Moser DK. Pathophysiology of heart failure update: The role of neurohumoral activation in the progression of heart failure. AACN clinical issues. 1998;9:157-171 84. Mendzef SD, Slovinski JR. Neurohormones and heart failure. The Nursing clinics of North America. 2004;39:845-861 85. Chidsey CA, Harrison DC, Braunwald E. Augmentation of the plasma nor- epinephrine response to exercise in patients with congestive heart failure. The New England journal of medicine. 1962;267:650-654 86. Francis GS, Benedict C, Johnstone DE, Kirlin PC, Nicklas J, Liang CS, Kubo SH, Rudin-Toretsky E, Yusuf S. Comparison of neuroendocrine activation in patients with left ventricular dysfunction with and without congestive heart failure. A substudy of the studies of left ventricular dysfunction (solvd). Circulation. 1990;82:1724-1729 87. Cohn JN, Levine TB, Olivari MT, Garberg V, Lura D, Francis GS, Simon AB, Rector T. Plasma norepinephrine as a guide to prognosis in patients with chronic congestive heart failure. The New England journal of medicine. 1984;311:819-823 88. Dash R, Kadambi V, Schmidt AG, Tepe NM, Biniakiewicz D, Gerst MJ, Canning AM, Abraham WT, Hoit BD, Liggett SB, Lorenz JN, Dorn GW, 2nd, Kranias EG. Interactions between phospholamban and beta- adrenergic drive may lead to cardiomyopathy and early mortality. Circulation. 2001;103:889-896 89. Mann DL, Kent RL, Parsons B, Cooper Gt. Adrenergic effects on the biology of the adult mammalian cardiocyte. Circulation. 1992;85:790-804 90. Bristow MR. Beta-adrenergic receptor blockade in chronic heart failure. Circulation. 2000;101:558-569
227
91. Engelhardt S, Hein L, Wiesmann F, Lohse MJ. Progressive hypertrophy and heart failure in beta1-adrenergic receptor transgenic mice. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:7059-7064 92. Chruscinski AJ, Rohrer DK, Schauble E, Desai KH, Bernstein D, Kobilka BK. Targeted disruption of the beta2 adrenergic receptor gene. The Journal of biological chemistry. 1999;274:16694-16700 93. Hartzell HC, Duchatelle-Gourdon I. Regulation of the cardiac delayed rectifier K current by neurotransmitters and magnesium. Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy. 1993;7 Suppl 3:547-554 94. Zhang LM, Wang Z, Nattel S. Effects of sustained beta-adrenergic stimulation on ionic currents of cultured adult guinea pig cardiomyocytes. American journal of physiology. Heart and circulatory physiology. 2002;282:H880-889 95. Fedida D, Braun AP, Giles WR. Alpha 1-adrenoceptors in myocardium: Functional aspects and transmembrane signaling mechanisms. Physiological reviews. 1993;73:469-487 96. Boixel C, Gavillet B, Rougier JS, Abriel H. Aldosterone increases voltage- gated sodium current in ventricular myocytes. American journal of physiology. Heart and circulatory physiology. 2006;290:H2257-2266 97. Benitah JP, Vassort G. Aldosterone upregulates Ca(2+) current in adult rat cardiomyocytes. Circulation research. 1999;85:1139-1145 98. Yu H, Gao J, Wang H, Wymore R, Steinberg S, McKinnon D, Rosen MR, Cohen IS. Effects of the renin-angiotensin system on the current I(to) in epicardial and endocardial ventricular myocytes from the canine heart. Circulation research. 2000;86:1062-1068 99. Benitah JP, Perrier E, Gomez AM, Vassort G. Effects of aldosterone on transient outward K+ current density in rat ventricular myocytes. The Journal of physiology. 2001;537:151-160
228
100. Domenighetti AA, Boixel C, Cefai D, Abriel H, Pedrazzini T. Chronic angiotensin II stimulation in the heart produces an acquired long QT syndrome associated with IK1 potassium current downregulation. Journal of molecular and cellular cardiology. 2007;42:63-70 101. Tillmann HC, Schumacher B, Yasenyev O, Junker M, Christ M, Feuring M, Wehling M. Acute effects of aldosterone on intracardiac monophasic action potentials. International journal of cardiology. 2002;84:33-39; discussion 39-40 102. Charpentier F, Drouin E, Gauthier C, Le Marec H. Early after/depolarizations and triggered activity: Mechanisms and autonomic regulation. Fundamental & clinical pharmacology. 1993;7:39-49 103. Chang MG, Chang CY, de Lange E, Xu L, O'Rourke B, Karagueuzian HS, Tung L, Marban E, Garfinkel A, Weiss JN, Qu Z, Abraham MR. Dynamics of early afterdepolarization-mediated triggered activity in cardiac monolayers. Biophysical journal. 2012;102:2706-2714 104. Naccarella F, Naccarelli GV, Maranga SS, Lepera G, Grippo MC, Melandri F, Gatti M, Pazzaglia S, Spinelli G, Angelini V, Ambrosioni E, Borghi C, Giovagnorio MT, Nisam S. Do ACE inhibitors or angiotensin II antagonists reduce total mortality and arrhythmic mortality? A critical review of controlled clinical trials. Current opinion in cardiology. 2002;17:6-18 105. Fang JC. Angiotensin-converting enzyme inhibitors or beta-blockers in heart failure: Does it matter who goes first? Circulation. 2005;112:2380- 2382 106. Al-Gobari M, El Khatib C, Pillon F, Gueyffier F. Beta-blockers for the prevention of sudden cardiac death in heart failure patients: A meta- analysis of randomized controlled trials. BMC cardiovascular disorders. 2013;13:52 107. Sabbah HN. The cellular and physiologic effects of beta blockers in heart failure. Clinical cardiology. 1999;22 Suppl 5:V16-20
229
108. Reiken S, Wehrens XH, Vest JA, Barbone A, Klotz S, Mancini D, Burkhoff D, Marks AR. Beta-blockers restore calcium release channel function and improve cardiac muscle performance in human heart failure. Circulation. 2003;107:2459-2466 109. Wakili R, Voigt N, Kaab S, Dobrev D, Nattel S. Recent advances in the molecular pathophysiology of atrial fibrillation. The Journal of clinical investigation. 2011;121:2955-2968 110. Iwasaki YK, Nishida K, Kato T, Nattel S. Atrial fibrillation pathophysiology: Implications for management. Circulation. 2011;124:2264-2274 111. Wijffels MC, Kirchhof CJ, Dorland R, Allessie MA. Atrial fibrillation begets atrial fibrillation. A study in awake chronically instrumented goats. Circulation. 1995;92:1954-1968 112. Morillo CA, Klein GJ, Jones DL, Guiraudon CM. Chronic rapid atrial pacing. Structural, functional, and electrophysiological characteristics of a new model of sustained atrial fibrillation. Circulation. 1995;91:1588-1595 113. Yue L, Feng J, Gaspo R, Li GR, Wang Z, Nattel S. Ionic remodeling underlying action potential changes in a canine model of atrial fibrillation. Circulation research. 1997;81:512-525 114. van der Velden HMW, van der Zee L, Wijffels MC, van Leuven C, Dorland R, Vos MA, Jongsma HJ, Allessie MA. Atrial fibrillation in the goat induces changes in monophasic action potential and mrna expression of ion channels involved in repolarization. Journal of cardiovascular electrophysiology. 2000;11:1262-1269 115. Van Wagoner DR, Pond AL, Lamorgese M, Rossie SS, McCarthy PM, Nerbonne JM. Atrial L-type Ca2+ currents and human atrial fibrillation. Circulation research. 1999;85:428-436 116. Dun W, Chandra P, Danilo P, Jr., Rosen MR, Boyden PA. Chronic atrial fibrillation does not further decrease outward currents. It increases them. American journal of physiology. Heart and circulatory physiology. 2003;285:H1378-1384
230
117. Bosch RF, Zeng X, Grammer JB, Popovic K, Mewis C, Kuhlkamp V. Ionic mechanisms of electrical remodeling in human atrial fibrillation. Cardiovascular research. 1999;44:121-131 118. Workman AJ, Kane KA, Rankin AC. The contribution of ionic currents to changes in refractoriness of human atrial myocytes associated with chronic atrial fibrillation. Cardiovascular research. 2001;52:226-235 119. Dobrev D, Wettwer E, Kortner A, Knaut M, Schuler S, Ravens U. Human inward rectifier potassium channels in chronic and postoperative atrial fibrillation. Cardiovascular research. 2002;54:397-404 120. Burstein B, Comtois P, Michael G, Nishida K, Villeneuve L, Yeh YH, Nattel S. Changes in connexin expression and the atrial fibrillation substrate in congestive heart failure. Circulation research. 2009;105:1213-1222 121. Kato T, Iwasaki YK, Nattel S. Connexins and atrial fibrillation: Filling in the gaps. Circulation. 2012;125:203-206 122. Bers DM. Cardiac excitation-contraction coupling. Nature. 2002;415:198- 205 123. Bos JL. Epac proteins: Multi-purpose cAMP targets. Trends in biochemical sciences. 2006;31:680-686 124. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A, Bos JL. Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature. 1998;396:474-477 125. Bos JL, Rehmann H, Wittinghofer A. Gefs and gaps: Critical elements in the control of small G proteins. Cell. 2007;129:865-877 126. Hochbaum D, Tanos T, Ribeiro-Neto F, Altschuler D, Coso OA. Activation of JNK by Epac is independent of its activity as a Rap guanine nucleotide exchanger. The Journal of biological chemistry. 2003;278:33738-33746 127. Lopez De Jesus M, Stope MB, Oude Weernink PA, Mahlke Y, Borgermann C, Ananaba VN, Rimmbach C, Rosskopf D, Michel MC, Jakobs KH, Schmidt M. Cyclic AMP-dependent and Epac-mediated
231
activation of R-Ras by G protein-coupled receptors leads to phospholipase D stimulation. The Journal of biological chemistry. 2006;281:21837-21847 128. Shi GX, Rehmann H, Andres DA. A novel cyclic AMP-dependent Epac-Rit signaling pathway contributes to PACAP38-mediated neuronal differentiation. Molecular and cellular biology. 2006;26:9136-9147 129. Sehrawat S, Cullere X, Patel S, Italiano J, Jr., Mayadas TN. Role of Epac1, an exchange factor for Rap GTPases, in endothelial microtubule dynamics and barrier function. Molecular biology of the cell. 2008;19:1261- 1270 130. Kawasaki H, Springett GM, Mochizuki N, Toki S, Nakaya M, Matsuda M, Housman DE, Graybiel AM. A family of cAMP-binding proteins that directly activate Rap1. Science. 1998;282:2275-2279 131. Niimura M, Miki T, Shibasaki T, Fujimoto W, Iwanaga T, Seino S. Critical role of the N-terminal cyclic AMP-binding domain of Epac2 in its subcellular localization and function. Journal of cellular physiology. 2009;219:652-658 132. Rehmann H, Arias-Palomo E, Hadders MA, Schwede F, Llorca O, Bos JL. Structure of Epac2 in complex with a cyclic AMP analogue and RAP1B. Nature. 2008;455:124-127 133. de Rooij J, Rehmann H, van Triest M, Cool RH, Wittinghofer A, Bos JL. Mechanism of regulation of the Epac family of cAMP-dependent RAPGEFs. The Journal of biological chemistry. 2000;275:20829-20836 134. Laurent AC, Breckler M, Berthouze M, Lezoualc'h F. Role of Epac in brain and heart. Biochemical Society transactions. 2012;40:51-57 135. Borland G, Smith BO, Yarwood SJ. Epac proteins transduce diverse cellular actions of cAMP. British journal of pharmacology. 2009;158:70-86 136. Rehmann H, Das J, Knipscheer P, Wittinghofer A, Bos JL. Structure of the cyclic-AMP-responsive exchange factor Epac2 in its auto-inhibited state. Nature. 2006;439:625-628
232
137. Enserink JM, Christensen AE, de Rooij J, van Triest M, Schwede F, Genieser HG, Doskeland SO, Blank JL, Bos JL. A novel Epac-specific cAMP analogue demonstrates independent regulation of Rap1 and ERK. Nature cell biology. 2002;4:901-906 138. Dao KK, Teigen K, Kopperud R, Hodneland E, Schwede F, Christensen AE, Martinez A, Doskeland SO. Epac1 and cAMP-dependent protein kinase holoenzyme have similar cAMP affinity, but their cAMP domains have distinct structural features and cyclic nucleotide recognition. The Journal of biological chemistry. 2006;281:21500-21511 139. Schmidt M, Dekker FJ, Maarsingh H. Exchange protein directly activated by cAMP (Epac): A multidomain cAMP mediator in the regulation of diverse biological functions. Pharmacological reviews. 2013;65:670-709 140. Poppe H, Rybalkin SD, Rehmann H, Hinds TR, Tang XB, Christensen AE, Schwede F, Genieser HG, Bos JL, Doskeland SO, Beavo JA, Butt E. Cyclic nucleotide analogs as probes of signaling pathways. Nature methods. 2008;5:277-278 141. Tsalkova T, Mei FC, Cheng X. A fluorescence-based high-throughput assay for the discovery of exchange protein directly activated by cyclic AMP (Epac) antagonists. PloS one. 2012;7:e30441 142. Chen H, Tsalkova T, Mei FC, Hu Y, Cheng X, Zhou J. 5-Cyano-6-oxo-1,6- dihydro-pyrimidines as potent antagonists targeting exchange proteins directly activated by cAMP. Bioorganic & medicinal chemistry letters. 2012;22:4038-4043 143. Almahariq M, Tsalkova T, Mei FC, Chen H, Zhou J, Sastry SK, Schwede F, Cheng X. A novel Epac-specific inhibitor suppresses pancreatic cancer cell migration and invasion. Molecular pharmacology. 2013;83:122-128 144. Fabiato A. Calcium-induced release of calcium from the cardiac sarcoplasmic reticulum. The American journal of physiology. 1983;245:C1- 14
233
145. Grimm M, Brown JH. Beta-adrenergic receptor signaling in the heart: Role of CaMKII. Journal of molecular and cellular cardiology. 2010;48:322-330 146. Hove-Madsen L, Llach A, Bayes-Genis A, Roura S, Rodriguez Font E, Aris A, Cinca J. Atrial fibrillation is associated with increased spontaneous calcium release from the sarcoplasmic reticulum in human atrial myocytes. Circulation. 2004;110:1358-1363 147. Somekawa S, Fukuhara S, Nakaoka Y, Fujita H, Saito Y, Mochizuki N. Enhanced functional gap junction neoformation by protein kinase A- dependent and Epac-dependent signals downstream of cAMP in cardiac myocytes. Circulation research. 2005;97:655-662 148. Davis LM, Rodefeld ME, Green K, Beyer EC, Saffitz JE. Gap junction protein phenotypes of the human heart and conduction system. Journal of cardiovascular electrophysiology. 1995;6:813-822 149. Vozzi C, Dupont E, Coppen SR, Yeh HI, Severs NJ. Chamber-related differences in connexin expression in the human heart. Journal of molecular and cellular cardiology. 1999;31:991-1003 150. Kang G, Joseph JW, Chepurny OG, Monaco M, Wheeler MB, Bos JL, Schwede F, Genieser HG, Holz GG. Epac-selective cAMP analog 8- pCPT-2'-o-me-cAMP as a stimulus for Ca2+-induced Ca2+ release and exocytosis in pancreatic beta-cells. The Journal of biological chemistry. 2003;278:8279-8285 151. Oestreich EA, Wang H, Malik S, Kaproth-Joslin KA, Blaxall BC, Kelley GG, Dirksen RT, Smrcka AV. Epac-mediated activation of phospholipase C(epsilon) plays a critical role in beta-adrenergic receptor-dependent enhancement of Ca2+ mobilization in cardiac myocytes. The Journal of biological chemistry. 2007;282:5488-5495 152. Oestreich EA, Malik S, Goonasekera SA, Blaxall BC, Kelley GG, Dirksen RT, Smrcka AV. Epac and phospholipase Cepsilon regulate Ca2+ release in the heart by activation of protein kinase Cepsilon and calcium-
234
calmodulin kinase II. The Journal of biological chemistry. 2009;284:1514- 1522 153. Cazorla O, Lucas A, Poirier F, Lacampagne A, Lezoualc'h F. The cAMP binding protein Epac regulates cardiac myofilament function. Proceedings of the National Academy of Sciences of the United States of America. 2009;106:14144-14149 154. Ruiz-Hurtado G, Dominguez-Rodriguez A, Pereira L, Fernandez-Velasco M, Cassan C, Lezoualc'h F, Benitah JP, Gomez AM. Sustained Epac activation induces calmodulin dependent positive inotropic effect in adult cardiomyocytes. Journal of molecular and cellular cardiology. 2012;53:617-625 155. London B. Understanding cardiac calcium channelopathies. Circulation. 2008;118:2221-2222 156. Pereira L, Metrich M, Fernandez-Velasco M, Lucas A, Leroy J, Perrier R, Morel E, Fischmeister R, Richard S, Benitah JP, Lezoualc'h F, Gomez AM. The cAMP binding protein Epac modulates Ca2+ sparks by a Ca2+/calmodulin kinase signalling pathway in rat cardiac myocytes. The Journal of physiology. 2007;583:685-694 157. Hothi SS, Gurung IS, Heathcote JC, Zhang Y, Booth SW, Skepper JN, Grace AA, Huang CL. Epac activation, altered calcium homeostasis and ventricular arrhythmogenesis in the murine heart. Pflugers Archiv : European journal of physiology. 2008;457:253-270 158. Morel E, Marcantoni A, Gastineau M, Birkedal R, Rochais F, Garnier A, Lompre AM, Vandecasteele G, Lezoualc'h F. cAMP-binding protein Epac induces cardiomyocyte hypertrophy. Circulation research. 2005;97:1296- 1304 159. Benitah JP, Alvarez JL, Gomez AM. L-type Ca(2+) current in ventricular cardiomyocytes. Journal of molecular and cellular cardiology. 2010;48:26- 36
235
160. Pereira L, Cheng H, Lao DH, Na L, van Oort RJ, Brown JH, Wehrens XH, Chen J, Bers DM. Epac2 mediates cardiac beta1-adrenergic-dependent sarcoplasmic reticulum Ca2+ leak and arrhythmia. Circulation. 2013;127:913-922 161. Okumura S, Fujita T, Cai W, Jin M, Namekata I, Mototani Y, Jin H, Ohnuki Y, Tsuneoka Y, Kurotani R, Suita K, Kawakami Y, Hamaguchi S, Abe T, Kiyonari H, Tsunematsu T, Bai Y, Suzuki S, Hidaka Y, Umemura M, Ichikawa Y, Yokoyama U, Sato M, Ishikawa F, Izumi-Nakaseko H, Adachi- Akahane S, Tanaka H, Ishikawa Y. Epac1-dependent phospholamban phosphorylation mediates the cardiac response to stresses. The Journal of clinical investigation. 2014;124:2785-2801 162. McMullen JR, Jennings GL. Differences between pathological and physiological cardiac hypertrophy: Novel therapeutic strategies to treat heart failure. Clinical and experimental pharmacology & physiology. 2007;34:255-262 163. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the framingham heart study. The New England journal of medicine. 1990;322:1561-1566 164. Weber KT, Brilla CG, Janicki JS. Myocardial fibrosis: Functional significance and regulatory factors. Cardiovascular research. 1993;27:341- 348 165. Boccafoschi F, Mosca C, Ramella M, Valente G, Cannas M. The effect of mechanical strain on soft (cardiovascular) and hard (bone) tissues: Common pathways for different biological outcomes. Cell adhesion & migration. 2013;7:165-173 166. Ruwhof C, van der Laarse A. Mechanical stress-induced cardiac hypertrophy: Mechanisms and signal transduction pathways. Cardiovascular research. 2000;47:23-37
236
167. Saygili E, Rana OR, Saygili E, Reuter H, Frank K, Schwinger RH, Muller- Ehmsen J, Zobel C. Losartan prevents stretch-induced electrical remodeling in cultured atrial neonatal myocytes. American journal of physiology. Heart and circulatory physiology. 2007;292:H2898-2905 168. Shyu KG. Cellular and molecular effects of mechanical stretch on vascular cells and cardiac myocytes. Clinical science. 2009;116:377-389 169. Metrich M, Lucas A, Gastineau M, Samuel JL, Heymes C, Morel E, Lezoualc'h F. Epac mediates beta-adrenergic receptor-induced cardiomyocyte hypertrophy. Circulation research. 2008;102:959-965 170. Ulucan C, Wang X, Baljinnyam E, Bai Y, Okumura S, Sato M, Minamisawa S, Hirotani S, Ishikawa Y. Developmental changes in gene expression of Epac and its upregulation in myocardial hypertrophy. American journal of physiology. Heart and circulatory physiology. 2007;293:H1662-1672 171. Dodge-Kafka KL, Soughayer J, Pare GC, Carlisle Michel JJ, Langeberg LK, Kapiloff MS, Scott JD. The protein kinase A anchoring protein mAKAP coordinates two integrated cAMP effector pathways. Nature. 2005;437:574-578 172. Metrich M, Berthouze M, Morel E, Crozatier B, Gomez AM, Lezoualc'h F. Role of the cAMP-binding protein Epac in cardiovascular physiology and pathophysiology. Pflugers Archiv : European journal of physiology. 2010;459:535-546 173. Vliem MJ, Ponsioen B, Schwede F, Pannekoek WJ, Riedl J, Kooistra MR, Jalink K, Genieser HG, Bos JL, Rehmann H. 8-pCPT-2'-o-me-cAMP-AM: An improved Epac-selective cAMP analogue. Chembiochem : a European journal of chemical biology. 2008;9:2052-2054 174. Ster J, De Bock F, Guerineau NC, Janossy A, Barrere-Lemaire S, Bos JL, Bockaert J, Fagni L. Exchange protein activated by cAMP (Epac) mediates cAMP activation of p38 MAPK and modulation of Ca2+- dependent K+ channels in cerebellar neurons. Proceedings of the National
237
Academy of Sciences of the United States of America. 2007;104:2519- 2524 175. Purves GI, Kamishima T, Davies LM, Quayle JM, Dart C. Exchange protein activated by cAMP (Epac) mediates cAMP-dependent but protein kinase A-insensitive modulation of vascular ATP-sensitive potassium channels. The Journal of physiology. 2009;587:3639-3650 176. Kang G, Chepurny OG, Malester B, Rindler MJ, Rehmann H, Bos JL, Schwede F, Coetzee WA, Holz GG. cAMP sensor Epac as a determinant of ATP-sensitive potassium channel activity in human pancreatic beta cells and rat INS-1 cells. The Journal of physiology. 2006;573:595-609 177. Zhang CL, Katoh M, Shibasaki T, Minami K, Sunaga Y, Takahashi H, Yokoi N, Iwasaki M, Miki T, Seino S. The cAMP sensor Epac2 is a direct target of antidiabetic sulfonylurea drugs. Science. 2009;325:607-610 178. Novara M, Baldelli P, Cavallari D, Carabelli V, Giancippoli A, Carbone E. Exposure to cAMP and beta-adrenergic stimulation recruits Ca(v)3 T-type channels in rat chromaffin cells through Epac cAMP-receptor proteins. The Journal of physiology. 2004;558:433-449 179. Brette F, Blandin E, Simard C, Guinamard R, Salle L. Epac activator critically regulates action potential duration by decreasing potassium current in rat adult ventricle. Journal of molecular and cellular cardiology. 2013;57:96-105 180. Tsalkova T, Mei FC, Li S, Chepurny OG, Leech CA, Liu T, Holz GG, Woods VL, Jr., Cheng X. Isoform-specific antagonists of exchange proteins directly activated by cAMP. Proceedings of the National Academy of Sciences of the United States of America. 2012;109:18613-18618 181. Camelliti P, Borg TK, Kohl P. Structural and functional characterisation of cardiac fibroblasts. Cardiovascular research. 2005;65:40-51 182. Fan D, Takawale A, Lee J, Kassiri Z. Cardiac fibroblasts, fibrosis and extracellular matrix remodeling in heart disease. Fibrogenesis & tissue repair. 2012;5:15
238
183. Porter KE, Turner NA. Cardiac fibroblasts: At the heart of myocardial remodeling. Pharmacology & therapeutics. 2009;123:255-278 184. Camelliti P, Green CR, LeGrice I, Kohl P. Fibroblast network in rabbit sinoatrial node: Structural and functional identification of homogeneous and heterogeneous cell coupling. Circulation research. 2004;94:828-835 185. Chen W, Frangogiannis NG. The role of inflammatory and fibrogenic pathways in heart failure associated with aging. Heart failure reviews. 2010;15:415-422 186. Burstein B, Nattel S. Atrial fibrosis: Mechanisms and clinical relevance in atrial fibrillation. Journal of the American College of Cardiology. 2008;51:802-809 187. Weber KT, Pick R, Jalil JE, Janicki JS, Carroll EP. Patterns of myocardial fibrosis. Journal of molecular and cellular cardiology. 1989;21 Suppl 5:121-131 188. Xu J, Cui G, Esmailian F, Plunkett M, Marelli D, Ardehali A, Odim J, Laks H, Sen L. Atrial extracellular matrix remodeling and the maintenance of atrial fibrillation. Circulation. 2004;109:363-368 189. Grammer JB, Bohm J, Dufour A, Benz M, Lange R, Bauernschmitt R. Atrial fibrosis in heart surgery patients decreased collagen III/I ratio in postoperative atrial fibrillation. Basic research in cardiology. 2005;100:288- 294 190. Hanna N, Cardin S, Leung TK, Nattel S. Differences in atrial versus ventricular remodeling in dogs with ventricular tachypacing-induced congestive heart failure. Cardiovascular research. 2004;63:236-244 191. Frustaci A, Chimenti C, Bellocci F, Morgante E, Russo MA, Maseri A. Histological substrate of atrial biopsies in patients with lone atrial fibrillation. Circulation. 1997;96:1180-1184 192. Boldt A, Wetzel U, Lauschke J, Weigl J, Gummert J, Hindricks G, Kottkamp H, Dhein S. Fibrosis in left atrial tissue of patients with atrial
239
fibrillation with and without underlying mitral valve disease. Heart. 2004;90:400-405 193. Armstrong PW, Stopps TP, Ford SE, de Bold AJ. Rapid ventricular pacing in the dog: Pathophysiologic studies of heart failure. Circulation. 1986;74:1075-1084 194. Li D, Fareh S, Leung TK, Nattel S. Promotion of atrial fibrillation by heart failure in dogs: Atrial remodeling of a different sort. Circulation. 1999;100:87-95 195. Cardin S, Libby E, Pelletier P, Le Bouter S, Shiroshita-Takeshita A, Le Meur N, Leger J, Demolombe S, Ponton A, Glass L, Nattel S. Contrasting gene expression profiles in two canine models of atrial fibrillation. Circulation research. 2007;100:425-433 196. Cardin S, Li D, Thorin-Trescases N, Leung TK, Thorin E, Nattel S. Evolution of the atrial fibrillation substrate in experimental congestive heart failure: Angiotensin-dependent and -independent pathways. Cardiovascular research. 2003;60:315-325 197. Verheule S, Sato T, Everett Tt, Engle SK, Otten D, Rubart-von der Lohe M, Nakajima HO, Nakajima H, Field LJ, Olgin JE. Increased vulnerability to atrial fibrillation in transgenic mice with selective atrial fibrosis caused by overexpression of TGF-beta1. Circulation research. 2004;94:1458-1465 198. Mines GR. On dynamic equilibrium in the heart. The Journal of physiology. 1913;46:349-383 199. Comtois P, Kneller J, Nattel S. Of circles and spirals: Bridging the gap between the leading circle and spiral wave concepts of cardiac reentry. Europace : European pacing, arrhythmias, and cardiac electrophysiology : journal of the working groups on cardiac pacing, arrhythmias, and cardiac cellular electrophysiology of the European Society of Cardiology. 2005;7 Suppl 2:10-20 200. Zlochiver S, Munoz V, Vikstrom KL, Taffet SM, Berenfeld O, Jalife J. Electrotonic myofibroblast-to-myocyte coupling increases propensity to
240
reentrant arrhythmias in two-dimensional cardiac monolayers. Biophysical journal. 2008;95:4469-4480 201. Petrov VV, Fagard RH, Lijnen PJ. Stimulation of collagen production by transforming growth factor-beta1 during differentiation of cardiac fibroblasts to myofibroblasts. Hypertension. 2002;39:258-263 202. Katz AM. Proliferative signaling and disease progression in heart failure. Circulation journal : official journal of the Japanese Circulation Society. 2002;66:225-231 203. Ehrlich JR, Hohnloser SH, Nattel S. Role of angiotensin system and effects of its inhibition in atrial fibrillation: Clinical and experimental evidence. European heart journal. 2006;27:512-518 204. Xiao HD, Fuchs S, Campbell DJ, Lewis W, Dudley SC, Jr., Kasi VS, Hoit BD, Keshelava G, Zhao H, Capecchi MR, Bernstein KE. Mice with cardiac- restricted angiotensin-converting enzyme (ACE) have atrial enlargement, cardiac arrhythmia, and sudden death. The American journal of pathology. 2004;165:1019-1032 205. Hunyady L, Catt KJ. Pleiotropic AT1 receptor signaling pathways mediating physiological and pathogenic actions of angiotensin II. Molecular endocrinology. 2006;20:953-970 206. Burstein B, Libby E, Calderone A, Nattel S. Differential behaviors of atrial versus ventricular fibroblasts: A potential role for platelet-derived growth factor in atrial-ventricular remodeling differences. Circulation. 2008;117:1630-1641 207. Rosenkranz S. TGF-beta1 and angiotensin networking in cardiac remodeling. Cardiovascular research. 2004;63:423-432 208. Schiller M, Javelaud D, Mauviel A. TGF-beta-induced smad signaling and gene regulation: Consequences for extracellular matrix remodeling and wound healing. Journal of dermatological science. 2004;35:83-92 209. Heldin CH, Miyazono K, ten Dijke P. TGF-beta signalling from cell membrane to nucleus through smad proteins. Nature. 1997;390:465-471
241
210. Attisano L, Wrana JL. Signal transduction by the TGF-beta superfamily. Science. 2002;296:1646-1647 211. Li X, Ma C, Dong J, Liu X, Long D, Tian Y, Yu R. The fibrosis and atrial fibrillation: Is the transforming growth factor-beta 1 a candidate etiology of atrial fibrillation. Medical hypotheses. 2008;70:317-319 212. Ahmed MS, Oie E, Vinge LE, Yndestad A, Oystein Andersen G, Andersson Y, Attramadal T, Attramadal H. Connective tissue growth factor--a novel mediator of angiotensin II-stimulated cardiac fibroblast activation in heart failure in rats. Journal of molecular and cellular cardiology. 2004;36:393-404 213. Chen MM, Lam A, Abraham JA, Schreiner GF, Joly AH. CTGF expression is induced by TGF- beta in cardiac fibroblasts and cardiac myocytes: A potential role in heart fibrosis. Journal of molecular and cellular cardiology. 2000;32:1805-1819 214. Yokoyama U, Patel HH, Lai NC, Aroonsakool N, Roth DM, Insel PA. The cyclic AMP effector epac integrates pro- and anti-fibrotic signals. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:6386-6391 215. Villarreal F, Epperson SA, Ramirez-Sanchez I, Yamazaki KG, Brunton LL. Regulation of cardiac fibroblast collagen synthesis by adenosine: Roles for Epac and PI3K. American journal of physiology. Cell physiology. 2009;296:C1178-1184 216. Chen C, Du J, Feng W, Song Y, Lu Z, Xu M, Li Z, Zhang Y. Beta- adrenergic receptors stimulate interleukin-6 production through Epac- dependent activation of PKCdelta/p38 MAPK signalling in neonatal mouse cardiac fibroblasts. British journal of pharmacology. 2012;166:676-688 217. Insel PA, Murray F, Yokoyama U, Romano S, Yun H, Brown L, Snead A, Lu D, Aroonsakool N. cAMP and Epac in the regulation of tissue fibrosis. British journal of pharmacology. 2012;166:447-456
242
218. Marx SO, Kurokawa J, Reiken S, Motoike H, D'Armiento J, Marks AR, Kass RS. Requirement of a macromolecular signaling complex for beta adrenergic receptor modulation of the KCNQ1-KCNE1 potassium channel. Science. 2002;295:496-499 219. Kurokawa J, Chen L, Kass RS. Requirement of subunit expression for cAMP-mediated regulation of a heart potassium channel. Proceedings of the National Academy of Sciences of the United States of America. 2003;100:2122-2127 220. Shibata MC, Flather MD, Wang D. Systematic review of the impact of beta blockers on mortality and hospital admissions in heart failure. European journal of heart failure. 2001;3:351-357 221. Akar FG, Wu RC, Juang GJ, Tian Y, Burysek M, Disilvestre D, Xiong W, Armoundas AA, Tomaselli GF. Molecular mechanisms underlying K+ current downregulation in canine tachycardia-induced heart failure. American journal of physiology. Heart and circulatory physiology. 2005;288:H2887-2896 222. Splawski I, Shen J, Timothy KW, Lehmann MH, Priori S, Robinson JL, Moss AJ, Schwartz PJ, Towbin JA, Vincent GM, Keating MT. Spectrum of mutations in long-QT syndrome genes. KvLQT1, HERG, SCN5a, KCNE1, and KCNE2. Circulation. 2000;102:1178-1185 223. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology. 2002;3:RESEARCH0034 224. Paddison PJ, Cleary M, Silva JM, Chang K, Sheth N, Sachidanandam R, Hannon GJ. Cloning of short hairpin RNAs for gene knockdown in mammalian cells. Nature methods. 2004;1:163-167 225. Luo J, Deng ZL, Luo X, Tang N, Song WX, Chen J, Sharff KA, Luu HH, Haydon RC, Kinzler KW, Vogelstein B, He TC. A protocol for rapid
243
generation of recombinant adenoviruses using the adeasy system. Nature protocols. 2007;2:1236-1247 226. Rockman HA, Koch WJ, Lefkowitz RJ. Seven-transmembrane-spanning receptors and heart function. Nature. 2002;415:206-212 227. Christensen AE, Selheim F, de Rooij J, Dremier S, Schwede F, Dao KK, Martinez A, Maenhaut C, Bos JL, Genieser HG, Doskeland SO. cAMP analog mapping of Epac1 and cAMP kinase. Discriminating analogs demonstrate that Epac and cAMP kinase act synergistically to promote PC-12 cell neurite extension. The Journal of biological chemistry. 2003;278:35394-35402 228. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes & development. 2003;17:2205- 2232 229. Yoo B, Lemaire A, Mangmool S, Wolf MJ, Curcio A, Mao L, Rockman HA. Beta1-adrenergic receptors stimulate cardiac contractility and CaMKII activation in vivo and enhance cardiac dysfunction following myocardial infarction. American journal of physiology. Heart and circulatory physiology. 2009;297:H1377-1386 230. Tsuji Y, Zicha S, Qi XY, Kodama I, Nattel S. Potassium channel subunit remodeling in rabbits exposed to long-term bradycardia or tachycardia: Discrete arrhythmogenic consequences related to differential delayed- rectifier changes. Circulation. 2006;113:345-355 231. Tsuji Y, Opthof T, Kamiya K, Yasui K, Liu W, Lu Z, Kodama I. Pacing- induced heart failure causes a reduction of delayed rectifier potassium currents along with decreases in calcium and transient outward currents in rabbit ventricle. Cardiovascular research. 2000;48:300-309 232. Li D, Melnyk P, Feng J, Wang Z, Petrecca K, Shrier A, Nattel S. Effects of experimental heart failure on atrial cellular and ionic electrophysiology. Circulation. 2000;101:2631-2638
244
233. Petkova-Kirova PS, Gursoy E, Mehdi H, McTiernan CF, London B, Salama G. Electrical remodeling of cardiac myocytes from mice with heart failure due to the overexpression of tumor necrosis factor-alpha. American journal of physiology. Heart and circulatory physiology. 2006;290:H2098- 2107 234. Rose J, Armoundas AA, Tian Y, DiSilvestre D, Burysek M, Halperin V, O'Rourke B, Kass DA, Marban E, Tomaselli GF. Molecular correlates of altered expression of potassium currents in failing rabbit myocardium. American journal of physiology. Heart and circulatory physiology. 2005;288:H2077-2087 235. Furukawa T, Kurokawa J. Potassium channel remodeling in cardiac hypertrophy. Journal of molecular and cellular cardiology. 2006;41:753- 761 236. Volders PG, Sipido KR, Vos MA, Kulcsar A, Verduyn SC, Wellens HJ. Cellular basis of biventricular hypertrophy and arrhythmogenesis in dogs with chronic complete atrioventricular block and acquired torsade de pointes. Circulation. 1998;98:1136-1147 237. Ramakers C, Vos MA, Doevendans PA, Schoenmakers M, Wu YS, Scicchitano S, Iodice A, Thomas GP, Antzelevitch C, Dumaine R. Coordinated down-regulation of KCNQ1 and KCNE1 expression contributes to reduction of I(Ks) in canine hypertrophied hearts. Cardiovascular research. 2003;57:486-496 238. Vrtovec B, Delgado R, Zewail A, Thomas CD, Richartz BM, Radovancevic B. Prolonged QTc interval and high B-type natriuretic peptide levels together predict mortality in patients with advanced heart failure. Circulation. 2003;107:1764-1769 239. Metrich M, Morel E, Berthouze M, Pereira L, Charron P, Gomez AM, Lezoualc'h F. Functional characterization of the cAMP-binding proteins Epac in cardiac myocytes. Pharmacological reports : PR. 2009;61:146-153
245
240. Rossow CF, Dilly KW, Yuan C, Nieves-Cintron M, Cabarrus JL, Santana LF. NFATc3-dependent loss of I(to) gradient across the left ventricular wall during chronic beta adrenergic stimulation. Journal of molecular and cellular cardiology. 2009;46:249-256 241. Rossow CF, Minami E, Chase EG, Murry CE, Santana LF. NFATc3- induced reductions in voltage-gated K+ currents after myocardial infarction. Circulation research. 2004;94:1340-1350 242. Rossow CF, Dilly KW, Santana LF. Differential calcineurin/NFATc3 activity contributes to the Ito transmural gradient in the mouse heart. Circulation research. 2006;98:1306-1313 243. Xiao L, Coutu P, Villeneuve LR, Tadevosyan A, Maguy A, Le Bouter S, Allen BG, Nattel S. Mechanisms underlying rate-dependent remodeling of transient outward potassium current in canine ventricular myocytes. Circulation research. 2008;103:733-742 244. Gong N, Bodi I, Zobel C, Schwartz A, Molkentin JD, Backx PH. Calcineurin increases cardiac transient outward K+ currents via transcriptional up-regulation of Kv4.2 channel subunits. The Journal of biological chemistry. 2006;281:38498-38506 245. Qi XY, Yeh YH, Xiao L, Burstein B, Maguy A, Chartier D, Villeneuve LR, Brundel BJ, Dobrev D, Nattel S. Cellular signaling underlying atrial tachycardia remodeling of L-type calcium current. Circulation research. 2008;103:845-854 246. Dolmetsch RE, Lewis RS, Goodnow CC, Healy JI. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature. 1997;386:855-858 247. Sun C, Sumners C, Raizada MK. Chronotropic action of angiotensin II in neurons via protein kinase C and CaMKII. Hypertension. 2002;39:562-566 248. Wagner S, Hacker E, Grandi E, Weber SL, Dybkova N, Sossalla S, Sowa T, Fabritz L, Kirchhof P, Bers DM, Maier LS. Ca/calmodulin kinase II
246
differentially modulates potassium currents. Circulation. Arrhythmia and electrophysiology. 2009;2:285-294 249. Khoo MS, Li J, Singh MV, Yang Y, Kannankeril P, Wu Y, Grueter CE, Guan X, Oddis CV, Zhang R, Mendes L, Ni G, Madu EC, Yang J, Bass M, Gomez RJ, Wadzinski BE, Olson EN, Colbran RJ, Anderson ME. Death, cardiac dysfunction, and arrhythmias are increased by calmodulin kinase II in calcineurin cardiomyopathy. Circulation. 2006;114:1352-1359 250. Sabbah HN, Goldberg AD, Schoels W, Kono T, Webb C, Brachmann J, Goldstein S. Spontaneous and inducible ventricular arrhythmias in a canine model of chronic heart failure: Relation to haemodynamics and sympathoadrenergic activation. European heart journal. 1992;13:1562- 1572 251. Schwartz PJ. Pharmacological and non-pharmacological management of the congenital long QT syndrome: The rationale. Pharmacology & therapeutics. 2011;131:171-177 252. Romey G, Attali B, Chouabe C, Abitbol I, Guillemare E, Barhanin J, Lazdunski M. Molecular mechanism and functional significance of the mink control of the KvLQT1 channel activity. The Journal of biological chemistry. 1997;272:16713-16716 253. Lu Z, Kamiya K, Opthof T, Yasui K, Kodama I. Density and kinetics of I(Kr) and I(Ks) in guinea pig and rabbit ventricular myocytes explain different efficacy of I(Ks) blockade at high heart rate in guinea pig and rabbit: Implications for arrhythmogenesis in humans. Circulation. 2001;104:951- 956 254. Zicha S, Moss I, Allen B, Varro A, Papp J, Dumaine R, Antzelevich C, Nattel S. Molecular basis of species-specific expression of repolarizing K+ currents in the heart. American journal of physiology. Heart and circulatory physiology. 2003;285:H1641-1649
247
255. Pavlovic D, McLatchie LM, Shattock MJ. The rate of loss of T-tubules in cultured adult ventricular myocytes is species dependent. Experimental physiology. 2010;95:518-527 256. Skwor TA, Cho H, Cassidy C, Yoshimura T, McMurray DN. Recombinant guinea pig CCL5 (RANTES) differentially modulates cytokine production in alveolar and peritoneal macrophages. J Leukoc Biol. 2004;76:1229-1239 257. Rehal S, Blanckaert P, Roizes S, von der Weid PY. Characterization of biosynthesis and modes of action of prostaglandin E2 and prostacyclin in guinea pig mesenteric lymphatic vessels. Br J Pharmacol. 2009;158:1961- 1970 258. Navarro-Lopez J, Jimenez-Diaz L, Geranton SM, Ashmore JF. Electrophysiological and molecular analysis of Kv7/KCNQ potassium channels in the inferior colliculus of adult guinea pig. J Mol Neurosci. 2009;37:263-268 259. Hu A, Jiao X, Gao E, Koch WJ, Sharifi-Azad S, Grunwald Z, Ma XL, Sun JZ. Chronic beta-adrenergic receptor stimulation induces cardiac apoptosis and aggravates myocardial ischemia/reperfusion injury by provoking inducible nitric-oxide synthase-mediated nitrative stress. The Journal of pharmacology and experimental therapeutics. 2006;318:469- 475 260. Piper RD, Li FY, Myers ML, Sibbald WJ. Effects of isoproterenol on myocardial structure and function in septic rats. Journal of applied physiology. 1999;86:993-1001 261. Heather LC, Catchpole AF, Stuckey DJ, Cole MA, Carr CA, Clarke K. Isoproterenol induces in vivo functional and metabolic abnormalities: Similar to those found in the infarcted rat heart. Journal of physiology and pharmacology : an official journal of the Polish Physiological Society. 2009;60:31-39 262. Oudit GY, Crackower MA, Eriksson U, Sarao R, Kozieradzki I, Sasaki T, Irie-Sasaki J, Gidrewicz D, Rybin VO, Wada T, Steinberg SF, Backx PH,
248
Penninger JM. Phosphoinositide 3-kinase gamma-deficient mice are protected from isoproterenol-induced heart failure. Circulation. 2003;108:2147-2152 263. Grimm D, Elsner D, Schunkert H, Pfeifer M, Griese D, Bruckschlegel G, Muders F, Riegger GA, Kromer EP. Development of heart failure following isoproterenol administration in the rat: Role of the renin-angiotensin system. Cardiovascular research. 1998;37:91-100 264. Teerlink JR, Pfeffer JM, Pfeffer MA. Progressive ventricular remodeling in response to diffuse isoproterenol-induced myocardial necrosis in rats. Circulation research. 1994;75:105-113 265. Shipsey SJ, Bryant SM, Hart G. Effects of hypertrophy on regional action potential characteristics in the rat left ventricle: A cellular basis for T-wave inversion? Circulation. 1997;96:2061-2068 266. Krandycheva V, Kharin S, Strelkova M, Shumikhin K, Sobolev A, Shmakov D. Ventricular repolarization in a rat model of global heart failure. Clinical and experimental pharmacology & physiology. 2013;40:431-437 267. Meszaros J, Khananshvili D, Hart G. Mechanisms underlying delayed afterdepolarizations in hypertrophied left ventricular myocytes of rats. American journal of physiology. Heart and circulatory physiology. 2001;281:H903-914 268. Boluyt MO, Long X, Eschenhagen T, Mende U, Schmitz W, Crow MT, Lakatta EG. Isoproterenol infusion induces alterations in expression of hypertrophy-associated genes in rat heart. The American journal of physiology. 1995;269:H638-647 269. Li H, Lu ZZ, Chen C, Song Y, Xiao H, Zhang YY. Echocardiographic assessment of beta-adrenoceptor stimulation-induced heart failure with reduced heart rate in mice. Clinical and experimental pharmacology & physiology. 2014;41:58-66 270. Soltysinska E, Olesen SP, Osadchii OE. Myocardial structural, contractile and electrophysiological changes in the guinea-pig heart failure model
249
induced by chronic sympathetic activation. Experimental physiology. 2011;96:647-663 271. Reffelmann T, Kloner RA. Transthoracic echocardiography in rats. Evalution of commonly used indices of left ventricular dimensions, contractile performance, and hypertrophy in a genetic model of hypertrophic heart failure (SHHF-Mcc-facp-Rats) in comparison with Wistar rats during aging. Basic research in cardiology. 2003;98:275-284 272. Osadchii OE. Cardiac hypertrophy induced by sustained beta- adrenoreceptor activation: Pathophysiological aspects. Heart failure reviews. 2007;12:66-86 273. Gustafsson AB, Brunton LL. Beta-adrenergic stimulation of rat cardiac fibroblasts enhances induction of nitric-oxide synthase by interleukin-1beta via message stabilization. Molecular pharmacology. 2000;58:1470-1478 274. Turner NA, Porter KE, Smith WH, White HL, Ball SG, Balmforth AJ. Chronic beta2-adrenergic receptor stimulation increases proliferation of human cardiac fibroblasts via an autocrine mechanism. Cardiovascular research. 2003;57:784-792 275. Meszaros JG, Gonzalez AM, Endo-Mochizuki Y, Villegas S, Villarreal F, Brunton LL. Identification of G protein-coupled signaling pathways in cardiac fibroblasts: Cross talk between G(q) and G(s). American journal of physiology. Cell physiology. 2000;278:C154-162 276. Nakatsuji S, Yamate J, Kuwamura M, Kotani T, Sakuma S. In vivo responses of macrophages and myofibroblasts in the healing following isoproterenol-induced myocardial injury in rats. Virchows Archiv : an international journal of pathology. 1997;430:63-69 277. Benjamin IJ, Jalil JE, Tan LB, Cho K, Weber KT, Clark WA. Isoproterenol- induced myocardial fibrosis in relation to myocyte necrosis. Circulation research. 1989;65:657-670 278. Kobayashi M, Machida N, Mitsuishi M, Yamane Y. Beta-blocker improves survival, left ventricular function, and myocardial remodeling in
250
hypertensive rats with diastolic heart failure. American journal of hypertension. 2004;17:1112-1119 279. Asai K, Yang GP, Geng YJ, Takagi G, Bishop S, Ishikawa Y, Shannon RP, Wagner TE, Vatner DE, Homcy CJ, Vatner SF. Beta-adrenergic receptor blockade arrests myocyte damage and preserves cardiac function in the transgenic G(salpha) mouse. The Journal of clinical investigation. 1999;104:551-558 280. Ostrom RS, Naugle JE, Hase M, Gregorian C, Swaney JS, Insel PA, Brunton LL, Meszaros JG. Angiotensin II enhances adenylyl cyclase signaling via Ca2+/calmodulin. Gq-Gs cross-talk regulates collagen production in cardiac fibroblasts. The Journal of biological chemistry. 2003;278:24461-24468 281. Liu X, Sun SQ, Hassid A, Ostrom RS. cAMP inhibits transforming growth factor-beta-stimulated collagen synthesis via inhibition of extracellular signal-regulated kinase 1/2 and Smad signaling in cardiac fibroblasts. Molecular pharmacology. 2006;70:1992-2003 282. Liu X, Thangavel M, Sun SQ, Kaminsky J, Mahautmr P, Stitham J, Hwa J, Ostrom RS. Adenylyl cyclase type 6 overexpression selectively enhances beta-adrenergic and prostacyclin receptor-mediated inhibition of cardiac fibroblast function because of colocalization in lipid rafts. Naunyn- Schmiedeberg's archives of pharmacology. 2008;377:359-369 283. Cha TJ, Ehrlich JR, Zhang L, Shi YF, Tardif JC, Leung TK, Nattel S. Dissociation between ionic remodeling and ability to sustain atrial fibrillation during recovery from experimental congestive heart failure. Circulation. 2004;109:412-418 284. Li D, Zhang L, Kneller J, Nattel S. Potential ionic mechanism for repolarization differences between canine right and left atrium. Circulation research. 2001;88:1168-1175 285. Jinnin M, Ihn H, Tamaki K. Characterization of SIS3, a novel specific inhibitor of Smad3, and its effect on transforming growth factor-beta1-
251
induced extracellular matrix expression. Molecular pharmacology. 2006;69:597-607 286. Lim H, Zhu YZ. Role of transforming growth factor-beta in the progression of heart failure. Cellular and molecular life sciences : CMLS. 2006;63:2584-2596 287. Border WA, Noble NA. Fibrosis linked to TGF-beta in yet another disease. The Journal of clinical investigation. 1995;96:655-656 288. Bhambi B, Eghbali M. Effect of norepinephrine on myocardial collagen gene expression and response of cardiac fibroblasts after norepinephrine treatment. The American journal of pathology. 1991;139:1131-1142 289. Swaney JS, Roth DM, Olson ER, Naugle JE, Meszaros JG, Insel PA. Inhibition of cardiac myofibroblast formation and collagen synthesis by activation and overexpression of adenylyl cyclase. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:437-442 290. Huang SK, Wettlaufer SH, Chung J, Peters-Golden M. Prostaglandin E2 inhibits specific lung fibroblast functions via selective actions of PKA and Epac-1. American journal of respiratory cell and molecular biology. 2008;39:482-489 291. Fisher SA, Absher M. Norepinephrine and Ang II stimulate secretion of TGF-beta by neonatal rat cardiac fibroblasts in vitro. The American journal of physiology. 1995;268:C910-917 292. Akiyama-Uchida Y, Ashizawa N, Ohtsuru A, Seto S, Tsukazaki T, Kikuchi H, Yamashita S, Yano K. Norepinephrine enhances fibrosis mediated by TGF-beta in cardiac fibroblasts. Hypertension. 2002;40:148-154 293. Takahashi N, Calderone A, Izzo NJ, Jr., Maki TM, Marsh JD, Colucci WS. Hypertrophic stimuli induce transforming growth factor-beta 1 expression in rat ventricular myocytes. The Journal of clinical investigation. 1994;94:1470-1476
252
294. Divakaran V, Adrogue J, Ishiyama M, Entman ML, Haudek S, Sivasubramanian N, Mann DL. Adaptive and maladptive effects of Smad3 signaling in the adult heart after hemodynamic pressure overloading. Circulation. Heart failure. 2009;2:633-642 295. Sato M, Muragaki Y, Saika S, Roberts AB, Ooshima A. Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. The Journal of clinical investigation. 2003;112:1486-1494 296. Ashcroft GS, Yang X, Glick AB, Weinstein M, Letterio JL, Mizel DE, Anzano M, Greenwell-Wild T, Wahl SM, Deng C, Roberts AB. Mice lacking Smad3 show accelerated wound healing and an impaired local inflammatory response. Nature cell biology. 1999;1:260-266 297. Flanders KC. Smad3 as a mediator of the fibrotic response. International journal of experimental pathology. 2004;85:47-64 298. Aranguiz-Urroz P, Canales J, Copaja M, Troncoso R, Vicencio JM, Carrillo C, Lara H, Lavandero S, Diaz-Araya G. Beta(2)-adrenergic receptor regulates cardiac fibroblast autophagy and collagen degradation. Biochimica et biophysica acta. 2011;1812:23-31 299. Sakabe M, Shiroshita-Takeshita A, Maguy A, Dumesnil C, Nigam A, Leung TK, Nattel S. Omega-3 polyunsaturated fatty acids prevent atrial fibrillation associated with heart failure but not atrial tachycardia remodeling. Circulation. 2007;116:2101-2109 300. Shiroshita-Takeshita A, Sakabe M, Haugan K, Hennan JK, Nattel S. Model-dependent effects of the gap junction conduction-enhancing antiarrhythmic peptide rotigaptide (ZP123) on experimental atrial fibrillation in dogs. Circulation. 2007;115:310-318 301. Dawson K, Wakili R, Ordog B, Clauss S, Chen Y, Iwasaki Y, Voigt N, Qi XY, Sinner MF, Dobrev D, Kaab S, Nattel S. MicroRNA29: A mechanistic contributor and potential biomarker in atrial fibrillation. Circulation. 2013;127:1466-1475, 1475e1461-1428
253
302. Yeh YH, Wakili R, Qi XY, Chartier D, Boknik P, Kaab S, Ravens U, Coutu P, Dobrev D, Nattel S. Calcium-handling abnormalities underlying atrial arrhythmogenesis and contractile dysfunction in dogs with congestive heart failure. Circulation. Arrhythmia and electrophysiology. 2008;1:93-102 303. Xiang Y, Kobilka BK. Myocyte adrenoceptor signaling pathways. Science. 2003;300:1530-1532 304. Santana LF. NFAT-dependent excitation-transcription coupling in heart. Circulation research. 2008;103:681-683 305. Ruiz-Hurtado G, Morel E, Dominguez-Rodriguez A, Llach A, Lezoualc'h F, Benitah JP, Gomez AM. Epac in cardiac calcium signaling. Journal of molecular and cellular cardiology. 2013;58:162-171 306. Bisserier M, Blondeau JP, Lezoualc'h F. Epac proteins: Specific ligands and role in cardiac remodelling. Biochemical Society transactions. 2014;42:257-264 307. Zankov DP, Omatsu-Kanbe M, Isono T, Toyoda F, Ding WG, Matsuura H, Horie M. Angiotensin II potentiates the slow component of delayed rectifier K+ current via the AT1 receptor in guinea pig atrial myocytes. Circulation. 2006;113:1278-1286 308. Matavel A, Lopes CM. PKC activation and PIP(2) depletion underlie biphasic regulation of IKs by Gq-coupled receptors. Journal of molecular and cellular cardiology. 2009;46:704-712 309. Li J, Marionneau C, Zhang R, Shah V, Hell JW, Nerbonne JM, Anderson ME. Calmodulin kinase II inhibition shortens action potential duration by upregulation of K+ currents. Circulation research. 2006;99:1092-1099 310. Rosati B, McKinnon D. Regulation of ion channel expression. Circulation research. 2004;94:874-883 311. Pikkarainen S, Tokola H, Kerkela R, Ruskoaho H. GATA transcription factors in the developing and adult heart. Cardiovascular research. 2004;63:196-207
254
312. Morimoto T, Hasegawa K, Wada H, Kakita T, Kaburagi S, Yanazume T, Sasayama S. Calcineurin-GATA4 pathway is involved in beta-adrenergic agonist-responsive endothelin-1 transcription in cardiac myocytes. The Journal of biological chemistry. 2001;276:34983-34989 313. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, Keating MT. Coassembly of K(v)LQT1 and mink (IsK) proteins to form cardiac I(Ks) potassium channel. Nature. 1996;384:80-83 314. Takumi T, Ohkubo H, Nakanishi S. Cloning of a membrane protein that induces a slow voltage-gated potassium current. Science. 1988;242:1042- 1045 315. Nakajo K, Kubo Y. Nano-environmental changes by KCNE proteins modify KCNQ channel function. Channels. 2011;5:397-401 316. Wang KW, Goldstein SA. Subunit composition of minK potassium channels. Neuron. 1995;14:1303-1309 317. Chen H, Kim LA, Rajan S, Xu S, Goldstein SA. Charybdotoxin binding in the I(Ks) pore demonstrates two minK subunits in each channel complex. Neuron. 2003;40:15-23 318. Osteen JD, Sampson KJ, Kass RS. The cardiac IKs channel, complex indeed. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:18751-18752 319. Nakajo K, Ulbrich MH, Kubo Y, Isacoff EY. Stoichiometry of the KCNQ1 - KCNE1 ion channel complex. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:18862-18867 320. Wang W, Xia J, Kass RS. Mink-KvLQT1 fusion proteins, evidence for multiple stoichiometries of the assembled IsK channel. The Journal of biological chemistry. 1998;273:34069-34074 321. Barhanin J, Attali B, Lazdunski M. IKs, a slow and intriguing cardiac K+ channel and its associated long QT diseases. Trends in cardiovascular medicine. 1998;8:207-214
255
322. Olmedo I, Munoz C, Guzman N, Catalan M, Vivar R, Ayala P, Humeres C, Aranguiz P, Garcia L, Velarde V, Diaz-Araya G. Epac expression and function in cardiac fibroblasts and myofibroblasts. Toxicology and applied pharmacology. 2013;272:414-422 323. Liu X, Li F, Sun SQ, Thangavel M, Kaminsky J, Balazs L, Ostrom RS. Fibroblast-specific expression of AC6 enhances beta-adrenergic and prostacyclin signaling and blunts bleomycin-induced pulmonary fibrosis. American journal of physiology. Lung cellular and molecular physiology. 2010;298:L819-829 324. Insel PA, Snead A, Murray F, Zhang L, Yokouchi H, Katakia T, Kwon O, Dimucci D, Wilderman A. GPCR expression in tissues and cells: Are the optimal receptors being used as drug targets? British journal of pharmacology. 2012;165:1613-1616 325. Bers DM. Calcium cycling and signaling in cardiac myocytes. Annual review of physiology. 2008;70:23-49 326. Roderick HL, Bootman MD. Bi-directional signalling from the InsP3 receptor: Regulation by calcium and accessory factors. Biochemical Society transactions. 2003;31:950-953 327. Berridge MJ. Inositol trisphosphate and calcium signalling mechanisms. Biochimica et biophysica acta. 2009;1793:933-940 328. Bootman MD, Fearnley C, Smyrnias I, MacDonald F, Roderick HL. An update on nuclear calcium signalling. Journal of cell science. 2009;122:2337-2350 329. Hohendanner F, McCulloch AD, Blatter LA, Michailova AP. Calcium and IP3 dynamics in cardiac myocytes: Experimental and computational perspectives and approaches. Frontiers in pharmacology. 2014;5:35 330. Wu X, Zhang T, Bossuyt J, Li X, McKinsey TA, Dedman JR, Olson EN, Chen J, Brown JH, Bers DM. Local InsP3-dependent perinuclear Ca2+ signaling in cardiac myocyte excitation-transcription coupling. The Journal of clinical investigation. 2006;116:675-682
256
331. Kockskamper J, Zima AV, Roderick HL, Pieske B, Blatter LA, Bootman MD. Emerging roles of inositol 1,4,5-trisphosphate signaling in cardiac myocytes. Journal of molecular and cellular cardiology. 2008;45:128-147 332. Go LO, Moschella MC, Watras J, Handa KK, Fyfe BS, Marks AR. Differential regulation of two types of intracellular calcium release channels during end-stage heart failure. The Journal of clinical investigation. 1995;95:888-894 333. Ai X, Curran JW, Shannon TR, Bers DM, Pogwizd SM. Ca2+/calmodulin- dependent protein kinase modulates cardiac ryanodine receptor phosphorylation and sarcoplasmic reticulum Ca2+ leak in heart failure. Circulation research. 2005;97:1314-1322 334. Pereira L, Ruiz-Hurtado G, Morel E, Laurent AC, Metrich M, Dominguez- Rodriguez A, Lauton-Santos S, Lucas A, Benitah JP, Bers DM, Lezoualc'h F, Gomez AM. Epac enhances excitation-transcription coupling in cardiac myocytes. Journal of molecular and cellular cardiology. 2012;52:283-291 335. Metrich M, Laurent AC, Breckler M, Duquesnes N, Hmitou I, Courillau D, Blondeau JP, Crozatier B, Lezoualc'h F, Morel E. Epac activation induces histone deacetylase nuclear export via a Ras-dependent signalling pathway. Cellular signalling. 2010;22:1459-1468 336. Boivin B, Lavoie C, Vaniotis G, Baragli A, Villeneuve LR, Ethier N, Trieu P, Allen BG, Hebert TE. Functional beta-adrenergic receptor signalling on nuclear membranes in adult rat and mouse ventricular cardiomyocytes. Cardiovascular research. 2006;71:69-78 337. Boivin B, Vaniotis G, Allen BG, Hebert TE. G protein-coupled receptors in and on the cell nucleus: A new signaling paradigm? Journal of receptor and signal transduction research. 2008;28:15-28 338. Vaniotis G, Del Duca D, Trieu P, Rohlicek CV, Hebert TE, Allen BG. Nuclear beta-adrenergic receptors modulate gene expression in adult rat heart. Cellular signalling. 2011;23:89-98
257
339. Buu NT, Hui R, Falardeau P. Norepinephrine in neonatal rat ventricular myocytes: Association with the cell nucleus and binding to nuclear alpha 1- and beta-adrenergic receptors. Journal of molecular and cellular cardiology. 1993;25:1037-1046 340. Jones WK, Brown M, Ren X, He S, McGuinness M. NF-kappaB as an integrator of diverse signaling pathways: The heart of myocardial signaling? Cardiovascular toxicology. 2003;3:229-254 341. Li X, Stark GR. NFkappaB-dependent signaling pathways. Experimental hematology. 2002;30:285-296 342. Liu Q, Chen Y, Auger-Messier M, Molkentin JD. Interaction between NFkappaB and NFAT coordinates cardiac hypertrophy and pathological remodeling. Circulation research. 2012;110:1077-1086 343. Vaniotis G, Glazkova I, Merlen C, Smith C, Villeneuve LR, Chatenet D, Therien M, Fournier A, Tadevosyan A, Trieu P, Nattel S, Hebert TE, Allen BG. Regulation of cardiac nitric oxide signaling by nuclear beta-adrenergic and endothelin receptors. Journal of molecular and cellular cardiology. 2013;62:58-68 344. Ohguchi K, Banno Y, Akao Y, Nozawa Y. Involvement of phospholipase D1 in collagen type I production of human dermal fibroblasts. Biochemical and biophysical research communications. 2006;348:1398-1402 345. Schmidt M, Sand C, Jakobs KH, Michel MC, Weernink PA. Epac and the cardiovascular system. Current opinion in pharmacology. 2007;7:193-200 346. Racke K, Haag S, Bahulayan A, Warnken M. Pulmonary fibroblasts, an emerging target for anti-obstructive drugs. Naunyn-Schmiedeberg's archives of pharmacology. 2008;378:193-201
258
Appendix
Exchange protein directly activated by cAMP mediates slow delayed-rectifier current remodeling by sustained β-adrenergic activation in guinea pig hearts. Aflaki M, Qi XY, Xiao L, Ordog B, Tadevosyan A, Luo X, Maguy A, Shi Y, Tardif JC, Nattel S. Circ Res. 2014 Mar 14; 114(6):993-1003
259
Exchange Protein Directly Activated by cAMP Mediates Slow Delayed-Rectifier Current Remodeling by Sustained β-Adrenergic Activation in Guinea Pig Hearts Mona Aflaki, Xiao-Yan Qi, Ling Xiao, Balazs Ordog, Artavazd Tadevosyan, Xiaobin Luo, Ange Maguy, Yanfen Shi, Jean-Claude Tardif and Stanley Nattel
Circ Res. 2014;114:993-1003; originally published online February 7, 2014; doi: 10.1161/CIRCRESAHA.113.302982 Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2014 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/114/6/993
Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2014/02/07/CIRCRESAHA.113.302982.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at: http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 Molecular Medicine
Exchange Protein Directly Activated by cAMP Mediates Slow Delayed-Rectifier Current Remodeling by Sustained β-Adrenergic Activation in Guinea Pig Hearts
Mona Aflaki, Xiao-Yan Qi, Ling Xiao, Balazs Ordog, Artavazd Tadevosyan, Xiaobin Luo, Ange Maguy, Yanfen Shi, Jean-Claude Tardif, Stanley Nattel
Rationale: β-Adrenoceptor activation contributes to sudden death risk in heart failure. Chronic β-adrenergic stimulation, as occurs in patients with heart failure, causes potentially arrhythmogenic reductions in slow delayed- + rectifier K current (IKs).
Objective: To assess the molecular mechanisms of IKs downregulation caused by chronic β-adrenergic activation, particularly the role of exchange protein directly activated by cAMP (Epac). Methods and Results: Isolated guinea pig left ventricular cardiomyocytes were incubated in primary culture and exposed to isoproterenol (1 μmol/L) or vehicle for 30 hours. Sustained isoproterenol exposure decreased
IKs density (whole cell patch clamp) by 58% (P<0.0001), with corresponding decreases in potassium voltage- gated channel subfamily E member 1 (KCNE1) mRNA and membrane protein expression (by 45% and 51%, respectively). Potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) mRNA expression was unchanged. The β1-adrenoceptor antagonist 1-[2-((3-Carbamoyl-4-hydroxy)phenoxy)ethylamino]-3-[4- (1-methyl-4-trifluoromethyl-2-imidazolyl)phenoxy]-2-propanol dihydrochloride (CGP-20712A) prevented
isoproterenol-induced IKs downregulation, whereas the β2-antagonist ICI-118551 had no effect. The selective
Epac activator 8-pCPT-2′-O-Me-cAMP decreased IKs density to an extent similar to isoproterenol exposure,
and adenoviral-mediated knockdown of Epac1 prevented isoproterenol-induced IKs/KCNE1 downregulation. In contrast, protein kinase A inhibition with a cell-permeable highly selective peptide blocker did not affect
IKs downregulation. 1,2-Bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetate-AM acetoxymethyl ester (BAPTA- AM), cyclosporine, and inhibitor of nuclear factor of activated T cell (NFAT)-calcineurin association-6 (INCA6)
prevented IKs reduction by isoproterenol and INCA6 suppressed isopr oterenol-induced KCNE1 downregulation, consistent with signal-transduction via the Ca2+/calcineurin/NFAT pathway. Isoproterenol induced nuclear NFATc3/c4 translocation (immunofluorescence), which was suppressed by Epac1 knockdown. Chronic in vivo
administration of isoproterenol to guinea pigs reduced IKs density and KCNE1 mRNA and protein expression while inducing cardiac dysfunction and action potential prolongation. Selective in vivo activation of Epac via sp-
8-pCPT-2′-O-Me-cAMP infusion decreased IKs density and KCNE1 mRNA/protein expression.
Conclusions: Prolonged β1-adrenoceptor stimulation suppresses IKs by downregulating KCNE1 mRNA and protein via Epac-mediated Ca2+/calcineurin/NFAT signaling. These results provide new insights into the molecular basis of K+ channel remodeling under sustained adrenergic stimulation. (Circ Res. 2014;114:993-1003.)
Key Words: β-adrenergic receptors ■ arrhythmias, cardiac ■ calcineurin ■ heart failure ■ ion channels
+ ongestive heart failure (CHF) remains a leading cause Reduced slow delayed-rectifier potassium K -current (IKs) Cof mortality, with arrhythmic sudden death implicated is a particularly common and important finding in CHF- 3,6 in ≈50% of deaths. Action potential (AP) prolongation is a related remodeling. Reduced IKs impairs repolarization consistent finding in patients and animal models with CHF.1–3 and promotes arrhythmogenesis, as classically seen with Plasma norepinephrine concentration elevation predicts mutations of the underlying subunits potassium voltage- outcomes in CHF,4 and β-blockers reduce CHF mortality.5 gated channel subfamily E member 1 (KCNE1) and potas-
Original received November 5, 2013; revision received February 6, 2014; accepted February 7, 2014. In January 2014, the average time from submission to first decision for all original research papers submitted to Circulation Research was 14.35 days. From the Department of Medicine, Research Center, Montreal Heart Institute, Université de Montréal, Montreal, Quebec, Canada (M.A., X.-Y.Q., L.X., B.O., A.T., X.L., A.M., Y.S., J.-C.T., S.N.); and Department of Pharmacology and Therapeutics, McGill University, Montreal, Quebec, Canada (M.A., S.N.). The online-only Data Supplement is available with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA. 113.302982/-/DC1. Correspondence to Stanley Nattel, MD, Department of Pharmacology, McGill University, 5000 Belanger St E, Montreal, Quebec H1T 1C8, Canada. E-mail [email protected] © 2014 American Heart Association, Inc. Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.113.302982 Downloaded from http://circres.ahajournals.org/ at Institut993 de Cardiologie de Montreal on October 1, 2014 994 Circulation Research March 14, 2014
humidified, 5% CO2-enriched atmosphere. After 2 hours, fresh me- Nonstandard Abbreviations and Acronyms dium was added and supplemented with 1-μmol/L isoproterenol in drug treatment groups. Cells were kept in culture for an additional 8-pCPT 8-pCPT-2′-O-Me-cAMP 30 hours. In some experiments, 1-[2-((3-carbamoyl-4-hydroxy) AP action potential phenoxy)ethylamino]-3-[4-(1-methyl-4-trifluoromethyl-2-imid- BAPTA 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetate azolyl)phenoxy]-2-propanol dihydrochloride (CGP-20712A); CaMKII Ca2+/calmodulin-dependent protein kinase type II (±)-1-[2,3-(dihydro-7-methyl-1H-inden-4-yl)oxy]-3-[(1-methyle- thyl)amino]-2-butanol hydrochloride (ICI-118551); 8-Br-cAMP; CGP-20712A 1-[2-((3-carbamoyl-4-hydroxy)phenoxy)ethylamino]- 7β-acetoxy-8,13-epoxy-1α,6β,9α-trihydroxylabd-14-en-11-one 3-[4-(1-methyl-4-trifluoromethyl-2-imidazolyl)phenoxy]- (forskolin); 8-pCPT-2′-O-Me-cAMP (8-pCPT); inhibitor of 2-propanol dihydrochloride nuclear factor of activated T cell (NFAT)-calcineurin associa- CHF congestive heart failure tion-6 (NFAT6); cyclosporine; 1,2-bis(o-aminophenoxy)ethane- Epac exchange protein directly activated by cAMP N,N,N′,N′-tetraacetate acetoxymethyl ester (BAPTA)-AM; Forskolin 7β-acetoxy-8,13-epoxy-1α,6β,9α-trihydroxylabd- myristoylated protein kinase A inhibitor peptide (PKI); U-73122; 14-en-11-one N-[2-[N-(4-chlorocinnamyl)-N-methylaminomethyl]phenyl]- N-(2-hydroxyethyl)-4-methoxybenzenesulfonamide phosphate salt GGTI 298 N-[4-[2(R)-amino-3-mercaptopropyl]amino-2- (KN93); KN92; or N-[4-[2(R)-amino-3-mercaptopropyl]amino-2-(1- (1-naphthalenyl)benzoyl]-l-leucine methyl ester trifluoroacetate salt naphthalenyl)benzoyl]-l-leucine methyl ester trifluoroacetate salt (GGTI) were added to cultured cardiomyocytes along with isoproter- ICI-118551 (±)-1-[2,3-(dihydro-7-methyl-1H-inden-4-yl)oxy]- enol (1 μmol/L). In other experiments, shRNA in an adenoviral vec- 3-[(1-methylethyl)amino]-2-butanol hydrochloride tor, produced based on previously described methods,11,12 was used
ICaL L-type calcium current to knockdown Epac1 (Online Figure I). In all experiments studying effects of blockers on isoproterenol action, cells from the same iso- IK1 inward rectifier current I slow delayed-rectifier potassium current lates were exposed in parallel to isoproterenol as an internal control. Ks T-tubule distribution (with di-4-ANEPPS as a marker) and protein- KCNE1 potassium voltage-gated channel subfamily E member 1 synthesis ([3H]-leucine incorporation) were assessed in isolated cells KCNQ1 potassium voltage-gated channel, KQT-like subfamily, as described in Methods in the Online Data Supplement. member 1 KN93 N-[2-[N-(4-Chlorocinnamyl)-N-methylaminomethyl] Electrophysiology phenyl]-N-(2-hydroxyethyl)-4-methoxybenzenesulfonamide phosphate salt Cell Culture NFAT nuclear factor of activated T cells After 30 hours of exposure to interventions, cardiomyocytes were washed with Tyrode solution before study. PKA protein kinase A PKI protein kinase A inhibitor peptide Freshly Isolated Cells After In Vivo Treatment Rap1 Ras-related protein 1 Cells were studied within 8 hours of isolation. Tight-seal whole-cell patch-clamp technique was used to record currents in voltage-clamp mode. APs were recorded with perforated patch current clamp. All sium voltage-gated channel, KQT-like subfamily, member 1 experiments were performed at 36±1°C. For detailed electrophysi- (KCNQ1) in long-QT syndrome.7 ological methods, see Methods in the Online Data Supplement. Cell capacitance was 104±4 pF for control and 106±4 pF for We previously showed that sustained β-adrenergic stimula- isoproterenol-treated cells in culture; 199±11pF for in vivo vehicle- 8 tion decreases IKs density in the guinea pig, but the underly- control and 252±16 pF isoproterenol-treated groups (P<0.05); 146±9 ing molecular basis remains poorly understood. β-Adrenergic pF for vehicle-control and 180±11 pF for sp-8-pCPT–treated animals stimulation causes cardiac remodeling via cAMP, classically (P<0.05) for cells isolated from in vivo–treated animals. mediated by protein kinase A (PKA); however, the novel protein family, exchange protein directly activated by cAMP Immunoblots and Immunochemistry Membrane protein was denatured and fractionated on 8% SDS-PAGE 9,10 (Epac), has been shown to mediate β-adrenoceptor actions. and then transferred electrophoretically to immobilon-P polyvinyli- Little is known about the involvement of Epac in cardiac re- dene fluoride membranes. Membranes were incubated with primary modeling, particularly at the electrophysiological level. The antibodies overnight and then exposed to secondary antibodies. All present study aimed to clarify the molecular mechanisms un- results were normalized to GAPDH immunoblots. Immunochemistry was used to quantify membrane expression of KCNE1 protein and derlying -adrenergic downregulation of I , with a particular β Ks nuclear translocation of NFAT. focus on the potential role of Epac. Real-Time Polymerase Chain Reaction Methods For RNA isolation and quantitative PCR methods, see Methods in the For detailed methods description, see the Online Data Supplement. Online Data Supplement. Gene expression levels were normalized to the geometric average of multiple reference genes.13 Cardiomyocyte Isolation Guinea pigs were injected with heparin (1.0 U/kg) and euthanized by In Vivo Models stunning-induced areflexic coma followed by cardiac excision. Hearts Guinea pigs received daily intraperitoneal injections of isoproterenol were retrogradely perfused with 200 μmol/L Ca2+-containing Tyrode or vehicle. Isoproterenol was injected at an initial dose of 50 μg/kg solution. When clear, the perfusate was changed to Ca2+-free Tyrode per day. The dose was increased 100 μg/kg per day every week for solution and digested with 280 U/mg collagenase type II. Cells were 13 weeks. To produce in vivo Epac activation, sp-8-pCPT was admin- obtained by trituration and stored in Kraftbrühe solution. istered via osmotic minipump (16 μg/d) for 6 weeks; vehicle-filled minipumps were used for parallel control animals. Echocardiography Cell Culture and Treatment was used to assess cardiac function changes14 in isoproterenol-treated Cardiomyocytes were reintroduced to Ca2+ by stepwise addition of and parallel control animals, as detailed in Methods in the Online cell culture medium. Cells were plated and maintained at 37°C in a Data Supplement.
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 Aflaki et al Epac Mediates β-Adrenergic IKs Downregulation 995
Data Analysis expression of the underlying KCNQ1 and KCNE1 subunits, was Clampfit 9.0 (Axon) and GraphPad Prism 5.0 were used for data stable in the absence of isoproterenol. Isoproterenol treatment analysis. Group comparisons were performed with unpaired Student increased cell area by ≈50% (Online Figure IIIA), did not af- t tests (for single 2-group comparisons) or 1-way ANOVA with Bonferroni-corrected t tests (for multiple-group comparisons). Data fect cell capacitance (Online Figure IIIB), and increased leucine are expressed as mean±SEM. incorporation (Online Figure IIIC). T-tubule density decreased in culture, with significantly greater decreases in isoproterenol- Results treated cells versus parallel controls (Online Figure IIID and IIIE), potentially accounting for unchanged capacitance in iso- Sustained β-Adrenergic Stimulation Decreases I Ks proterenol-treated cells, despite increased cell size. We first established the stability of the guinea pig cell culture I recordings from control and isoproterenol (1 system in vitro (Online Figure II). I density, as well as protein Ks Ks μ mol/L)-treated cells are shown in Figure 1A and 1B. Figure 1C and 1D shows overall current density/voltage rela- tions, indicating a significant decrease (by≈ 60%) in isoproter- enol-treated cells. Current densities normalized to maximum
Figure 1. Effects of isoproterenol (Iso) on slow delayed- Figure 2. Relationship between isoproterenol (Iso) effects rectifier potassium current (IKs) and action potentials (APs). and β-receptor subtype, cAMP and protein kinase A inhibitor A to D, In vitro effects. A and B, Original recordings in cells peptide (PKI). Left, Slow delayed-rectifier potassium current incubated with control and isoproterenol containing medium, (IKs) recordings (+50 mV) and right, mean±SEM data; under respectively. Voltage protocol (4-s depolarizing pulses at 0.1 Hz, vehicle-culture (control [CTL]) and (A and B) Iso, β1-(1-[2-((3- followed by 3 seconds at −30 mV to observe tail currents). C, carbamoyl-4-hydroxy)phenoxy)ethylamino]-3-[4-(1-methyl-4-
IKstep density–voltage relations for cells cultured in the presence trifluoromethyl-2-imidazolyl)phenoxy]-2-propanol dihydrochloride of Iso or vehicle (control [CTL]). D, Tail current (IKTAIL) density– [CGP-201712A]) and β2-((±)-1-[2,3-(dihydro-7-methyl-1H-inden- voltage relations. E to H, Effects of chronic in vivo isoproterenol 4-yl)oxy]-3-[(1-methylethyl)amino]-2-butanol hydrochloride administration on IKs. E and F, Original recordings in cells [ICI-18551]) adrenoceptor antagonists (***P<0.001, Iso vs CTL; incubated with control and isoproterenol containing medium, ###P<0.001, Iso+β1-blocker vs Iso-alone); (C and D) 8-bromo- respectively. G, IKstep density–voltage relations in freshly isolated cAMP (8-Br-cAMP) (***P<0.001, Iso vs CTL; ###P<0.001, ventricular cardiomyocytes from isoproterenol-treated and 8-Br-cAMP vs CTL); (E and F) 7β-acetoxy-8,13-epoxy-1α,6β,9α-
CTL animals. H, Tail current (IKTAIL) density–voltage relations. I, trihydroxylabd-14-en-11-one (forskolin), 8-Br-cAMP+PKI Representative AP recordings (1 Hz) from guinea pigs treated (***P<0.001, forskolin vs CTL; ###P<0.001, 8-Br-cAMP+PKI with isoproterenol and CTL animals. J, AP duration (APD) vs CTL). G and H, PKI (***P<0.001, Iso vs CTL; ##P<0.01, at 50% (APD50) and 90% (APD90) repolarization. **P<0.01, ###P<0.001, PKI+Iso vs CTL). Voltage protocol at top right. ***P<0.001 vs CTL at same test potential (TP). Group data are Treatment duration for all drugs including isoproterenol was 30 mean±SEM. n indicates number of cells. hours. n indicates number of cells; and TP, test potential.
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 996 Circulation Research March 14, 2014
values in each cell (Online Figure IVA and IVB) superim- reduced IKs (Figure 2C), mimicking isoproterenol effects posed, indicating that isoproterenol treatment did not affect (Figure 2D). Similar changes were observed with forskolin, voltage dependence. Half-activation voltages (Boltzmann which increases intracellular cAMP levels by directly ac- fit) averaged +34.6±1.3 and +33.2±2.5 mV in control (n=13) tivating adenylyl cyclase (Figure 2E and 2F). Acute IKs en- and isoproterenol-treated (n=8) cells, respectively (P=NS). hancement caused by β-adrenergic stimulation is mediated 16 Isoproterenol exposure accelerated IKs activation by reducing by PKA activation/phosphorylation of KCNQ1 on Ser-27. the slow-phase time constant (Online Figure IVC and IVD). To evaluate the role of PKA in IKs downregulation, cardio- myocytes were exposed for 30 hours to isoproterenol in the Involvement of β1-Adrenoceptors and presence of the N-myristoylated (cell permeable) form of the cAMP Signaling peptide PKA-inhibitor PKI (1 μmol/L). PKI did not suppress Cells incubated with isoproterenol and highly selective β1 isoproterenol-induced I downregulation (Figure 2G and 2H). (CGP-20712A) or β2 (ICI-118551) antagonists were com- Ks In contrast, PKI blunted IKs enhancement resulting from acute pared with parallel control and isoproterenol-alone groups. isoproterenol exposure (Online Figure VA and VB), indicating Figure 2A shows representative I recordings. Corresponding Ks that the persistent chronic-isoproterenol effect in the presence current density/voltage relationships (Figure 2B) indicate of PKI is not because of inactivity of PKI. In addition, chronic that concomitant treatment with the β -blocker CGP-20712A 1 treatment of cells with 8-Br-cAMP plus PKI suppressed I , abolished the isoproterenol effect. The β -blocker ICI-118551 Ks 2 further excluding the involvement of PKA (Figure 2E and 2F). failed to alter isoproterenol action, confirming that the isopro- terenol effect is mediated through β1-adrenergic receptors. Involvement of Epac
After β1-adrenoceptor activation, the trimeric G-protein To assess the involvement of Epac, we treated cardiomyocytes complex releases Gαs, which activates adenylyl cyclase, with 6-μmol/L 8-pCPT-2′-O-Me-cAMP (8-pCPT), a highly se- increasing intracellular cAMP levels.15 Sustained expo- lective Epac activator.17 Sustained Epac activation with 8-pCPT sure to the cell-permeable cAMP agonist 8-bromo-cAMP reduced IKs densities to values comparable with those in a
Figure 3. Effects of isoproterenol (Iso), exchange protein directly activated by cAMP (Epac) activation and Epac knockdown. A to E, In vitro studies. A, Slow delayed-rectifier potassium
current (IKs) recordings at +50 mV under vehicle- control (CTL), Iso, and 8-pCPT-2′-O-Me-cAMP.
B, Mean±SEM IKs density–voltage relations. C, IKs recordings for cells infected with scrambled construct (Scr+Iso)-virus, or Epac knockdown probe (Epac1KD+Iso), and cells cultured in the
presence of Iso. D, Mean±SEM IKs density–voltage relations **P<0.01, ***P<0.001 vs CTL; ##P<0.01,
###P<0.001 vs Iso-alone. E, Mean±SEM IKs densities at +60 mV. **P<0.01, ***P<0.001 for comparison shown. F to H, Effects of in vivo sp-
8-pCPT administration. F, IKs recordings from animals treated with sp-8-pCPT and vehicle (CTL).
G, Mean±SEM tail current (IKTAIL) density–voltage relations. H, Representative action potential (AP) recordings (1 Hz) from sp-8-pCPT–treated animals and CTL (left); AP duration (APD) at 50% (APD50) and 90% (APD90) repolarization (right). n indicates number of cells; and TP, test potential.
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 Aflaki et al Epac Mediates β-Adrenergic IKs Downregulation 997 parallel isoproterenol-treated group (Figure 3A; eg, at +50 mV, (≈42%; P<0.05) by isoproterenol incubation (Figure 5B). To from 3.3±0.4 pA/pF in control to 1.7±0.2 pA/pF in isoproter- assess the functional role of NFAT in IKs downregulation, we enol and 1.4±0.2 pA/pF in 8-pCPT). treated cardiomyocytes with a cell-permeable NFAT blocker Figure 3A and 3B shows that Epac stimulation can mimic (inhibitor of NFAT-calcineurin association-6; 1-μmol/L), which the effect of isoproterenol, but to establish the role of Epac as prevented IKs downregulation by isoproterenol (Figure 5C and a mediator of isoproterenol-induced IKs downregulation, it is 5D). Epac1 knockdown suppressed β-adrenergically mediated necessary to assess the effects of Epac inhibition on isoprotere- translocation of NFATc3 and c4 into the nucleus, confirming nol action. In the absence of a specific pharmacological inhibi- NFAT translocation as an event downstream to isoproterenol- tor, we turned to genetic knockdown. Two isoforms of Epac induced Epac activation (Online Figure IX). (Epac1 and Epac2) are encoded by distinct genes (RAPGEF3 In Vivo Models and RAPGEF4).18 Epac1 is highly expressed in the heart, kid- Chronic in vivo -adrenergic stimulation increased left ven- neys, ovaries, and thyroid glands, whereas Epac2 is predomi- β tricular mass/body weight ratio, indicating cardiac hypertro- nant in the brain and pituitary.19 Furthermore, isoproterenol phy (Online Table II). Echocardiography showed significant treatment enhanced the expression of Epac1 in our in vitro sys- impairments in left ventricular ejection fraction and fractional tem (Online Figure VIA) and not that of Epac2 (Online Figure shortening (Online Table III). Figure 1E and 1F shows repre- VIB) and increased the Epac1/2 expression ratio (Online sentative I recordings from control and isoproterenol-treated Figure VIC). Based on these data, we decided to target Epac1 Ks animals. I density was significantly reduced, by≈ 65% and designed a specific shRNA (Online Figure I), along with Ks (Figure 1G and 1H). In vivo isoproterenol administration did a scrambled control sequence, each inserted in bicistronic ad- not alter I voltage dependence (Online Figure IVE and IVF) enoviral delivery vectors incorporating green fluorescent pro- Ks but significantly accelerated I activation (Online Figure IVG tein. Incubation with the Epac1 knockdown-virus attenuated Ks and IVH), similar to the effect observed in vitro. Of note, in Epac1 expression after isoproterenol exposure (Online Figure vivo isoproterenol administration did not cause detubulation VIIA), whereas Epac2 expression was unaffected (Online (Online Figure IIIF and IIIG). AP duration was significantly Figure VIIB). The scrambled-virus did not alter Epac expres- increased in isoproterenol-treated animals (Figure 1I and 1J). sion in the presence of isoproterenol (Online Figure VIIA), The expression of both Epac1 and Epac2 mRNA was increased and isoproterenol significantly increased Epac1 expression in (Online Figure VID and VIE), but the increase in Epac2 was the presence of scrambled-virus versus scrambled-virus incu- larger than in Epac1, decreasing the Epac1/Epac2 expression bation alone (Online Figure VIIIA). Figure 3C shows repre- ratio (Online Figure VIF). In vivo isoproterenol also remodeled sentative I recordings in cells treated with isoproterenol in Ks other ionic currents, reducing L-type calcium current (I ) the presence of the scrambled-control virus, knockdown-virus, CaL density by ≈45% and inward rectifier current (I ) by ≈47% and virus noninfected control, respectively. Epac1 knockdown K1 (Online Figure X). In vivo administration of the Epac activa- suppressed isoproterenol-induced downregulation of I , as Ks tor sp-8-pCPT decreased I by ≈64%, reproducing the effect compared with isoproterenol-alone and scrambled sequence Ks of isoproterenol (Figure 3F and 3G). AP duration was signifi- (Figure 3D and 3E). These data are strong evidence for a cen- cantly prolonged in sp-8-pCPT–treated animals (Figure 3H). tral role of Epac1 in isoproterenol-induced IKs downregulation. As was the case for isoproterenol, ICaL and IK1 were reduced (by Role of Ca2+/Calcineurin/NFAT ≈30% each) in sp-8-pCPT–treated animals (Online Figure XI). Epac action is commonly transduced by increased intracellu- lar Ca2+ levels.20 To determine the role of cell Ca2+ in mediat- ing effects of Epac in our system, we used a cell-permeable calcium chelator (BAPTA-AM, 10-μmol/L). Cardiomyocytes incubated with isoproterenol and BAPTA-AM did not show a reduction in IKs current density on isoproterenol exposure (Figure 4A), whereas cells from the same isolates exposed to isoproterenol showed typical IKs suppression. We then turned our attention to potential downstream Ca2+- dependent mediators of Epac action. Calcineurin is a Ca2+- activated phosphatase that is known to mediate Epac-induced cardiac hypertrophy.10 To assess the role of calcineurin, car- diomyocytes were treated with the calcineurin blocker cy- closporine A (0.8 μmol/L). Cyclosporine prevented the
isoproterenol-induced downregulation of IKs (Figure 4B). A Figure 4. Effects of intracellular Ca2+ buffering and calcineurin + major mediator of calcineurin action is the nuclear factor of inhibition. A, Left, Slow delayed-rectifier K current (IKs) activated T-lymphocytes, which is dephosphorylated by calci- recordings (at +50 mV) after culture in vehicle-control (CTL), neurin, allowing increased transport into the nucleus and en- isoproterenol (Iso) or 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′- tetraacetate acetoxymethyl ester (BAPTA)-AM plus Iso (BAPTA- hanced transcription factor action.21 Figure 5A shows enhanced AM+Iso). Right, Corresponding mean±SEM IKs density–voltage nuclear localization of NFATc4 (red) and NFATc3 (green) fol- relations. B, IKs recordings at +50 mV after culture in CTL, Iso, and lowing isoproterenol exposure. Overall nuclear localization was cyclosporine A plus Iso (Cyclo+Iso) media. Right, Corresponding mean±SEM IKs density–voltage relationship. *P<0.05, ***P<0.001 increased for both NFATc3 (by ≈61%; P<0.01) and NFATc4 vs CTL. n indicates number of cells; and TP, test potential.
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 998 Circulation Research March 14, 2014
Figure 5. Role of nuclear factor of activated T cells (NFAT) in isoproterenol effects. A, Immunolocalization of NFATc3 and NFATc4 in cardiomyocytes cultured in vehicle-control (CTL) or isoproterenol-containing (Iso) medium. ToProIII was used to label nuclei. B, Mean±SEM nuclear/ cytosolic NFATc3 and NFATc4 fluorescence-
intensity ratios. *P<0.05, ***P<0.001 vs CTL. C, IKs recordings (at +50 mV) from cells cultured under CTL, Iso, and Iso+INCA6 (1 μmol/L) conditions.
Voltage protocol as in Figure 1. D, Mean±SEM IKs density–voltage relations in CTL, Iso, and inhibitor of NFAT-calcineurin association-6 (INCA6; 1 μmol/L)+Iso. *P<0.05, ***P<0.001 vs CTL. E and F, Mean±SEM potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) and potassium voltage-gated channel subfamily E member 1 (KCNE1) mRNA expression in cells cultured with control-vehicle, isoproterenol-alone, and isoproterenol in the presence of INCA6 (1 or 5 μmol/L). *P<0.05, ***P<0.001 for comparison shown (for E and F, number (n) of independent quantitative polymerase chain reaction analyses, each with RNA from cultured cells from 2 hearts). N indicates number of cells; and TP, test potential.
The results above indicated an important role for Ca2+/ Molecular Basis of Isoproterenol/Epac Effect on IKs calcineurin/NFAT signaling but do not exclude the involve- To further address the mechanisms underlying IKs downregulation, ment of other molecular pathways. Ras-related protein 1 we assessed mRNA expression for the IKs subunits KCNQ1 and KCNE1. KCNQ1 mRNA expression was not significantly altered (Rap1) is known to be activated after Epac activation.18 Its (Figure 5E), but KCNE1 mRNA expression was clearly reduced, potential role was assessed by incubating cells with GGTI by ≈45% (Figures 5F and 6A). These results suggest KCNE1 as (a Rap1 blocker). GGTI prevented isoproterenol-induced IKs the downstream target of the Epac1-stimulated Ca2+/calcineu- reduction (Online Figure XIIIA and XIIIB). Phospholipase rin/NFAT system. Numerous NFAT-binding sites are located C (PLC) is another downstream effector of some Epac1 ef- on the 5′-upstream region of the guinea pig transcriptional start fects.22 Concomitant treatment of cells with isoproterenol and site for KCNE1, including 1 within 300 bp (Online Figure XII). U-73122 (a phospholipase C inhibitor) did not prevent iso-
The NFAT blocker inhibitor of NFAT-calcineurin association-6 proterenol-induced reductions in IKs density (Online Figure (INCA6) suppressed KCNE1 downregulation (Figure 5F), with- XIIIC and XIIID). Ca2+/calmodulin-dependent kinase type II out altering KCNQ1 expression (Figure 5E), consistent with (CaMKII) is known to be activated by β1-adrenergic stimu- NFAT-mediated regulation. Representative KCNE1 immunob- lation.23 Concomitant stimulation of cells with isoproterenol lots are shown, along with mean data, in Figure 6A. Isoproterenol and KN93 (a CaMKII blocker) prevented reductions in IKs incubation reduced KCNE1 protein expression significantly, by density, whereas the inactive congener KN92 was ineffective 56%. The protein expression changes were further confirmed via (Online Figure XIIIE and XIIIF), indicating the necessity immunostaining (Figure 6B), which showed reduced membrane for intact CaMKII activity for the isoproterenol effect. In the expression of KCNE1 protein (by ≈82%; P<0.01) in response absence of adrenergic stimulation, neither GGTI nor KN93 to sustained in vitro isoproterenol exposure. Corresponding in altered IKs (Online Figure XIV). vivo results are shown in Figure 6C and 6D. KCNE1 protein and mRNA expression were significantly decreased after in vivo Discussion isoproterenol administration (Figure 6C). Similar changes were In this study, we found that chronic β-adrenergic stimula- seen with in vivo sp-8-pCPT infusion (Figure 6D). tion decreases IKs density both in vitro and in vivo while
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 Aflaki et al Epac Mediates β-Adrenergic IKs Downregulation 999
Figure 6. Potassium voltage-gated channel subfamily E member 1 (KCNE1) expression changes. A and B, In vitro studies. A, Top, Crude membrane protein extracts and RNA extracts were obtained from cells cultured in control-vehicle (CTL) and isoproterenol-medium (Iso). KCNE1 bands were seen on immunoblot at the expected molecular mass of ≈20 kDa. Bottom, Mean±SEM expression levels for KCNE1 protein relative to GAPDH bands on the same lanes (*P<0.05), and mRNA expression (***P<0.001). B, Immunostaining for KCNE1 and mean±SEM membrane fluorescence intensity.C and D, In vivo model results. C, Top, Immunoblots for membrane KCNE1 protein in cardiomyocytes from animals treated with isoproterenol or vehicle (CTL). Bottom, Left, Mean±SEM protein expression levels (*P<0.05); right, mRNA expression. D, Top, Immunoblots for membrane KCNE1 protein for animals treated with sp-8-pCPT or vehicle. Bottom, Left, Mean±SEM protein expression levels; right, mRNA expression (*P<0.05, ***P<0.001). n indicates numbers of independent experiments, each from 1 heart.
downregulating KCNE1 subunits. Detailed characterization in or protein expression. Borlak et al34 reported an increase in vitro showed that this effect is mediated via Epac signaling KCNQ1 and KCNE1 subunit mRNA in heart samples from through the Ca2+/calcineurin/NFAT pathway. A summary of humans with end-stage CHF. Some of the discrepancies our experimental observations and the mechanistic model they may be because of differences in the severity and duration suggest is provided in Figure 7. of CHF, as well as species and drug therapy conditions. The QT-interval prolongation associated with K+-channel down- Remodeling of Delayed-Rectifier +K Currents regulation is a significant predictor of sudden cardiac death in 35 The delayed-rectifier K+ current system is crucial for car- patients with CHF. diac repolarization in mammals. I downregulation occurs Ks Epac Signaling in Cardiac Remodeling 1 in patients with terminal CHF and in ventricular and atrial cAMP, the universal second messenger that is produced via ad- 3,24–30 cells from different animal models. Animal models of enylyl cyclase after β-receptor activation, plays an important role 31 hypertrophy also show reduced IKs. Atrioventricular block– in cardiovascular physiology. Although PKA is the primary ef- induced remodeling also decreases IKs in ventricular cardio- fector of cAMP, other more recently identified proteins, such as myocytes.32,33 Less is known about the signal-transduction Epac, represent important signaling mechanisms downstream mechanisms that lead to IKs downregulation and the underlying to cAMP. Here, we report that chronic in vitro stimulation of changes in I subunits. Prior studies have provided discrepant Ks β 1-adrenergic receptors activates Epac1, which decreases IKs results. Tsuji et al24 showed a decrease in both KCNQ1 and density independently of PKA. In vivo, isoproterenol adminis- KCNE1 subunits in rabbits with tachypacing-induced heart tration increases Epac expression, and its effects are mimicked failure, with a corresponding change in the protein. However, by an Epac agonist. Epac1 (RAPGEF3) mRNA is highly ex- other studies of tachypacing-induced CHF in dogs6 and rab- pressed in heart.36 Myocardial Epac1 expression increases in rats bits30 did not show changes in KCNQ1 and KCNE1 mRNA with pressure-overload induced by aortic constriction and in rat
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 1000 Circulation Research March 14, 2014
Figure 7. Schematic representation of the mechanisms involved in slow + delayed-rectifier K current (IKs) downregulation by sustained β- adrenergic stimulation. Blockers (red) and activators (blue) were used to probe specific components of the pathway. 8-pCPT indicates 8-pCPT-2′-O-Me- cAMP; AC, adenylyl cyclase; BAPTA-AM, 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′- tetraacetate acetoxymethyl ester; CaMKII, Ca2+/calmodulin-dependent protein kinase type II; CGP-20712A, 1-[2-((3-carbamoyl- 4-hydroxy)phenoxy)ethylamino]-3-[4-(1- methyl-4-trifluoromethyl-2-imidazolyl) phenoxy]-2-propanol dihydrochloride; CN, calcineurin; Epac, exchange protein directly activated by cAMP; INCA6, inhibitor of NFAT-calcineurin Association-6; KCNE1, potassium voltage-gated channel subfamily E member 1; KCNQ1, potassium voltage- gated channel, KQT-like subfamily, member 1; NFAT, nuclear factor of activated T cell; PKI, protein kinase A inhibitor peptide; and Rap1, Ras-related protein 1. ventricular cardiomyocytes treated with isoproterenol.10 Epac1 suppression with cyclosporine A). NFAT translocation was a and Epac2 are also upregulated in the hearts of mice subjected to central event: blockade of calcineurin-induced NFAT dephos- 37 chronic-isoproterenol infusion. Epac1 expression is increased phorylation with INCA6 prevented IKs and KCNE1 down-
≈2-fold in ventricular cardiomyocytes from patients with CHF, regulation, and the suppression of isoproterenol-induced IKs with no change in Epac2 expression.10 Thus, cardiac Epac expres- downregulation by Epac knockdown was accompanied by the sion increases under cardiac-load and adrenergic-stimulation con- prevention of NFAT translocation to the nucleus. The signaling ditions that cause hypertrophy and remodeling. There is extensive system that we uncovered is consistent with prior studies of evidence for a causative role of Epac in cardiac hypertrophy.20 Epac effects in the heart. Calcineurin activity is increased in Little is known about the role of Epac in cardiac electrophysiol- cells treated with 8-pCPT,10 and Epac activation is known to ogy. Epac activation inhibits ATP-sensitive K+-channels in pan- significantly increase NFAT nuclear translocation,44 which is creatic β-cells38 and Epac1 coimmunoprecipitates with SUR1, important for the induction of cardiac hypertrophy. a subunit of the K -channel. Exposure of rat chromaffin cells ATP + 2+ Relationship to Other Signaling Systems in K to 8-pCPT increases T-type Ca -current and Cav3.1-subunit expression.39 Acute perfusion of rat and mouse cardiomyocytes Channel Remodeling 45 with 8-pCPT does not affect L-type Ca2+ current,23,40 but the Epac Rossow et al have shown spatial heterogeneity of activator 8-4-(chlorophenylthio)-2'-O-methyladenosine-3',5'- NFATc3-dependent Ito downregulation, causing a loss of the monophosphate (cpTOME) strongly enhances Ca2+-induced Ca2+ normal transmural gradient in mouse ventricular cardiomyo- release in mouse cardiomyocytes.22 Acute Epac activation failed cytes after chronic in vivo isoproterenol infusion. β-Adrenergic to induce any changes in AP duration in 2 studies40,41; however, stimulation increased intracellular Ca2+, calcineurin, and NFAT 45 a more recent investigation showed AP duration increases in rats activity, which reduced Kv4.2 expression and Ito density. The after acute 8-CPT-acetoxymethyl-ester perfusion.42 upstream pathway was not identified. In mice with myocardial 2+ Epac activation increases Ca sparks via CaMKII phosphor- infarction, downregulation of Ito and IKslow1,2 was prevented by ylation of ryanodine receptors in rat cardiomyocytes.40 A recent calcineurin inhibition or NFATc3 knockout.46 Although calci- elegant study showed that in vivo infusion of an Epac activator neurin/NFAT signaling suppresses Ito transcription in most stud- 47,48 49 to rats elicits a PKA-independent positive inotropic response, ies, Ito upregulation occurs in neonatal rat cardiomyocytes. increases cardiomyocyte Ca2+ transients, enhances sarcoplas- Cav1.2 is downregulated via the same pathway in canine car- mic reticulum Ca2+ stores and Ca2+ transients, and promotes diomyocytes.50 NFAT is an important downstream mediator of Ca2+-dependent arrhythmic activity.43 Inhibition of calcineurin responses to changes in intracellular Ca2+51; our data are the first or CaMKII prevented Epac-induced Ca2+ responses. showing a role in downregulating delayed-rectifier K+-currents. We also identified the involvement of other signaling mol- The present study is the first to implicate Epac in KsI re- ecules, such as CaMKII and Rap1, in I regulation. Previous modeling. The Epac dependence of adrenergically induced IKs Ks downregulation was established by the ability of direct Epac studies have identified a role for CaMKII in toI downregulation activation to mimic adrenergic effects, the lack of change with in tachycardia remodeling of canine ventricular cardiomyo- PKA inhibition, and the suppression of adrenergic effects on cytes.48 Interestingly, in that work, like the present study, the 2+ IKs and KCNE1 expression when Epac was knocked down. primary signaling system involved was the Ca /calcineurin/ Signaling was Ca2+ dependent (as evidenced by the effect of NFAT system, but intact CaMKII function was necessary for BAPTA) and required intact calcineurin action (shown by K+ current downregulation. CaMKII activation also suppresses
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 Aflaki et al Epac Mediates β-Adrenergic IKs Downregulation 1001 delayed-rectifier +K currents in neurons.52 Transgenic CaMKIIδc controls (generally, cells cultured in vehicle and isoproterenol) 53 overexpression reduces Kir2.1 expression and IK1 in mice. for each set of experiments. Thus, each data set shown con- CaMKII-expression is increased in calcineurin-transgenic mice; sists of simultaneously cultured/studied cells from each isolate.
CaMKII-inhibitory drugs improve left ventricular function and There are important differences in IKs properties among spe- prevent arrhythmias.54 Less is known about the role of Rap1 cies.59,60 Caution is therefore needed in extrapolating our results in cardiac electrophysiology. Rap1, along with phospholipase to other species, especially humans. C, participates in Ca2+-induced Ca2+-release after β-adrenergic We observed cellular hypertrophy after chronic-isoproterenol stimulation and Epac activation.22 It is possible that CaMKII exposure in terms of increased cell dimensions, but not ca- and Rap1 contribute to Ca2+ liberation, which we found was es- pacitance. The discrepancy is likely related to the detubula- tion that occurs in cultured cardiomyocytes,61 which was sential for IKs downregulation. Prior studies have demonstrated a role for Rap1 and CaMKII in Epac-induced increases of mu- exaggerated by isoproterenol and reduces the effective cell rine Ca2+-induced Ca2+ release, although intact phospholipase C membrane surface area (Online Figure III). Chronic in vivo 22 was also needed. Additional work will be needed to clarify the isoproterenol stimulation produced similar changes in IKs and detailed molecular signaling associated with these molecules. KCNE1 expression to those seen with in vitro treatment, de- spite no evidence of detubulation and a significant increase Novel Findings and Potential Significance in cell capacitance. Interestingly, in vivo Epac administration
Our study is the first to define the mechanisms underlying IKs reproduced the IKs remodeling effects of isoproterenol. downregulation induced by chronic β-adrenergic stimulation. The electrophysiological consequences of background adren- It is also the first to show a central role of Epac signaling in ergic tone in vivo will reflect the chronic ion-channel remodeling the control of K+ channel expression. Our findings may be effects plus any additional changes because of ongoing (acute) ad- relevant to the prevention of malignant arrhythmias in a vari- renergic signaling. The ion-channel remodeling we observed af- ety of contexts. Sympatho-adrenergic activation is an impor- fected adrenergically enhanced outward K+ current (60% decrease tant contributor to arrhythmic risk in patients with CHF,4 as 2+ in IKs) more than inward Ca current (45% reduction). Thus, any well as in animal models.55 It may become possible to target acute adrenergic effects would be expected to increase inward Epac-mediated electric remodeling to prevent potentially lethal current more than outward and to further delay repolarization. arrhythmic events. β-Adrenoceptor blockers are the mainstay Additional work is clearly needed to define the mechanisms of ad- of therapy to prevent arrhythmic events in long-QT syndrome renergic regulation of ion channels other than IKs, to determine the patients.56 Their protective action is reasonably attributed to the systems effects of chronically elevated adrenergic tone in vivo and suppression of acute electrophysiological effects of adrenergic to assess their specific role in disease-state paradigms like CHF. stimulation; however, they may also act to maintain repolariza- We performed in vivo experiments to determine whether the tion reserve that might otherwise be suppressed by downregula- phenomena we observed under cell-culture conditions in vitro tion of IKs through chronically elevated background adrenergic also pertain to the effects of sustained β-adrenergic stimulation in tone. The Epac system was described relatively recently,18 and vivo. We based our in vivo study conditions for isoproterenol on our knowledge about its role in cardiac pathophysiology is rath- previous studies in the guinea pig, which showed that significant er limited.57 Our study is the first to implicate Epac in cardiac changes in cardiac structure/function/electrophysiology required ion-channel remodeling and to detail the associated signaling 3 months of incremental intraperitoneal therapy.62 We based the pathway. More work is needed to establish the role of Epac sig- Epac regimen on prior studies in rats, which used continuous in- naling in other aspects of cardiac electric remodeling. fusion for 4 weeks,63 but we increased the duration of therapy One potentially interesting and novel aspect of the remod- to 6 weeks, the maximum duration possible with our osmotic eling we observed was a change in the kinetics of IKs with minipumps, because of anticipated potential species differences. chronic exposure to isoproterenol or agents that mimicked In view of differences in exposure period, dose, etc, the differ- its signaling like 8-bromo-cAMP and 8-pCPT. The KCNE1 ent series we performed can only be compared qualitatively: in subunit is known to contribute importantly to the formation vivo isoproterenol and sp-8-pCPT produced similar effects to of IKs channels, slowing activation and enhancing current den- each other, with changes consistent with our in vitro observa- sity.58 The kinetic changes that we observed may therefore be tions. The in vitro model allowed us to perform extensive de- caused by selective downregulation of KCNE1, with conse- tailed mechanistic studies that could not be practically executed quent changes in KCNE1:KCNQ1 stoichiometry. in vivo, whereas the in vivo studies allowed us to confirm that the phenomena we observed in vitro are applicable to in vivo condi- Potential Limitations tions. We used sp-8-pCPT as an Epac-selective agonist, as have We used an in vitro primary culture system of adult ventricular many prior studies,10,17,20,22,36,38,40–44 but sp-8-pCPT products can cardiomyocytes, with an animal system that, unlike mouse and have effects on other signaling systems.64 We confirmed the role + rat models, has important delayed-rectifier K currents of the of Epac signaling in vitro with adenoviral-mediated knockdown; type important for human cardiac repolarization. The use of this however, we were unable to apply gene knockdown in vivo; this in vitro system allowed the exploration of detailed mechanisms limitation should be considered in interpreting our results. with probes not readily applicable in vivo. Changes in cardio- myocyte properties over time in culture are a potential problem, Acknowledgments but we established the stability of I density and associated Ks We thank Nathalie L’Heureux, Chantal St. Cyr, Marc-Andre Meus, subunits in culture. In addition, the density of IKs sometimes var- and Louis-Robert Villeneuve for technical help and France Thériault ied among different sets of cells. We therefore included internal for secretarial help.
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 1002 Circulation Research March 14, 2014
Sources of Funding 19. Kawasaki H, Springett GM, Mochizuki N, Toki S, Nakaya M, Matsuda M, Housman DE, Graybiel AM. A family of cAMP-binding proteins that This work was supported by Canadian Institutes of Health Research directly activate Rap1. Science. 1998;282:2275–2279. (MOP68929), Quebec Heart and Stroke Foundation and Fondation 20. Métrich M, Berthouze M, Morel E, Crozatier B, Gomez AM, Lezoualc’h Leducq (ENAFRA award, 07CVD03). F. Role of the cAMP-binding protein Epac in cardiovascular physiology and pathophysiology. Pflugers Arch. 2010;459:535–546. Disclosures 21. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by cal- cium, calcineurin, and NFAT. Genes Dev. 2003;17:2205–2232. None. 22. Oestreich EA, Malik S, Goonasekera SA, Blaxall BC, Kelley GG, Dirksen RT, Smrcka AV. Epac and phospholipase Cepsilon regulate Ca2+ release in References the heart by activation of protein kinase Cepsilon and calcium-calmodulin kinase II. J Biol Chem. 2009;284:1514–1522. 1. Beuckelmann DJ, Näbauer M, Erdmann E. Alterations of K+ currents in 23. Yoo B, Lemaire A, Mangmool S, Wolf MJ, Curcio A, Mao L, Rockman HA. isolated human ventricular myocytes from patients with terminal heart Beta1-adrenergic receptors stimulate cardiac contractility and CaMKII failure. Circ Res. 1993;73:379–385. activation in vivo and enhance cardiac dysfunction following myocardial 2. Kääb S, Nuss HB, Chiamvimonvat N, O’Rourke B, Pak PH, Kass DA, infarction. Am J Physiol Heart Circ Physiol. 2009;297:H1377–H1386. Marban E, Tomaselli GF. Ionic mechanism of action potential prolonga- 24. Tsuji Y, Zicha S, Qi XY, Kodama I, Nattel S. Potassium channel subunit re- tion in ventricular myocytes from dogs with pacing-induced heart failure. modeling in rabbits exposed to long-term bradycardia or tachycardia: dis- Circ Res. 1996;78:262–273. crete arrhythmogenic consequences related to differential delayed-rectifier 3. Nattel S, Maguy A, Le Bouter S, Yeh YH. Arrhythmogenic ion-channel changes. Circulation. 2006;113:345–355. remodeling in the heart: heart failure, myocardial infarction, and atrial fi- 25. Li GR, Lau CP, Ducharme A, Tardif JC, Nattel S. Transmural action po- brillation. Physiol Rev. 2007;87:425–456. tential and ionic current remodeling in ventricles of failing canine hearts. 4. Cohn JN, Levine TB, Olivari MT, Garberg V, Lura D, Francis GS, Am J Physiol Heart Circ Physiol. 2002;283:H1031–H1041. Simon AB, Rector T. Plasma norepinephrine as a guide to progno- 26. Tsuji Y, Opthof T, Kamiya K, Yasui K, Liu W, Lu Z, Kodama I. sis in patients with chronic congestive heart failure. N Engl J Med. Pacing-induced heart failure causes a reduction of delayed rectifier po- 1984;311:819–823. tassium currents along with decreases in calcium and transient outward 5. Shibata MC, Flather MD, Wang D. Systematic review of the impact of currents in rabbit ventricle. Cardiovasc Res. 2000;48:300–309. beta blockers on mortality and hospital admissions in heart failure. Eur J 27. Li D, Melnyk P, Feng J, Wang Z, Petrecca K, Shrier A, Nattel S. Effects Heart Fail. 2001;3:351–357. of experimental heart failure on atrial cellular and ionic electrophysiology. 6. Akar FG, Wu RC, Juang GJ, Tian Y, Burysek M, Disilvestre D, Xiong Circulation. 2000;101:2631–2638. W, Armoundas AA, Tomaselli GF. Molecular mechanisms underlying K+ 28. Li GR, Lau CP, Leung TK, Nattel S. Ionic current abnormalities associated current downregulation in canine tachycardia-induced heart failure. Am J with prolonged action potentials in cardiomyocytes from diseased human Physiol Heart Circ Physiol. 2005;288:H2887–H2896. right ventricles. Heart Rhythm. 2004;1:460–468. 7. Splawski I, Shen J, Timothy KW, Lehmann MH, Priori S, Robinson JL, 29. Petkova-Kirova PS, Gursoy E, Mehdi H, McTiernan CF, London B, Moss AJ, Schwartz PJ, Towbin JA, Vincent GM, Keating MT. Spectrum Salama G. Electrical remodeling of cardiac myocytes from mice with of mutations in long-QT syndrome genes. KVLQT1, HERG, SCN5A, heart failure due to the overexpression of tumor necrosis factor-alpha. KCNE1, and KCNE2. Circulation. 2000;102:1178–1185. Am J Physiol Heart Circ Physiol. 2006;290:H2098–H2107. 8. Zhang LM, Wang Z, Nattel S. Effects of sustained beta-adrenergic stimu- 30. Rose J, Armoundas AA, Tian Y, DiSilvestre D, Burysek M, Halperin V, lation on ionic currents of cultured adult guinea pig cardiomyocytes. Am J O’Rourke B, Kass DA, Marbán E, Tomaselli GF. Molecular correlates of Physiol Heart Circ Physiol. 2002;282:H880–H889. altered expression of potassium currents in failing rabbit myocardium. 9. Bos JL. Epac proteins: multi-purpose cAMP targets. Trends Biochem Sci. Am J Physiol Heart Circ Physiol. 2005;288:H2077–H2087. 2006;31:680–686. 31. Furukawa T, Kurokawa J. Potassium channel remodeling in cardiac hyper- 10. Métrich M, Lucas A, Gastineau M, Samuel JL, Heymes C, Morel E, trophy. J Mol Cell Cardiol. 2006;41:753–761. Lezoualc’h F. Epac mediates beta-adrenergic receptor-induced cardio- 32. Volders PG, Sipido KR, Vos MA, Kulcsár A, Verduyn SC, Wellens HJ. myocyte hypertrophy. Circ Res. 2008;102:959–965. Cellular basis of biventricular hypertrophy and arrhythmogenesis in dogs 11. Paddison PJ, Cleary M, Silva JM, Chang K, Sheth N, Sachidanandam R, with chronic complete atrioventricular block and acquired torsade de Hannon GJ. Cloning of short hairpin RNAs for gene knockdown in mam- pointes. Circulation. 1998;98:1136–1147. malian cells. Nat Methods. 2004;1:163–167. 33. Ramakers C, Vos MA, Doevendans PA, Schoenmakers M, Wu YS, 12. Luo J, Deng ZL, Luo X, Tang N, Song WX, Chen J, Sharff KA, Luu HH, Scicchitano S, Iodice A, Thomas GP, Antzelevitch C, Dumaine R. Haydon RC, Kinzler KW, Vogelstein B, He TC. A protocol for rapid gener- Coordinated down-regulation of KCNQ1 and KCNE1 expression contrib- ation of recombinant adenoviruses using the AdEasy system. Nat Protoc. utes to reduction of I(Ks) in canine hypertrophied hearts. Cardiovasc Res. 2007;2:1236–1247. 2003;57:486–496. 13. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe 34. Borlak J, Thum T. Hallmarks of ion channel gene expression in end-stage A, Speleman F. Accurate normalization of real-time quantitative RT-PCR heart failure. FASEB J. 2003;17:1592–1608. data by geometric averaging of multiple internal control genes. Genome 35. Vrtovec B, Delgado R, Zewail A, Thomas CD, Richartz BM, Radovancevic Biol. 2002;3:RESEARCH0034. B. Prolonged QTc interval and high B-type natriuretic peptide lev- 14. Reffelmann T, Kloner RA. Transthoracic echocardiography in rats. els together predict mortality in patients with advanced heart failure. Evalution of commonly used indices of left ventricular dimensions, con- Circulation. 2003;107:1764–1769. tractile performance, and hypertrophy in a genetic model of hypertrophic 36. Métrich M, Morel E, Berthouze M, Pereira L, Charron P, Gomez AM, heart failure (SHHF-Mcc-facp-Rats) in comparison with Wistar rats dur- Lezoualc’h F. Functional characterization of the cAMP-binding proteins ing aging. Basic Res Cardiol. 2003;98:275–284. Epac in cardiac myocytes. Pharmacol Rep. 2009;61:146–153. 15. Rockman HA, Koch WJ, Lefkowitz RJ. Seven-transmembrane-spanning 37. Ulucan C, Wang X, Baljinnyam E, Bai Y, Okumura S, Sato M, Minamisawa receptors and heart function. Nature. 2002;415:206–212. S, Hirotani S, Ishikawa Y. Developmental changes in gene expression of 16. Marx SO, Kurokawa J, Reiken S, Motoike H, D’Armiento J, Marks AR, Epac and its upregulation in myocardial hypertrophy. Am J Physiol Heart Kass RS. Requirement of a macromolecular signaling complex for beta Circ Physiol. 2007;293:H1662–H1672. adrenergic receptor modulation of the KCNQ1-KCNE1 potassium chan- 38. Kang G, Chepurny OG, Malester B, Rindler MJ, Rehmann H, Bos JL, nel. Science. 2002;295:496–499. Schwede F, Coetzee WA, Holz GG. cAMP sensor Epac as a determinant 17. Christensen AE, Selheim F, de Rooij J, Dremier S, Schwede F, Dao KK, of ATP-sensitive potassium channel activity in human pancreatic beta cells Martinez A, Maenhaut C, Bos JL, Genieser HG, Døskeland SO. cAMP and rat INS-1 cells. J Physiol. 2006;573:595–609. analog mapping of Epac1 and cAMP kinase. Discriminating analogs dem- 39. Novara M, Baldelli P, Cavallari D, Carabelli V, Giancippoli A, Carbone onstrate that Epac and cAMP kinase act synergistically to promote PC-12 E. Exposure to cAMP and beta-adrenergic stimulation recruits Ca(V)3 cell neurite extension. J Biol Chem. 2003;278:35394–35402. T-type channels in rat chromaffin cells through Epac cAMP-receptor pro- 18. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, teins. J Physiol. 2004;558:433–449. Wittinghofer A, Bos JL. Epac is a Rap1 guanine-nucleotide-exchange fac- 40. Pereira L, Métrich M, Fernández-Velasco M, Lucas A, Leroy J, Perrier tor directly activated by cyclic AMP. Nature. 1998;396:474–477. R, Morel E, Fischmeister R, Richard S, Bénitah JP, Lezoualc’h F, Gómez
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 Aflaki et al Epac Mediates β-Adrenergic IKs Downregulation 1003
AM. The cAMP binding protein Epac modulates Ca2+ sparks by a Ca2+/ 53. Wagner S, Hacker E, Grandi E, Weber SL, Dybkova N, Sossalla S, Sowa calmodulin kinase signalling pathway in rat cardiac myocytes. J Physiol. T, Fabritz L, Kirchhof P, Bers DM, Maier LS. Ca/calmodulin kinase II dif- 2007;583:685–694. ferentially modulates potassium currents. Circ Arrhythm Electrophysiol. 41. Hothi SS, Gurung IS, Heathcote JC, Zhang Y, Booth SW, Skepper JN, 2009;2:285–294. Grace AA, Huang CL. Epac activation, altered calcium homeostasis 54. Khoo MS, Li J, Singh MV, Yang Y, Kannankeril P, Wu Y, Grueter CE, and ventricular arrhythmogenesis in the murine heart. Pflugers Arch. Guan X, Oddis CV, Zhang R, Mendes L, Ni G, Madu EC, Yang J, Bass M, 2008;457:253–270. Gomez RJ, Wadzinski BE, Olson EN, Colbran RJ, Anderson ME. Death, 42. Brette F, Blandin E, Simard C, Guinamard R, Sallé L. Epac activator criti- cardiac dysfunction, and arrhythmias are increased by calmodulin kinaseII cally regulates action potential duration by decreasing potassium current in calcineurin cardiomyopathy. Circulation. 2006;114:1352–1359. in rat adult ventricle. J Mol Cell Cardiol. 2013;57:96–105. 55. Sabbah HN, Goldberg AD, Schoels W, Kono T, Webb C, Brachmann J, 43. Ruiz-Hurtado G, Domínguez-Rodríguez A, Pereira L, Fernández-Velasco Goldstein S. Spontaneous and inducible ventricular arrhythmias in a ca- M, Cassan C, Lezoualc’h F, Benitah JP, Gómez AM. Sustained Epac ac- nine model of chronic heart failure: relation to haemodynamics and sym- tivation induces calmodulin dependent positive inotropic effect in adult pathoadrenergic activation. Eur Heart J. 1992;13:1562–1572. cardiomyocytes. J Mol Cell Cardiol. 2012;53:617–625. 56. Schwartz PJ. Pharmacological and non-pharmacological management 44. Morel E, Marcantoni A, Gastineau M, Birkedal R, Rochais F, Garnier A, of the congenital long QT syndrome: the rationale. Pharmacol Ther. Lompré AM, Vandecasteele G, Lezoualc’h F. cAMP-binding protein Epac 2011;131:171–177. induces cardiomyocyte hypertrophy. Circ Res. 2005;97:1296–1304. 57. Laurent AC, Breckler M, Berthouze M, Lezoualc’h F. Role of Epac in 45. Rossow CF, Dilly KW, Yuan C, Nieves-Cintrón M, Cabarrus JL, Santana brain and heart. Biochem Soc Trans. 2012;40:51–57. LF. NFATc3-dependent loss of I(to) gradient across the left ventricular 58. Romey G, Attali B, Chouabe C, Abitbol I, Guillemare E, Barhanin wall during chronic beta adrenergic stimulation. J Mol Cell Cardiol. J, Lazdunski M. Molecular mechanism and functional significance 2009;46:249–256. of the MinK control of the KvLQT1 channel activity. J Biol Chem. 46. Rossow CF, Minami E, Chase EG, Murry CE, Santana LF. NFATc3-induced 1997;272:16713–16716. reductions in voltage-gated K+ currents after myocardial infarction. Circ 59. Lu Z, Kamiya K, Opthof T, Yasui K, Kodama I. Density and kinetics of I(Kr) Res. 2004;94:1340–1350. and I(Ks) in guinea pig and rabbit ventricular myocytes explain different 47. Rossow CF, Dilly KW, Santana LF. Differential calcineurin/NFATc3 ac- efficacy of I(Ks) blockade at high heart rate in guinea pig and rabbit: impli- tivity contributes to the Ito transmural gradient in the mouse heart. Circ cations for arrhythmogenesis in humans. Circulation. 2001;104:951–956. Res. 2006;98:1306–1313. 60. Zicha S, Moss I, Allen B, Varro A, Papp J, Dumaine R, Antzelevich 48. Xiao L, Coutu P, Villeneuve LR, Tadevosyan A, Maguy A, Le Bouter S, C, Nattel S. Molecular basis of species-specific expression of repo- Allen BG, Nattel S. Mechanisms underlying rate-dependent remodeling of larizing K+ currents in the heart. Am J Physiol Heart Circ Physiol. transient outward potassium current in canine ventricular myocytes. Circ 2003;285:H1641–H1649. Res. 2008;103:733–742. 61. Pavlović D, McLatchie LM, Shattock MJ. The rate of loss of T-tubules 49. Gong N, Bodi I, Zobel C, Schwartz A, Molkentin JD, Backx PH. in cultured adult ventricular myocytes is species dependent. Exp Physiol. Calcineurin increases cardiac transient outward K+ currents via tran- 2010;95:518–527. scriptional up-regulation of Kv4.2 channel subunits. J Biol Chem. 62. Soltysinska E, Olesen SP, Osadchii OE. Myocardial structural, contractile 2006;281:38498–38506. and electrophysiological changes in the guinea-pig heart failure model in- 50. Qi XY, Yeh YH, Xiao L, Burstein B, Maguy A, Chartier D, Villeneuve LR, duced by chronic sympathetic activation. Exp Physiol. 2011;96:647–663. Brundel BJ, Dobrev D, Nattel S. Cellular signaling underlying atrial tachy- 63. Ruiz-Hurtado G, Domínguez-Rodríguez A, Pereira L, Fernández-Velasco cardia remodeling of L-type calcium current. Circ Res. 2008;103:845–854. M, Cassan C, Lezoualc’h F, Benitah JP, Gómez AM. Sustained Epac ac- 51. Dolmetsch RE, Lewis RS, Goodnow CC, Healy JI. Differential activation tivation induces calmodulin dependent positive inotropic effect in adult of transcription factors induced by Ca2+ response amplitude and duration. cardiomyocytes. J Mol Cell Cardiol. 2012;53:617–625. Nature. 1997;386:855–858. 64. Poppe H, Rybalkin SD, Rehmann H, Hinds TR, Tang XB, Christensen 52. Sun C, Sumners C, Raizada MK. Chronotropic action of angioten- AE, Schwede F, Genieser HG, Bos JL, Doskeland SO, Beavo JA, Butt E. sin II in neurons via protein kinase C and CaMKII. Hypertension. Cyclic nucleotide analogs as probes of signaling pathways. Nat Methods. 2002;39:562–566. 2008;5:277–278.
Novelty and Significance What Is Known? failure) that are associated with a sustained increase in sympa- thetic nervous system adrenergic drive. It is important to know • Chronic adrenergic hyperactivity characterizes a variety of arrhythmic conditions, including congestive heart failure. the molecular mechanisms by which arrhythmias occur to devise • Although the acute arrhythmogenic effects of adrenergic stimulation more effective preventive approaches. The mechanisms by which are well defined, the effects of chronic adrenergic stimulation on the a transient increase in adrenergic stimulation causes arrhythmias electrophysiological determinants of arrhythmia are less clear. are well known. However, how sustained adrenergic hyperactiv- • Sustained adrenergic activation has been shown to downregulate slow ity alters cardiac electric function to make the heart vulnerable + delayed-rectifier K -current, IKs, but the molecular mechanisms are to dangerous rhythm disturbances is poorly understood. In this poorly defined. study, we asked how sustained β-adrenergic stimulation causes arrhythmia-promoting downregulation of important cardiac What New Information Does This Article Contribute? potassium channels. With the use of in vitro experiments with guinea pig heart cells and in vivo studies involving long-term ad- • Sustained β-adrenergic stimulation reduces IKs and delays repolariza- tion by causing transcriptional downregulation of the β-subunit potas- ministration of β-adrenergic signaling agonists to guinea pigs in sium voltage-gated channel subfamily E member 1. vivo, we defined the underlying basis: a specific pathway medi- • These effects are mediated via the exchange protein activated by ated by the exchange protein activated by cAMP, which increases cAMP and not by protein kinase A. intracellular calcium activation of calcineurin/nuclear factor of • Exchange protein activated by cAMP acts by initiating a Ca2+-calmodulin/ activated T cells signaling to transcriptionally downregulate an calcineurin/nuclear factor of activated T cells signaling pathway. accessory subunit of a cardiac potassium channel known to be important in maintaining cardiac electric stability. These findings Cardiac rhythm disturbances (arrhythmias) remain a leading have the potential to help in devising innovative approaches to cause of death for many cardiac diseases (like congestive heart preventing sudden cardiac death.
Downloaded from http://circres.ahajournals.org/ at Institut de Cardiologie de Montreal on October 1, 2014 1
Supplemental Material
Exchange Protein Directly Activated by cAMP (Epac) Mediates Slow Delayed-Rectifier Current Remodeling by Sustained Beta-Adrenergic Activation in Guinea Pig Hearts
Mona Aflaki, BSc, Xiao-Yan Qi, PhD, Ling Xiao, PhD, Balazs Ordog, PhD, Artavazd Tadevosyan, MSc, Xiaobin Luo, PhD, Ange Maguy, PhD, Yanfen Shi, MD, PhD, Jean-Claude Tardif, MD and Stanley Nattel, MD
Supplemental Materials and Methods
Guinea Pig Ventricular-cardiomyocyte Isolation Animal care and handling procedures complied with the guidelines established in the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and were approved by the ethics committee of the Montreal Heart Institute. Guinea pigs weighing 350-450 g were injected with heparin (1.0 units/kg) and euthanized by stunning-induced coma with loss of all reflex-responses, followed by cardiac excision. The heart was quickly excised and transferred to ice-cold oxygenated Tyrode solution (mmol/L: NaCl 136, KCl 5.4, MgCl2 1, HEPES, Na2H2PO4 0.33; pH adjusted to 7.35). The heart was retrogradely-perfused via the aorta with 200-µmol/L Ca2+-containing Tyrode solution. When clear, the perfusate was changed to Ca2+-free Tyrode solution and digested with the addition of 280-U/mg collagenase type-II (Worthington; 25 mg in 50 mL Tyrode solution) and 1% bovine serum albumin (Bioshop). Cells were obtained by trituration and stored in KB-solution containing (mmol/L): KCl 20, KH2PO4 10, glucose 10, mannitol 40, albumin 0.1%, L-glutamic acid 70, β-hydroxybutyric 10, taurine 20, EGTA 10; (pH 7.35). Cells were concentrated and allowed to settle by gravity. The pellet was kept for cell culture.
Cell Culture and Drug Treatment Cardiomyocytes were reintroduced to calcium by a stepwise addition of cell-culture medium (Hyclone M199+Earle’s salts and L-glutamine) to the cells resuspended in KB (successively 200, 500, 1000, and 1800 μmol/L). The medium was supplemented with Na-penicillin and streptomycin (Hyclone, 1-µg/mL) and insulin-transferrin-selenium-X (GIBCO-1%). Cells were plated at low density (~104 cells/cm2) on glass coverslips and culture dishes coated with laminin (Sigma, 20-µg/mL) and maintained at 37°C in a humidified, 5% CO2-enriched atmosphere. After 2 hours, dead cells were removed. Fresh medium was added and supplemented with 1-µmol/L isoproterenol (Iso, Sigma) in drug-treatment groups. Cells were kept in culture for an additional 30 hours. In some experiments, CGP-20712A (Sigma, 300-nmol/L), ICI-118551 (Sigma, 500-nmol/L), 8-Br-cAMP (Sigma, 1-mmol/L), forskolin (Calbiochem, 10-μmol/L), 8-pCPT (Sigma, 6-µmol/L), INCA-6 (Calbiochem, 1- µmol/L), cyclosporine (Sigma, 0.8-µmol/L), BAPTA-AM (Santa Cruz, 10-µmol/L), myristoylated (cell-permeable) PKI (Invitrogen, 1-µmol/L), U-73122 hydrate (Sigma, 1-µmol/L ), KN93 (Calbiochem, 500-nmol/L), KN92 (Calbiochem, 500-nmol/L), or GGTI 298 trifuoroacetate salt hydrate (Sigma, 1-μmol/L) were added to cultured cardiomyocytes along with isoproterenol (1-µmol/L) and compared to the appropriate control and 2
isoproterenol-only groups. In all experiments studying effects of blockers on isoproterenol action, cells from the same isolates were exposed in parallel to isoproterenol as an internal control.
Electrophysiology Cell culture: After 30 hours of exposure to interventions in culture, cardiomyocytes were washed with Tyrode solution. Isoproterenol-treated cells were washed with 1-µmol/L propranolol (Sigma) to block any potential acute effects of residual isoproterenol bound to the membrane. All experiments were performed at 36±1°C. The whole-cell patch clamp technique was used to record currents in voltage- clamp mode. Borosilicate glass electrodes were filled with pipette solution containing (mmol/L): GTP 0.1, K-aspartate 110, KCl 20, MgCl2 1, Mg2-ATP 5, HEPES 10, Na2-phosphocreatine 5 and EGTA 10; pH adjusted to 7.2 with KOH, and attached to a patch-clamp amplifier (Axopatch 200A). Electrodes had tip-resistance of 2-4 MΩ when filled. To record IKs, coverslips with cultured cardiomyocytes were placed 2+ in the bath and superfused with Tyrode solution containing 1-mmol/L Ca , CdCl2 (200-µmol/L, to inhibit 2+ L-type Ca -current) and dofetilide (1-µmol/L, to inhibit IKr).
Freshly isolated cells after in-vivo treatment: To record IK1, ventricular cardiomyocytes were perfused 2+ 2+ with Tyrode solution containing 1-mmol/L Ca , CdCl2 (200-µmol/L, to inhibit L-type Ca -current) and 2+ dofetilide (1-µmol/L, to inhibit IKr). IK1 was defined on the basis of current sensitive to Ba (1-mmol/L). For IKs recording, the extracellular solution was modified to (mmol/L): N-methylglucamine (NMG) 140; KCl 5.4; MgCl2 1; glucose 5; HEPES 10 (pH 7.4, HCl). The whole-cell perforated-patch technique was used to record APs in current-clamp mode. Junction potentials averaged 10.5 mV and were corrected for APs only. The pipette solution for action potential (AP) recordings was modified to contain low EGTA 2+- (0.005 mmol/L). The extracellular solution for Ca current (ICa) measurement contained (mmol/L): tetraethylammonium-chloride 136, CsCl 5.4, MgCl2 1, CaCl2 2, NaH2PO4 0.33, dextrose 10, and HEPES 5 (pH 7.4, CsOH). Niflumic acid (50 μmol/L) and 4-aminopyridine (2-mmol/L) were added to inhibit Ca2+-dependent Cl--current and transient-outward K+-current respectively. The pipette solution contained (mmol/L) CsCl 120, tetraethylammonium-chloride 20, MgCl2 1, EGTA 10, MgATP 5, HEPES 10, and Li-GTP 0.1 (pH 7.4, CsOH). Electrodes had tip-resistance of 2-4 MΩ when filled.
Cell capacitance was 104±4 pF for CTL and 106±4 pF for isoproterenol-treated cells in culture. Cell capacitance was 199±11 pF for CTL and 252±16 pF for in-vivo isoproterenol-treated animals (P<0.05). Cell capacitance was 146±9 pF for CTL and 180±11 pF for in-vivo sp-8p-CPT treated animals (P<0.05).
Protein-extraction and Immunoblots Protein extraction: Membrane protein fractions were isolated with extraction buffer containing: 25-mmol/L Tris-HCl (pH 7.34), 5-mmol/L EGTA, 5-mmol/L EDTA, 150-mmol/L NaCl, 0.2 mmol/L Na3VO4, 0.1 AEBSF, 20 mmol/L glycerol-2-phosphate, 10-µg/mL aprotinine, 10-µg/mL leuptenin, 1-µmol/L microcystin, 1-µg/mL pepstatin (pH 7.4); followed by homogenization. After centrifugation at 3000 rpm and 4ºC for 10 minutes, the supernatant containing the cell membranes was centrifuged at 48,000 rpm for one hour. Membrane pellets were re-suspended in extraction buffer supplemented with 1% Triton X-100 and stored at -20°C.
Western blots: Protein concentration was determined with the Bradford method. Membrane protein (10-20 µg) was denatured and fractionated on 8% SDS-polyacrylamide gels, then proteins were transferred electrophoretically to Immobilon-P polyvinylidene fluoride (PVDF) membranes (Millipore) in 25-mmol/L Tris-base, 192-mmol/L glycine and 20%-ethanol at 0.3 A for 1 hour. Membranes were blocked in phosphate buffered saline (PBS, mmol/L: 137 NaCl, 10 phosphate, 2.7 KCl,; pH 7.4, NaOH) with 5% non-fat dry milk for 1 hour and incubated with primary antibodies (rabbit anti-KCNE1 1:1000, as kindly provided by Dr Jacques Barhanin) overnight at 4°C. After washing and re-blocking, membranes were incubated with donkey anti-rabbit (1:10,000, Jackson Immunolabs) secondary antibodies. Antibody was detected with Western-Lightning Chemiluminescence Reagent Plus 3
(Perkin-Elmer Life Sciences). Later, the same membranes were also probed with anti-GAPDH at room temperature for 1 hour in order to control for equal protein loading. Secondary antibody was horseradish peroxidase-conjugated goat anti-mouse IgG (1:10,000, Jackson Immunolabs).
Confocal Microscopy After 30 hours of exposure to interventions or control vehicle in culture, cardiomyocytes were washed with PBS and then fixed with 2%-formaldehyde (20 min, Sigma). Cells were blocked and permeablized with 2% normal donkey serum (NDS, Jackson), and 0.2% TritonX-100 (Sigma) for 1 hour. Cells were then incubated overnight at 4°C with primary antibodies for KCNE1 (1:200 rabbit polyclonal), NFATc3 (1:200, mouse monoclonal, Santa Cruz) and NFATc4 (1:200, rabbit polyclonal, Santa Cruz) in PBS containing 1% NDS, 1% BSA, 0.05% Triton. This was followed by 3 washes and incubation with secondary antibody (donkey-anti-mouse Alexa-555 and donkey-anti-rabbit Alexa-488, Jackson) at room temperature for 1 hour. Additionally, cells were incubated with ToPro3 (1-µmol/L, Invitrogen) for 30 minutes at room temperature. Confocal microscopy was performed with the Olympus Fluoview FV1000 system. Control experiments with secondary antibodies revealed very low-level or absent background staining. Signals were analyzed with Fluoview Olympus software. Nuclear and cytosolic densities of NFATc3 and NFATc4 staining were determined as the sum of the intensities of pixels within nuclear or cytosolic regions normalized to the corresponding nuclear or cytosolic areas. Phalloidin was used as a cardiomyocyte marker.
RNA Isolation/Real-time PCR Guinea pig ventricular cardiomyocytes were collected after 30-hr culture in intervention- or CTL-medium, or after isolation following isoproterenol or sp-8pCPT treatment. Total RNA was extracted with Nucleospin RNA II (Macherey- Nagel) kit. Cells were homogenized in TRIzol Reagent (Invitrogen), and mixed with equal amount of 70% ethanol. The lysate was loaded on to a NucleoSpin RNA II column and centrifuged for 30 s at 11,000 g to ensure RNA-binding. MDB (Membrane Desalting Buffer) was added to the columns to prepare the membrane for subsequent DNase reaction. To eliminate genomic DNA, RNA was treated with a DNase reaction mixture (room temperature, 30 min). The silica membrane was washed with Buffer RA2 (wash buffer) and RA3 (wash buffer concentrate) and then dried. RNA was eluted with 40 µL of RNase-free water (HyClone®, Thermo) and centrifuged at 11,000 g for 1 min. RNA was quantified spectrophotometrically at 260-nm and sample integrity was confirmed by agarose gel electrophoresis. One μg of each RNA sample was reverse transcribed with the High Capacity cDNA Archive Kit (Applied Biosystems). Real-time PCR was performed with SYBR Green (Power Syber Green master mix, Applied Biosystems). Primer sequences are shown in Supplemental Table 1. Each cDNA sample was run in duplicate on the Stratagene Mx3000P qPCR platform. Primer specificity was verified with dissociation curve analyses and gel electrophoresis of the PCR products. Gene expression levels were normalized to the geometric average of multiple reference genes (18-S rRNA, GAPDH, β-actin and HPRT) according to Vandesompele et al.1
Construction of Epac-1 Knock-down Adenoviral Vectors To attenuate Epac1 expression in guinea pig cardiomyocytes, an E1-E3-deleted adenoviral vector, over-expressing a microRNA-embedded shRNA (shRNAmir) sequence targeted to Epac1 mRNA (Ensembl Gene ID: ENSCPOG00000006002) was developed. First, we created an adenoviral shuttle plasmid that carries a CMV promoter-driven GFP expression cassette and the microRNA-context sequence in the 3`untranslated region of GFP with unique restriction sites for cloning of shRNAmirs (Supplemental Figure IA). The turbo GFP cDNA was PCR-amplified from pGIPZ (Open Biosystems) with the following primares: 5` GGTAGTCGACCACCGACTCTACTAGAGGAT (sense) and 5` TGCGGCCGCGGCCGCTACTTGTACATTAT (antisense). The PCR product was cloned in pAdTrack- CMV (a gift of Bert Vogelstein, Addgene plasmid #16405) at SalI – NotI sites, generating the AdS-GFP plasmid. Two XbaI fragments of AdS-GFP between positions 1612 and 3298 were deleted using the 4
dam-, dcm- E. coli strain ER2925 (New England Biolabs), resulting in AdS-GFP-ΔXbaI. Finally, the microRNA-context sequence was PCR amplified from pGIPZ with 5` TAGCGGCCGCTTGTTTGAATGAGGCTTCAG sense and 5` TGCAAGCTTCGCATTAGTCTTC CAATTGAA antisense primers and the PCR product was cloned in AdS-GFP-ΔXbaI between NotI and HindIII sites, constructing the AdS-empty plasmid. The Epac1-targeted shRNAmir sequence was cloned in AdS-empty (Supplemental Figure IB) following previously published protocols.2 Briefly, the shRNAmir sequence was designed with the web-based ‘shRNA retriever’ tool available on the homepage of Ravi Sachidanandam`s laboratory (http://katahdin.cshl.org/, Cold Spring Harbor Laboratory, NY, USA). The 97-bp long synthetic oligonucleotides (Epac1: 5` TGCTGTTGACAGTGAGCGAACAGAG ACATTCCTCAGTGACTAGTGAAGCCACAGATGTAGTCACTGAGGAATGTCTCTGTCTGCCTACT GCCTCGGA, scrambled: 5` TGCTGTTGACAGTGAGCGAACGTAAGCAAAGCGGTGATCATA GTGAAGCCACAGATGTATGATCACCGCTTTGCTTACGTCTGCCTACTGCCTCGGA, with the 22- bp mature siRNA sequences italicized) were PCR amplified with 5` CAGAAGGCTCGAGAAGGTATA TTGCTGTTGACAGTGAGCG sense and 5` CTAAAGTAGCCC CTTGAATTCCGAGGCAGTAGGC A antisense primers and the PCR products cloned in AdS-empty at XhoI and EcoRI sites. Recombinant adenoviral genomes and initial virus cultures were generated by employing the Adeasy system (Johns Hopkins University, http://www.coloncancer.org/adeasy.htm), according to previously published protocols.3 Recombinant adenoviruses were amplified in Hek293 cells (ATCC) and were purified with the Adenovirus Standard Purification ViraKit™ (Virapur LLC). Functional titers of the final virus preparations were determined by infecting Hek293T/17 cells with limiting dilutions of the virus. Guinea pig ventricular cardiomyocytes were transduced with the Epac1-KD and scrambled virus and kept in culture for 72 hr with the appropriate controls. The infection efficiency of the virus was close to 100% of viable cardiomyocytes (Supplemental Figure IC).
In vivo chronic β-adrenergic stimulation model Male Hartley guinea pigs weighing 300-350 g were acclimated to the new environment for a period of one week. Guinea pigs received daily I.P. injections of isoproterenol (Sigma, dissolved in 0.9% saline- solution) for the treatment group and vehicle (0.9% saline-solution) for the control group. Isoproterenol -1 was injected at an initial dose of 50 μgkg /day and after the first week the dose was increased by -1 -1 100 μgkg /day every week over 13 weeks, to a final dose of 1.4 mgkg /day for the last week. On the last day guinea pigs were anaesthetized with isoflurane (2-3%) and subjected to echocardiography.
In vivo chronic Epac-treatment Guinea pigs weighing 250-300 g were anaesthetized with isoflurane and osmotic minipumps (model 2006, Alzet, Cupertino, CA) were implanted subcutaneously in the neck. The minipumps were filled with Sp-8-pCPT (Axxora, non-hydrolyzable form of 8-pCPT, dissolved in sterile water), and used to provide constant delivery at 16 μg/day over 6 weeks, Guinea pigs implanted with vehicle-filled minipumps were used as parallel controls.
Echocardiography Transthoracic echocardiographic studies were performed at baseline and 13 weeks after injection, with animals being sedated with isoflurane, using a phased-array probe 10S (4.5-11.5 Megahertz) in a Vivid 7 dimension system (GE Healthcare Ultrasound, Horten, Norway).
M-mode echocardiograms were used to measure left ventricular (LV) dimensions at both end cardiac diastole (LVDd) and systole (LVDs), LV fractional shortening (FS) was calculated as (LVDd – LVDs) / LVDd X 100%, and LV ejection fraction (EF) was obtained by the formula packed in Vivid 7 dimension system suggested by American Society of Echocardiography. The thickness of LV anterior wall and that of LV posterior wall were also measured in LV M-mode spectrum, LV mass was calculated using formula suggested by Reffelmann et al for small animals.4 LV mass / Body weight (BW), LVDd / BW, and LV mass / LVDd ratio were calculated to evaluate LV structural remodeling. 5
Pulsed wave Doppler was used to study trans mitral flow (TMF), left lower and upper pulmonary venous flow (PVF), and trans aortic flow (TAF). Peak velocity in early filling E wave, time interval from mitral valve (MV) closing to opening (MVco) were measured in TMF. Velocity of systolic flow (S) and that of diastolic flow (D) were measured, and S/D ratio was calculated in PVF. LV ejection time (ET) was measured in TAF. LV global myocardial performance index (MPI) was calculated as (MVco-LVET)/ LVET X 100%.
Mitral annulus movement was recorded by tissue Doppler imaging. Lateral and septal mitral annulus moving velocities in systole (S lateral, S septal), early and atrial diastole (e’, a’) were measured. And time intervals from ending of a’ to beginning of e’(b), and from beginning to ending of S (a) were measured. LV regional MPI was calculated by (b-a) / a X 100%, and E/e’ was calculated for both lateral wall and septum.
Cardiomyocyte T-tubule network analysis Freshly isolated ventricular cardiomyocytes were plated on laminin-coated Petri dishes. Cell membranes were stained with 2-μmol/L di-4-ANEPPS in Kraft-Bruhe (KB) solution. Samples were excited with an argon (488nm) laser and fluorescence collected at 515-nm emission wavelength with an LSM 710 confocal microscope. Z-series were acquired every 300-nm from top to bottom of each cardiomyocyte. Fluorescent latex beads (170-nm) were used to determine the point spread function (PSF) of the imaging system. Acquired Z-series were further deconvolved with Huygens Professional 4.4.0 software using maximum likelihood estimation with a Richardson-Lucy algorithm. The 20 most central Z-slices, corresponding to a 6-μm thickness, were used to build maximum intensity projections with MIP rendering. The extent of the T-tubule network was determined using the Image Pro Plus 6.0 software (Media Cybernetics). Briefly, the sum of the pixel intensity associated with the total membrane network was first quantified (a). In a second step, the peripheral membrane region was excluded, considering exclusively the inner membrane network (i.e., T-tubules), and the corresponding sum of the pixel intensity quantified as (b). The extent of T-tubule network within cardiomyocytes (y) was expressed as a percentage of the total membrane network and determined as follows: y = (b x 100)/a.
Incorporation of [3H]-leucine To examine the effect of Isoproterenol on protein synthesis, the incorporation of radioactive-labeled [3H]-leucine was quantified in cardiomyocytes. Cultured guinea pig ventricular cardiomyocytes were stabilized in culture and treated with vehicle (CTL) or isoproterenol (1-μmol/L) in the presence of [3H]-leucine (1-μCi/mL) for 30 h. The cells were washed with PBS and then treated with 10%-trichloroacetic acid at 4°C for 30 min to precipitate protein content. The precipitates were then dissolved in NaOH (0.25 N). Aliquots were counted by liquid scintillation counting.
Data Analysis Clampfit 9.2 (Axon) and GraphPad Prism 5.01 were used for data analysis. Group comparisons were performed with unpaired Student t-tests (for single comparisons between 2 groups) or one-way ANOVA with Bonferroni-corrected t-tests (for multiple-group comparisons). Patch-clamp data were analyzed with two-way ANOVA and Bonferroni-corrected t-tests. A two-tailed P<0.05 indicated statistical significance. Data are expressed as mean±SEM.
6
References
1. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitativeRT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:RESEARCH0034.
2. Paddison PJ, Cleary M, Silva JM, Chang K, Sheth N, Sachidanandam R, Hannon GJ. Cloning of short hairpin rnas for gene knockdown in mammalian cells. Nat Methods. 2004;1:163-167.
3. Luo J, Deng ZL, Luo X, Tang N, Song WX, Chen J, Sharff KA, Luu HH, Haydon RC, Kinzler KW, Vogelstein B, He TC. A protocol for rapid generation of recombinant adenoviruses using the adeasy system. Nat Protoc. 2007;2:1236-1247.
4. Reffelmann T, Kloner RA. Transthoracic echocardiography in rats. Evalution of commonly used indices of left ventricular dimensions, contractile performance, and hypertrophy in a genetic model of hypertrophic heart failure (shhf-mcc-facp-rats) in comparison with wistar rats during aging. Basic Res Cardiol. 2003;98:275-284.
5. Rockman HA, Koch WJ, Lefkowitz RJ. Seven-transmembrane-spanning receptors and heart function. Nature. 2002;415:206-212.
7
Supplemental Figures
Supplemental Figure I. A: Schematic illustrating the adenoviral viral construct designed to knock down Epac1 expression in primary culture. CMV=cytomegalovirus promoter GFP=green fluorescent protein B: Complementary siRNA sequence that was used to knock down Epac1 and corresponding guinea pig Epac1 mRNA sequence. C: Transmission and corresponding fluorescent mode images of adenovirus- infected ventricular cardiomyocytes.
8
Supplemental Figure II. A: Mean±SEM IKs density-voltage relations at baseline and after 30-hr culture in vehicle-control medium (CTL). B: Representative immunoblots and mean±SEM expression-levels for KCNE1 protein following normalization to GAPDH band intensities on the same lanes (n=3). C: Representative immunoblots and mean±SEM expression levels for KCNQ1 protein normalized to GAPDH (n=3). Samples were obtained from membrane protein extracts. (N=number of independent experiments).
9
Supplemental Figure III. A, B: Cell size (cell area, µm2) and cell capacitance (pF) for vehicle (CTL) and isoproterenol-treated cells. C: [3H]-leucine incorporation in cells incubated with vehicle (CTL) or isoproterenol for 30 hours. D: Di-4-ANEPPS T-tubule staining in freshly isolated cardiomyocytes and 30- hour cultured cardiomyocytes in CTL and isoproterenol-containing conditions. E: The extent of T-tubule network within cardiomyocytes analyzed as percentage of the total membrane network (**P<0.01, ***P<0.001, N=number of cells) F: Di-4-ANEPPS T-tubule staining in freshly isolated cardiomyocytes from CTL and isoproterenol treated animals. G: The extent of T-tubule network within cardiomyocytes analyzed as percentage of the total membrane network (N= number of cells).
10
Supplemental Figure IV. A-D. Effects of in-vitro isoproterenol treatment (for 30 hours) on IKs
properties: A: IKSTEP normalized to maximum values in each cell. B: IKTAIL normalized to maximum value in each cell. Curves are fits to experimental data by Boltzmann function.*P<0.05, **P<0.01, ***P<0.001 vs CTL at the same test potential (TP). (N=number of cells) C: Time constant (τ) of activation as determined with biexponential fits. Isoproterenol significantly accelerated the slow phase time constant. D: Results at + 60 mV. E-H. Effects of in-vivo isoproterenol treatment (progressively-increasing doses
over 13 weeks) on IKs properties: E: IKSTEP normalized to maximum values in each cell. F: IKTAIL normalized to maximum value in each cell. Curves are fits to experimental data by Boltzmann function. G: Time constant (τ) of activation as determined with biexponential fits. Isoproterenol significantly accelerated the slow phase time constant. H: Results at + 60 mV, *P<0.05, **P<0.01, ***P<0.001 (N=number of cells). 11
Supplemental Figure V. A: IKs recordings for control cells and cells acutely perfused with 1-μmol/L isoproterenol, alone or along with PKI. B: Mean±SEM IKs density-voltage relations for corresponding conditions. *P<0.05, ***P<0.001, versus control (CTL).
12
Supplemental Figure VI. A-C. In-vitro isoproterenol (30-hour exposure in culture) effect on Epac1 and 2 expression. A, B: Mean±SEM normalized results for Epac1 (N=11) and Epac2 (N=10) mRNA expression in vehicle (CTL) and isoproterenol treated cells. C: Mean±SEM, Epac1/Epac2 ratio in CTL and isoproterenol treated cells. D-F. In-vivo isoproterenol effect (progressively-increasing doses over 13 weeks) on Epac1 and Epac2 expression. D, E: Mean±SEM normalized results for Epac1 and Epac2 mRNA expression in CTL (N=5) and isoproterenol (N=7) treated animals. F: Mean±SEM, Epac1/Epac2 ratio in CTL and isoproterenol treated cells.
13
Supplemental Figure VII. Mean±SEM normalized results for Epac1 and Epac2 expression in the presence of GFP-carrying adenovirus in a bicistronic vector with a scrambled construct (Scr+Iso), GFP- carrying adenovirus in a bicistronic vector with an Epac-knockdown probe (KD+Iso), and Iso-alone (Iso). Cells were exposed to isoproterenol for 30 hours at the end of a 72-hour period virus-incubation period. ***P<0.001. C, D: Mean±SEM normalized results for KCNE1 and KCNQ1 mRNA expression in the presence of Scr+ isoproterenol, KD + isoproterenol and Iso-alone. *P<0.05
14
Supplemental Figure VIII. A, B: Mean±SEM normalized results for Epac1 and Epac2 mRNA expression in scrambled construct (Scr) and Scr+isoproterenol (Iso) treated cells. Cells were exposed to isoproterenol or vehicle for 30 hours at the end of a 72-hour period virus-incubation period. *P<0.05. 15
Supplemental Figure IX. Effects of Epac-knockdown on isoproterenol-induced NFAT-localization changes. Immunolocalization of NFATc3 and NFATc4 viral gene-transfer cells in isoproterenol-cultured cardiomyocytes for scrambled (Scr+Iso) or Epac1 knockdown (KD+Iso) virus. Top: Representative images. Bottom: Mean±SEM ratios of nuclear/cytosolic NFATc3 (**P<0.01) and NFATc4 (*P<0.05) fluorescence-intensity ratios. N=number of cells. Because of the limited number of cells in each heart, the fact that cells were divided for different conditions, and the substantial death-rate of cells in prolonged culture with viral infection, a very limited number of healthy surviving cells was available after immunostaining for each condition. We therefore analyzed only 1 cell per experiment, and the Ns shown are the number of experiments. Cells were exposed to isoproterenol for 30 hours at the end of a 72-hour period virus-incubation period.
16
Supplemental Figure X. Effects of in-vivo isoproterenol administration (progressively increasing doses over 13 weeks) on cellular electrophysiological properties. A: Representative ICaL recordings from CTL and isoproterenol treated animals. B: Mean±SEM ICaL density *P<0.05, **P<0.01, ***P<0.001 (n=number of cells) C: Representative IK1 recordings from CTL and isoproterenol treated 2+ animals D: Mean±SEM IK1 density-voltage relations, recorded as Ba -sensitive current, with ramp protocol in insert. Please note different scales for CTL versus Iso recordings in C. *P<0.05, **P<0.01, ***P<0.001 (n=number of cells).
17
Supplemental Figure XI. Effects of in-vivo sp-8-pCPT administration on cellular electrophysiological properties. Guinea pig were treated with 16 μg/day sp-8-pCPT or vehicle for 6 weeks, after which cardiomyocytes were isolated and subjected to patch-clamp study. A: cell capacitace in CTL and sp-8- pCPT condition (pF) (*P<0.05, n=number of cells). B: HW/BW ratio in CTL and sp-8-pCPT treated animals (n=number of animals). C: Representative ICaL recordings from CTL and sp-8-pCPT treated animals. D: Means±SEM ICaL density, *P<0.05. E: Representative IK1 recordings from CTL and sp-8- pCPT treated animals, recorded as Ba2+-sensitive current, with ramp protocol in insert. F: Means±SEM IK1 density-voltage relations *P<0.05, ***P<0.001 (n=number of cells).
18
Predicted NFAT binding sites within the 5kb KCNE1 guinea pig promoter
-4749 GCTCAACTAT TTCAAGGAAA GAGACATTAT GGTAGCTACT GTTATATCAG NFAT binding site ……………………………………………………………………………………………………………………………………………… -4549 ATCAGGTGAT AAAACACTGT GGAAAGAAGA AGAGGTACTG AGAACAGGAG NFAT binding site ……………………………………………………………………………………………………………………………………………… -4299 TCGAATCTAG TATTTTGTAT TTTCACTTAA GTCAGAAACT CTTTCCTAAA NFAT binding site
-4249 ATGTTCTGGG TGCCGGAGTG GGGACAAAAG GTGAACAAGA GAATCTCTAA ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… -3499 CTGGAAGGCT CTGGTGGCCT CAGTTGGCTT ATTTCCTGAT AAGAGGTAAA NFAT binding site
-3449 TAGCATATGT GTCCAGAATT TGGACAGAGG GTTGTAAGAA AGATGAAAAC -3399 AACAGAGAAT TGCTTCCAAG ACAAACTGAC TCATCGGATT CTTGACTCAA -3349 TTAGGATCAT TCACCCAAAT TAAGCTTCTA CATAATTGGT TTTACCCTAG -3299 TGCTGTTTCC TAAAACAAAT AATGCCAAAT GATTTCAAGA CTGCATCTTT NFAT binding site ……………………………………………………………………………………………………………………………………………… -3099 GGCTGTGACC TGCCCATCGG CCCTGGCTGC CCCAGAATAT CCCCCTCCTG -3049 GAGGAAATCT GGGCATCAAC ACAAAAAGCC TTGCCCAGGC AGTAAGCACA NFAT binding site
-2999 TAAGGAAAGG CAAAAGTTGC CAGTGCTAGG AAAGCTGCTG TTTTGGAAGC NFAT binding site
-2949 TTCCGGGCTG TTATCAGTGC TGATAGGTGA GCCAACTGGA GCAGACACTA ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………… ………………………………………………………………………………………………………………………………………………
-349 AGACATCTGA GAGCCATGGT CCACCAGGGG ACAGCCCACT CTAAAACCCT -299 ACAACCTCAA ATCCTTGGGC TACAATTTCT TAACTAGGTG GAAAAACCAA NFAT binding site
-249 TAAAGTCATC CTGGAACCAC AGAATGTGCG CCTGCTATGT CCTGTCTGCC -199 TGCAAGATCA GTGATATTGC CTATTCTCCA AAAAGGAAAT GACGCAGAAG -149 AGAAGGCTCA CTTCTGTCAC CTGGGCCTCT GTGCGTGTGT GTGTGTGTGT -99 GTGCGTGTGT GTGAGTGTGT GTGTGTGTGT GTGTGTGTGT GTGTGTGTGT
TSS (+1) -49 AATTTAGCCA ATGTGCACTT CTGATTTCAG GCTGCATCTT TCTTTTCGGC +2 AGCTTGCCTG GGACGTTCAC TCTCCCACCG TGGAAGCTTG CAGCCCAGGA +52 TGATCTTGCC TAATTCCACA GCTGTGATGC CCTTCCTGAC CACCGTGTGG Translation Start Site
+102 CAGGGGACAG TTCAACCCA
Supplemental Figure XII. Putative NFAT binding sites for KCNE1 promoter in guinea pig. 5000 bp- length sequence upstream of the transcription start site (translation start site is in yellow highlight) of guinea pig KCNE1 promoter. Gene analyzed by MatInspector (Genomatix, www.genomatix.de). 19
Supplemental Figure XIII. Left: IKs-recordings (step to +50 mV) and Right: Mean±SEM, IKs density- voltage relations in cultured cells for: A, B: CTL cardiomyocytes versus isoproterenol (1-μmol/L, 30-hr) treated cardiomyocytes versus GGTI+isoproterenol treated cells. Rap1 inhibition prevented isoproterenol-induced decrease in IKs density. C, D: CTL cardiomyocytes versus isoproterenol-only versus U73122+isoproterenol exposed cardiomyocytes. PLC inhibition did not prevent isoproterenol- induced decrease in IKs density. E, F: CTL cardiomyocytes versus isoproterenol treated cells, isoproterenol + KN93-treated cells and isoproterenol + KN92-treated treated cells. All exposures were for 30 hours during culture. CaMKII inhibition prevented isoproterenol-mediated reduction in IKs density. *P<0.05, **P<0.01, ***P<0.001, versus control at same voltage. (n= number of cells).
20
Supplemental Figure XIV A:IKs-recordings (step to +50 mV) and B: Mean±SEM, IKs density-voltage relations in cultured cells treated with Rap1 inhibitor (GGTI) or CaMKII inhibitor (KN93) or vehicle, in the absence of adrenergic stimulation.
21
Supplemental Tables
Supplemental Table I.
Gene name: Primer sequence Gene Bank no/ID
RAPGEF3 For 5` GATGTGGAAGCGAAGACCAT ENSCPOG 00000006002 (Epac1) Rev 5` AGGGTGTAACGCAGCAAAGT
RAPGEF4 For 5` GAGCTGGTGGACTGGATGCT ENSCPOG 00000010605 (Epac2) Rev 5` TGGTTGAGGACACCGTCTTCT
KCNE1 For 5` TCGCACGACCCGTT NT_176273.1
Rev 5` TCAATGACGCAACACGATCTG
KCNQ1 For 5` TCAGGCGCATGCAGTACTTT NT_176377.1
Rev 5` GATTCGCACCATGAGGTTGA
HPRT11 For 5`AGGTGTTTATCCCTCATGGACTAATT ENSCPOG00000002512
Rev 5` CCTCCCATCTCCTTCATCACAT
β-actin2 For 5` ACTCTCCACCTTCCAGCAGA NM_031144
Rev 5` AGGGTGTAACGCAGCAAAGT
GAPDH3 For 5` TACGACAAGTCCCTCAAGATTG NT_176312.1
Rev 5` TCTGGGTGGCAGTGATGG
18S For 5` ACGGCTACCACATCCAAGGA NT_176398.1
Rev 5` CCAATTACAGGGCCTCGAAA
1. Skwor TA, Cho H, Cassidy C, Yoshimura T, McMurray DN. Recombinant guinea pig CCL5 (RANTES) differentially modulates cytokine production in alveolar and peritoneal macrophages. J Leukoc Biol. 2004;76:1229-1239.
2. Rehal S, Blanckaert P, Roizes S, von der Weid PY. Characterization of biosynthesis and modes of action of prostaglandin E2 and prostacyclin in guinea pig mesenteric lymphatic vessels. Br J Pharmacol. 2009;158:1961-1970.
3. Navarro-Lopez J, Jimenez-Diaz L, Geranton SM, Ashmore JF. Electrophysiological and molecular analysis of Kv7/KCNQ potassium channels in the inferior colliculus of adult guinea pig. J Mol Neurosci. 2009;37:263-268. 22
Supplemental Table II. General and Echocardiographic Indices of Left Ventricular Structural Remodeling
Control Iso P value (n=5) (n=9) (Iso vs control) LVDd (mm) Baseline 7.56±0.75 7.75±0.40 0.539 End 10.54±0.51 11.22±0.65 0.066 % change 40.6±16.1 45.1±8.6 0.508 LVDd/BW Ratio (mm/kg) Baseline 23.9±2.1 23.7±2.2 0.867 End 10.7±1.0 12.8±1.7 0.029 % change -55.0±3.6 -45.7±8.0 0.031 LV mass (g) Baseline 0.84±0.09 0.84±0.11 0.997 End 1.92±0.30 2.65±0.33 0.001 % change 131.6±46.5 217.8±48.4 0.007 LV mass/BW Ratio (g/kg) Baseline 2.65±0.22 2.56±0.32 0.582 End 1.95±0.22 3.00±0.42 <0.001 % change -26.8±3.6 18.0±16.8 <0.001 LV mass/LVDd Ratio (g/mm) Baseline 0.11±0.00 0.11±0.01 0.657 End 0.18±0.02 0.24±0.03 0.002 % change 63.7±17.8 119.1±30.4 0.003 LVDd: left ventricular dimension at end cardiac diastole; BW: body weight.
23
Supplemental Table III. Echocardiographic Indices of Left Ventricular Systolic Function
Control Iso P value (n=5) (n=9) (Iso vs Control) FS (%) Baseline 42.7±6.9 39.9±3.7 0.345 End 48.8±6.4 35.3±4.1 0.002 % change 11.0±30.4 -11.1±12.9 0.077 EF (%) Baseline 78.4±7.0 75.8±4.1 0.388 End 81.0±6.3 69.2±5.5 0.003 % change 4.4±16.2 -8.5±8.6 0.072 S Septal (cm/s) Baseline 3.34±1.18 3.78±0.71 0.398 End 4.46±1.04 4.16±0.92 0.581 % change 38.9±24.6 11.0±20.9 0.043 FS: left ventricular (LV) fractional shortening; EF: LV ejection fraction; S Septal: LV basal septal systolic contractility.
24
Supplemental Table IV. Echocardiographic Indices of Left Ventricular Diastolic Function
Control Iso P value (n=5) (n=9) (Iso vs Control) Lateral E/e’ Ratio Baseline 12.1±4.4 8.7±1.8 0.103 End 10.5±3.0 13.7±5.0 0.215 % change -3.7±17.7 39.7±31.4 0.113 Septal E/e’ Ratio Baseline 13.9±5.5 11.3±2.7 0.257 End 13.5±5.0 16.3±2.1 0.215 % change 1.7±43.9 50.1±36.5 0.069 S/D ratio (in Upper Left PVF) Baseline 1.04±0.16 0.99±0.17 0.660 End 1.13±0.29 0.80±0.10 0.008 % change 7.9±13.1 -17.4±13.9 0.007 S/D ratio (in Lower Left PVF) Baseline 1.51±0.33 1.40±0.30 0.554 End 1.48±0.27 0.95±0.19 0.001 % change 1.3±25.3 -28.8±26.2 0.066 Lateral E/e’: transmitral flow E wave velocity/lateral mitral annulus moving velocity; Septal E/e’: transmitral flow E wave velocity/septal mitral annulus moving velocity; S/D: systolic wave velocity / diastolic wave velocity ratio; PVF: pulmonary venous flow.
25
Supplemental Table V. Echocardiographic Indices of Left Ventricular Myocardial Performance
Control Iso P value (n=5) (n=9) (Iso vs Control) Global MPI (%) Baseline 42.7±7.3 39.4±6.9 0.409 End 40.8±8.2 50.0±11.6 0.146 % change -1.6±28.3 30.5±39.8 0.139 Lateral MPI (%) Baseline 46.6±7.8 40.5±5.8 0.117 End 45.9±12.1 55.7±6.5 0.067 % change -2.4±13.1 40.1±25.6 0.004 Septal MPI (%) Baseline 41.2±4.6 37.5±7.5 0.343 End 39.4±9.2 56.7±8.8 0.004 % change -4.0±19.2 55.4±32.0 0.002 MPI: myocardial performance index.