Cells and Their Inhibitors Metalloproteinases of IL-2-Activated

Secreted and Membrane-Associated Matrix Metalloproteinases of IL-2-Activated NK Cells and Their Inhibitors

This information is current as Myoung H. Kim, Richard P. Kitson, Per Albertsson, Ulf of September 27, 2021. Nannmark, Per H. Basse, Peter J. K. Kuppen, Marianne E. Hokland and Ronald H. Goldfarb J Immunol 2000; 164:5883-5889; ; doi: 10.4049/jimmunol.164.11.5883

http://www.jimmunol.org/content/164/11/5883 Downloaded from

References This article cites 65 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/164/11/5883.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Secreted and Membrane-Associated Matrix Metalloproteinases of IL-2-Activated NK Cells and Their Inhibitors1

Myoung H. Kim,* Richard P. Kitson,* Per Albertsson,†‡ Ulf Nannmark,† Per H. Basse,§ Peter J. K. Kuppen,¶ Marianne E. Hokland,ʈ and Ronald H. Goldfarb2*

We have previously documented that rat IL-2-activated NK (A-NK) cells produce matrix metalloproteinase-2 (MMP-2) and MMP-9. In this study, we describe mouse A-NK cell-derived MMPs, including MT-MMPs, and also TIMPs. RT-PCR analysis from cDNA of mouse A-NK cells revealed mRNA for MMP-2, MMP-9, MMP-11, MMP-13, MT1-MMP, MT2-MMP, TIMP-1, and TIMP-2. MMP-2 and MMP-9 expression was confirmed by gelatin zymography. Moreover, we report for the first time that MT-MMPs are expressed by NK cells, i.e., large granular lymphocytes as determined by both RT-PCR and Western blots. TIMP-1 expression was detected as a 29-kDa protein in Western blots. It is intriguing that TIMP-2 protein from A-NK cells was also detected as a 29-kDa protein, which is clearly different from the previously reported molecular mass of 21 kDa in mouse and Downloaded from human cells. In addition, inhibition of MMPs by BB-94, a selective inhibitor of MMP, significantly inhibited the ability of mouse A-NK cells to migrate through Matrigel, a model basement membrane. Taken together, these findings suggest that A-NK cells may therefore use multiple MMPs in various cellular functions, including degradation of various extracellular matrix molecules as they extravasate from blood vessels and accumulate within cancer metastases following their adoptive transfer. The Journal of Im- munology, 2000, 164: 5883–5889. http://www.jimmunol.org/ he matrix metalloproteinases (MMPs)3 are members of a thus enabling cells to invade into tissues. MMPs are secreted as family of at least 21 Zn2ϩ-dependent endopeptidases, of proenzymes and subsequently activated by proteolytic cleavage. T which 16 are soluble, secreted enzymes, while the other 5 MMP activity is regulated by the naturally occurring inhibitors are membrane bound (1–4). The expression of most MMPs is such as ␣-macroglobulins and the tissue inhibitors of MMPs highly regulated by several mechanisms: at mRNA level transcrip- (TIMPs) (3, 7). There are four members of the TIMP family de- tionally by cytokines, hormones, and growth factors, and at protein termined to date (9). Among them, TIMP-1 and TIMP-2 are most level by proteolytic activation of latent enzymes and inhibition of well characterized as inhibitors of all known MMPs. TIMP-1 is a active enzymes by endogenous inhibitors (3, 5–8). They play im- glycoprotein of 28.5 kDa (9, 10). TIMP-2 is an unglycosylated by guest on September 27, 2021 portant roles in many normal biological processes, including post- protein of 21 kDa with 39% homology to TIMP-1 (11). TIMP-2 partum uterine involution, wound healing, and angiogenesis as from different species, i.e., mouse, rat, and bovine, have 97%, well as in pathological processes, including arthritis, emphysema, 98%, and 91% homology to human TIMP-2, respectively (11). and cancer metastasis (3). The main characteristic of MMPs is the TIMP-3 and TIMP-4 proteins have apparent molecular masses of degradation of the extracellular matrix of basement membranes, 24 and 23 kDa, respectively (12, 13). The balance between the production and activation of latent enzymes, and inhibition of active enzymes seems to play a critical role determining the invasive *Department of Molecular Biology and Immunology, University of North Texas potential of many solid tumors and inflammation caused by tissue- Health Science Center at Fort Worth and Institute for Cancer Research, Fort Worth, TX 76107; Departments of †Anatomy and Cell Biology and ‡Oncology, University of infiltrating immune effector cells (3). Go¨teborg, Go¨teborg, Sweden; §University of Pittsburgh Cancer Institute, Pittsburgh, MMPs in immune cells serve numerous specialized immuno- PA 15213; ¶Department of Surgery, University of Leiden Medical Center, Leiden, The Netherlands; and ʈInstitute of Medical Microbiology, University of Aarhus, Den- logic functions in addition to extracellular matrix degradation (5). mark T lymphocytes have been shown to produce MMP-9 constitu- Received for publication November 17, 1999. Accepted for publication March tively, whereas MMP-2 expression is induced by IL-2 and VCAM- 17, 2000. 1-dependent adhesion to endothelial cells (14, 15). These MMPs The costs of publication of this article were defrayed in part by the payment of page contribute to the ability of T cells to migrate through model sub- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. endothelial basement membranes (14, 16). Neutrophils have been 1 This work was supported in part by grants from the American Cancer Society (RPG- shown to store MMP-8 and MMP-9 intracellularly in specific gran- 5-042-03-IM) and Bank One to R.H.G., Swedish Medical Council (K97-12RM- ules and to secrete these enzymes upon stimulation (17–19). Mac- 12142) and the Agnes and Gustav Backlund Foundation to P.A., the King Gustav V rophages express MMP-1, MMP-2, MMP-3, MMP-7, MMP-9, Jubilee Clinic Research Foundation to U.N. and P.A., and the Assar Gabrielsson Research Foundation to U.N. This study has been presented in preliminary form at the and MT1-MMP as well as MMP-12 (20–24). These MMPs me- American Society for Biochemistry and Molecular Biology Meeting 1999, in San diate secretion of Fas ligand and TNF-␣ by cleavage of their mem- Francisco, CA (67). brane-bound forms, and generation of angiostatin from plasmino- 2 Address correspondence and reprint requests to Dr. Ronald H. Goldfarb, Depart- gen by proteolytic cleavage (25–28). ment of Molecular Biology and Immunology, University of North Texas Health Sci- ence Center at Fort Worth and Institute for Cancer Research, 3500 Camp Bowie Cells of the immune system, including IL-2-activated NK (A- Blvd., Fort Worth, TX 76107-2699. E-mail address: [email protected] NK) cells as well as macrophages and cytolytic T cells, have gen- 3 Abbreviations used in this paper: MMP, matrix metalloproteinase; A-NK, IL-2- erated much interest for their immunotherapeutic potential for es- activated NK; CM, complete medium; IP-10, IFN-␥-inducible protein 10; MIP, macrophage-inflammatory protein; MT-MMP, membrane-type MMP; TIMP, tissue in- tablished cancer (29–34). Previous studies have shown that hibitor of MMP. fluorescently labeled A-NK cells, following their adoptive transfer,

Table I. Primer sequences used in PCR of mouse A-NK cell cDNA

Enzymes Forward (5Ј 3 3Ј) Reverse (5Ј 3 3Ј)

MMP-2 GAGTTGGCAGTGCAATACCT GCCGTCCTTCTCAAAGTTGT MMP-9 AGTTTGGTGTCGCGGAGCAC TACATGAGCGCTTCCGGCAC MMP-11 GCACTGCTGGAGCCGGAAAC GGACCTTCACCTTCACGGGA MMP-13 CTGGTCTTCTGGCACACGCT GCAGCGCTCAGTCTCTTCAC MT1-MMP GTGCCCTATGCCTACATCCG TTGGGTATCCGTCCATCACT MT2-MMP GACAGCTCACCGTTTGATGG ATGTTGGGGCCATACTGGTC TIMP-1 CTGGCATCCTCTTGTTGCTA AGGGATCTCCAGGTGCACAA TIMP-2 AGACGTAGTGATCAGGGCCA GTACCACGCGCAAGAACCAT

can accumulate within established pulmonary and hepatic tumor Preparation of whole cell lysates from mouse A-NK cells metastases (35, 36). To reach the tumor cells, the circulating A-NK Day 7 nude mouse A-NK cells were stimulated with 100 ng/ml PMA and cells must adhere to endothelial cells and penetrate through the 6000 IU/ml IL-2 for 24 h before harvest. Then cells were washed once with subendothelial extracellular matrix and actively migrate into the PBS, and lysed in PBS containing 1% Triton X-100. Cell lysates were perivascular tissue space. Once in contact with target cells, A-NK cleared by centrifugation at 4500 ϫ g for 15 min. Resulting lysates were cells exert their cytotoxic effects by secreting various proteolytic frozen at Ϫ80°C. Downloaded from enzymes and cytolytic proteins, including granzymes and perforin (37). These observations have led to the hypothesis that A-NK Gelatin zymography cells might produce matrix-degrading enzymes. Indeed, rat A-NK SDS-PAGE gelatin zymography was performed as previously described cells have been shown to produce MMP-2 and MMP-9, and with some modiﬁcation (38). Brieﬂy, after electrophoresis, the gel was RNK-16 cells, a rat NK tumor cell line, to produce MMP-3 and washed at room temperature for3hinwashing buffer (50 mM Tris-HCl,

pH 7.5, 5 mM CaCl ,1␮M ZnCl , 2.5% Triton X-100) and then incubated http://www.jimmunol.org/ MMP-13 (38, 39). 2 2 for 20 h at 37°C in the same buffer containing only 1% Triton X-100. The In this study, we examine an array of soluble and MT-MMPs gel was stained with a solution of 0.25% Coomassie brilliant blue R-250 and TIMPs produced by mouse A-NK cells and their potential role and destained in 7% acetic acid and 10% methanol. in the NK cell migration through a model basement membrane. Western blot analysis Materials and Methods HT-1080, B16F1, and mouse A-NK media supernatants (for TIMP anal- Animals ysis) or mouse A-NK cell lysates (for MT-MMP analysis) were separated Nude mice were from Harlan Sprague-Dawley (Indianapolis, IN). The an- on 10% SDS polyacrylamide gels under reducing conditions and then transferred to a nitrocellulose membrane using a Mini trans-blot electro- imals were housed in a specific pathogen-free animal facility. by guest on September 27, 2021 phoretic transfer cell (Bio-Rad, Hercules, CA). The membranes were Reagents and chemicals blocked for 30 min at room temperature in T-PBS, pH 7.5 (PBS with 0.2% Tween-20) with 10% nonfat dry milk and 1% goat serum. After washing, Tissue culture medium and FBS were purchased from Life Technologies the blot was incubated with primary Ab as indicated in figure legends for (Grand Island, NY). rIL-2 was a generous gift of Chiron (Emeryville, CA). 1 h at room temperature. The blots were washed five times in T-PBS and All reagents were of the highest available commercial purity. Abs to MT1- incubated with peroxidase-coupled goat anti-mouse IgG (HϩL) (for mAb MMP (clone 114-1F2) were obtained from Oncogene Research Products detection; Pierce Chemical, Rockford, IL) or goat anti-rabbit IgG (for poly- (Cambridge, MA). Abs to TIMP-1 (polyclonal Ab), TIMP-2 (clone 67- 4H11), and MT2-MMP (clone 67-4H111) were obtained from Chemicon clonal Ab detection; Sigma), according to manufacturer’s instruction for International (Temecular, CA). 1 h at room temperature. After extensive washing, the bands were detected using SuperSignal CL-HRP Substrate System (Pierce Chemical). The re- Preparation of mouse A-NK cells sulting chemiluminescence was recorded on ECL Hyper film (Amersham Pharmacia Biotech, Piscataway, NJ). A-NK cells were prepared essentially as described previously (40). Spleens were harvested from nude mice, and splenocytes were incubated in nylon Immunodepletion of TIMP-1 wool column preequilibrated with warm complete medium (CM; RPMI 1640 with 10% FBS, 55 ␮M 2-ME, 100 U/ml penicillin, 100 ␮g/ml strep- Mouse A-NK supernatant (1 ml) was incubated with 2 ␮g of polyclonal tomycin sulfate, 2 mM glutamine, 0.1 mM MEM nonessential amino acids, TIMP-1 Ab for1honarotating shaker at 4°C. Protein A beads (30 ␮lof and 1 mM sodium pyruvate). Nonadherent cells were washed off by 2 settled bead volume; Sigma) were washed extensively with PBS, added to column volumes of CM, counted, and cultured in CM containing 6000 the Ab supernatant, and incubated for 30 min on a rotating shaker at 4°C IU/ml IL-2. On day 2, nonadherent cells were removed, and the flasks were to capture TIMP-1-Ab complexes. The beads were removed by centrifu- gently washed with prewarmed (37°C) CM to remove cells not firmly gation, and the resulting supernatants were concentrated in Microcon 10 attached to the plastic surface. New CM containing 6000 IU/ml IL-2 was microconcentrators (Amicon). Control A-NK supernatants (1 ml) were added, and the adherent cells were cultured for additional days, as indicated concentrated in the same manner. Concentrated supernatants were analyzed in figure legends. by Western blot, as described above and in figure legends.

Concentration of conditioned medium RT-PCR After 7 days in culture, A-NK cells from nude mice were placed in Opti- Total RNA was isolated from mouse A-NK cells using RNeasy columns MEM (Life Technologies) supplemented with 6000 IU/ml human rIL-2 (Qiagen, Chatsworth, CA). cDNA synthesis was performed using the RT- and 100 ng/ml of PMA (Sigma, St. Louis, MO) for an additional 24 h. ϳ PCR kit from Stratagene (La Jolla, CA). For each cDNA synthesis, total HT-1080 and B16F1 mouse melanoma cells were grown to 80% con- 6 fluence and stimulated with 100 ng/ml PMA for 24 h before collection of RNA from 10 cells were reverse transcribed using random hexamer or ␮ supernatants. PMA was added to enhance the production of MMPs (41, oligo(dT)16 primer in a volume of 50 l each, according to the protocol 42). Culture supernatants were collected, centrifuged to remove debris, and supplied by Stratagene. The two reactions were combined after heat inac- concentrated in Amicon (Beverly, MA) Centriprep concentrators up to 60- tivation of reverse transcriptase, and 2 ␮l of the cDNA was used for each fold. Aliquots were frozen at Ϫ80°C. HT-1080 and B16F1 supernatants PCR amplification in a buffer stated in figure legends. PCR primers are were prepared in the same manner and stored at Ϫ80°C. described in Table I. The Journal of Immunology 5885

FIGURE 1. RT-PCR analysis of MMPs and TIMPs of mouse A-NK cells. Total RNA was isolated from day 8 A-NK cells cultured from nude mouse splenocytes, as described in Materials and Methods. Primers used for PCR were described in Table I. PCR for MMP-2 and MMP-11, and MT1- and MT2-MMP done in buffer containing 60 mM Tris-HCl (pH 9),

15 mM (NH4)2SO4, 2 mM MgCl2. PCR for MMP-9, and MMP-13, and TIMP-1 and TIMP-2 were done in 20 mM Tris-HCl (pH 8.8), 2 mM

MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, and 0.1 FIGURE 2. Gelatin zymographic analysis of MMP-2 and MMP-9 from mg/ml BSA. mouse A-NK cell supernatants. Day 7 mouse A-NK cells and HT-1080 Downloaded from cells were incubated in Opti-MEM containing 6000 IU/ml IL-2 (for A-NK cells only) and 100 ng/ml PMA for 24 h. Media supernatants were concentrated, as described in Materials and Methods. MMP-9 and MMP-2 indicate the 92- and 72-kDa gelatinolytic bands. The enzymatic activity ء Invasion assay marked with may indicate the latent form of mouse MMP-9 (also see Results). The assay was performed as previously described (38). Brieﬂy, day 6 http://www.jimmunol.org/ A-NK cells prepared from nude mice were harvested, washed with RPMI 1640, and resuspended in Opti-MEM containing 6000 IU/ml of IL-2. A total of 500,000 cells in 0.2 ml were loaded into the top well, and 1 ml of The results indicated that there are three major gelatin-cleaving Opti-MEM containing 6000 IU/ml of IL-2 was added to the bottom cham- activities present in mouse A-NK cells, two of which correspond ber. For chemotaxis, RANTES (10 ng/ml), MIP-1␣ (1 ng/ml), or IP-10 (1 to the 72-kDa MMP-2 and the 92-kDa MMP-9 of HT-1080 cells. ng/ml) was added to the bottom chamber. For inhibition studies, 10 ␮M BB-94 or 100 ␮M benzamidine was added to the top well. Determination The third gelatinolytic band showed at higher molecular mass than of cell numbers invaded through Matrigel was done essentially as de- MMP-9 in HT-1080 sample. It has been shown that a latent form scribed previously (38) by labeling invaded cells with 1 ␮M calcein AM. of mouse MMP-9 has an apparent molecular mass at about 105

All determinations were performed in triplicate. kDa that is larger than human MMP-9 (43). Our Western blot by guest on September 27, 2021 using mAb against human MMP-9 (clone 1-11c) also reacted with Results the protein in A-NK supernatant at the similar molecular mass, RT-PCR analysis of cDNAs from A-NK cells thus suggesting this higher molecular mass might be a latent form Previously, we have detected MMP-2 and MMP-9 in rat IL-2- of MMP-9 (data not shown). A weak but detectable gelatinolytic activated NK cells using zymography, RT-PCR, and Western blot. band was also noticed at about ϳ30 kDa. Incubation with BB-94 Because most of our in vivo tumor model and immunotherapy (also called Batimastat) (44), a broad inhibitor of MMPs, resulted studies are done in mouse systems, it was of interest to see whether in the complete ablation of enzymatic activity in all bands, while mouse A-NK cells also produced MMPs. To prepare a pure pop- incubation with 3,4-dichloroisocoumarin, a general inhibitor of ulation of mouse A-NK cells, we used splenocytes from nude mice serine proteases that is known not to react with MMPs, had no passed through nylon wool column to eliminate B cells and mac- effect on the pattern of bands observed in the zymograms of sam- rophages. Flow-cytometric analysis of day 8 cultured A-NK cells ples from either HT1080 or A-NK cells. These results confirmed showed that greater than 99% of A-NK cells are negative for the identity of these bands as MMPs. CD3⑀, CD19, and macrophage marker staining (data not shown). Total RNA was prepared from day 8 A-NK cells and subjected to Western blot analysis of MT-MMPs RT-PCR analysis using primers for known mouse MMPs and To confirm the presence of MT-MMPs and TIMPs, we performed TIMPs (Table I). Results in Fig. 1 showed that mouse A-NK cells Western blot analyses. For the Western blots of MT-MMPs, whole expressed two gelatinases, MMP-2 and MMP-9, similar to rat cell lysates were prepared from mouse A-NK cells, as described in A-NK cells as well as MMP-11 (a stromelysin) and MMP-13 (an Materials and Methods. Mouse mAb raised against human MT1- interstitial collagenase). In addition, we were able to detect the MMP recognized mouse proteins at an apparent molecular mass of expression of two MT-MMPs, MT1- and MT2-MMP, and two 70 kDa (Fig. 3). Smaller bands at about 43 and 40 kDa may rep- TIMPs, TIMP-1 and TIMP-2. resent the proteolytically processed forms of MT1-MMP, as noted previously (45, 46). Mouse mAb to mouse MT2-MMP specifically Gelatin zymography analysis of mouse A-NK culture recognized mouse MT2-MMP as a 73-kDa band (Fig. 3). Molec- supernatants ular masses of MT-MMPs in mouse A-NK samples are in good To determine the enzymatic activities of MMPs identified in RT- agreement with those reported previously (43, 47, 48). PCR, we performed SDS-PAGE gelatin zymography. Superna- tants isolated from mouse A-NK cells grown in serum-free me- Western blot analysis of TIMPs dium were concentrated, as described in Materials and Methods, TIMP-1 protein in mouse A-NK cell culture supernatant was iden- and analyzed by SDS-PAGE gelatin zymography in conjunction tified in Western blots using polyclonal Ab against human TIMP-1 with HT-1080 supernatant concentrated in the same way (Fig. 2). (Fig. 4A). This Ab recognized human TIMP-1 in HT-1080 culture 5886 MMPs AND TIMPs OF A-NK CELLS

FIGURE 5. Immunodepletion of TIMP-1. TIMP-1 protein was depleted from mouse A-NK supernatants, as described in Materials and Methods. Blot was done as in Fig. 4. A, Blot with polyclonal TIMP-1 Ab; B, blot with FIGURE 3. Western blot analysis of MT1-MMP and MT2-MMP in TIMP-2 mAb. Lanes: Control, no immunodepletion; ϪTIMP-1, immu- Indicates TIMP-1 ,ء .mouse A-NK cells. Blots of SDS-PAGE gels of whole cell lysates were nodepletion of TIMP-1; Std, molecular mass markers blocked and incubated with mouse mAb to human MT1-MMP (2 ␮g/ml, 4

protein, and indicates TIMP-2 protein. Downloaded from A), or to mouse MT2-MMP (1 ␮g/ml, B). Closed arrows indicate MT1- are thought to be proteolytically processed ء MMP. Bands indicated by forms of MT1-MMP. An open arrow indicates MT2-MMP. recognized by TIMP-2 mAb is TIMP-1 protein. TIMP-1 was depleted from mouse A-NK supernatant, as described in Materials and Methods, using rabbit polyclonal TIMP-1 Ab against C-ter- supernatants at 29 kDa. TIMP-1 in mouse A-NK supernatants also minal domain of human TIMP-1. TIMP-1 depletion was confirmed http://www.jimmunol.org/ appeared as a major protein band of 29 kDa and as a minor protein by Western blot (Fig. 5A). However, TIMP-2 mAb was still able band of about 36 kDa. It has been shown that the molecular mass to detect the 29-kDa band in TIMP-1-depleted supernatant, con- of TIMP-1 protein can range from 30 to 34 kDa, depending on the firming that this 29-kDa band is not TIMP-1 and indeed TIMP-2 degree of glycosylation (49). Mouse mAb against human TIMP-2 protein (Fig. 5B). specifically recognized mouse TIMP-2 in B16F1, a mouse melanoma cell line, and human TIMP-2 in HT-1080 sample as a 24- Dependence of mouse A-NK cell invasion on MMPs kDa protein (Fig. 4B). This TIMP-2 Ab has been characterized We used a Matrigel invasion assay to determine the role of MMPs previously to cross-react with TIMP-2 species from mouse, rat, in the ability of mouse A-NK cells to invade through a model by guest on September 27, 2021 guinea pig, and rabbit, but not to recognize TIMP-1 (11). How- basement membrane. Day 6 nude mouse A-NK cells were placed ever, this TIMP-2 mAb specifically recognized TIMP-2 in mouse in a Matrigel invasion chamber in the presence of BB-94 or ben- A-NK supernatant as a 29-kDa protein. Because this molecular zamidine, an inhibitor of neutral serine proteases. As shown in Fig. mass is very similar to TIMP-1 protein, we performed Western 6, BB-94 at 10 ␮M inhibited about 90% of the invasion of mouse blot analysis after immunodepletion of TIMP-1 protein in A-NK A-NK cells through Matrigel in a 24-h period; however, no sig- cell supernatants to exclude any possibility that the 29-kDa band nificant inhibition of mouse A-NK invasion was observed by treatment with benzamidine. BB-94 has been shown to not affect the

FIGURE 6. Inhibition of mouse A-NK cell migration across a model FIGURE 4. Western blot analysis of TIMP-1 and TIPM-2. Media su- basement membrane by BB-94, an inhibitor of MMPs. A-NK cells pernatants from mouse A-NK, HT-1080, and B16F1 cells (for TIMP-2 (500,000) in 0.2 ml were placed in the top well of Matrigel invasion cham- only) were prepared as in Fig. 2, except HT-1080 supernatants used for bers with either no addition, 10 ␮M BB-94, or 100 ␮M benzamidine. In TIMP-2 Western blot are not PMA stimulated. Blots were blocked and addition, RANTES (10 ng/ml), MIP-1␣ (1 ng/ml), or IP-10 (1 ng/ml) was incubated with rabbit polyclonal Ab to human TIMP-1 (1 ␮g/ml, A)orto added to the bottom chamber of some wells. Results are expressed as cell mouse mAb to human TIMP-2 (1 ␮g/ml, B). Molecular mass markers are numbers invaded through Matrigel chambers. Each bar represents the av- as indicated Std. erage of triplicate determinations (ϮSD). The Journal of Immunology 5887 viability or cytolytic activity of A-NK cells (38). Various chemo- specific modifications or extra sequences, and its MMP inhibitory kines such as MIP-1␣, RANTES, and IP-10 at the concentration as well as other functions. tested had no significant effect on migration of mouse A-NK cells. MMPs have also been reported in other cell types of the immune These results suggest that MMPs produced by A-NK cells are system. T cells, macrophages, and neutrophils all produce MMPs essential for the ability of these cells to degrade and migrate that mediate functional roles in immunity and inflammation (5). through the basement membrane. Although it has been reported that MT1-MMP was expressed from macrophages and human T cell lines (59, 60), this study is the first report documenting the presence of MT-MMPs in NK cells, i.e., Discussion large granular lymphocytes. The extracellular matrix-degrading function of MT1-MMP is Our previous studies have suggested that degradation of the com- well established in tumor cell invasion and metastasis (61, 62). ponents of extracellular matrices would either contribute to, or be Acting as a plasma membrane-associated activator and receptor of an essential prerequisite, for the process of A-NK cell migration MMP-2 and digesting extracellular matrix components by itself, through extracellular matrices and accumulation into cancer me- MT1-MMP has the potential to localize matrix degradation to the tastases (36). As we have previously reported, rat A-NK cells pro- vicinity of the tumor cell surface (63–65). While we have also duce MMP-2 and MMP-9, which are inhibited by the MMP in- examined the expression of other MMPs, including MMP-11 (a hibitor BB-94. Moreover, inhibition of these proteases resulted in stromelysin), MMP-13 (an interstitial collagenase), and MT2- more than 50% inhibition of migration of A-NK cells through MMP, their exact role and scope in NK cell function are obscure

Matrigel, a model basement membrane (38). and remain to be determined. Most of these MMPs have the ca- Downloaded from In this study, we have expanded on our previous findings and pacity to degrade extracellular matrix and basement membrane have determined the presence of mRNAs for MMP-2, MMP-9, proteins, while some of them have also been shown to mediate the MMP-11, MMP-13, MT1-MMP, MT2-MMP, TIMP-1, and proteolytic processing of other immune system regulatory mole- TIMP-2 in mouse A-NK cells by RT-PCR analysis. The activities cules; in an in vitro assay, MMP-1, MMP-3, and MMP-7 were able of MMP-2 and MMP-9 in mouse A-NK cell culture supernatant to cleave a GST-TNF-␣ fusion protein to 17-kDa protein that con- were shown by gelatin zymography. A weak but detectable gela- tains the same amino terminus as the mature form of TNF-␣ (26). http://www.jimmunol.org/ ϳ tinolytic band was present at 30 kDa. Among the MMPs deter- MMP-2 and MMP-9 also mediate this cleavage, but with less ef- mined by RT-PCR, mouse MMP-11, which has lost its propeptide ficiency. MMP-3, MMP-7, MMP-9, and MMP-12 have been and the majority of its C-terminal domain, has a molecular mass at shown to cleave plasminogen to angiostatin in an in vitro system 28 kDa. This form has demonstrated proteolytic activity against (27, 28). The release of Fas ligand from human CD4ϩ T cells or casein, fibronectin, laminin, and gelatin (50, 51). This suggests that mouse T lymphoma cell lines stably transfected with human Fas the gelatinolytic band at the low molecular mass might be a trun- ligand cDNA was inhibited by MMP-inhibitors, BB-94 and cated form of MMP-11. KB8112, but not by inhibitors of other proteases. This suggests Western blot analysis confirmed the presence of MT1-MMP, that MMPs play a role in Fas ligand release (25). These observa- MT2-MMP, TIMP-1, and TIMP-2 in mouse A-NK cells. It is in- tions merit the further investigation of A-NK cell MMPs for po- by guest on September 27, 2021 triguing to notice that the apparent molecular mass of TIMP-2 tential roles in regulation of angiogenesis and apoptosis. This may from mouse A-NK cells is 29 kDa, which is different from those of be of critical importance in the regulation of the accumulation of human HT-1080 cells, or mouse B16F1 melanoma cells (see be- A-NK cells within tumor metastases, because such accumulation low). It has been shown that TIMP-2 cDNAs cloned from cultured has been documented to be correlated in metastatic tumors with colon 26 mouse carcinoma cells and from human heart tissue have high numbers of microvessels (66). 92% homology at the cDNA level and 97% homology at the pro- Thus, expression of numerous MMPs and TIMPs from A-NK tein level; these are also known to be nonglycosylated proteins cells may contribute to important and multiple functions of A-NK (52). Moreover, TIMP-2 proteins purified from human and mouse cells, including extracellular matrix degradation, infiltration into serum showed similar molecular mass at 24 kDa in Western blot tumor metastases, and perhaps secretion of cytokines, and poten- by the TIMP-2 mAb (11). Using the same mAb, we demonstrated tial modulation of cytolytic, apoptotic, and angiostatic effector that TIMP-2 proteins from HT-1080 and B16F1 mouse melanoma pathways of NK cell function. cells showed the same molecular mass of 24 kDa in Western blots. Thus, these results suggest that the difference in molecular mass may be A-NK cell specific. The cause for this discrepancy is under Acknowledgments active investigation in our laboratory. The RT-PCR results showed We thank Chiron for providing us with the IL-2 used in these studies, and that the PCR-amplified TIMP-2 band is the same size as that pre- British Biotech Pharmaceuticals (Oxford, UK) for supplying us with BB- dicted from mouse fibroblast cDNA clone. However, it cannot be 94. We also thank Yaming Xue for his expert technical assistance. excluded that there might be additional sequences at the N or C terminus of the protein, or that there are some point mutations that might introduce glycosylation sites. The best known role of TIMPs References is in inhibiting matrix degradation by MMPs. It is also noteworthy 1. Matrisian, L. M. 1992. The matrix-degrading metalloproteinases. BioEssays 14: that at least TIMP-1 and TIMP-2 have other reported functions, 455. 2. Westermarck, J., and V. M. Kahari. 1999. Regulation of matrix metalloproteinase such as erythroid-potentiating activity and growth-promoting ac- expression in tumor invasion. FASEB J. 13:781. tivities on various cultured cell lines (53–56). TIMP-2, but not 3. Nagase, H., and J. F. Woessner Jr. 1999. Matrix metalloproteinases. J. Biol. TIMP-1, inhibits basic fibroblast factor-induced human microvas- Chem. 274:21491. 4. Shapiro, S. D., and R. M. Senior. 1999. Matrix metalloproteinases: matrix deg- cular endothelial cell proliferation in culture, which is unrelated to radation and more. Am. J. Respir. Cell Mol. Biol. 20:1100. its metalloproteinase-inhibitory activity (57). It has been shown 5. Goetzl, E. J., M. J. Banda, and D. Leppert. 1996. Matrix metalloproteinases in that separate domains of TIMP-1 are responsible for the MMP- immunity. J. Immunol. 156:1. 6. Crawford, H. C., and L. M. Matrisian. 1996. Mechanisms controlling the tran- inhibitory and erythroid-potentiating activities (58). Thus, it will scription of matrix metalloproteinase genes in normal and neoplastic cells. En- be interesting to determine whether this 29-kDa TIMP-2 has any zyme Protein 49:20. 5888 MMPs AND TIMPs OF A-NK CELLS

7. Parsons, S. L., S. A. Watson, P. D. Brown, H. M. Collins, and R. J. Steele. 1997. administration of the liposome-encapsulated macrophage activator CGP 19835A. Matrix metalloproteinases. Br. J. Surg. 84:160. Cancer Res. 54:5882. 8. Fini, M. E., J. R. Cook, R. Mohan, and C. E. Brinckerhoft. 1998. Matrix Met- 33. Killion, J. J., and I. J. Fidler. 1994. Systemic targeting of liposome-encapsulated alloproteinases. W. C. Parks and R. P. Mecham, eds. Academic Press, San Diego, immunomodulators to macrophages for treatment of cancer metastasis. Immuno- p. 299. Methods 4:273. 9. Gomez, D. E., D. F. Alonso, H. Yoshiji, and U. P. Thorgeirsson. 1997. Tissue 34. Svane, I. M., M. Boesen, and A. M. Engel. 1999. The role of cytotoxic T-lym- inhibitors of metalloproteinases: structure, regulation and biological functions. phocytes in the prevention and immune surveillance of tumors: lessons from Eur J. Cell Biol. 74:111. normal and immunodeficient mice. Med. Oncol. 16:223. 10. Edwards, D. R., P. Waterhouse, M. L. Holman, and D. T. Denhardt. 1986. A 35. Basse, P., R. B. Herberman, U. Nannmark, B. R. Johansson, M. Hokland, growth-responsive gene (16C8) in normal mouse fibroblasts homologous to a K. Wasserman, and R. H. Goldfarb. 1991. Accumulation of adoptively trans- human collagenase inhibitor with erythroid-potentiating activity: evidence for ferred adherent, lymphokine-activated killer cells in murine metastases. J. Exp. inducible and constitutive transcripts. Nucleic Acids Res. 14:8863. Med. 174:479. 11. Fujimoto, N., H. Tokai, K. Iwata, Y. Okada, and T. Hayakawa. 1995. Determi- 36. Basse, P. H., U. Nannmark, B. R. Johansson, R. B. Herberman, and nation of tissue inhibitor of metalloproteinases-2 (TIMP-2) in experimental ani- R. H. Goldfarb. 1991. Establishment of cell-to-cell contact by adoptively trans- mals using monoclonal antibodies against TIMP-2-specific oligopeptides. J. Im- ferred adherent lymphokine-activated killer cells with metastatic murine mela- munol. Methods 187:33. noma cells. J. Natl. Cancer Inst. 83:944. 12. Liu, Y. E., M. Wang, J. Greene, J. Su, S. Ullrich, H. Li, S. Sheng, P. Alexander, 37. Lowin, B., M. C. Peitsch, and J. Tschopp. 1995. Perforin and granzymes: crucial Q. A. Sang, and Y. E. Shi. 1997. Preparation and characterization of recombinant effector molecules in cytolytic T lymphocyte and natural killer cell-mediated tissue inhibitor of metalloproteinase 4 (TIMP-4). J. Biol. Chem. 272:20479. cytotoxicity. Curr. Top. Microbiol. Immunol. 198:1. 13. Leco, K. J., R. Khokha, N. Pavloff, S. P. Hawkes, and D. R. Edwards. 1994. 38. Kitson, R. P., P. M. Appasamy, U. Nannmark, P. Albertsson, M. K. Gabauer, and Tissue inhibitor of metalloproteinases-3 (TIMP-3) is an extracellular matrix-as- R. H. Goldfarb. 1998. Matrix metalloproteinases produced by rat IL-2 activated sociated protein with a distinctive pattern of expression in mouse cells and tis- natural killer cells. J. Immunol. 160:4248. sues. J. Biol. Chem. 269:9352. 39. Zeng, L., S. An, and E. J. Goetzl. 1996. Selective regulation of RNK-16 cell 14. Leppert, D., E. Waubant, R. Galardy, N. W. Bunnett, and S. L. Hauser. 1995. T matrix metalloproteinases by the EP4 subtype of prostaglandin E2 receptor. Bio- cell gelatinases mediate basement membrane transmigration in vitro. J. Immunol.

chemistry 35:7159. Downloaded from 154:4379. 40. Gunji, Y., N. L. Vujanovic, J. C. Hiserodt, R. B. Herberman, and E. Gorelik. 15. Romanic, A. M., and J. A. Madri. 1994. The induction of 72-kD gelatinase in T 1989. Generation and characterization of puriﬁed adherent lymphokine-activated cells upon adhesion to endothelial cells is VCAM-1 dependent. J. Cell Biol. killer cells in mice. J. Immunol. 142:1748. 125:1165. 41. Zhou, H., E. J. Bernhard, F. E. Fox, and P. C. Billings. 1993. Induction of 16. Xia, M., D. Leppert, S. L. Hauser, S. P. Sreedharan, P. J. Nelson, A. M. Krensky, metalloproteinase activity in human T-lymphocytes. Biochim. Biophys. Acta and E. J. Goetzl. 1996. Stimulus speciﬁcity of matrix metalloproteinase depen- 1177:174. dence of human T cell migration through a model basement membrane. J. Im- 42. Mackay, A. R., R. H. Corbitt, J. L. Hartzler, and U. P. Thorgeirsson. 1990. munol. 156:160. Basement membrane type IV collagen degradation: evidence for the involvement 17. Mollinedo, F., C. Gajate, and D. L. Schneider. 1991. Cytochrome b co-fraction- of a proteolytic cascade independent of metalloproteinases. Cancer Res. 50:5997. http://www.jimmunol.org/ ates with gelatinase-containing granules in human neutrophils. Mol. Cell. Bio- 43. Tanaka, H., K. Hojo, H. Yoshida, T. Yoshioka, and K. Sugita. 1993. Molecular chem. 105:49. cloning and expression of the mouse 105-kDa gelatinase cDNA. Biochem. Bio- 18. Mollinedo, F., R. Pulido, P. M. Lacal, and F. Sanchez-Madrid. 1991. Mobiliza- phys. Res. Commun. 190:732. tion of gelatinase-rich granules as a regulatory mechanism of early functional 44. Fisher, C., B. S. Gilbertson, E. A. Powers, G. Petzold, R. Poorman, and responses in human neutrophils. Scand. J. Immunol. 34:33. M. A. Mitchell. 1994. Interstitial collagenase is required for angiogenesis in vitro. 19. Hasty, K. A., T. F. Pourmotabbed, G. I. Goldberg, J. P. Thompson, Dev. Biol. 162:499. D. G. Spinella, R. M. Stevens, and C. L. Mainardi. 1990. Human neutrophil 45. Lohi, J., K. Lehti, J. Westermarck, V. M. Kahari, and J. Keski-Oja. 1996. Reg- collagenase: a distinct gene product with homology to other matrix metallopro- ulation of membrane-type matrix metalloproteinase-1 expression by growth fac- teinases. J. Biol. Chem. 265:11421. tors and phorbol 12-myristate 13-acetate. Eur. J. Biochem. 239:239. 20. Shapiro, S. D., D. K. Kobayashi, and T. J. Ley. 1993. Cloning and characteriza- 46. Lehti, K., J. Lohi, H. Valtanen, and J. Keski-Oja. 1998. Proteolytic processing of tion of a unique elastolytic metalloproteinase produced by human alveolar mac-

membrane-type-1 matrix metalloproteinase is associated with gelatinase A acti- by guest on September 27, 2021 rophages. J. Biol. Chem. 268:23824. vation at the cell surface. Biochem. J. 334:345. 21. Shapiro, S. D., D. K. Kobayashi, A. P. Pentland, and H. G. Welgus. 1993. In- duction of macrophage metalloproteinases by extracellular matrix: evidence for 47. Sato, H., T. Takino, Y. Okada, J. Cao, A. Shinagawa, E. Yamamoto, and enzyme- and substrate-speciﬁc responses involving prostaglandin-dependent M. Seiki. 1994. A matrix metalloproteinase expressed on the surface of invasive mechanisms. J. Biol. Chem. 268:8170. tumor cells. Nature 370:61. 22. Busiek, D. F., V. Baragi, L. C. Nehring, W. C. Parks, and H. G. Welgus. 1995. 48. Will, H., and B. Hinzmann. 1995. cDNA sequence and mRNA tissue distribution Matrilysin expression by human mononuclear phagocytes and its regulation by of a novel human matrix metalloproteinase with a potential transmembrane seg- cytokines and hormones. J. Immunol. 154:6484. ment. Eur. J. Biochem. 231:602. 23. Birkedal-Hansen, H., W. G. Moore, M. K. Bodden, L. J. Windsor, 49. Williamson, R. A., F. A. Marston, S. Angal, P. Koklitis, M. Panico, H. R. Morris, B. Birkedal-Hansen, A. DeCarlo, and J. A. Engler. 1993. Matrix metalloprotein- A. F. Carne, B. J. Smith, T. J. Harris, and R. B. Freedman. 1990. Disulphide bond ases: a review. Crit. Rev. Oral Biol. Med. 4:197. assignment in human tissue inhibitor of metalloproteinases (TIMP). Biochem. J. 24. Welgus, H. G., E. J. Campbell, J. D. Cury, A. Z. Eisen, R. M. Senior, 268:267. S. M. Wilhelm, and G. I. Goldberg. 1990. Neutral metalloproteinases produced 50. Basset, P., J. P. Bellocq, O. Lefebvre, A. Noel, M. P. Chenard, C. Wolf, by human mononuclear phagocytes: enzyme proﬁle, regulation, and expression P. Anglard, and M. C. Rio. 1997. Stromelysin-3: a paradigm for stroma-derived during cellular development. J. Clin. Invest. 86:1496. factors implicated in carcinoma progression. Crit. Rev. Oncol. Hematol. 26:43. 25. Kayagaki, N., A. Kawasaki, T. Ebata, H. Ohmoto, S. Ikeda, S. Inoue, K. Yoshino, 51. Murphy, G., J. P. Segain, M. O’Shea, M. Cockett, C. Ioannou, O. Lefebvre, K. Okumura, and H. Yagita. 1995. Metalloproteinase-mediated release of human P. Chambon, and P. Basset. 1993. The 28-kDa N-terminal domain of mouse Fas ligand. J. Exp. Med. 182:1777. stromelysin-3 has the general properties of a weak metalloproteinase. J. Biol. 26. Gearing, A. J., P. Beckett, M. Christodoulou, M. Churchill, J. Clements, Chem. 268:15435. A. H. Davidson, A. H. Drummond, W. A. Galloway, R. Gilbert, J. L. Gordon, et 52. Shimizu, S., K. Malik, H. Sejima, J. Kishi, T. Hayakawa, and O. Koiwai. 1992. al. 1994. Processing of tumor necrosis factor-␣ precursor by metalloproteinases. Cloning and sequencing of the cDNA encoding a mouse tissue inhibitor of met- Nature 370:555. alloproteinase-2. Gene 114:291. 27. Cornelius, L. A., L. C. Nehring, E. Harding, M. Bolanowski, H. G. Welgus, 53. Gasson, J. C., D. W. Golde, S. E. Kaufman, C. A. Westbrook, R. M. Hewick, D. K. Kobayashi, R. A. Pierce, and S. D. Shapiro. 1998. Matrix metalloprotein- R. J. Kaufman, G. G. Wong, P. A. Temple, A. C. Leary, E. L. Brown, et al. 1985. ases generate angiostatin: effects on neovascularization. J. Immunol. 161:6845. Molecular characterization and expression of the gene encoding human erythroid- 28. Patterson, B. C., and Q. A. Sang. 1997. Angiostatin-converting enzyme activities potentiating activity. Nature 315:768. of human matrilysin (MMP-7) and gelatinase B/type IV collagenase (MMP-9). 54. Hayakawa, T., K. Yamashita, E. Ohuchi, and A. Shinagawa. 1994. Cell growth- J. Biol. Chem. 272:28823. promoting activity of tissue inhibitor of metalloproteinases-2 (TIMP-2). J. Cell 29. Rosenberg, S. A., M. T. Lotze, L. M. Muul, A. E. Chang, F. P. Avis, S. Leitman, Sci. 107:2373. W. M. Linehan, C. N. Robertson, R. E. Lee, J. T. Rubin, et al. 1987. A progress 55. Stetler-Stevenson, W. G., N. Bersch, and D. W. Golde. 1992. Tissue inhibitor of report on the treatment of 157 patients with advanced cancer using lymphokine- metalloproteinase-2 (TIMP-2) has erythroid-potentiating activity. FEBS Lett. activated killer cells and interleukin-2 or high-dose interleukin-2 alone. N. Engl. 296:231. J. Med. 316:888. 56. Hayakawa, T., K. Yamashita, K. Tanzawa, E. Uchijima, and K. Iwata. 1992. 30. Goldfarb, R. H., T. L. Whiteside, P. H. Basse, W. C. Lin, N. Vujanovic, and Growth-promoting activity of tissue inhibitor of metalloproteinases-1 (TIMP-1) R. B. Herberman. 1994. Natural killer cells and gene therapy: potential of gene for a wide range of cells: a possible new growth factor in serum. FEBS Lett. transfection for optimizing effector cell functions and for targeting gene products 298:29. into tumor metastases. Nat. Immun. 13:131. 57. Murphy, A. N., E. J. Unsworth, and W. G. Stetler-Stevenson. 1993. Tissue in- 31. Goldfarb, R. H., and K. W. Brunson. 1995. Antimetastatic therapy. In Biological hibitor of metalloproteinases-2 inhibits bFGF-induced human microvascular en- Therapy of Cancer, 2nd Ed. V. T. J. DeVita, S. Hellman, and S. A. Rosenberg, dothelial cell proliferation. J. Cell. Physiol. 157:351. eds. J.B. Lippincott and Company, Philadelphia, p. 853. 58. Chesler, L., D. W. Golde, N. Bersch, and M. D. Johnson. 1995. Metalloproteinase 32. Tanguay, S., C. D. Bucana, M. R. Wilson, I. J. Fidler, A. C. von Eschenbach, and inhibition and erythroid potentiation are independent activities of tissue inhibitor J. J. Killion. 1994. In vivo modulation of macrophage tumoricidal activity by oral of metalloproteinases-1. Blood 86:4506. The Journal of Immunology 5889

59. Esparza, J., C. Vilardell, J. Calvo, M. Juan, J. Vives, A. Urbano-Marquez, tral nervous system white matter. J. Cell Biol. 144:373. J. Yague, and M. C. Cid. 1999. Fibronectin up-regulates gelatinase B (MMP-9) 64. D’Ortho, M. P., H. Will, S. Atkinson, G. Butler, A. Messent, J. Gavrilovic, and induces coordinated expression of gelatinase A (MMP-2) and its activator B. Smith, R. Timpl, L. Zardi, and G. Murphy. 1997. Membrane-type matrix MT1-MMP (MMP-14) by human T lymphocyte cell lines: a process repressed metalloproteinases 1 and 2 exhibit broad-spectrum proteolytic capacities compa- through RAS/MAP kinase signaling pathways. Blood 94:2754. rable to many matrix metalloproteinases. Eur. J. Biochem. 250:751. 60. Ohtani, H., H. Motohashi, H. Sato, M. Seiki, and H. Nagura. 1996. Dual over- 65. Pei, D., and S. J. Weiss. 1996. Transmembrane-deletion mutants of the mem- expression pattern of membrane-type metalloproteinase-1 in cancer and stromal brane-type matrix metalloproteinase-1 process progelatinase A and express in- cells in human gastrointestinal carcinoma revealed by in situ hybridization and trinsic matrix-degrading activity. J. Biol. Chem. 271:9135. immunoelectron microscopy. Int. J. Cancer 68:565. 66. Nannmark, U., B. R. Johansson, J. L. Bryant, M. L. Unger, M. E. Hokland, 61. Sato, H., and M. Seiki. 1996. Membrane-type matrix metalloproteinases (MT- R. H. Goldfarb, and P. H. Basse. 1995. Microvessel origin and distribution in MMPs) in tumor metastasis. J. Biochem. 119:209. pulmonary metastases of B16 melanoma: implication for adoptive immunother- 62. Sato, H., Y. Okada, and M. Seiki. 1997. Membrane-type matrix metalloprotein- apy. Cancer Res. 55:4627. ases (MT-MMPs) in cell invasion. Thromb. Haemostasis 78:497. 67. Kim, M. H., R. P. Kitson, Y. Xue, and R. H. Goldfarb. 1999. Identiﬁcation of 63. Belien, A. T., P. A. Paganetti, and M. E. Schwab. 1999. Membrane-type 1 matrix matrix metalloproteinases (MMPs) produced by rat and mouse IL-2 activated NK metalloprotease (MT1-MMP) enables invasive migration of glioma cells in cen (A-NK) cells. FASEB J. 13:1176. Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021