Assessment of Anti-Α-Galactosidase a Igg Antibody Development In

Assessment of Anti-α-Galactosidase A IgG Antibody Development in Fabry Disease Patients by ELISA and Purification of a Recombinant Human α-Galactosidase A from a Stable Overexpressing Human Cell Line

Lucía López Vásquez

A thesis submitted in conformity with the requirements for the degree of Master of Science Institute of Medical Science University of Toronto

Lucía López Vásquez

Master of Science

Institute of Medical Science University of Toronto

2017 Abstract

Fabry disease is an X-linked lysosomal storage disorder caused by a deficiency in α-galactosidase

A (α-gal A). Enzyme replacement therapy (ERT) consists of regular infusions of recombinant α- gal A. Fabry disease patients commonly develop IgG antibodies against this enzyme and there is a concern that they may reduce the efficacy and safety of ERT. We developed an ELISA to measure anti-α-gal A IgG antibodies and found that 61% of patients on ERT were seropositive.

We also designed a fast, single-chromatography purification protocol for α-gal A from the supernatant of a human embryonic kidney 293T cell line engineered to stably overexpress a 6xhis- tagged human α-gal A. We obtained 0.342 mg/L with the expected molecular weight but lower enzymatic activity than expected. This α-gal A is bound by antibodies from seropositive patients and not by those from healthy individuals, which suggests that it may serve as antigen in our

ELISA to measure anti-α-gal A antibodies.

Acknowledgments

I would like to thank my supervisor, Dr. Jeffrey Medin, for the invaluable and life-changing opportunity that he has given me. I will be forever in your gratitude. I also want to thank my committee members Dr. Myron Cybulsky, Dr. Dwayne Barber and Dr. Reginald Gorczynski for their input throughout my research. Likewise, I am thankful to Dr. Alberto Marin, Dr. Avi

Chakrabartty and Dr. Toya Ohashi for taking the time to serve on my examining committee and for the constructive feedback.

I would like to extend my sincere and profound gratitude to Dr. Ju Huang for the excellent guidance you provided me and the confidence you placed in me. To Dr. Shaalee Sone for all the support throughout this program, especially early on. To Fabian Yu for taking a chance with me and for your continued support. To Murtaza S. Nagree for teaching me so much, for allowing me to work with you in one of the most interesting projects in the lab and in our review, and for helping me get a job I like before graduation. To Elliot Berinstein for always being willing to help out and discuss experiments and bro stuff alike. To Dr. Mustafa A. Kamani for always being happy to answer my all-over-the-place questions. To Bryan Au for the guidance at the onset of my research.

And to the rest of the Medin lab for the camaraderie and everything that I learned from all of you.

I would also like to thank María Fernanda (Mafe) Monroy for taking the time to teach me excellent mouse skills and, along with Álvaro Rodelo, for that ‘sister republic’ warmth and kindness.

I want to thank my family in Canada for taking me into your home upon my arrival. Your generosity never ceases to amaze me and I am forever in your debt. I also want to thank my friends and family from back home for your continued love and support. iii

I am thankful for the generous funding to study and travel to conferences provided during my MSc from the Canadian Institutes of Health Research (CIHR), the Institute of Medical Science, the

University of Toronto School of Graduate Studies and the University Health Network Office of

Research Trainee. Likewise, I want to thank everyone in the Institute of Medical Science team for their continued support throughout my program, especially Dr. Howard Mount, Dr. Vasu

Venkateswaran, Hazel Pollard, Kaki Narh-Blackwood, Michelle Rosen, Sarah Topa, Danny Fee and Elena Gessas.

For my mom and my step-dad, who took me to where I am now. And for my husband, for supporting me from beginning to end despite all the difficulties.

Contributions

Chapter 3

Fabry patient data and blood samples were provided by Dr. Chantal Morell and Syed Wasim from

University Health Network. Dr. Mustafa A. Kamani isolated plasma from these blood samples.

Dr. Roscoe O. Brady kindly donated the recombinant human α-galactosidase A utilized as antigen in the ELISA. Elliot Berinstein and I performed flow cytometry. Ju Huang and I optimized chromatography conditions. Alexia DeRuyter tested the conditions of large-scale α-galactosidase

A purification under my supervision. Murtaza S. Nagree obtained the his-tagged protein used as

Western blot control from Zhenhao Fang from Dr. Ikura’s lab.

Table of Contents

Acknowledgments...... iii

Contributions...... v

Table of Contents ...... vi

List of Tables ...... ix

List of Figures ...... x

List of Abbreviations ...... xi

Chapter 1 Literature Review ...... 1

1.1 Glycosphingolipids ...... 1

1.1.1 De novo GSL synthesis pathway ...... 2

1.1.2 GSL function ...... 7

1.1.3 GSL catabolism and salvage pathway ...... 12

1.2 The lysosome ...... 13

1.2.1 Synthesis and trafficking of lysosomal proteins ...... 14

1.2.2 Sphingolipid activator proteins ...... 15

1.2.3 Lysosomal storage disorders (LSDs) ...... 16

1.3 Fabry Disease ...... 16

1.3.1 α-galactosidase A ...... 18

1.3.2 Clinical manifestations of Fabry disease ...... 24

1.3.3 Other variants of Fabry disease...... 30

1.3.4 Gb3 accumulation ...... 31

1.3.5 GLA mutation and severity of disease ...... 37

1.3.6 Diagnosis of Fabry disease ...... 39

1.3.7 Treatment of Fabry disease ...... 42 vi

Chapter 2 Research Aims...... 69

Chapter 3 Development of an ELISA to Measure Anti-α-Galactosidase A IgG Antibodies and Purification of a Recombinant Human α-Galactosidase A from a Stable Overexpressing Human Cell Line ...... 71

3.1 Materials and methods ...... 71

3.1.1 Samples from Fabry disease patients ...... 71

3.1.2 Anti-human α-gal A IgG antibodies ELISA ...... 71

3.1.3 Cloning of the GLA cDNA into the PiggyBac™ plasmid ...... 72

3.1.4 Generation of the α-gal A-overexpressing HEK293T cell line ...... 72

3.1.5 Flow cytometry ...... 73

3.1.6 DNA sequencing ...... 73

3.1.7 α-gal A enzyme activity assay and BCA protein assay ...... 74

3.1.8 SDS-PAGE and Western blot ...... 74

3.1.9 Cell and culture supernatant collection and processing for α-gal A purification ..75

3.1.10 Ni-NTA chromatography ...... 76

3.1.11 Desalting and concentrating the purified α-gal A ...... 76

3.1.12 De-glycosylation with PNGase F...... 77

3.1.13 Statistical methods ...... 77

3.2 Results ...... 77

3.2.1 Anti-α-gal A IgG antibody levels ...... 77

3.2.2 Generation of the his-tagged-α-gal A-overexpressing HEK 293T cell line ...... 85

3.2.3 Evaluation of α-gal A purification: intracellular vs secreted ...... 85

3.2.4 Optimization of growth conditions for α-gal A purification from culture supernatant ...... 85

3.2.5 Purification of his-tagged α-gal A from culture supernatant with a nickel- charged column ...... 86

3.2.6 Characterization of the purified α-gal A ...... 91 vii

3.2.7 IgG antibodies from the serum of Fabry disease patients bind to the purified α- gal A ...... 91

Chapter 4 General Discussion ...... 94

4.1 ELISA to measure anti-α-gal A IgG antibodies ...... 94

4.2 Anti-α-gal A antibodies ...... 94

4.3 α-gal A purification strategy ...... 97

4.3.1 α-gal A expression system ...... 97

4.3.2 Chromatography ...... 102

4.4 Purified α-gal A ...... 103

4.5 Potential use of purified α-gal A to measure anti-α-gal A antibodies in Fabry disease patients ...... 105

Chapter 5 Conclusions ...... 107

Chapter 6 Future Directions ...... 108

6.1 Use of purified α-gal A to detect anti-α-gal A antibodies by ELISA ...... 108

6.2 Use of purified α-gal A to test antibody-mediated inhibition of α-gal A uptake ...... 109

References ...... 111

viii

List of Tables

Table 1.1. Sphingolipid-accumulating LSDs ...... 17

Table 1.2. Incidences of the most prominent clinical manifestations of Fabry disease in male and female patients ...... 25

Table 1.3. Occurrence of major clinical events in Fabry disease patients with and without ERT expressed as percentage of patients who experienced such event ...... 50

Table 1.4. Incidence and other characteristics of anti-α-gal A IgG antibodies in clinical trials of ERT for Fabry disease ...... 53

Table 3.1. Age, mutation, ERT status, anti-human α-gal A IgG antibodies levels, serum creatinine levels and presence of left ventricular hypertrophy in Fabry disease patients ...... 79

List of Figures

Figure 1.1. General structure of a glycosphingolipid ...... 1

Figure 1.2. GSL biosynthesis pathway ...... 2

Figure 1.3. Globo-series GSL synthesis pathway ...... 4

Figure 1.4. Some GalCer GSLs ...... 7

Figure 1.5. Location and structure of GLA ...... 18

Figure 1.6. 3D structure of α-gal A ...... 20

Figure 1.7. α-gal A active site interactions with α-galactose ...... 21

Figure 1.8. Conversion of Gb3 to lactosylceramide by α-gal A ...... 23

Figure 1.9. Common visible manifestations of Fabry disease ...... 27

Figure 1.10. Conversion of Gb3 to lyso-Gb3 ...... 41

Figure 3.1. Incidence of antibodies by agalsidase preparation and no correlation between mutation type and antibody levels or development of antibodies ...... 83

Figure 3.2. No correlation between left ventricular hypertrophy or serum creatinine levels and development of antibodies or antibody levels ...... 84

Figure 3.3. Characterization of the his-tagged α-gal A-overexpressing HEK 293T cell line (α2) ...... 87

Figure 3.4. Purity of his-tagged α-gal A purified from cell lysate or culture supernatant ...... 88

Figure 3.5. Adaptation to grow with less FBS did not reduce production of α-gal A by α2 cells while decreasing protein contaminants ...... 89

Figure 3.6. His-tagged α-gal A present in chromatography fractions ...... 90

Figure 3.7. Homogeneity of purified α-gal A and confirmation of N-glycosylation ...... 92

Figure 3.8. Binding of anti-α-gal A antibodies to purified α-gal A ...... 93

List of Abbreviations

α-gal A α-galactosidase A

AAV Adeno-associated viruses

BKV BK virus

CERT Ceramide transport protein

CHB Cell homogenization buffer

CHO Chinese hamster ovary

CMV Cytomegalovirus

CNS Central nervous system

CRIM Cross-reactive immunologic material

DC Dendritic cell

DGJ 1-deoxy-galactonojirimycin

DHFR Dihydrofolate reductase

EBV Epstein-Barr virus

EGFR Epidermal growth factor receptor

ER Endoplasmic reticulum

ERT Enzyme replacement therapy

FBS Fetal bovine serum

GalCer Galactosylceramide

GalNAc N-acetylgalactosamine xi

Gb3 Globotriaosylceramide

Gb4 Globotetraosylceramide

Gb5 Globopentosylceramide

GGA Golgi localized γ-ear containing ARF-binding proteins

GlcCer Glucosylceramide

GlcNac N-acetylglucosaminyl

GPI Glycosylphosphatidylinositol

GSL Glycosphingolipid

GST Glutathione S-transferase

HSC Hematopoietic stem cell

ICAM-1 Intercellular adhesion molecule-1

IR Insulin receptor

LacCer Lactosylceramide

LAMP Lysosome-associated membrane protein

LDL Low-density lipoprotein

LIMP Lysosomal integral membrane protein

LRP Low density lipoprotein receptor-related protein

LSD Lysosomal storage disorder

LV Lentiviral vector

LVH Left ventricular hypertrophy xii

LysoGb3 Globotriaosylsphingosine

M6P Mannose-6-phosphate

M6PR Mannose-6-phosphate-specific receptors

NB-DNJ N-butyldeoxynojiromycin

P4 1-phenyl-2-palmitoylamino-3-pyrrolidino-1-propanol

PBMC Peripheral blood mononuclear cell

PBS Phosphate-buffered saline

PECAM-1 Platelet endothelial cell adhesion molecule-1

PSQ Penicillin-streptomycin-glutamine

SAP Sphingolipid activator protein

SEC Size-exclusion chromatography

TGN Trans-Golgi network

Tr1 T regulatory 1

UCE Uncovering enzyme

VGEF Vascular endothelial growth factor

VT Verotoxin

VT1 Verotoxin 1

VT2 Verotoxin 2

WPRE Woodchuck hepatitis virus post-transcriptional regulatory element

xiii

Chapter 1

Literature Review

1.1 Glycosphingolipids

Glycosphingolipids (GSLs) are composed of a hydrophobic ceramide moiety and an oligosaccharide chain (Fig. 1.1). Ceramides are made up of sphingosine and related long chain aliphatic amines joined by amide linkages to various fatty acids. In neutral GSLs, the fatty acid moieties are primarily saturated and monounsaturated compounds with chain lengths from C16 to

C26 (reviewed by Robert J Desnick, Ioannou, and Eng 2001). Ceramides are highly hydrophobic and do not exist in biological fluids such as the cytosol. Instead, they exert their biological effects at the membrane level (reviewed by Kolesnick, Goñi, and Alonso 2000). They are abundant in sphingolipid-rich regions of membranes such as caveolae (P. Liu and Anderson 1995) and other rafts which serve as important components of signaling microdomains within the cell (reviewed by Kolesnick, Goñi, and Alonso 2000).

Figure 1.1. General structure of a glycosphingolipid. Image adapted from Magnusson and Asim 1997.

1 2

1.1.1 De novo GSL synthesis pathway

Ceramides are synthesized on the cytosolic leaflet of the endoplasmic reticulum (ER) (Buton et al.

2002) by ceramide synthases CerS1 to CerS6 in mammals, which are located in the ER and mitochondrial membranes (reviewed by Mullen, Hannun, and Obeid 2012). These enzymes control sphingolipid synthesis for both de novo and salvage pathways and differ in their preference of acyl-chain lengths (reviewed by Mullen, Hannun, and Obeid 2012). For instance, CerS1 mainly synthesizes C18:0 ceramides while CerS2 predominantly makes C22:0, C24:0 and C26:0 ceramides

(reviewed by Mullen, Hannun, and Obeid 2012).

Carbohydrate groups are covalently attached to the terminal hydroxyl group of the ceramide by a glycosidic linkage to the reducing end of the carbohydrate. The carbohydrate moiety of a glycosphingolipid may vary from a monosaccharide to a large branched-chain oligosaccharide with 20 or more sugar residues (reviewed by Robert J Desnick, Ioannou, and Eng 2001). The first sugar linked to the ceramide is either glucose, galactose or rarely fucose (Watanabe, Matsubara, and Hakomori 1976), which generate glucosylceramide (GlcCer), galactosylceramide (GalCer) or fucosylceramide, respectively (Fig. 1.2).

Figure 1.2. GSL biosynthesis pathway. Addition of glucose, galactose or fucose to ceramide generates GlcCer, GalCer or fucosylceramide, respectively.

1.1.1.1 Glucose GSLs

Glucose GSLs comprise the vast majority of total GSLs. Their synthesis begins with the transport of ceramide from the ER to the cytosolic leaflet of the Golgi either by the ceramide transport protein (CERT) (Hanada et al. 2003) or a CERT-independent mechanism (probably vesicular traffic) (Giussani et al. 2008). Here, glucosylceramide synthase catalyzes the transfer of a glucose residue to ceramide to form GlcCer. All subsequent GSLs are synthesized on the luminal leaflet of the Golgi (Lannert et al. 1994).

Lactosylceramide (LacCer) formation is catalyzed by LacCer synthase, which transfers UDP- galactose to GlcCer (Lannert et al. 1994) (Fig. 1.2). LacCer synthase activity has been localized to the trans Golgi but it is also expressed at the cis/medial Golgi (Lannert et al. 1998; Halter et al.

2007). LacCer is the key precursor of all the sub-classes of glucose-based GSLs. While the mechanism that determines which biosynthetic pathway it follows is unclear, it has been shown that some of the enzymes responsible for making each of the sub-classes are expressed at different locations in the Golgi (Halter et al. 2007; Yamaji, Nishikawa, and Hanada 2010).

1.1.1.1.1 Globotriaosylceramide

k Globotriaosylceramide (Gb3, also named CD77 and the p blood group antigen (Marcus, Kundu, and Suzuki 1981)) is the first GSL in the globo-series and is formed by the addition of galactose to LacCer by Gb3 synthase (Fig. 1.3) (Y. Kojima et al. 2000). This enzyme is expressed in both the cis and trans Golgi (Halter et al. 2007; Yamaji, Nishikawa, and Hanada 2010). Subsequent addition of N-acetylgalactosamine (GalNAc) produces globotetraosylceramide (Gb4) and addition of an α1-3 linked GalNAc to Gb4 forms globopentosylceramide (Gb5), also known as the Fossman antigen (Yoda, Ishibashi, and Makita 1980). Interestingly, knockout mice of GlcCer and LacCer

synthases are embryonic lethal (Yamashita 2000; Nishie et al. 2010), while Gb3 synthase knockout mice appear normal (Okuda et al. 2006).

Figure 1.3. Globo-series GSL synthesis pathway. Galactosylation of LacCer produces Gb3, the first GSL of the globo-series. Addition of GalNAc forms Gb4 and further addition of GalNAc forms Gb5.

Gb3 is a verotoxin receptor

Verotoxins (VTs) are a family of E. coli-derived AB5 subunits that cause hemolytic uremic syndrome, a nephropathy resulting from glomerular occlusion (Karmali et al. 1985). Gb3 acts as a receptor for VTs (Jacewicz et al. 1986; C. A. Lingwood et al. 1987); deletion of Gb3 synthase renders mice completely resistant to verotoxin 1 (VT1) and verotoxin 2 (VT2) (Okuda et al. 2006).

Both the ceramide portion and the terminal Gal (α1-4) Gal residue of the carbohydrate head group are critical for binding (C. A. Lingwood et al. 1987). VT1 binding is increased as a function of

5 fatty acid chain length, mainly C16 to C22, while VT2c binding is restricted to C18 (Kiarash,

Boyd, and Lingwood 1994). Binding of VT to Gb3 triggers transmembrane signaling, activation of Src family kinases (Falguières et al. 2001) and entry of VT by receptor-mediated endocytosis

(Khine and Lingwood 1994). Length of the fatty acid chain of Gb3 also influences intracellular targeting of VT and, in turn, sensitivity of the host cells to the toxin (Arab and Lingwood 1998).

Cells containing higher levels of the shorter fatty acid Gb3 isoforms are more sensitive to VT1 and the toxin is targeted to the ER, nuclear membrane and nucleus (Arab and Lingwood 1998; Clifford

A. Lingwood, Rhine, and Arab 1998). In contrast, longer fatty acid Gb3 isoforms are less sensitive to VT1 and the toxin is targeted to the Golgi (Arab and Lingwood 1998; Clifford A. Lingwood,

Rhine, and Arab 1998). Zoja et al. (1992) showed there is a correlation between Gb3 expression and damage induced by VTs. In a rabbit model, clinical symptoms and microangiopathic lesions in the CNS, GI tract and lungs coincided with Gb3 expression in these organs (Zoja et al. 1992).

On the other hand, these lesions were absent in the kidney, heart and liver, where no Gb3 was detected (Zoja et al. 1992). The relationship between Gb3 expression and VT pathology in humans is explained in section 1.3.1.1.

Gb3 is an HIV co-receptor

Gb3 is also involved in HIV infection. The surface envelope glycoprotein of the virus, gp120, binds to CD4 on T cells and monocytes. This induces a conformational change that exposes the V3 loop, which binds to a chemokine co-receptor, either CXCR4 or CCR5. The V3 loop also contains a

GSL-binding motif (Mahfoud et al. 2002) to which several glycolipids adhere, including GalCer and Gb3 (Bhat et al. 1993; Cook et al. 1994; Fantini et al. 1997; Hammache, Piéroni, et al. 1998).

GalCer binding by gp120 has been suggested as the mechanism of HIV targeting and entry into

CD4-negative cells such as mucosal epithelial cells (Cook et al. 1994; Fantini et al. 1993; Harouse,

Collman, and González-Scarano 1995). As with VT, gp120 has been shown to bind to C16, C22, and C24 Gb3-containing vesicles, but not to C18 and C20 Gb3 (Mahfoud, Manis, and Lingwood

2009).

The high affinity between Gb3 and gp120 has been explored as a tool to inhibit HIV infection. To this end, adamantylGb3, a soluble Gb3 mimic, has been shown to inhibit HIV infection of cultured and primary lymphoid target cells in vitro, even with HIV strains that are resistant to other therapeutic drugs (Lund et al. 2006). The GSL binding site in the V3 loop is in the center of the chemokine receptor binding domain and therefore GSL binding should inhibit subsequent chemokine receptor binding (Delézay et al. 1996; Xiao et al. 1998). Furthermore, while gp120 must bind to CD4 to open the V3 loop and then bind to the chemokine receptor (Wu et al. 1996), gp120-GSL binding does not require prior recognition of CD4, although soluble CD4 enhances gp120-GSL interaction (Hammache, Yahi, et al. 1998; Clifford A. Lingwood et al. 2010). This may occur because Gb3 is smaller than the chemokine receptors and can therefore more easily access the binding site in the V3 loop. It has also been suggested that gp120 binding to GalCer does not prevent binding to the chemokine receptor because the carbohydrate group is smaller than that of Gb3 (C. A. Lingwood et al. 2010).

1.1.1.2 Galactose GSLs

Ceramide synthesized in the ER can be galactosylated by GalCer synthase to produce GalCer (Fig.

1.2). GalCer-based GSLs usually have a 2-hydroxy fatty acid but can also contain a non-hydroxy fatty acid (Burger, van der Bijl, and van Meer 1996). The former is synthesized on the luminal leaflet of the ER and the latter on the cytosolic leaflet of the Golgi (Burger, van der Bijl, and van

Meer 1996). GalCer is expressed primarily in the kidneys, intestine, Schwann cells, oligodendrocytes and testis (Stahl et al. 1994). GalCer GSLs are important components of myelin

7 sheath and Schwann cells (reviewed by Ichikawa and Hirabayashi 1998). Galabiosylceramide and sulfogalactosylceramide (sulfatide) (Fig. 1.4) are synthesized on the luminal side of the Golgi

(Burger, van der Bijl, and van Meer 1996; Buton et al. 2002) by α-1,4-galactosyltransferase and

GalCer sulfotransferase, respectively (Y. Kojima et al. 2000).

Figure 1.4. Some GalCer GSLs. Galactosylation of GalCer forms galabiosylceramide. Addition of sialic acid to GalCer makes ganglioside GM4. Addition of sulfate to GalCer forms sulfogalactosylceramide.

1.1.2 GSL function

GSLs are predominantly found on the exoplasmic leaflet of the plasma membrane but also on nuclear (Ledeen and Wu 2006) and mitochondrial (Morales et al. 2004) membranes. They were originally thought to have merely a structural function, giving the cell membrane a carbohydrate protective coat. However, over the past decades they have been shown to be of greater physiological importance despite being a small fraction of the total plasma membrane lipids (Gerrit

Van Meer and Holthuis 2000). Exceptions to this are the apical plasma membrane of epithelial cells of the intestinal and urinary tracts, where GSLs are found at particularly high concentrations

8 of 30–40 mol% of total lipids (Forstner, Tanaka, and Isselbacher 1968; Kawai, Fujita, and Nakao

1974; Stubbs, Ketterer, and Hicks 1979).

1.1.2.1 GSLs form membrane rafts

Sphingolipids do not distribute homogeneously in the cellular membrane. Their saturated backbones can be tightly packed which allows them to associate with other sphingolipids and cholesterol to form semi-ordered lipid microdomains called lipid rafts, membrane rafts or detergent-resistant membranes (Boggs 1987; Simons and Ikonen 1997). They can exist transiently or be stable structures (D. Lingwood and Simons 2010). Certain proteins associate with these rafts, such as glycosylphosphatidylinositol (GPI)-anchored proteins (Brown and Rose 1992), flotillins, caveolins, G-protein-coupled receptors, and some receptor tyrosine kinases including the epidermal growth factor receptor (EGFR) (reviewed by Balbis and Posner 2010) and the insulin receptor (IR) (Kabayama et al. 2007). In addition, it is thought that association of sphingolipids with proteins destined for the cell membrane in the Golgi causes their joint delivery to the cell membrane via vesicular transport (Simons and Ikonen 1997; van Meer and Simons 1988).

1.1.2.1.1 Gb3 in membrane rafts

Gb3 in membranes is not always part of a raft (Falguières et al. 2001; Smith et al. 2006). The VT- induced transmembrane signaling and transport of the VT-Gb3 complex from the cell surface to endosomes, Golgi and ER only occurs if the initial Gb3 is part of a membrane raft (Katagiri et al.

1999; Falguières et al. 2001). When VT binds to Gb3 that is not part of a membrane raft, the VT-

Gb3 complex is internalized and trafficked to lysosomes, where the toxin is degraded and therefore there is no cytotoxicity (Falguières et al. 2001). Consequently, it has been suggested that cells that express Gb3 that is not part of a raft on their surface are protected against VT (C. A. Lingwood et

al. 2010). In the human kidney, Gb3 is expressed in the glomerulus and the tubular epithelial cells

(Boyd and Lingwood 1989), yet hemolytic uremic syndrome pathology is mostly limited to the glomerulus (Goldwater 2007). This is likely due to the fact that glomerular Gb3 is organized into rafts while tubular Gb3 is not (F. Khan, Proulx, and Lingwood 2009).

1.1.2.2 GSL modulation of signal transduction

GSLs can modulate signal transduction by interacting with some of the receptors they associate with. For example, a specific GSL prevents the dimerization of EGFR, inhibiting its kinase activity

(Bremer, Schlessinger, and Hakomori 1986; Meuillet et al. 2000; Zurita, Maccioni, and Daniotti

2001; Yoon et al. 2006; Kawashima et al. 2009). Similarly, a GSL inhibits tyrosine phosphorylation of the IR, which ultimately suppresses insulin-dependent glucose uptake by cells

(Nojiri, Stroud, and Hakomori 1991; Tagami et al. 2002; Kabayama et al. 2007). A number of

GSLs inhibit tyrosine phosphorylation of the platelet-derived growth factor receptor (Bremer et al.

1984). Protein kinase C activity is inhibited by some GSLs (Farooqui et al. 1988) and they also modulate integrin function (Wang, Sun, and Paller 2001).

1.1.2.3 GSL regulation of endocytosis and intracellular protein trafficking

GSLs are involved in vesicular trafficking. Abnormal levels lead to the re-routing of some endocytosed molecules to other compartments (Chen et al. 1999; Sprong et al. 2001; Sillence et al. 2002). Additionally, there is a gradient of lipid expression within cellular membranes: the plasma membrane contains the highest concentration of sphingolipids, the ER the lowest, and the

Golgi has intermediate levels (Lippincott-Schwartz and Phair 2010). Low sphingolipid levels in the ER result in a less ordered membrane that facilitates protein entry and folding, while the high

10 cell surface concentration creates a thicker membrane with higher permeability stringency

(Lippincott-Schwartz and Phair 2010).

1.1.2.4 GSL regulation of cell proliferation

Signals such as oxidized low-density lipoprotein (LDL), growth factors and pro-inflammatory cytokines can activate LacCer synthase and increase LacCer levels (reviewed by Chatterjee and

Pandey 2008). LacCer then activates NADPH oxidase to produce reactive oxygen species, which initiates a signaling cascade that culminates in cell proliferation (Bhunia et al. 1996). Moreover, several GSLs have been associated with various tumours (Hakomori 1986), but some are thought to inhibit cell proliferation (reviewed by Chatterjee and Pandey 2008). As mentioned before

(section 1.1.2.2), a GSL modulates EGFR activity, which is important in cell proliferation (Bremer,

Schlessinger, and Hakomori 1986; Meuillet et al. 2000; Zurita, Maccioni, and Daniotti 2001; Yoon et al. 2006; Kawashima et al. 2009).

1.1.2.5 LacCer induction and direct mediation of cell adhesion

Synthesis of LacCer induced by oxidized LDL also leads to an increase in cellular adhesion between neutrophils and endothelial cells by increasing expression of CD11/CD18 and intercellular adhesion molecule-1 (ICAM-1), respectively (Arai et al. 1998; Bhunia et al. 1998).

Similarly, vascular endothelial growth factor (VGEF) induces LacCer synthesis in endothelial cells, initiating a signaling cascade that results in the cell-surface expression of platelet endothelial cell adhesion molecule-1 (PECAM-1), a protein involved in angiogenesis (Rajesh, Kolmakova, and Chatterjee 2005). It has also been shown that adhesion of mouse melanoma B16 cells to endothelial cells is mediated by LacCer expressed on the latter (N. Kojima et al. 1992).

1.1.2.6 GSLs as receptors

GSLs participate in adhesion/recognition processes by interactions with GSLs and lectins in other cells (reviewed by Wennekes et al. 2009). Cholesterol regulates GSL conformation and, in turn, its receptor function (D. Lingwood et al. 2011). In the presence of cholesterol, the GSL glycan group is tilted towards the membrane (more parallel to the membrane) and in its absence, it is more perpendicular to the membrane (D. Lingwood et al. 2011). The parallel configuration makes the

GSL receptor more inaccessible to ligands. For instance, binding of VT to Gb3 is reduced in the presence of cholesterol (D. Lingwood et al. 2011).

1.1.2.7 GSLs involvement in embryonic development

GSLs play an essential role in the development of organisms. This is evidenced by defects in embryonic differentiation and, in some species, lethality in knockouts of the gene that encodes the enzyme that makes GlcCer (Yamashita 2000; Liang et al. 2010). Specifically, GSLs have been shown to regulate the epithelial-mesenchymal transition during embryonic development (Guan,

Handa, and Hakomori 2009; Guan et al. 2010).

1.1.2.8 GlcCer and ceramide contribute to prevent water loss from the

skin

Cells in the stratum corneum, the outermost layer of the epidermis, secrete large quantities of lipid, primarily GlcCer (reviewed by Holleran, Takagi, and Uchida 2006). This lipid-rich extracellular matrix prevents water loss from the skin (reviewed by Feingold and Elias 2014). It has been shown that GlcCer synthase activity increases during epidermal differentiation (Takagi et al. 1999). In addition, the enzyme that hydrolyzes GlcCer to produce ceramide (glucocerebrosidase) has a

12 higher activity in the outer epidermal layers (Takagi et al. 1999). Consistently, skin diseases such as atopic dermatitis and lamellar ichthyosis have been associated with reduced ceramide levels

(reviewed by Choi and Maibach 2005). Defects in glucocerebrosidase (as in type II Gaucher disease) and in ABCA12, a transporter of GlcCer, coincide with ultrastructural defects in the outer epidermal layer (Holleran et al. 1994) and skin defects (Sakai et al. 2007), respectively.

1.1.2.9 Other functions of sphingolipids

Sphingolipids also play important roles in the brain, as evidenced by the neurological defects observed in diseases in which GSL metabolism is affected (Goker-Alpan et al. 2008; Marks et al.

2008; Akiyama et al. 2005; Hara et al. 2000). They are also found in the plasma at low concentrations, typically associated with LDL and other lipoproteins (J. T. Clarke 1981). Some

GSL synthesis intermediates such as ceramide and sphingosine are key mediators in cell growth

(reviewed by Chalfant and Spiegel 2005), apoptosis (Bose et al. 1995; De Maria et al. 1997; Mullen et al. 2011), proliferation, autophagy (reviewed by Young, Kester, and Wang 2013) and stress response (Maceyka and Machamer 1997; G. Liu, Kleine, and Hébert 1999).

1.1.3 GSL catabolism and salvage pathway

GSLs can also be synthesized from products resulting from the degradation of existing GSLs, which primarily occurs in the lysosome. GSLs reach this organelle incorporated in the membrane of intra-lysosomal vesicles (Fürst and Sandhoff 1992) formed by endocytosis of the plasma membrane, receptor-mediated endocytosis of LDL and phagocytosis by macrophages (reviewed by Wennekes et al. 2009). In the lysosome, the sugar moieties can be sequentially cleaved by exoglycosidases to eventually form ceramide and free sugars (reviewed by Kitatani, Idkowiak-

Baldys, and Hannun 2008). In general, a particular GSL species is hydrolyzed by a single specific

13 lysosomal enzyme. Ceramide can then be deacylated by acid ceramidase to produce sphingosine, which exits the lysosome along with other GSL degradation products such as monosaccharides and sialic acid (reviewed by Kitatani, Idkowiak-Baldys, and Hannun 2008). This sphingosine can either be broken down to simpler products that are no longer sphingolipids or serve as a substrate for CerS to synthesize ceramide for re-entry into the GSL synthesis pathway (reviewed by Kitatani,

Idkowiak-Baldys, and Hannun 2008). A study by Gillard, Clement, and Marcus (1998) suggests that in slowly dividing cells, GSL synthesis primarily occurs via the recycling pathway, whilst in actively dividing cells the de novo pathway is upregulated.

1.2 The lysosome

The lysosome is the main cell organelle responsible for the degradation of most biological macromolecules including proteins, polysaccharides, nucleic acids, phospholipids and glyco- conjugates such as GSLs. Endocytosis, phagocytosis, autophagy or direct transport localize GSLs to the lysosome (reviewed by Kolter and Sandhoff 2005). Their degradation occurs through the concerted action of more than 50 soluble acid hydrolases and 120 lysosomal membrane proteins.

The lyososomal membrane is mainly composed of lipids such as phospholipids, cholesterol and dolichol derivatives (reviewed by Winchester, 2001), as well as highly glycosylated proteins such as lysosome-associated membrane proteins 1 (LAMP-1) and 2 (LAMP-2), and lysosomal integral membrane proteins 1 (LIMP-1) and 2 (LIMP-2) (reviewed by Winchester, 2001). The highly glycosylated luminal domains of these proteins form a carbohydrate coat that protects the lysosomal membrane from the catabolic activity of luminal hydrolases. Other lysosome-associated membrane proteins maintain an acidic pH in the lumen of the organelle (lysosomal V-type H+-

ATPase), transport digestion products to the cytoplasm (amino acid, oligopeptide, monosaccharide and oligosaccharide transporters) and mediate fusion with other organelles, such as endosomes

14 that carry molecules for degradation or newly synthesized lysosomal components (reviewed by

Winchester, 2001).

1.2.1 Synthesis and trafficking of lysosomal proteins

Precursors of soluble lysosomal proteins are synthesized on ribosomes associated with the rough

ER. Lysosomal proteins typically have an N-terminal sequence of 20-25 amino acids that directs their co-translational translocation into the lumen of the ER, where the signal peptide is cleaved.

Here, they also undergo N-glycosylation by the transfer of preformed oligosaccharides to asparagine residues within the sequence Asn-X-Ser/Thr (where X can be any amino acid except

Pro or Asp). Lysosomal enzymes are then transported by vesicles to the Golgi, where complex sugar residues (e.g. galactose, fucose, N-acetylglucosamine, N-acetyl neuraminic acid) are added to their oligosaccharide chains and some mannose residues on one or more high-mannose-type oligosaccharides are modified with phosphate groups to form mannose-6-phosphate (M6P) residues (reviewed by Braulke & Bonifacino, 2009). The latter reaction is catalyzed by the sequential action of N-acetylglucosaminyl-1-phosphotransferase (GlcNac-1-phosphotransferase) and N-acetylglucosamine-1-phosphodiester α N-acetylglucosaminidase (or uncovering enzyme,

UCE) (Lazzarino and Gabel 1989). M6P residues can bind to M6P-specific receptors (M6PRs) in late Golgi compartments. M6PRs are type I transmembrane proteins present in the trans-Golgi network (TGN), endosomes and the plasma membrane, but not in lysosomes. They contain sorting signals in their cytosolic tails that bind to γ-ear containing ARF-binding proteins (GGAs)

(Puertollano et al. 2001; Zhu et al. 2001; Doray, Bruns, et al. 2002), which are clathrin adaptors localized to the TGN (Boman et al. 2000; Dell’Angelica et al. 2000; Hirst et al. 2000), and to clathrin-associated adaptor protein 1 (AP-1) (Höning et al. 1997; Ghosh and Kornfeld 2004). These adaptor proteins mediate the exit of M6PR-ligand complexes from the TGN in clathrin-coated

15 intermediates (Doray, Ghosh, et al. 2002) that fuse with endosomes, where the low pH promotes disassociation of the complexes and M6PR then recycles back to the TGN (Gonzalez-Noriega et al. 1980). There are other receptors that mediate M6P-independent trafficking of some soluble lysosomal proteins to lysosomes, such as neurotensin receptor 3 or sortilin (Lefrancois et al. 2003;

Ni and Morales 2006), LDL receptor-related protein (LRP) (Hiesberger et al. 1998) and LIMP-2

(Reczek et al. 2007).

Lysosomal membrane proteins, unlike soluble ones, are not modified with M6P and their trafficking to lysosomes depends on sorting signals in their cytosolic tails that interact with AP-1,

-2, -3 and -4 (Ohno et al. 1996; Aguilar et al. 2001; Ohno et al. 1995; Höning et al. 1996). They can reach the lysosome through a direct pathway in which they are transported from the TGN to endosomes and then lysosomes (Harter and Mellman 1992); or through an indirect pathway in which they are transported from the TGN to the plasma membrane, internalized into endosomes and then lysosomes (Janvier and Bonifacino 2005).

1.2.2 Sphingolipid activator proteins

GSLs with less than four sugar residues are only degraded in the presence of sphingolipid activator proteins (SAPs or saposins) in the lysosome. In vitro, these SAPs can often be replaced by detergents. SAPs either mediate the interaction between the membrane-bound GSL and the water- soluble enzyme or activate the enzyme directly. Five SAPs have been described: the GM2 activator protein and saposins -A, -B, -C and -D (Sandhoff, Kolter, and Harzer 2001). SAPs A-D are derived from the same precursor protein, prosaposin, and their nomenclature is based on their position within it (reviewed by Kishimoto, Hiraiwa, and O’Brien 1992). They are glycoproteins with molecular weights of 8-11 kDa that share a high degree of homology (Ponting 1994) and some

16 properties but have different specificities and mechanisms of action (Sandhoff, Kolter, and Harzer

2001). Saposin B will be further discussed in section 1.3.1.4.1.

Some studies have noted that intra-lysosomal membranes are enriched in bis-(mono-acylglycero)- phosphate and are low in cholesterol (Locatelli-Hoops et al. 2006; Remmel et al. 2007). It has been suggested that these conditions, along with saposins, are also necessary for GSL degradation.

1.2.3 Lysosomal storage disorders (LSDs)

Lysosomal storage disorders are caused by genetic defects that lead to deficiencies in the function, expression or trafficking of lysosomal hydrolases or their cofactors which result in the accumulation of macromolecules such as GSLs but also other sphingolipids, oligosaccharides, gangliosides, glycosaminoglycans or sulfatides (Robert J. Desnick and Schuchman 2002). Almost

50 LSDs have been identified (reviewed by Giugliani et al. 2016) and retrospective studies have shown that as a group they affect 1:4,000 to 1:7,700 individuals, varying from different countries and regions (Meikle et al. 1999; Poorthuis et al. 1999; Pinto et al. 2004; Hult et al. 2014). However, recent neonatal screening programs indicate that their incidence is higher, from 1:1,619 (Hopkins et al. 2015) to 1:2,315 (Mechtler et al. 2012). Table 1.1 lists LSDs caused by the accumulation of some of the sphingolipids mentioned above.

1.3 Fabry Disease

Fabry disease (also known as Anderson-Fabry Disease, angiokeratoma corporis diffusum and α- galactosidase A (α-gal A) deficiency; OMIM #301500) results from mutations in the GLA gene which cause deficiencies in the enzyme it encodes, α-gal A (EC 3.2.1.22), and the accumulation of glycosphingolipids, particularly Gb3 (Brady et al. 1967). Fabry disease has an X-linked

17 inheritance and an estimated incidence of 1:40,000 in males (Meikle et al. 1999; Robert J. Desnick,

Ioannou, and Eng 2001) but neonatal screenings have shown much higher incidences of 1:1,250 males in Taiwan (Hwu et al. 2009), 1:2,913 individuals in Missouri (Hopkins et al. 2015), 1:3,024 in Japan (Inoue et al. 2013), 1:3,100 in Italy (Spada et al. 2006) and 1:3,859 in Austria (Mechtler et al. 2012). Quality of life of Fabry disease patients is negatively impacted (Arends, Hollak, and

Biegstraaten 2015) and life expectancy is reduced by approximately 20 years in males (K. D.

MacDermot, Holmes, and Miners 2001b) and 15 years in females (K. D. MacDermot, Holmes, and Miners 2001a).

Table 1.1. Sphingolipid-accumulating LSDs. Some of the LSDs characterized by sphingolipid accumulation and the proteins that are defective in each. All are lysosomal hydrolyses with the exception of NPC1 and NPC2, which are lysosomal membrane proteins involved in intracellular lipid transport (Ioannou 2000).

Disease Sphingolipid accumulated Defective protein

Farber Ceramide Acid ceramidase

Krabbe GalCer β-galactosylceramidase

Gaucher GlcCer Glucocerebrosidase

Metachromatic leukodystrophy Sulfatide Arylsulfatase

Fabry Gb3, galabiosylceramide α-galactosidase A

Sandhoff Gb4 β-Hexosaminidase

All GSLs, cholesterol, Niemann-Pick type C NPC1, NPC2 sphingomyelin and sphingosine

1.3.1 α-galactosidase A

1.3.1.1 GLA gene

The gene that encodes α-gal A is located in the Xq22 region of chromosome X and spans 10,223 bp (Fox et al. 1984; Calhoun et al. 1985; Kornreich, Desnick, and Bishop 1989) (Fig. 1.5). It has seven exons that range in length from 92 to 291 bp, while the introns are 200 bp to 3.7 kb

(Kornreich, Desnick, and Bishop 1989). These contain 12 Alu repetitive elements that constitute about 30% of the gene, making it one of the most Alu-rich genes (Kornreich, Desnick, and Bishop

1989).

Figure 1.5. Location and structure of GLA. On the bottom part, exons are denoted by solid rectangles and Alu repeats are denoted by grey arrows, which indicate their orientations. Image adapted from Somenzi et al. (2011) and Desnick, Ioannou, and Eng (2001).

GLA has several putative regulatory elements in the 5’ flanking region, such as a TAATAA sequence, five CCAAT box sequences, and two GC box consensus sequences for transcription factor Sp1 (Kornreich, Desnick, and Bishop 1989), which are found in many housekeeping genes.

This region also contains potential enhancer-binding sites, including the conserved recognition motif of the AP1 enhancer-binding protein (W. Lee, Mitchell, and Tjian 1987), the immunoglobulin OCTA enhancer element (Lenardo, Pierce, and Baltimore 1987), a reverse

19 complement of the c-fos enhancer element (Prywes and Roeder 1986) and four direct repeats of the chorion box enhancer (Spoerel, Nguyen, and Kafatos 1986; Kornreich, Desnick, and Bishop

1989). Upstream from the initiation ATG (bp -669 to +1), GLA has a methylation-free island

(Kornreich, Desnick, and Bishop 1989). These are GC-rich regions that are enriched in CpG dinucleotides but remain not methylated. They are typically found in housekeeping genes (Bird

1986) and have been implicated in maintaining the inactivation of X-linked genes (Yang and

Caskey 1987; Keith, Singer-Sam, and Riggs 1986). Conversely, the 3’ flanking region of GLA is short, containing sequences similar to consensus downstream elements such as the GT-box and the T-rich sequence that are involved in polyadenylation (Kornreich, Desnick, and Bishop 1989;

Bishop, Kornreich, and Desnick 1988; McDevitt et al. 1986; Gil and Proudfoot 1987; McLauchlan et al. 1985).

1.3.1.1.1 Mutations in the GLA gene

To date, 672 mutations in the GLA gene that cause Fabry disease have been reported in the Human

Gene Mutation Database: 455 missense or nonsense mutations, 101 small deletions, 33 small insertions, 34 mutations that affect splicing, 27 gross deletions, 10 small indels, 6 complex rearrangements, 4 gross insertions or duplications, and 2 mutations in the regulatory elements of the gene. Most mutations are specific to individual families (reviewed by Robert J Desnick,

Ioannou, and Eng 2001).

1.3.1.2 Physical properties of α-galactosidase A

The processed transcript of the human GLA gene is 1.4 kb and it encodes a protein of 429 amino acids (Dean and Sweeley 1979) that is translated and co-translationally glycosylated in the ER into a ~50 kDa precursor (Bishop and Sweeley 1978; Bishop and Desnick 1981; LeDonne, Fairley, and

Sweeley 1983; Bishop et al. 1986). After cleavage of the N-terminal 31 residues that compose the signal peptide, the glycoprotein undergoes modification of its N-linked oligosaccharide moieties in the Golgi and is then transported to the lysosome via the M6PR-mediated pathway (Lemansky et al. 1987) as described in section 1.2.1.

The mature α-gal A is a soluble homodimeric glycoprotein of a native molecular mass of 101 kDa

(Bishop and Sweeley 1978; Kusiak, Quirk, and Brady 1978; Dean and Sweeley 1979; Bishop and

Desnick 1981). Each monomer is composed of two domains (Fig. 1.6.a) (S. C. Garman and

Garboczi 2004). Domain 1 includes residues 32 to 330 while domain 2 is comprised of residues

331 to 429 (S. C. Garman and Garboczi 2004). The homodimer has protein dimensions of approximately 75 Å x 75 Å x 50 Å (Fig. 1.6.b-c) and 30 residues from each monomer contribute to the dimer interface (S. C. Garman and Garboczi 2004). Each monomer contains five disulfide bonds (C52–C94, C56–C63, C142–C172, C202–C223, and C378–C382) (S. C. Garman and

Garboczi 2004).

Figure 1.6. 3D structure of α-gal A. (a) The α-gal A monomer. (b) and (c) Two views of the α-gal A homodimer. The monomer is colored from N (blue) to C (red) terminus. The galactose ligand in the active site is shown in yellow and red CPK atoms. Image taken from Garman and Garboczi (2004).

The active site cleft is found in a broad opening on the concave surface of the enzyme (Fig. 1.6.c)

(S. C. Garman and Garboczi 2004). Residues from seven loops in domain 1 form the active site:

W47, D92, D93, Y134, C142, K168, D170, E203, L206, Y207, R227, D231, D266, and M267, with C172 making a disulfide bond to C142 (S. C. Garman and Garboczi 2004). The side chains of these residues make specific contacts to each functional group on α-galactose (Fig. 1.7). α-gal

A shows little specificity for the distal portion of the substrate beyond the glycosidic linkage (S.

C. Garman and Garboczi 2004).

Figure 1.7. α-gal A active site interactions with α-galactose. α-galactose is in bold and the side chains of the residues of α-gal A that comprise the active site are labeled. Hydrogen bonds and polar interactions are in red and van der Waals interactions are in blue. Image taken from Garman and Garboczi (2004).

The α-gal A homodimer is negatively charged at neutral pH as each monomer has 47 carboxylate groups and 36 basic residues (S. C. Garman and Garboczi 2004). The isoelectric point of the plasma α-gal A is 4.2 (Bishop and Sweeley 1978; Bishop and Desnick 1981) while the tissue forms range in pI from 4.3 to 5.1 (Beutler and Kuhl 1972; Dean and Sweeley 1979; Bishop and Desnick

1981; Kusiak, Quirk, and Brady 1978). These variations result from differing amounts of sialic acid on the carbohydrate chains (Bishop and Desnick 1981).

1.3.1.3 Glycosylation of α-galactosidase A

The cDNA sequence of α-gal A has four consensus glycosylation sites that correspond to amino acid residues N139, N192, N215 and N408 (Robert J. Desnick, Ioannou, and Eng 2001). However, only the first three are occupied as determined by site-directed mutagenesis (Ioannou et al. 1998) and X-ray crystallography (S. C. Garman and Garboczi 2004). Glycosylation at site 215 is critical for the formation of a soluble, active enzyme, and for its transport to the lysosome (Ioannou et al.

1998). Elimination of any two or all three glycosylation yields an unstable enzyme that is degraded in the ER (Ioannou et al. 1998). All three oligosaccharide chains fall distal to the active sites of the protein and to the dimer interface (S. C. Garman and Garboczi 2004).

The carbohydrate structures of these chains markedly vary from the secreted and the intracellular forms of recombinant human α-gal A expressed in CHO cells (Matsuura et al. 1998). In the secreted enzyme, the oligosaccharides are heterogeneous, with 63% high mannose, 30% complex and 5% hybrid structures (Matsuura et al. 1998). Approximately 40% of the high mannose and

30% of the hybrid oligosaccharides are phosphorylated, and 30% of the complex oligosaccharides are sialylated (Matsuura et al. 1998). In contrast, the intracellular enzyme has 7.7% complex and

92% high mannose chains, of which only 3% are phosphorylated (Matsuura et al. 1998). These differences in phosphorylation and sialic acid content between the secreted and intracellular forms are consistent with the differences in pI seen in plasma and tissue α-gal A (see section 1.3.1.2).

The carbohydrates at sites N192 and N215 have a large proportion of mannose while those at site

N139 have no mannose, only complex carbohydrate (K. Lee et al. 2003). Therefore, the oligosaccharides at sites N192 and N215 are responsible for targeting α-gal A to the lysosome (S.

C. Garman and Garboczi 2004). Unlike many N-linked carbohydrates that lie along the surface of the protein and shield surface-exposed hydrophobic residues, the oligosaccharide at N215 extends

23 away from the protein, which would facilitate binding to the M6PR (S. C. Garman and Garboczi

2004).

1.3.1.4 α-galactosidase A activity

α-gal A catalyzes the hydrolysis of substrates that have terminal α-galactosyl residues such as Gb3

(Fig. 1.8). This is a two-step reaction: the first nucleophilic attack upon the substrate comes from

D170, cleaving the glycosidic linkage and forming a covalent enzyme-intermediate complex (S.

C. Garman and Garboczi 2004). In the second step, a water molecule deprotonated by D231 attacks

C1 of the covalent intermediate, liberating the second half of the catalytic product and regenerating the enzyme to its initial state (S. C. Garman and Garboczi 2004).

Figure 1.8. Conversion of Gb3 to lactosylceramide by α-gal A. Image adapted from Kanehisa et al. 2016.

Maximal activity of α-gal A with the artificial substrate 4-methylumbelliferyl-α-D- galactopyranoside occurs at pH 4.6 and has a Km of 2 mM (R. J. Desnick et al. 1973; Beutler and

Kuhl 1972; Bishop and Desnick 1981; Bishop and Sweeley 1978; Ho 1973); with the detergent- solubilized Gb3 as substrate, optimum pH is 3.8 to 4.0 and the Km is 0.1 to 0.2 mM (Bishop and

Desnick 1981; Dean and Sweeley 1979; Bishop and Sweeley 1978; Ho 1973).

1.3.1.4.1 SAP-B

In vivo, SAP-B must bind to Gb3 to render it available for hydrolysis by α-gal A (Kase et al. 1996).

SAP-B also catalyzes the hydrolysis of sulfatide and GM1 ganglioside. The inherited deficiency of SAP-B activity causes a disorder that is phenotypically similar to metachromatic leukodystrophy (Table 1.1), in which sulfatide accumulates (Shapiro et al. 1979; Inui, Emmett, and Wenger 1983). In patients with SAP-B deficiency, α-gal A, β-galactosidase and cerebrosidase sulfatase activities are not detectable in urine (Li et al. 1985).

1.3.2 Clinical manifestations of Fabry disease

Deficient α-gal A activity leads to the progressive deposition of GSLs with α-galactosyl moieties, particularly Gb3, in most tissues, which results in a multisystem disorder. Fabry disease patients with non-detectable or very low α-gal A activity usually develop the classic, early-onset Fabry disease phenotype (Eng et al. 1997; Branton et al. 2002) in which early symptoms typically begin during childhood or adolescence with a median age of onset of 9–10 years in males and 13–23 years in females (A. Mehta et al. 2004; Eng et al. 2007). Table 1.2 summarizes the incidence of some of these symptoms as reported in various studies.

1.3.2.1 Neuropathic pain

Two types of pain have been observed in Fabry disease patients: episodic crises and constant discomfort (Wise, Wallace, and Jellinek 1962; Lockman et al. 1973). Painful crises or acroparesthesias usually begin in childhood –as early as 2 years of age (Laney et al. 2015)– or early adolescence and indicate the clinical onset of Fabry disease (reviewed by Robert J Desnick,

Ioannou, and Eng 2001). They may last from minutes to days and consist of excruciating, burning

Table 1.2. Incidences of the most prominent clinical manifestations of Fabry disease in male and female patients.

Clinical manifestation Incidence References

(K. D. MacDermot, Holmes, and Miners Males 62-79% 2001b; K. D. MacDermot, Holmes, and Neuropathic pain Females 56-77% Miners 2001a; P. B. Deegan et al. 2006; S. Sirrs et al. 2010; Eng et al. 2007)

Males 31-71% (P. B. Deegan et al. 2006; Eng et al. 2007; Angiokeratoma K. D. MacDermot, Holmes, and Miners Females 35-40% 2001a)

Males 56% (K. D. MacDermot, Holmes, and Miners Hypohidrosis Females 33% 2001a)

Males 12% Ocular features (P. B. Deegan et al. 2006; Eng et al. 2007) Females 50%

(K. D. MacDermot, Holmes, and Miners Males 19-81% 2001a; Hoffmann et al. 2007; P. B. Gastrointestinal problems Females 50-70% Deegan et al. 2006; S. Sirrs et al. 2010; Eng et al. 2007)

Males 59-88% (K. D. MacDermot, Holmes, and Miners Cardiac problems 2001a; P. B. Deegan et al. 2006; S. Sirrs et Females 35-59% al. 2010)

Males 84% (K. D. MacDermot, Holmes, and Miners Renal problems 2001b; K. D. MacDermot, Holmes, and Females 35-40% Miners 2001a; P. B. Deegan et al. 2006)

(K. D. MacDermot, Holmes, and Miners Males 7-24% 2001b; J. MacDermot and MacDermot Cerebrovascular problems Females 4-25% 2001a; P B Deegan et al. 2006; S. Sirrs et al. 2010)

Males 80% (Hajioff, Goodwin, et al. 2003; P. B. Auditory abnormalities Females 48% Deegan et al. 2006)

26 pain felt initially in the palms and soles but it can extend to the proximal extremities and other parts of the body (Robert J. Desnick, Ioannou, and Eng 2001). Acroparesthesias are often triggered by fever, exercise, fatigue, emotional stress or rapid changes in temperature and humidity

(reviewed by Robert J Desnick, Ioannou, and Eng 2001). As patients get older, acroparesthesias tend to decrease in frequency and severity (reviewed by Robert J Desnick, Ioannou, and Eng 2001).

In addition to these, most patients have a nagging, constant discomfort in their hands and feet characterized by burning, tingling paresthesias (Lockman et al. 1973). They may be an attenuated form of the episodic crises (Robert J. Desnick, Ioannou, and Eng 2001). Pain is the most debilitating symptom of Fabry disease and patients usually change their lifestyles in an effort to avoid the factors that trigger it (Robert J. Desnick, Ioannou, and Eng 2001).

1.3.2.2 Angiokeratomas

Angiokeratomas are cutaneous vascular lesions (Fig. 1.9.a-b). They commonly start to appear in children after 5 years of age (Laney et al. 2015). These lesions develop slowly as individual punctate dark red to blue-black lesions but increase with age in number and size (reviewed by

Robert J Desnick, Ioannou, and Eng 2001). Angiokeratomas range in size from pinhead to several millimeters (reviewed by Robert J Desnick et al. 2003). Clusters of lesions are most dense between the umbilicus and the knees and have a tendency toward bilateral symmetry (reviewed by Robert

J Desnick, Ioannou, and Eng 2001). The hips, back, thighs, buttocks, penis and scrotum are most commonly involved (reviewed by Robert J Desnick, Ioannou, and Eng 2001).

Figure 1.9. Common visible manifestations of Fabry disease. (a-b) Angiokeratomas. (c) Whorled corneal opacity. Image taken from Robert J Desnick et al. 2003.

1.3.2.3 Hypohidrosis

Sweat glands of Fabry disease patients are often atrophied, leading to hypohidrosis (reviewed

Robert J Desnick, Ioannou, and Eng 2001). This inability to sweat normally is accompanied by temperature sensitivity and difficulty to perform physical exercise (Robert J. Desnick, Ioannou, and Eng 2001). Hypohidrosis often begins in childhood and has been reported as early as 2.5 years of age (Laney et al. 2015).

1.3.2.4 Ocular features

In Fabry disease, the cornea, lens, conjunctiva and retina are involved (Franceschetti 1968; Sher,

Letson, and Desnick 1979). Four common abnormalities have been described: corneal opacities or whorls, lenticular opacities, vessel dilation and tortuosity. Corneal opacities begin as a diffuse haziness in the sub-epithelial layer and progress into whorled streaks extending from a central vortex to the periphery of the cornea (Fig. 1.9.c) (Robert J. Desnick, Ioannou, and Eng 2001). They range from white to golden-brown, can be very faint and can only be seen by slit-lamp microscopy

(Robert J. Desnick, Ioannou, and Eng 2001). Corneal opacities have been reported in patients as young as 5 months of age and may be the earliest symptom of Fabry disease (Laney et al. 2015).

On the other hand, lenticular opacities can appear on the anterior or posterior lens capsule. Some are unique to Fabry disease patients and have been termed Fabry cataracts (Robert J. Desnick,

Ioannou, and Eng 2001). Tortuosity of the conjunctival and retinal vessels is common and is part of the diffuse systemic vascular involvement in Fabry disease (Robert J. Desnick, Ioannou, and

Eng 2001). It can occur as early as 4 years of age (Laney et al. 2015).

Vision is not impaired by any of these abnormalities, but acute visual loss has occurred in some

Fabry disease male patients as a result of unilateral total central retinal artery occlusion (Sher,

Letson, and Desnick 1979; Andersen et al. 1994). Some studies have found a correlation between these ocular features and disease severity (Allen et al. 2010; Pitz et al. 2015).

1.3.2.5 Gastrointestinal problems

Episodic diarrhea, abdominal pain and, to a lesser extent, nausea, vomiting, and flank pain are the most common gastrointestinal complaints of Fabry disease patients (Rowe, Gilliam, and Warthin

1974; Nelis and Jacobs 1989). Some patients have thickened, edematous folds and mild dilatation of the small bowel, a granular-appearing ileum, and have lost haustral markings throughout the colon, particularly in the distal segments (Rowe, Gilliam, and Warthin 1974). Large vessel disease of the superior mesenteric artery has also been described (Jardine et al. 1994). Gastrointestinal issues have been reported in Fabry disease patients as young as one year old (Laney et al. 2015).

1.3.2.6 Cardiac problems

Cardiac disease occurs in most hemizygous males. It is characterized by left ventricular enlargement and hypertrophy as well as mitral insufficiency (Ferrans, Hibbs, and Burda 1969;

Becker et al. 1975). Involvement of the myocardium and possibly the conduction system results

29 in electrocardiographic abnormalities that may show ST segment changes and T-wave inversion

(J. Mehta et al. 1977). Chest pain, arrhythmia, intermittent supraventricular tachycardia and a short

PR interval have also been reported (J. Mehta et al. 1977; Pochis et al. 1994). Some of these symptoms have been observed in the pediatric population (Kampmann et al. 2008; Laney et al.

2015). Late cardiac complications in Fabry disease may include angina pectoris, myocardial ischemia and infarction, congestive heart failure and severe mitral regurgitation (Ferrans, Hibbs, and Burda 1969; Becker et al. 1975).

1.3.2.7 Renal problems

During childhood and adolescence, protein, casts, red cells and desquamated kidney and urinary tract cells may appear in the urine (Robert J. Desnick, Ioannou, and Eng 2001). Decreased urinary concentrating ability also occurs early in life and proteinuria usually begins in adolescence or early adulthood (Pabico et al. 1973; Branton et al. 2002). Polyuria and a syndrome similar to vasopressin-resistant diabetes insipidus occasionally occur (reviewed by Robert J Desnick,

Ioannou, and Eng 2001). In a study that reviewed the clinical records of 105 male Fabry patients,

20% of them developed early renal insufficiency by 35 years of age; by 42 years of age, 50% of surviving patients had renal insufficiency; and by 47 years of age, 50% of surviving patients had end-stage renal disease (Branton et al. 2002). Before the advent of chronic dialysis and renal transplant, death of Fabry disease patients occurred at a mean age of 41 years, most commonly from uremia (Colombi et al. 1967b).

1.3.2.8 Cerebrovascular problems

Cerebrovascular manifestations of Fabry disease result primarily from multifocal small vessel involvement and may include thromboses, transient ischemic attacks, basilar artery ischemia and

30 aneurysm, seizures, hemiplegia, hemianesthesia, aphasia, labyrinthine disorders or cerebral hemorrhage (Wise, Wallace, and Jellinek 1962; Morgan et al. 1990). A meta-analysis (n = 8302) suggests that approximately 1% of young stroke patients may have Fabry disease (Shi et al. 2014).

Personality changes and psychotic behavior may occur with increasing age (Moumdjian et al.

1989; Mendez et al. 1997).

1.3.2.9 Hearing problems

Most male patients have high frequency sensorineural hearing loss, either bilateral or unilateral

(Robert J. Desnick, Ioannou, and Eng 2001; Hajioff, Goodwin, et al. 2003) and some also experience intermittent ringing in the ears (tinnitus). This generally develops later in life as most children affected with Fabry disease have normal hearing (Keilmann 2003; Keilmann et al. 2009;

Sakurai et al. 2009).

1.3.2.10 Growth impairment

Many affected males have retarded growth and delayed onset of puberty (Hopkin et al. 2008).

1.3.3 Other variants of Fabry disease

While Fabry disease patients with none or very low α-gal A activity typically develop most of the symptoms described above, hemizygous males with residual enzyme activity tend to develop the atypical, late-onset phenotype limited primarily to cardiac and, less frequently, renal manifestations during or after the third decade of life (Clarke et al. 1971; reviewed by Robert J

Desnick, Ioannou, and Eng 2001). This involvement limited to the heart may be due to the early accumulation of GSLs in the myocardium, which has been shown in fetuses (Robert J. Desnick,

Ioannou, and Eng 2001). Most classically affected patients die of renal and vascular complications

31 before the myocardial manifestations become apparent. In contrast, patients with the atypical form may have sufficient residual α-gal A activity to protect the kidneys and vascular endothelium but it may be inadequate to prevent GSL accumulation in myocardial cells (Robert J. Desnick,

Ioannou, and Eng 2001).

On the other hand, female heterozygotes usually have residual to normal activity (Daitx et al. 2015) and with increasing age can manifest minor symptoms of the disease such as corneal opacities, isolated angiokeratomas and neuropathic pain (Robert J. Desnick, Ioannou, and Eng 2001; K. D.

MacDermot, Holmes, and Miners 2001a). However, a few heterozygotes with renal manifestations, premature strokes and myocardial infarctions have been reported, although these issues usually arise later in life than in classically affected males (Ferrans, Hibbs, and Burda 1969;

R. J. Desnick et al. 1972; Van Loo et al. 1996). Such a markedly wide range of manifestations is expected in females heterozygous for X-linked diseases because of random X chromosome inactivation.

1.3.4 Gb3 accumulation

In Fabry disease, the following GSLs accumulate: Gb3, galabiosylceramide, the blood group B glycolipid and the blood group B1 glycolipid (reviewed by Robert J Desnick, Ioannou, and Eng

2001). These are all neutral GSLs and have α-galactosyl moieties. There is a fifth human GSL with these characteristics, the blood group P1 glycolipid, but it has not been reported to accumulate in

Fabry disease (reviewed by Robert J Desnick, Ioannou, and Eng 2001).

The accumulation of these GSLs, predominantly Gb3, occurs primarily in the lysosomes of endothelial and smooth-muscle cells of blood vessels (reviewed by Robert J Desnick, Ioannou, and Eng 2001). The swollen vascular endothelial cells, usually accompanied by endothelial

32 proliferation, narrows the lumen of the blood vessel, causing a focal increase of intraluminal pressure, dilatation, motor unresponsiveness and instability, which leads to ischemia or infarction

(reviewed by Robert J Desnick, Ioannou, and Eng 2001). To a lesser degree, Gb3 accumulates in the lysosomes of histiocytic and reticular cells of connective tissue (reviewed by Robert J Desnick,

Ioannou, and Eng 2001). These deposits also occur in epithelial cells of the cornea, in epithelial cells of glomeruli and tubules of the kidney, in muscle fibers of the heart and in ganglion cells of the autonomic system (reviewed by Robert J Desnick, Ioannou, and Eng 2001). GSL deposition does not occur in hepatocytes but is present in Kupffer cells and in the portal vessels and central vein of the liver (Elleder 1985).

GSL deposits show a “Maltese cross” configuration under polarized light microscopy and are birefringent (reviewed by Robert J Desnick, Ioannou, and Eng 2001). At high resolution, lysosomes with GSL deposits show a typical pattern of concentric or lamellar inclusions with alternating light- and dark-staining bands (reviewed by Robert J Desnick, Ioannou, and Eng 2001).

1.3.4.1 Gb3 accumulation in the skin

The markedly dilated capillaries of the dermal papillae pressure the epithelium and cause its elevation, flattening or hypertrophy, which is known as a telangiectasia or angioma. The larger lesions may cause abnormal thickening of the skin or hyperkeratosis. The term angiokeratoma is derived from these two symptoms. Deeper vessels show less dilatation and aneurysm formation

(reviewed by Robert J Desnick, Ioannou, and Eng 2001).

GSLs also deposit in the muscles attached to hair follicles (arrectores pilorum muscles), the sweat gland epithelium, perineural cells (Hashimoto, Gross, and Lever 1965; Sagebiel and Parker 1968), unmyelinated axons that innervate sweat glands and the endothelium of the small blood vessels

33 around sweat glands (Lao et al. 1998). This is likely responsible for the hypohidrosis that presents in many Fabry disease patients. In addition, they have an impaired ability for vasoconstriction and severe cases also show an inability to vasodilate, which may the related to the observed temperature intolerance (Robert J. Desnick, Ioannou, and Eng 2001).

1.3.4.2 Gb3 accumulation in the nervous system

The vasculature of the nervous system also presents GSL accumulation in Fabry disease (Grunnet and Spilsbury 1973; Cable et al. 1982; DeVeber et al. 1992). In the brain, this increases the probability of thromboses and stroke (Robert J. Desnick, Ioannou, and Eng 2001). GSL deposition in nervous tissue occurs in perineural sheath cells of peripheral nerves, neurons of the peripheral and central autonomic nervous system and certain primary neurons of somatic afferent pathways

(Kocen and Thomas 1970; Sung 1979). Vascular ischemia and GSL deposition in the perineurium may cause the peripheral nerve conduction abnormalities observed in some Fabry disease patients

(Sheth and Swick 1980a). GSL deposition in Schwann cells has been observed in some Fabry patients (Sung 1979). There is loss of small cell bodies of spinal ganglia (Onishi and Dyck 1974).

Loss of small myelinated and unmyelinated fibers has been reported in peripheral sensory neurons in the calves on Fabry disease patients (Kocen and Thomas 1970; Onishi and Dyck 1974). This may contribute to the characteristic pain (Sheth and Swick 1980b; Cable, Kolodny, and Adams

1982; Gemignani et al. 1984; Scott et al. 1999).

Brain stem centres in which GSL deposition has been observed include the nuclei gracilis and cuneatus, the dorsal autonomic vagal nuclei, salivary nuclei, nucleus ambiguous, thalamus, reticular substance, mesencephalic nucleus of the fifth nerve, and the substantia nigra (Onishi and

Dyck 1974). Hemisphere involvement has been noted in the amygdaloid, hypothalamic and hippocampal nuclei (DeVeber et al. 1992). Lesions in the hypothalamus may be related to the

34 episodic fevers some Fabry disease patients suffer (Colombi et al. 1967a). Studies have revealed

GSL deposits in the fifth and sixth cortical layers of the inferior temporal gyrus, the Edinger-

Westphal nucleus, the parasympathetic cell column and the midline nucleus (reviewed by Robert

J Desnick, Ioannou, and Eng 2001). GSL storage in neuronal cells of the anterior and posterior lobes of the pituitary has also been reported (DeVeber et al. 1992). Such involvement of the peripheral and central autonomic nerve cells may contribute to hypohidrosis (Yamamoto et al.

1996), along with sweat gland dysfunction and gastrointestinal symptoms (Robert J. Desnick,

Ioannou, and Eng 2001).

1.3.4.3 Gb3 accumulation in the eye

GSLs accumulate in endothelial, perivascular and smooth muscle cells of all ocular and orbital vessels (Witschel and Mathyl 1969; Font and Fine 1972); in the smooth muscle of the iris and ciliary body (Witschel and Mathyl 1969; Font and Fine 1972); in perineural cells, the connective tissue and the epithelium of the lens and cornea (Font and Fine 1972; Witschel and Mathyl 1969;

Macrae, Ghosh, and McCulloch 1985); in the basal layer and surface of the epithelium of the conjunctiva and in the conjunctival goblet cells (Macrae, Ghosh, and McCulloch 1985). There may be hyperplasia and edema of corneal epithelial cells. It has been proposed that the corneal opacities may result from the formation of a series of subepithelial ridges or from the reduplication of the basement membrane (Witschel and Mathyl 1969; Font and Fine 1972).

1.3.4.4 Gb3 accumulation in the heart

GSL deposition in myocardial cells, valvular fibrocytes and coronary vessels is the cause of cardiac issues in Fabry disease (R. J. Desnick et al. 1976; Ferrans, Hibbs, and Burda 1969). The left ventricular myocardium and the mitral valve are the sites with more lipid deposition in the heart

(R. J. Desnick et al. 1976), which may explain the frequency of left ventricular hypertrophy and mitral insufficiency in Fabry disease patients. Most commonly the left atrium and ventricle are enlarged, and the ventricular walls and septum are thickened, but there have been cases of gross cardiomegaly (reviewed by Robert J Desnick, Ioannou, and Eng 2001). Mitral and tricuspid valves have many lipid-laden cells embedded in fibrous tissue (R. J. Desnick et al. 1976). The most common valvular defect is thickening and interchordal hooding of the leaflets of the mitral valve, which may lead to mitral valve prolapse (Robert J. Desnick, Ioannou, and Eng 2001). Within myocardial cells there is extensive GSL deposition around the nucleus and between myofibrils

(reviewed by Robert J Desnick, Ioannou, and Eng 2001). Endothelial and smooth muscle cells of vessels also accumulate GSLs and are hypertrophied (reviewed by Robert J Desnick, Ioannou, and

Eng 2001). Gb3 deposition in the coronary arteries leads to myocardial ischemia and frank infarction (Ferrans, Hibbs, and Burda 1969; Becker et al. 1975; R. J. Desnick et al. 1976).

1.3.4.5 Gb3 accumulation in the kidney

Gb3 accumulation in kidney cells has been shown in the fetal stage (Elleder, Poupĕtová, and

Kozich 1998; A. C. Vedder et al. 2006; Thurberg and Politei 2012). GSL deposition in epithelial cells of the glomerulus and of the distal tubules causes lesions in the nephron and the renal vasculature, which lead to renal the problems seen in Fabry disease (Colley et al. 1958; Burkholder et al. 1980). Glomerular, interstitial or vascular lesions have been reported in children with Fabry disease (7-18 years of age) and Gb3 accumulation in the kidney (Tøndel et al. 2008). GSL-laden distal tubular epithelial cells desquamate and may be detected in the urinary sediment early in the disease (R. J. Desnick et al. 1971). Early proteinuria (reported in children as young as 10 years of age) may be caused by alterations in the glomerular epithelial cells and their foot processes

(Mcnary and Lowenstein 1965; Tøndel et al. 2008). The loss of concentrating ability may be due

36 to decreased water permeability of the distal tubules and collecting ducts secondary to GSL deposition (reviewed by Robert J Desnick, Ioannou, and Eng 2001). In later stages there is some

GSL accumulation in proximal tubules, interstitial histiocytes and interstitial cells (reviewed by

Robert J Desnick, Ioannou, and Eng 2001). Gradual loss of corticomedullary differentiation has also been reported (reviewed by Robert J Desnick, Ioannou, and Eng 2001). With end-stage renal disease come severe arteriolar sclerosis, glomerular atrophy and diffuse interstitial fibrosis

(reviewed by Robert J Desnick, Ioannou, and Eng 2001). Kidney size typically increases during the third decade of life and decreases during the fourth and fifth decades (reviewed by Robert J

Desnick, Ioannou, and Eng 2001).

1.3.4.6 Gb3 accumulation in the gastrointestinal tract

Neurons and nerve fibers of intestinal nerve plexuses and smooth muscle have GSL deposition, which may contribute to uncoordinated intestinal smooth-muscle activity that in turn causes diarrhea or constipation (Friedman et al. 1984; Robert J. Desnick, Ioannou, and Eng 2001). GSL accumulation in vessels and nerves that supply the bowel may be the cause of abdominal pain

(Jardine et al. 1994).

1.3.4.7 Gb3 accumulation in other tissues

Many other organs, including the adrenal glands, liver, pancreas, prostate, testis, thyroid and urinary bladder show involvement of the blood vessels, smooth muscle, ganglia, and nerves

(reviewed by Robert J Desnick, Ioannou, and Eng 2001). GSL accumulation in the testis and the pituitary gland may account for the growth retardation, delayed puberty and slow beard growth

(Vogelberg, Solbach, and Gries 1969; Faraggiana et al. 1981). In addition, GSL deposits have been shown in epithelial cells, mucous glands, synovial membrane, smooth muscle of the bronchus,

37 alveolar ciliated epithelial cells and goblet cells, type II alveolar epithelial pneumocytes, and skeletal muscle (Uchino et al. 1995). GSL accumulation has been noted in reticuloendothelial cells of the bone marrow, liver, spleen, and lymph nodes (reviewed by Robert J Desnick, Ioannou, and

Eng 2001). Gb3 deposits have been reported in both the maternal and fetal regions of the placenta of affected males (Elleder, Poupĕtová, and Kozich 1998; Thurberg and Politei 2012).

1.3.4.8 Gb3 accumulation in the plasma

Gb3 concentration is 3- to 10-fold higher in the plasma of Fabry disease patients than of unaffected individuals (reviewed by Robert J Desnick, Ioannou, and Eng 2001). Gb3 is primarily transported by LDL and HDL lipoproteins in proportions similar to those in normal plasma: approximately 60 and 30%, respectively (Dawson, Kruski, and Scanu 1976; Van Den Bergh and Tager 1976). Since

Gb3 deposits are found in Kupffer cells and other tissues of the liver but not in hepatocytes (Elleder

1985), this suggests that Gb3 synthesized in hepatocytes is associated with lipoproteins and secreted as a complex (J. T. Clarke and Stoltz 1976; Robert J. Desnick, Ioannou, and Eng 2001).

It has been proposed that the circulating Gb3 can enter vascular endothelial and smooth-muscle cells throughout the body by the high-affinity lipoprotein receptor-mediated uptake pathway

(Robert J. Desnick, Ioannou, and Eng 2001).

1.3.5 GLA mutation and severity of disease

Classically affected hemizygous patients with no detectable or very low α-gal A activity have a variety of mutations in the GLA gene including large and small gene rearrangements, splicing defects, missense mutations and nonsense mutations (Eng et al. 1993; Eng and Desnick 1994;

Robert J. Desnick, Ioannou, and Eng 2001). In contrast, most late-onset Fabry disease patients have missense mutations and residual α-gal A activity (Eng et al. 1997; Robert J. Desnick, Ioannou,

38 and Eng 2001). However, the clinical heterogeneity observed in individuals with the same GLA mutation, even within the same family, is evidence that there is not a clear genotype-phenotype correlation and that there are other factors aside from α-gal A activity levels that influence the risk and severity of Fabry disease complications. These factors could be genetic, epigenetic and environmental.

It has been suggested that the higher the residual α-gal A activity, the greater the influence these other factors could have on the development of clinical manifestations of Fabry disease (Raphael

Schiffmann et al. 2016). More specifically, Schiffmann et al. (2016) have proposed that in patients with GLA mutations –usually nonsense and some missense– that lead to α-gal A activity levels from 0–10% of normal levels (Eng et al. 1993; Eng and Desnick 1994), non-GLA factors have little effect on the likelihood of developing Fabry-related clinical complications. In patients with certain missense and splice GLA mutations that lead to a residual enzyme activity of 15–30% of normal (Eng et al. 1997), these complications are less common and are likely to depend, to a large extent, on genetic and epigenetic modifiers. Finally, in patients with GLA mutations associated with an α-gal A activity above 35–40% of normal levels, Schiffmann et al. (2016) suggest that clinical features similar to those that occur in Fabry disease are more likely to have an underlying cause that is not the below average α-gal A activity.

There has been sparse research looking into genetic modifiers of Fabry disease. One example is the factor V G1691A (factor V Leiden) mutation, which was associated with an increased frequency of cerebral lesions in Fabry disease patients and the Fabry mouse model (Altarescu,

Moore, and Schiffmann 2005; Shen et al. 2006; Lenders et al. 2015).

1.3.6 Diagnosis of Fabry disease

Registry and cohort studies show that it takes a mean of 14 years in males and 16-19 years in females from symptom onset to diagnosis of Fabry disease (A. Mehta et al. 2004; Eng et al. 2007).

Patients are often initially misdiagnosed with other disorders because Fabry disease is a rare disease, a lack of awareness among the wide range of clinical specialists patients may initially go to and the non-specificity of many of the clinical features which in isolation may be attributed to other causes (Thomas and Mehta 2013). For example, the characteristic neuropathic pain is often misdiagnosed as rheumatic fever, growing pains and juvenile idiopathic arthritis (Pagnini et al.

2011; Lidove et al. 2012).

1.3.6.1 Clinical evaluation

Presumptive diagnosis of Fabry disease is most commonly made from the family history of the disease, pain in the extremities, angiokeratomas and corneal opacities (Robert J. Desnick, Ioannou, and Eng 2001; Lidove et al. 2012). Diagnosis of all suspect patients must be confirmed molecularly, biochemically or by other methods.

1.3.6.2 Identification of the GLA gene mutation

The molecular diagnosis of Fabry disease requires the GLA gene to be fully sequenced because of the large number of variants that have been reported (Daitx et al. 2015). Many mutations have been almost invariably associated with a particular set of clinical manifestations, which may serve to predict the progression of disease in the patient. Unfortunately, there are several GLA mutations reported with unknown pathogenic significance and there are no databases that comprehensively record Fabry disease clinical manifestations in association with every variant.

1.3.6.3 Measurement of α-gal A activity

Measuring α-gal A activity in plasma and leukocytes is the main current method for the biochemical diagnosis of Fabry disease (Daitx et al. 2015). Measurement of activity in dried blood spots is valuable to screen high-risk populations (Civallero et al. 2006) but is not sufficiently reliable to serve as a definitive diagnostic tool (Daitx et al. 2015). It has been estimated that 30–

35% of normal enzyme activity is the cutoff for diagnosing Fabry disease (Raphael Schiffmann et al. 2016). Demonstration of activity below these levels in the presence of a known pathogenic mutation is sufficient for diagnosis (Robert J. Desnick et al. 2003). In addition, enzyme activity can in some cases be predictive of the disease severity as discussed in section 1.3.5. However, measuring α-gal A activity in women is not a reliable method to identify carriers of GLA deleterious mutations because many of these individuals have normal or close to normal enzyme activity (Daitx et al. 2015). Also, when a patient has a GLA mutation of unknown pathogenicity and α-gal A activity above 30–35% of normal levels, other variables should be considered for diagnosis.

1.3.6.4 Measurement of Gb3 or lyso-Gb3 in plasma or urine

When α-gal A activity levels and previous reports of the GLA mutation are inconclusive, it may be useful to investigate substrate accumulation by measuring Gb3 or globotriaosylsphingosine

(lyso-Gb3) in plasma or urine (Aerts et al. 2008). Lyso-Gb3 is formed by the deacylation of Gb3

(Fig. 1.10) and is a cationic amphiphile with a large polar sugar moiety, which makes it relatively hydrophilic and water-soluble (Aerts et al. 2008). It has been shown to be increased in the plasma of Fabry disease patients (Aerts et al. 2008), just as glucosylsphingosine (deacylated glucosylceramide) is elevated in Gaucher disease (Nilsson and Svennerholm 1982; Orvisky et al.

2002) and galactosylsphingosine (deacylated galactosylceramide) is elevated in Krabbe disease

(Vanier and Svennerholm 1976; Svennerholm, Vanier, and Månsson 1980), along with their acylated forms. Thus, it has been used as a biomarker of Fabry disease (Niemann et al. 2014;

Bouwien E. Smid et al. 2015). However, both Gb3 and lyso-Gb3 have limitations as diagnostic tools because they may be normal in attenuated forms of the disease and heterozygous women

(Bouwien E. Smid et al. 2015), and may be elevated in heart disease patients who have no GLA mutations and normal α-gal A activity (Raphael Schiffmann et al. 2014).

Figure 1.10. Conversion of Gb3 to lyso-Gb3. Image adapted from Aerts et al. (2008).

1.3.6.5 Identification of lysosomal inclusions

It has been proposed that the identification of typical lysosomal inclusions in tissue biopsy specimens is the gold standard for diagnosis of Fabry disease (B. E. Smid et al. 2014; van der Tol et al. 2014), but this criterion also has limitations. Inclusions have been observed in other LSDs and in silicon nephropathy (Strømme et al. 1997; Apelland et al. 2014), and tissue Gb3 levels may be increased in the absence of lysosomal inclusions (Askari et al. 2007; Xu et al. 2015).

1.3.6.6 Measurement of tissue levels of Gb3

Similar to lysosomal inclusions, it has been suggested that the demonstration of elevated levels of

Gb3 in relevant tissues (kidney, heart or skin) by mass spectrometry or immunohistochemistry is a specific way to determine the pathogenicity of a previously unknown GLA mutation (Raphael

Schiffmann et al. 2016).

1.3.6.7 Prenatal diagnosis

For prenatal diagnosis, α-gal A activity is assayed in the chorionic villi obtained at 9 to 10 weeks of pregnancy or in cultured amniotic cells obtained by amniocentesis at approximately 15 weeks of pregnancy (Brady, Uhlendorf, and Jacobson 1971; Kleijer et al. 1987). Detection of the family

GLA mutation is also valuable for diagnosis (Robert J. Desnick, Ioannou, and Eng 2001).

1.3.7 Treatment of Fabry disease

1.3.7.1 Genetic counseling

When an individual is diagnosed with Fabry disease, genetic counseling should be provided to inform the patient of the natural history of the disease, its inheritance and the options for treatment

(Robert J. Desnick, Ioannou, and Eng 2001). Patients should be advised to inform other family members of the availability of diagnostic testing, genetic counseling and prenatal diagnosis

(Robert J. Desnick, Ioannou, and Eng 2001).

1.3.7.2 Symptom management

In the past, management of Fabry disease was non-specific and limited to symptom control and supportive therapies to maintain end-organ function. Numerous drugs have been tried to relieve

43 neuropathic pain. Carbamazepine and diphenylhydantoin, individually or in combination, can provide pain relief in Fabry disease patients (Lockman et al. 1973; Lenoir et al. 1977).

Angiokeratoma can be removed by argon laser treatment, mostly for cosmetic reasons (Newton and McGibbon 1987; Lapins, Emtestam, and Marcusson 1993). Some patients with gastrointestinal symptoms may benefit from the oral prokinetic drug, metoclopramide (Argoff et al. 1998). Prophylactic anticoagulants are recommended for stroke-prone patients (Robert J.

Desnick, Ioannou, and Eng 2001).

1.3.7.3 Chronic hemodialysis and renal transplantation

As mentioned in section 1.3.2.7, most male patients died from renal insufficiency at an average age of 41 before the advent of dialysis and renal transplantation (Colombi et al. 1967a). Successful kidney transplantation corrects renal function (Donati, Novario, and Gastaldi 1987; Tsakiris et al.

1996) and the engrafted kidney has been shown to remain free of GSL deposition as determined by histology (Mosnier et al. 1991). Chronic hemodialysis is an effective measure for patients who are unable or unwilling to undergo renal transplantation (Robert J. Desnick, Ioannou, and Eng

2001). When successful, either procedure prolongs the life of Fabry disease patients (Donati,

Novario, and Gastaldi 1987; Tsakiris et al. 1996; Erten et al. 1998; Mosnier et al. 1991).

1.3.7.4 Enzyme replacement therapy (ERT)

The start of the XXI century saw the advent of a specific treatment for Fabry disease: enzyme replacement therapy (ERT). It consists on the intravenous injection of recombinant α-gal A to supplement the deficiency of this enzyme. Early studies provided the rationale of this approach by showing that partially purified α-gal A could be taken up by cultured skin fibroblasts from Fabry disease patients and reduce Gb3 deposits to normal levels (Dawson, Matalon, and Li 1973; Osada,

Kuroda, and Ikai 1987; Hasholt and Sørensen 1984; Mayes et al. 1982). On the other hand, a number of trials demonstrated that α-gal A purified from organs and intravenously infused into

Fabry disease patients had a short half-life in the circulation and was rapidly cleared, while the plasma form of α-gal A had a much longer half-life (Mapes et al. 1970; Brady et al. 1973; R. J.

Desnick et al. 1979). This difference in clearance from the circulation is probably related to the difference in post-translational modifications of these isozymes. One of these studies found that the α-gal A purified from spleen contained few charged sialic acid and/or phosphate residues, while the plasma form was highly sialylated and phosphorylated (R. J. Desnick et al. 1979), as mentioned before (section 1.3.1.3). This fits the general observation that sialylated glycoproteins are retained longer in the circulation than desialylated glycoproteins (Ashwell and Morell 1974).

Similarly, the reduction in plasma Gb3 lasted longer with the infusion of plasma α-gal A than with splenic α-gal A (R. J. Desnick et al. 1979). Importantly, two consecutive doses of plasma α-gal were shown to reduce circulating Gb3 to normal levels (R. J. Desnick et al. 1980). This proved the feasibility of ERT for Fabry disease. Efforts then focused on the large-scale production of recombinant human α-gal A.

1.3.7.4.1 Agalsidase alfa and beta

In 2001, two recombinant human α-gal A preparations were approved by the European Medicines

Agency: agalsidase alfa (Replagal®; Shire HGT) at a recommended dose of 0.2 mg/kg (R.

Schiffmann et al. 2001), and agalsidase beta (Fabrazyme®; Genzyme Corp.) at a dose of 1 mg/kg

(Eng, Banikazemi, et al. 2001; Eng, Guffon, et al. 2001), administered intravenously once every two weeks. The FDA approved agalsidase beta in 2003 and agalsidase alfa in 2009. Agalsidase alfa is produced in a human cell line of undisclosed origin and agalsidase beta is generated in

Chinese hamster ovary (CHO) cells (Eng, Guffon, et al. 2001).

There are no significant differences between the Vmax, Km and enzymatic activities of the two enzyme products (K. Lee et al. 2003). Both preparations have complex but comparable isoelectric focusing band patterns, indicating charge heterogeneity (K. Lee et al. 2003). This is significantly reduced after treatment with neuraminidase but not with phosphatase, which means that this charge heterogeneity is mainly due to varying amounts of sialic acid on the enzymes (K. Lee et al. 2003).

Under reducing conditions, each preparation contains a greater proportion of a protein of 51.2 kDa and another of 47.5 kDa (K. Lee et al. 2003). Both preparations have the expected amino acid sequence except in the carboxy-terminus. The predominant form in agalsidase alfa is missing the last leucine, and in agalsidase beta it is the full-length protein; they contain similar proportions of a form lacking the last two amino acid residues (K. Lee et al. 2003). The carboxy-terminally truncated species probably result from proteolytic processing of the mature protein.

Agalsidase alfa and beta have different compositions of monosaccharides (K. Lee et al. 2003).

While both have the same amount of sialic acid on a mole/mole of protein basis, agalsidase beta has a higher proportion of fully sialylated oligosaccharides (K. Lee et al. 2003). The predominant oligosaccharides present at each of the glycosylation sites are the same in both preparations, although the relative ratios of these species vary between the two (K. Lee et al. 2003). Also, agalsidase beta has more M6P than agalsidase alfa on a molar basis (K. Lee et al. 2003). Consistent with this, the same authors found that more agalsidase beta bound to the cation-independent M6P receptor than agalsidase alfa and that there was a greater uptake of agalsidase beta into Fabry fibroblasts (K. Lee et al. 2003). Similarly, when injected intravenously into Fabry knockout mice, approximately twice as much agalsidase beta than alfa was found in the heart, kidney and spleen, while levels in the liver were similar (K. Lee et al. 2003). The half-life of agalsidase alfa in the circulation has been measured at 56 to 108 minutes by various groups (J. T. R. Clarke et al. 2007;

Shire Human Genetic Therapies 2010) and its intracellular half-life is reported to be 24 to 48 hours

(R. Schiffmann et al. 2000).

1.3.7.4.2 Therapeutic benefits of ERT

Therapeutic benefits of ERT on cardiac function

ERT can decrease interventricular septal thickness and reduce or stabilize left ventricular mass, even in patients with left ventricular hypertrophy (Baehner et al. 2003; Beck et al. 2004; Hughes et al. 2008; Kampmann et al. 2009; A. Mehta et al. 2009; Whybra et al. 2009). In a small study (n

= 15), mean left ventricular mass increased in the placebo group by 21.8 g and decreased in the

ERT group by 11.5 g (Hughes et al. 2008). After 5 years of ERT, stabilization or improvement in left ventricular mass index was seen in 23/32 patients with baseline left ventricular hypertrophy and in 23/25 patients that had not yet reached left ventricular hypertrophy at baseline (A. Mehta et al. 2009). In another study with female patients, 13/25 subjects diagnosed with left ventricular hypertrophy had a reduction in left ventricular mass greater than 20% after 1 year of ERT, and after 4 years, 7/25 patients had normal left ventricular mass (Whybra et al. 2009). However, of the

11 females with normal left ventricular mass at baseline, one developed left ventricular hypertrophy while receiving ERT (Whybra et al. 2009). Hughes et al. (2008) reported a reduction in myocardial Gb3 but it was not statistically significant.

Therapeutic benefits of ERT on renal function

In patients with early stages of chronic kidney disease, ERT can stabilize kidney function, but in patients with advanced chronic kidney disease, it can only slow its progression (R. Schiffmann et al. 2001; Raphael Schiffmann, Ries, et al. 2006; Feriozzi et al. 2009; A. Mehta et al. 2009; West

47 et al. 2009; Germain et al. 2007; Beck et al. 2004). A large study found that the annual rate of decline in estimated glomerular filtration rate of Fabry disease patients is 2.4 times higher in the placebo group than in the ERT group treated for 12 to 54 months (7.0 and 2.9 mL/min/1.73 m2, respectively) (West et al. 2009). ERT can also reduce proteinuria (Baehner et al. 2003). In addition, biopsies from 8 patients who received ERT for 54 months showed complete clearance of Gb3 in renal capillary endothelial cells (Germain et al. 2007). Results from a small study suggest that switching from biweekly to weekly infusions of agalsidase alfa may increase the benefit to kidney function (Raphael Schiffmann et al. 2007).

Therapeutic benefits of ERT on cerebrovascular complications

Fabry disease patients have elevated cerebral flow velocities and regional cerebral blood flow, which are reduced by ERT (Moore, Altarescu, Ling, et al. 2002; Moore, Altarescu, Herscovitch, et al. 2002). However, the relationship between increased risk of stroke and elevated regional cerebral blood flow remains unclear (Uma Ramaswami 2011).

Therapeutic benefits of ERT on other symptoms and quality of

life

Common Fabry disease symptoms such as acroparesthesia, hypohidrosis and abnormal gut motility and pain have a negative impact on quality of life. In this regard, ERT has been shown to reduce pain significantly (R. Schiffmann et al. 2001; Raphael Schiffmann et al. 2003; A. Mehta et al. 2009). Neuropathic pain severity score declined from 6.2 to 4.3 after 6 months on ERT (R.

Schiffmann et al. 2001) and other studies have replicated these results (Raphael Schiffmann et al.

2003). ERT has allowed some patients to discontinue their neuropathic pain medications (R.

Schiffmann et al. 2001). Similarly, after 3 years of ERT, sweat excretion in Fabry disease patients

48 improved from 0.24 to 0.57 mL/mm2 (control population had a mean of 1.05 mL/mm2) and the threshold for cold and warm sensation in the foot was significantly reduced (Raphael Schiffmann et al. 2003). However, nerve fiber regeneration has not been reported yet (Raphael Schiffmann,

Hauer, et al. 2006).

ERT can also decrease the severity and frequency of abdominal pain and diarrhea (Dehout et al.

2004; Hoffmann et al. 2007). Abdominal pain was reported by 49% of the patients at baseline and by 39% after 12 months of ERT; 27% reported diarrhea at baseline and the prevalence was reduced by 8% after treatment (Hoffmann et al. 2007). In addition, studies have reported an improvement in hearing threshold of 4-7 dB above baseline after 12 months of ERT in patients that have not progressed to severe hearing loss (Hajioff, Goodwin, et al. 2003; Hajioff, Enever, et al. 2003;

Hajioff et al. 2006). Patients on ERT report to have an improved quality of life (Baehner et al.

2003; A. Mehta et al. 2009).

1.3.7.4.3 Agalsidase alfa versus agalsidase beta

A few trials directly comparing the efficacies of agalsidase alfa and agalsidase beta have been conducted (Anouk C. Vedder et al. 2007; van Breemen et al. 2011; S. M. Sirrs et al. 2014). Vedder et al. (2007) administered agalsidase alfa at its recommended dose of 0.2 mg/kg and agalsidase beta at an equivalent dose instead of its recommended 1.0 mg/kg. No reduction in left ventricular mass was observed in either group and other disease parameters did not differ between the two therapies after 1 to 2 years (Anouk C. Vedder et al. 2007). Van Breemen et al. (2011) compared agalsidase alfa at 0.2 mg/kg and agalsidase beta at 0.2 mg/kg and 1.0 mg/kg. Plasma Gb3 and lyso-

Gb3 markedly decreased with all treatments within 3 months and remained stable (van Breemen et al. 2011). The Canadian Fabry Disease Initiative, a large randomized controlled trial, has shown no difference between the frequencies of clinically relevant events in patients treated with either

49 agalsidase at its corresponding dose (S. M. Sirrs et al. 2014). Similarly, systematic reviews have found no evidence to conclude that one form is superior than the other (El Dib et al. 2016).

1.3.7.4.4 Shortcomings of ERT

Benefits of ERT are mostly limited to improving quality of life symptoms and to delaying or slowing disease progression, especially at an early stage. Cohort studies have described the occurrence of major clinical events including stroke, cardiac, end stage renal disease and sudden death in 26–53% of male patients on ERT (Table 1.3) (Banikazemi et al. 2007; Rombach et al.

2013; Weidemann et al. 2013; S. M. Sirrs et al. 2014). Incidence of these events in the placebo groups were 42–58% (Banikazemi et al. 2007; Rombach et al. 2013; Weidemann et al. 2013).

In the trial conducted by Weidemann et al. (2013), 53% of patients on ERT suffered a major clinical event. It must be noted that this cohort was older and thus at a later stage of disease than other patient groups (mean age 40 ± 9 years) (Weidemann et al. 2013), which may explain the high incidence of clinical events. However, the comparison group was composed of Fabry disease patients from the Fabry Registry that did not receive ERT matched to individuals in the treated group by age, gender, previous transient ischemic attack and chronic disease stage, and 58% of these patients suffered one of these events. All three trials report no difference in patient death between the ERT and the non-treated groups (Banikazemi et al. 2007; Rombach et al. 2013;

Weidemann et al. 2013). These results indicate that ERT does not prevent the occurrence of clinically relevant events, although it has been found to delay them (Banikazemi et al. 2007;

Rombach et al. 2013). Mehta (2013) points out that ERT has shifted the main cause of death in

Fabry disease patients from renal to cardiac failure. While ERT has benefits on Fabry patient quality of life, improvement of risk of morbidity and mortality remains to be demonstrated.

Table 1.3. Occurrence of major clinical events in Fabry disease patients with and without ERT expressed as percentage of patients who experienced such event.

Clinical Cerebro- Reference Group (n) Deathb Cardiacc Renald eventa vasculare

ERT (51) 28% 2% 6% 20% 0% Banikazemi et al. (2007) Placebo (31) 42% 0% 13% 23% 7%

ERT (58) 26% 7% 12% 7% 5% Rombach et al. (2013) Untreated (42) 45% 5% 31% 2% 12%

ERT (40) 53% 18% 15% 10% 10% Weidemann et al. (2013) Untreated (40) 58% 5% 0% 28% 25%

Sirrs et al. ERT (178) 27% 5% 17% 3% 8% (2014) a All major clinical events. Some patients present more than one event. b Includes deaths attributed to Fabry disease and to seemingly unrelated causes. c Includes onset of atrial fibrillation, other arrhythmias necessitating hospitalization, pacemaker or cardiac defibrillator implantation, cardiac congestion necessitating hospitalization, myocardial infarction, percutaneous coronary intervention or coronary artery bypass graft. d Includes onset of end-stage kidney disease, dialysis or renal transplantation. e Includes transient ischemic attack and stroke.

It has been suggested that early initiation of ERT could be more beneficial because it could prevent

Gb3 accumulation before irreversible organ damage occurs (Hopkin et al. 2015). Moreover, the use of ERT in children is well tolerated, decreases pain and improves pain-related quality-of-life

(Ries et al. 2006; U. Ramaswami et al. 2007; Raphael Schiffmann et al. 2010; Goker-Alpan et al.

2016). Establishment of earlier ERT would require accurate and rapid diagnosis and a change in current criteria for starting ERT, which typically include significant renal, cardiac or cerebrovascular disease or pain (Mehta et al. 2006). However, the increased benefit of starting

ERT in childhood, if any, remains to be demonstrated and may not apply to every affected system.

1.3.7.4.5 Adverse events of ERT

The most common adverse events of ERT are infusion-associated reactions, which have been reported in 14-55% of treated Fabry patients in clinical trials vs 23% in placebo groups

(Banikazemi et al. 2007; Uma Ramaswami 2011). These reactions are typically mild to moderate in severity, and include rigors, fever, nausea and vomiting, headache, chest pain, flushing, pruritus, rhinitis, tremor, dyspnea, somnolence and acroparesthesia (Ramaswami 2011). Infusion- associated reactions tend to decrease in frequency with prolonged treatment (Wilcox et al. 2012).

1.3.7.4.6 Antibodies against infused proteins

Humoral immune responses to proteins infused for therapeutic purposes are common. They occur in replacement therapies for LSDs including Fabry, Gaucher (Pastores et al. 2016), and Pompe disease (Patel et al. 2012), MPS I (Xue et al. 2015), MPS II (Barbier et al. 2013), MPS VI (Brands et al. 2013) and other diseases such as hemophilia A and B (Osooli and Berntorp 2015). These antibodies can reduce the efficacy of the treatment by binding to the infused protein and modifying its tissue distribution, metabolic clearance, subcellular trafficking and/or catalytic activity (D. A.

Brooks, Kakavanos, and Hopwood 2003; Schellekens and Casadevall 2004). This immune response is influenced by several factors: route of administration, dose, duration of treatment, level of endogenous structurally similar proteins, characteristics of the infused protein, immune competence of the patient and concomitant medication (reviewed by Deegan 2012).

Incidence of IgG antibodies against rh α-gal A in Fabry disease

In some Fabry disease patients who receive ERT, anti-rh α-gal A IgG antibodies have been reported (Table 1.4). Results from several clinical trials suggest that agalsidase alpha is less

52 immunogenic than agalsidase beta: 11 to 57% of male patients treated with the former develop antibodies (R. Schiffmann et al. 2001; Linthorst et al. 2004; Raphael Schiffmann, Ries, et al. 2006;

Ries et al. 2006; Ries et al. 2007; J. T. R. Clarke et al. 2007; Raphael Schiffmann et al. 2007;

Anouk C. Vedder et al. 2007; Hughes et al. 2008; Anouk C. Vedder et al. 2008; van Breemen et al. 2011; Rombach et al. 2012), while 47 to 91% of male patients treated with the latter develop antibodies (Eng, Guffon, et al. 2001; Eng, Banikazemi, et al. 2001; Wilcox et al. 2004; Linthorst et al. 2004; Banikazemi et al. 2007; Germain et al. 2007; Ohashi et al. 2007; Anouk C. Vedder et al. 2007; Ohashi et al. 2008; Anouk C. Vedder et al. 2008; Wraith et al. 2008; Bénichou et al.

2009; Lubanda et al. 2009; van Breemen et al. 2011; Rombach et al. 2012; Wilcox et al. 2012).

One trial that directly compared both preparations found no difference in the incidence of antibodies (Linthorst et al. 2004), while another found a greater incidence in patients treated with agalsidase beta (Vedder et al. 2008).

Table 1.4. Incidence and other characteristics of anti-α-gal A IgG antibodies in clinical trials of ERT for Fabry disease.

# patients developing Persistence of Reference Agalsidase Additional information antibodies (%) antibodies

Schiffmann et Antibodies decreased Antibodies appeared to have no effect on safety or efficacy, Alfa 2/14 (21%) adult males al. (2001) over time and no correlation with infusion reactions

Antibodies became Eng et al. 51/58 (88%) males and undetectable in 7 Antibodies appeared to have no effect on reduction of Gb (2001), Wilcox Beta females over 16 years patients, decreased in 3 storage in organs tested, plasma Gb3 and serum creatinine et al. (2004) old 32, did not change or increase in 12

8/15 (53%) males over Antibodies appeared to have no effect on the Eng et al. (2001) Beta - 16 years old pharmacokinetic profiles between the first and last infusion

All 7 patients with infusion-associated reactions were IgG Alfa 4/7 (57%) Antibodies decreased positive. IgG-positive sera inhibited α-gal A activity in vitro Linthorst et al. in some patients and by 65-95%. All IgG-positive sera were cross-reactive. (2004) Beta 7/11 (64%) did not change in 4 There was no correlation between type of GLA mutation and the development of antibodies

Urinary sediment Gb3 rose in patients with a persistent IgG response, nearly reaching baseline levels, while in patients Schiffmann et 14/25 (56%) adult After 4-4.5 years, 6 Alfa with transient or no IgG, levels remained below 20% of al. (2006) males patients tolerized baseline. Antibodies appeared to have no effect on changes in renal function

53 54

Ries et al. 1/19 (5%) boys After 2 years, the Antibodies inhibited α-gal A activity in vitro by 87% (2006), Ries et Alfa patient was still (neutralizing) al. (2007) 0/5 (0%) girls positive

40/55 (73%) males and By 35 months, 1 male Banikazemi et Beta 3/8 (38%) females over and all 3 females - al. (2007) 16 years old tolerized

Clarke et al. Alfa 2/18 (11%) adult males - - (2007)

Antibodies became Antibodies appeared to have no effect on changes in renal 51/56 (91%) males and undetectable in 9 function. Gb was cleared from kidney tissue even in Germain et al. 3 Beta 1/2 females (50%) over patients, decreased in patients with antibodies. The frequency of infusion- (2007) 16 years old 32 and did not change associated reactions increased with initial appearance of in 9 antibodies but then decreased over time

By 12 months of ERT, urinary Gb normalized in all IgG- Ohashi et al. No patient tolerized 3 Beta 7/14 (50%) males negative patients and in the 3 IgG-positive patients with the (2007) during the study lowest antibody titers

Schiffmann et Antibodies appeared to have no effect on changes in renal Alfa 5/11 (46%) adult males No change in 2-4 years al. (2007) function

10/16 (62.5%) adult Infusion-associated reactions occurred in 3/10 IgG-positive Vedder et al. Antibodies decreased patients. Antibodies appeared to have a negative effect on Alfa, beta males, 0/13 (0%) adult (2007) in 2 patients urinary and plasma Gb3 reduction, but they did not correlate females with the occurrence of significant clinical events

Hughes et al. Urinary but not plasma Gb was elevated in 2 of these Alfa 3/15 (20%) adult males - 3 (2008) patients at the time of IgG detection but fell afterwards

Sera from seropositive patients inhibited α-gal A activity in vitro (neutralizing). Incubation of agalsidase beta with high- titer sera greatly reduced α-gal A activity in lysed Fabry Ohashi et al. Beta 9/19 (47%) adult males - fibroblasts incubated with the mixture and in organs of (2008) Fabry mice injected with the mixture. This inhibition was overcome by increasing the dose of agalsidase beta in the mouse experiment

In patients treated with agalsidase beta at 0.2 mg/kg, urinary

Gb3 decreased in IgG negative patients but increased in IgG positive patients. Treatment with agalsidase beta at 1.0 mg/kg led to a decrease in both groups. Antibodies Alfa 4/10 (40%) males appeared to have no effect on plasma Gb3 and left Vedder et al. - ventricular mass reduction. Antibodies from 17/18 patients (2008) Beta 14/18 (78%) males inhibited α-gal A activity in vitro (neutralizing). There was a strong correlation between antibody titers and neutralizing effect. There was no correlation between the presence of antibodies and residual α-gal A activity or the presence of nonsense and missense mutations

By 12 months, Antibodies appeared to have no effect on clearance of 11/14 (79%) boys Wraith et al. antibody levels plasma and dermal Gb . 5/6 patients with infusion- Beta 3 (2008) decreased in some associated reactions were IgG positive but no correlation 0/2 (0%) girls patients was found

Antibodies decreased There was no correlation between development of 104/122 (85%) adult in 64-92% of male antibodies or their titers and occurrence of clinical events, males Bénichou et al. patients and became although there was a tendency for patients with the highest Beta (2009) undetectable in 13- titers to have clinical events. There was no correlation 6/12 (50%) adult 16%. They decreased between antibody titer and the rate of change in renal females in 1/6 female patients function. In one of the cohorts, antibodies appeared to have

and became no effect on plasma Gb3 levels, and in the other cohort they

undetectable in the impaired Gb3 reduction but levels remained within the other 5 normal range in most patients. There was a correlation between antibody titers and the proportion of patients that

accumulated Gb3 in the dermal capillary endothelial cells

Urinary Gb reduction was greater in patients with no or Antibodies became 3 low antibodies and there was no reduction in patients with undetectable in 3 Lubanda et al. 18/21 (86%) adult the highest titers. Patients with highest titers had deletions Beta patients, remained low (2009) males in the coding region of GLA that predict truncation of α-gal in 2 and decreased in A. All 3 patients who did not develop antibodies and all 3 12 patients who tolerized had missense mutations

Alfa 3/7 (43%) males Reduction of plasma lyso-Gb3 was significantly less in seropositive patients receiving agalsidase alfa. Plasma lyso- Van Breemen et Beta 13/15 (87%) males - Gb3 tended to be higher in seropositive patients treated with al. (2011) agalsidase alfa or beta at 0.2 mg/kg, but not in seropositive Alfa, beta 0/21 (0%) females patients treated with agalsidase beta at 1.0 mg/kg

Alfa 5/14 (36%) adult males Plasma Gb3, plasma lyso-Gb3 and urinary Gb3 reduction was greater in seronegative patients. Switching seropositive 3/17 patients tolerized Beta 12/15 (80%) adult patients from 0.2 mg/kg to 1.0 mg/kg further reduced lyso- Rombach et al. (2 of these 3 had the males Gb3 levels, but these were still higher than in seronegative (2012) lowest titers of all patients. Seropositive patients had a tendency towards a patients) 0/30 (0%) adult higher incidence of clinical events than seronegative females patients (4/9 and 1/8, respectively)

Plasma Gb was slightly but significantly higher in 47/416 male patients 3 416/571 (73%) males seropositive male patients than in seronegative male Wilcox et al. tolerized and 18/31 Beta patients. Antibodies had no effect on plasma Gb3 in female (2012) female patients 31/251 (12%) females patients. Male seropositive patients were more likely to tolerized. Patients who have infusion-associated reactions than seronegative

tolerized tended to patients. Patients with nonsense mutations in GLA were have lower titers more likely to develop antibodies than patients with missense mutations

It is possible that agalsidase alfa is intrinsically less antigenic than agalsidase beta. Even though both enzyme preparations are biochemically very similar, they have minor differences in glycosylation (see section 3.7.4.1) (K. Lee et al. 2003), which is expected because post- translational modifications are species- and cell type-specific (N. Jenkins, Parekh, and James

1996), and agalsidase alfa and beta are expressed in different cell lines. Furthermore, glycosylation has been shown to affect the antigenicity of recombinant proteins (S. A. Brooks 2004). α-gal A produced in CHO cell lines (as is agalsidase beta) contains a small proportion of the sialic acid N- glycolyneuraminic acid (Matsuura et al. 1998). This sialic acid is not found in human tissues (Chou et al. 2002) and antibodies against it are present at varying levels in approximately 85% of humans

(Ghaderi et al. 2010). These pre-existing antibodies could facilitate a secondary immune response to an infused rh α-gal A that contains N-glycolyneuraminic acic (Deegan 2012). However, the specific presence of this sialic acid has not been reported in agalsidase beta. Conversely, incomplete sialylation of glycoproteins is associated with higher antigenicity (Gribben et al. 1990).

Since agalsidase alfa has less complete sialylation than agalsidase beta (K. Lee et al. 2003), the former would be expected to be more immunogenic. On the other hand, a study found that antibodies of all patients treated with either product are cross-reactive in vitro (Linthorst et al.

2004). This suggests that both agalsidases probably share the same epitope(s), which would mean that differences in antigenicity are not due to structural dissimilarities.

Another possibility is that the higher frequency of antibody development in patients treated with agalsidase beta is due to this drug being administered at a dose that is five times that of agalsidase alfa (1.0 and 0.2 mg/kg, respectively). Two studies have shown that administration of both drugs at an equal dose (0.2 mg/kg) results in no significant difference in the incidence of antibodies in male Fabry disease patients (Vedder et al. 2008; Rombach et al. 2012). However, van Breemen et

58 59 al. (2011) reported a greater incidence of antibodies in patients treated with agalsidase beta (5/6) than alfa (3/7) at 0.2 mg/kg.

On the other hand, anti-α-gal A antibodies are less frequent in female Fabry disease patients treated with either drug (Table 1.4) (Eng, Guffon, et al. 2001; Wilcox et al. 2004), which is consistent with other X-linked diseases such as hemophilia A (Osooli and Berntorp 2015). This is due to the presence of residual native α-gal A that acts as cross-reactive immunologic material (CRIM), causing a higher level of immune tolerance towards the infused recombinant protein. This also predicts that male patients with nonsense mutations, large deletions or rearrangements will have a greater risk of developing antibodies than patients with missense mutations. While this occurs in hemophilia A patients (Osooli and Berntorp 2015), the link is not clear in Fabry disease. Two clinical trials found no correlation between mutation type and development of antibodies

(Linthorst et al. 2004; Vedder et al. 2008) but two did (Lubanda et al. 2009; Wilcox et al. 2012).

Similarly, Vedder et al. (2008) found no correlation between residual α-gal A activity and development of antibodies but Linthorst et al. (2004) did. This difficulty to correlate mutation type and probability to develop antibodies may occur because some missense mutations affect epitopes of the protein, diminishing the capability of the mutant protein to induce tolerance.

Significance of IgG antibodies against recombinant α-gal A

Whether anti-α-gal A antibodies reduce the efficacy of ERT in Fabry disease is currently debated.

A number of studies have found no correlation between development of antibodies and reduction of plasma Gb3 (Eng, Banikazemi, et al. 2001; Wilcox et al. 2004; Hughes et al. 2008; Anouk C.

Vedder et al. 2008; Wraith et al. 2008), of tissue Gb3 (Eng et al. 2001; Wilcox et al. 2004; Germain et al. 2007; Wraith et al. 2008), of creatinine clearance rate (Schiffmann et al. 2001), of serum creatinine (Eng et al. 2001; Wilcox et al. 2004), of left ventricular mass (Anouk C. Vedder et al.

2008), of pain (Schiffmann et al. 2001) and the pharmacokinetic profile of agalsidase beta (Eng,

Guffon, et al. 2001). In contrast, some clinical trials have found a correlation between development of antibodies and failure to reduce Gb3 in the skin (Bénichou et al. 2009; Lubanda et al. 2009) and plasma Gb3 or lyso-Gb3 (Anouk C. Vedder et al. 2007; van Breemen et al. 2011; Rombach et al.

2012; Wilcox et al. 2012). In addition, several studies have shown an association with impaired urinary Gb3 clearance (Raphael Schiffmann, Ries, et al. 2006; Ohashi et al. 2007; Anouk C. Vedder et al. 2007; Hughes et al. 2008; Anouk C. Vedder et al. 2008; Lubanda et al. 2009; Rombach et al.

2012).

In other protein-based therapies such as those for Gaucher disease and hemophilia A, antibodies are most likely to decrease clinical efficacy when present at very high titers (Pastores et al. 2016;

Osooli and Berntorp 2015). Results from some clinical trials suggest that this may be the case in

Fabry disease. In patients treated with agalsidase beta at 0.2 mg/kg, urinary Gb3 decreased in seronegative patients but increased in seropositive patients, whereas treatment with 1.0 mg/kg led to a similar decrease in both groups (Vedder et al. 2008). In another study, plasma lyso-Gb3 tended to be higher in seropositive patients receiving agalsidase alfa or beta at 0.2 mg/kg than in seropositive patients receiving agalsidase beta at 1.0 mg/kg (van Breemen et al. 2011). Likewise, switching seropositive patients from 0.2 mg/kg to 1.0 mg/kg of agalsidase beta further reduced lyso-Gb3 levels, although they remained higher than in seronegative patients (Rombach et al.

2012). Hence it would seem that a low dose of α-gal A may be sufficient to maintain Gb3 clearance in seronegative and low-titer patients, while a high dose is required in high-titer patients. A higher amount of enzyme is more likely to saturate existing antibodies, leaving more molecules free to be taken up by target cells and exert their therapeutic benefit.

It must be noted that major clinical events such as renal failure, myocardial infarction, stroke and death are much more relevant outcomes than plasma and urinary Gb3. Unfortunately, few studies have explored the effect of anti-α-gal A antibodies on clinical events. Vedder et al. (2007) found no correlation between anti-α-gal A antibodies and clinical outcome and two studies reported a tendency for seropositive patients to experience a clinical event more often than seronegative patients, but this was not statistically significant (Bénichou et al. 2009; Rombach et al. 2012).

Therefore, the long-term impact of circulating anti-α-gal A antibodies on clinical outcomes remains unclear.

Nevertheless, it has been shown that serum from most seropositive patients inhibits α-gal A activity in vitro (Ries et al. 2007; Anouk C. Vedder et al. 2008; Ohashi et al. 2008; Linthorst et al.

2004). In addition, Linthorst et al. (2004) demonstrated that an IgG molecule is responsible for the neutralizing effect by depleting the serum of IgG antibodies. However, the clinical in vivo relevance of in vitro neutralizing activity is not entirely understood. To this end, Linthorst et al.

(2004) also showed that IgG antibodies bind to α-gal A in the circulation. Ohashi et al. (2008) reported that pre-incubation of agalsidase beta with sera from patients with high anti-α-gal A antibody titers significantly reduced α-gal A activity in Fabry fibroblasts incubated with this mixture and in organs of Fabry mice injected with this mixture. Importantly, utilizing a higher concentration of agalsidase beta overcame the inhibitory effect of antibodies in the mouse experiment (Ohashi et al. 2008), which is consistent with the clinical data that suggests that the higher dose of 1.0 mg/kg can lead to better outcomes in seropositive patients (Rombach et al.

2012). While the mechanism of antibody-mediated inhibition of α-gal A activity in cells and tissues has not been elucidated, it is possible that antibody binding inhibits uptake into cells and/or enzyme activity in the lysosome after cellular uptake.

Anti-α-gal A IgG antibodies spontaneously decrease or disappear over time in some Fabry disease patients (Eng, Guffon, et al. 2001; Wilcox et al. 2004; Raphael Schiffmann, Ries, et al. 2006;

Banikazemi et al. 2007; Germain et al. 2007; Bénichou et al. 2009; Lubanda et al. 2009; Rombach et al. 2012; Wilcox et al. 2012) (Table 1.4). In other LSDs such as Pompe disease, methotrexate and anti-CD20 have been attempted to decrease the antibody response (Mendelsohn et al. 2009).

Co-injection of α-gal A with methotrexate suppressed the development of IgG antibodies against the enzyme in the Fabry mouse model (R. D. Garman, Munroe, and Richards 2004). However, this has not been translated to a clinical setting.

Aside from the possible detrimental effect that antibodies may have on the efficacy of ERT, it has been suggested that anti-α-gal A antibodies may also affect future second generation α-gal A preparations, chaperone treatment that promotes the stability of the patient’s endogenous mutated

α-gal A or gene therapy for Fabry disease (Rombach et al. 2012).

Antibodies and infusion-associated reactions in ERT

Antibodies can cause infusion-associated reactions such as anaphylaxis (type 1 hypersensitivity response) in protein-based therapies (reviewed by Bigger et al. 2015). To avoid these reactions, the rate of infusion must be decreased or, in more severe cases, patients must be pre-treated with anti-histamines or corticosteroids (reviewed by Bigger et al. 2015). IgE antibodies normally mediate these allergic reactions but this antibody isotype is rarely found in Fabry disease patients receiving ERT (Uma Ramaswami 2011; Bigger, Saif, and Linthorst 2015). In contrast, some studies have shown an association between IgG antibodies and infusion-associated reactions, although not significant (Linthorst et al. 2004; Wraith et al. 2008; Wilcox et al. 2012) (Table 1.4).

On the other hand, Schiffmann et al. (2001) reported no correlation between the two.

1.3.7.5 Chaperone therapy

Given the limited effectiveness of ERT and its prohibitive cost (around $200,000 USD per patient per year), other therapeutic approaches have been explored, such as chaperone therapy. Certain missense mutations of GLA produce catalytically active mutant enzymes that are unstable and degraded in the ER under normal physiologic conditions but can be stabilized by galactose or melibiose. This chaperone activity was demonstrated in lymphoblasts derived from Fabry disease patients with different missense mutations (Okumiya et al. 1995). Every other day infusion of galactose in a patient with a late-onset variant (missense mutation G328R) resulted in an improvement of cardiac function (Frustaci et al. 2001). Similarly, 1-deoxy-galactonojirimycin

(DGJ, migalastat), a potent competitive inhibitor of α-gal A, was found to enhance its activity in

Fabry fibroblasts at concentrations lower than those required for intracellular inhibition (Fan et al.

1999). Migalastat appears to accelerate transport and maturation of the mutant enzyme (Fan et al.

1999). This compound binds to the NH group of the D170 residue of α-gal A (Guce et al. 2011).

It has been proposed that protonation of the carboxylic acid of the aspartic acid at the lower pH of the lysosome reduces binding of α-gal A to migalastat, which would make it a good candidate for a pharmacological chaperone (Guce et al. 2011). Oral administration of migalastat to transgenic mice that overexpress mutant α-gal A increased enzyme activity the heart, kidney, liver and spleen

(Fan et al. 1999; Khanna et al. 2010). Migalastat increased α-gal A activity by at least 50% and reduced Gb3 levels in the blood, skin and kidney of patients with amenable mutations in a phase 2 clinical trial (Germain et al. 2012). Migalastat (Galafold™) has been approved for the treatment of Fabry disease in the European Union in patients with amenable mutations (Markham 2016).

1.3.7.6 Substrate reduction

Inhibitors of GlcCer synthase are used to decrease the synthesis of GlcCer, the precursor of Gb3

(Fig. 1.2). A number of compounds have been evaluated for various LSDs. N- butyldeoxynojiromycin (NB-DNJ, miglustat, Zavesca™) has been tested in Gaucher disease patients but it is less efficacious than ERT (Cox et al. 2003) and has several side effects (Hollak et al. 2009). This may be caused by its off-target inhibition of other enzymes (Ridley et al. 2013;

Shayman and Larsen 2014). Compounds based on 1-phenyl-2-palmitoylamino-3-pyrrolidino-1- propanol (P4), including EtDO-P4 (eliglustat tartrate, Cerdelga™), were shown to reduce Gb3 levels in lymphocytes derived from Fabry disease patients (Abe, Arend, et al. 2000) and in the kidneys of the Fabry disease mouse model (Abe, Gregory, et al. 2000; Marshall et al. 2010). A novel GlcCer inhibitor with access to the CNS has been shown to reduce Gb3 levels in the kidney and CNS of the Fabry mouse model more efficiently than ERT, but not in other organs (Ashe et al. 2015). Importantly, as ERT and GlcCer inhibitors have different mechanisms of action, treating animals with both drugs resulted in the greatest Gb3 reduction in all organs tested (Ashe et al.

2015). Thus, is has been proposed that combining ERT and substrate reduction therapy may have complementary and additive benefits in Fabry disease patients, but this has not been clinically evaluated.

1.3.7.7 Chronic plasmapheresis

Chronic plasmapheresis aims to deplete the accumulated substrates from the circulation before their deposition in the vasculature. Despite reducing circulating Gb3 to normal levels, it returned to pre-treatment levels 5 days after a 6-month period of chronic plasmapheresis (Pyeritz et al. 1980;

Moser et al. 1980). There have been no further reports of this strategy.

1.3.7.8 Fetal liver transplantation

Fetal liver transplantation has been performed in three Fabry disease patients in an attempt to replace the deficient enzyme by introducing cells with normal α-gal A activity (Touraine et al.

1979). Following transplantation, α-gal A levels in serum and leukocytes were unchanged

(Touraine et al. 1979). However, patients noted subjective improvement in some clinical manifestations including increased sweating, reduced acroparesthesias and slightly decreased angiokeratoma (Touraine et al. 1979). Substrate levels in serum and urine were slightly decreased

(Touraine et al. 1979). There have been no further reports of this therapeutic avenue.

1.3.7.9 Bone marrow transplantation

To date, there are no reports of bone marrow transplantation in Fabry disease patients. However, normal murine bone marrow has been transplanted into α-gal A-deficient mice (Ohshima et al.

1999; Yokoi et al. 2011). A reduction of Gb3 in the liver, spleen, heart, and lung, but not in the kidney, was observed (Ohshima et al. 1999; Yokoi et al. 2011).

1.3.7.10 Gene therapy

Fabry disease is an ideal candidate for gene therapy. It is a monogenic disease and the α-gal A that is expressed by transduced cells can be secreted and subsequently taken up by unmodified bystander cells via M6P receptor, a process named metabolic co-operativity or cross-correction

(Medin et al. 1996). The first studies on gene therapy for Fabry disease utilized onco-retroviral vectors to deliver the coding sequence of GLA to Fabry patient-derived bone marrow and CD34+ hematopoietic progenitor cells (Toshihiro Takenaka, Hendrickson, et al. 1999; Takiyama et al.

1999). Subsequent animal studies demonstrated that allogeneic transplantation of retrovirally

66 transduced bone marrow cells leads to long-term expression and secretion of α-gal A (Toshihiro

Takenaka, Qin, et al. 1999) and to Gb3 reduction in plasma, peripheral blood mononuclear cells

(PBMCs), liver, spleen, heart, lung and kidney in Fabry mice (T. Takenaka et al. 2000). A pre- selection strategy using a retroviral vector was also tested and it led to enhanced α-gal A activity in plasma and most organs tested (Qin et al. 2001). Despite these positive results, retroviral vectors have rarely been used in the last decade because they have two major disadvantages: first, they are genotoxic as they tend to integrate close to genes involved in cell growth and proliferation (Hacein-

Bey-Abina et al. 2003; Trobridge 2011). Secondly, they have a limited ability to transduce only dividing cells (Dorrell et al. 2000). This makes transduction of hematopoietic stem cells (HSCs) difficult because it requires longer culture times and transient activation of the cell cycle, which lowers engraftment potential and longevity. In fact, a clinical trial for Fabry disease using a retroviral vector was approved in 2000 but was later withdrawn (reviewed by Ruiz de Garibay,

Solinís, and Rodríguez-Gascón 2013).

With the use of HIV-1-derived, replication-incompetent and self-inactivating lentiviral vectors

(LVs), the limitations of onco-retroviral vectors appear to have been overcome. LVs do not show preferential integration near genes important for cell growth and proliferation (Schröder et al.

2002; Montini et al. 2006; Arumugam et al. 2009; Ronen et al. 2011). In addition, LVs require shorter transduction times and do not require target cells to be cycling because of their viral accessory proteins and nuclear localization signals (Gothot et al. 1998; Miyoshi et al. 1999; Dorrell et al. 2000; Guenechea et al. 2000; Barrette et al. 2000). In 2003, fibroblasts from Fabry disease patients were transduced with a LV encoding the α-gal A transgene, which led to the clearance of

Gb3 deposits (D’Costa et al. 2003). Both in vivo and ex vivo studies utilizing a LV have shown a long-term increase in α-gal A activity and Gb3 reduction in relevant organs (Yoshimitsu et al.

2004; Yoshimitsu et al. 2007). Recently, our laboratory transduced CD34+ cells from a Fabry

67 disease patient with a clinical LV to assess the safety and therapeutic effects in vitro and in vivo

(A. Khan et al., manuscript in preparation). Furthermore, a clinical trial utilizing this LV for gene therapy of Fabry disease patients is currently under way (ClinicalTrials.gov identifier:

NCT02800070).

Adenoviral vectors have also been tested in the context of Fabry disease. These vectors can infect both dividing and non-dividing cells and the adenoviral genome does not integrate into the host but remains episomal. Direct injection of adenoviral vectors into Fabry mice has resulted in a transient increase in α-gal A activity (R. J. Ziegler et al. 1999; Passineau et al. 2011). Drawbacks of adenoviral vectors include their triggering of a potentially strong immune response that would require an immunosuppressive regime, and the high number of viral particles needed to achieve an efficient transfection. These characteristics have hindered the clinical feasibility of adenoviral vector-mediated gene therapy.

Vectors derived from adeno-associated viruses (AAVs), in contrast, have been shown to persist for long periods of time in the liver, muscle and other organs without causing toxic effects

(reviewed by Gonçalves 2005). In the first gene therapy studies for Fabry disease, AAV vectors were injected systemically (Park et al. 2003), into the hepatic portal vein (Jung et al. 2001) or the quadriceps (Takahashi et al. 2002) of Fabry mice. α-gal A activity remained increased for 6 months in several tissues and there was a reduction in Gb3 levels in relevant organs. No signs of immune response or liver toxicity were observed in either case. These results were further improved with the use of an AAV8 vector directed to the liver (Robin J. Ziegler et al. 2007), probably because the capsid of the AAV serotype 8 is superior at infection of mouse hepatocytes (Gao et al. 2006).

A study using an AAV1 vector systemically demonstrated that a greater therapeutic benefit is obtained when treating neonatal Fabry mice (Ogawa et al. 2009), possibly because induction of

tolerance is facilitated and because organ damage caused by Gb3 accumulation is prevented.

Systemic injection of an AAV 2/8 vector, which encodes the capsid of AAV8, led to an increase in α-gal A activity similar to wild-type levels for 60 weeks post-treatment (J.-O. Choi et al. 2010).

Importantly, Gb3 reduction was similar to that of mice that received ERT in all tissues examined and it was greater in the kidneys. However, the positive results seen in mice have not translated to larger animal models. The AAV8 hepatocyte-specific vector has been tested in non-human primates (Hurlbut et al. 2010). It is believed that pre-existing anti-AAV8 antibodies reduced the amount of viral particles that reached the liver. Even though significant viral copy number was achieved when the viral dose was increased, there was not adequate expression of the transgenic

α-gal A to be clinically relevant. However, humoral immune tolerance was achieved, which led the authors to suggest that this may be a strategy for immune tolerization prior to ERT (Nietupski et al. 2011).

Gene therapy for Fabry disease has also been attempted utilizing non-viral vectors. Vectors and routes of administration used include naked plasmids delivered intramuscularly (Lavigne et al.

2005) or by retrograde renal vein injection (Nakamura et al. 2008), cationic liposomes (Novo et al. 1997; Przybylska et al. 2004) and Lipofectin (Estruch et al. 2001). These methods have yielded, at best, a moderate and short-term increase in α-gal A activity, as well as a minimal effect in Gb3 levels. A study showed that additional doses of a cationic lipid vector can enhance levels and duration of α-gal A expression and Gb3 reduction in most tissues, although not in the kidneys

(Przybylska et al. 2004). Other vectors such as solid lipid nanoparticles are currently being explored to treat Fabry disease (Ruiz De Garibay et al. 2015), but the low transfection efficiency of non-viral vectors remains a major limitation.

Chapter 2

Research Aims

To date, the preferred treatment for Fabry disease consists of the intravenous infusion of recombinant human α-gal A to supplement the deficiency of this enzyme. Development of circulating IgG antibodies against this recombinant α-gal A is common among Fabry disease patients receiving ERT, occurring in 11 to 91% of male patients, an incidence that appears to depend greatly on the enzyme preparation (agalsidase alfa or beta) that the patient is treated with

(J. T. R. Clarke et al. 2007; Germain et al. 2007).

Thus far, there is conflicting evidence regarding the possible effect these antibodies may have on important biomarkers of Fabry disease such as plasma Gb3 or lyso-Gb3 (Eng, Banikazemi, et al.

2001; Wilcox et al. 2004; Hughes et al. 2008; Anouk C. Vedder et al. 2008; Wraith et al. 2008;

Anouk C. Vedder et al. 2007; van Breemen et al. 2011; Rombach et al. 2012; Wilcox et al. 2012) and urinary Gb3 (Raphael Schiffmann, Ries, et al. 2006; Ohashi et al. 2007; Anouk C. Vedder et al. 2007; Hughes et al. 2008; Anouk C. Vedder et al. 2008; Lubanda et al. 2009; Rombach et al.

2012). Nevertheless, there is a concern that these antibodies may have the potential to reduce the efficacy of ERT as they have been shown to bind to α-gal A in the circulation (Linthorst et al.

2004), to inhibit uptake of α-gal into cells in vitro and in an animal model (Ohashi et al. 2008), and to inhibit enzyme activity in vitro (Linthorst et al. 2004; Ries et al. 2006; Ries et al. 2007;

Ohashi et al. 2008). In addition, it is possible that anti-α-gal A antibodies generated against agalsidase alfa or beta affect future second generation α-gal A preparations, chaperone treatment that promotes the stability of the patient’s endogenous mutated α-gal A or gene therapy for Fabry disease. For these reasons, anti-α-gal A IgG antibodies are routinely monitored in many on-going

69 70

ERT clinical trials such as the Canadian Fabry Disease Initiative (ClinicalTrials.gov identifier:

NCT00455104).

With this in mind, the aims of this thesis were: (1) to develop an ELISA protocol to measure the levels of anti-α-gal A IgG antibodies in the serum of Fabry disease patients and (2) to purify a human α-gal A that can be used in the future to titer anti-α-gal A IgG antibodies. Because the α- gal A used as antigen in our ELISA was a gift from Dr. Roscoe Brady, we sought to purify our own human α-gal A for future antibody titering. Agalsidase alfa and beta are expressed and purified from the culture medium of CHO cells and human fibroblasts, respectively (Lee et al.

2003). Because glycosylation patterns affect the antigenicity of recombinant proteins (Brooks

2004), we sought to purify a human α-gal A with human post-translational modifications.

Therefore, we chose to express our enzyme in human embryonic kidney (HEK) 293T cells. We utilized the PiggyBac™ transposon system to generate a stable cell line that overexpresses a his- tagged human α-gal A. We then optimized an affinity chromatography protocol and characterized the product obtained. Finally, we showed that our purified α-gal A is bound by antibodies present in seropositive patients and not by those present in healthy individuals, which suggests that it may be suitable to use as antigen in our ELISA to measure anti-α-gal A antibody levels.

Chapter 3

Development of an ELISA to Measure Anti-α-Galactosidase A IgG

Antibodies and Purification of a Recombinant Human α-

Galactosidase A from a Stable Overexpressing Human Cell Line

3.1 Materials and methods

3.1.1 Samples from Fabry disease patients

Ten mL of blood were drawn from five healthy controls and 49 male Fabry disease patients. Blood was collected in EDTA-coated tubes, plasma was separated from cells by centrifugation at 1377 x g for 5 minutes at room temperature and subsequently aliquoted. Aliquots to be used in the immediate future were stored at 4 °C and the rest were stored at -80 °C. LVH was determined by

MRI. Samples and patient information were collected in accordance with a protocol approved by the University Health Network Research Ethics Board. The data were kept anonymous.

3.1.2 Anti-human α-gal A IgG antibodies ELISA

Microtiter plates (Immulon 2 HB clear flat-bottom 96-well plates, Thermo Scientific, #3455) were coated with a recombinant human α-gal A purified from the supernatant of CHO cells (a gift from

Dr. Roscoe Brady) at 1 μg/mL in 1X phosphate-buffered saline (PBS; Bioshop, #PBS404) overnight at room temperature. Wells were washed three times with 200 μL of PBS-T (PBS +

0.05% Tween 20) and blocked with blocking buffer (PBS-T + 5% bovine serum albumin) for 2 hours at room temperature. Wells were washed three times and Fabry patients’ sera diluted in blocking buffer were added and incubated overnight at room temperature. Wells were washed six times and goat anti-human IgG Fc conjugated to HRP (1:1000; Chemicon, #AP113P) was added

71 72 and incubated for 45 minutes at room temperature. Wells were washed five times and substrate solution (TMB Substrate, Cell Signaling Technology, #7004) was added. The reaction was stopped by adding 1 M HCl and absorbance at 450 nm was measured on a BioTek ELx800 Absorbance

Reader (BioTek Instruments Inc., Winooski, VT, USA). Serum of a healthy donor, serially diluted, was used to generate a standard curve and antibody levels were calculated as the fold-change in absorbance over the healthy donor. In each plate, serum from at least one other healthy donor was run as negative control. Each sample was run in triplicate and in two or more independent experiments. Samples with an average minus standard deviation (SD) fold-change ≥ 2 were considered positive for anti-α-gal A IgG antibodies. Samples with an average minus standard deviation fold-change ≤ 2 were considered negative for anti-α-gal A IgG antibodies.

3.1.3 Cloning of the GLA cDNA into the PiggyBac™ plasmid

The cDNA of the human GLA gene and a truncated sequence consisting of base pairs 1-300, both with a 6 histidine tail (6xHis) sequence (CATCATCACCACCACCAT) on the C-terminus, were synthesized and cloned into pUC57 by GenScript. They were then cloned into the PiggyBac™

Transposon Vector System plasmid PB513B-1 (System Biosciences, Inc.) downstream of the

CMV promoter, yielding PB513B-1.α2 and PB513B-1.f1, respectively. PB513B also contains the puromycin resistance and GFP genes. The cloned genes were confirmed by sequencing the plasmids at the Centre for Applied Genomics, Sick Kids.

3.1.4 Generation of the α-gal A-overexpressing HEK293T cell line

HEK293T cells cultured in DMEM (Gibco®, Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco®, Life Technologies, # 16000044) and 1X penicillin-streptomycin- glutamine (PSQ; Gibco®, Life Technologies, #10378016) were grown to 60-80% confluency and

73 co-transfected with the Super PiggyBac transposase expression vector (PB210PA-1, System

Biosciences, Inc.) and either PB513B-1.α2 or PB513B-1.f1 in a 1:2.5 ratio as indicated by the manufacturer. Transfection control cells (not transfected or NT) were only transfected with

PB210PA-1. Cells were split the next day and 1, 2, 3, 5 or 10 µg/mL puromycin was added to the medium. Optimal dose for selection was determined as the highest dose that allowed some of the clones transfected with both plasmids to grow whilst killing all the NT cells (3 µg/mL). Selection was always applied thereafter.

3.1.5 Flow cytometry

Cells were collected 23 days post-transfection and under selection at 3 µg/mL puromycin (or no selection in the case of the NT cells) to assess GFP expression by flow cytometry. They were detached with 0.05% trypsin (Gibco®, Life Technologies, #25300054), washed with 1X PBS and resuspended in FACS buffer (PBS, 2% FBS, 1 mmol/L ethylenediaminetetraacetic acid, 0.1%

NaN3). GFP expression was assessed by flow cytometry using a FACSCalibur machine (BD

Biosciences, Franklin Lakes, NJ, USA) and results were analyzed with the CellQuestPro and

FlowJo softwares.

3.1.6 DNA sequencing gDNA was isolated from 2x106 cells using the Gentra Puregene Cell Kit (Qiagen, #158745) as per the manufacturer’s instructions. The integrated sequences of the transgenes were confirmed by sequencing at the Centre for Applied Genomics, Sick Kids, utilizing the sets of primers

CCATCCACGCTGTTTTGACC and GCTTCCCTGGGAGTTTTGGATA;

GCAAAGGACTGAAGCTAGGGA and AGCAAGTAACTCAGATGGCCC; and

GATTGGCAACTTTGGCCTCA and TAAATCGGATCCGCGGCC.

3.1.7 α-gal A enzyme activity assay and BCA protein assay

To measure α-gal A activity, 1x106 cells were plated in a 6-well plate. After culture overnight, culture supernatant was collected and cells were trypsinized and washed with PBS. Cells were counted and 1x106 cells were resuspended in cell homogenization buffer (CHB; 28 mM citric acid,

44 mM disodium phosphate, 5 mg/mL sodium taurocholate, pH 4.4). Cells were lysed by freezing and thawing at 37 °C 6 times. After centrifugation at 13,000 rcf for 10 min, the cell lysate was collected and used in the enzyme activity assay. Culture supernatant and cell lysate samples were diluted as necessary in CHB, added to a Microfluor® 2 plate (Thermo Scientific, #7905) and incubated with 5 mM 4-methylumbelliferyl-α-D-galactopyranoside (RPI, Mount Prospect, IL) in presence of the α-N-acetylgalactosaminidase inhibitor, N-acetyl-D-galactosamine (100 mM;

Sigma, Oakville, Ontario, Canada), for 2 hours at 37 °C. The reaction was stopped by addition of stop solution (1.1 M glycine, 0.1 M NaOH, pH 10) and fluorescence (excitation 350 nm, emission

460 nm) was measured in a fluorometer (type 374 MFX, Dynex Technologies). The 4- methylumbelliferone product was quantified by comparison with standards of known concentration. Activity in the cell lysate was normalized to protein amount. Protein concentration was measured using the BCA Protein Assay Kit (Pierce™, Thermo Scientific™, #23225) as per the manufacturer’s instructions.

3.1.8 SDS-PAGE and Western blot

Proteins were visualized by 12% SDS-polyacrylamide gel electrophoresis (PAGE) silver-stained with the Pierce® Silver Stain Kit (Thermo Scientific, #24612) as per the manufacturer’s instructions. The proteins separated on a gel were electroblotted onto a polyvinylidene difluoride

(PVDF) transfer membrane (Thermo Scientific, #88518). The membrane was blocked with 1X

Tris-buffered saline (TBS), 0.05% Tween 20 (Bioshop, #TWN510) and 5% milk (Bioshop,

#SKI400) for 1 hour at room temperature or overnight at 4 °C. The membrane was then incubated with an anti-human α-gal A antibody (1:1,666; Thermo Scientific, #PA5-13687), an anti-His antibody conjugated to HRP (1:2,500; Thermo Scientific, #MA1-21315-HRP) or human serum

(1:500-1:1000) overnight at 4 °C. Anti-α-gal A antibody incubation was followed by incubation with goat anti-rabbit IgG antibody conjugated to HRP (1:2,500; Sigma-Aldrich, #A6154) for 1 hour at room temperature. Human serum incubation was followed by incubation with goat anti- human IgG Fc conjugated to HRP (1:1000; Chemicon, #AP113P) for 1 hour at room temperature.

Signal was developed with the SuperSignal® West Pico Chemiluminiscent Substrate (Thermo

Scientific, #34087).

3.1.9 Cell and culture supernatant collection and processing for α-gal A

purification

Thirty 15-cm cell culture dishes (Corning, #353025) were seeded with 12.5x106 α2 cells in DMEM supplemented with 4-10% FBS, 1X PSQ and 3 µg/mL puromycin. Culture supernatant was collected 2 days later and filtered with a 0.22 μm Stericup (EMD Millipore, #SCGPU05RE) on ice. Filtered supernatant was either used for chromatography immediately or stored at -80 °C. Cells that were used to seed new plates were washed with 1X PBS and trypsinized as previously described, whilst the rest were washed with 1X PBS and incubated with 500 μL per plate of M-

PER® Mammalian Protein Extraction Reagent (Thermo Scientific, #7850) and 1X Halt™ Protease

Inhibitor Cocktail, EDTA-free (Thermo Scientific, #87785) for 5 minutes at 4 °C. They were then scraped off the plates with a cell scraper and centrifuged at 14,000 x g for 10 minutes. The supernatant obtained was collected and either used for chromatography immediately or stored at -

80 °C.

3.1.10 Ni-NTA chromatography

Culture supernatant collected from 30 150 mm cell culture dishes (approximately 500 mL) was mixed in a 1 L glass bottle with an equal volume of washing buffer: 50 mM Tris-HCl, 500 mM

NaCl and 50 mM imidazole (Sigma, #I5513), pH 7.5, for a final concentration of imidazole of 25 mM. All nickel-charged beads from the HisPur™ Ni-NTA Purification Kit (Thermo Scientific,

#88229) equilibrated with washing buffer were added to the supernatant-washing buffer mixture.

This was incubated at 4 °C on an end-over-end rocking platform overnight. The bottle was then set down on a flat surface at 4 °C for 2-3 hours to allow the beads to collect at the bottom. The top

900 mL were removed from the bottle and the remaining 100 mL that contained the beads were loaded onto the chromatography column, which was centrifuged at 700 x g for 2 minutes at 4 °C.

The column was washed with 6 mL washing buffer until protein concentration in the wash fractions reached 0.00 mg/mL as measured by spectrophotometry (NanoDrop 1000, Thermo

Scientific) at 280 nm (typically 3-4 washes). His-tagged α-gal A was then eluted with 3 mL elution buffer (250 mM imidazole, 1X PBS) until protein concentration in the elution fractions reached

0.00 mg/mL (typically 3-4 elutions).

When using cell lysate as protein source, it was loaded into the equilibrated chromatography column and incubated at 4 °C for 30 minutes. The column was centrifuged at 700 x g for 2 minutes at 4 °C and loaded again. This was repeated until all the cell lysate volume was used. The column was washed and the enzyme eluted as described for culture supernatant.

3.1.11 Desalting and concentrating the purified α-gal A

A Zeba Spin Desalting Column with a 7 kDa molecular weight cutoff (Thermo Scientific, #89893) was used as indicated by the manufacturer to remove the highly concentrated imidazole from the

77 elution buffer. Immediately after desalting, an Amicon® Ultra-15 Centrifugal Filter Device with a 30 kDa molecular weight cutoff (EMD Millipore, #UFC9030) was used to concentrate the sample by centrifuging at 3,900 x g for 10 minutes at 4 °C.

3.1.12 De-glycosylation with PNGase F

Three µg of glycoprotein were de-glycosylated using PNGase F (New England Biolabs, #P074S) as indicated by the manufacturer.

3.1.13 Statistical methods

Differences in age were analyzed using a two-tailed t-test. Differences in development of antibodies between agalsidase preparations, mutation type or presence of left ventricular hypertrophy were analyzed using a Chi-square test. Antibody levels and mutation type or presence of LVH, as well as antibody development and serum creatinine levels were analyzed using Mann-

Whitney Test. The R2 value was calculated to correlate antibody levels and serum creatinine levels.

α-gal A activity levels between cell lines were compared by a two-tailed t-test. These analyses were performed in GraphPad Prism v6.01.

3.2 Results

3.2.1 Anti-α-gal A IgG antibody levels

We used the α-gal A gifted to our lab by Dr. Brady as antigen to measure the levels of anti-human

α-gal A IgG antibodies in the serum of Fabry disease patients by ELISA. As part of the validation of this protocol, the ERT status of these patients was only disclosed after analysis. Therefore, antibody levels in ERT-naïve patients and in healthy individuals were also assayed. As shown in

Table 3.1, all 13 patients that had not received ERT, except for patient 26, tested negative by our protocol. In addition, all 5 healthy individuals also tested negative (data not shown).

Overall, 61% of patients on ERT were seropositive in this study. Age was not significantly different between seropositive and seronegative patients that received ERT (mean of 46 and 47 years, respectively). 58% of patients on agalsidase alfa were seropositive while 80% of patients on agalsidase beta were seropositive (Fig. 3.1.a). Age was not significantly different between the two groups (mean of 46 and 49 years, respectively). There was no correlation between agalsidase preparation and development of anti-α-gal A antibodies. However, it must be noted that the sample size of patients on agalsidase beta was small (n = 5). Similarly, there was no correlation between mutation type and development of antibodies (Fig. 3.1.b) or antibody levels (Fig. 3.1.c).

Neither development of antibodies or antibody levels appeared to have an effect in development of LVH (Fig. 3.2.a-b). There was a tendency for serum creatinine levels to be higher in seropositive patients compared to seronegative patients but it was not significant (Fig. 3.2.c). Antibody levels and serum creatinine levels did not correlate (Fig. 3.2.d).

Table 3.1. Age, mutation, ERT status, anti-human α-gal A IgG antibodies levels, serum creatinine levels and presence of left ventricular hypertrophy in Fabry disease patients.

Patient Age Mutation Mutation type ERT status Antibody levels Antibody Left Serum (fold-change status ventricular creatinine mean ± SD) hypertrophy (µmol/L)

1 36 g.639+919G>A Intronic variant No 2.47 ± 0.73 ‒ N/A 57

2 20 774_775delAC Deletion Agalsidase alfa 23.71 ± 2.51 + No 73

3 20 774_775delAC Deletion Agalsidase alfa 53.43 ± 5.49 + N/A 69

4 28 774_775delAC Deletion Agalsidase alfa 5.96 ± 0.17 + N/A 55

5 23 774_775delAC Deletion Agalsidase alfa 2.53 ± 0.40 + N/A 95

6 50 774_775delAC Deletion Agalsidase alfa 1.60 ± 0.49 ‒ N/A 192

7 47 p.N215S Missense No 1.57 ± 0.43 ‒ N/A 74

8 55 p.N215S Missense Agalsidase alfa 1.42 ± 0.31 ‒ No 99

9 51 p.N215S Missense No 2.26 ± 0.55 ‒ N/A 64

10 48 p.Q386* Nonsense No 1.61 ± 0.42 ‒ No 59

11 34 p.L129P Missense Agalsidase beta 11.68 ± 0.67 + No 65

12 39 p.N215S Missense Agalsidase beta 1104.21 ± 98.67 + N/A 143

79 80

13 59 p.W81* Nonsense Agalsidase alfa 2.23 ± 0.22 + N/A 90

14 28 p.W81* Nonsense Agalsidase beta 0.60 ± 0.07 ‒ No 58

15 41 c.956T>C Not reported No 1.32 ± 0.12 ‒ No 98

16 44 p.S87* Nonsense No 0.43 ± 0.04 ‒ N/A 69

17 79 p.N215S Missense Agalsidase beta 69.66 ± 6.56 + N/A 93

18 34 p.A143P Missense No 1.10 ± 0.52 ‒ N/A 47

19 44 c.621DupT Duplication Agalsidase alfa 2.44 ± 0.26 + No 60

20 57 p.A285D Missense Agalsidase alfa 19.14 ± 1.91 + N/A 127

21 69 p.N215S Missense Agalsidase alfa 2.07 ± 0.84 ‒ Yes 69

22 28 p.A285D Missense Agalsidase alfa 1.32 ± 0.11 ‒ No 69

23 59 g.639+919G>A Intronic variant Agalsidase alfa 1.73 ± 0.34 ‒ Yes 95

24 56 p.A285D Missense Agalsidase alfa 3.67 ± 0.08 + N/A 389

25 48 c.1046G>A Not reported Agalsidase alfa 57.02 ± 6.74 + Yes 355

26 27 c.1046G>A Not reported No 6.82 ± 3.20 + N/A 67

27 68 p.A143P Missense Agalsidase alfa 3.73 ± 0.78 + No 70

28 64 c.266T>C Not reported Agalsidase beta 4.71 ± 0.34 + Yes 61

29 67 1000-2A>G Not reported Agalsidase alfa 1.04 ± 0.35 ‒ Yes 101

30 31 1000-2A>G Not reported No 0.90 ± 0.17 ‒ N/A 60

31 55 c.266T>C Not reported Agalsidase alfa 8.51 ± 0.84 + N/A 254

32 51 c.962A>T Not reported Agalsidase alfa 0.60 ± 0.10 ‒ Yes 67

33 53 p.R342Q Missense Agalsidase alfa* 252.88 ± 5.58 + Yes 89

34 26 962A>T Not reported Agalsidase alfa 1.88 ± 0.70 ‒ No 69

35 40 p.I319T Missense Agalsidase alfa* 0.33 ± 0.03 ‒ N/A 256

36 52 p.A143P Missense Agalsidase alfa 0.29 ± 0.05 ‒ No 77

37 75 p.Q386* Nonsense Agalsidase alfa* 4.03 ± 0.38 + N/A 73

38 31 p.A285D Missense Agalsidase alfa 3.39 ± 0.15 + N/a 1152

39 49 p.Q386* Nonsense Agalsidase alfa 3.81 ± 0.64 + Yes 74

40 20 p.A285D Missense Agalsidase alfa 5.91 ± 0.30 + N/A 65

41 45 p.H125P Missense Agalsidase alfa 0.69 ± 0.14 ‒ No 68

42 33 p.N215S Missense No 0.57 ± 0.13 ‒ No 67

43 54 p.I91T Missense No 0.54 ± 0.10 ‒ No 457

44 28 p.A285D Missense Agalsidase alfa 0.75 ± 0.29 ‒ N/A 66

45 37 p.A143P Missense Agalsidase alfa 51.76 ± 0.92 + No 69

46 63 g.639+919G>A Intronic variant Agalsidase alfa 0.79 ± 0.15 ‒ Yes 82

47 44 p.W81* Nonsense Agalsidase alfa 159.37 ± 2.83 + N/A 122

48 30 p.R100K Missense No 0.45 ± 0.13 ‒ N/A 76

54 53 g.136C>T Intronic variant No 0.21 ± 0.06 ‒ N/A 57

* These patients were on agalsidase beta in the past and switched to agalsidase alfa.

Figure 3.1. Incidence of antibodies by agalsidase preparation and no correlation between mutation type and antibody levels or development of antibodies. (a) Number of seropositive and seronegative patients on agalsidase alfa or beta. (b) Number of patients on ERT that have missense or nonsense mutations and their anti-α-gal A antibody status. (c) Antibody levels, expressed as the mean minus standard deviation of fold-change over the standard (a healthy individual), of each patient with a missense or nonsense mutation receiving ERT. The dotted line marks the cutoff value for seropositivity.

83 84

Figure 3.2. No correlation between left ventricular hypertrophy or serum creatinine levels and development of antibodies or antibody levels. (a) Number of seropositive or seronegative patients on ERT that present or do not present left ventricular hypertrophy. (b) Antibody levels in patients on ERT that present or do not present left ventricular hypertrophy. (c) Serum creatinine levels in seropositive and seronegative patients on ERT. (d) Serum creatinine levels compared to antibody levels in patients on ERT. The dotted line marks the cutoff value for seropositivity. LVH: left ventricular hypertrophy.

Having developed an ELISA protocol to measure the levels of anti-α-gal A IgG antibodies in Fabry disease patients, we sought to generate our own α-galactosidase A in order to have an in-house source of antigen for this assay. With this in mind, we chose to express the human α-gal A in a human cell line: the human embryonic kidney (HEK) 293T cell line.

3.2.2 Generation of the his-tagged-α-gal A-overexpressing HEK 293T cell

line

Twenty-three days after transfection with the plasmids from the PiggyBac system, 84% of cells transfected with the full-length cDNA of α-gal A (α2 cells) and 86% of cells transfected with the truncated α-gal A (f1 cells) cultured with puromycin were GFP-positive (Fig. 3.3.a), indicating stable integration and expression from the vectors. Sequencing confirmed integration of the α-gal

A-6xHis cDNA in α2 cells and of the truncated sequence in f1 cells. Intracellular α-gal A enzyme activity was 3.6 times higher in α2 cells than in f1 cells and 3.8 times higher than in NT cells, whilst in the culture supernatant it was 13.7 times higher in α2 cells than in f1 cells and 48 times higher than in NT cells (Fig. 3.3.b). Intracellular overexpression of α-gal A by α2 cells compared to NT cells was also demonstrated by Western blot (Fig. 3.3.c).

3.2.3 Evaluation of α-gal A purification: intracellular vs secreted

Given that α-gal A activity was increased in both the cell lysate and the culture supernatant of α2, both were tested as sources to purify the his-tagged α-gal A from by affinity chromatography.

SDS-PAGE indicated that the purification product from the culture supernatant appeared to have fewer contaminants (Fig. 3.4) and this source was used henceforth.

3.2.4 Optimization of growth conditions for α-gal A purification from culture

supernatant

We sought to reduce FBS content in the culture medium of α2 cells in order to reduce contaminants in the α-gal A preparation. FBS in the growth medium of α2 was progressively reduced from 10% to 7.5%, then to 5% and finally to 4%. Each adaptation step except for the first lasted

86 approximately 3 to 4 months. As evidenced in Fig. 3.5.a, culture supernatant from α2 cells grown with 4% FBS has visibly fewer proteins than that of α2 cells grown with 10% FBS. Importantly, adapting the cells to grow in less FBS did not reduce their capacity to secrete α-gal A to the culture supernatant, which was verified at each adaptation step (Fig. 3.5.b).

3.2.5 Purification of his-tagged α-gal A from culture supernatant with a

nickel-charged column

α2 cells adapted to grow in 4% FBS were seeded at 12.5x106 cells per dish in 30 15-cm cell culture dishes. After 2 days in culture, supernatant (approximately 500 mL) was collected and cell debris was filtered out at 4 °C. It was either used for chromatography immediately or stored at -80 °C for future use. It was mixed with an equal volume of washing buffer containing 50 mM imidazole, for a final concentration of 25 mM. Nickel-charged beads, equilibrated with washing buffer, were added to the supernatant-washing buffer mixture and this was incubated at 4 °C with gentle rocking overnight. Allowing the beads to collect at the bottom of the bottle permitted the removal of most of the supernatant from the top (approximately 900 mL). The remaining volume containing the nickel-charged beads and the his-tagged enzyme was loaded into the chromatography column.

After flow-through was collected, the column was washed with washing buffer and the his-tagged

α-gal A was eluted with elution buffer containing 250 mM imidazole. Some of the enzyme leaked out of the column in the flow-through and the washes (Fig. 3.6, lanes 1-5) but the his-tagged α-gal

A was more concentrated in the first two elution fractions (Fig. 3.6, lanes 6-7).

Figure 3.3. Characterization of the his-tagged α-gal A-overexpressing HEK 293T cell line (α2). (a) GFP expression in HEK293T cells transfected with PB513B-1.α2 and PB513B-1.f1 compared to non- transfected cells 23 days post-transfection assessed by flow cytometry. (b) α-gal A activity was analyzed

88 intracellularly and in the culture supernatant of α2 cells, f1 cells and NT cells. In each experiment, the same number of cells were plated for each cell line, cells were cultured for the same length of time, samples were collected simultaneously and α-gal A activity was determined in the same assay. Data represent mean ± SEM (n = 2-3). *P < 0.05, **P < 0.01, ***P < 0.001. (c) Samples were obtained lysing the same number of cells in the same volume of lysis buffer and the same volume of each was run in a 12% gel. The membrane was stained with an anti-human α-gal A antibody. α2: HEK 293T cells transfected with a plasmid containing the full cDNA sequence of α-gal A; f1: HEK 293T cells transfected with a plasmid containing a truncated cDNA sequence of α-gal A; GFP: green fluorescent protein; NT: HEK 293T cells not transfected.

Figure 3.4. Purity of his-tagged α-gal A purified from cell lysate or culture supernatant. Samples were taken from the pooled elution fractions of chromatography performed on each source of protein. SDS- PAGE (12%) was performed and the gel was visualized by silver stain. CL: cell lysate; sup: culture supernatant.

Figure 3.5. Adaptation to grow with less FBS did not reduce production of α-gal A by α2 cells while decreasing protein contaminants. (a) The same volume of culture supernatant obtained from growing the

90 identical number of α2 cells for the same length of time was run in a 12% gel and protein was visualized by silver stain. (b) α-gal A activity was analyzed intracellularly and in the culture supernatant of α2 cells adapted to grow with 7.5%, 5% and 4% FBS in the culture medium, and compared to α2 cells that grow with 10% FBS. In each experiment, the same number of cells were plated for each cell line, cells were cultured for the same length of time, samples were collected simultaneously and α-gal A activity was determined in the same assay. Data represent mean ± SEM (n = 2-4). NS: not significant; ***P < 0.001.

Figure 3.6. His-tagged α-gal A present in chromatography fractions. Western blot of fractions of an affinity chromatography performed on 500 mL of culture supernatant from α2 cells adapted to grow with 4% FBS. The same volume of all fractions was run in 12% gels and each membrane was stained with either an anti-human α-gal A (top) or an anti-6xHis (bottom) antibody. Lane 1: culture supernatant used as source for chromatography; lane 2: chromatography flow-through; lanes 3-5: consecutive washes done with washing buffer (50 mM imidazole); lanes 6-8: consecutive elutions done with elution buffer (250 mM imidazole); lane 9: molecular weight marker; lane 10: a mixture of a purified α-gal A (gifted by Dr. Roscoe Brady) and a purified his-tagged protein of ~27 kDa (gifted by Zhenhao Fang from the Ikura Lab).

3.2.6 Characterization of the purified α-gal A

In order to obtain a greater yield, the elution fractions obtained from 8 purifications performed as described were combined into approximately 100 mL. Because a high concentration of imidazole such as the one present in the elution buffer can interfere with the ultrafiltration filter device used to concentrate the sample, we first desalted it using a size-exclusion chromatographic resin to separate proteins from small molecules (smaller than 2 kDa). Immediately after desalting, the enzyme was concentrated using a filter with a molecular weight cut-off of 30 kDa. Desalting and concentrating reduced the sample volume from 100 mL to 4 mL. Protein concentration in this final sample was 0.342 mg/mL as determined by BCA assay, for a yield of 1.368 mg of protein. α-gal

A activity in this sample was determined to be 969.78 nmol/h/mg.

This sample was visualized on an SDS-PAGE as a thicker band of approximately 55 kDa, a size that corresponds with the denatured α-gal A (Fig. 3.7, lane 1). This band is also present in the α- gal A preparation used in our ELISA (Fig. 3.7, lane 3). Our preparation had a few, fainter other bands, mostly of greater molecular weight. We also confirmed that our purified α-gal A was N- glycosylated because treatment with PNGase F, which cleaves the innermost GlcNAc of high mannose, hybrid and complex oligosaccharides from asparagine residues, resulted in a decrease in molecular weight of α-gal A similar to that of the α-gal A gifted to us by Dr. Brady (Fig. 3.7, lanes

2 and 4, respectively).

3.2.7 IgG antibodies from the serum of Fabry disease patients bind to the

purified α-gal A

As a preliminary assessment of the ability of our purified α-gal A to be bound by anti-α-gal A antibodies of Fabry disease patients, the enzyme preparation was blotted against various sera (Fig.

3.8b-c). Six of eight of the seropositive samples tested bound to a protein of ~55 kDa, and 3 of them (33, 40 and 47) also bound to a smaller protein. The fact that commercial antibodies against

α-gal A (Fig. 3.8a) and 6xHis (Fig. 3.6, lanes 6 and 7) both bind to a protein of approximately the same size suggests that this smaller protein may be a partially degraded form of α-gal A. In that case, it would not cause a false positive signal in an ELISA. Antibodies from patient 3 did not bind to our purified α-gal A despite this patient being seropositive. Antibodies from patient 26 bound to a larger protein but not to one of ~55 kDa, which may explain why it generates a positive signal in the ELISA against the α-gal A gifted to us by Dr. Brady even though this patient has not received

ERT. Finally, antibodies from a healthy individual used in the ELISA as a negative control (Neg) did not bind to any protein present in our α-gal A preparation.

Figure 3.7. Homogeneity of purified α-gal A and confirmation of N-glycosylation. The same amount of protein was run in each lane in a 12% SDS-PAGE and visualized by silver stain. Lane 1: α-gal A preparation, desalted and concentrated; lane 2: α-gal A preparation, desalted, concentrated and treated with PNGase F, which has a molecular weight of 36 kDa; lane 3: α-gal A preparation gifted to our lab by Dr. Roscoe Brady; lane 4: α-gal A preparation gifted to our lab by Dr. Roscoe Brady treated with PNGase F; lane M: molecular weight marker.

Figure 3.8. Binding of anti-α-gal A antibodies to purified α-gal A. Western blots in (a), (b) and (c) were performed separately. The same amount of purified α-gal A was run in each lane in a 12% SDS-PAGE and each membrane was stained with either (a) a commercial anti-human α-gal A antibody (Com; 1:1666); (b) serum from a healthy control used as a negative control in the ELISA (Neg), Fabry disease patient 12, 26 and 17 (1:1000); (c) serum from Fabry disease patient 27, 33, 40, 47 and 3 (1:500). M: molecular weight marker.

Chapter 4

General Discussion

4.1 ELISA to measure anti-α-gal A IgG antibodies

One of the aims of this study was to test an ELISA protocol designed to measure anti-α-gal A IgG antibody levels in the serum of Fabry disease patients. In this assay, a purified α-gal A donated to our lab by Dr. Roscoe Brady was used as antigen. Unfortunately, we did not have a recent external assessment of the anti-α-gal A antibody levels of these patients to compare our results to and validate our protocol. Instead, we measured anti-α-gal A antibody levels in all subjects before disclosing whether they were healthy individuals, Fabry disease patients or their ERT status.

Therefore, we were not biased to which subjects could possibly have developed anti-α-gal A antibodies and which could not have. All 5 healthy individuals were determined to be seronegative by our protocol, as well as 11/12 patients that were ERT-naïve. We showed that IgG antibodies in the serum of our only false positive result (patient 26) bind to a protein of ~70 kDa in our own α- gal A preparation and not to one of ~55 kDa corresponding to α-gal A, which the rest of the positive sera tested bound to. It is possible that this protein of ~70 kDa is also present in the α-gal A preparation used in our ELISA and causes a false positive signal with the serum of patient 26.

4.2 Anti-α-gal A antibodies

Another purpose of this study was to evaluate the development of anti-α-gal A IgG antibodies in male Fabry disease patients treated with agalsidase alfa or beta. At the time their blood samples were collected, 61% of these patients had circulating anti-α-gal A antibodies. Most of the patients in this study (31/36) were treated with agalsidase alfa. Comparative studies have shown that

94 95 patients receiving this enzyme preparation develop anti-α-gal A antibodies less often than those treated with agalsidase beta (Anouk C. Vedder et al. 2008; van Breemen et al. 2011; Rombach et al. 2012). Accordingly, we found that 58% and 80% of patients on agalsidase alfa and beta, respectively, developed antibodies. Despite the small number of patients in the agalsidase beta group, the prevalence we observed falls within the range reported by several clinical trials of 47 to

91% (Eng, Guffon, et al. 2001; Eng, Banikazemi, et al. 2001; Wilcox et al. 2004; Linthorst et al.

2004; Banikazemi et al. 2007; Germain et al. 2007; Ohashi et al. 2007; Anouk C. Vedder et al.

2007; Ohashi et al. 2008; Anouk C. Vedder et al. 2008; Wraith et al. 2008; Bénichou et al. 2009;

Lubanda et al. 2009; van Breemen et al. 2011; Rombach et al. 2012; Wilcox et al. 2012). On the other hand, the frequency of patients on agalsidase alfa that developed antibodies (58%) is slightly higher than the highest frequency reported to our knowledge: 57% (Linthorst et al. 2004). It must be noted that 3/31 patients currently receiving agalsidase alfa were treated at some point with agalsidase beta and 2 of them are seropositive. Since anti-α-gal A antibodies generated against either agalsidase have been shown to be cross-reactive (Linthorst et al. 2004), it is possible that these two patients developed antibodies against agalsidase beta before they switched to agalsidase alfa.

Patients with nonsense mutations that result in a truncated α-gal A would be expected to be more likely to develop anti-α-gal A antibodies than patients with missense mutations, as observed in other genetic diseases (Osooli and Berntorp 2015). Because an α-gal A protein with only an amino acid change is structurally more similar to the wild-type protein than a truncated α-gal A, the former would act as CRIM more efficiently than the latter, mediating a greater immune tolerance towards the infused recombinant α-gal A. However, we observed no correlation between mutation type and development of antibodies or antibody levels, although our population of Fabry disease patients with nonsense mutations that were on ERT was small (n = 5). Yet, our results are

96 consistent with those of some clinical trials (Linthorst et al. 2004; Anouk C. Vedder et al. 2008).

Studies have also investigated residual α-gal A activity as a possible predictor of antibody development but results have been contradictory to date (Linthorst et al. 2004; Anouk C. Vedder et al. 2008). This may occur because a mutated α-gal A with no enzymatic activity can nevertheless act as CRIM and induce immune tolerance.

The long-term impact of anti-α-gal A antibodies on major clinical outcomes in Fabry disease patients treated with ERT remains unclear because few studies have explored this. At most, a non- statistically significant tendency for seropositive patients to suffer a clinically relevant event more often than seronegative patients has been reported (Bénichou et al. 2009; Rombach et al. 2012).

Our results indicate that anti-α-gal A antibodies have no effect on the development of left ventricular hypertrophy. This is consistent with a study that found no correlation between development of antibodies and left ventricular mass (Anouk C. Vedder et al. 2008). However, we did not have left ventricular hypertrophy data from 16 out of 36 patients on ERT. Furthermore, it might have been more informative to investigate whether there is a relationship between anti-α- gal A antibodies and left ventricular mass. Because the average age of patients receiving ERT in this study was 47, it is possible that many of the younger patients would not have developed left ventricular hypertrophy yet regardless of treatment while an increase in left ventricular mass could still have been observed. Unfortunately, we did not have this data. On the other hand, we observed a tendency for serum creatinine levels to be higher in seropositive patients but it was not significant. Serum creatinine is a commonly used indicator of renal function. It rises when there is marked nephron damage and is therefore a late marker of kidney disease. As with left ventricular mass, it might have been more useful to look at a marker that can reveal early-stage kidney disease such as estimated glomerular filtration rate. It would also have been interesting to examine the relationship between anti-α-gal A antibodies and urinary Gb3 because the two have commonly

97 been reported to be associated (Raphael Schiffmann, Ries, et al. 2006; Ohashi et al. 2007; Anouk

C. Vedder et al. 2007; Hughes et al. 2008; Anouk C. Vedder et al. 2008; Lubanda et al. 2009;

Rombach et al. 2012).

4.3 α-gal A purification strategy

4.3.1 α-gal A expression system

Historically, Escherichia coli has been used to express and study proteins because it is a relatively simple and low-cost method. However, some proteins do not express and fold properly in prokaryotic systems. Mammalian membrane-bound receptors and secreted proteins usually contain post-translational modifications such as disulfide bonds and glycosylations that are required for proper folding, which precludes their expression in prokaryiotic cells. Since the α-gal

A monomer has five disulfide bonds and is N-glycosylated at three sites, E. coli is not an appropriate system to overexpress the human α-gal A protein. Fortunately, a number of eukaryotic systems are now commonly used to express recombinant proteins. These include yeast (Pichia pastoris and Saccharomyces cerevisiae), baculovirus expression vector systems (Autographa californica multiple nuclear polyhedrosis virus and insect cell hosts Spodoptera frugiperda or

Trichoplusia ni) and mammalian cell systems such as CHO cells and HEK 293 cells (reviewed by

Dalton and Barton 2014).

Yeast expression systems can produce very high amounts of secreted recombinant protein in a relatively short amount of time because these cells grow rapidly (reviewed by Dalton and Barton

2014). In addition, this expression system is less costly than others because the culture media can be an order of magnitude less expensive than that of insect or mammalian cells. Also, yeast can grow at high densities in reusable glass Erlenmeyer shake flasks or in oxygen sparged fermenters

(Jahic et al. 2006). A downside of yeast expression systems is that they express certain proteases that can degrade some recombinant proteins but protease-deficient cell lines have been developed to overcome this (Dalton and Barton 2014). On the other hand, while P. pastoris and S. cerevisiae can make high-mannose type N-glycosylations, they cannot produce the more complex patterns characteristic of mammalian proteins (Wildt and Gerngross 2005). Because glycosylation patterns affect the antigenicity of recombinant proteins (S. A. Brooks 2004), a yeast expression system was unsuitable to express an α-gal A protein meant to be used as antigen to measure antibodies generated against ERT.

The baculovirus and insect cell expression system is currently widely used for the production of cytosolic proteins that cannot be synthesized in prokaryotic systems (Unger and Peleg 2012).

However, they often yield lower amounts of secreted proteins than mammalian expression systems

(Jarvis 2009). Viral genes and the transgene, which is usually under control of a strong viral promoter, are transcribed and translated at exceptionally high levels, while synthesis of the host’s proteins markedly decrease upon infection. Because complex secreted proteins require host factors such as glycosylation machinery, chaperones for folding and disulfide isomerases, secreted proteins do not fold in great amounts and are instead trapped in large intracellular aggregates

(Frenzel, Hust, and Schirrmann 2013). Another disadvantage of this system is its dependence on a viral vector. Although viral production has been streamlined over the past few years, it is still a time-consuming step. In addition, once the baculovirus has been amplified in sufficient amounts for a large-scale expression experiment, it must be titred and an optimal multiplicity of infection must be established empirically. Moreover, because the viral genome does not integrate into that of the host, cells must be transduced before each round of purification and the virus is consumed on the production of a limited amount of protein. In addition, there is no economic benefit in using insect cells over mammalian cells since their culture media cost about the same (Dalton and Barton

2014). Finally, insect cells cannot synthesize sialylated complex glycans (Rendic, Wilson, and

Paschinger 2008) and a significant proportion of complex oligosaccharides in the secreted form of

α-gal A are sialylated (Matsuura et al. 1998).

Mammalian cells are the prevailing expression system for biopharmaceutical protein production in part because they are more likely to properly fold and synthesize adequate post-translational modifications of mammalian proteins. Glycosylation patterns of proteins produced in mammalian cells are most often similar to those observed in vivo, although there are minor differences depending on the species of the cells used (Nigel Jenkins et al. 2009). Because agalsidase alfa and beta are produced in mammalian cell lines and we aimed to purify an α-gal A to measure antibodies generated against agalsidases, we chose to use a mammalian cell line to express it. Widely used cell lines include the dihydrofolate reductase (DHFR)-deficient CHO cell line (CHO-DG44), the adenovirus 5-transformed HEK 293 cell line, the SV40-transformed African green monkey kidney fibroblast CV-1 cell line (COS-1) and the non Ig-secreting subclone of NS1 cells, NS0 (Dalton and Barton 2014). Each cell line has its own benefits and drawbacks.

Because the NS0 cell line is derived from B cells, it is most commonly used for antibody expression (Barnes, Bentley, and Dickson 2000) and we deemed it unsuitable to purify α-gal A from. Conversely, COS-1 cells are normally used in transient expression experiments. Since these cells express the SV40 large tumour antigen, fast vector and transgene amplification can be achieved with vectors containing the SV40 origin of replication. This leads to high expression of the transgene for several days before cell viability decreases (Lufino, Edser, and Wade-Martins

2008). Transient expression is most advantageous for preliminary expression experiments to screen several proteins or many variants of the same protein. However, as this was not our case, we thought it more convenient to generate a stable cell line to overexpress α-gal A.

100

Stable cell lines are a self-renewing resource that can be stored for long periods of time under cryogenic conditions and will provide a reliable and consistent level of protein expression. CHO-

DG44 cells usually yield higher amounts of recombinant proteins than other cell lines (Frenzel,

Hust, and Schirrmann 2013) and are commonly used for biopharmaceutical production

(Cacciatore, Chasin, and Leonard 2010). However, DHFR/methotrexate-mediated selection and screening of high-secreting clones is very laborious, which may be a problem in academic labs

(Dalton and Barton 2014). HEK 293 cells grow robustly, can adapt from growing as an adherent monolayer to suspension and can be cultured in a variety of normal and serum-free media. In addition, they are easily transfected with efficiencies of over 50% using linear polyethylenimine or near 100% using commercial lipid formulations (Backliwal et al. 2008). HEK 293T cells are a variant that stably expresses the SV40 large tumour antigen and can also be used in transient expression studies as COS-1 cells.

Stable mammalian cell expression can be achieved through two strategies. Firstly, the expression cassette containing the transgene remains episomal and is autonomously replicated. This is most commonly achieved by using viral elements derived from the Epstein-Barr virus (EBV) or the BK virus (BKV). With this method, transgene expression can be very high but varies dramatically with vector copy number (Lufino, Edser, and Wade-Martins 2008). Alternatively, a mammalian artificial chromosome expression system has recently been introduced but it has only been reported to be used for the production of monoclonal antibodies (reviewed by Kennard 2011). In the second approach, stable transgene expression is achieved by the chromosomal integration of the expression cassette. There are several methods to accomplish this including retroviral vectors, site- specific recombinases and transposon vector systems (reviewed by Lai, Yang, and Ng 2013).

Transposons are mobile DNA sequences that can efficiently be excised from a region in a chromosome or vector and be integrated into another location in a process mediated by a

101 transposase. We used a commercially available PiggyBac transposon expression system in which a plasmid expresses the PiggyBac transposase and the other contains the expression cassette flanked by inverted terminal repeat sequences that are specifically recognized by the transposase.

This expression cassette contains the transgene of interest under the control of the viral promoter from cytomegalovirus (CMV), one of the strongest promoters most commonly used in expression experiments (Dalton and Barton 2014).

Stable chromosomal expression systems require an efficient selection marker to maintain expression. This is most often achieved by physically coupling the transgene to a dominant drug selection marker so when the drug is applied, only cells that express the drug resistance gene ‒and most likely also the transgene of interest‒ will survive. Common drugs used in this context are neomycin/G418, hygromycin, blastocidin S, zeocin and puromycin (Dalton and Barton 2014). In addition to selection markers, reporter genes allow to rapidly and non-invasively monitor cell transfection or transduction rates. The most common reporter gene used in expression cell lines is

GFP (Dalton and Barton 2014). The expression cassette of the PiggyBac expression system we used in this study contains a fusion gene of the puromycin resistance gene and the GFP gene under the control of the human EF-1α promoter, another strong promoter that is also widely used expression experiments (Dalton and Barton 2014). This fusion gene allowed us to confirm modification of our cells early on by assessing GFP expression by flow cytometry, to select modified cells using puromycin and to confirm the efficacy of selection by flow cytometry.

Finally, we thought it was best to purify α-gal A from the cell culture medium than from the cell lysate for a number of reasons. It is more convenient because there are more contaminant proteins in the cell lysate, as revealed by SDS-PAGE, and because minimal processing of the cell culture medium prior to chromatography is required. Secondly, both agalsidase alfa and beta are isolated

102 from cell culture medium (Lee et al. 2003). Since secreted and intracellular α-gal A have been shown to have different glycosylation patterns (Matsuura et al. 1998) and due to the antigenicity of glycosylations (Brooks 2004), we thought that a secreted α-gal A would be more appropriate to detect antibodies raised against the commercial preparations.

4.3.2 Chromatography

Purification of untagged proteins usually requires multiple purification steps, while affinity-tagged proteins can often be sufficiently purified in a single chromatography (GE Healthcare, 2010). For this reason, we thought it convenient to add a tag to our recombinant α-gal A. The most commonly used tags for affinity chromatography are the histidine tag and the glutathione S-transferase (GST) tag. The latter is 220 amino acids (26 kDa) while histidine tags usually consist of 6 to 10 histidine residues. Because of their small size, histidine tags are less disruptive than other tags to the properties of the proteins to which they are attached and their removal is not necessary for all downstream applications. Tags with 6 histidines (6xhis) are most commonly used as they seem to be the minimum length required for a strong interaction of the tagged protein with the metal ions of the chromatography column. While 10xhis tags bind more strongly to the column and therefore provide higher resolution, we chose a 6xhis tag because a smaller tag would have a lower probability of interacting with antibodies in human plasma and generating false positives in an

ELISA.

The fact that there is his-tagged α-gal A present in the flow-through and wash fractions of our chromatography indicates that our is protocol is not completely efficient. Since the binding capacity of the nickel column used is up to 180 mg and the cell supernatant mixed with the column contains approximately 800 mg of total protein (as measured by BCA protein assay), it is unlikely that the leakage of our target protein is due to it alone overloading the column. Instead, it is

103 probable that there are other proteins in the supernatant that bind to the column with similar strength and contribute to overload it. If this is the case, increasing the concentration of imidazole in the binding buffer could prevent binding of other proteins with less affinity for the column than the his-tagged α-gal A. If this does not increase retention of our target protein in the column, it may be necessary to use a larger his tag that can compete more efficiently with other proteins in the supernatant. Ultimately, cells fully adapted to grow in serum-free medium, such as the HEK

293F cell line, could be used in order to dramatically reduce the amount of competing proteins in the supernatant. Nevertheless, we did not consider this leakage of target protein a fundamental issue in our protocol because the yield of the purified product was sufficient.

4.4 Purified α-gal A

Our analysis suggests that our his-tagged α-gal A is adequately processed by the cell machinery, although the smaller band detected by the anti-α-gal A and the anti-his antibodies suggests that some of our enzyme is partially degraded either before or after reaching the extracellular medium.

Cleavage of the signal peptide could be confirmed in the future by N-terminal sequencing. De- glycosylation and SDS-PAGE analysis indicates that our recombinant α-gal A seems to be glycosylated similarly to the α-gal A used in our ELISA protocol that was donated by Dr. Brady.

The glycosylation pattern of an α-gal A expressed in HEK 293T cells should not differ significantly from that occurring in other human cells. However, the exact nature and proportions of the glycosylations of our enzyme should be studied in the future because of their effect on the antigenicity of recombinant proteins (S. A. Brooks 2004), an aspect that is highly relevant to the intended use of this purification product.

The specific enzymatic activity of our α-gal A was much lower than that of commercial α-gal A

(969.78 and 3,870,000 nmol/h/mg, respectively. The latter was determined by Lee et al., 2003).

104

This may be caused by the his tag added to the C-terminus of our recombinant protein. Miyamura et al. (1996) determined that α-gal A activity increased when 2-10 residues of the C-terminus of the human protein were deleted, whereas deletions of 12 or more residues resulted in inactive enzymes. In the agalsidase alfa and beta preparations, a significant percentage of the α-gal A molecules lack one or two residues of the C-terminus, which may confer a higher enzymatic activity to these drugs (Lee et al. 2003). In the coffee bean α-gal A, deletion of more than four residues rendered an inactive enzyme (Maranville and Zhu 2000). More importantly, the same occurred when this α-gal A was fused at the C-terminus to GFP or to other glycosidases

(Maranville and Zhu 2000). Alteration of the C-terminus in our his-tagged α-gal A could be the cause of its low activity compared to the commercial non-tagged preparations. If this were the case, designing an α-gal A without a few of the C-terminus residues and/or removal of the his tag are potential strategies to increase the specific activity of the enzyme.

In our case, however, it is possible that the his tag only partially explains the reduced enzyme activity. Corchero et al. (2011) also utilized a 6xhis tag on the C-terminus to purify human α-gal

A from HEK 293 cells but the specific activity of their purified enzyme was only 2-fold lower than that of commercial α-gal A. Given that their purification process was very similar to ours (6xhis tag on the C-terminus, purification from supernatant, filtration of supernatant prior to IMAC, elution with imidazole and buffer exchange), it would appear that a factor other than the his-tag on the C-terminus and our purification strategy causes such a reduction in enzymatic activity. In the study by Corchero et al. (2011), both Western blot and SDS-PAGE show a single band corresponding to α-gal A. This indicates that there is no degraded enzyme and no protein contaminants present in their purified product (although they used Coomassie staining, which is less sensitive than silver staining), as opposed to ours. Since α-gal A specific enzymatic activity is calculated based on total protein present in the sample, it is possible that the lower activity

105 measured in our product is in part due to an overestimation of the amount of intact α-gal A in the sample, i.e., that there are protein contaminants and partially degraded α-gal A molecules that do not contribute to the degradation of the substrate in the activity assay but are nevertheless included in the specific activity calculations.

In addition to this, the oligomeric status of the native purified α-gal A should be assessed in the future by size-exclusion chromatography (SEC) because a large percentage of the molecules remaining as monomers would also explain the lower enzymatic activity observed.

4.5 Potential use of purified α-gal A to measure anti-α-gal A antibodies in Fabry disease patients

While we do not need a fully active α-gal A in order to measure anti-α-gal A antibodies, some of the possible causes for the lower activity of our product may impair its recognition by antibodies as well. For example, if a large proportion of our α-gal A molecules do not dimerize, some conformation-dependent anti-α-gal A antibodies will give a false negative result. Hence the importance of assessing the SEC profile in our preparation, which should be similar to that of agalsidase alfa and beta.

Similarly, protein contaminants in our sample could lead to false positives when screening sera from Fabry disease patients. In this regard, our preliminary assessment by Western blot showed that none of the 9 samples tested bound to a protein different than α-gal A or a partially degraded form of α-gal A, except for the sample from patient 26, which also binds to some protein present in the α-gal A preparation donated by Dr. Brady despite this patient never having received ERT.

These results suggest that other contaminant proteins present in our sample will not cause false negatives, but this is limited by the sample size of this experiment (9 out of 54 total samples).

106

If these contaminant proteins prove to be a concern in the future, purity could be increased in several ways, some of which have been mentioned already. Despite having reduced the FBS amount in the cell culture medium from 10% to 4%, the complete elimination of FBS from the supernatant would most likely further increase purity. For this purpose, a HEK 293F cell line, fully adapted to grow in serum-free medium, could be used. This cell line has the added advantage of growing in suspension, which also allows volumetric scalability and thus an increase in yield. The caveats of using this cell line is that its culture medium is approximately three times more costly than regular DMEM and that large tank bioreactors are not common in an academic laboratory setting.

Another approach to increase purity would be to use a different purification strategy. For instance, an additional purification step could be added to our existing protocol. After IMAC, a second chromatography utilizing a column with immobilized D-galactose (a substrate for α-gal A) would most likely yield a purer product, a strategy used by Yasuda et al. (2004). The downside to this would be the need for a second concentration step and the impact on protein stability and final yield that a longer protocol might have. Another option would be to use a larger tag, such as a

10xhis tag or a GST tag, thus increasing binding strength during the chromatography and therefore purity of the final product. In this case, however, the tags would have to be removed from the enzyme so that they do not interfere with proper folding and dimerization of α-gal A and/or with the anti-α-gal A ELISA.

Chapter 5

Conclusions

The first aim of this study was to test an ELISA protocol to measure anti-α-gal A IgG antibodies in the serum of Fabry disease patients. This assay had a very low rate of false-positives (1 out of

17 obligate negative samples), which were probably caused by impurities in the antigen preparation. Through this protocol, we determined that over half of the patients on ERT were seropositive. In addition, we found a higher incidence of anti-α-gal A antibodies in patients receiving agalsidase beta over those receiving agalsidase alfa, although the significance of these results is limited by the small population of patients on agalsidase beta. The type of mutation on the GLA gene did not appear to influence the development of antibodies and these appeared to have no effect on late disease progression markers.

The second aim was to purify a human α-gal A from human cells that can be used in the future to titer anti-α-gal A antibodies. We developed a rapid, single-step purification method that can be easily scaled up if necessary. Furthermore, the α-gal A purified in this way is bound by antibodies present in seropositive patients and not by those present in healthy individuals, which suggests that it may be suitable to use as antigen in our ELISA to measure anti-α-gal A antibody levels.

107

Chapter 6

Future Directions

6.1 Use of purified α-gal A to detect anti-α-gal A antibodies by ELISA

The α-gal A purified in this study is recognized by IgG antibodies in the sera of most of the seropositive Fabry disease patients tested by Western blot. Therefore, its use as antigen in the

ELISA protocol developed in this study to measure anti-α-gal A IgG antibodies should be tested next. The fact that our α-gal A preparation does not seem to have more contaminants than the enzyme from Dr. Brady that we used in our ELISA would lead us to anticipate that a similar concentration of our purified α-gal A will be adequate for this assay. However, as discussed in section 4.4, the lower α-gal A activity of our preparation could indicate that the concentration of

α-gal A homodimers is lower than expected. Therefore, a side-by-side comparison of both preparations must be performed to determine the concentration at which several sera, both positive and negative, generate similar optical density values. Finding an appropriate antigen concentration should be the most challenging part of adapting this ELISA protocol as the rest of the conditions should remain the same.

In addition, this protocol could be adapted to measure levels of IgE antibodies in Fabry disease patients. This isotype occurs less frequently than IgG in Fabry disease patients on ERT and has only been observed in patients receiving agalsidase beta (Raphael Schiffmann, Ries, et al. 2006;

Tanaka et al. 2010; Patrick B. Deegan 2012). Even though adverse reactions to agalsidase infusions tend to be mild, IgE antibodies have been correlated with the occurrence of adverse clinical symptoms (Tanaka et al. 2010). Furthermore, unlike IgG antibodies, IgE antibodies against

108 109 agalsidase beta have not been documented to cross-react with agalsidase alfa (Tanaka et al. 2010).

Consequently, a patient that experiences IgE-mediated severe adverse reactions with infusion of agalsidase beta may benefit from switching to agalsidase alfa, as reported by Tanaka et al. (2010).

In these cases, monitoring anti-α-gal A IgE levels provides valuable information.

6.2 Use of purified α-gal A to test antibody-mediated inhibition of

α-gal A uptake

While a highly sensitive quantitative assay to detect long-lived anti-α-gal A IgG antibodies is useful, it does not provide information on the functional nature of the immune response. A functional assay could either determine whether antibodies directly inhibit activity of α-gal A or assess their inhibition of a critical step in the action of the enzyme. As mentioned before, it has been shown that anti-α-gal A IgG antibodies inhibit in vitro enzyme activity (Ries et al. 2007;

Anouk C. Vedder et al. 2008; Ohashi et al. 2008; Linthorst et al. 2004). Furthermore, it has been demonstrated that IgG antibodies bind to α-gal A in the circulation (Linthorst et al. 2004) and that pre-incubation of agalsidase beta with sera from patients with high anti-α-gal A antibody titers reduced α-gal A activity in Fabry fibroblasts incubated with this mixture and in organs of Fabry mice injected with this mixture (Ohashi et al. 2008). While it appears that antibody binding inhibits

α-gal A uptake into cells and/or enzyme activity in the lysosome after cellular uptake, the specific mechanism of antibody-mediated inhibition of α-gal A activity in cells and tissues has not been definitively elucidated.

Our his-tagged α-gal A could be utilized for this purpose. For instance, levels of his-tagged 55 kDa protein in the cell lysate of Fabry fibroblasts could be measured by Western blot after incubation

110 of these cells with our enzyme with or without positive sera from Fabry disease patients. This would help to determine whether antibodies block cellular uptake of the enzyme.

References

Abe, Akira, Lois J. Arend, Lihsueh Lee, Clifford Lingwood, Roscoe O. Brady, and James A. Shayman. 2000. “Glycosphingolipid Depletion in Fabry Disease Lymphoblasts with Potent Inhibitors of Glucosylceramide Synthase.” Kidney International 57 (2): 446–54. doi:10.1046/j.1523-1755.2000.00864.x.

Abe, Akira, Susan Gregory, Lihsueh Lee, Paul D. Killen, Roscoe O. Brady, Ashok Kulkarni, and James A. Shayman. 2000. “Reduction of Globotriaosylceramide in Fabry Disease Mice by Substrate Deprivation.” Journal of Clinical Investigation 105 (11): 1563–71. doi:10.1172/JCI9711.

Aerts, Johannes M., Johanna E. Groener, Sijmen Kuiper, Wilma E. Donker-Koopman, Anneke Strijland, Roelof Ottenhoff, Cindy van Roomen, et al. 2008. “Elevated Globotriaosylsphingosine Is a Hallmark of Fabry Disease.” Proceedings of the National Academy of Sciences of the United States of America 105 (8): 2812–17. doi:10.1073/pnas.0712309105.

Aguilar, R. C., M. Boehm, I. Gorshkova, R. J. Crouch, K. Tomita, T. Saito, H. Ohno, and J. S. Bonifacino. 2001. “Signal-Binding Specificity of the mu4 Subunit of the Adaptor Protein Complex AP-4.” The Journal of Biological Chemistry 276 (16): 13145–52. doi:10.1074/jbc.M010591200.

Akiyama, Masashi, Yoriko Sugiyama-Nakagiri, Kaori Sakai, James R. McMillan, Maki Goto, Ken Arita, Yukiko Tsuji-Abe, et al. 2005. “Mutations in Lipid Transporter ABCA12 in Harlequin Ichthyosis and Functional Recovery by Corrective Gene Transfer.” The Journal of Clinical Investigation 115 (7): 1777–84. doi:10.1172/JCI24834.

Allen, L. E., E. M. Cosgrave, J. P. Kersey, and U. Ramaswami. 2010. “Fabry Disease in Children: Correlation between Ocular Manifestations, Genotype and Systemic Clinical Severity.” The British Journal of Ophthalmology 94 (12): 1602–5. doi:10.1136/bjo.2009.176651.

Altarescu, Gheona, David F. Moore, and Raphael Schiffmann. 2005. “Effect of Genetic Modifiers on Cerebral Lesions in Fabry Disease.” Neurology 64 (12): 2148–50.

111 112

doi:10.1212/01.WNL.0000166000.24321.4F.

Andersen, M. V., H. Dahl, H. Fledelius, and N. V. Nielsen. 1994. “Central Retinal Artery Occlusion in a Patient with Fabry’s Disease Documented by Scanning Laser Ophthalmoscopy.” Acta Ophthalmologica 72 (5): 635–38. http://www.ncbi.nlm.nih.gov/pubmed/7887166.

Apelland, Turid, Einar Gude, Erik H. Strøm, Lars Gullestad, Kristin L. Eiklid, Jan-Eric Månsson, Finn P. Reinholt, et al. 2014. “Familial Globotriaosylceramide-Associated Cardiomyopathy Mimicking Fabry Disease.” Heart (British Cardiac Society) 100 (22): 1793–98. doi:10.1136/heartjnl-2014-305616.

Arab, S., and C. A. Lingwood. 1998. “Intracellular Targeting of the Endoplasmic Reticulum/nuclear Envelope by Retrograde Transport May Determine Cell Hypersensitivity to Verotoxin via Globotriaosyl Ceramide Fatty Acid Isoform Traffic.” Journal of Cellular Physiology 177 (4): 646–60. doi:10.1002/(SICI)1097-4652(199812)177:4<646::AID- JCP15>3.0.CO;2-B.

Arai, T., A. K. Bhunia, S. Chatterjee, and G. B. Bulkley. 1998. “Lactosylceramide Stimulates Human Neutrophils to Upregulate Mac-1, Adhere to Endothelium, and Generate Reactive Oxygen Metabolites in Vitro.” Circulation Research 82 (5): 540–47. http://www.ncbi.nlm.nih.gov/pubmed/9529158.

Arends, M., C. E. Hollak, and M. Biegstraaten. 2015. “Quality of Life in Patients with Fabry Disease: A Systematic Review of the Literature.” Orphanet J Rare Dis 10 (77): 77. doi:10.1186/s13023-015-0296-8.

Argoff, C. E., N. W. Barton, R. O. Brady, and H. A. Ziessman. 1998. “Gastrointestinal Symptoms and Delayed Gastric Emptying in Fabry’s Disease: Response to Metoclopramide.” Nuclear Medicine Communications 19 (9): 887–91. http://www.ncbi.nlm.nih.gov/pubmed/10581595.

Arumugam, Paritha I, Tomoyasu Higashimoto, Fabrizia Urbinati, Ute Modlich, Shawna Nestheide, Ping Xia, Catherine Fox, Andrea Corsinotti, Christopher Baum, and Punam Malik. 2009. “Genotoxic Potential of Lineage-Specific Lentivirus Vectors Carrying the Beta-Globin Locus Control Region.” Molecular Therapy : The Journal of the American Society of Gene

113

Therapy 17 (11): 1929–37.

Ashe, Karen M., Eva Budman, Dinesh S. Bangari, Craig S. Siegel, Jennifer B. Nietupski, Bing Wang, Robert J. Desnick, et al. 2015. “Efficacy of Enzyme and Substrate Reduction Therapy with a Novel Antagonist of Glucosylceramide Synthase for Fabry Disease.” Molecular Medicine 21: 389–99. doi:10.2119/molmed.2015.00088.

Ashwell, Gilbert, and Anatol G. Morell. 1974. “The Role of Surface Carbohydrates in the Hepatic Recognition and Transport of Circulating Glycoproteins.” Adv. Enzymol. Relat. Areas Mol. Biol. 41 (0): 99–128. doi:10.1002/9780470122860.ch3.

Askari, Hasan, Christine R. Kaneski, Cristina Semino-Mora, Priya Desai, Agnes Ang, David E. Kleiner, Lorah T. Perlee, et al. 2007. “Cellular and Tissue Localization of Globotriaosylceramide in Fabry Disease.” Virchows Archiv : An International Journal of Pathology 451 (4): 823–34. doi:10.1007/s00428-007-0468-6.

Backliwal, Gaurav, Markus Hildinger, Vivek Hasija, and Florian M. Wurm. 2008. “High-Density Transfection with HEK-293 Cells Allows Doubling of Transient Titers and Removes Need for a Priori DNA Complex Formation with PEI.” Biotechnology and Bioengineering 99 (3): 721–27. doi:10.1002/bit.21596.

Baehner, F., C. Kampmann, C. Whybra, E. Miebach, C. M. Wiethoff, and M. Beck. 2003. “Enzyme Replacement Therapy in Heterozygous Females with Fabry Disease: Results of a Phase IIIB Study.” Journal of Inherited Metabolic Disease 26 (7): 617–27. doi:10.1023/B:BOLI.0000005658.14563.77.

Balbis, Alejandro, and Barry I. Posner. 2010. “Compartmentalization of EGFR in Cellular Membranes: Role of Membrane Rafts.” Journal of Cellular Biochemistry 109 (6): 1103–8. doi:10.1002/jcb.22505.

Banikazemi, Maryam, Jan Bultas, Stephen Waldek, William R. Wilcox, Chester B. Whitley, Marie McDonald, Richard Finkel, et al. 2007. “Agalsidase-Beta Therapy for Advanced Fabry Disease: A Randomized Trial.” Annals of Internal Medicine 146 (2): 77–86. http://www.ncbi.nlm.nih.gov/pubmed/17179052.

114

Barbier, A. J., B. Bielefeld, D. A. H. Whiteman, M. Natarajan, A.. Pano, and D. A. Amato. 2013. “The Relationship between Anti-Idursulfase Antibody Status and Safety and Efficacy Outcomes in Attenuated Mucopolysaccharidosis II Patients Aged 5years and Older Treated with Intravenous Idursulfase.” Molecular Genetics and Metabolism 110 (3): 303–10. doi:10.1016/j.ymgme.2013.08.002.

Barnes, Louise M., Catherine M. Bentley, and Alan J. Dickson. 2000. “Advances in Animal Cell Recombinant Protein Production: GS-NS0 Expression System.” Cytotechnology 32 (2): 109– 23. doi:10.1023/A:1008170710003.

Barrette, S, J L Douglas, N E Seidel, and D M Bodine. 2000. “Lentivirus-Based Vectors Transduce Mouse Hematopoietic Stem Cells with Similar Efficiency to Moloney Murine Leukemia Virus-Based Vectors.” Blood 96 (10): 3385–91.

Beck, M., R. Ricci, U. Widmer, F. Dehout, A. García De Lorenzo, C. Kampmann, A. Linhart, et al. 2004. “Fabry Disease: Overall Effects of Agalsidase Alfa Treatment.” European Journal of Clinical Investigation 34 (12): 838–44. doi:10.1111/j.1365-2362.2004.01424.x.

Becker, A. E., R. Schoorl, A. G. Balk, and R. M. van der Heide. 1975. “Cardiac Manifestations of Fabry’s Disease. Report of a Case with Mitral Insufficiency and Electrocardiographic Evidence of Myocardial Infarction.” The American Journal of Cardiology 36 (6): 829–35. http://www.ncbi.nlm.nih.gov/pubmed/812352.

Bénichou, Bernard, Sunita Goyal, Crystal Sung, Andrea M. Norfleet, and Fanny O’Brien. 2009. “A Retrospective Analysis of the Potential Impact of IgG Antibodies to Agalsidase Beta on Efficacy during Enzyme Replacement Therapy for Fabry Disease.” Molecular Genetics and Metabolism 96 (1): 4–12. doi:10.1016/j.ymgme.2008.10.004.

Beutler, E., and W. Kuhl. 1972. “Purification and Properties of Human Alpha-Galactosidases.” The Journal of Biological Chemistry 247 (22): 7195–7200. http://www.ncbi.nlm.nih.gov/pubmed/4629399.

Bhat, S., R. V. Mettus, E. P. Reddy, K. E. Ugen, V. Srikanthan, W. V. Williams, and D. B. Weiner. 1993. “The Galactosyl Ceramide/sulfatide Receptor Binding Region of HIV-1 gp120 Maps to Amino Acids 206-275.” AIDS Research and Human Retroviruses 9 (2): 175–81.

115

doi:10.1089/aid.1993.9.175.

Bhunia, A. K., T. Arai, G. Bulkley, and S. Chatterjee. 1998. “Lactosylceramide Mediates Tumor Necrosis Factor-Alpha-Induced Intercellular Adhesion Molecule-1 (ICAM-1) Expression and the Adhesion of Neutrophil in Human Umbilical Vein Endothelial Cells.” The Journal of Biological Chemistry 273 (51): 34349–57. http://www.ncbi.nlm.nih.gov/pubmed/9852101.

Bhunia, A. K., H. Han, A. Snowden, and S. Chatterjee. 1996. “Lactosylceramide Stimulates Ras- GTP Loading, Kinases (MEK, Raf), p44 Mitogen-Activated Protein Kinase, and c-Fos Expression in Human Aortic Smooth Muscle Cells.” The Journal of Biological Chemistry 271 (18): 10660–66. http://www.ncbi.nlm.nih.gov/pubmed/8631872.

Bigger, Brian W., Muhammad Saif, and Gabor E. Linthorst. 2015. “The Role of Antibodies in Enzyme Treatments and Therapeutic Strategies.” Best Practice and Research: Clinical Endocrinology and Metabolism 29 (2). Elsevier Ltd: 183–94. doi:10.1016/j.beem.2015.01.006.

Bird, A. P. 1986. “CpG-Rich Islands and the Function of DNA Methylation.” Nature 321 (6067): 209–13. doi:10.1038/321209a0.

Bishop, D. F., D. H. Calhoun, H. S. Bernstein, P. Hantzopoulos, M. Quinn, and R. J. Desnick. 1986. “Human Alpha-Galactosidase A: Nucleotide Sequence of a cDNA Clone Encoding the Mature Enzyme.” Proceedings of the National Academy of Sciences of the United States of America 83 (13): 4859–63. http://www.ncbi.nlm.nih.gov/pubmed/3014515.

Bishop, D F, and R J Desnick. 1981. “Affinity Purification of Alpha-Galactosidase A from Human Spleen, Placenta, and Plasma with Elimination of Pyrogen Contamination. Properties of the Purified Splenic Enzyme Compared to Other Forms.” The Journal of Biological Chemistry 256 (3): 1307–16. http://www.ncbi.nlm.nih.gov/pubmed/6256390.

Bishop, D F, R Kornreich, and R J Desnick. 1988. “Structural Organization of the Human Alpha- Galactosidase A Gene: Further Evidence for the Absence of a 3’ Untranslated Region.” Proceedings of the National Academy of Sciences of the United States of America 85 (11): 3903–7. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=280328&tool=pmcentrez&rend

116

ertype=abstract.

Bishop, D F, and C C Sweeley. 1978. “Plasma Alpha-Galactosidase A:properties and Comparisons with Tissue Alpha-Galactosidases.” Biochimica et Biophysica Acta 525 (2): 399–409. http://www.ncbi.nlm.nih.gov/pubmed/210818.

Boggs, J. M. 1987. “Lipid Intermolecular Hydrogen Bonding: Influence on Structural Organization and Membrane Function.” Biochimica et Biophysica Acta 906 (3): 353–404. http://www.ncbi.nlm.nih.gov/pubmed/3307919.

Boman, A. L., C. J. Zhang, X. Zhu, and R. A. Kahn. 2000. “A Family of ADP-Ribosylation Factor Effectors That Can Alter Membrane Transport through the Trans-Golgi.” Molecular Biology of the Cell 11 (4): 1241–55. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=14844&tool=pmcentrez&render type=abstract.

Bose, R., M. Verheij, A. Haimovitz-Friedman, K. Scotto, Z. Fuks, and R. Kolesnick. 1995. “Ceramide Synthase Mediates Daunorubicin-Induced Apoptosis: An Alternative Mechanism for Generating Death Signals.” Cell 82 (3): 405–14. http://www.ncbi.nlm.nih.gov/pubmed/7634330.

Boyd, B., and C. Lingwood. 1989. “Verotoxin Receptor Glycolipid in Human Renal Tissue.” Nephron 51 (2): 207–10. http://www.ncbi.nlm.nih.gov/pubmed/2644572.

Brady, R. O., A. E. Gal, R. M. Bradley, E. Martensson, A. L. Warshaw, and L. Laster. 1967. “Enzymatic Defect in Fabry’s Disease. Ceramidetrihexosidase Deficiency.” The New England Journal of Medicine 276 (21): 1163–67. doi:10.1056/NEJM196705252762101.

Brady, R O, J F Tallman, W G Johnson, A E Gal, W R Leahy, J M Quirk, and A S Dekaban. 1973. “Replacement Therapy for Inherited Enzyme Deficiency. Use of Purified Ceramidetrihexosidase in Fabry’s Disease.” The New England Journal of Medicine 289 (1): 9–14. doi:10.1056/NEJM197307052890103.

Brady, R O, B W Uhlendorf, and C B Jacobson. 1971. “Fabry’s Disease: Antenatal Detection.” Science (New York, N.Y.) 172 (3979): 174–75.

117

http://www.ncbi.nlm.nih.gov/pubmed/5547732.

Brands, Marion M., Marianne Hoogeveen-Westerveld, Marian A. Kroos, Willemieke Nobel, George J. Ruijter, Lale Özkan, Iris Plug, et al. 2013. “Mucopolysaccharidosis Type VI Phenotypes-Genotypes and Antibody Response to Galsulfase.” Orphanet Journal of Rare Diseases 8 (1): 51. doi:10.1186/1750-1172-8-51.

Branton, Mary H., Raphael Schiffmann, Sharda G. Sabnis, Gary J. Murray, Jane M. Quirk, Gheona Altarescu, Lev Goldfarb, et al. 2002. “Natural History of Fabry Renal Disease: Influence of Alpha-Galactosidase A Activity and Genetic Mutations on Clinical Course.” Medicine 81 (2): 122–38. http://www.ncbi.nlm.nih.gov/pubmed/11889412.

Braulke, Thomas, and Juan S. Bonifacino. 2009. “Sorting of Lysosomal Proteins.” Biochimica et Biophysica Acta 1793 (4): 605–14. doi:10.1016/j.bbamcr.2008.10.016.

Bremer, E. G., S. Hakomori, D. F. Bowen-Pope, E. Raines, and R. Ross. 1984. “Ganglioside- Mediated Modulation of Cell Growth, Growth Factor Binding, and Receptor Phosphorylation.” The Journal of Biological Chemistry 259 (11): 6818–25. http://www.ncbi.nlm.nih.gov/pubmed/6327695.

Bremer, E G, Joseph Schlessinger, and S Hakomori. 1986. “Ganglioside-Mediated Modulation of Cell Growth. Specific Effects of GM3 on Tyrosine Phosphorylation of the Epidermal Growth Factor Receptor.” The Journal of Biological Chemistry 261 (5): 2434–40. http://www.ncbi.nlm.nih.gov/pubmed/2418024.

Brooks, Doug A., Revecca Kakavanos, and John J. Hopwood. 2003. “Significance of Immune Response to Enzyme-Replacement Therapy for Patients with a Lysosomal Storage Disorder.” Trends in Molecular Medicine. doi:10.1016/j.molmed.2003.08.004.

Brooks, Susan A. 2004. “Appropriate Glycosylation of Recombinant Proteins for Human Use: Implications of Choice of Expression System.” Molecular Biotechnology 28 (3): 241–55. doi:10.1385/MB:28:3:241.

Brown, D. A., and J. K. Rose. 1992. “Sorting of GPI-Anchored Proteins to Glycolipid-Enriched Membrane Subdomains during Transport to the Apical Cell Surface.” Cell 68 (3): 533–44.

118

http://www.ncbi.nlm.nih.gov/pubmed/1531449.

Burger, K. N., P. van der Bijl, and G. van Meer. 1996. “Topology of Sphingolipid Galactosyltransferases in ER and Golgi: Transbilayer Movement of Monohexosyl Sphingolipids Is Required for Higher Glycosphingolipid Biosynthesis.” The Journal of Cell Biology 133 (1): 15–28. http://www.ncbi.nlm.nih.gov/pubmed/8601603.

Burkholder, P. M., S. J. Updike, R. A. Ware, and O. G. Reese. 1980. “Clinicopathologic, Enzymatic, and Genetic Features in a Case of Fabry’s Disease.” Archives of Pathology & Laboratory Medicine 104 (1): 17–25. http://www.ncbi.nlm.nih.gov/pubmed/6766061.

Buton, Xavier, Paulette Hervé, Janek Kubelt, Astrid Tannert, Koert N. J. Burger, P. Fellmann, Peter Müller, Andreas Herrmann, Michel Seigneuret, and Philippe F. Devaux. 2002. “Transbilayer Movement of Monohexosylsphingolipids in Endoplasmic Reticulum and Golgi Membranes.” Biochemistry 41 (43): 13106–15. http://www.ncbi.nlm.nih.gov/pubmed/12390039.

Cable, W. J., A. M. Dvorak, J. E. Osage, and E. H. Kolodny. 1982. “Fabry Disease: Significance of Ultrastructural Localization of Lipid Inclusions in Dermal Nerves.” Neurology 32 (4): 347– 53. http://www.ncbi.nlm.nih.gov/pubmed/6278363.

Cable, W J, E H Kolodny, and R D Adams. 1982. “Fabry Disease: Impaired Autonomic Function.” Neurology 32 (5): 498–502. http://www.ncbi.nlm.nih.gov/pubmed/6803189.

Cacciatore, Jonathan J., Lawrence A. Chasin, and Edward F. Leonard. 2010. “Gene Amplification and Vector Engineering to Achieve Rapid and High-Level Therapeutic Protein Production Using the Dhfr-Based CHO Cell Selection System.” Biotechnology Advances. doi:10.1016/j.biotechadv.2010.04.003.

Calhoun, D. H., D. F. Bishop, H. S. Bernstein, M. Quinn, P. Hantzopoulos, and R. J. Desnick. 1985. “Fabry Disease: Isolation of a cDNA Clone Encoding Human Alpha-Galactosidase A.” Proceedings of the National Academy of Sciences of the United States of America 82 (21): 7364–68. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=391345&tool=pmcentrez&rend ertype=abstract.

119

Chalfant, Charles E., and Sarah Spiegel. 2005. “Sphingosine 1-Phosphate and Ceramide 1- Phosphate: Expanding Roles in Cell Signaling.” Journal of Cell Science 118 (Pt 20): 4605– 12. doi:10.1242/jcs.02637.

Chatterjee, Subroto, and Ambarish Pandey. 2008. “The Yin and Yang of Lactosylceramide Metabolism: Implications in Cell Function.” Biochimica et Biophysica Acta - General Subjects. doi:10.1016/j.bbagen.2007.08.010.

Chen, C. S., M. C. Patterson, C. L. Wheatley, J. F. O’Brien, and R. E. Pagano. 1999. “Broad Screening Test for Sphingolipid-Storage Diseases.” Lancet (London, England) 354 (9182): 901–5. doi:10.1016/S0140-6736(98)10034-X.

Choi, Jin-Ok, Mi Hee Lee, Hae-Young Park, and Sung-Chul Jung. 2010. “Characterization of Fabry Mice Treated with Recombinant Adeno-Associated Virus 2/8-Mediated Gene Transfer.” Journal of Biomedical Science 17: 26. doi:10.1186/1423-0127-17-26.

Choi, Myeong Jun, and Howard I. Maibach. 2005. “Role of Ceramides in Barrier Function of Healthy and Diseased Skin.” American Journal of Clinical Dermatology 6 (4): 215–23. http://www.ncbi.nlm.nih.gov/pubmed/16060709.

Chou, Hsun-Hua, Toshiyuki Hayakawa, Sandra Diaz, Matthias Krings, Etty Indriati, Meave Leakey, Svante Paabo, Yoko Satta, Naoyuki Takahata, and Ajit Varki. 2002. “Inactivation of CMP-N-Acetylneuraminic Acid Hydroxylase Occurred prior to Brain Expansion during Human Evolution.” Proceedings of the National Academy of Sciences of the United States of America 99 (18): 11736–41. doi:10.1073/pnas.182257399.

Civallero, Gabriel, Kristiane Michelin, Jurema de Mari, Marli Viapiana, Maira Burin, Janice C. Coelho, and Roberto Giugliani. 2006. “Twelve Different Enzyme Assays on Dried-Blood Filter Paper Samples for Detection of Patients with Selected Inherited Lysosomal Storage Diseases.” Clinica Chimica Acta; International Journal of Clinical Chemistry 372 (1–2): 98– 102. doi:10.1016/j.cca.2006.03.029.

Clarke, J. T. 1981. “The Glycosphingolipids of Human Plasma Lipoproteins.” Canadian Journal of Biochemistry 59 (6): 412–17. http://www.ncbi.nlm.nih.gov/pubmed/6794884.

120

Clarke, J. T., J. Knaack, J. C. Crawhall, and L. S. Wolfe. 1971. “Ceramide Trihexosidosis (Fabry’s Disease) without Skin Lesions.” The New England Journal of Medicine 284 (5): 233–35. doi:10.1056/NEJM197102042840503.

Clarke, J T, and J M Stoltz. 1976. “Uptake of Radiolabeled Galactosyl-(alpha1 Goes to 4)- Galactosyl-(beta1 Goes to 4)-Glucosylceramide by Human Serum Lipoproteins in Vitro.” Biochimica et Biophysica Acta 441 (1): 165–69. http://www.ncbi.nlm.nih.gov/pubmed/182248.

Clarke, Joe T. R., Michael L. West, Jan Bultas, and Raphael Schiffmann. 2007. “The Pharmacology of Multiple Regimens of Agalsidase Alfa Enzyme Replacement Therapy for Fabry Disease.” Genetics in Medicine 9 (8): 504–9. doi:10.1097GIM.0b013e318133fb1b.

Colley, J. R., D. L. Miller, M. S. Hutt, H. J. Wallace, and H. E. De Wardener. 1958. “The Renal Lesion in Angiokeratoma Corporis Diffusum.” Br Med J 1 (5082): 1266–68. http://www.ncbi.nlm.nih.gov/pubmed/13536474.

Colombi, A., A. Kostyal, R. Bracher, F. Gloor, R. Mazzi, and H. Thölen. 1967a. “Angiokeratoma Corporis Diffusum--Fabry’s Disease.” Helvetica Medica Acta 34 (1): 67. http://www.ncbi.nlm.nih.gov/pubmed/5592081.

———. 1967b. “Angiokeratoma Corporis Diffusum--Fabry’s Disease.” Helvetica Medica Acta 34 (1): 67–83. http://www.ncbi.nlm.nih.gov/pubmed/5592081.

Cook, D. G., J. Fantini, S. L. Spitalnik, and F. Gonzalez-Scarano. 1994. “Binding of Human Immunodeficiency Virus Type I (HIV-1) gp120 to Galactosylceramide (GalCer): Relationship to the V3 Loop.” Virology 201 (2): 206–14. doi:10.1006/viro.1994.1287.

Corchero, José Luis, Rosa Mendoza, Julia Lorenzo, Victor Rodríguez-Sureda, Carmen Domínguez, Esther Vázquez, Neus Ferrer-Miralles, and Antonio Villaverde. 2011. “Integrated Approach to Produce a Recombinant, His-Tagged Human α-Galactosidase a in Mammalian Cells.” Biotechnology Progress 27 (5): 1206–17. doi:10.1002/btpr.637.

Cox, T. M., J. M. F. G. Aerts, G. Andria, M. Beck, N. Belmatoug, B. Bembi, R. Chertkoff, et al. 2003. “The Role of the Iminosugar N-Butyldeoxynojirmycin (Miglustat) in the Management

121

of Type I (Non-Neuronopathic) Gaucher Disease: A Position Statement.” Journal of Inherited Metabolic Disease. doi:10.1023/A:1025902113005.

D’Costa, Jenice, Judith Harvey-White, Pankaj Qasba, Advait Limaye, Christine R. Kaneski, Alberta Davis-Warren, Roscoe O. Brady, Krys S. Bankiewicz, Eugene O. Major, and Suresh K. Arya. 2003. “HIV-2 Derived Lentiviral Vectors: Gene Transfer in Parkinson’s and Fabry Disease Models in Vitro.” Journal of Medical Virology 71 (2): 173–82. doi:10.1002/jmv.10467.

Daitx, Vanessa Vitcoski, Jamila Mezzalira, Vitória da Costa Moraes, Ana Carolina Breier, Jaqueline Cé, and Janice Carneiro Coelho. 2015. “Comparing the Alpha-Galactosidase A Biochemical Properties from Healthy Individuals and Fabry Disease Patients.” Clinica Chimica Acta; International Journal of Clinical Chemistry 445 (May): 60–64. doi:10.1016/j.cca.2015.03.014.

Dalton, Annamarie C., and William A. Barton. 2014. “Over-Expression of Secreted Proteins from Mammalian Cell Lines.” Protein Science. Wiley-Blackwell. doi:10.1002/pro.2439.

Dawson, G., A. W. Kruski, and A. M. Scanu. 1976. “Distribution of Glycosphingolipids in the Serum Lipoproteins of Normal Human Subjects and Patients with Hypo- and Hyperlipidemias.” Journal of Lipid Research 17 (2): 125–31. http://www.ncbi.nlm.nih.gov/pubmed/178813.

Dawson, G., R. Matalon, and Y. T. Li. 1973. “Correction of the Enzymic Defect in Cultured Fibroblasts from Patients with Fabry’s Disease: Treatment with Purified α-Galactosidase from Ficin.” Pediatric Research 7 (8): 684–90. doi:10.1203/00006450-197308000-00002.

De Maria, R., L. Lenti, F. Malisan, F. D’Agostino, B. Tomassini, A. Zeuner, M. R. Rippo, and R. Testi. 1997. “Requirement for GD3 Ganglioside in CD95- and Ceramide-Induced Apoptosis.” Science (New York, N.Y.) 277 (5332): 1652–55. http://www.ncbi.nlm.nih.gov/pubmed/9287216.

Dean, K. J., and C. C. Sweeley. 1979. “Studies on Human Liver Alpha-Galactosidases. I. Purification of Alpha-Galactosidase A and Its Enzymatic Properties with Glycolipid and Oligosaccharide Substrates.” The Journal of Biological Chemistry 254 (20): 9994–10000.

122

http://www.ncbi.nlm.nih.gov/pubmed/39940.

Deegan, P. B., A. F. Baehner, M. A. Barba Romero, D. A. Hughes, C. Kampmann, and M. Beck. 2006. “Natural History of Fabry Disease in Females in the Fabry Outcome Survey.” Journal of Medical Genetics 43 (September 2009): 347–52. doi:10.1136/jmg.2005.036327.

Deegan, Patrick B. 2012. “Fabry Disease, Enzyme Replacement Therapy and the Significance of Antibody Responses.” Journal of Inherited Metabolic Disease 35 (2): 227–43. doi:10.1007/s10545-011-9400-y.

Dehout, F., D. Roland, S. Treille de Granseigne, B. Guillaume, and L. Van Maldergem. 2004. “Relief of Gastrointestinal Symptoms under Enzyme Replacement Therapy [Corrected] in Patients with Fabry Disease.” Journal of Inherited Metabolic Disease 27 (4): 499–505. doi:10.1023/B:BOLI.0000037342.59612.69.

Delézay, O., D. Hammache, J. Fantini, and N. Yahi. 1996. “SPC3, a V3 Loop-Derived Synthetic Peptide Inhibitor of HIV-1 Infection, Binds to Cell Surface Glycosphingolipids.” Biochemistry 35 (49): 15663–71. doi:10.1021/bi961205g.

Dell’Angelica, E. C., R. Puertollano, C. Mullins, R. C. Aguilar, J. D. Vargas, L. M. Hartnell, and J. S. Bonifacino. 2000. “GGAs: A Family of ADP Ribosylation Factor-Binding Proteins Related to Adaptors and Associated with the Golgi Complex.” The Journal of Cell Biology 149 (1): 81–94. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2175099&tool=pmcentrez&ren dertype=abstract.

Desnick, R. J., K. Y. Allen, S. J. Desnick, M. K. Raman, R. W. Bernlohr, and W. Krivit. 1973. “Fabry’s Disease: Enzymatic Diagnosis of Hemizygotes and Heterozygotes. Alpha- Galactosidase Activities in Plasma, Serum, Urine, and Leukocytes.” The Journal of Laboratory and Clinical Medicine 81 (2): 157–71. http://www.ncbi.nlm.nih.gov/pubmed/4683418.

Desnick, R. J., L. C. Blieden, H. L. Sharp, P. J. Hofschire, and J. H. Moller. 1976. “Cardiac Valvular Anomalies in Fabry Disease. Clinical, Morphologic, and Biochemical Studies.” Circulation 54 (5): 818–25. http://www.ncbi.nlm.nih.gov/pubmed/824066.

123

Desnick, R. J., G. Dawson, S. J. Desnick, C. C. Sweeley, and W. Krivit. 1971. “Diagnosis of Glycosphingolipidoses by Urinary-Sediment Analysis.” The New England Journal of Medicine 284 (14): 739–44. doi:10.1056/NEJM197104082841401.

Desnick, R. J., K. J. Dean, G. A. Grabowski, D. F. Bishop, and C. C. Sweeley. 1980. “Enzyme Therapy XVII: Metabolic and Immunologic Evaluation of Alpha- Galactosidase A Replacement in Fabry Disease.” Birth Defects Original Article Series 16 (1): 393–413. http://www.ncbi.nlm.nih.gov/pubmed/6256019.

Desnick, R. J., K. J. Dean, G. Grabowski, D. F. Bishop, and C. C. Sweeley. 1979. “Enzyme Therapy in Fabry Disease: Differential in Vivo Plasma Clearance and Metabolic Effectiveness of Plasma and Splenic Alpha-Galactosidase A Isozymes.” Proceedings of the National Academy of Sciences of the United States of America 76 (10): 5326–30. doi:10.1073/pnas.76.10.5326.

Desnick, R. J., R. L. Simmons, K. Y. Allen, J. E. Woods, C. F. Anderson, J. S. Najarian, and W. Krivit. 1972. “Correction of Enzymatic Deficiencies by Renal Transplantation: Fabry’s Disease.” Surgery 72 (2): 203–11. http://www.ncbi.nlm.nih.gov/pubmed/4559379.

Desnick, Robert J., Roscoe Brady, John Barranger, Allan J. Collins, Dominique P. Germain, Martin Goldman, Gregory Grabowski, Seymour Packman, and William R. Wilcox. 2003. “Fabry Disease, an under-Recognized Multisystemic Disorder: Expert Recommendations for Diagnosis, Management, and Enzyme Replacement Therapy.” Annals of Internal Medicine. doi:10.7326/0003-4819-138-4-200302180-00014.

Desnick, Robert J., Yiannis A. Ioannou, and Christine M. Eng. 2001. “Alpha-Galactosidase A Deficiency: Fabry Disease.” In The Metabolic and Molecular Bases of Inherited Disease, edited by C R Scriver, A L Beaudet, W S Sly, and D Valle, 8th ed., 3733–3774. New York: McGraw-Hill.

Desnick, Robert J., and Edward H. Schuchman. 2002. “Enzyme Replacement and Enhancement Therapies: Lessons from Lysosomal Disorders.” Nature Reviews. Genetics 3 (12): 954–66. doi:10.1038/nrg963.

DeVeber, G. A., G. A. Schwarting, E. H. Kolodny, and N. W. Kowall. 1992. “Fabry Disease:

124

Immunocytochemical Characterization of Neuronal Involvement.” Annals of Neurology 31 (4): 409–15. doi:10.1002/ana.410310410.

Donati, D., R. Novario, and L. Gastaldi. 1987. “Natural History and Treatment of Uremia Secondary to Fabry’s Disease: An European Experience.” Nephron 46 (4): 353–59. http://www.ncbi.nlm.nih.gov/pubmed/3116442.

Doray, Balraj, Kerry Bruns, Pradipta Ghosh, and Stuart Kornfeld. 2002. “Interaction of the Cation- Dependent Mannose 6-Phosphate Receptor with GGA Proteins.” The Journal of Biological Chemistry 277 (21): 18477–82. doi:10.1074/jbc.M201879200.

Doray, Balraj, Pradipta Ghosh, Janice Griffith, Hans J. Geuze, and Stuart Kornfeld. 2002. “Cooperation of GGAs and AP-1 in Packaging MPRs at the Trans-Golgi Network.” Science (New York, N.Y.) 297 (5587): 1700–1703. doi:10.1126/science.1075327.

Dorrell, C, OI Gan, DS Pereira, RG Hawley, and JE Dick. 2000. “Expansion of Human Cord Blood CD34(+)CD38(-) Cells in Ex Vivo Culture during Retroviral Transduction without a Corresponding Increase in SCID Repopulating Cell (SRC) Frequency: Dissociation of SRC Phenotype and Function.” Blood 95 (1): 102–10.

El Dib, R., H. Gomaa, R. P. Carvalho, S. E. Camargo, R. Bazan, P. Barretti, and F. C. Barreto. 2016. “Enzyme Replacement Therapy for Anderson-Fabry Disease.” The Cochrane Database of Systematic Reviews 2: CD006663. doi:10.1002/14651858.CD006663.pub4.

Elleder, M. 1985. “Fabry’s Disease: Absence of Storage as a Feature of Liver Sinus Endothelium.” Acta Histochemica 77 (1): 33–36. doi:10.1016/S0065-1281(85)80010-6.

Elleder, M., H. Poupĕtová, and V. Kozich. 1998. “Fetal Pathology in Fabry’s Disease and Mucopolysaccharidosis Type I.” Ceskoslovenska Patologie 34 (1): 7–12. http://www.ncbi.nlm.nih.gov/pubmed/9560877.

Eng, C. M., G. A. Ashley, T. S. Burgert, A. L. Enriquez, M. D’Souza, and R. J. Desnick. 1997. “Fabry Disease: Thirty-Five Mutations in the Alpha-Galactosidase A Gene in Patients with Classic and Variant Phenotypes.” Molecular Medicine (Cambridge, Mass.) 3 (3): 174–82. http://www.ncbi.nlm.nih.gov/pubmed/9100224.

125

Eng, C. M., M. Banikazemi, R. E. Gordon, M. Goldman, R. Phelps, L. Kim, A. Gass, et al. 2001. “A Phase 1/2 Clinical Trial of Enzyme Replacement in Fabry Disease: Pharmacokinetic, Substrate Clearance, and Safety Studies.” American Journal of Human Genetics 68 (3): 711– 22. doi:10.1086/318809.

Eng, C. M., and R. J. Desnick. 1994. “Molecular Basis of Fabry Disease: Mutations and Polymorphisms in the Human Alpha-Galactosidase A Gene.” Human Mutation 3 (2): 103– 11. doi:10.1002/humu.1380030204.

Eng, C. M., J. Fletcher, W. R. Wilcox, S. Waldek, C. R. Scott, D. O. Sillence, F. Breunig, et al. 2007. “Fabry Disease: Baseline Medical Characteristics of a Cohort of 1765 Males and Females in the Fabry Registry.” Journal of Inherited Metabolic Disease 30 (2): 184–92. doi:10.1007/s10545-007-0521-2.

Eng, C. M., N. Guffon, W. R. Wilcox, D. P. Germain, P. Lee, S. Waldek, L. Caplan, G. E. Linthorst, and R. J. Desnick. 2001. “Safety and Efficacy of Recombinant Human Alpha- Galactosidase A--Replacement Therapy in Fabry’s Disease.” N Engl J Med 345 (1): 9–16. doi:10.1056/NEJM200107053450102.

Eng, C. M., L. A. Resnick-Silverman, D. J. Niehaus, K. H. Astrin, and R. J. Desnick. 1993. “Nature and Frequency of Mutations in the Alpha-Galactosidase A Gene That Cause Fabry Disease.” American Journal of Human Genetics 53 (6): 1186–97. http://www.ncbi.nlm.nih.gov/pubmed/7504405.

Erten, Y., F. N. Özdemir, B. Demirhan, H. Karakayali, A. Demiraǧ, and H. Akkoç. 1998. “A Case of Fabry’s Disease with Normal Kidney Function at 10 Years after Successful Renal Transplantation.” Transplantation Proceedings 30 (3): 842–43. doi:10.1016/S0041- 1345(98)00071-2.

Estruch, Elaine Joanna, Stephen Lewis Hart, Christine Kinnon, and Bryan G. Winchester. 2001. “Non-Viral, Integrin-Mediated Gene Transfer into Fibroblasts from Patients with Lysosomal Storage Diseases.” Journal of Gene Medicine 3 (5): 488–97. doi:10.1002/jgm.214.

Falguières, T., F. Mallard, C. Baron, D. Hanau, C. Lingwood, B. Goud, J. Salamero, and L. Johannes. 2001. “Targeting of Shiga Toxin B-Subunit to Retrograde Transport Route in

126

Association with Detergent-Resistant Membranes.” Molecular Biology of the Cell 12 (8): 2453–68. http://www.ncbi.nlm.nih.gov/pubmed/11514628.

Fan, J. Q., S. Ishii, N. Asano, and Y. Suzuki. 1999. “Accelerated Transport and Maturation of Lysosomal Alpha-Galactosidase A in Fabry Lymphoblasts by an Enzyme Inhibitor.” Nature Medicine 5 (1): 112–15. doi:10.1038/4801.

Fantini, J., D. G. Cook, N. Nathanson, S. L. Spitalnik, and F. Gonzalez-Scarano. 1993. “Infection of Colonic Epithelial Cell Lines by Type 1 Human Immunodeficiency Virus Is Associated with Cell Surface Expression of Galactosylceramide, a Potential Alternative gp120 Receptor.” Proceedings of the National Academy of Sciences of the United States of America 90 (7): 2700–2704. http://www.ncbi.nlm.nih.gov/pubmed/8464878.

Fantini, J., D. Hammache, O. Delézay, N. Yahi, C. André-Barrès, I. Rico-Lattes, and A. Lattes. 1997. “Synthetic Soluble Analogs of Galactosylceramide (GalCer) Bind to the V3 Domain of HIV-1 gp120 and Inhibit HIV-1-Induced Fusion and Entry.” The Journal of Biological Chemistry 272 (11): 7245–52. http://www.ncbi.nlm.nih.gov/pubmed/9054420.

Faraggiana, T., J. Churg, E. Grishman, L. Strauss, A. Prado, D. F. Bishop, E. Schuchman, and R. J. Desnick. 1981. “Light- and Electron-Microscopic Histochemistry of Fabry’s Disease.” The American Journal of Pathology 103 (2): 247–62. http://www.ncbi.nlm.nih.gov/pubmed/6786101.

Farooqui, A. A., T. Farooqui, A. J. Yates, and L. A. Horrocks. 1988. “Regulation of Protein Kinase C Activity by Various Lipids.” Neurochemical Research 13 (6): 499–511. http://www.ncbi.nlm.nih.gov/pubmed/3043250.

Feingold, Kenneth R., and Peter M. Elias. 2014. “Role of Lipids in the Formation and Maintenance of the Cutaneous Permeability Barrier.” Biochimica et Biophysica Acta 1841 (3): 280–94. doi:10.1016/j.bbalip.2013.11.007.

Feriozzi, Sandro, Andreas Schwarting, Gere Sunder-Plassmann, Michael West, and Markus Cybulla. 2009. “Agalsidase Alfa Slows the Decline in Renal Function in Patients with Fabry Disease.” American Journal of Nephrology 29 (5): 353–61. doi:10.1159/000168482.

127

Ferrans, V. J., R. G. Hibbs, and C. D. Burda. 1969. “The Heart in Fabry’s Disease. A Histochemical and Electron Microscopic Study.” The American Journal of Cardiology 24 (1): 95–110. http://www.ncbi.nlm.nih.gov/pubmed/4893820.

Font, R. L., and B. S. Fine. 1972. “Ocular Pathology in Fabry’s Disease. Histochemical and Electron Microscopic Observations.” American Journal of Ophthalmology 73 (3): 419–30. http://www.ncbi.nlm.nih.gov/pubmed/4335185.

Forstner, G. G., K. Tanaka, and K. J. Isselbacher. 1968. “Lipid Composition of the Isolated Rat Intestinal Microvillus Membrane.” The Biochemical Journal 109 (1): 51–59. http://www.ncbi.nlm.nih.gov/pubmed/5669848.

Fox, M. F., D. L. DuToit, L. Warnich, and A. E. Retief. 1984. “Regional Localization of Alpha- Galactosidase (GLA) to Xpter----q22, Hexosaminidase B (HEXB) to 5q13----Qter, and Arylsulfatase B (ARSB) to 5pter----q13.” Cytogenetics and Cell Genetics 38 (1): 45–49. http://www.ncbi.nlm.nih.gov/pubmed/6323102.

Franceschetti, A. T. 1968. “Cornea Verticillata (Gruber) and Its Relation to Fabry’s Disease (Angiokeratoma Corporis Diffusum).” Ophthalmologica 156 (3): 232–38. http://www.ncbi.nlm.nih.gov/pubmed/5304462.

Frenzel, André, Michael Hust, and Thomas Schirrmann. 2013. “Expression of Recombinant Antibodies.” Frontiers in Immunology. doi:10.3389/fimmu.2013.00217.

Friedman, L. S., S. E. Kirkham, J. R. Thistlethwaite, D. Platika, E. H. Kolodny, and M. D. Schuffler. 1984. Jejunal diverticulosis with perforation as a complication of Fabry’s disease., 86 Gastroenterology 558–63.

Frustaci, Andrea, Cristina Chimenti, Roberta Ricci, Luigi Natale, Matteo A. Russo, Maurizio Pieroni, Christine M. Eng, and Robert J. Desnick. 2001. “Improvement in Cardiac Function in the Cardiac Variant of Fabry’s Disease with Galactose-Infusion Therapy.” New England Journal of Medicine 345 (1): 25–32. doi:10.1056/NEJM200107053450104.

Fürst, W., and K. Sandhoff. 1992. “Activator Proteins and Topology of Lysosomal Sphingolipid Catabolism.” Biochimica et Biophysica Acta 1126 (1): 1–16.

128

http://www.ncbi.nlm.nih.gov/pubmed/1606169.

Gao, Guangping, You Lu, Roberto Calcedo, Rebecca L. Grant, Peter Bell, Lili Wang, Joanita Figueredo, Martin Lock, and James M. Wilson. 2006. “Biology of AAV Serotype Vectors in Liver-Directed Gene Transfer to Nonhuman Primates.” Molecular Therapy 13 (1): 77–87. doi:10.1016/j.ymthe.2005.08.017.

Garman, Richard D., K. Munroe, and S. M. Richards. 2004. “Methotrexate Reduces Antibody Responses to Recombinant Human α-Galactosidase A Therapy in a Mouse Model of Fabry Disease.” Clinical and Experimental Immunology 137 (3): 496–502. doi:10.1111/j.1365- 2249.2004.02567.x.

Garman, Scott C., and David N. Garboczi. 2004. “The Molecular Defect Leading to Fabry Disease: Structure of Human Alpha-Galactosidase.” Journal of Molecular Biology 337 (2): 319–35. doi:10.1016/j.jmb.2004.01.035.

GE Healthcare. 2010. “Strategies for Protein Purification Handbook,” 167.

Gemignani, F., A. Marbini, M. M. Bragaglia, and E. Govoni. 1984. “Pathological Study of the Sural Nerve in Fabry’s Disease.” Eur Neurol 23 (3): 173–81. http://www.ncbi.nlm.nih.gov/pubmed/6088246.

Germain, Dominique P., Roberto Giugliani, Derralynn A. Hughes, Atul Mehta, Kathy Nicholls, Laura Barisoni, Charles J. Jennette, et al. 2012. “Safety and Pharmacodynamic Effects of a Pharmacological Chaperone on α-Galactosidase A Activity and Globotriaosylceramide Clearance in Fabry Disease: Report from Two Phase 2 Clinical Studies.” Orphanet Journal of Rare Diseases 7 (1): 91. doi:10.1186/1750-1172-7-91.

Germain, Dominique P., Stephen Waldek, Maryam Banikazemi, David A. Bushinsky, Joel Charrow, Robert J. Desnick, Philip Lee, et al. 2007. “Sustained, Long-Term Renal Stabilization After 54 Months of Agalsidase Beta Therapy in Patients with Fabry Disease.” Journal of the American Society of Nephrology 18 (5): 1547–57. doi:10.1681/ASN.2006080816.

Ghaderi, Darius, Rachel E. Taylor, Vered Padler-Karavani, Sandra Diaz, and Ajit Varki. 2010.

129

“Implications of the Presence of N-Glycolylneuraminic Acid in Recombinant Therapeutic Glycoproteins.” Nature Biotechnology 28 (8): 863–67. doi:10.1038/nbt.1651.

Ghosh, Pradipta, and Stuart Kornfeld. 2004. “The Cytoplasmic Tail of the Cation-Independent Mannose 6-Phosphate Receptor Contains Four Binding Sites for AP-1.” Archives of Biochemistry and Biophysics 426 (2): 225–30. doi:10.1016/j.abb.2004.02.011.

Gil, A., and N. J. Proudfoot. 1987. “Position-Dependent Sequence Elements Downstream of AAUAAA Are Required for Efficient Rabbit Beta-Globin mRNA 3’ End Formation.” Cell 49 (3): 399–406. http://www.ncbi.nlm.nih.gov/pubmed/3568131.

Gillard, B. K., R. G. Clement, and D. M. Marcus. 1998. “Variations among Cell Lines in the Synthesis of Sphingolipids in de Novo and Recycling Pathways.” Glycobiology 8 (9): 885– 90. http://www.ncbi.nlm.nih.gov/pubmed/9675221.

Giugliani, Roberto, Ana-Carolina Brusius-Facchin, Gabriela Pasqualim, Sandra Leistner-Segal, Mariluce Riegel, and Ursula Matte. 2016. “Current Molecular Genetics Strategies for the Diagnosis of Lysosomal Storage Disorders.” Expert Review of Molecular Diagnostics 16 (1): 113–23. doi:10.1586/14737159.2016.1121101.

Giussani, Paola, Thomas Colleoni, Loredana Brioschi, Rosaria Bassi, Kentaro Hanada, Guido Tettamanti, Laura Riboni, and Paola Viani. 2008. “Ceramide Traffic in C6 Glioma Cells: Evidence for CERT-Dependent and Independent Transport from ER to the Golgi Apparatus.” Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids 1781 (1–2): 40–51. doi:10.1016/j.bbalip.2007.11.002.

Goker-Alpan, Ozlem, Nicola Longo, Marie McDonald, Suma P. Shankar, Raphael Schiffmann, Peter Chang, Yinghua Shen, and Arian Pano. 2016. “An Open-Label Clinical Trial of Agalsidase Alfa Enzyme Replacement Therapy in Children with Fabry Disease Who Are Naïve to Enzyme Replacement Therapy.” Drug Design, Development and Therapy 10: 1771– 81. doi:10.2147/DDDT.S102761.

Goker-Alpan, Ozlem, Grisel Lopez, Joseph Vithayathil, Joie Davis, Mark Hallett, and Ellen Sidransky. 2008. “The Spectrum of Parkinsonian Manifestations Associated with Glucocerebrosidase Mutations.” Archives of Neurology 65 (10): 1353–57.

130

doi:10.1001/archneur.65.10.1353.

Goldwater, Paul N. 2007. “Treatment and Prevention of Enterohemorrhagic Escherichia Coli Infection and Hemolytic Uremic Syndrome.” Expert Review of Anti-Infective Therapy 5 (4): 653–63. doi:10.1586/14787210.5.4.653.

Gonçalves, Manuel A. F. V. 2005. “Adeno-Associated Virus: From Defective Virus to Effective Vector.” Virology Journal 2: 43. doi:10.1186/1743-422X-2-43.

Gonzalez-Noriega, A., J. H. Grubb, V. Talkad, and W. S. Sly. 1980. “Chloroquine Inhibits Lysosomal Enzyme Pinocytosis and Enhances Lysosomal Enzyme Secretion by Impairing Receptor Recycling.” The Journal of Cell Biology 85 (3): 839–52. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2111452&tool=pmcentrez&ren dertype=abstract.

Gothot, A, J C van der Loo, D W Clapp, and E F Srour. 1998. “Cell Cycle-Related Changes in Repopulating Capacity of Human Mobilized Peripheral Blood CD34(+) Cells in Non-Obese Diabetic/severe Combined Immune-Deficient Mice.” Blood 92 (8): 2641–49.

Gribben, J. G., S. Devereux, N. S. B. Thomas, M. Keim, H. M. Jones, A. H. Goldstone, and D. C. Linch. 1990. “Development of Antibodies to Unprotected Glycosylation Sites on Recombinant Human GM-CSF.” The Lancet 335 (8687): 434–37. doi:10.1016/0140- 6736(90)90665-R.

Grunnet, M. L., and P. R. Spilsbury. 1973. “The Central Nervous System in Fabry’s Disease. An Ultrastructural Study.” Archives of Neurology 28 (4): 231–34. http://www.ncbi.nlm.nih.gov/pubmed/4347323.

Guan, Feng, Kazuko Handa, and Sen-itiroh Hakomori. 2009. “Specific Glycosphingolipids Mediate Epithelial-to-Mesenchymal Transition of Human and Mouse Epithelial Cell Lines.” Proceedings of the National Academy of Sciences of the United States of America 106 (18): 7461–66. doi:10.1073/pnas.0902368106.

Guan, Feng, Lana Schaffer, Kazuko Handa, and Sen-Itiroh Hakomori. 2010. “Functional Role of Gangliotetraosylceramide in Epithelial-to-Mesenchymal Transition Process Induced by

131

Hypoxia and by TGF-{beta}.” FASEB Journal : Official Publication of the Federation of American Societies for Experimental Biology 24 (12): 4889–4903. doi:10.1096/fj.10-162107.

Guce, Abigail I., Nathaniel E. Clark, Jerome J. Rogich, and Scott C. Garman. 2011. “The Molecular Basis of Pharmacological Chaperoning in Human α-Galactosidase.” Chemistry and Biology 18 (12): 1521–26. doi:10.1016/j.chembiol.2011.10.012.

Guenechea, G, O I Gan, T Inamitsu, C Dorrell, D S Pereira, M Kelly, L Naldini, and J E Dick. 2000. “Transduction of Human CD34+ CD38- Bone Marrow and Cord Blood-Derived SCID- Repopulating Cells with Third-Generation Lentiviral Vectors.” Molecular Therapy : The Journal of the American Society of Gene Therapy 1 (6): 566–73. doi:10.1006/mthe.2000.0077.

Hacein-Bey-Abina, S, C Von Kalle, M Schmidt, M P McCormack, N Wulffraat, P Leboulch, A Lim, et al. 2003. “LMO2-Associated Clonal T Cell Proliferation in Two Patients after Gene Therapy for SCID-X1.” Science (New York, N.Y.) 302 (5644): 415–19.

Hajioff, D., Y. Enever, R. Quiney, J. Zuckerman, K. Macdermot, and A. Mehta. 2003. “Hearing Loss in Fabry Disease: The Effect of Agalsidase Alfa Replacement Therapy.” Journal of Inherited Metabolic Disease 26 (8): 787–94. doi:10.1023/B:BOLI.0000009948.86528.72.

Hajioff, D., S. Goodwin, R. Quiney, J. Zuckerman, K. D. MacDermot, and A. Mehta. 2003. “Hearing Improvement in Patients with Fabry Disease Treated with Agalsidase Alfa.” Acta Paediatrica 92 (443): 28–30. doi:10.1080/08035320310000429.

Hajioff, D., S. Hegemannn, G. Conti, M. Beck, G. Sunder-Plassmann, U. Widmer, A. Mehta, and A. Keilmann. 2006. “Agalsidase Alpha and Hearing in Fabry Disease: Data from the Fabry Outcome Survey.” European Journal of Clinical Investigation 36 (9): 663–67. doi:10.1111/j.1365-2362.2006.01701.x.

Hakomori, S. 1986. “Tumor-Associated Glycolipid Antigens, Their Metabolism and Organization.” Chemistry and Physics of Lipids 42 (1–3): 209–33. http://www.ncbi.nlm.nih.gov/pubmed/2435423.

Halter, David, Sylvia Neumann, Suzanne M. van Dijk, Jasja Wolthoorn, Ann M. de Mazière, Otilia

132

V. Vieira, Peter Mattjus, Judith Klumperman, Gerrit van Meer, and Hein Sprong. 2007. “Pre- and Post-Golgi Translocation of Glucosylceramide in Glycosphingolipid Synthesis.” The Journal of Cell Biology 179 (1): 101–15. doi:10.1083/jcb.200704091.

Hammache, D., G. Piéroni, N. Yahi, O. Delézay, N. Koch, H. Lafont, C. Tamalet, and J. Fantini. 1998. “Specific Interaction of HIV-1 and HIV-2 Surface Envelope Glycoproteins with Monolayers of Galactosylceramide and Ganglioside GM3.” The Journal of Biological Chemistry 273 (14): 7967–71. http://www.ncbi.nlm.nih.gov/pubmed/9525894.

Hammache, D., N. Yahi, G. Piéroni, F. Ariasi, C. Tamalet, and J. Fantini. 1998. “Sequential Interaction of CD4 and HIV-1 gp120 with a Reconstituted Membrane Patch of Ganglioside GM3: Implications for the Role of Glycolipids as Potential HIV-1 Fusion Cofactors.” Biochemical and Biophysical Research Communications 246 (1): 117–22. doi:10.1006/bbrc.1998.8531.

Hanada, Kentaro, Keigo Kumagai, Satoshi Yasuda, Yukiko Miura, Miyuki Kawano, Masayoshi Fukasawa, and Masahiro Nishijima. 2003. “Molecular Machinery for Non-Vesicular Trafficking of Ceramide.” Nature 426 (6968): 803–9. doi:10.1038/nature02188.

Hara, J., K. Higuchi, R. Okamoto, M. Kawashima, and G. Imokawa. 2000. “High-Expression of Sphingomyelin Deacylase Is an Important Determinant of Ceramide Deficiency Leading to Barrier Disruption in Atopic Dermatitis.” The Journal of Investigative Dermatology 115 (3): 406–13. doi:10.1046/j.1523-1747.2000.00072.x.

Harouse, J. M., R. G. Collman, and F. González-Scarano. 1995. “Human Immunodeficiency Virus Type 1 Infection of SK-N-MC Cells: Domains of gp120 Involved in Entry into a CD4- Negative, Galactosyl ceramide/3’ Sulfo-Galactosyl Ceramide-Positive Cell Line.” Journal of Virology 69 (12): 7383–90. http://www.ncbi.nlm.nih.gov/pubmed/7494242.

Harter, C., and I. Mellman. 1992. “Transport of the Lysosomal Membrane Glycoprotein lgp120 (Lgp-A) to Lysosomes Does Not Require Appearance on the Plasma Membrane.” The Journal of Cell Biology 117 (2): 311–25. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2289424&tool=pmcentrez&ren dertype=abstract.

133

Hashimoto, K., B. G. Gross, and W. F. Lever. 1965. “ANGIOKERATOMA CORPORIS DIFFUSUM (FABRY). HISTOCHEMICAL AND ELECTRON MICROSCOPIC STUDIES OF THE SKIN.” The Journal of Investigative Dermatology 44 (February): 119–28. http://www.ncbi.nlm.nih.gov/pubmed/14258908.

Hasholt, Lis, and S. A. Sørensen. 1984. “A Microtechnique for Quantitative Measurements of Acid Hydrolases in Fibroblasts. Its Application in Diagnosis of Fabry Disease and Enzyme Replacement Studies.” Clinica Chimica Acta 142 (2): 257–61. doi:10.1016/0009- 8981(84)90384-X.

Hiesberger, T., S. Hüttler, A. Rohlmann, W. Schneider, K. Sandhoff, and J. Herz. 1998. “Cellular Uptake of Saposin (SAP) Precursor and Lysosomal Delivery by the Low Density Lipoprotein Receptor-Related Protein (LRP).” The EMBO Journal 17 (16): 4617–25. doi:10.1093/emboj/17.16.4617.

Hirst, J., W. W. Lui, N. A. Bright, N. Totty, M. N. Seaman, and M. S. Robinson. 2000. “A Family of Proteins with Gamma-Adaptin and VHS Domains That Facilitate Trafficking between the Trans-Golgi Network and the Vacuole/lysosome.” The Journal of Cell Biology 149 (1): 67– 80. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2175106&tool=pmcentrez&ren dertype=abstract.

Ho, M. W. 1973. “Hydrolysis of Ceramide Trihexoside by a Specific -Galactosidase from Human Liver.” The Biochemical Journal 133 (1): 1–10. http://www.ncbi.nlm.nih.gov/pubmed/4721621.

Hoffmann, Bjoern, Martin Schwarz, Atul Mehta, and Satish Keshav. 2007. “Gastrointestinal Symptoms in 342 Patients With Fabry Disease: Prevalence and Response to Enzyme Replacement Therapy.” Clinical Gastroenterology and Hepatology 5 (12): 1447–53. doi:10.1016/j.cgh.2007.08.012.

Hollak, Carla E. M., Derralynn Hughes, Ivo N. Van Schaik, Barbara Schwierin, and Bruno Bembi. 2009. “Miglustat (Zavesca) in Type 1 Gaucher Disease: 5-Year Results of a Post- Authorisation Safety Surveillance Programme.” Pharmacoepidemiology and Drug Safety 18

134

(9): 770–77. doi:10.1002/pds.1779.

Holleran, Walter M., Edward I. Ginns, Gopinathan K. Menon, Jens Uwe Grundmann, Manigé Fartasch, Cindy E. McKinney, Peter M. Elias, and Ellen Sidransky. 1994. “Consequences of β-Glucocerebrosidase Deficiency in Epidermis: Ultrastructure and Permeability Barrier Alterations in Gaucher Disease.” Journal of Clinical Investigation 93 (4): 1756–64. doi:10.1172/JCI117160.

Holleran, Walter M., Yutaka Takagi, and Yoshikazu Uchida. 2006. “Epidermal Sphingolipids: Metabolism, Function, and Roles in Skin Disorders.” FEBS Letters 580 (23): 5456–66. doi:10.1016/j.febslet.2006.08.039.

Höning, S., J. Griffith, H. J. Geuze, and W. Hunziker. 1996. “The Tyrosine-Based Lysosomal Targeting Signal in Lamp-1 Mediates Sorting into Golgi-Derived Clathrin-Coated Vesicles.” The EMBO Journal 15 (19): 5230–39. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=452267&tool=pmcentrez&rend ertype=abstract.

Höning, S., M. Sosa, A. Hille-Rehfeld, and K. von Figura. 1997. “The 46-kDa Mannose 6- Phosphate Receptor Contains Multiple Binding Sites for Clathrin Adaptors.” The Journal of Biological Chemistry 272 (32): 19884–90. http://www.ncbi.nlm.nih.gov/pubmed/9242653.

Hopkin, Robert J., John Bissler, Maryam Banikazemi, Lorne Clarke, Christine M. Eng, Dominique P. Germain, Roberta Lemay, Anna Tylki-Szymanska, and William R. Wilcox. 2008. “Characterization of Fabry Disease in 352 Pediatric Patients in the Fabry Registry.” Pediatric Research 64 (5): 550–55. doi:10.1203/PDR.0b013e318183f132.

Hopkin, Robert J., John L. Jefferies, Dawn A. Laney, Victoria H. Lawson, Michael Mauer, Matthew R. Taylor, and William R. Wilcox. 2015. “The Management and Treatment of Children with Fabry Disease: A United States-Based Perspective.” Molecular Genetics and Metabolism 117: 104–13. doi:10.1016/j.ymgme.2015.10.007.

Hopkins, Patrick V., Carlene Campbell, Tracy Klug, Sharmini Rogers, Julie Raburn-Miller, and Jami Kiesling. 2015. “Lysosomal Storage Disorder Screening Implementation: Findings from the First Six Months of Full Population Pilot Testing in Missouri.” The Journal of Pediatrics

135

166 (1): 172–77. doi:10.1016/j.jpeds.2014.09.023.

Hughes, D. A., P. M. Elliott, J. Shah, J. Zuckerman, G. Coghlan, J. Brookes, and A. B. Mehta. 2008. “Effects of Enzyme Replacement Therapy on the Cardiomyopathy of Anderson Fabry Disease: A Randomised, Double-Blind, Placebo-Controlled Clinical Trial of Agalsidase Alfa.” Heart 94 (2): 153–58. doi:10.1136/hrt.2006.104026.

Hult, Malin, Niklas Darin, Ulrika von Döbeln, and Jan-Eric Månsson. 2014. “Epidemiology of Lysosomal Storage Diseases in Sweden.” Acta Paediatrica (Oslo, Norway : 1992) 103 (12): 1258–63. doi:10.1111/apa.12807.

Hurlbut, Gregory D., Robin J. Ziegler, Jennifer B. Nietupski, Joseph W. Foley, Lisa A. Woodworth, Elizabeth Meyers, Scott D. Bercury, et al. 2010. “Preexisting Immunity and Low Expression in Primates Highlight Translational Challenges for Liver-Directed AAV8- Mediated Gene Therapy.” Molecular Therapy: The Journal of the American Society of Gene Therapy 18 (11): 1983–94. doi:10.1038/mt.2010.175.

Hwu, Wuh-Liang, Yin-Hsiu Chien, Ni-Chung Lee, Shu-Chuan Chiang, Robert Dobrovolny, Ai- Chu Huang, Hui-Ying Yeh, et al. 2009. “Newborn Screening for Fabry Disease in Taiwan Reveals a High Incidence of the Later-Onset GLA Mutation c.936+919G>A (IVS4+919G>A).” Human Mutation 30 (10): 1397–1405. doi:10.1002/humu.21074.

Ichikawa, S., and Y. Hirabayashi. 1998. “Glucosylceramide Synthase and Glycosphingolipid Synthesis.” Trends in Cell Biology 8 (5): 198–202. http://www.ncbi.nlm.nih.gov/pubmed/9695839.

Inoue, Takahito, Kiyoko Hattori, Kenji Ihara, Atsushi Ishii, Kimitoshi Nakamura, and Shinichi Hirose. 2013. “Newborn Screening for Fabry Disease in Japan: Prevalence and Genotypes of Fabry Disease in a Pilot Study.” Journal of Human Genetics 58 (8): 548–52. doi:10.1038/jhg.2013.48.

Inui, K., M. Emmett, and D. A. Wenger. 1983. “Immunological Evidence for Deficiency in an Activator Protein for Sulfatide Sulfatase in a Variant Form of Metachromatic Leukodystrophy.” Proceedings of the National Academy of Sciences of the United States of America 80 (10): 3074–77. http://www.ncbi.nlm.nih.gov/pubmed/6134282.

136

Ioannou, Y. A. 2000. “The Structure and Function of the Niemann-Pick C1 Protein.” Molecular Genetics and Metabolism 71 (1–2): 175–81. doi:10.1006/mgme.2000.3061.

Ioannou, Y. A., K. M. Zeidner, M. E. Grace, and R. J. Desnick. 1998. “Human Alpha- Galactosidase A: Glycosylation Site 3 Is Essential for Enzyme Solubility.” Biochemical Journal 332 (Pt 3): 789–97. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1219542/%5Cnhttp://www.ncbi.nlm.nih.go v/pmc/articles/PMC1219542/pdf/9620884.pdf.

Jacewicz, M., H. Clausen, E. Nudelman, A. Donohue-Rolfe, and G. T. Keusch. 1986. “Pathogenesis of Shigella Diarrhea. XI. Isolation of a Shigella Toxin-Binding Glycolipid from Rabbit Jejunum and HeLa Cells and Its Identification as Globotriaosylceramide.” The Journal of Experimental Medicine 163 (6): 1391–1404. http://www.ncbi.nlm.nih.gov/pubmed/3519828.

Jahic, Mehmedalija, Andres Veide, Theppanya Charoenrat, Tuula Teeri, and Sven-Olof Enfors. 2006. “Process Technology for Production and Recovery of Heterologous Proteins with Pichia Pastoris.” Biotechnology Progress 22 (6): 1465–73. doi:10.1021/bp060171t.

Janvier, Katy, and Juan S. Bonifacino. 2005. “Role of the Endocytic Machinery in the Sorting of Lysosome-Associated Membrane Proteins.” Molecular Biology of the Cell 16 (9): 4231–42. doi:10.1091/mbc.E05-03-0213.

Jardine, D. L., M. A. Fitzpatrick, W. D. Troughton, and A. B. Tie. 1994. “Small Bowel Ischaemia in Fabry’s Disease.” Journal of Gastroenterology and Hepatology 9 (2): 201–4. http://www.ncbi.nlm.nih.gov/pubmed/8003656.

Jarvis, Donald L. 2009. “Baculovirus-Insect Cell Expression Systems.” Methods in Enzymology. doi:10.1016/S0076-6879(09)63014-7.

Jenkins, N., R. B. Parekh, and D. C. James. 1996. “Getting the Glycosylation Right: Implications for the Biotechnology Industry.” Nature Biotechnology 14 (8): 975–81. doi:10.1038/nbt0896- 975.

Jenkins, Nigel, Paula Meleady, Raymond Tyther, and Lisa Murphy. 2009. “Strategies for

137

Analysing and Improving the Expression and Quality of Recombinant Proteins Made in Mammalian Cells.” Biotechnology and Applied Biochemistry 53 (Pt 2): 73–83. doi:10.1042/BA20080258.

Jung, S. C., I. P. Han, A. Limaye, R. Xu, M. P. Gelderman, P. Zerfas, K. Tirumalai, et al. 2001. “Adeno-Associated Viral Vector-Mediated Gene Transfer Results in Long-Term Enzymatic and Functional Correction in Multiple Organs of Fabry Mice.” Proceedings of the National Academy of Sciences of the United States of America 98 (5): 2676–81. doi:10.1073/pnas.051634498.

Kabayama, Kazuya, Takashige Sato, Kumiko Saito, Nicoletta Loberto, Alessandro Prinetti, Sandro Sonnino, Masataka Kinjo, Yasuyuki Igarashi, and Jin-ichi Inokuchi. 2007. “Dissociation of the Insulin Receptor and Caveolin-1 Complex by Ganglioside GM3 in the State of Insulin Resistance.” Proceedings of the National Academy of Sciences of the United States of America 104 (34): 13678–83. doi:10.1073/pnas.0703650104.

Kampmann, Christoph, Ale Linhart, Richard B. Devereux, and Raphael Schiffmann. 2009. “Effect of Agalsidase Alfa Replacement Therapy on Fabry Disease-Related Hypertrophic Cardiomyopathy: A 12- to 36-Month, Retrospective, Blinded Echocardiographic Pooled Analysis.” Clinical Therapeutics 31 (9): 1966–76. doi:10.1016/j.clinthera.2009.09.008.

Kampmann, Christoph, Christiane M. Wiethoff, Catharina Whybra, Frank A. Baehner, Eugen Mengel, and Michael Beck. 2008. “Cardiac Manifestations of Anderson-Fabry Disease in Children and Adolescents.” Acta Paediatrica, International Journal of Paediatrics 97 (4): 463–69. doi:10.1111/j.1651-2227.2008.00700.x.

Kanehisa, Minoru, Yoko Sato, Masayuki Kawashima, Miho Furumichi, and Mao Tanabe. 2016. “KEGG as a Reference Resource for Gene and Protein Annotation.” Nucleic Acids Research 44 (D1): D457-62. doi:10.1093/nar/gkv1070.

Karmali, M. A., M. Petric, C. Lim, P. C. Fleming, G. S. Arbus, and H. Lior. 1985. “The Association between Idiopathic Hemolytic Uremic Syndrome and Infection by Verotoxin-Producing Escherichia Coli.” The Journal of Infectious Diseases 151 (5): 775–82. http://www.ncbi.nlm.nih.gov/pubmed/3886804.

138

Kase, R., U. Bierfreund, A. Klein, T. Kolter, K. Itoh, M. Suzuki, Y. Hashimoto, K. Sandhoff, and H. Sakuraba. 1996. “Only Sphingolipid Activator Protein B (SAP-B or Saposin B) Stimulates the Degradation of Globotriaosylceramide by Recombinant Human Lysosomal Alpha- Galactosidase in a Detergent-Free Liposomal System.” FEBS Letters 393 (1): 74–76. http://www.ncbi.nlm.nih.gov/pubmed/8804427.

Katagiri, Y. U., T. Mori, H. Nakajima, C. Katagiri, T. Taguchi, T. Takeda, N. Kiyokawa, and J. Fujimoto. 1999. “Activation of Src Family Kinase Yes Induced by Shiga Toxin Binding to Globotriaosyl Ceramide (Gb3/CD77) in Low Density, Detergent-Insoluble Microdomains.” The Journal of Biological Chemistry 274 (49): 35278–82. http://www.ncbi.nlm.nih.gov/pubmed/10575015.

Kawai, K., M. Fujita, and M. Nakao. 1974. “Lipid Components of Two Different Regions of an Intestinal Epithelial Cell Membrane of Mouse.” Biochimica et Biophysica Acta 369 (2): 222– 33. http://www.ncbi.nlm.nih.gov/pubmed/4371841.

Kawashima, Nagako, Seon-Joo Yoon, Kohji Itoh, and Ken-ichi Nakayama. 2009. “Tyrosine Kinase Activity of Epidermal Growth Factor Receptor Is Regulated by GM3 Binding through Carbohydrate to Carbohydrate Interactions.” The Journal of Biological Chemistry 284 (10): 6147–55. doi:10.1074/jbc.M808171200.

Keilmann, A. 2003. “Inner Ear Function in Children with Fabry Disease.” Acta Paediatrica (Oslo, Norway : 1992). Supplement 92 (443): 31–2; discussion 27. http://www.ncbi.nlm.nih.gov/pubmed/14989463.

Keilmann, A., D. Hajioff, U. Ramaswami, and FOS Investigators. 2009. “Ear Symptoms in Children with Fabry Disease: Data from the Fabry Outcome Survey.” Journal of Inherited Metabolic Disease 32 (6): 739–44. doi:10.1007/s10545-009-1290-x.

Keith, D. H., J. Singer-Sam, and A. D. Riggs. 1986. “Active X Chromosome DNA Is Unmethylated at Eight CCGG Sites Clustered in a Guanine-plus-Cytosine-Rich Island at the 5’ End of the Gene for Phosphoglycerate Kinase.” Molecular and Cellular Biology 6 (11): 4122–25. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=367182&tool=pmcentrez&rend

139

ertype=abstract.

Kennard, Malcolm L. 2011. “Engineered Mammalian Chromosomes in Cellular Protein Production: Future Prospects.” Methods in Molecular Biology (Clifton, N.J.). doi:10.1007/978-1-61779-099-7_15.

Khan, A., B. C. Au, J. Huang, S. Dworski, P. O’Hoski, N. Prokopishyn, M. Rothe, et al. n.d. “Lentivector Iterations and Pre-Clinical Scale-up/Toxicity Testing: Targeting Patient Mobilized CD34+ Hematopoietic Cells for Correction of Fabry Disease.”

Khan, Fahima, François Proulx, and Clifford A. Lingwood. 2009. “Detergent-Resistant Globotriaosyl Ceramide May Define Verotoxin/glomeruli-Restricted Hemolytic Uremic Syndrome Pathology.” Kidney International 75 (11): 1209–16. doi:10.1038/ki.2009.7.

Khanna, Richie, Rebecca Soska, Yi Lun, Jessie Feng, Michelle Frascella, Brandy Young, Nastry Brignol, et al. 2010. “The Pharmacological Chaperone 1-Deoxygalactonojirimycin Reduces Tissue Globotriaosylceramide Levels in a Mouse Model of Fabry Disease.” Molecular Therapy : The Journal of the American Society of Gene Therapy 18 (1): 23–33. doi:10.1038/mt.2009.220.

Khine, A. A., and C. A. Lingwood. 1994. “Capping and Receptor-Mediated Endocytosis of Cell- Bound Verotoxin (Shiga-like Toxin). 1: Chemical Identification of an Amino Acid in the B Subunit Necessary for Efficient Receptor Glycolipid Binding and Cellular Internalization.” Journal of Cellular Physiology 161 (2): 319–32. doi:10.1002/jcp.1041610217.

Kiarash, A., B. Boyd, and C. A. Lingwood. 1994. “Glycosphingolipid Receptor Function Is Modified by Fatty Acid Content. Verotoxin 1 and Verotoxin 2c Preferentially Recognize Different Globotriaosyl Ceramide Fatty Acid Homologues.” The Journal of Biological Chemistry 269 (15): 11138–46. http://www.ncbi.nlm.nih.gov/pubmed/8157640.

Kishimoto, Y., M. Hiraiwa, and J. S. O’Brien. 1992. “Saposins: Structure, Function, Distribution, and Molecular Genetics.” Journal of Lipid Research 33 (9): 1255–67. http://www.ncbi.nlm.nih.gov/pubmed/1402395.

Kitatani, Kazuyuki, Jolanta Idkowiak-Baldys, and Yusuf A. Hannun. 2008. “The Sphingolipid

140

Salvage Pathway in Ceramide Metabolism and Signaling.” Cellular Signalling 20 (6): 1010– 18. doi:10.1016/j.cellsig.2007.12.006.

Kleijer, W. J., L. M. Hussaarts-Odijk, E. S. Sachs, M. G. Jahoda, and M. F. Niermeijer. 1987. “Prenatal Diagnosis of Fabry’s Disease by Direct Analysis of Chorionic Villi.” Prenatal Diagnosis 7 (4): 283–87. http://www.ncbi.nlm.nih.gov/pubmed/3035532.

Kocen, R. S., and P. K. Thomas. 1970. “Peripheral Nerve Involvement in Fabry’s Disease.” Archives of Neurology 22 (1): 81–88. http://www.ncbi.nlm.nih.gov/pubmed/4311670.

Kojima, Naoya, Mitsuru Shiota, Yoshito Sadahira, Kazuko Handa, and Sen Itiroh Hakomori. 1992. “Cell Adhesion in a Dynamic Flow System as Compared to Static System: Glycosphingolipid-Glycosphingolipid Interaction in the Dynamic System Predominates over Lectin- or Integrin-Based Mechanisms in Adhesion of B16 Melanoma Cells to Non-Activated Endothelia.” Journal of Biological Chemistry. http://www.ncbi.nlm.nih.gov/pubmed/1512264.

Kojima, Y., S. Fukumoto, K. Furukawa, T. Okajima, J. Wiels, K. Yokoyama, Y. Suzuki, T. Urano, M. Ohta, and K. Furukawa. 2000. “Molecular Cloning of globotriaosylceramide/CD77 Synthase, a Glycosyltransferase That Initiates the Synthesis of Globo Series Glycosphingolipids.” The Journal of Biological Chemistry 275 (20): 15152–56. doi:10.1074/jbc.M909620199.

Kolesnick, R. N., F. M. Goñi, and A. Alonso. 2000. “Compartmentalization of Ceramide Signaling: Physical Foundations and Biological Effects.” Journal of Cellular Physiology 184 (3): 285–300. doi:10.1002/1097-4652(200009)184:3<285::AID-JCP2>3.0.CO;2-3.

Kolter, Thomas, and Konrad Sandhoff. 2005. “Principles of Lysosomal Membrane Digestion: Stimulation of Sphingolipid Degradation by Sphingolipid Activator Proteins and Anionic Lysosomal Lipids.” Annual Review of Cell and Developmental Biology 21: 81–103. doi:10.1146/annurev.cellbio.21.122303.120013.

Kornreich, R., R. J. Desnick, and D. F. Bishop. 1989. “Nucleotide Sequence of the Human Alpha- Galactosidase A Gene.” Nucleic Acids Research 17 (8): 3301–2. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=317741&tool=pmcentrez&rend

141

ertype=abstract.

Kusiak, J. W., J. M. Quirk, and R. O. Brady. 1978. “Purification and Properties of the Two Major Isozymes of Alpha-Galactosidase from Human Placenta.” The Journal of Biological Chemistry 253 (1): 184–90. http://www.ncbi.nlm.nih.gov/pubmed/201618.

Lai, Tingfeng, Yuansheng Yang, and Say Kong Ng. 2013. “Advances in Mammalian Cell Line Development Technologies for Recombinant Protein Production.” Pharmaceuticals. Multidisciplinary Digital Publishing Institute (MDPI). doi:10.3390/ph6050579.

Laney, Dawn A., Dawn S. Peck, Andrea M. Atherton, Linda P. Manwaring, Katherine M. Christensen, Suma P. Shankar, Dorothy K. Grange, William R. Wilcox, and Robert J. Hopkin. 2015. “Fabry Disease in Infancy and Early Childhood: A Systematic Literature Review.” Genetics in Medicine : Official Journal of the American College of Medical Genetics 17 (5): 323–30. doi:10.1038/gim.2014.120.

Lannert, Heinrich, Garsten Bünning, Dieter Jeckel, and Felix T. Wieland. 1994. “Lactosylceramide Is Synthesized in the Lumen of the Golgi Apparatus.” FEBS Letters 342 (1): 91–96. doi:10.1016/0014-5793(94)80591-1.

Lannert, Heinrich, Karin Gorgas, Ingrid Meißner, Felix T. Wieland, and Dieter Jeckel. 1998. “Functional Organization of the Golgi Apparatus in Glycosphingolipid Biosynthesis. Lactosylceramide and Subsequent Glycospingolipids Are Formed in the Lumen of the Late Golgi.” Journal of Biological Chemistry 273 (5): 2939–46. doi:10.1074/jbc.273.5.2939.

Lao, L. M., M. Kumakiri, H. Mima, H. Kuwahara, H. Ishida, K. Ishiguro, T. Fujita, and K. Ueda. 1998. “The Ultrastructural Characteristics of Eccrine Sweat Glands in a Fabry Disease Patient with Hypohidrosis.” Journal of Dermatological Science 18 (2): 109–17. http://www.ncbi.nlm.nih.gov/pubmed/9833977.

Lapins, J., L. Emtestam, and J. A. Marcusson. 1993. “Angiokeratomas in Fabry’s Disease and Fordyce’s Disease: Successful Treatment with Copper Vapour Laser.” Acta Dermato- Venereologica 73 (2): 133–35. http://www.ncbi.nlm.nih.gov/pubmed/8103260.

Lavigne, Matthieu D., Marita Pohlschmidt, Javier F. Novo, Bernard Higgins, Valery Alakhov,

142

Hanns Lochmuller, Hitoshi Sakuraba, Geoffrey Goldspink, Kay MacDermot, and Dariusz C. G??recki. 2005. “Promoter Dependence of Plasmid-Pluronics Targeted ?? Galactosidase A Expression in Skeletal Muscle of Fabry Mice.” Molecular Therapy 12 (5): 985–90. doi:10.1016/j.ymthe.2005.02.032.

Lazzarino, D. A., and C. A. Gabel. 1989. “Mannose Processing Is an Important Determinant in the Assembly of Phosphorylated High Mannose-Type Oligosaccharides.” The Journal of Biological Chemistry 264 (9): 5015–23. http://www.ncbi.nlm.nih.gov/pubmed/2925680.

Ledeen, Robert W., and Gusheng Wu. 2006. “Sphingolipids of the Nucleus and Their Role in Nuclear Signaling.” Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. doi:10.1016/j.bbalip.2006.04.010.

LeDonne, N. C., J. L. Fairley, and C. C. Sweeley. 1983. “Biosynthesis of Alpha-Galactosidase A in Cultured Chang Liver Cells.” Archives of Biochemistry and Biophysics 224 (1): 186–95. http://www.ncbi.nlm.nih.gov/pubmed/6307147.

Lee, Karen, Xiaoying Jin, Kate Zhang, Lorraine Copertino, Laura Andrews, Jennifer Baker- Malcolm, Laura Geagan, et al. 2003. “A Biochemical and Pharmacological Comparison of Enzyme Replacement Therapies for the Glycolipid Storage Disorder Fabry Disease.” Glycobiology 13 (4): 305–13. doi:10.1093/glycob/cwg034.

Lee, W., P. Mitchell, and R. Tjian. 1987. “Purified Transcription Factor AP-1 Interacts with TPA- Inducible Enhancer Elements.” Cell 49 (6): 741–52. http://www.ncbi.nlm.nih.gov/pubmed/3034433.

Lefrancois, Stephane, Jibin Zeng, A. Jacob Hassan, Maryssa Canuel, and Carlos R. Morales. 2003. “The Lysosomal Trafficking of Sphingolipid Activator Proteins (SAPs) Is Mediated by Sortilin.” The EMBO Journal 22 (24): 6430–37. doi:10.1093/emboj/cdg629.

Lemansky, P., D. F. Bishop, R. J. Desnick, A. Hasilik, and K. von Figura. 1987. “Synthesis and Processing of Alpha-Galactosidase A in Human Fibroblasts. Evidence for Different Mutations in Fabry Disease.” The Journal of Biological Chemistry 262 (5): 2062–65. http://www.ncbi.nlm.nih.gov/pubmed/3029062.

143

Lenardo, M., J. W. Pierce, and D. Baltimore. 1987. “Protein-Binding Sites in Ig Gene Enhancers Determine Transcriptional Activity and Inducibility.” Science (New York, N.Y.) 236 (4808): 1573–77. http://www.ncbi.nlm.nih.gov/pubmed/3109035.

Lenders, Malte, Nesrin Karabul, Thomas Duning, Boris Schmitz, Michael Schelleckes, Rolf Mesters, Hans Werner Hense, Michael Beck, Stefan Martin Brand, and Eva Brand. 2015. “Thromboembolic Events in Fabry Disease and the Impact of Factor v Leiden.” Neurology 84 (10): 1009–16. doi:10.1212/WNL.0000000000001333.

Lenoir, G., M. Rivron, M. C. Gubler, J. L. Dufier, F. S. Tome, and M. Guivarch. 1977. “Fabry’s Disease. Carbamazepine Therapy in Acrodyniform Syndrome.” Archives Françaises de Pédiatrie 34 (8): 704–16. http://www.ncbi.nlm.nih.gov/pubmed/412484.

Li, S. C., H. Kihara, S. Serizawa, Y. T. Li, A. L. Fluharty, J. S. Mayes, and L. J. Shapiro. 1985. “Activator Protein Required for the Enzymatic Hydrolysis of Cerebroside Sulfate. Deficiency in Urine of Patients Affected with Cerebroside Sulfatase Activator Deficiency and Identity with Activators for the Enzymatic Hydrolysis of GM1 Ganglioside and Gb3.” The Journal of Biological Chemistry 260 (3): 1867–71. http://www.ncbi.nlm.nih.gov/pubmed/2981875.

Liang, Yuh-Jin, Huan-Hsien Kuo, Chi-Hung Lin, Yen-Ying Chen, Bei-Chia Yang, Yuan-Yuan Cheng, Alice L. Yu, Kay-Hooi Khoo, and John Yu. 2010. “Switching of the Core Structures of Glycosphingolipids from Globo- and Lacto- to Ganglio-Series upon Human Embryonic Stem Cell Differentiation.” Proceedings of the National Academy of Sciences of the United States of America 107 (52): 22564–69. doi:10.1073/pnas.1007290108.

Lidove, O., P. Kaminsky, E. Hachulla, V. Leguy-Seguin, C. Lavigne, I. Marie, F. Maillot, et al. 2012. “Fabry Disease ‘The New Great Imposter’: Results of the French Observatoire in Internal Medicine Departments (FIMeD).” Clinical Genetics 81 (6): 571–77. doi:10.1111/j.1399-0004.2011.01718.x.

Lingwood, C. A., B. Binnington, A. Manis, and D. R. Branch. 2010. “Globotriaosyl Ceramide Receptor Function - Where Membrane Structure and Pathology Intersect.” FEBS Letters 584 (9): 1879–86. doi:10.1016/j.febslet.2009.11.089.

Lingwood, C. A., H. Law, S. Richardson, M. Petric, J. L. Brunton, S. De Grandis, and M. Karmali.

144

1987. “Glycolipid Binding of Purified and Recombinant Escherichia Coli Produced Verotoxin in Vitro.” Journal of Biological Chemistry 262 (18): 8834–39. http://www.ncbi.nlm.nih.gov/pubmed/3298243.

Lingwood, Clifford A., Adam Manis, Radia Mahfoud, Fahima Khan, Beth Binnington, and Murugesapillai Mylvaganam. 2010. “New Aspects of the Regulation of Glycosphingolipid Receptor Function.” Chemistry and Physics of Lipids 163 (1): 27–35. doi:10.1016/j.chemphyslip.2009.09.001.

Lingwood, Clifford A., Aye Aye Rhine, and Sara Arab. 1998. “Globotriaosyl Ceramide (Gb3) Expression in Human Tumour Cells: Intracellular Trafficking Defines a New Retrograde Transport Pathway from the Cell Surface to the Nucleus, Which Correlates with Sensitivity to Verotoxin.” Acta Biochimica Polonica 45 (2): 351–59. http://www.ncbi.nlm.nih.gov/pubmed/9821866.

Lingwood, Daniel, Beth Binnington, Tomasz Róg, Ilpo Vattulainen, Michal Grzybek, Unal Coskun, Clifford A. Lingwood, and Kai Simons. 2011. “Cholesterol Modulates Glycolipid Conformation and Receptor Activity.” Nature Chemical Biology 7 (5): 260–62. doi:10.1038/nchembio.551.

Lingwood, Daniel, and Kai Simons. 2010. “Lipid Rafts as a Membrane-Organizing Principle.” Science (New York, N.Y.) 327 (5961): 46–50. doi:10.1126/science.1174621.

Linthorst, Gabor E., C. E. M. Hollak, Wilma E. Donker-Koopman, Anneke Strijland, and J. M. F. G. Aerts. 2004. “Enzyme Therapy for Fabry Disease: Neutralizing Antibodies toward Agalsidase Alpha and Beta.” Kidney International 66 (4): 1589–95. doi:10.1111/j.1523- 1755.2004.00924.x.

Lippincott-Schwartz, Jennifer, and Robert D. Phair. 2010. “Lipids and Cholesterol as Regulators of Traffic in the Endomembrane System.” Annual Review of Biophysics 39: 559–78. doi:10.1146/annurev.biophys.093008.131357.

Liu, G., L. Kleine, and R. L. Hébert. 1999. “Advances in the Signal Transduction of Ceramide and Related Sphingolipids.” Critical Reviews in Clinical Laboratory Sciences 36 (6): 511–73. doi:10.1080/10408369991239240.

145

Liu, P., and R. G. Anderson. 1995. “Compartmentalized Production of Ceramide at the Cell Surface.” The Journal of Biological Chemistry 270 (45): 27179–85. http://www.ncbi.nlm.nih.gov/pubmed/7592974.

Locatelli-Hoops, Silvia, Natascha Remmel, Ralf Klingenstein, Bernadette Breiden, Maksim Rossocha, Maike Schoeniger, Christine Koenigs, Wolfram Saenger, and Konrad Sandhoff. 2006. “Saposin A Mobilizes Lipids from Low Cholesterol and High Bis(monoacylglycerol)phosphate-Containing Membranes: Patient Variant Saposin A Lacks Lipid Extraction Capacity.” The Journal of Biological Chemistry 281 (43): 32451–60. doi:10.1074/jbc.M607281200.

Lockman, L. A., D. B. Hunninghake, W. Krivit, and R. J. Desnick. 1973. “Relief of Pain of Fabry’s Disease by Diphenylhydantoin.” Neurology 23 (8): 871–75. http://www.ncbi.nlm.nih.gov/pubmed/4578349.

Lubanda, J. C., Ene Anijalg, V. Bzduch, Beth L. Thurberg, B. Benichou, and Anna Tylki- Szymanska. 2009. “Evaluation of a Low Dose, after a Standard Therapeutic Dose, of Agalsidase Beta during Enzyme Replacement Therapy in Patients with Fabry Disease.” Genet Med 11 (4): 256–64. doi:10.1097/GIM.0b013e3181981d82.

Lufino, Michele M. P., Pauline A. H. Edser, and Richard Wade-Martins. 2008. “Advances in High- Capacity Extrachromosomal Vector Technology: Episomal Maintenance, Vector Delivery, and Transgene Expression.” Molecular Therapy : The Journal of the American Society of Gene Therapy 16 (9): 1525–38. doi:10.1038/mt.2008.156.

Lund, Nicole, Donald R. Branch, Murugespillai Mylvaganam, Davin Chark, Xue-Zhong Ma, Darinka Sakac, Beth Binnington, et al. 2006. “A Novel Soluble Mimic of the Glycolipid, Globotriaosyl Ceramide Inhibits HIV Infection.” AIDS (London, England) 20 (3): 333–43. doi:10.1097/01.aids.0000206499.78664.58.

MacDermot, John, and Kay D. MacDermot. 2001. “Neuropathic Pain in Anderson-Fabry Disease: Pathology and Therapeutic Options.” European Journal of Pharmacology. doi:10.1016/S0014-2999(01)01312-7.

MacDermot, K. D., A. Holmes, and A. H. Miners. 2001a. “Anderson-Fabry Disease: Clinical

146

Manifestations and Impact of Disease in a Cohort of 60 Obligate Carrier Females.” J Med Genet 38 (11): 769–75. doi:10.1136/jmg.38.11.769.

MacDermot, K D, A Holmes, and A H Miners. 2001b. “Anderson-Fabry Disease: Clinical Manifestations and Impact of Disease in a Cohort of 98 Hemizygous Males.” J Med Genet 38 (11): 750–60. doi:10.1136/jmg.38.11.750.

Maceyka, M., and C. E. Machamer. 1997. “Ceramide Accumulation Uncovers a Cycling Pathway for the Cis-Golgi Network Marker, Infectious Bronchitis Virus M Protein.” The Journal of Cell Biology 139 (6): 1411–18. http://www.ncbi.nlm.nih.gov/pubmed/9396747.

Macrae, W. G., M. Ghosh, and C. McCulloch. 1985. “Corneal Changes in Fabry’s Disease: A Clinico-Pathologic Case Report of a Heterozygote.” Ophthalmic Paediatrics and Genetics 5 (3): 185–90. http://www.ncbi.nlm.nih.gov/pubmed/3934620.

Magnusson, H. G., and Kumar Ray Asim. 1997. Ganglioside analogs. EP0642523 B1, issued 1997. http://www.google.com/patents/EP0642523B1?cl=en.

Mahfoud, Radhia, Nicolas Garmy, Marc Maresca, Nouara Yahi, Antoine Puigserver, and Jacques Fantini. 2002. “Identification of a Common Sphingolipid-Binding Domain in Alzheimer, Prion, and HIV-1 Proteins.” The Journal of Biological Chemistry 277 (13): 11292–96. doi:10.1074/jbc.M111679200.

Mahfoud, Radhia, Adam Manis, and Clifford A. Lingwood. 2009. “Fatty Acid-Dependent Globotriaosyl Ceramide Receptor Function in Detergent Resistant Model Membranes.” Journal of Lipid Research 50 (9): 1744–55. doi:10.1194/jlr.M800385-JLR200.

Mapes, C. A., R. L. Anderson, C. C. Sweeley, R. J. Desnick, and W. Krivit. 1970. “Enzyme Replacement in Fabry’s Disease, an Inborn Error of Metabolism.” Science (New York, N.Y.) 169 (3949): 987–89. http://www.ncbi.nlm.nih.gov/pubmed/4914726.

Maranville, Elizabeth, and Alex Zhu. 2000. “The Carboxyl Terminus of Coffee Bean α- Galactosidase Is Critical for Enzyme Activity Pressing C-Terminal Deletion Mutants in the Methyl-.” Archives of Biochemistry and Biophysics 373 (1): 225–30. doi:10.1006/abbi.1999.1532.

147

Marcus, D. M., S. K. Kundu, and A. Suzuki. 1981. “The P Blood Group System: Recent Progress in Immunochemistry and Genetics.” Seminars in Hematology 18 (1): 63–71. http://www.ncbi.nlm.nih.gov/pubmed/7010611.

Markham, Anthony. 2016. “Migalastat: First Global Approval.” Drugs 76 (11): 1147–52. doi:10.1007/s40265-016-0607-y.

Marks, Neville, Martin J. Berg, Mariko Saito, and Mitsuo Saito. 2008. “Glucosylceramide Synthase Decrease in Frontal Cortex of Alzheimer Brain Correlates with Abnormal Increase in Endogenous Ceramides: Consequences to Morphology and Viability on Enzyme Suppression in Cultured Primary Neurons.” Brain Research 1191 (January): 136–47. doi:10.1016/j.brainres.2007.10.066.

Marshall, John, Karen M. Ashe, Dinesh Bangari, KerryAnne McEachern, Wei Lien Chuang, Joshua Pacheco, Diane P. Copeland, et al. 2010. “Substrate Reduction Augments the Efficacy of Enzyme Therapy in a Mouse Model of Fabry Disease.” PLoS ONE 5 (11): e15033. doi:10.1371/journal.pone.0015033.

Matsuura, Fumito, Masaya Ohta, Yiannis A. Ioannou, and Robert J. Desnick. 1998. “Human α- Galactosidase A: Characterization of the N-Linked Oligosaccharides on the Intracellular and Secreted Glycoforms Overexpressed by Chinese Hamster Ovary Cells.” Glycobiology 8 (4): 329–39. doi:10.1093/glycob/8.4.329.

Mayes, J. S., E. L. Cray, V. A. Dell, J. B. Scheerer, and R. N. Sifers. 1982. “Endocytosis of Lysosomal Alpha-Galactosidase A by Cultured Fibroblasts from Patients with Fabry Disease.” American Journal of Human Genetics 34 (4): 602–10. http://www.ncbi.nlm.nih.gov/pubmed/6285697.

McDevitt, M. A., R. P. Hart, W. W. Wong, and J. R. Nevins. 1986. “Sequences Capable of Restoring poly(A) Site Function Define Two Distinct Downstream Elements.” The EMBO Journal 5 (11): 2907–13. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1167241&tool=pmcentrez&ren dertype=abstract.

McLauchlan, J., D. Gaffney, J. L. Whitton, and J. B. Clements. 1985. “The Consensus Sequence

148

YGTGTTYY Located Downstream from the AATAAA Signal Is Required for Efficient Formation of mRNA 3’ Termini.” Nucleic Acids Research 13 (4): 1347–68. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=341077&tool=pmcentrez&rend ertype=abstract.

Mcnary, W. F., and L. M. Lowenstein. 1965. “A Morphological Study of the Renal Lesion in Angiokeratoma Corporis Diffusum Universale (Fabry’s Disease).” The Journal of Urology 93 (June): 641–48. http://www.ncbi.nlm.nih.gov/pubmed/14300263.

Mechtler, Thomas P., Susanne Stary, Thomas F. Metz, Víctor R. De Jesús, Susanne Greber- Platzer, Arnold Pollak, Kurt R. Herkner, Berthold Streubel, and David C. Kasper. 2012. “Neonatal Screening for Lysosomal Storage Disorders: Feasibility and Incidence from a Nationwide Study in Austria.” Lancet (London, England) 379 (9813): 335–41. doi:10.1016/S0140-6736(11)61266-X.

Medin, J. A., M. Tudor, R. Simovitch, J. M. Quirk, S. Jacobson, G. J. Murray, and R. O. Brady. 1996. “Correction in Trans for Fabry Disease: Expression, Secretion and Uptake of Alpha- Galactosidase A in Patient-Derived Cells Driven by a High-Titer Recombinant Retroviral Vector.” Proceedings of the National Academy of Sciences 93 (15): 7917–22. doi:10.1073/pnas.93.15.7917.

Mehta, A. B. 2013. “Fabry Disease: Is There a Role for Enzyme Replacement Therapy?” Journal of Internal Medicine, October. doi:10.1111/joim.12089.

Mehta, A., M. Beck, P. Elliott, R. Giugliani, A. Linhart, G. Sunder-Plassmann, R. Schiffmann, et al. 2009. “Enzyme Replacement Therapy with Agalsidase Alfa in Patients with Fabry’s Disease: An Analysis of Registry Data.” Lancet (London, England) 374 (9706): 1986–96. doi:10.1016/S0140-6736(09)61493-8.

Mehta, A., R. Ricci, U. Widmer, F. Dehout, A. Garcia De Lorenzo, C. Kampmann, A. Linhart, G. Sunder-Plassmann, M. Ries, and M. Beck. 2004. “Fabry Disease Defined: Baseline Clinical Manifestations of 366 Patients in the Fabry Outcome Survey.” European Journal of Clinical Investigation 34 (3): 236–42. doi:10.1111/j.1365-2362.2004.01309.x.

Mehta, Atul, Michael Beck, Aleš Linhart, and Gere Sunder-Plassmann. 2006. Monitoring and

149

Follow-up of Patients. Fabry Disease: Perspectives from 5 Years of FOS. Oxford PharmaGenesis. http://www.ncbi.nlm.nih.gov/pubmed/21290668.

Mehta, J., N. Tuna, J. H. Moller, and R. J. Desnick. 1977. “Electrocardiographic and Vectorcardiographic Abnormalities in Fabry’s Disease.” American Heart Journal 93 (6): 699–705. http://www.ncbi.nlm.nih.gov/pubmed/140598.

Meikle, P. J., J. J. Hopwood, A. E. Clague, and W. F. Carey. 1999. “Prevalence of Lysosomal Storage Disorders.” JAMA 281 (3): 249–54. http://www.ncbi.nlm.nih.gov/pubmed/9918480.

Mendelsohn, Nancy J., Yoav H. Messinger, Amy S. Rosenberg, and Priya S. Kishnani. 2009. “Elimination of Antibodies to Recombinant Enzyme in Pompe’s Disease.” The New England Journal of Medicine 360 (2): 194–95. doi:10.1056/NEJMc0806809.

Mendez, M. F., T. M. Stanley, N. M. Medel, Z. Li, and D. T. Tedesco. 1997. “The Vascular Dementia of Fabry’s Disease.” Dement Geriatr Cogn Disord 8 (4): 252–57. http://www.ncbi.nlm.nih.gov/pubmed/9213072.

Meuillet, E. J., B. Mania-Farnell, D. George, J. I. Inokuchi, and E. G. Bremer. 2000. “Modulation of EGF Receptor Activity by Changes in the GM3 Content in a Human Epidermoid Carcinoma Cell Line, A431.” Experimental Cell Research 256 (1): 74–82. doi:10.1006/excr.1999.4509.

Miyamura, N., E. Araki, K. Matsuda, R. Yoshimura, N. Furukawa, K. Tsuruzoe, T. Shirotani, H. Kishikawa, K. Yamaguchi, and M. Shichiri. 1996. “A Carboxy-Terminal Truncation of Human Alpha-Galactosidase A in a Heterozygous Female with Fabry Disease and Modification of the Enzymatic Activity by the Carboxy-Terminal Domain. Increased, Reduced, or Absent Enzyme Activity Depending on Number of Amino.” J Clin Invest 98 (8): 1809–17. doi:10.1172/JCI118981.

Miyoshi, H, K A Smith, D E Mosier, I M Verma, and B E Torbett. 1999. “Transduction of Human CD34+ Cells That Mediate Long-Term Engraftment of NOD/SCID Mice by HIV Vectors.” Science (New York, N.Y.) 283 (5402): 682–86.

Montini, Eugenio, Daniela Cesana, Manfred Schmidt, Francesca Sanvito, Maurilio Ponzoni,

150

Cynthia Bartholomae, Lucia Sergi Sergi, et al. 2006. “Hematopoietic Stem Cell Gene Transfer in a Tumor-Prone Mouse Model Uncovers Low Genotoxicity of Lentiviral Vector Integration.” Nature Biotechnology 24 (6): 687–96.

Moore, David F., Gheona Altarescu, Peter Herscovitch, and Raphael Schiffmann. 2002. “Enzyme Replacement Reverses Abnormal Cerebrovascular Responses in Fabry Disease.” BMC Neurology 2 (June): 4. doi:10.1186/1471-2377-2-4.

Moore, David F., Gheona Altarescu, Geoffrey S. F. Ling, Neal Jeffries, Karen P. Frei, Thais Weibel, Gustavo Charria-Ortiz, et al. 2002. “Elevated Cerebral Blood Flow Velocities in Fabry Disease with Reversal after Enzyme Replacement.” Stroke 33 (2): 525–31. doi:10.1161/hs0202.102601.

Morales, Albert, Anna Colell, Montserrat Mari, Carmen Garcia-Ruiz, and José C. Fernandez- Checa. 2004. “Glycosphingolipids and Mitochondria: Role in Apoptosis and Disease.” Glycoconjugate Journal 20 (9): 579–88. doi:10.1023/B:GLYC.0000043294.62504.2c.

Morgan, S. H., P. Rudge, S. J. Smith, A. M. Bronstein, B. E. Kendall, E. Holly, E. P. Young, M. D. Crawfurd, and R. Bannister. 1990. “The Neurological Complications of Anderson-Fabry Disease (Alpha-Galactosidase A Deficiency)--Investigation of Symptomatic and Presymptomatic Patients.” The Quarterly Journal of Medicine 75 (277): 491–507. http://www.ncbi.nlm.nih.gov/pubmed/2167495.

Moser, H. W., H. Braine, R. E. Pyeritz, D. Ullman, C. Murray, and A. K. Asbury. 1980. “Therapeutic Trial of Plasmapheresis in Refsum Disease and in Fabry Disease.” Birth Defects Orig.Artic.Ser. 16 (0547–6844): 491–97.

Mosnier, J. F., C. Degott, J. Bedrossian, G. Molas, F. Degos, A. Pruna, and F. Potet. 1991. “Recurrence of Fabry’s Disease in a Renal Allograft Eleven Years after Successful Renal Transplantation.” Transplantation 51 (4): 759–62. http://www.ncbi.nlm.nih.gov/pubmed/1849671.

Moumdjian, R., D. Tampieri, D. Melanson, and R. Ethier. 1989. “Anderson-Fabry Disease: A Case Report with MR, CT, and Cerebral Angiography.” AJNR. American Journal of Neuroradiology 10 (5 Suppl): S69-70. http://www.ncbi.nlm.nih.gov/pubmed/2505577.

151

Mullen, Thomas D., Yusuf A. Hannun, and Lina M. Obeid. 2012. “Ceramide Synthases at the Centre of Sphingolipid Metabolism and Biology.” The Biochemical Journal 441 (3): 789– 802. doi:10.1042/BJ20111626.

Mullen, Thomas D., Russell W. Jenkins, Christopher J. Clarke, Jacek Bielawski, Yusuf A. Hannun, and Lina M. Obeid. 2011. “Ceramide Synthase-Dependent Ceramide Generation and Programmed Cell Death: Involvement of Salvage Pathway in Regulating Postmitochondrial Events.” The Journal of Biological Chemistry 286 (18): 15929–42. doi:10.1074/jbc.M111.230870.

Nakamura, Gen, Hiroki Maruyama, Satoshi Ishii, Masaaki Shimotori, Shigemi Kameda, Toru Kono, Jun Ichi Miyazaki, Ashok B. Kulkarni, and Fumitake Gejyo. 2008. “Naked Plasmid DNA-Based α-Galactosidase a Gene Transfer Partially Reduces Systemic Accumulation of Globotriaosylceramide in Fabry Mice.” Molecular Biotechnology 38 (2): 109–19. doi:10.1007/s12033-007-9008-5.

Nelis, G. F., and G. J. Jacobs. 1989. “Anorexia, Weight Loss, and Diarrhea as Presenting Symptoms of Angiokeratoma Corporis Diffusum (Fabry-Anderson’s Disease).” Digestive Diseases and Sciences 34 (11): 1798–1800. http://www.ncbi.nlm.nih.gov/pubmed/2510982.

Newton, J. A., and D. H. McGibbon. 1987. “The Treatment of Multiple Angiokeratomata with the Argon Laser.” Clinical and Experimental Dermatology 12 (1): 23–25. http://www.ncbi.nlm.nih.gov/pubmed/3652499.

Ni, Xiaoyan, and Carlos R. Morales. 2006. “The Lysosomal Trafficking of Acid Sphingomyelinase Is Mediated by Sortilin and Mannose 6-Phosphate Receptor.” Traffic (Copenhagen, Denmark) 7 (7): 889–902. doi:10.1111/j.1600-0854.2006.00429.x.

Niemann, Markus, Arndt Rolfs, Stefan Störk, Bart Bijnens, Frank Breunig, Meinrad Beer, Georg Ertl, Christoph Wanner, and Frank Weidemann. 2014. “Gene Mutations versus Clinically Relevant Phenotypes: Lyso-Gb3 Defines Fabry Disease.” Circulation. Cardiovascular Genetics 7 (1): 8–16. doi:10.1161/CIRCGENETICS.113.000249.

Nietupski, Jennifer B., Gregory D. Hurlbut, Robin J. Ziegler, Qiuming Chu, Bradley L. Hodges, Karen M. Ashe, Mark Bree, et al. 2011. “Systemic Administration of AAV8-α-Galactosidase

152

A Induces Humoral Tolerance in Nonhuman Primates despite Low Hepatic Expression.” Molecular Therapy: The Journal of the American Society of Gene Therapy 19 (11): 1999– 2011. doi:10.1038/mt.2011.119.

Nilsson, O., and L. Svennerholm. 1982. “Accumulation of Glucosylceramide and Glucosylsphingosine (Psychosine) in Cerebrum and Cerebellum in Infantile and Juvenile Gaucher Disease.” Journal of Neurochemistry 39 (3): 709–18. doi:10.1111/j.1471- 4159.1982.tb07950.x.

Nishie, Toshikazu, Yoko Hikimochi, Kota Zama, Yoshiyasu Fukusumi, Mitutoshi Ito, Haruka Yokoyama, Chie Naruse, Makoto Ito, and Masahide Asano. 2010. “Beta4- Galactosyltransferase-5 Is a Lactosylceramide Synthase Essential for Mouse Extra- Embryonic Development.” Glycobiology 20 (10): 1311–22. doi:10.1093/glycob/cwq098.

Nojiri, Hisao, Mark Stroud, and Sen Itiroh Hakomori. 1991. “A Specific Type of Ganglioside as a Modulator of Insulin-Dependent Cell Growth and Insulin Receptor Tyrosine Kinase Activity: Possible Association of Ganglioside-Induced Inhibition of Insulin Receptor Function and Monocytic Differentiation Induction in HL.” Journal of Biological Chemistry 266 (7): 4531– 37. http://www.ncbi.nlm.nih.gov/pubmed/1999434.

Novo, F. J., D. C. Górecki, G. Goldspink, and K. D. MacDermot. 1997. “Gene Transfer and Expression of Human α-Galactosidase from Mouse Muscle in Vitro and in Vivo.” Gene Therapy 4 (5): 488–92. doi:10.1038/sj.gt.3300410.

Ogawa, Koichi, Yukihiko Hirai, Masamichi Ishizaki, Hiroshi Takahashi, Hideki Hanawa, Yoshitaka Fukunaga, and Takashi Shimada. 2009. “Long-Term Inhibition of Glycosphingolipid Accumulation in Fabry Model Mice by a Single Systemic Injection of AAV1 Vector in the Neonatal Period.” Molecular Genetics and Metabolism 96 (3): 91–96. doi:10.1016/j.ymgme.2008.10.017.

Ohashi, Toya, Sayoko Iizuka, Hiroyuki Ida, and Yoshikatsu Eto. 2008. “Reduced Alpha-Gal A Enzyme Activity in Fabry Fibroblast Cells and Fabry Mice Tissues Induced by Serum from Antibody Positive Patients with Fabry Disease.” Molecular Genetics and Metabolism 94 (3): 313–18. doi:10.1016/j.ymgme.2008.03.008.

153

Ohashi, Toya, Mio Sakuma, Teruo Kitagawa, Ken Suzuki, Nobuyuki Ishige, and Yoshikatsu Eto. 2007. “Influence of Antibody Formation on Reduction of Globotriaosylceramide (GL-3) in Urine from Fabry Patients during Agalsidase Beta Therapy.” Molecular Genetics and Metabolism 92 (3): 271–73. doi:10.1016/j.ymgme.2007.06.013.

Ohno, H., M. C. Fournier, G. Poy, and J. S. Bonifacino. 1996. “Structural Determinants of Interaction of Tyrosine-Based Sorting Signals with the Adaptor Medium Chains.” The Journal of Biological Chemistry 271 (46): 29009–15. http://www.ncbi.nlm.nih.gov/pubmed/8910552.

Ohno, H., J. Stewart, M. C. Fournier, H. Bosshart, I. Rhee, S. Miyatake, T. Saito, A. Gallusser, T. Kirchhausen, and J. S. Bonifacino. 1995. “Interaction of Tyrosine-Based Sorting Signals with Clathrin-Associated Proteins.” Science (New York, N.Y.) 269 (5232): 1872–75. http://www.ncbi.nlm.nih.gov/pubmed/7569928.

Ohshima, T., R. Schiffmann, G. J. Murray, J. Kopp, J. M. Quirk, S. Stahl, C. C. Chan, et al. 1999. “Aging Accentuates and Bone Marrow Transplantation Ameliorates Metabolic Defects in Fabry Disease Mice.” Proceedings of the National Academy of Sciences of the United States of America 96 (11): 6423–27. http://www.ncbi.nlm.nih.gov/pubmed/10339603.

Okuda, Tetsuya, Noriyo Tokuda, Shin-ichiro Numata, Masafumi Ito, Michio Ohta, Kumiko Kawamura, Joelle Wiels, et al. 2006. “Targeted Disruption of Gb3/CD77 Synthase Gene Resulted in the Complete Deletion of Globo-Series Glycosphingolipids and Loss of Sensitivity to Verotoxins.” The Journal of Biological Chemistry 281 (15): 10230–35. doi:10.1074/jbc.M600057200.

Okumiya, T., S. Ishii, T. Takenaka, R. Kase, S. Kamei, H. Sakuraba, and Y. Suzuki. 1995. “Galactose Stabilizes Various Missense Mutants of Alpha-Galactosidase in Fabry Disease.” Biochemical and Biophysical Research Communications 214 (3): 1219–24. doi:10.1006/bbrc.1995.2416.

Onishi, A., and Peter James Dyck. 1974. “Loss of Small Peripheral Sensory Neurons in Fabry Disease. Histologic and Morphometric Evaluation of Cutaneous Nerves, Spinal Ganglia, and Posterior Columns.” Archives of Neurology 31 (2): 120–27.

154

doi:10.1001/archneur.1974.00490380068009.

Orvisky, Eduard, Joseph K. Park, Mary E. LaMarca, Edward I. Ginns, Brian M. Martin, Nahid Tayebi, and Ellen Sidransky. 2002. “Glucosylsphingosine Accumulation in Tissues from Patients with Gaucher Disease: Correlation with Phenotype and Genotype.” Molecular Genetics and Metabolism 76 (4): 262–70. doi:10.1016/S1096-7192(02)00117-8.

Osada, Toshiya, Yoichiro Kuroda, and Atsushi Ikai. 1987. “Endocytotic Internalization of α-2- Macroglobulin: α-Galactosidase Conjugate by Cultured Fibroblasts Derived from Fabry Hemizygote.” Biochemical and Biophysical Research Communications 142 (1): 100–106. doi:10.1016/0006-291X(87)90456-6.

Osooli, M., and E. Berntorp. 2015. “Inhibitors in Haemophilia: What Have We Learned from Registries? A Systematic Review.” Journal of Internal Medicine. doi:10.1111/joim.12301.

Pabico, R. C., B. C. Atancio, B. A. McKenna, T. Pamukcoglu, and R. Yodaiken. 1973. “Renal Pathologic Lesions and Functional Alterations in a Man with Fabry’s Disease.” The American Journal of Medicine 55 (3): 415–25. http://www.ncbi.nlm.nih.gov/pubmed/4746561.

Pagnini, Ilaria, Walter Borsini, Franco Cecchi, Aurelio Sgalambro, Iacopo Olivotto, Anna Frullini, and Rolando Cimaz. 2011. “Distal Extremity Pain as a Presenting Feature of Fabry’s Disease.” Arthritis Care & Research 63 (3): 390–95. doi:10.1002/acr.20385.

Park, Jinhee, Gary J. Murray, Advait Limaye, Jane M. Quirk, Monique P. Gelderman, Roscoe O. Brady, and Pankaj Qasba. 2003. “Long-Term Correction of Globotriaosylceramide Storage in Fabry Mice by Recombinant Adeno-Associated Virus-Mediated Gene Transfer.” Proceedings of the National Academy of Sciences of the United States of America 100 (6): 3450–54. doi:10.1073/pnas.0537900100.

Passineau, Michael J., Timothy Fahrenholz, Laurie Machen, Lee Zourelias, Katherine Nega, Rachel Paul, Mary J. MacDougall, et al. 2011. “α-Galactosidase A Expressed in the Salivary Glands Partially Corrects Organ Biochemical Deficits in the Fabry Mouse through Endocrine Trafficking.” Human Gene Therapy 22 (March): 293–301. doi:10.1089/hum.2010.069.

Pastores, G. M., H. B. Turkia, D. E. Gonzalez, H. Ida, A. A. Tantawy, Y. Qin, Y. Qiu, Q. Dinh,

155

and A. Zimran. 2016. “Development of Anti-Velaglucerase Alfa Antibodies in Clinical Trial- Treated Patients with Gaucher Disease.” Blood Cells Mol Dis 59: 37–43. doi:10.1016/j.bcmd.2016.03.004.

Patel, T., S. Banugaria, L. Case, S. Wenninger, B. Schoser, Kishnani P. Mol, and Genet Metab. 2012. “The Impact of Antibodies in Late-Onset Pompe Disease : A Case Series and Literature Helping to Explain Some of the Variability in Treatment Response to Myozyme , but Further Research Is Required . Patients ( LOPD ), Have Some Residual GAA Enzyme Activity.” Molecular Genetics and Metabolism 106 (3): 2012. http://www.ncbi.nlm.nih.gov/pubmed/22613277.

Pinto, Rui, Carla Caseiro, Manuela Lemos, Lurdes Lopes, Augusta Fontes, Helena Ribeiro, Eugénia Pinto, et al. 2004. “Prevalence of Lysosomal Storage Diseases in Portugal.” European Journal of Human Genetics : EJHG 12 (2): 87–92. doi:10.1038/sj.ejhg.5201044.

Pitz, Susanne, Gisela Kalkum, Laila Arash, Nesrin Karabul, Andrea Sodi, Sylvain Larroque, Michael Beck, and Andreas Gal. 2015. “Ocular Signs Correlate Well with Disease Severity and Genotype in Fabry Disease.” PLoS ONE 10 (3): e0120814. doi:10.1371/journal.pone.0120814.

Pochis, W. T., J. T. Litzow, B. G. King, and D. Kenny. 1994. “Electrophysiologic Findings in Fabry’s Disease with a Short PR Interval.” The American Journal of Cardiology 74 (2): 203– 4. http://www.ncbi.nlm.nih.gov/pubmed/8023796.

Ponting, C. P. 1994. “Acid Sphingomyelinase Possesses a Domain Homologous to Its Activator Proteins: Saposins B and D.” Protein Science : A Publication of the Protein Society 3 (2): 359–61. doi:10.1002/pro.5560030219.

Poorthuis, B. J. H. M., Ron A. Wevers, Wim J. Kleijer, J. E. M. Groener, J. G. N. De Jong, Sonja Van Weely, Klary E. Niezen-Koning, and Otto P. Van Diggelen. 1999. “The Frequency of Lysosomal Storage Diseases in The Netherlands.” Human Genetics 105 (1–2): 151–56. doi:10.1007/s004399900075.

Prywes, R., and R. G. Roeder. 1986. “Inducible Binding of a Factor to the c-Fos Enhancer.” Cell 47 (5): 777–84. http://www.ncbi.nlm.nih.gov/pubmed/3096578.

156

Przybylska, Malgorzata, I. Huan Wu, Hongmei Zhao, Robin J. Ziegler, Jennifer D. Tousignant, Robert J. Desnick, Ronald K. Scheule, Seng H. Cheng, and Nelson S. Yew. 2004. “Partial Correction of the ??-Galactosidase A Deficiency and Reduction of Glycolipid Storage in Fabry Mice Using Synthetic Vectors.” Journal of Gene Medicine 6 (1): 85–92. doi:10.1002/jgm.468.

Puertollano, R., R. C. Aguilar, I. Gorshkova, R. J. Crouch, and J. S. Bonifacino. 2001. “Sorting of Mannose 6-Phosphate Receptors Mediated by the GGAs.” Science (New York, N.Y.) 292 (5522): 1712–16. doi:10.1126/science.1060750.

Pyeritz, R. E., M. D. Ullman, A. B. Moser, H. G. Braine, and H. W. Moser. 1980. “Plasma Exchange Removes Glycosphingolipid in Fabry Disease.” American Journal of Medical Genetics 7 (3): 301–7. doi:10.1002/ajmg.1320070308.

Qin, G, T Takenaka, K Telsch, L Kelley, T Howard, T Levade, R Deans, et al. 2001. “Preselective Gene Therapy for Fabry Disease.” Proceedings of the National Academy of Sciences of the United States of America 98 (6): 3428–33. doi:10.1073/pnas.061020598.

Rajesh, Mohanraj, Antonina Kolmakova, and Subroto Chatterjee. 2005. “Novel Role of Lactosylceramide in Vascular Endothelial Growth Factor-Mediated Angiogenesis in Human Endothelial Cells.” Circulation Research 97 (8): 796–804. doi:10.1161/01.RES.0000185327.45463.A8.

Ramaswami, U., S. Wendt, G. Pintos-Morell, R. Parini, C. Whybra, J. A. Leon Leal, F. Santus, and M. Beck. 2007. “Enzyme Replacement Therapy with Agalsidase Alfa in Children with Fabry Disease.” Acta Paediatrica, International Journal of Paediatrics 96 (1): 122–27. doi:10.1111/j.1651-2227.2007.00029.x.

Ramaswami, Uma. 2011. “Update on Role of Agalsidase Alfa in Management of Fabry Disease.” Drug Design, Development and Therapy 5: 155–73. doi:10.2147/DDDT.S11985.

Reczek, David, Michael Schwake, Jenny Schröder, Heather Hughes, Judith Blanz, Xiaoying Jin, William Brondyk, Scott Van Patten, Tim Edmunds, and Paul Saftig. 2007. “LIMP-2 Is a Receptor for Lysosomal Mannose-6-Phosphate-Independent Targeting of Beta- Glucocerebrosidase.” Cell 131 (4): 770–83. doi:10.1016/j.cell.2007.10.018.

157

Remmel, Natascha, Silvia Locatelli-Hoops, Bernadette Breiden, Guenter Schwarzmann, and Konrad Sandhoff. 2007. “Saposin B Mobilizes Lipids from Cholesterol-Poor and Bis(monoacylglycero)phosphate-Rich Membranes at Acidic pH. Unglycosylated Patient Variant Saposin B Lacks Lipid-Extraction Capacity.” The FEBS Journal 274 (13): 3405–20. doi:10.1111/j.1742-4658.2007.05873.x.

Rendic, Dubravko, Iain B. H. Wilson, and Katharina Paschinger. 2008. “The Glycosylation Capacity of Insect Cells.” Croatica Chemica Acta 81 (1): 7–21. doi:10.1002/chin.200831267.

Ridley, Christina M., Karen E. Thur, Jessica Shanahan, Nagendra Babu Thillaiappan, Ann Shen, Karly Uhl, Charlotte M. Walden, et al. 2013. “β-Glucosidase 2 (GBA2) Activity and Imino Sugar Pharmacology.” Journal of Biological Chemistry 288 (36): 26052–66. doi:10.1074/jbc.M113.463562.

Ries, Markus, J. T. R. Clarke, Catharina Whybra, Margaret Timmons, Chevalia Robinson, Bradley L. Schlaggar, Gregory Pastores, et al. 2006. “Enzyme-Replacement Therapy With Agalsidase Alfa in Children With Fabry Disease.” Pediatrics 118 (3): 924–32. doi:10.1542/peds.2005- 2895.

Ries, Markus, Joe T. Clarke, Catharina Whybra, Atul Mehta, Kenneth S. Loveday, Roscoe O. Brady, Michael Beck, and Raphael Schiffmann. 2007. “Enzyme Replacement in Fabry Disease: Pharmacokinetics and Pharmacodynamics of Agalsidase Alpha in Children and Adolescents.” Journal of Clinical Pharmacology 47 (10): 1222–30. doi:10.1177/0091270007305299.

Rombach, Saskia M., Johannes M. F. G. Aerts, Ben J. H. M. Poorthuis, Johanna E. M. Groener, Wilma Donker-Koopman, Erik Hendriks, Mina Mirzaian, et al. 2012. “Long-Term Effect of Antibodies against Infused Alpha-Galactosidase A in Fabry Disease on Plasma and Urinary (lyso)Gb3 Reduction and Treatment Outcome.” PLoS ONE 7 (10): e47805. doi:10.1371/journal.pone.0047805.

Rombach, Saskia M., Bouwien E. Smid, Machtelt G. Bouwman, Gabor E. Linthorst, Marcel G. W. Dijkgraaf, and Carla E. M. Hollak. 2013. “Long Term Enzyme Replacement Therapy for Fabry Disease: Effectiveness on Kidney, Heart and Brain.” Orphanet Journal of Rare

158

Diseases 8 (1): 47. doi:10.1186/1750-1172-8-47.

Ronen, Keshet, Olivier Negre, Shannah Roth, Charlotte Colomb, Nirav Malani, Maria Denaro, Troy Brady, et al. 2011. “Distribution of Lentiviral Vector Integration Sites in Mice Following Therapeutic Gene Transfer to Treat β-Thalassemia.” Molecular Therapy : The Journal of the American Society of Gene Therapy 19 (7): 1273–86. doi:10.1038/mt.2011.20.

Rowe, J. W., J. I. Gilliam, and T. A. Warthin. 1974. “Intestinal Manifestations of Fabry’s Disease.” Annals of Internal Medicine 81 (5): 628–31. http://www.ncbi.nlm.nih.gov/pubmed/4214387.

Ruiz De Garibay, A. P., M. A. Solinís, A. Del Pozo-Rodríguez, P. S. Apaolaza, J. S. Shen, and A. Rodríguez-Gascón. 2015. “Solid Lipid Nanoparticles as Non-Viral Vectors for Gene Transfection in a Cell Model of Fabry Disease.” Journal of Biomedical Nanotechnology 11 (3): 500–511. doi:10.1166/jbn.2015.1968.

Ruiz de Garibay, Aritz Perez, María Angeles Solinís, and Alicia Rodríguez-Gascón. 2013. “Gene Therapy for Fabry Disease: A Review of the Literature.” BioDrugs 27 (3): 237–46. doi:10.1007/s40259-013-0032-7.

Sagebiel, R. W., and F. Parker. 1968. “Cutaneous Lesions of Fabry’s Disease: Glycolipid Lipidosis; Light and Electron Microscopic Findings.” The Journal of Investigative Dermatology 50 (3): 208–13. http://www.ncbi.nlm.nih.gov/pubmed/5644893.

Sakai, Kaori, Masashi Akiyama, Yoriko Sugiyama-Nakagiri, James R. McMillan, Daisuke Sawamura, and Hiroshi Shimizu. 2007. “Localization of ABCA12 from Golgi Apparatus to Lamellar Granules in Human Upper Epidermal Keratinocytes.” Experimental Dermatology 16 (11): 920–26. doi:10.1111/j.1600-0625.2007.00614.x.

Sakurai, Yuika, Hiromi Kojima, Masanori Shiwa, Toya Ohashi, Yoshikatsu Eto, and Hiroshi Moriyama. 2009. “The Hearing Status in 12 Female and 15 Male Japanese Fabry Patients.” Auris, Nasus, Larynx 36 (6): 627–32. doi:10.1016/j.anl.2009.01.001.

Sandhoff, K., T. Kolter, and K. Harzer. 2001. “Sphingolipid Activator Proteins.” In The Metabolic and Molecular Bases of Inherited Disease, Vol. III, edited by R Scriver, AL Beaudet, WS Sly, and D Valle, 8thed., 3371–88. New York: McGraw-Hill.

159

Schellekens, Huub, and Nicole Casadevall. 2004. “Immunogenicity of Recombinant Human Proteins: Causes and Consequences.” Journal of Neurology 251 Suppl: II4-9. doi:10.1007/s00415-004-1202-9.

Schiffmann, R., J. B. Kopp, H. A. Austin, S. Sabnis, D. F. Moore, T. Weibel, J. E. Balow, and R. O. Brady. 2001. “Enzyme Replacement Therapy in Fabry Disease: A Randomized Controlled Trial.” JAMA 285 (21): 2743–49. http://www.ncbi.nlm.nih.gov/pubmed/11386930.

Schiffmann, R., G. J. Murray, D. Treco, P. Daniel, M. Sellos-Moura, M. Myers, J. M. Quirk, et al. 2000. “Infusion of Alpha-Galactosidase A Reduces Tissue Globotriaosylceramide Storage in Patients with Fabry Disease.” Proceedings of the National Academy of Sciences of the United States of America 97 (1): 365–70. doi:10.1073/pnas.97.1.365.

Schiffmann, Raphael, Hasan Askari, Margaret Timmons, Chevalia Robinson, William Benko, Roscoe O. Brady, and Markus Ries. 2007. “Weekly Enzyme Replacement Therapy May Slow Decline of Renal Function in Patients with Fabry Disease Who Are on Long-Term Biweekly Dosing.” Journal of the American Society of Nephrology 18 (5): 1576–83. doi:10.1681/ASN.2006111263.

Schiffmann, Raphael, Mary Kay Floeter, James M. Dambrosia, Surya Gupta, David F. Moore, Yehonatan Sharabi, Ramesh K. Khurana, and Roscoe O. Brady. 2003. “Enzyme Replacement Therapy Improves Peripheral Nerve and Sweat Function in Fabry Disease.” Muscle & Nerve 28 (6): 703–10. doi:10.1002/mus.10497.

Schiffmann, Raphael, Sabrina Forni, Caren Swift, Nastry Brignol, Xiaoyang Wu, David J. Lockhart, Derek Blankenship, et al. 2014. “Risk of Death in Heart Disease Is Associated with Elevated Urinary Globotriaosylceramide.” Journal of the American Heart Association 3 (1): e000394. doi:10.1161/JAHA.113.000394.

Schiffmann, Raphael, Maria Fuller, Lorne A. Clarke, and Johannes M. F. G. Aerts. 2016. “Is It Fabry Disease?” Genetics in Medicine : Official Journal of the American College of Medical Genetics, May. doi:10.1038/gim.2016.55.

Schiffmann, Raphael, Peter Hauer, Barbara Freeman, Markus Ries, Leland J. C. Scott, Michael Polydefkis, Roscoe O. Brady, Justin C. McArthur, and Kathryn Wagner. 2006. “Enzyme

160

Replacement Therapy and Intraepidermal Innervation Density in Fabry Disease.” Muscle and Nerve 34 (1): 53–56. doi:10.1002/mus.20550.

Schiffmann, Raphael, Rick A. Martin, Tyler Reimschisel, Karen Johnson, Victoria Castaneda, Y. Howard Lien, Gregory M. Pastores, Christoph Kampmann, Markus Ries, and Joe T. R. Clarke. 2010. “Four-Year Prospective Clinical Trial of Agalsidase Alfa in Children with Fabry Disease.” Journal of Pediatrics 156 (5). doi:10.1016/j.jpeds.2009.11.007.

Schiffmann, Raphael, Markus Ries, Margaret Timmons, John T. Flaherty, and Roscoe O. Brady. 2006. “Long-Term Therapy with Agalsidase Alfa for Fabry Disease: Safety and Effects on Renal Function in a Home Infusion Setting.” Nephrology, Dialysis, Transplantation : Official Publication of the European Dialysis and Transplant Association - European Renal Association 21 (2): 345–54. doi:10.1093/ndt/gfi152.

Schröder, A. R W, Paul Shinn, Huaming Chen, Charles Berry, Joseph R. Ecker, and Frederic Bushman. 2002. “HIV-1 Integration in the Human Genome Favors Active Genes and Local Hotspots.” Cell 110 (4): 521–29.

Scott, L. J., J. W. Griffin, C. Luciano, N. W. Barton, Tapas K. Banerjee, T. Crawford, J. C. McArthur, A. Tournay, and R. Schiffmann. 1999. “Quantitative Analysis of Epidermal Innervation in Fabry Disease.” Neurology 52 (6): 1249–54. doi:10.1212/WNL.52.6.1249.

Shapiro, L. J., K. A. Aleck, M. M. Kaback, H. Itabashi, R. J. Desnick, N. Brand, R. L. Stevens, A. L. Fluharty, and H. Kihara. 1979. “Metachromatic Leukodystrophy without Arylsulfatase A Deficiency.” Pediatric Research 13 (10): 1179–81. doi:10.1203/00006450-197910000- 00021.

Shayman, James A., and Scott D. Larsen. 2014. “The Development and Use of Small Molecule Inhibitors of Glycosphingolipid Metabolism for Lysosomal Storage Diseases.” Journal of Lipid Research 55 (7). American Society for Biochemistry and Molecular Biology: 1–35. doi:10.1194/jlr.R047167.

Shen, Yuechun, Peter F. Bodary, Fernando B. Vargas, Jonathon W. Homeister, David Gordon, Kristen A. Ostenso, James A. Shayman, and Daniel T. Eitzman. 2006. “α-Galactosidase A Deficiency Leads to Increased Tissue Fibrin Deposition and Thrombosis in Mice

161

Homozygous for the Factor V Leiden Mutation.” Stroke 37 (4): 1106–8. doi:10.1161/01.STR.0000206442.86238.39.

Sher, N. A., R. D. Letson, and R. J. Desnick. 1979. “The Ocular Manifestations in Fabry’s Disease.” Archives of Ophthalmology (Chicago, Ill. : 1960) 97 (4): 671–76. http://www.ncbi.nlm.nih.gov/pubmed/106811.

Sheth, K. J., and H. M. Swick. 1980a. “Peripheral Nerve Conduction in Fabry Disease.” Annals of Neurology 7 (4): 319–23. doi:10.1002/ana.410070406.

———. 1980b. “Peripheral Nerve Conduction in Fabry Disease.” Annals of Neurology 7 (4): 319– 23. doi:10.1002/ana.410070406.

Shi, Qiyun, Junji Chen, Jitphapa Pongmoragot, Sylvain Lanthier, and Gustavo Saposnik. 2014. “Prevalence of Fabry Disease in Stroke Patients - A Systematic Review and Meta-Analysis.” Journal of Stroke and Cerebrovascular Diseases 23 (5): 985–92. doi:10.1016/j.jstrokecerebrovasdis.2013.08.010.

Shire Human Genetic Therapies. 2010. “Replagal: Summary of Product Characteristics.” Danderyd, Sweden: Shire Human Genetic Therapies.

Sillence, Dan J., Vishwajeet Puri, David L. Marks, Terry D. Butters, Raymond A. Dwek, Richard E. Pagano, and Frances M. Platt. 2002. “Glucosylceramide Modulates Membrane Traffic along the Endocytic Pathway.” Journal of Lipid Research 43 (11): 1837–45. http://www.ncbi.nlm.nih.gov/pubmed/12401882.

Simons, K., and E. Ikonen. 1997. “Functional Rafts in Cell Membranes.” Nature 387 (6633): 569– 72. doi:10.1038/42408.

Sirrs, S., J. T. R. Clarke, D. G. Bichet, R. Casey, K. Lemoine, G. Flowerdew, D. S. Sinasac, and M. L. West. 2010. “Baseline Characteristics of Patients Enrolled in the Canadian Fabry Disease Initiative.” Molecular Genetics and Metabolism 99 (4): 367–73. doi:10.1016/j.ymgme.2009.11.001.

Sirrs, S. M., D. G. Bichet, R. Casey, J. T. R. Clarke, K. Lemoine, S. Doucette, and M. L. West. 2014. “Outcomes of Patients Treated through the Canadian Fabry Disease Initiative.”

162

Molecular Genetics and Metabolism 111 (4): 499–506. doi:10.1016/j.ymgme.2014.01.014.

Smid, B. E., L. van der Tol, F. Cecchi, P. M. Elliott, D. A. Hughes, G. E. Linthorst, J. Timmermans, et al. 2014. “Uncertain Diagnosis of Fabry Disease: Consensus Recommendation on Diagnosis in Adults with Left Ventricular Hypertrophy and Genetic Variants of Unknown Significance.” International Journal of Cardiology 177 (2). Elsevier: 400–408. doi:10.1016/j.ijcard.2014.09.001.

Smid, Bouwien E., Linda van der Tol, Marieke Biegstraaten, Gabor E. Linthorst, Carla E. M. Hollak, and Ben J. H. M. Poorthuis. 2015. “Plasma Globotriaosylsphingosine in Relation to Phenotypes of Fabry Disease.” Journal of Medical Genetics 52 (4): 262–68. doi:10.1136/jmedgenet-2014-102872.

Smith, Daniel C., Daniel J. Sillence, Thomas Falguières, Rosemary M. Jarvis, Ludger Johannes, J Michael Lord, Frances M. Platt, and Lynne M. Roberts. 2006. “The Association of Shiga-like Toxin with Detergent-Resistant Membranes Is Modulated by Glucosylceramide and Is an Essential Requirement in the Endoplasmic Reticulum for a Cytotoxic Effect.” Molecular Biology of the Cell 17 (3): 1375–87. doi:10.1091/mbc.E05-11-1035.

Somenzi, D., M. Corradini, A. Morrone, F. Iannuzzella, and S. Pasquali. 2011. “Malattia Di Fabry in Madre E Figlio: Una Nuova Variante Nucleotidica c.1229 C>T.” In 52 Congresso SIN 2011. Genova. http://www.webposter.it/web/eventi/postsin11/?List=WsIdRisposta,WsRelease,WsTxtParol eKey,WsTxtIdSessione,WsresetKey&c1=238&c2=1&c3=&c4=&c5=false.

Spada, Marco, Severo Pagliardini, Makiko Yasuda, Turgut Tukel, Geetha Thiagarajan, Hitoshi Sakuraba, Alberto Ponzone, and Robert J. Desnick. 2006. “High Incidence of Later-Onset Fabry Disease Revealed by Newborn Screening.” American Journal of Human Genetics 79 (1): 31–40. doi:10.1086/504601.

Spoerel, N., H. T. Nguyen, and F. C. Kafatos. 1986. “Gene Regulation and Evolution in the Chorion Locus of Bombyx Mori. Structural and Developmental Characterization of Four Eggshell Genes and Their Flanking DNA Regions.” Journal of Molecular Biology 190 (1): 23–35. http://www.ncbi.nlm.nih.gov/pubmed/3023635.

163

Sprong, H., S. Degroote, T. Claessens, J. van Drunen, V. Oorschot, B. H. Westerink, Y. Hirabayashi, J. Klumperman, P. van der Sluijs, and G. van Meer. 2001. “Glycosphingolipids Are Required for Sorting Melanosomal Proteins in the Golgi Complex.” The Journal of Cell Biology 155 (3): 369–80. doi:10.1083/jcb.200106104.

Stahl, N., H. Jurevics, P. Morell, K. Suzuki, and B. Popko. 1994. “Isolation, Characterization, and Expression of cDNA Clones That Encode Rat UDP-Galactose: Ceramide Galactosyltransferase.” Journal of Neuroscience Research 38 (2): 234–42. doi:10.1002/jnr.490380214.

Strømme, Petter, Jan Eric Månsson, Helge Scott, Kari Skullerud, and Torstein Hovig. 1997. “Encephaloneuropathy with Lysosomal Zebra Bodies and GM2 Ganglioside Storage.” Pediatric Neurology 16 (2). Elsevier: 141–44. doi:10.1016/S0887-8994(96)00298-6.

Stubbs, C. D., B. Ketterer, and R. M. Hicks. 1979. “The Isolation and Analysis of the Luminal Plasma Membrane of Calf Urinary Bladder Epithelium.” Biochimica et Biophysica Acta 558 (1): 58–72. http://www.ncbi.nlm.nih.gov/pubmed/497198.

Sung, J. H. 1979. “Autonomic Neurons Affected by Lipid Storage in the Spinal Cord in Fabry’s Disease: Distribution of Autonomic Neurons in the Sacral Cord.” Journal of Neuropathology and Experimental Neurology 38 (2): 87–98. http://www.ncbi.nlm.nih.gov/pubmed/122226.

Svennerholm, L., M. T. Vanier, and J. E. Månsson. 1980. “Krabbe Disease: A Galactosylsphingosine (Psychosine) Lipidosis.” Journal of Lipid Research 21 (1): 53–64. http://www.ncbi.nlm.nih.gov/pubmed/7354254.

Tagami, Seiichi, Jin-ichi Inokuchi Ji, Kazuya Kabayama, Haruhiko Yoshimura, Futoshi Kitamura, Satoshi Uemura, Chie Ogawa, et al. 2002. “Ganglioside GM3 Participates in the Pathological Conditions of Insulin Resistance.” The Journal of Biological Chemistry 277 (5): 3085–92. doi:10.1074/jbc.M103705200.

Takagi, Y., E. Kriehuber, G. Imokawa, P. M. Elias, and W. M. Holleran. 1999. “Beta- Glucocerebrosidase Activity in Mammalian Stratum Corneum.” Journal of Lipid Research 40 (5): 861–69. http://www.ncbi.nlm.nih.gov/pubmed/10224155.

164

Takahashi, Hiroshi, Yukihiko Hirai, Makoto Migita, Yoshihiko Seino, Yuh Fukuda, Hitoshi Sakuraba, Ryoichi Kase, Toshihide Kobayashi, Yasuhiro Hashimoto, and Takashi Shimada. 2002. “Long-Term Systemic Therapy of Fabry Disease in a Knockout Mouse by Adeno- Associated Virus-Mediated Muscle-Directed Gene Transfer.” Proceedings of the National Academy of Sciences of the United States of America 99 (21): 13777–82. doi:10.1073/pnas.222221899.

Takenaka, T., G. J. Murray, G. Qin, J. M. Quirk, T. Ohshima, P. Qasba, K. Clark, A. B. Kulkarni, R. O. Brady, and J. A. Medin. 2000. “Long-Term Enzyme Correction and Lipid Reduction in Multiple Organs of Primary and Secondary Transplanted Fabry Mice Receiving Transduced Bone Marrow Cells.” Proceedings of the National Academy of Sciences of the United States of America 97 (13): 7515–20. doi:10.1073/pnas.120177997.

Takenaka, Toshihiro, Chad S. Hendrickson, David M. Tworek, Matthew Tudor, Raphael Schiffmann, Roscoe O. Brady, and Jeffrey A. Medin. 1999. “Enzymatic and Functional Correction along with Long-Term Enzyme Secretion from Transduced Bone Marrow Hematopoietic Stem/progenitor and Stromal Cells Derived from Patients with Fabry Disease.” Experimental Hematology 27 (7): 1149–59. doi:10.1016/S0301-472X(99)00050-8.

Takenaka, Toshihiro, G. Qin, R. O. Brady, and J. A. Medin. 1999. “Circulating Alpha- Galactosidase A Derived from Transduced Bone Marrow Cells: Relevance for Corrective Gene Transfer for Fabry Disease.” Hum Gene Ther 10 (12): 1931–39. doi:10.1089/10430349950017293.

Takiyama, N., J. T. Dunigan, M. J. Vallor, R. Kase, H. Sakuraba, and J. A. Barranger. 1999. “Retrovirus-Mediated Transfer of Human Alpha-Galactosidase A Gene to Human CD34+ Hematopoietic Progenitor Cells.” Human Gene Therapy 10 (18): 2881–89. doi:10.1089/10430349950016302.

Tanaka, Akemi, Taisuke Takeda, Takao Hoshina, Kazuyoshi Fukai, and Tsunekazu Yamano. 2010. “Enzyme Replacement Therapy in a Patient with Fabry Disease and the Development of IgE Antibodies against Agalsidase Beta but Not Agalsidase Alpha.” Journal of Inherited Metabolic Disease 33 (SUPPL. 3): S249-52. doi:10.1007/s10545-010-9136-0.

165

Thomas, A. S., and A. B. Mehta. 2013. “Difficulties and Barriers in Diagnosing Fabry Disease: What Can Be Learnt from the Literature?” Expert Opinion on Medical Diagnostics 7 (6): 589–99.

Thurberg, Beth L., and Juan M. Politei. 2012. “Histologic Abnormalities of Placental Tissues in Fabry Disease: A Case Report and Review of the Literature.” Human Pathology. doi:10.1016/j.humpath.2011.07.020.

Tøndel, Camilla, Leif Bostad, Asle Hirth, and Einar Svarstad. 2008. “Renal Biopsy Findings in Children and Adolescents With Fabry Disease and Minimal Albuminuria.” American Journal of Kidney Diseases 51 (5): 767–76. doi:10.1053/j.ajkd.2007.12.032.

Touraine, J. L., M. C. Malik, H. Perrot, I. Maire, J. P. Revillard, E. Grosshans, and J. Traeger. 1979. “Fabry’s Disease: Two Patients Improved by Fetal Liver Cells.” La Nouvelle Presse Mé dicale 8 (18): 1499–1503. http://www.ncbi.nlm.nih.gov/pubmed/112574.

Trobridge, Grant D. 2011. “Genotoxicity of Retroviral Hematopoietic Stem Cell Gene Therapy.” Expert Opinion on Biological Therapy 11 (5): 581–93. doi:10.1517/14712598.2011.562496.

Tsakiris, D., H. K. Simpson, E. H. Jones, J. D. Briggs, C. G. Elinder, S. Mendel, G. Piccoli, et al. 1996. “Report on Management of Renale Failure in Europe, XXVI, 1995. Rare Diseases in Renal Replacement Therapy in the ERA-EDTA Registry.” Nephrology, Dialysis, Transplantation : Official Publication of the European Dialysis and Transplant Association - European Renal Association 11 Suppl 7: 4–20. http://www.ncbi.nlm.nih.gov/pubmed/9067983.

Uchino, M., E. Uyama, H. Kawano, J. Hokamaki, K. Kugiyama, Y. Murakami, H. Yasue, and M. Ando. 1995. “A Histochemical and Electron Microscopic Study of Skeletal and Cardiac Muscle from a Fabry Disease Patient and Carrier.” Acta Neuropathologica 90 (3): 334–38. doi:10.1007/s004010050339.

Unger, Tamar, and Yoav Peleg. 2012. “Recombinant Protein Expression in the Baculovirus- Infected Insect Cell System.” Methods in Molecular Biology 800: 187–99. doi:10.1007/978- 1-61779-349-3_13.

166 van Breemen, Mariëlle J., Saskia M. Rombach, Nick Dekker, Ben J. Poorthuis, Gabor E. Linthorst, Aeilko H. Zwinderman, Frank Breunig, Christoph Wanner, Johannes M. Aerts, and Carla E. Hollak. 2011. “Reduction of Elevated Plasma Globotriaosylsphingosine in Patients with Classic Fabry Disease Following Enzyme Replacement Therapy.” Biochimica et Biophysica Acta - Molecular Basis of Disease 1812 (1): 70–76. doi:10.1016/j.bbadis.2010.09.007.

Van Den Bergh, Frank A. J. T. M., and Joseph M. Tager. 1976. “Localization of Neutral Glycosphingolipids in Human Plasma.” Biochimica et Biophysica Acta (BBA)/Lipids and Lipid Metabolism 441 (3): 391–402. doi:10.1016/0005-2760(76)90236-8. van der Tol, L., B. E. Smid, B. J. H. M. Poorthuis, M. Biegstraaten, R. H. Lekanne Deprez, G. E. Linthorst, and C. E. M. Hollak. 2014. “A Systematic Review on Screening for Fabry Disease: Prevalence of Individuals with Genetic Variants of Unknown Significance.” Journal of Medical Genetics 51 (1): 1–9. doi:10.1136/jmedgenet-2013-101857.

Van Loo, A., R. Vanholder, K. Madsen, M. Praet, J. Kint, A. De Paepe, L. Messiaen, et al. 1996. “Novel Frameshift Mutation in a Heterozygous Woman with Fabry Disease and End-Stage Renal Failure.” American Journal of Nephrology 16 (4): 352–57. http://www.ncbi.nlm.nih.gov/pubmed/8739292. van Meer, G., and K. Simons. 1988. “Lipid Polarity and Sorting in Epithelial Cells.” Journal of Cellular Biochemistry 36 (1): 51–58. doi:10.1002/jcb.240360106.

Van Meer, Gerrit, and J. C. M. Holthuis. 2000. “Sphingolipid Transport in Eukaryotic Cells.” Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. doi:10.1016/S1388- 1981(00)00054-8.

Vanier, M., and L. Svennerholm. 1976. “Chemical Pathology of Krabbe Disease: The Occurrence of Psychosine and Other Neutral Sphingoglycolipids.” Advances in Experimental Medicine and Biology 68: 115–26. http://www.ncbi.nlm.nih.gov/pubmed/937104.

Vedder, A. C., A. Strijland, M. A. vd Bergh Weerman, S. Florquin, J. M. F. G. Aerts, and C. E. M. Hollak. 2006. “Manifestations of Fabry Disease in Placental Tissue.” Journal of Inherited Metabolic Disease 29 (1): 106–11. doi:10.1007/s10545-006-0196-0.

167

Vedder, Anouk C., Frank Breunig, Wilma E. Donker-Koopman, Kevin Mills, Elisabeth Young, Bryan Winchester, Ineke J. M. Ten Berge, et al. 2008. “Treatment of Fabry Disease with Different Dosing Regimens of Agalsidase: Effects on Antibody Formation and GL-3.” Molecular Genetics and Metabolism 94 (3): 319–25. doi:10.1016/j.ymgme.2008.03.003.

Vedder, Anouk C., Gabor E. Linthorst, Gunnar Houge, Johanna E. M. Groener, Els E. Ormel, Berto J. Bouma, Johannes M. F. G. Aerts, Asle Hirth, and Carla E. M. Hollak. 2007. “Treatment of Fabry Disease: Outcome of a Comparative Trial with Agalsidase Alfa or Beta at a Dose of 0.2 Mg/kg.” PLoS ONE 2 (7): e598. doi:10.1371/journal.pone.0000598.

Vogelberg, K. H., H. G. Solbach, and F. A. Gries. 1969. “Lipoid Chemical Studies on Angiokeratoma Corporis Diffusum (Fabry’s Syndrome).” Klinische Wochenschrift 47 (17): 916–19. http://www.ncbi.nlm.nih.gov/pubmed/5381980.

Wang, X. Q., P. Sun, and A. S. Paller. 2001. “Inhibition of Integrin-Linked Kinase/protein Kinase B/Akt Signaling: Mechanism for Ganglioside-Induced Apoptosis.” The Journal of Biological Chemistry 276 (48): 44504–11. doi:10.1074/jbc.M106563200.

Watanabe, K., T. Matsubara, and S. Hakomori. 1976. “Alpha-L-Fucopyranosylceramide, a Novel Glycolipid Accumulated in Some of the Human Colon Tumors.” The Journal of Biological Chemistry 251 (8): 2385–87. http://www.ncbi.nlm.nih.gov/pubmed/1262328.

Weidemann, F., M. Niemann, S. Störk, F. Breunig, M. Beer, C. Sommer, S. Herrmann, G. Ertl, and C. Wanner. 2013. “Long-Term Outcome of Enzyme-Replacement Therapy in Advanced Fabry Disease: Evidence for Disease Progression towards Serious Complications.” Journal of Internal Medicine 274 (4): 331–41. doi:10.1111/joim.12077.

Wennekes, Tom, Richard J. B. H. N. van den Berg, Rolf G. Boot, Gijsbert A. van der Marel, Herman S. Overkleeft, and Johannes M. F. G. Aerts. 2009. “Glycosphingolipids--Nature, Function, and Pharmacological Modulation.” Angewandte Chemie (International Ed. in English) 48 (47): 8848–69. doi:10.1002/anie.200902620.

West, Michael, Kathy Nicholls, Atul Mehta, Joe T. R. Clarke, Robert Steiner, Michael Beck, Bruce A. Barshop, et al. 2009. “Agalsidase Alfa and Kidney Dysfunction in Fabry Disease.” Journal of the American Society of Nephrology : JASN 20 (5): 1132–39.

168

doi:10.1681/ASN.2008080870.

Whybra, Catharina, Elke Miebach, Eugen Mengel, Andreas Gal, Karin Baron, Michael Beck, and Christoph Kampmann. 2009. “A 4-Year Study of the Efficacy and Tolerability of Enzyme Replacement Therapy with Agalsidase Alfa in 36 Women with Fabry Disease.” Genetics in Medicine 11 (6): 441–49. doi:10.1097/GIM.0b013e3181a23bec.

Wilcox, William R., Maryam Banikazemi, Nathalie Guffon, Stephen Waldek, Philip Lee, Gabor E. Linthorst, Robert J. Desnick, and Dominique P. Germain. 2004. “Long-Term Safety and Efficacy of Enzyme Replacement Therapy for Fabry Disease.” American Journal of Human Genetics 75 (1): 65–74. doi:10.1086/422366.

Wilcox, William R., Gabor E. Linthorst, Dominique P. Germain, Ulla Feldt-Rasmussen, Stephen Waldek, Susan M. Richards, Dana Beitner-Johnson, et al. 2012. “Anti-α-Galactosidase A Antibody Response to Agalsidase Beta Treatment: Data from the Fabry Registry.” Molecular Genetics and Metabolism 105 (3): 443–49. doi:10.1016/j.ymgme.2011.12.006.

Wildt, Stefan, and Tilllman U. Gerngross. 2005. “The Humanization of N-Glycosylation Pathways in Yeast.” Nature Reviews. Microbiology 3 (2): 119–28. doi:10.1038/nrmicro1087.

Winchester, B. G. 2001. “Lysosomal Membrane Proteins.” European Journal of Paediatric Neurology : EJPN : Official Journal of the European Paediatric Neurology Society 5 Suppl A (January): 11–19. http://www.ncbi.nlm.nih.gov/pubmed/11588980.

Wise, D., H. J. Wallace, and E. H. Jellinek. 1962. “Angiokeratoma Corporis Diffusum. A Clinical Study of Eight Affected Families.” The Quarterly Journal of Medicine 31 (April): 177–206. http://www.ncbi.nlm.nih.gov/pubmed/14007664.

Witschel, H., and J. Mathyl. 1969. “Morphological Bases of the Specific Ocular Changes in Fabry’s Disease.” Klinische Monatsblä tter Fü r Augenheilkunde 154 (4): 599–605. http://www.ncbi.nlm.nih.gov/pubmed/5354438.

Wraith, J. Edmond, Anna Tylki-Szymanska, Nathalie Guffon, Y. Howard Lien, Michel Tsimaratos, Ashok Vellodi, and Dominique P. Germain. 2008. “Safety and Efficacy of Enzyme Replacement Therapy with Agalsidase Beta: An International, Open-Label Study in

169

Pediatric Patients with Fabry Disease.” Journal of Pediatrics 152 (4): 563–70. doi:10.1016/j.jpeds.2007.09.007.

Wu, L., N. P. Gerard, R. Wyatt, H. Choe, C. Parolin, N. Ruffing, A. Borsetti, et al. 1996. “CD4- Induced Interaction of Primary HIV-1 gp120 Glycoproteins with the Chemokine Receptor CCR-5.” Nature 384 (6605): 179–83. doi:10.1038/384179a0.

Xiao, L., S. M. Owen, I. Goldman, A. A. Lal, J. J. DeJong, J. Goudsmit, and R. B. Lal. 1998. “CCR5 Coreceptor Usage of Non-Syncytium-Inducing Primary HIV-1 Is Independent of Phylogenetically Distinct Global HIV-1 Isolates: Delineation of Consensus Motif in the V3 Domain That Predicts CCR-5 Usage.” Virology 240 (1): 83–92. doi:10.1006/viro.1997.8924.

Xu, Su, Yi Lun, Nastry Brignol, Rick Hamler, Adriane Schilling, Michelle Frascella, Sean Sullivan, et al. 2015. “Coformulation of a Novel Human α-Galactosidase A With the Pharmacological Chaperone AT1001 Leads to Improved Substrate Reduction in Fabry Mice.” Molecular Therapy 23 (7): 1169–81. doi:10.1038/mt.2015.87.

Xue, Yong, Susan M. Richards, Asif Mahmood, and Gerald F. Cox. 2015. “Effect of Anti- Laronidase Antibodies on Efficacy and Safety of Laronidase Enzyme Replacement Therapy for MPS I: A Comprehensive Meta-Analysis of Pooled Data from Multiple Studies.” Molecular Genetics and Metabolism. doi:10.1016/j.ymgme.2016.02.006.

Yamaji, Toshiyuki, Kiyotaka Nishikawa, and Kentaro Hanada. 2010. “Transmembrane BAX Inhibitor Motif Containing (TMBIM) Family Proteins Perturbs a Trans-Golgi Network Enzyme, Gb3 Synthase, and Reduces Gb3 Biosynthesis.” The Journal of Biological Chemistry 285 (46): 35505–18. doi:10.1074/jbc.M110.154229.

Yamamoto, K., G. Sobue, S. Iwase, K. Kumazawa, T. Mitsuma, and T. Mano. 1996. “Possible Mechanism of Anhidrosis in a Symptomatic Female Carrier of Fabry’s Disease: An Assessment by Skin Sympathetic Nerve Activity and Sympathetic Skin Response.” Clinical Autonomic Research 6 (2): 107–10. doi:10.1007/BF02291231.

Yamashita, T. 2000. “A Vital Role for Glycosphingolipid Synthesis during Development and Differentiaion.” Seikagaku 72 (12): 1420–25. doi:10.1073/pnas.96.16.9142.

170

Yang, T. P., and C. T. Caskey. 1987. “Nuclease Sensitivity of the Mouse HPRT Gene Promoter Region: Differential Sensitivity on the Active and Inactive X Chromosomes.” Molecular and Cellular Biology 7 (8): 2994–98. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=367922&tool=pmcentrez&rend ertype=abstract.

Yasuda, Kayo, Hui Hwa Chang, Hui Li Wu, Satoshi Ishii, and Jian Qiang Fan. 2004. “Efficient and Rapid Purification of Recombinant Human α-Galactosidase A by Affinity Column Chromatography.” Protein Expression and Purification 37 (2): 499–506. doi:10.1016/j.pep.2004.07.005.

Yoda, Y., T. Ishibashi, and A. Makita. 1980. “Isolation, Characterization, and Biosynthesis of Forssman Antigen in Human Lung and Lung Carcinoma.” Journal of Biochemistry 88 (6): 1887–90. http://www.ncbi.nlm.nih.gov/pubmed/6257673.

Yokoi, Takayuki, Hiroshi Kobayashi, Yohta Shimada, Yoshikatsu Eto, Nobuyuki Ishige, Teruo Kitagawa, Makoto Otsu, Hiromitsu Nakauchi, Hiroyuki Ida, and Toya Ohashi. 2011. “Minimum Requirement of Donor Cells to Reduce the Glycolipid Storage Following Bone Marrow Transplantation in a Murine Model of Fabry Disease.” The Journal of Gene Medicine 13 (5): 262–68. doi:10.1002/jgm.1566.

Yoon, Seon-Joo, Ken-ichi Nakayama, Toshiyuki Hikita, Kazuko Handa, and Sen-itiroh Hakomori. 2006. “Epidermal Growth Factor Receptor Tyrosine Kinase Is Modulated by GM3 Interaction with N-Linked GlcNAc Termini of the Receptor.” Proceedings of the National Academy of Sciences of the United States of America 103 (50): 18987–91. doi:10.1073/pnas.0609281103.

Yoshimitsu, Makoto, K. Higuchi, S. Ramsubir, T. Nonaka, V. I. Rasaiah, C. Siatskas, S. B. Liang, G. J. Murray, R. O. Brady, and J. A. Medin. 2007. “Efficient Correction of Fabry Mice and Patient Cells Mediated by Lentiviral Transduction of Hematopoietic Stem/progenitor Cells.” Gene Therapy 14 (3): 256–65. doi:10.1038/sj.gt.3302839.

Yoshimitsu, Makoto, Takeya Sato, Kesheng Tao, Jagdeep S. Walia, Vanessa I. Rasaiah, Gillian T. Sleep, Gary J. Murray, et al. 2004. “Bioluminescent Imaging of a Marking Transgene and Correction of Fabry Mice by Neonatal Injection of Recombinant Lentiviral Vectors.”

171

Proceedings of the National Academy of Sciences of the United States of America 101 (48): 16909–14. doi:10.1073/pnas.0407572101.

Young, Megan M., Mark Kester, and Hong-Gang Wang. 2013. “Sphingolipids: Regulators of Crosstalk between Apoptosis and Autophagy.” Journal of Lipid Research 54 (1): 5–19. doi:10.1194/jlr.R031278.

Zhu, Y., B. Doray, A. Poussu, V. P. Lehto, and S. Kornfeld. 2001. “Binding of GGA2 to the Lysosomal Enzyme Sorting Motif of the Mannose 6-Phosphate Receptor.” Science (New York, N.Y.) 292 (5522): 1716–18. doi:10.1126/science.1060896.

Ziegler, R. J., N. S. Yew, C. Li, M. Cherry, P. Berthelette, H. Romanczuk, Y. A. Ioannou, K. M. Zeidner, R. J. Desnick, and S. H. Cheng. 1999. “Correction of Enzymatic and Lysosomal Storage Defects in Fabry Mice by Adenovirus-Mediated Gene Transfer.” Human Gene Therapy 10 (10): 1667–82. doi:10.1089/10430349950017671.

Ziegler, Robin J., Maribeth Cherry, Christine M. Barbon, Chester Li, Scott D Bercury, Donna Armentano, Robert J. Desnick, and Seng H. Cheng. 2007. “Correction of the Biochemical and Functional Deficits in Fabry Mice Following AAV8-Mediated Hepatic Expression of Alpha-Galactosidase A.” Molecular Therapy : The Journal of the American Society of Gene Therapy 15 (3): 492–500. doi:10.1038/sj.mt.6300066.

Zoja, C., D. Corna, C. Farina, G. Sacchi, C. Lingwood, M. P. Doyle, V. V. Padhye, M. Abbate, and G. Remuzzi. 1992. “Verotoxin Glycolipid Receptors Determine the Localization of Microangiopathic Process in Rabbits given Verotoxin-1.” The Journal of Laboratory and Clinical Medicine 120 (2): 229–38. http://www.ncbi.nlm.nih.gov/pubmed/1323633.

Zurita, A. R., H. J. Maccioni, and J. L. Daniotti. 2001. “Modulation of Epidermal Growth Factor Receptor Phosphorylation by Endogenously Expressed Gangliosides.” The Biochemical Journal 355 (Pt 2): 465–72. doi:10.1042/0264-6021:3550465.