US 201203.01433A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0301433 A1 Lu et al. (43) Pub. Date: Nov. 29, 2012
(54) BACTERIOPHAGES EXPRESSING AMYLOID Related U.S. Application Data PEPTDES AND USES THEREOF (60) Provisional application No. 61/229,703, filed on Jul. 29, 2009, provisional application No. 61/233,697, (75) Inventors: Timothy Kuan-Ta Lu, filed on Aug. 13, 2009. Charlestown, MA (US); Susan Lindquist, Chestnut Hill, MA (US); Publication Classification Rajaraman Krishnan, Quincy, (51) Int. Cl. MA (US); James Collins, Newton CI2N 7/01 (2006.01) Center, MA (US); Charles W. C2S 9/00 (2006.01) O'Donnell, Somerville, MA (US); A6II 35/76 (2006.01) Bonnie Berger Leighton, (52) U.S. Cl...... 424/93.2; 435/235.1: 435/264 Newtonville, MA (US); Srinivas (57) ABSTRACT Devadas, Lexington, MA (US) The present invention generally relates to engineered bacte riophages which express amyloid peptides for the modulation (73) Assignees: WHITE HEAD INSTITUTE FOR (e.g. increase or decrease) of protein aggregates and amyloid BIOMEDICAL RESEARCH, formation. In some embodiments, the engineered bacterioph Cambridge, MA (US); ages express anti-amyloid peptides for inhibiting protein MASSACHUSETTS INSTITUTE aggregation and amyloid formation, which can be useful in OF TECHNOLOGY, Cambridge, the treatment and prevention of and bacterial infections and MA (US); TRUSTEES OF biofilms. In some embodiments, the engineered bacterioph BOSTON UNIVERSITY, Boston, ages express amyloid peptides for promoting amyloid forma MA (US) tion, which are useful for increasing amyloid formation Such as promoting bacterial biofilms. Other aspects relate to meth (21) Appl. No.: 13/387,888 ods to inhibit bacteria biofilms, and methods for the treatment of amyloid related disorders, e.g., Alzheimer's disease using (22) PCT Filed: Jul. 29, 2010 an anti-amyloid peptide engineered bacteriophages. Other aspects of the invention relate to engineered bacteriophages (86). PCT No.: PCT/US 10/43770 to express the amyloid peptides on the bacteriophage Surface and/or secrete the amyloid peptides, e.g., anti-amyloid pep S371 (c)(1), tides and pro-amyloid peptides, and uses thereof for modula (2), (4) Date: Aug. 8, 2012 tion protein aggregates and amyloid formation. Patent Application Publication Nov. 29, 2012 Sheet 1 of 54 US 2012/0301.433 A1 Patent Application Publication Nov. 29, 2012 Sheet 2 of 54 US 2012/0301.433 A1
--21-3 SECD NO: 15 --&-32-2 SED NO. 34 -- 30-1 SECD NO:32 --24-3 SEGD NO: 18 -o-18-1 SECONO: 12 -o-2-3 SED NO:29 -X-22-1 SEQDN): 16 -o-31-1 SED NO:33
45%
25% 1.E--O 1.E--O2 1.E--03 1.E--04 1.E--5 .E--OS PFU FIG. 2 Patent Application Publication Nov. 29, 2012 Sheet 3 of 54 US 2012/0301.433 A1
V8(50.IH
NOTWO IOTAN 4 Patent Application Publication Nov. 29, 2012 Sheet 4 of 54 US 2012/0301.433 A1
-o-csgA FIBER ASSEMBLY DATA -0-18-1 (500) SEC ID: 12 19000 -A-27-3(500) SEC ID: 29
14OOO
9000
4000 or, O 50 100 150 2OO 250 3OO Patent Application Publication Nov. 29, 2012 Sheet 5 of 54 US 2012/0301.433 A1
ÄÖHVALVYNN?éAÕI,ANASSNSVILÕGIAVVIÐNIÐ??JÕXALWEISNXIÐNMÖCITLV
HONETI?IESTIJ?UNIWW?ûs]
Patent Application Publication Nov. 29, 2012 Sheet 7 of 54 US 2012/0301.433 A1
IML1
9(01)I
WOIO-ZINTOSOOO900 Patent Application Publication Nov. 29, 2012 Sheet 8 of 54 US 2012/0301.433 A1
8IZ'50IJI OZ"50IJI
WZ'50IJI Patent Application Publication Nov. 29, 2012 Sheet 9 of 54
e N (NY)3ONOSONY Patent Application Publication Nov. 29, 2012 Sheet 10 of 54 US 2012/0301.433 A1
HSNOEPSNNESSEHN-ººººººd.AASVIVSSS:AIVVIVWA:TXiKi V8(50IJI Patent Application Publication Nov. 29, 2012 Sheet 11 of 54 US 2012/0301.433 A1
% ? •689 (“Qu00)V8%)IAI XHALWEISNÆÐNMOGITIIVSNERIÐHÓLICIISSOEICIS905)A(IV)ºn?)55HÕLILICISNHVCILÕTVTVSN999XÔ?INI Patent Application Publication Nov. 29, 2012 Sheet 12 of 54 US 2012/0301.433 A1
TIGT OGT TIGT IGT ZGT TGT TIGT TGT
9 |6
| (“Qu00)V8(5)IAI 6.-556 Patent Application Publication Nov. 29, 2012 Sheet 13 of 54 US 2012/0301.433 A1
818 '50IJI
**** Patent Application Publication Nov. 29, 2012 Sheet 14 of 54 US 2012/0301.433 A1
(“Qu00)818%)IJI INI?SNao: 3 NIESNäÐSN) Patent Application Publication Nov. 29, 2012 Sheet 15 of 54 US 2012/0301.433 A1
“qu00)818( °5)IJI Patent Application Publication Nov. 29, 2012 Sheet 16 of 54 US 2012/0301.433 A1
MÅLTIS,HTJÄNTTIAA\IHXHAXHJ?—-?NH?HLYNNOEMIT?s?TINTIAAYH×AHW-- (“Quoo){9(9IAI
***** Patent Application Publication Nov. 29, 2012 Sheet 17 of 54 US 2012/0301.433 A1
(*41100)8.18(50.IJI
Patent Application Publication Nov. 29, 2012 Sheet 19 of 54 US 2012/0301.433 A1
?:*** ·ozº:·Otº1 TTA,Hylae (“Quoo){9(9IAI
13||||
Patent Application Publication Nov. 29, 2012 Sheet 22 of 54 US 2012/0301.433 A1
(O8 ž?–– °50IJI J?T?un?nsTu??in?TIDLIWTRYGWild 101010129pmuu?nºG?ZZOROV Patent Application Publication Nov. 29, 2012 Sheet 23 of 54 US 2012/0301.433 A1
(“Qu00)O8%9IJI Patent Application Publication Nov. 29, 2012 Sheet 24 of 54 US 2012/0301.433 A1
* (*41100)O8%)IJI Patent Application Publication Nov. 29, 2012 Sheet 25 of 54 US 2012/0301.433 A1
(“Quoo)O9 °50IJI Patent Application Publication Nov. 29, 2012 Sheet 26 of 54 US 2012/0301.433 A1
(“Quo0)OS’91)I Patent Application Publication Nov. 29, 2012 Sheet 27 of 54 US 2012/0301.433 A1
(“Quo0)O9 °50IJI Patent Application Publication Nov. 29, 2012 Sheet 28 of 54 US 2012/0301.433 A1
(*41100)O8%)IH Patent Application Publication Nov. 29, 2012 Sheet 29 of 54 US 2012/0301.433 A1
(“Qu00)O8%)IJI Patent Application Publication Nov. 29, 2012 Sheet 30 of 54 US 2012/0301.433 A1
( ‘quoo)O9 °50IJI Patent Application Publication Nov. 29, 2012 Sheet 31 of 54 US 2012/0301.433 A1
‘HOC
NHH
V6™OIJI
SS OOAWYA Patent Application Publication Nov. 29, 2012 Sheet 32 of 54 US 2012/0301.433 A1
as
s 9 N St. N s N s s s
SOIOTANY% Patent Application Publication Nov. 29, 2012 Sheet 33 of 54 US 2012/0301.433 A1
s
5 s is a ONSOA
O&OOOOO Patent Application Publication Nov. 29, 2012 Sheet 34 of 54 US 2012/0301.433 A1
QQQQQOOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO OOOOOOO
Patent Application Publication Nov. 29, 2012 Sheet 37 of 54 US 2012/0301.433 A1
t rains au
9 FONS as ddd-g?so-yy-Ll Sidda'gisoddd-Ll g: Hyugas-y- SEddd-'g5S)-L SEYY1-asso-L1 dyyyy?soddd-Ll is 3...diddayåsoddd-Ll El Hillgas as E-yas u03. M-II
--earerrararerrarers 39VHd ON e C OO900 OZVNON Patent Application Publication Nov. 29, 2012 Sheet 38 of 54 US 2012/0301.433 A1
as e SCYS
cle ur SE a g 5 S if as N O 3 X K> R
(l)3ONSWNOO
9 “ONOIS
3...dyyyyisoddd-Ll siddddyåsoddd-Ll 'fist u03 ML m39VHd ON (u/n}901) ST1300033197IA Patent Application Publication Nov. 29, 2012 Sheet 39 of 54 US 2012/0301.433 A1
S.R S
Patent Application Publication Nov. 29, 2012 Sheet 40 of 54 US 2012/0301.433 A1
1.0
|||30MHAON |-_tium?º?ºl)444-?yl-£1850-BHH-paluu(1930NDIDES) |[luI/Bd881)ddd-Zyl-£18380-888-11
FIG. 14
Patent Application Publication Nov. 29, 2012 Sheet 42 of 54 US 2012/0301.433 A1
2.0
1.5
0.5 :
u00-LI
FIG. 16 Patent Application Publication Nov. 29, 2012 Sheet 43 of 54 US 2012/0301.433 A1
: s SN ge -- -
Oool. x:y
s s s e ce s s e e s war (W) WSW Patent Application Publication Nov. 29, 2012 Sheet 44 of 54 US 2012/0301.433 A1
s s Sg 5. s s e s vis (W) WSW
s
s
s e s o s se s (i) WSW Patent Application Publication Nov. 29, 2012 Sheet 45 of 54 US 2012/0301.433 A1
8I‘50IJI
Patent Application Publication Nov. 29, 2012 Sheet 46 of 54 US 2012/0301.433 A1
18-09(ZZZUNDIDES)A
©?ðAAI!“,(<INCIDES) 6I’50IJI
Patent Application Publication Nov. 29, 2012 Sheet 47 of 54 US 2012/0301.433 A1
(a 2.5uMNMOPHAGE ALL, DATA o 2.5uMNM25ul 1316 PHAGE O2.5uMNM50 ul 1316 PHAGE O 2.5MNM 100ul 1316 PHAGE 1500 & 2.5uMNM 200ul 1316 PiSE 8 2.5uMNM 500ul 1316 PHAGE 1OOO A 2.5uMNM25ul 1318 PHAGE A 2.5uMNM50 ul 1318 PHAGE 500 + 2.5uMNM 10Oul 1318 PHAGE + 2.5uMNM 200ul 1318 PHAGE - - - 25 MNM soul. 1318 PAGE TIME (MIN) NM. ThT BINDING 1316 AND 1318 NORMALIZED TO SE8 PFU/mL
a 2.5M NMO PHAGE 2000 ALDATA G 2.5uMNM25ul 1316 PHAGE to 2.5uMNM 500 uL 1316 PHAGE 1500 A 2.5uMNM25ul 1318 PHAGE
OBO
500
Too to so 80 TIME (MIN) NM. ThT BINDING 1316 AND 1318 NORMALIZED TO SE8PFU/mL Y-v-1 FIG. 20A Patent Application Publication Nov. 29, 2012 Sheet 48 of 54 US 2012/0301.433 A1
ALDATA 2.5M NMO PHAGE 2000 O2.5uMNM50 ul 1316 PHAGE a 2.5uMNM 50ul 1318 PHAGE 1500
1000
500
SR38ss 200 o ra 600 800 TIME (MIN) NM. ThT BINDING 1316 AND 1318 NORMALIZED TO SE8PFU/mL
ALDATA 2.5MNMOPHAGE 2000 O 2.5uMNM 100 ul 1316 PHAGE +2.5uMNM 10Oul 1318 PHAGE 1500
OOO
500
R. . . . 200 400 s so 800 TIME (MIN) NM. ThT BINDING 1316 AND 1318 NORMALIZED TO SE8 PFU/mL Y-v-1 FIG. 20A (cont.) Patent Application Publication Nov. 29, 2012 Sheet 49 of 54 US 2012/0301.433 A1
a 2.5uMNMOPHAGE ALDATA o 2.5uMNM 200ul 1316PHAGE + 2.5uMNM 200ul 1318 PHAGE 1500
1000
500
O - - - TIME (MIN) NM. ThT BINDING 1316 AND 1318 NORMALIZED TO SE8 PFU/mL
a 2.5uMNMOPHAGE
2000 ALDATA 92.5uMNM 500ul 1316 PHAGE ty 2.5uMNM 500ul 1318 PHAGE 1500
1OOO
500
O 2OO 400 SO 809 TIME (MIN) NM. ThTBNDING 1316 AND 1318 NORMALIZED TOSE8PFU/mL. Y- V -1 FIG. 20A (cont.) Patent Application Publication Nov. 29, 2012 Sheet 50 of 54 US 2012/0301.433 A1
25u NORMALIZED TO 1.6E10 2.5uMNMOPHAGE 2OOO o 2.5uMNM25ul 1316 PHAGE O2.5uMNM25ul 1318 PHAGE O2.5uMNM25ul 1317 PHAGE 1500 c 2.5 MNM 25ul 1319 PHAGE 8 2.5uMNM25uLT7 CONTROL E 1000 ?t 2.5uMNM25ul T wt 500
- 600 TIME (MIN) ALL BINDING TRIALSNORMALIZED TO 1.6E10
ALL, DATA NORMALIZED TO GEO a 2.5uMNMO PHAGE 2000 o 2.5uMNM5Oul 1316 PHAGE O2.5uMNM50 ul 1318 PHAGE O 2.5uMNM50 ul 1317 PHAGE 1500 8 2.5uMNM 50ul 1319PHAGE 8 2.5uMNM 5OuLT7 CONTROL E 1000 # 2.5uMNM 5Oul TT wt 500
TIME (MIN) ALL BINDING TRIALSNORMALIZED TO 1,6E10 Y-v -1 FIG. 20B Patent Application Publication Nov. 29, 2012 Sheet 51 of 54 US 2012/0301.433 A1
2.5uMNMO PHAGE 2000 1OOul NORMALIZED TO 1,6E10 o 2.5uMNM 100ul 1316 PHAGE O2.5uMNM 100ul 1318 PHAGE 1500 O2.5uMNM 100ul 1317 PHAGE & 2.5uMNM 100ul 1319 PHAGE t 0 2.5MNM 100 ulT7 CONTROL 1000 a 2.5uMNM 100 uLT7 wt 500
O 2OO 400 600 800 TIME (MIN) ALL BINDING TRIALSNORMALIZED TO 1.6E10
200 u0RMAZED TO 1.6E10 (32.5uMNMO PHAGE 2000 o 2.5uMNM 200ul 1316 PHAGE O2.5uMNM 200ul 1318 PHAGE O 2.5uMNM 200ul 1317 PHAGE 1500 o 2.5uMNM 200 uL 1319 PHAGE 8 2.5 MNM 200 uLT7 CONTROL 1OOO # 2.5uMNM 200ul T1 wt 500
O - TIME (MIN) ALL BINDING TRIALSNORMAZED TO 1.6E10 N -v-/ FIG. 20B (cont.) Patent Application Publication Nov. 29, 2012 Sheet 52 of 54 US 2012/0301.433 A1
a 2.5uMNMOPHAGE 2000 500 LNORMALIZED TO 1.6EO e 2.5uMNM 500ul 1316 PHAGE O2.5MNM 500ul 1318 PHAGE O 2.5uMNM 500 uL 1317 PHAGE 1500 & 2.5uMNM 500 uL1319 PHASE t 8 2.5uMNM 500ul T7 CONTROL it 1000 # 2.5uMNM 500 uLT7 wt SOO
TIME (MIN) ALL BINDING TRIALSNORMALIZED TO 1.6E10
FIG. 20B (cont.) Patent Application Publication Nov. 29, 2012 Sheet 53 of 54 US 2012/0301.433 A1
ALLDATA 2.5uMNMOPHAGE 1000 0 2.5uMNM 50ul 1317 PHAGE O2.5uMNM 500ul 1317 800 O 2.5uMNM 50ul 1319 600 8 2.5uMNM 500 uL 1319 g o 2.5uMNM50 uLT7 wt 400 * 2.5uMNM 500 ulTwt * 2.5uMNM50 ulT CONTROL 200 • 2.5uMNM 500 uLT7 CONTROL Too 400 -- TIME (MIN) NMTh BINDING PHAGENORMALIED TO 1.6E10 ALL BINDING EXPERIMENTS PERFORMED ON SAME DAY INSAME PLATE
50 LPHAGE G2.5M NMO PHAGE 1000 e 2.5uMNM50 ul 1317 PHAGE O 2.5uMNM 50ul 1319 800 0 2.5uMNM50 uLT7 wt 600 * 2.5uMNM50 uLT7 CONTROL 400
200
O 200 400 600 800 TIME (MIN) NMTh BINDING PHAGENORMAZED TO 1.6E10 ALL BENDING EXPERIMENTS PERFORMED ON SAME DAY INSAME PLATE Y-v-1 FIG. 20O. Patent Application Publication Nov. 29, 2012 Sheet 54 of 54 US 2012/0301.433 A1
SOOu PHAGE a 2.5uMNMOPHAGE 1OOO 0 2.5uMNM 500ul 1317 & 2.5uMNM 500ul 1319 * 2.5uMNM 500 ul T wit 2.5uMNM 500 uLT7 CONTROL t 500
O ...Y.Y. is is sis O 200 400 GOO BOO TIME (MIN) NMTh BINDING PHAGENORMALIED TO1. GEO ALL BINDING EXPERIMENTS PERFORMED ON SAME DAY INSAME PLATE FIG. 20O (cont.) US 2012/03.01433 A1 Nov. 29, 2012
BACTERIOPHAGES EXPRESSING AMYLOD tion using antimicrobial agents. This is a costly and risky PEPTIDES AND USES THEREOF procedure and re-infection can quickly occur upon replace ment of the catheter. CROSS REFERENCE TO RELATED 0006 Bacteriophages (often known simply as “phages') APPLICATIONS are viruses that grow within bacteria. The name translates as 0001. This application claims benefit under 35 U.S.C. 119 “eaters of bacteria' and reflects the fact that as they grow, the (e) of U.S. Provisional Patent Application Ser. No. 61/229, majority of bacteriophages kill the bacterial host in order to 703 filed Jul. 29, 2009, and U.S. Provisional Patent Applica release the next generation of bacteriophages. Naturally tion Ser. No. 61/233,697 filed Aug. 13, 2009, the contents of occurring bacteriophages are incapable of infecting anything each are incorporated herein in their entirety by reference. other than specific strains of the target bacteria, undermining their potential for use as control agents. GOVERNMENT SUPPORT 0007 Bacteriophages (phage) and their therapeutic uses 0002 This invention was made with government support have been the subject of much interest since they were first under R01 GM 025874-29 and OD003644 awarded by the recognized early in the 20th century. Lytic bacteriophages are National Institites of Health (NIH). The Government has viruses that infect bacteria exclusively, replicate, disrupt bac certain rights to the invention. terial metabolism and destroy the cell upon release of phage progeny in a process known as lysis. These bacteriophages FIELD OF THE INVENTION have very effective antibacterial activity and in theory have 0003. The present invention relates to the field of treat several advantages over antibiotics. Most notably they repli ment and prevention of bacteria and bacterial infections. In cate at the site of infection and are therefore available in particular, the present invention relates to engineered bacte abundance where they are most required; no serious or irre riophages that have been engineered to express and secrete versible side effects of phage therapy have yet been described amyloid peptides, including anti-amyloid peptides and pro and selecting alternative phages against resistant bacteria is a amyloid peptides. relatively rapid process that can be carried out in days or weeks. BACKGROUND OF THE INVENTION 0008 Bacteriophages have been reported to be used to 0004 Bacterial biofilms are sources of contamination that sanitize surfaces that may be contaminated with bacteria, as are difficult to eliminate in a variety of industrial, environ discussed in for example, U.S. Pat. No. 6,699,701. Also, mental and clinical settings. Biofilms are polymer structures systems using bacteriophages that encode enzymes that secreted by bacteria to protect bacteria from various environ mental attacks, and thus result also in protection of the bac attack certain biofilm components have been described. Other teria from disinfectants and antibiotics. Biofilms can be found examples of lytic enzymes, such as dispersin encoded by on any environmental Surface where sufficient moisture and bacteriophages that have been used to destroy bacteria have nutrients are present. Bacterial biofilms are associated with been reported in U.S. Pat. No. 6,335,012 and U.S. Patent many human and animal health and environmental problems. Application Publication No. 2005/0004030. For instance, bacteria form biofilms on implanted medical 0009 For example, PCT Publication No. WO 2004/ devices, e.g., catheters, heart Valves, joint replacements, and 062677 discusses a method of treating bacterial biofilm using damaged tissue. Such as the lungs of cystic fibrosis patients. a bacteriophage capable of infecting the bacteria within the Bacteria in biofilms are highly resistant to antibiotics and host biofilm and wherein the bacteriophage also encodes a defenses and consequently are persistent sources of infection. polysaccharide lyase enzyme that is capable of degrading 0005 Biofilms also contaminate surfaces such as water polysaccharides in the biofilm. In one embodiment, addi pipes and the like, and render also other industrial Surfaces tional enzyme is absorbed on the Surface of the phage. hard to disinfect. For example, catheters, in particular central (0010. However, even when the phage of WO 2004/062677 venous catheters (CVCs), are one of the most frequently used is delivered with an enzyme mixture or with an enzyme “asso tools for the treatment of patients with chronic or critical ciated' or “absorbed on the surface of the first phage dose, illnesses and are inserted in more than 20 million hospital the method requires that after the initial administration, the patients in the USA each year. Their use is often severely phage released from the destroyed bacteria must “find and compromised as a result of bacterial biofilm infection which infectat least one additional bacterium to enable it to continue is associated with significant mortality and increased costs. to degrade polysaccharides in the biofilm. Therefore, WO Catheters are associated with infection by many biofilm 2004/062677 specifically discusses the benefits of using mul forming organisms such as Staphylococcus epidermidis, Sta tiple dosages of phage administration to enhance the results phylococcus aureus, Pseudomonas aeruginosa, Enterococ (see, e.g., page 14, lines 6-10). Such multiple administration cus faecalis and Candida albicans which frequently result in is not always possible or practical. Additionally, WO 2004/ generalized blood stream infection. Approximately 250,000 062677 describes use of modified phages to degrade polysac cases of CVC-associated bloodstream infections occur in the charides in the biofilm once it has formed. There is no dis US each year with an associated mortality of 12%-25% and cussion, teaching or Suggestion of uses of bacteriophages an estimated cost of treatment per episode of approximately which prevent the formation or maintenance of the biofilm. S25,000. Treatment of CVC-associated infections with con Moreover, bacterial infections can persist and propagate if ventional antimicrobial agents alone is frequently unsuccess surrounded by a biofilm, and use of bacteriophage to effec ful due to the extremely high tolerance of biofilms to these tively reduce bacterial infections can be limited by the agents. Once CVCs become infected the most effective treat requirement for the bacteriophage to find and infect bacteria ment still involves removal of the catheter, where possible, before it can destroy the Surrounding biofilm, providing a and the treatment of any Surrounding tissue or systemic infec formidable obstacle when the bacterial concentration in the US 2012/03.01433 A1 Nov. 29, 2012
biofilm is low or when most of the bacteria have been tein aggregates formed by a first polypeptide which acts as a destroyed and some bacterial isolates are still protected by a seed for the formation of an aggregate comprising at least in large mass of biofilm. part, a second polypeptide. 0011. The Eastern European research and clinical trials, 0016. In alternative embodiments and one aspect of the particularly in treating human diseases, such as intestinal present invention relates to the engineered bacteriophages as infections, have apparently concentrated on use of naturally discussed herein which express an amyloid peptide which occurring phages and their combined uses (Lorch, A. (1999), promotes the formation or maintenance of protein aggregates. “Bacteriophages: An alternative to antibiotics?” Biotechnol In one embodiment, an engineered bacteriophage which ogy and Development Monitor, No. 39, p. 14-17). Bacte expresses an amyloid which promotes the formation of pro riophage have also been used in the past for treatment of plant tein aggregrated is termed an "amyloid peptide engineered diseases, such as fireblight as described in U.S. Pat. No. bacteriophage' or “pro-amyloid peptide engineered bacte 4,678,750. Non-engineered bacteriophages have been used as riophage' and promotes or increases the formation of protein carriers to deliver antibiotics (such as chloroamphenicol) aggregates which comprise of two or more different polypep (Yacoby et al., Antimicrobial agents and chemotherapy, tides, e.g., "higher order aggregates' which are protein aggre 2006; 50: 2087-2097), which suggest attaching aminoglyco gates formed by a first polypeptide which acts as a seed for the sides antibiotics, such as chloroamphenicol, to the outside of formation of an aggregate comprising at least in part, a second filamentous non-engineered bacteriophage (Yacoby et al., polypeptide. In some embodiments, a pro-amyloid peptide Antimicrobial agents and chemotherapy, 2007: 51; 2156 engineered bacteriophage can be used to promote or increase 2163). Bacteriophages have also been engineered to express bacteria and/or promote the formation of a bacterial biofilms lethal cell death genes Gef and ChpBK (Westwater et al., in environmental, industrial, and clinical settings by admin 2003, Antimicrobial agents and chemotherapy, 47: 1301 istering a composition comprising at least one pro-amyloid 1307). engineered bacteriophage as discussed herein. Pro-amyloid 0012. There are amyloids found in humans, yeast, and peptides are useful in circimstsances where it is desirable to bacteria. Curli protein in E. coli constitute amyloids (Chap encourage biofilm formation, Such as for example but not man, et al. Role of Escherichia coli curli operons in directing limited to, establishing microbial biofilms for remediation, amyloid fiber formation. Science 295, 851-855, (2002). microbial fuel cells, “beneficial biofilms that block “harm There is a lack of effective treatments for diseases which ful' biofilms from forming on important surfaces, etc). involve amyloidosis. Small-molecule inhibition of amyloids 0017. In some embodiments, an anti-amyloid peptide is hard to achieve since protein-protein interfaces need to be expressed by an anti-amyloid peptide engineered bacterioph disrupted (Arkin et al., Small-molecule inhibitors of protein age as disclosed herein is a peptide derived from a first amy protein interactions: progressing towards the dream. Nat Rev loidogenic polypeptide or a second amyloidogenic polypep Drug Discov 3,301-317 (2004)). Peptide-based inhibitors of tide which makes up a high order aggregate. In some amyloids are difficult to deliver to sites of disease or to bac embodiments, an anti-amyloid peptide expressed by an anti terially infected surfaces which are difficult to access by amyloid peptide engineered bacteriophage as disclosed conventional routes of administration. herein is a CsgAora CsgB peptide. In some embodiments, an 0013 Therefore, there is a need for improved composi anti-amyloid peptide engineered bacteriophage can be used tions and methods to prevent the formation and maintenance to inhibit bacteria and/or removing bacterial biofilms in envi of bacterial biofilms. ronmental, industrial, and clinical settings by administering a composition comprising at least one engineered bacterioph SUMMARY OF THE INVENTION age as discussed herein. 0014. The present invention relates in part to compositions 0018. One advantage of the anti-amyloid peptide engi and methods to inhibit or disrupt the formation of, or main neered bacteriophage as disclosed herein is to prevent the tenance of protein aggregates. One aspect of the present self-aggregation of anti-amyloid peptides. For example, one invention is directed to engineeredbacteriophages expressing of the major problems associated with use of anti-amyloid at least one anti-amyloid peptide which inhibits or disrupts peptides for therapeutic or other purposes (e.g. anti-amyloid the formation or maintenance of protein aggregates, in par peptides administered by themselves or in a pharmaceutical ticular high order aggregates which comprise at least two composition) is their tendency to self-aggregate. Thus, the different polypeptides. In some embodiments, the anti-amy inventors have demonstrated that by placing the anti-amyloid loid peptide which inhibits or disrupts the formation of, or peptides on the Surface of a bacteriophage capsid, it provides maintenance of protein aggregates is expressed on the Surface a structure for anti-amyloid peptide spacing and prevents of the bacteriophage, and in Some embodiments the anti aggregation of the anti-amyloid peptides, as well as provides amyloid peptide is released from the bacteria infected with a convenient way to synthesize a lot of anti-amyloid peptides the bacteriophage, for example by Secretion or release at the and deliver them to inhibit amyloid formation or inhibit amy time of bacterial lysis. loid maintenance. 0015. Accordingly, one aspect of the present invention 0019. The inventors also demonstrated that an anti-amy relates to the engineered bacteriophages as discussed herein loid peptide engineered bacteriophage as disclosed hereincan which express an anti-amyloid peptide which inhibit or dis reduce the number of bacteria in a population of bacteria. rupt the formation or maintenance of protein aggregates. In Accordingly, the inventors have developed a modular design one embodiment, an engineered bacteriophage which strategy in which bacteriophages are engineered to have expresses an anti-amyloid peptide is termed an 'anti-amyloid enhanced ability to inhibit and kill bacteria which produce peptide engineered bacteriophage' or simply as an “engi biofilms by expressing an anti-amyloid peptide which blocks neered bacteriophage’ herein and inhibits the formation of amyloid formation or inhibits or disrupts the formation or protein aggregates which comprise of two or more different maintenance of protein aggregates, such as curli amyloid polypeptides, e.g., "higher order aggregates' which are pro present in bacterial biofilms. US 2012/03.01433 A1 Nov. 29, 2012
0020. In some embodiments, a bacteriophage can be engi polysaccharide within said biofilm. However, other studies neered or modified to express at least one anti-amyloid pep have reported that addition of alginate lyase to established P tide. In some embodiments, an anti-amyloid peptide engi aeruginosa biofilm caused no observable detachment of bio neered bacteriophage can be further modified to also express film and the use of lyases would not be optimal for biofilm a biofilm degrading enzyme. Such as dispersin B (DspB), an treatment (Christensen et al., 2001). International Patent enzyme that hydrolyzes B-1,6-N-acetyl-D-glucosamine, Application WO/2006/137847, which are incorporated according to the methods as disclosed in U.S. patent applica herein by reference, describes a bacteriophage that expresses tion Ser. Nos. 12/337,677 and 11/662,551 and International a biofilm degrading enzyme attached to its Surface. Application WO06/137847 which are incorporated herein in 0026. However, one of the key problem associated with their entirety by reference. the use of bacteriophages as potential therapeutics are their 0021. Also discussed herein is the generation of a diverse inability to access bacteria protected by the biofilm barrier. library of anti-amyloid peptide engineered bacteriophages Accordingly, one aspect of the present invention overcomes described herein, such as a library of anti-amyloid peptide this problem by providing an anti-amyloid peptide engi engineered bacteriophages which are capable of inhibiting neered bacteriophage that encodes an anti-amyloid peptide or the formation or maintenance of amyloid formation, for portion thereof that is displayed on the Surface of the phage. example, for reducing biofilm produced by a wide variety of Consequently, in Such embodiments, the anti-amyloid pep bacterial strains. tide engineered bacteriophage has an active anti-amyloid 0022. Bacteriophages (often known simply as “phages') peptide on its surface that will inhibit the formation or main are viruses that grow within bacteria. The name translates as tenance of the biofilm by inhibiting curliamyloid formation. “eaters of bacteria' and reflects the fact that as they grow, the Thereafter, when the anti-amyloid peptide engineered bacte majority of bacteriophages kill the bacterial host in order to riophage encounters a bacterial cell, the phage will replicate. release the next generation of bacteriophages. Accordingly, After the phage enters the cell for replication in addition to the the replication of anti-amyloid peptide engineered bacte normal phage components that are needed for replication in riophages with Subsequent bacterial lysis and expression of the cell, there will also be the anti-amyloid peptide and a an anti-amyloid peptide renders this a two-pronged attack moiety, typically a capsid protein or a capsid attaching part of strategy for inhibiting amyloid formation in bacterial biofilm, Such capsid protein, fused to the anti-amyloid peptide for as well as killing bacteria and eliminating bacterial popula attaching the anti-amyloid peptide to the phage Surface. Thus tions, and/or removing bacterial biofilms in environmental, after the multiplication and lysis of the cell by the phage a new industrial, and clinical settings. generation of these anti-amyloid peptide engineered bacte 0023 Bacteriophages and their therapeutic uses have been riophage are produced. These in turn will inhibit biofilm the subject of much interest since they were first recognized maintenance and/or formation or maintenance and can repli early in the 20th century. Lytic bacteriophages are viruses that cate in Subsequent bacterial cells thus creating a continuous infect bacteria exclusively, replicate, disrupt bacterial system for inhibition of biofilm formation and maintenance. metabolism and destroy the cell upon release of phage prog Each new generation of anti-amyloid peptide engineered bac eny in a process known as lysis. These bacteriophages have teriophage carries the anti-amyloid peptide allowing the anti very effective antibacterial activity and in theory have several amyloid peptide engineered bacteriophage to attack the bio advantages over antibiotics. Most notably they replicate at the film from outside, by the inhibition of curli amyloid site of infection and are therefore available in abundance formation and maintenance, and lyse the bacteria from inside, where they are most required; no serious or irreversible side by the action of anti-amyloid peptide engineered bacterioph effects of phage therapy have yet been described and selecting age infecting the bacterium, multiplification of the phage, and alternative phages against resistant bacteria is a relatively consequent cell lysis. rapid process that can be carried out in days or weeks. 0027. In some embodiments, a moiety can be used to 0024. Bacteriophage have been used in the past for treat direct and attach the anti-amyloid peptide to the Surface of an ment of plant diseases, such as fireblight as described in U.S. anti-amyloid peptide engineered bacteriophage according to Pat. No. 4,678,750. Also, bacteriophages have been previ the present invention include, for example, moieties that are ously used to destroy biofilms (e.g., U.S. Pat. No. 6,699,701). commonly used in the phage display techniques well known In addition, systems using natural bacteriophages that encode to one skilled in the art. For example, the anti-amyloid peptide biofilm destroying enzymes in general have been described. can be part of the other part of a fusion protein, wherein the Examples of lytic enzymes encoded by bacteriophages that other part of the fusion protein is part of the surface of the have been used as enzyme dispersion to destroy bacteria have phage such as the capsid, for example, a 10B capsid protein. been reported (U.S. Pat. No. 6,335,012 and U.S. Patent Appli For example, the 10B capsid protein makes up about 10% of cation Publication No. 2005/0004030 which is incorporated the capsid protein of T7 phage. Proteases can be displayed on herein by reference). The Eastern European research and the surface of the phage as described by Atwell S and Wells J clinical trials, particularly in treating human diseases, such as A (Selection for improved subtiligases by phage display. Proc intestinal infections, has apparently concentrated on use of Natl Acad Sci USA. 1999.96(17):9497-502). Atwell and naturally occurring phages and their combined uses (Lorch, Wells describe a system where about 16-17 amino acids of A. (1999), "Bacteriophages: An alternative to antibiotics? active sites of the protease were displayed on the phage and Biotechnology and Development Monitor, No. 39, p. 14-17). showed protease activity. Accordingly, one useful amino 0025. For example, PCT Publication No. WO 2004/ acids sequence is signal peptide-XXX-SEGGGSEGGG-XX 062677 and U.S. patent application Ser. No. 10/541,716 pro (SEQID NO: 219) (X is optional, oranyamino acid). Another vides a method of treating bacterial biofilm, wherein the example of useful moieties is a Xylan binding domain of method comprises use of a first bacteriophage that is capable Xylanase (Miyakubo H. Sugio A, Kubo T. Nakai R. Wakaba of infecting a bacterium within said biofilm, and a first yashi K, Nakamura S. Phage display of Xylan-binding mod polysaccharide lyase enzyme that is capable of degrading a ule of xylanase J from alkaliphilic Bacillus sp. strain 41 M-1. US 2012/03.01433 A1 Nov. 29, 2012
Nucleic Acids Symp Ser. 2000. (44):165-6). In Miyakubo et 0032. One aspect of the present invention relates to engi al., the moiety displayed on the phage was not the active site neering or modification of any bacteriophage strain or species of the enzyme but the substrate binding site of the enzyme, to generate an anti-amyloid peptide engineered bacterioph which also retained its capacity to bind the substrate. Accord age disclosed herein. For example, an anti-amyloid peptide ingly, one aspect of the present invention provides an anti engineered bacteriophage can be engineered from any bacte amyloid peptide engineered bacteriophage which can con riophage known by a skilled artisan. For example, in one tinuously inhibit the formation and/or maintenance of a embodiment, the bacteriophage is a lysogenic bacteriophage, bacterial biofilm and uses thereof for inhibiting the formation for example but not limited to a M13 bacteriophage. In or maintenance of a biofilm. another embodiment, the bacteriophage is a lytic bacterioph age such as, but not limited to T7 bacteriophage. In another 0028. In addition to displaying at least one anti-amyloid embodiment, the bacteriophage is a phage Kora Staphyloc peptide on the Surface of an anti-amyloid peptide engineered cocus phage K for use against bacterial infections of methi bacteriophage, the phage may also encode an anti-amyloid cillin-resistant S. aureus. peptide that is not displayed on the Surface. 0033. One aspect of the present invention relates to an 0029. One aspect of the present invention describes an anti-amyloid peptide engineered bacteriophage which is an anti-amyloid peptide engineered bacteriophage for inhibiting anti-amyloid peptide engineered lysogenic M13 bacterioph the formation of a biofilm or inhibiting the maintenance of a age comprising a nucleic acid operatively linked to a pro biofilm, wherein essentially one dosage or round of infection moter, such as a M13 promoter, wherein the nucleic acid by the anti-amyloid peptide engineered bacteriophage is Suf encodes at least one anti-amyloid peptide, Such as a CsgA or ficient to allow complete inhibition of biofilm formation, a CsgB anti-amyloid peptide, where a CsgA peptide is because the infected bacteria will produce anti-amyloid pep selected from SEQID NOs: 11-18 or SEQID NOS: 35-58 or tide engineered bacteriophages that contain the anti-amyloid variants or modified variants thereof, and a CsgB peptide is peptides either on their surface or are expressed and released selected from SEQID NOS: 27-34 or SEQID NOs: 59-90, or (by lysis or secretion) from the bacteria. This allows replen variants or modified variants thereof. In some embodiments, ishment of the anti-amyloid peptide engineered bacterioph the CsgA peptide is a Class III CsgA peptide, e.g., selected age so they can continue to inhibit biofilm formation even in from SEQID NO: 52 or 53, and the CsgB peptide is a Class the absence of immediately infectable bacteria in the envi III Csg III peptide, e.g., selected from SEQID NO: 61-65. ronment. This solves a requirement for persistent re-applica 0034. In some embodiments, an anti-amyloid peptide tion which can be a problem by previously described phage engineered bacteriophage as disclosed herein is an anti-amy systems. For example, even when the phage of WO 2004/ loid peptide engineered lysogenic M13 bacteriophage com 062677 is delivered with an enzyme mixture or with an prising a nucleic acid operatively linked to a promoter, Such as enzyme associated on the Surface of the first phage dose, the a M13 promoter, wherein the nucleic acid encodes at least one method requires that after the initial administration, the phage anti-amyloid peptide Such as an anti-amyloid peptide, released from the destroyed bacteria must find and infect at selected from the group of SEQID NOs: 11-18 or 27 to 90, or least one additional bacterium to enable it to continue to variants or modified variants thereof. degrade the biofilm. Therefore, WO 2004/062677 specifi 0035. In some embodiments, an anti-amyloid peptide cally discusses the need for using multiple dosages of phage engineered bacteriophage as disclosed herein is an anti-amy administration to enhance the results. loid peptide engineered lysogenic M13 bacteriophage com 0030. Another aspect of the present invention relates to the prising a nucleic acid operatively linked to a promoter, Such as development of a diverse library of anti-amyloid peptide a M13 promoter, wherein the nucleic acid encodes at least one engineered bacteriophage. By multiplying within the bacte anti-amyloid peptide selected from the group of SEQ ID rial population and hijacking the bacterial machinery, use of NOs: 12, 16, 29 and 33. In some embodiments, an anti an anti-amyloid peptide engineered bacteriophage achieves amyloid peptide engineered bacteriophage is an engineered high local concentrations of both the lytic phage and the lysogenic M13 bacteriophage comprising a nucleic acid anti-amyloid peptide in the Zone of the bacterial population, operatively linked to a promoter, Such as a M13 promoter, even with Small initial phage inoculations. Thus, the present wherein the nucleic acid encodes at least one anti-amyloid invention is suitable for delivery of the anti-amyloid engi peptide selected from the CsgA III of peptides (SEQID NO: neered bacteriophage at bacterial infection where are difficult 52-53), or from the CsgAIIb peptide class (SEQID NOS:35, to reach or get access to. 36, 39-41, 45, 49-51), or from the CsgAIIa peptide group 0031. The inventors have demonstrated that an anti-amy (SEQ ID NO: 11 and 12) or from the CsgAI group (SEQID loid peptide engineered bacteriophage as disclosed herein is NOs: 42, 44, 46, 57 and 58). faster and has increased efficiency of killing bacteria, such as 0036. In another embodiment, an anti-amyloid peptide bacteria in biofilms as compared to use of a non-engineered engineered bacteriophage as disclosed herein is an engi bacteriophage alone (i.e. a bacteriophage which is not an neered lysogenic M13 bacteriophage comprising a nucleic engineered bacteriophage) (See FIG. 3). Thus, the inventors acid operatively linked to a promoter, such as a M13 pro have demonstrated a significant and Surprising improvement moter, wherein the nucleic acid encodes at least one antimi of such an anti-amyloid peptide engineered bacteriophage as crobial agent such as an anti-amyloid peptide, selected from disclosed herein over the combined use of non-engineered the CsgBIII group (SEQID NOs: 61-65) or from the CsgBIIb bacteriophages as therapies described in prior art. Specifi peptide group (SEQID NOs: 59, 60, 69, 75,81,93 and 94) or cally, the inventors have also demonstrated that use of such an from the CsgBIIa group (SEQ ID NO: 29) or from CsgBI anti-amyloid peptide engineered bacteriophage as disclosed peptide group (SEQID NOs: 66-68 and 70-72). herein is very effective at reducing the number of antibiotic 0037. In a preferred embodiment, the anti-amyloid pep resistant bacterial cells which can develop in the presence of tide engineered bacteriophage is an engineered lysogenic Sub-inhibitory antimicrobial drug concentrations. M13 bacteriophage comprising a nucleic acid operatively US 2012/03.01433 A1 Nov. 29, 2012 linked to a promoter, such as a M13 promoter, wherein the anti-amyloid peptide engineered bacteriophage in combina nucleic acid encodes at least one anti-amyloid peptide, tion with an additional antimicrobial agent allows a reduction selected from the CsgAIII group of peptides (SEQID NO:52, in the dose of either the antimicrobial agent or both, or a 53) or CsgBIII peptides (SEQID NOs: 61-65). reduction in the duration or frequency of treatment. In some 0038 Another aspect of the present invention relates to an embodiments, a reduction is about at least 10%, or about at anti-amyloid peptide engineered bacteriophage which is an least 20%, or about at least 30%, or about at least 40%, or anti-amyloid peptide engineered lytic T7 bacteriophage com about at least 50% or more than 50% of the dose of antimi prising a nucleic acid operatively linked to a promoter, Such as crobial agent as compared to the dose of an antimicrobial a T7 promoter, wherein the nucleic acid encodes at least one agent without the presence of an anti-amyloid peptide engi anti-amyloid peptide, such as a CsgA or a CsgB anti-amyloid neered bacteriophage. peptide, where a CsgA peptide is selected from SEQID NOs: 0042 Another aspect of the present invention relates to a 11-18 or SEQ ID NOs: SEQ ID NOs: 35-58 or variants or method to inhibit or eliminate a bacterial infection compris modified variants thereof, and a CsgB peptide is selected ing administering to a Surface infected with bacteria an anti from SEQID NOS: 27-34 or SEQID NOs: 59-90, or variants amyloid peptide engineered bacteriophage comprising a or modified variants thereof. nucleic acid operatively linked to a bacteriophage promoter, 0039. In some embodiments, an anti-amyloid peptide wherein the nucleic acid encodes at least one anti-amyloid engineered bacteriophage as disclosed herein is an anti-amy peptide. Such as a CsgA peptide and/or a CsgB peptide, loid peptide engineered lytic T7 bacteriophage comprising a including but not limited to SEQID NO:11-18 or 35-58 (i.e. nucleic acid operatively linked to a promoter, Such as a pro CsgA peptides) SEQ ID NOS: 27-34 or 59-90 (i.e. CsgB moter, Such a T7 promoter, wherein the nucleic acid encodes peptides) and SEQID NOs: 53-90 (modified CsgA and CsgB at least one anti-amyloid peptide Such as an anti-amyloid peptides). In some embodiments, the present invention relates peptide, selected from the group of SEQ ID NOS: 35-90, or to a method to inhibit or eliminate a bacterial infection com variants or modified variants thereof. prising administering to a Surface infected with bacteria an In some embodiments, an anti-amyloid peptide engineered anti-amyloid peptide engineered bacteriophage comprising a bacteriophage as disclosed herein is an anti-amyloid peptide nucleic acid operatively linked to a bacteriophage promoter, engineered lytic T7 bacteriophage comprising a nucleic acid wherein the nucleic acid encodes at least one anti-amyloid operatively linked to a promoter, such as a T7 promoter, peptide. Such as one selected from the CsgA III class of wherein the nucleic acid encodes at least one anti-amyloid peptides (SEQID NO: 52-53), or from the CsgAIIb class of peptide selected from the group of SEQID NOs: 12, 16, 29 peptides (SEQID NOS:35, 36,39-41, 45, 49-51), or from the and 33. In some embodiments, an anti-amyloid peptide engi CsgAIIa class of peptide (SEQID NO: 11 and 12) or from the neered bacteriophage is an engineered lytic T7 bacteriophage CsgAI class of peptides (SEQID NOs: 42, 44, 46, 57 and 58) comprising a nucleic acid operatively linked to a promoter, or from the CsgBIII class of peptides (SEQID NOs: 61-65) or Such as a T7 promoter, wherein the nucleic acid encodes at from the CsgBIIb class of peptides (SEQID NOs: 59, 60, 69, least one anti-amyloid peptide selected from the CsgA III 75, 81.93 and 94) or from the CsgBIIa class of peptides (SEQ class of peptides (SEQ ID NO: 52–53), or from the CsgAIIb ID NO: 29) or from CsgBI class of peptides (SEQ ID NOs: class of peptides (SEQID NOS:35, 36,39-41, 45, 49-51), or 66-68 and 70-72). from the CsgAIIa class of peptide (SEQID NO: 11 and 12) or 0043. In some embodiments, the method can also opti from the CsgAI class of peptides (SEQID NOs: 42, 44, 46, 57 mally include administering at least one additional agent, and 58). Such as an additional antimicrobial agent or other agent which In another embodiment, an anti-amyloid peptide engineered inhibits fiber assembly. bacteriophage as disclosed herein is an engineered lytic T7 0044. In some embodiments of all aspects described bacteriophage comprising a nucleic acid operatively linked to herein, a bacteriophage useful in the methods disclosed a promoter, such as a T7 promoter, wherein the nucleic acid herein and used to generate an anti-amyloid peptide engi encodes at least one antimicrobial agent Such as an anti neered bacteriophage is any bacteriophage know by a skilled amyloid peptide, selected from the CsgBIII class of peptides artisan. A non-limiting list of examples of bacteriophages (SEQ ID NOs: 61-65) or from the CsgBIIb class of peptides which can be used are disclosed in Table 9 herein. In one (SEQ ID NOs: 59, 60, 69, 75, 81, 93 and 94) or from the embodiment, the bacteriophage is a lysogenic bacteriophage CsgBIIa class of peptides (SEQ ID NO: 29) or from CsgBI Such as, for example a M13 lysogenic bacteriophage. In alter class of peptides (SEQ ID NOs: 66-68 and 70-72). native embodiments, a bacteriophage useful in all aspects 0040. In a preferred embodiment, the anti-amyloid pep disclosed herein is a lytic bacteriophage, for example but not tide engineered bacteriophage is an engineered lytic T7 bac limited to a T7 lytic bacteriophage. In one embodiment, a teriophage comprising a nucleic acid operatively linked to a bacteriophage useful in all aspects disclosed herein is a SP6 promoter. Such as a T7 promoter, wherein the nucleic acid bacteriophage or a phage K, or a staphylococcus phage K encodes at least one anti-amyloid peptide, selected from the bacteriophage. CsgAIII group of peptides (SEQID NO: 52-53) or CsgBIII 0045. In some embodiments, administration of any anti peptides (SEQID NOs: 61-65). amyloid peptide engineered bacteriophage as disclosed 0041. In some embodiments of the invention, an anti-amy herein can occur Substantially simultaneously with any addi loid engineered bacteriophage is administered in combina tional agent, such as an additional antimicrobial agent or tion with an additional antimicrobial agent, thus allowing a another agent which inhibits fiber assembly. In alternative reduction in the amount of Such additional antimicrobial embodiments, the administration of an anti-amyloid peptide agent as compared to if the antimicrobial agent were used engineered bacteriophage can occur prior to the administra separately (i.e. a decrease in dose of antimicrobial agent tion of at least one additional antimicrobial agent and/or agent required to effectively treat a subject suffering from an infec which inhibits fiber assembly. In other embodiments, the tion). For example, in Some embodiments, administering an administration of an additional antimicrobial agent or agent US 2012/03.01433 A1 Nov. 29, 2012
which inhibits fiber assembly occurs prior to the administra (modified CsgA or CsgB peptides, see Table 5). In some tion of an anti-amyloid peptide engineered bacteriophage. embodiments, the present invention provides a composition 0046. In some embodiments, additional antimicrobial comprising at least one lytic T7 anti-amyloid peptide engi agents which can be administered in combination with an neered bacteriophage comprising a nucleic acid operatively anti-amyloid peptide engineered bacteriophage as disclosed linked to a promoter, such as a T7 promoter, wherein the herein include, for example but not limited to, antimicrobial nucleic acid encodes at least one anti-amyloid peptide, for agents selected from a group comprising ciproflaxacin, levo example selected from the CsgAIII group of peptides (SEQ floxacin, and ofloxacin, gatifloxacin, norfloxacin, lomefloxa ID NO: 52, 53), or from the CsgBIII group of peptides (SEQ cin, trovafloxacin, moxifloxacin, sparfloxacin, gemifloxacin, ID NOs: 61-65). In some embodiments, the anti-amyloid paZufloxacin or variants or analogues thereof. In some peptide expressed by the lysogenic M13 anti-amyloid peptide embodiments, an antimicrobial agents useful in the methods engineered bacteriophage is selected from at least one of the as disclosed herein is ofloxacin or variants or analogues following from the group of CsgAIIb peptide group (SEQID thereof. In some embodiments, antimicrobial agents useful in NOs: 35,36, 39-41, 45, 49-51), or from the CsgAIIa peptide the methods as disclosed herein are aminoglycoside antimi group (SEQ ID NO: 11 and 12) or from the CsgAI group crobial agents, for example but not limited to, antimicrobial (SEQ ID NOs: 42, 44, 46, 57 and 58) or from the CsgBIIb agents selected from a group consisting of amikacin, genta peptide group (SEQID NOs: 59, 60, 69, 75,81,93 and 94) or mycin, tobramycin, metromycin, Streptomycin, kanamycin, from the CsgBIIa group (SEQ ID NO: 29) or from CsgBI paromomycin, neomycin or variants or analogues thereof. In peptide group (SEQID NOs: 66-68 and 70-72). Some embodiments, an antimicrobial agent useful in the 0048. In some embodiments, a composition comprising an methods as disclosed herein is gentamicin or variants orana anti-amyloid peptide engineered bacteriophage can further logues thereof. In some embodiments, antimicrobial agents comprise an additional agent, Such as for example an antimi useful in the methods as disclosed herein are 3-lactam anti crobial agent or an agent which inhibits fiber aggregation biotic antimicrobial agents, such as for example but not lim Such as, for example but not limited to, quinolone antimicro ited to, antimicrobial agents selected from a group consisting bial agents and/or aminoglycoside antimicrobial agents and/ of penicillin, amplicillin, penicillin derivatives, cephalospor or B-lactam antimicrobial agent, for example, but not limited ins, monobactams, carbapenems, B-lactamase inhibitors or to, antimicrobial agents selected from a group comprising variants or analogues thereof. In some embodiments, an anti ciproflaxacin, levofloxacin, and ofloxacin, gatifloxacin, nor microbial agent useful in the methods as disclosed herein is floxacin, lomefloxacin, trovafloxacin, moxifloxacin, spar ampicillin or variants or analogues thereof. floxacin, gemifloxacin, paZufloxacin, amikacin, gentamycin, Another aspect of the present invention relates to a composi tobramycin, netromycin, streptomycin, kanamycin, paromo tion comprising a lysogenic M13 anti-amyloid peptide engi mycin, neomycin, penicillin, amplicillin, penicillin deriva neered bacteriophage comprising a nucleic acid operatively tives, cephalosporins, monobactams, carbapenems, 3-lacta linked to a M13 promoter, wherein the nucleic acid encodes at mase inhibitors or variants or analogues thereof. least one anti-amyloid peptide, for example selected from 0049. In some embodiments, the composition comprises SEQID NO: 11-18 (CsgA peptides, see Table 3), or SEQID at least one anti-amyloid peptide engineered bacteriophage as NO: 27-34 (CsgB peptides, see Table 4) or SEQID NO:35-90 disclosed herein. (modified CsgA or CsgB peptides, see Table 5). In some 0050. Another aspect of the present invention relates to a embodiments, the present invention provides a composition kit comprising a lysogenic M13 anti-amyloid peptide engi comprising at least one lysogenic M13 anti-amyloid peptide neered bacteriophage comprising the nucleic acid operatively engineered bacteriophage comprising a nucleic acid opera linked to a promoter, such as a M13 promoter, wherein the tively linked to a M13 promoter, wherein the nucleic acid nucleic acid encodes at least one anti-amyloid peptide, for encodes at least one anti-amyloid peptide, for example example selected from SEQ ID NO: 11-18 (CsgA peptides, selected from the CsgAIII group of peptides (SEQID NO:52, see Table 3), or SEQID NO:27-34 (CsgB peptides, see Table 53), or from the CsgBIII group of peptides (SEQ ID NOs: 4) or SEQID NO:53-90 (modified CsgA or CsgB peptides, 61-65). In some embodiments, the anti-amyloid peptide see Table 5). expressed by the lysogenic M13 anti-amyloid peptide engi 0051. Another aspect of the present invention relates to a neered bacteriophage is selected from at least one of the kit comprising a lytic T7 anti-amyloid peptide engineered following from the group of CsgA III class of peptides (SEQ bacteriophage comprising the nucleic acid operatively linked ID NO: 52-53), or from the CsgAIIb class of peptides (SEQ to a T7 promoter, wherein the nucleic acid encodes at least ID NOS:35, 36,39-41, 45, 49-51), or from the CsgAIIa class one at least one anti-amyloid peptide, for example selected of peptide (SEQID NO: 11 and 12) or from the CsgAI class from SEQ ID NO: 11-18 (CsgA peptides, see Table 3), or of peptides (SEQID NOs: 42, 44, 46, 57 and 58) or from the SEQ ID NO:27-34 (CsgB peptides, see Table 4) or SEQ ID CsgBIII class of peptides (SEQ ID NOs: 61-65) or from the NO: 35-90 (modified CsgA or CsgB peptides, see Table 5). CsgBIIb class of peptides (SEQID NOS:59, 60, 69, 75,81,93 0.052 Another aspect the invention provides compositions and 94) or from the CsgBIIa class of peptides (SEQID NO: and methods for identifying anti-amyloid peptides that inhibit 29) or from CsgBI class of peptides (SEQID NOs: 66-68 and amyloid formation or maintenance. In Such an embodiment, 70-72). an anti-amyloid peptide can be identified using a computa 0047 Another aspect of the present invention relates to a tional method as described in Example 4. The computational composition comprising alytic T7 anti-amyloid peptide engi method comprises predicting amyloid fiber structures, and neered bacteriophage comprising a nucleic acid operatively constructing point mutations to identify potential residues linked to a T7 promoter, wherein the nucleic acid encodes at (“hits”) essential to enhancing or inhibiting fiber formation. least one anti-amyloid peptide, for example selected from The “hits’ can then be confirmed by mutation experiments as SEQID NO: 11-18 (CsgA peptides, see Table 3), or SEQID described in Example 4. In another embodiment, phage can NO:27-34 (CsgB peptides, see Table 4) or SEQID NO:35-90 be engineered to express a candidate anti-amyloid peptide. In US 2012/03.01433 A1 Nov. 29, 2012
Some embodiments the candidate anti-amyloid peptide is have also mainly focused on optimizing method to degrade derived from an amyloidogenic polypeptide, as disclosed bacteria biofilms, such as, for example introducing a lysase herein. In some embodiments the candidate anti-amyloid enzyme such as alginate lyse (discussed in International peptide is a modified version of a peptide derived from an Application WOO4/062677); or modifying bacteriophages to amyloidogenic polypeptide. In some embodiments the can inhibit the cell which propagates the bacteriophage. Such didate anti-amyloid peptide has a random sequence. In some introducing a KIL gene Such as the Holin gene in the bacte embodiments, a collection or plurality of engineered phage riophage (discussed in International Application WO02/ that collectively express a plurality of candidate anti-amyloid peptides (e.g., peptides derived from an amyloidogenic 034892 and WO04/046319), or introducing bacterial toxin polypeptide, modified versions thereof, or random genes such as pGef or ChpBK and Toxin A (discussed in U.S. sequences, are provided). The collection could comprise, Pat. No. 6,759.229 and Westwater et al., Antimicrobial agents e.g., between about 10 and about 10 or more different can and Chemotherapy, 2003., 47: 1301-1307). However, unlike didate anti-amyloid peptide sequences in various embodi the present invention the modified bacteriophages discussed ments. The ability of the anti-amyloid peptide engineered in WOO4/062677, WO02/034892, WOO4/046319, U.S. Pat. phage expressing a candidate anti-amyloid peptide to inhibit No. 6,759,229 and Westwater et al., have not been modified to amyloid formation or maintenance in vitro or in vivo is express anti-amyloid peptides to inhibit or disrupt the forma assessed, using, for example any method known to one of tion or maintenance of protein aggregates in the biofilms, nor ordinary skill in the art or as disclosed herein in the Examples. to inhibit the formation or maintenance of higher order aggre An anti-amyloid peptide engineered phage expressing a can gates, (where high order aggregates comprises of two or more didate anti-amyloid peptide which significantly inhibits amy different polypeptides which are formed by a first polypep loid formation or maintenance can be assessed using the tide which seeds the formation of an aggregate comprising at assay as described herein and those which inhibit bacterial least in part of a second polypeptide). infection and/or amyloid formation can be identified and 0057. In some embodiments, a non-engineered bacte selected. In some embodiments, the identified phage can be riophage can be used to block amyloid formation. selected to be used as an anti-amyloid agent as disclosed herein. In some embodiments, the selected candidate anti 0058. One aspect of the present invention relates to an amyloid peptide encoded by Such phage are used as anti engineered bacteriophage comprising a nucleic acid opera amyloid agents. For example, the present invention encom tively linked to a promoter, wherein the nucleic acid encodes passes use of an anti-amyloid peptide engineered phage at least one anti-amyloid peptide. expressing a candidate anti-amyloid peptide to identify anti 0059. In some embodiments, the anti-amyloid peptide is a amyloid peptides that inhibit formation of amyloids involved peptide between at least 5 and 50 amino acid long whose in disease Such as Alzheimer's disease or other amyloid sequence comprises at least 5 and no more than 50 contiguous associated diseases. Such anti-amyloid peptides can be amino acids of the sequence of a first amyloidogenic polypep selected and administered as a pharmaceutical composition tide which is capable of nucleating amyloid formation by a for treatment and/or prophylaxis of the disease. second amyloidogenic polypeptide. In some embodiments, 0053. In some embodiments, any one of these anti-amy the anti-amyloid peptide is a peptide between at least 5 and 50 loid peptide engineered bacteriophages, used alone, or can be amino acid long whose sequence comprises at least 5 and no used in any combination. In some embodiments, an anti more than 50 contiguous amino acids of the sequence of a amyloid peptide engineered bacteriophage as disclosed second amyloidogenic polypeptide, wherein a second amy herein can also be used with at least one additional antimi loidogenic polypeptide forms an amyloid formation with a crobial agent oran agent which inhibits amyloid aggregation. first amyloidogenic polypeptide. In some embodiments, the 0054. In some embodiments, the methods and composi anti-amyloid peptide is a peptide between least 8 and no more tions as disclosed herein are administered to a subject. In than 30 contiguous amino acids of the sequence of a first some embodiments, the methods to inhibit or eliminate a amyloidogenic polypeptide. In some embodiments, the anti bacterial infection comprising administering a composition amyloid peptide is a peptide between least 8 and no more than comprising an anti-amyloid peptide engineered bacterioph 30 contiguous amino acids of the sequence of a second amy age as disclosed herein to a subject, wherein the bacteria are loidogenic polypeptide. In some embodiments, the first and present in the Subject. In some embodiments, the Subject is a second amyloidogenic polypeptides are no more than 50% mammal, for example, but not limited to a human. In some identical. embodiments, the anti-amyloid peptide engineered bacte 0060. In some embodiments, at least one of the amy riophage inhibits bacterial infection by at least about 10%, or loidogenic polypeptide is a component of a naturally occur at least about 20%, or at least about 30%, or least about 40%, ring amyloid or a component of a high order aggregate com or at least about 50%, or at least about 60%, 70%, 80%, 90%, prising at least two different polypeptides. 95%, 99%, or greater than 99%, such as 100%. 0061. In some embodiments, at least one of the amy 0055. In some embodiments, an anti-amyloid peptide loidogenic polypeptides is a component of a biofilm gener engineered bacteriophage as disclosed herein can be used to ated by a bacterium, for example a human or animal patho reduce the number of bacteria as compared to use of a non genic bacteria. In some embodiments, the bacterium is a engineered bacteriophage. In some embodiments, an anti gram-negative bacterium, Such as a gram-negative rod. In amyloid peptide engineered bacteriophage as disclosed Some embodiments, the bacterium is an enterobacterium, or herein is useful in any combination to inhibit or eliminate a alternatively, a member of a genus selected from Escherichia, bacterial infection, such as for example inhibit or eliminate a Klebsiella, Salmonella, and Shigella. bacteria present a biofilm. 0062. In some embodiments, a first amyloidogenic 0056. Additionally, there are reports of modifying bacte polypeptide is a CsgB polypeptide, and the second amy riophages to increase their effectiveness of killing bacteria loidogenic polypeptide is a CsgA polypeptide. In some US 2012/03.01433 A1 Nov. 29, 2012 embodiments, the first and second amyloidogenic polypep by the engineered bacteriophage, for example, by lysis of the tides area CsgB polypeptide and a CsgA polypeptide, respec bacterial cell or alternatively, by secretion by the bacterial tively. host cell. In Such embodiments, where the anti-amyloid pep 0063. In some embodiments, an anti-amyloid peptide tide is secreted from the cell, the nucleic acid encoding the expressed by the bacteriophage is between 10 and 30 amino anti-amyloid peptide agent also encodes a signal sequence, acids in length, or between 15 and 25 amino acids in length. Such as, for example, a secretory sequence. In some embodi 0064. In some embodiments, the sequence of the anti ments, the secretory sequence is cleaved from the anti-amy amyloid peptide comprises or consists of a sequence selected loid peptide or antimicrobial peptide as the peptide exits the from SEQID NO: 1 or SEQID NO: 2 and orthologs thereof. bacteria cell. 0065. In some embodiments, the anti-amyloid peptide is 0072 Another apect of the present invention relates to a CsgA peptide, for example, a CsgA peptide selected from the method to reduce protein aggregate formation in a subject group comprising: SEQ ID NO; 11-18, CsgA III class of comprising administering to a subject at least one bacterioph peptides (SEQID NO: 52-53), or from the CsgAIIb class of age comprising a nucleic acid operatively linked to a pro peptides (SEQID NOS:35, 36,39-41, 45, 49-51), or from the moter, wherein the nucleic acid encodes at least one anti CsgAIIa class of peptide (SEQID NO: 11 and 12) or from the amyloid peptide. CsgAI class of peptides (SEQID NOs: 42, 44, 46, 57 and 58) 0073. In some embodiments, the subject suffers or is at or orthologs thereof. In some embodiments, the CsgA peptide risk of amyloid associated disorder. In some embodiments, is selected from the group comprising: SEQ ID NOs: 52 or the subject suffers from or is at increased risk of an infection 53) or orthologs thereof. by a bacterium, for example, a bacterium is associated with 0066. In some embodiments, the anti-amyloid peptide is a biofilm formation. CsgB peptide, for example, a CsgB peptide is selected from 0074. In some embodiments of this aspect and all aspects the group comprising: SEQID NO; 27-34, CsgBIII class of as disclosed herein, the Subject is a mammal. Such as a human. peptides (SEQID NOs: 61-65) or from the CsgBIIb class of 0075. In some embodiments, the method to reduce protein peptides (SEQID NOs: 59, 60, 69, 75,81,93 and 94) or from aggregate formation in a Subject comprising administering to the CsgBIIa class of peptides (SEQID NO: 29) or from CsgBI a subject at least one anti-amyloid peptide engineered bacte class of peptides (SEQ ID NOs: 66-68 and 70-72) or riophage as disclosed herein further comprises adding an orthologs thereof. In some embodiments, the CsgB peptide is additional agent to the Subject. selected from the group comprising: SEQID NOs: 61-65 or 0076. In some embodiments, the anti-amyloid peptide orthologs thereof. inhibits the formation of at least one of the amyloidogenic 0067. In some embodiments, the anti-amyloid peptide polypeptides that is a component of a naturally occurring sequence differs by not more than 3 amino acid insertions, amyloid or a component of a high order aggregate comprising deletions, or substitutions from that of the peptides of SEQID at least two different polypeptides. In some embodiments, the NO; 11-18, CsgA III class of peptides (SEQID NO: 52–53), high order aggregate comprises a fiber. In some embodi or from the CsgAIIb class of peptides (SEQ ID NOS:35, 36, ments, the first amyloidogenic polypeptide is a CsgB 39-41, 45, 49-51), or from the CsgAIIa class of peptide (SEQ polypeptide. In some embodiments, the second amy ID NO: 11 and 12) or from the CsgAI class of peptides (SEQ loidogenic polypeptide is a CsgA polypeptide. ID NOs: 42, 44, 46, 57 and 58), or SEQ ID NO; 27-34, 0077. In some embodiments, an anti-amyloid peptide CsgBIII class of peptides (SEQ ID NOs: 61-65) or from the expressed by the anti-amyloid peptide engineered bacte CsgBIIb class of peptides (SEQID NOS:59, 60, 69, 75,81,93 riophage varies in length, for example between 10 and 30 and 94) or from the CsgBIIa class of peptides (SEQID NO: amino acids in length, or for example, between 15 and 25 29) or from CsgBI class of peptides (SEQID NOs: 66-68 and amino acids in length. In some embodiments, an anti-amyloid 70-72). peptide expressed by the anti-amyloid peptide engineered 0068. In some embodiments, an anti-amyloid peptide bacteriophage comprises or consists of a sequence of at least sequence differs by not more than 4 amino acid insertions, 8 contagious amino acids selected from any in SEQID NO: 1 deletions or substutions. or SEQ ID NO: 2 and orthologs thereof. In some embodi 0069. In some embodiments, the N- and C-termini of an ments, an anti-amyloid peptide expressed by the anti-amyloid anti-amyloid peptide sequence alter by not more than 4 amino peptide engineered bacteriophage is a CsgA peptide, Such as, acid insertions, deletions or Substutions. for example, selected from the group comprising: SEQ ID 0070. In some embodiments, the N- and C-termini of the NO; 11-18, CsgA III class of peptides (SEQID NO: 52-53), anti-amyloid peptide sequence can vary in length, for or from the CsgAIIb class of peptides (SEQ ID NOS:35, 36, example, between 1 and 10 amino acids in length, or for 39-41, 45, 49-51), or from the CsgAIIa class of peptide (SEQ example, between 3 and 8 amino acids in length. In some ID NO: 11 and 12) or from the CsgAI class of peptides (SEQ embodiments, the N- and C-termini of the anti-amyloid pep ID NOs: 42, 44, 46, 57 and 58) or orthologs thereof. In some tide sequence can comprise at least one additional amino acid embodiments, an anti-amyloid peptide expressed by the anti residue. In particular, the N-terminus of the anti-amyloid amyloid peptide engineered bacteriophage is a CsgA peptide peptide sequence can be extended by at least 1, at least 2, or at is selected from the group comprising: SEQID NOs: 52, 53) least 3 or more arginine or other amino acid residues. The or orthologs thereof. In some embodiments, an anti-amyloid C-terminus of the anti-amyloid peptide sequence can be peptide expressed by the anti-amyloid peptide engineered extended by at least 1, at least 2, or at least 3 or more proline bacteriophage is a CsgB peptide, for example, selected from residues. the group comprising: SEQID NO; 27-34, CsgBIII class of 0071. In some embodiments, an anti-amyloid peptide is peptides (SEQID NOs: 61-65) or from the CsgBIIb class of expressed on the Surface of the engineered bacteriophage peptides (SEQID NOs: 59, 60, 69, 75,81,93 and 94) or from from which it is expressed. In some embodiments, an anti the CsgBIIa class of peptides (SEQIDNO: 29) or from CsgBI amyloid peptide is released from a bacterial host cell infected class of peptides (SEQ ID NOs: 66-68 and 70-72) or US 2012/03.01433 A1 Nov. 29, 2012
orthologs thereof. In some embodiments, an anti-amyloid construct #27 (SEQID NO: 29), #18 (SEQID NO: 12), #22 peptide expressed by the anti-amyloid peptide engineered (SEQ ID NO: 16), and #31 (SEQ ID NO: 33). Unmodified bacteriophage is a CsgB peptide selected from the group control T7select-415 bacteriophage are indicated by T7#2 in comprising: SEQID NOs: 61-65 or orthologs thereof. the legend. 0078. In some embodiments, a plurality of anti-amyloid I0084 FIG. 3A-3B shows amyloid-inhibiting peptides peptide engineered bacteriophages are administered to a Sub expressed on phage capsids to suppress in vitro amyloid fiber ject, and in Some embodiments, each bacteriophage com assembly. FIG. 3A shows that T7 phages expressing wild prises a nucleic acid which encodes one or more different type CsgA43-52. CsgAss-64, and CsgB 133-142 (T7-CsgA4s-s2. anti-amyloid peptides. In some embodiments, the plurality of T7-CsgAsse, and T7-CsgBa, bold green lines) stimu bacteriophages express one or more different anti-amyloid lated curli fiber assembly at concentrations below 10 PFU/ peptides from the same amyloidogenic polypeptide or a dif mL but blocked assembly at concentrations above 10 PFU/ ferent amyloidogenic polypeptide. In some embodiments, at mL with moderate efficacy (Class IIa). Three classes of least one bacteriophage in a plurality of bacteriophages recombinant phage expressing curli-inhibiting peptides were express one or more anti-amyloid peptides from a first amy distinguishable based on minimal (Class I, black lines), mod loidogenic polypeptide and at least one bacteriophage in a erate (Class IIb, blue lines), and strong inhibition of curli fiber plurality of bacteriophages expresses one or more anti-amy assembly (Class III, red lines) (see Example 4 and Tables 7 loid peptides from a second amyloidogenic polypeptide, for and 8). FIG. 3B shows T7 phages expressing wild-type example, where the first amyloidogenic polypeptide is a CsgAssoa (squares) and CsgB-42 (diamonds) seeded curli CsgA polypeptide and a second amyloidogenic polypeptide fiber assembly at 500 PFU/mL. CsgA seeded assembly is is a CsgB polypeptide. shown for comparison (triangles). 0079 Another aspect of the present invention provides a I0085 FIG. 4A-4B shows the polypeptide sequence of composition comprising an anti-amyloid peptide engineered CsgA (SEQ ID NO: 1) (FIG. 4A) and nucleic acid sequence bacteriophage as disclosed herein. In some embodiments, the encoding CsgA (SEQID NO:200) (FIG. 4B). composition further comprises a pharmaceutical acceptable I0086 FIG. 5A-5B shows the polypeptide sequence of carrier. In some embodiments, the composition further com CsgA (SEQ ID NO:2) (FIG. 5A) and nucleic acid sequence prises an additional agent, for example, other anti-amyloid encoding CsgB (SEQ ID NO:201) (FIG. 5B). peptides or an agent which inhibits fiber aggregation. I0087 FIG. 6 shows a histogram of the effectiveness of the 0080. Another aspect of the present invention relates to anti-amyloid peptide engineered bacteriophages at inhibiting kits comprising an anti-amyloid peptide engineered bacte the growth of E. coli biofilms. 1x10" plaque forming units riophage as disclosed herein, where the anti-amyloid peptide (PFU)/mL of anti-amyloid peptide engineered bacterioph engineered bacteriophage comprises a nucleic acid opera ages were used to inhibit biofilm grow for 36 hours. The level tively linked to a promoter, wherein the nucleic acid encodes of biofilm biomass was determined with crystal violet stain at least one anti-amyloid peptide. ing followed by solubilization inacetic acid and measurement 0081. Another aspect of the present invention relates to the of optical density at 600 nm. Anti-amyloid peptide engi use of any of the anti-amyloid peptide engineered bacterioph neered bacteriophage which express peptide sequence #76 ages as disclosed herein for reducing the formation or main (SEQ ID NO: 62) shows much lower biofilm biomass com tenance of protein aggregates. In some embodiments, the pared with control phage (T7 with a control peptide), T7 anti-amyloid peptide engineered bacteriophages are used to wild-type, and no phage treatment. Also shown are anti inhibit a naturally forming amyloid or a high order aggregate amyloid peptide engineered bacteriophage which express comprising of at least two different polypeptides. In Such peptide sequences #17 (SEQID NO: 11), #18 (SEQID NO: embodiments, a naturally forming amyloid comprises a first 12) and #27 (SEQ ID NO: 29). Of note, these anti-amyloid amyloidogenic polypeptide which is capable of nucleating peptide engineered bacteriophages which were tested are amyloid formation by a second amyloidogenic polypeptide. non-replicative, (i.e. they do not replicate within in the host In some embodiments, the anti-amyloid peptide engineered bacterial cells) so the experiment indicates the inhibition of bacteriophages are used to inhibit a naturally forming amy the biofilm formation by these peptides sequences; #76 (SEQ loid or a high order aggregate in a Subject, for example, an ID NO: 62), #17 (SEQID NO: 11), #18 (SEQID NO: 12) and amyloid or protein aggregate produced as part of a bacterial #27 (SEQID NO: 29). biofilm. I0088 FIGS. 7A-7E shows an assay to identify anti-amy loid peptides which bind to CsgA and CsgB polypeptides BRIEF DESCRIPTION OF FIGURES (nucleating sequences in CsgA and CsgB). FIG. 7A shows a 0082 FIG. 1 shows amyloid formation in the presence of schematic of CsgA polypeptides or CsgB polypeptides bind T7 or M13mp 18 bacteriophage. Varying pfu/ml were added ing to peptides located on a "dot of an assay, where the dots to wells containing 5 uM of curli or NM. Unmodified T7 are coated with individual anti-amyloid peptides oranti-amy exhibited minimal inhibition of curli and Sup35-NMamyloid loid peptide-engineered bacteriophages. Dots where aggre fiber assembly, while unmodified M13mp 18 had moderately grates form identify anti-amyloid peptides which bind to strong efficacy against both curli and Sup35-NM fiberforma CsgA or CsgB (i.e. can be peptides to the binding sites of tion. CsgA or CsgB) and are effective at inhibiting formation of 0083 FIG. 2 shows amyloid formation in the presence of aggregrates, and dots where no aggregrates form identify engineered T7 bacteriophage which display selected curli anti-amyloid peptides which do not specifically bind CsgA or inhibiting peptides on their capsid proteins. Varying pfu/ml CsgB polypeptides, and are less effective at ihibiting the were added to wells containing curli. The numbers in the formation of curli agregrates. FIG. 7B shows hits (identified legend refer to anti-amyloid peptide engineered T7 express by the arrow) of high order protein aggregrate, thus identify ing CsgA- or CsgB-peptides listed in Table 3 and Table 4. The ing anti-amyloid peptide engineered bacteriophages which most effective engineered bacteriophages were the ones with binds CsgA or CsgB polypeptides and thus is effective at US 2012/03.01433 A1 Nov. 29, 2012
inhibiting protein aggregrate formation. Relative fluores CsgA (SEQID NO: 205) and CsgB (SEQID NO: 206) with cence of Alexa-labelled full-length CsgA bound to peptide the N-terminal signal sequence. The signal sequences for arrays demonstrate that nucleation of CsgA is facilitated by CsgA and CsgB are shown in Bold. FIG. 12B shows the three peptides in CsgB (SEQ ID NOs: 250, 203 and 204) alignment of the polypeptide sequences of CsgA (SEQ ID which contain hydrophobic residues (underlined in red). FIG. NO: 207) and CsgB (SEQID NO: 208) without the N-termi 7C shows wildtype (wt) bacteriophage has formation of pro nal signal sequence. In both FIGS. 12A and 12B, the binding tein aggregrates in the presence of CsgB (left, postive con sequences in CsgB (SEQ ID NOs: 202 and 250) are under trol), no agregrates in the absence of CsgB polypeptide lined. Accordingly, an anti-amyloid peptide engineered bac (CsgB-) (middle, negative control) and absence of aggre teriophage as disclosed herein can comprise a fragment of at grates in the presence of bacteriophage CsgBpAAIVV least 7 consecutive amino acids from SEQ ID NO: 202 or (right). FIG. 7A-7C is an example of an assay which can be SEQID NO: 250. used to identify anti-amyloid peptide which inhibit aggre 0094 FIG. 13A-13E shows amyloid-inhibiting peptides grate formation as disclosed herein. FIG. 7D shows CsgB expressed on phage capsids to reduce biofilm formation, binding sequences, SEQ ID NOS: 250, 202. FIG. 7E shows block mammalian cell invasion by E. coli, decrease colony various concentrations of peptides bound to maleimide plates growth, and affect colony morphology. FIG. 13 A-13B shows to faciliate invitro assembly of soluble CsgA into amyloids as curli-inhibiting phage Suppressed biofilm formation based on monitored by ThT fluorescence. CsgBoo facilitates CsgA crystal violet staining and quantification with optical density assembly (0.1 uM, 0.25 uM, and 0.5 LM shown) with a readings at 600 nm (ODoo). All ODoo, data was normal process similar to a seeded assembly (i.e., can be fitted with ized so that untreated biofilms had ODoo-1. T7-RRR first order kinetics). CsgBs and CsgA alone show assem CsgB-PPP had the greatest efficacy against biofilm bly with lag phases even at their highest concentrations (0.5 formation. 10 PFU/mL of phage was used in each treatment uM shown). well. FIG. 13C shows E. coli invasion of HEp-2 cells, as I0089 FIGS. 8A-8C shows a schematic of the alignment of determined with a gentamicin protection assay, is decreased segments of the amino acid sequences other biofilm polypep in the presence of T7-CsgB-PPP and T7-RRR tides. FIG. 8A shows the amino acid sequences of these CsgB-PPP (SEQID NO: 61). FIG. 13D shows E. coli biofilm polypeptides are highly conserved and can be used to colony growth, measured by colony circumference, is derive anti-amyloid peptides as disclosed herein. In some retarded by knocking out csgA (green circles) or csgB (blue embodiments, the anti-amyloid peptides expressed by the triangles) as well as by treating with T7-CsgAas (grey anti-amyloid peptide engineered bacteriophages of the crosses) and T7-RRR-CsgB-PPP (red squares). E. coli present invention can comprise a peptide derived from any colony growth for untreated cells is shown for reference one of sequences shown in FIG. 8A (SEQ ID NO: 251-259). (black diamonds). FIG. 13E shows knocking out csgB or FIGS. 8B and 8C show amino acid sequences of additional treating E. coli with T7-RRR-CsgB-PPP results in the biofilm polypeptides which can be used to derive anti-amy loss of rough morphologies and binding of Congo red seen loid peptides as disclosed herein. The each polypeptide with wild-type cells. Also, E. coli AcsgB and E. coli treated sequence is identified by the GeneBank No followed by a with T7-RRR-CsgB-PPP are mucoid compared with and a portion of name of the polypeptide (SEQ ID NOs: wild-type cells. 260-384). Each Genebank sequence is incorporated herein in (0095 FIG. 14 shows the biofilm-inhibiting activity of the its entirety by reference. engineered phage, T7-RRR-CsgB-PPP (SEQ ID NO: 0090 FIGS. 9A-9B shows a histogram of the effect of the 61). Crystal violet staining of E. coli biofilms shows a con small molecule inhibitors DAPH-12, DAPH-6 and Amphot centration-dependent effect for biofilm inhibition by ericin B (AmphB) to prevent formation of curli amyloid T7-RRR-CsgB-PPP. T7med-RRR-CsgB-PPP, fibers. FIG.9A shows% amyloid fiber formation in the pres which expresses 5-15 peptides copies per phage, at a concen ence of CsgA, and in the presence of increasing ratios (1:20, tration of 10 PFU/mL displayed the poorest biofilm inhibi 1:10) of the inhibitors DAPH-6 or DAPH-12. DAPH-12 sece tion. tively inhibits Curliassembly. FIG.9B shows% amyloid fiber 0096 FIG. 15 shows varying the amino acids flanking formation in the presence of NM or CsgA, and in the presence CsgB modulated biofilm formation. Replacing the of increasing ratios (1:0.5, 1:2, 1:4) of the inhibitor AmphB. C-terminal prolines of T7-RRR-CsgB-PPP with gly AmphB does not inhibit Curli assembly. cines resulted in enhancement of biofilm formation rather 0091 FIG. 10A-10B shows characteristics of the assay to than inhibition. Decreasing the number of C-terminal pro identify inhibition of curli formation using the anti-amyloid lines reduced the efficacy of biofilm inhibition. Increasing the peptide engineered bacteriophages. FIG. 10A is a schematic arginine and/or proline residues in T7-RRR-CsgB of location of identified hits, and FIG. 10B shows increase in PPP had only moderate effects. ThT fluorescence (i.e. protein aggregation formation) over 0097 FIG.16 shows the efficacy of the peptide-displaying time. T7 bacteriophage to prevent biofilm formation on plastic 0092 FIG. 11A-11B shows characteristics of the assay to pegs. Preincubation of biofilm pegs with phage followed by identify inhibition of curli formation using the anti-amyloid biofilm growth and crystal violet staining revealed that peptide engineered bacteriophages. FIG. 11A shows a sche T7-RRR-CsgB-PPP and T7-RRR-CsgB-PP matic of hits where protein aggregates have formed at specific PPP were the most effective at blocking biofilm growth. locations in the assay. FIG. 11B shows a electron micrograph 0.098 FIG. 17A-17C shows in vitro aggregation of amy of an example of curli amyloid fibrils formed at locations loid-fi can be inhibited by anti-curliphage. The major nucle where proteins aggregrates have formed. ating sequence of CsgB contains a sequence, AIVV (SEQID 0093 FIG. 12A-12B shows amino acid sequence align NO: 199), that when reversed, is also present within a nucle ment and homology of CsgA and CsgB polypeptides. FIG. ating sequence in amyloid-?3 (GGVVIA) (SEQID NO: 197). 12A shows the alignment of the polypeptide sequences of FIG. 17A shows, as monitored by ThT fluorescence, the US 2012/03.01433 A1 Nov. 29, 2012
T7-RRR-CsgB-PPP phage increased the lag phase of claims. It is also understood that the foregoing detailed in vitro amyloid-13 assembly, while FIGS. 17B and 17C description and the following examples are illustrative only shows T7-con and T7-wt were ineffective at increasing the lag and are not to be taken as limitations upon the scope of the time of amyloid-f fiber assembly, respectively. invention. Various changes and modifications to the disclosed 0099 FIG. 18 shows site-specific mutations in CsgA and embodiments, which will be apparent to those of skill in the CsgB (SEQ ID NOs: 209-212) abolished curli formation as art, may be made without departing from the spirit and scope assayed by Congo red binding on agar plates. of the present invention. Further, all patents, patent applica 0100 FIG. 19 shows a schematic of AmyloidMutant iden tions, and publications identified are expressly incorporated tifying putative interactions between CsgA and CsgB con herein by reference for the purpose of describing and disclos firmed by experimental mutational analysis. Putative combi ing, for example, the methodologies described in Such publi nations of CsgA and CsgB interactions were scored using a cations that might be used in connection with the present Boltzmann statistical mechanical scoring function, log-odds invention. These publications are provided solely for their potentials derived from the Protein Data Bank, and an effi disclosure prior to the filing date of the present application. cient dynamic programming algorithm. One of the highest Nothing in this regard should be construed as an admission scoring interactions was detected to be between CsgAs that the inventors are not entitled to antedate such disclosure and CsgBao (NSALALQT/TAIVVQR) (SEQ ID by virtue of prior invention or for any other reason. All state NO:195/SEQID NO: 196), consistent with results from the ments as to the date or representation as to the contents of peptide arrays, as long with other CsgA sequences. these documents are based on the information available to the 0101 FIG.20A-20C shows the anti-amyloid peptide engi applicants and do not constitute any admission as to the neered bacteriophage can be used to efficiently suppress correctness of the dates or contents of these documents. aggregation of another aggregation-prone system, the yeast 0103) The present invention relates in part to compositions prion Sup35-NM. Five anti-amyloid peptide engineered bac and method to inhibit or disrupt the formation or maintenance teriophages including the control were constructed with dif of protein aggregates. One aspect of the present invention is ferent inserts. The anti-amyloid peptide engineered bacte directed to engineered bacteriophages which express, either riophage H1316 has the insert RRR in the surface of the bacteriophage or is released (by lysis or NQQNYQQYSQNGNQQQGNNRY-PPP (SEQ ID NO: secretion) one or more anti-amyloid peptides which inhibit or 226) (amino acids 9-29 of the NM prion domain). The anti disrupt the formation or maintenance of protein aggregates. amyloid peptide engineered bacteriophage #1317 has the 0104. Accordingly, one aspect of the present invention insert RRR-NQQNYQQYSQNGNQQQGNNRY-PPP relates to the engineered bacteriophages as discussed herein STOP (SEQID NO:227) (amino acids 9-29 of the NM prion which express an anti-amyloid peptide which inhibits or dis domain). The anti-amyloid peptide engineeredbacteriophage rupts the formation or maintenance of protein aggregates. In H1318 has the insert RRR-ISESTHINTNNANVTSADALIK one embodiment, an engineered bacteriophage which PPP (SEQ ID NO: 228) (amino acids 220-240 of the NM expresses an anti-amyloid peptide is termed an “anti-amyloid prion domain). The anti-amyloid peptide engineered bacte peptide engineered bacteriophage’ herein and inhibits pro riophage #1319 has the insert RRR-ISESTHNTNNANVT tein aggregates which comprise of two or more different SADALIK-PPP-STOP (SEQID NO: 229) (amino acids 220 polypeptides, e.g., "higher order aggregates' which are pro 240 of the NM prion domain). T7 control phage is from the tein aggregates formed by a first polypeptide which seeds the T7 select415 kit with control insert. FIG. 20A Shows the for formation of an aggregate comprising at least in part of a mation of Sup35-NM amyloid fiber assembly, as monitored second polypeptide. by ThT fluorescence, in the presence of the anti-amyloid peptide engineered bacteriophages #1316 and #1318. The 0105. The present invention is based in part on the discov concentration of the anti-amyloid peptide engineered bacte ery that Small anti-amyloid peptides sequences expressed riophages was normalized to 5x10 PFU/mL. FIG. 20B from bacteriophages inhibit curli fiber formation. In some shows formation of Sup35-NM amyloid fiber assembly, as embodiments, the anti-amyloid peptides are peptide monitored by ThT fluorescence, in the presence of a higher sequences of bacterial CsgB polypeptides. In some embodi concentration of anti-amyloid peptide engineered bacte ments, the anti-amyloid peptides are peptide sequences of riophages #1316, #1317, #1318, #139, T7 control or T7 wild bacterial CsgA polypeptides. As described in the Examples, type. The concentration of the anti-amyloid peptide engi specific peptides within E. coli CsgB nucleated assembly of neered bacteriophages was normalized to 1.6x10' PFU/mL. amyloid fibers and specific peptides within E. coli CsgA, or FIG. 20O is another set of experiment, similar to FIG. 20B, modified variants of the specific peptides when expressed on showing formation of Sup35-NM amyloid fiber assembly, as the Surface of a bacteriophage can inhibit amyloid formation monitored by ThT fluorescence, in the presence of the anti and inhibit bacteria. The results thus demonstrate that short amyloid peptide engineered bacteriophages #1317, #139. T7 peptide portions of bacterial biofilm forming proteins, lack control or T7 wild-type. The concentration of the anti-amy ing the context provided by some or all of the remainder of the loid peptide engineered bacteriophages was normalized to full length polypeptide from which they were derived, inhibit 1.6x1OPFU/mL. the assembly of the full length polypeptides to form higher order aggregates, e.g., fibrils. Furthermore, these results show the anti-amyloid peptide can inhibit aggregate formation DETAILED DESCRIPTION OF THE INVENTION when the anti-amyloid peptide is expressed on the Surface of 0102. It should be understood that this invention is not the bacteriophage. Notably, the results demonstrate that anti limited to the particular methodology, protocols, and amyloid peptide engineered bacteriophages can be used to reagents, etc., described herein and as Such can vary. The inhibit a first polypeptide that functions as a seed to nucleate terminology used herein is for the purpose of describing the assembly of a second polypeptide with a distinct particular embodiments only, and is not intended to limit the sequence. These anti-amyloid peptide engineered bacte scope of the present invention, which is defined solely by the riophages which express the anti-amyloid peptides, either on US 2012/03.01433 A1 Nov. 29, 2012 the surface of the bacteriophage or are released (i.e. by lysis or described herein, an anti-amyloid peptide engineered bacte secretion), compositions comprising the anti-amyloid pep riophage can comprise at least one or more than one anti tide engineered bacteriophages, and uses thereof are aspects amyloid peptide. Such as for example, at least 2, at least 3, at of the invention. least 4, at least 5, least 6, at least 7, at least 8, at least 9 or at 0106. In some embodiments, an anti-amyloid peptide least 10 or more different anti-amyloid peptides at any one expressed by an anti-amyloid peptide engineered bacterioph time. In some embodiments, an anti-amyloid peptide engi age as disclosed herein is a CsgA or a CsgB peptide. In some neered bacteriophage as disclosed herein can used in combi embodiments, an anti-amyloid peptide engineered bacte nation with at least one or more different anti-amyloid peptide riophage can be used to inhibit bacteria and/or remove bac engineeredbacteriophages, for example an anti-amyloid pep terial biofilms in environmental, industrial, and clinical set tide engineered bacteriophage as disclosed herein can used in tings by administering a composition comprising at least one combination with at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more engineered bacteriophage as discussed herein. different anti-amyloid peptide engineered bacteriophages. 0107. In particular, the inventors have engineered bacte 0113 Provided herein are a plurality of anti-amyloid pep riophages to express an anti-amyloid peptide, for example on tide engineered bacteriophages which express at least one or the outside of the bacteriophage surface or to release the a plurality of anti-amyloid peptides, wherein the peptides are anti-amyloid peptide (by lysis or secretion). Such engineered portions of a first amyloidogenic polypeptide that is prone to bacteriophages are referred to herein as an “anti-amyloid form aggregates with a second amyloidogenic polypeptide of peptide engineered bacteriophage'. In particular, the inven different sequence under appropriate conditions. In some tors have engineered bacteriophages to specifically express embodiments the first amyloidogenic polypeptide is any an anti-amyloid peptide, including but not limited to peptides polypeptide that can form heteroaggregates comprised in part derived from naturally occurring polypeptides to inhibit bio of a second amyloidogenic polypeptide. In some embodi film formation or maintenance and/or to allow for faster and ments of interest the first and second amyloidogenic polypep more effective killing of bacteria in bacterial infections, such tides are at least 70%, 80%, 85%, 90%, 95%, 96%,97%.98%, as bacterial infections comprising more than one different 99%, or 100% identical to polypeptides that assemble to form bacterial host species. amyloids present in biofilms. In some embodiments of par 0108. Accordingly, one aspect of the present invention ticular interest the first amyloidogenic polypeptide is a CsgB generally relates to an anti-amyloid peptide engineered bac polypeptide and the second amyloidogenic polypeptide is a teriophage where the bacteriophage has been modified or CsgA polypeptide. In some embodiments the first amy engineered to express and/or secrete an anti-amyloid peptide. loidogenic polypeptide is any naturally occurring polypep At least one, or any combination of different anti-amyloid tide wherein heteroaggregates formed in part from the peptide engineeredbacteriophage can be used alone, or in any polypeptide and/or in part from fragments of the polypeptide combination to inhibit bacterial biofilm formation or mainte play a role in disease, e.g., in mammals such as humans, nance and/or to reduce, eliminate, or kill a bacterial infection non-human primates, domesticated animals, rodents such as or reduce or eliminate bacterial contamination. In some mice or rats, etc. In some embodiments the first polypeptide is embodiments, an anti-amyloid peptide engineered bacte at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or riophage can be used with an additional agent, such as the 100% identical to such a naturally occurring polypeptide. same or a different anti-amyloid agent which is expressed by 0114. In some aspects, the present invention relates to a the bacteriophage. composition comprising anti-amyloid peptide engineered 0109 Accordingly, one aspect of the present invention bacteriophages. In some embodiments, a composition com relates to the use of an anti-amyloid peptide engineered bac prises a plurality of anti-amyloid peptide engineered bacte teriophage in conjunction with (i.e. in combination with) at riophages, e.g., up to 10, 50, 100, 150, 200, 250, or more least one other agent, such as an anti-amyloid agent or agent different anti-amyloid peptide engineered bacteriophages, which inhibits fiberaggregation. each expressing the same or unique (i.e. different) anti-amy 0110. One aspect of the present invention relates to a loid peptides. The sequences of the anti-amyloid peptides method to inhibit or disrupt the formation or maintenance of may collectively encompass between 20-100% of a complete protein aggregates. Another aspect of the present invention polypeptide sequence, e.g., 30-100%, 40-100%, 50-100%, relates to a method to eliminate or decrease protein aggre 60-100%, 70-100%, 80-100%, or 90-100% of the full length gates in bacterial biofilms. sequence of an amyloid polypeptide, Such as CsgA (SEQID 0111. In particular, one aspect of the present invention NO: 1) or CsgB (SEQID NO:2). The peptides may be, e.g., relates to methods and compositions comprising an anti-amy 6-12, 8-15, 10-20, 10-30, 20-30, 30-40, or 40-50 amino acids loid peptide engineered bacteriophage to inhibitor disrupt the in length. In some embodiments, the peptides overlap in formation or maintenance of protein aggregates such that the sequence by between, e.g., 1-25 residues, e.g., between 5-20 bacteriophage can Subsequently kill the bacteria and/or so residues, or between 10-15 residues. In some embodiments, that the bacteria are rendered more susceptible to other anti the peptides 'scan at least a portion of the polypeptide, i.e., bacterial agents or a subjects natural defenses and immune the starting positions of the peptides with respect to the system. polypeptide are displaced from one another ('staggered) by 0112 Another aspect of the present invention relates to the X residues where X is, for example, between 1-10 residues or use of an anti-amyloid peptide engineered bacteriophage to between 1-6 residues or between 1-3 residues. In one embodi inhibit or disrupt the formation or maintenance of protein ment, the starting positions of the peptides with respect to the aggregates, wherein the aggregates, in Some embodiments, polypeptide sequence are staggered by 1 amino acid. For comprise at least 2 different polypeptides, and more particu example, a first peptide corresponds to amino acids 1-20; a larly comprise a first amyloidogenic polypeptide which forms second peptide corresponds to amino acids 2-21; a third pep a seed to nucleate aggregation of a second amyloidogenic tide corresponds to amino acids 3-22, etc. In another embodi polypeptide. In one embodiment of this aspect and all aspects ment, the starting positions of the peptides with respect to the US 2012/03.01433 A1 Nov. 29, 2012 polypeptide sequence are staggered by 2 amino acids. For although CsgA is the major protein constituent and CsgB is example, a first peptide corresponds to amino acids 1-20; a the nucleating, or seed forming polypeptide. In living bacte second peptide corresponds to amino acids 3-22; a third pep ria, curli formation likely involves activities of several addi tide corresponds to amino acids 5-23, etc. The collection need tional polypeptides encoded by other Csg genes (CsgD, not include a peptide that comprises the N-terminal or C-ter CsgE, CsgF, CsgG), but these polypeptides are not required minal amino acid(s) of the polypeptide. For example, a signal for curli formation in vitro. Sequences of CsgA and CsgB sequence could be omitted. The collection could span any from a large number of bacteria have been identified. Exem N-terminal, C-terminal, or internal portion of the polypep plary CsgA and CsgB amino acid sequences are shown in tide. In some embodiments the peptides have a detectable FIGS. 4A (SEQID NO: 1) and 5A (SEQID NO: 2), respec label, a reactive moiety, a tag, a spacer, or a crosslinker linked tively. One of skill in the art will readily be able to find CsgA thereto. The peptides need not all be the same length and need and CsgB sequences by searching databases Such as Gen not all fall within any single range of lengths. Bank publicly available through the National Center for Bio 0115. In certain embodiments of all aspects of the inven tion, an anti-amyloid peptide expressed by the anti-amyloid technology Information (NCBI) (see ncbi.nlm.nih.gov), and peptide engineered bacteriophage as disclosed herein is a there are computational methods for determining, and pre fragment or peptide of a polypeptide that normally promotes dicting anti-amyloid peptides to inhibit curliformation in the formation of biofilms. In some embodiments, an anti-amyloid methods and bacteriophages as disclosed herein. peptide expressed by the anti-amyloid peptide engineered 0118. In one aspect of the present invention, an anti-amy bacteriophage is a peptide derived from a first or second loid peptide engineered bacteriophage as disclosed hereincan amyloidogenic polypeptide, wherein the first or second amy comprise a nucleic acid encoding an anti-amyloid peptide, loidogenic polypeptide are at least 70%, 80%, 85%, 90%, or wherein the anti-amyloid peptide is derived from a CsgB 95% identical to polypeptides that assemble to form amyloids polypeptide or a CsgA polypeptide. In another embodiment, present in biofilms e.g., bacterial polypeptides that assemble an anti-amyloid peptide engineered bacteriophage as dis to form amyloid fibers such as curli. Curli are the major closed herein can comprise a nucleic acid encoding a frag proteinaceous component of a complex extracellular matrix ment of a naturally occurring anti-amyloid agent. In other produced by many bacteria, e.g., many Enterobacteriaceae embodiments, an anti-amyloid peptide engineered bacte such as E. coli and Salmonella spp. (Barnhart MM, Chapman riophage as disclosed herein can comprise a nuclei acid MR. Annu Rey Microbiol., 60:131-47, 2006). Other biofilm encoding a fragment of a different Csg polypeptide selected forming bacteria of interest include Klebsiella, Pseudomo from the group of CsgD, CsgE, CsgF, CsgG polypeptides. nas, Enterobacter; Serratia, Citrobacter; Proteus, Yersinia, 0119. In some embodiments of this aspect and all aspects Citrobacter, Shewanella, Agrobacter; Campylobacter, etc. described herein, an anti-amyloid peptide engineered bacte 0116 Curli fibers are involved in adhesion to surfaces, cell riophage as disclosed herein can comprise a nucleic acid aggregation, and biofilm formation. Curli also mediate host encoding an anti-amyloid peptide such as, for example but it cell adhesion and invasion, and they are potent inducers of the not limited to, at least one of the following different CsgA host inflammatory response. Curli exhibit structural and bio peptide is selected from SEQID NOs: 11-18 or SEQID NOs: chemical properties of amyloids, e.g., they are nonbranching, 35-58 or variants or modified variants thereof, and a CsgB B-sheet rich fibers that are resistant to protease digestion and peptide is selected from SEQID NOS: 27-34 or SEQID NOs: denaturation by 1% SDS and bind to amyloid-specific moi 59-90, or variants or modified variants thereof. eties such as thioflavin T, which fluoresces when bound to I0120 In one embodiment of this aspect and all aspect amyloid, and Congo red, which produces a unique spectral described herein, an anti-amyloid peptide engineered bacte pattern (“red shift’) in the presence of amyloid. Polypeptides riophage can comprise at least 2, 3, 4, 5 or even more, for that assemble to form curli are of interest at least in part example 10 different nucleic acids which encode an anti because of their association with animal and human disease. amyloid peptide, for example, 2, 3, 4, 5, 6, 7 or more of the Bacterial polypeptides that promote formation of biofilms anti-amyloid peptides encoded by nucleic acid sequences present in a variety of natural habitats are also of interest. For SEQID NO: 3-10, 19-26. In some embodiments, any or all example, in a recent study bacteria producing extracellular different combinations of anti-amyloid peptides and be amyloid adhesins were identified within several phyla: Pro present in an anti-amyloid peptide engineered bacteriophage. teobacteria (Alpha-, Beta-, Gamma- and Deltaproteobacte I0121. In another aspect of the present invention, an anti ria), Bacteriodetes, Chloroflexi and Actinobacteria (Larsen, amyloid peptide engineered bacteriophage can comprise at P. et al., Environ Microbiol. 9(12):3077-90, 2007). Particu least one nucleic acid encoding an anti-amyloid agent which larly in drinking water biofilms, a high number of amyloid inhibits or blocks amyloid formation. In some embodiments positive bacteria were identified. Bacteria of interest may be of this aspect, and all other aspects described herein, such an gram-negative or gram-positive. In some embodiment bacte anti-amyloid peptide expressed by an anti-amyloid peptide ria of interest are rods. In some embodiments they are aerobic. engineered bacteriophage which inhibits or blocks the forma In some embodiments they are facultative anaerobes oranaer tion of amyloids refers to any anti-amyloid peptide which obes. inhibits the formation of amyloid aggregates by at least about 0117. In nature, curli are assembled by a process in which 10% or at least about 15%, or at least about 20% or at least the major curli Subunit polypeptide, CsgA, is nucleated into a about 30% or at least about 50% or more than 50%, or any fiber by the minor curli subunit polypeptide, CsgB.CsgA and integer between 10% and 50% or more, as compared to the CsgB are about 30% identical at the amino acid level and use of a control peptide (e.g. not an anti-amyloid peptide). contain five-fold internal symmetry characterized by con Stated another way, the anti-amyloid peptide can reduce the served polar residues. The assembly process is believed to presence of an amyloid aggregates by at least about 10% or at involve addition of soluble polypeptides to the growing fiber least about 15%, or at least about 20% or at least about 30% tip. Thus both subunits are incorporated into the fiber, or at least about 50% or more than 50%, or any integer US 2012/03.01433 A1 Nov. 29, 2012
between 10% and 50% or more, as compared to the use of a prise aggregation-prone polypeptides which bind to other control peptide is encompassed for use useful in the present different aggregation-prone polypeptide to form a higher invention. ordered aggregate, e.g., an aggregate referred to in the Scien 0122. In some embodiments, the reduction of the amount tific literature by terms such as "amyloid, "amyloid fibrils.” of amyloid formation or amyloid aggregates by the anti “fibrils” (also referred to as “fibers”) and “prions”. By “higher amyloid peptide expressed by an anti-amyloid peptide engi ordered” is meant an aggregate of at least 25 polypeptide neered bacteriophage is a reduction of at least about 10%, or Subunits, and is meant to exclude the many proteins that are at least about 15%, or at least about 20%, or at least about known to include polypeptide dimers, tetramers, or other 25%, or at least about 35%, or at least about 50%, or at least Small numbers of polypeptide subunits in an active complex, about 60%, or at least about 90% and all integers in between although the peptides and polypeptides may form Such com 10-90% of the amount of the amyloid deposits when com plexes as well. The term “higher-ordered aggregate also is pared to a similar amount of a bacteriophage which has not meant to exclude random agglomerations of denatured pro been engineered to express an anti-amyloid peptide. teins that can form in non-physiological conditions. The term 0123. The inventors have also demonstrated herein in “higher-ordered aggregate' is used interchangeably herein Examples that an anti-amyloid peptide engineered bacte with the term 'aggregate' unless otherwise indicated. riophage which comprises at least one anti-amyloid peptide I0128. The term “assembles' refers to the property of cer can decrease amyloid formation, for example inhibit in vitro tain polypeptides to form ordered aggregates under appropri and in vivo assembly of curli formation by bacteria. ate conditions and is not intended to imply that the formation of higher ordered aggregates will occur under every concen DEFINITIONS tration or every set of conditions. A peptide that, when present 0.124 For convenience, certain terms employed in the as part of a first polypeptide, can promote (e.g., accelerate or entire application (including the specification, examples, and cause) assembly of a second polypeptide differing in appended claims) are collected here. Unless defined other sequence from the first polypeptide. So as to form fibers wise, all technical and scientific terms used herein have the comprising both first and second polypeptides, is referred to same meaning as commonly understood by one of ordinary herein as a “nucleating peptide' and its amino acid sequence skill in the art to which this invention belongs. will be referred to as a “nucleating sequence'. Also, “nucle 0.125. As used herein, the term “anti-amyloid peptide ating peptide encompasses peptides that nucleate assembly engineeredbacteriophage” refers to a bacteriophage that have of a polypeptide with other polypeptides identical in been genetically engineered to comprise a nucleic acid which sequence. Curli are composed of polypeptides of different encodes an anti-amyloid peptide, for example, the anti-amy sequences (CsgA and CsgB) but many amyloids are com loid peptide reduces a formation or inhibits the maintenance posed of identical polypeptides. In some embodiments of the of protein aggregates comprised, in Some embodiments, of at invention, a nucleating peptide is characterized in that its least two different polypeptides. Naturally, one can engineer deletion (e.g., in part or in full) from a polypeptide signifi a bacteriophage to comprise at least one nucleic acid which cantly slows down or abolishes fiber assembly with a com encodes more than one anti-amyloid peptide, for example, patible polypeptide. two or more anti-amyloid peptides which are fragments from I0129. The term “naturally occurring amyloid” or “natu the same polypeptide (Such as CsgB) or to at least two rally forming amyloid” refers to formation of protein aggre polypeptides (such as CsgA and CsgB) which can be used in gates under a natural condition. In particular, the naturally the methods and compositions as disclosed herein. occurring amyloid or the naturally forming amyloid com 0126 The term “engineered bacteriophage' as used herein prises a first amyloidogenic polypeptide which is capable of refers to an anti-amyloid peptide engineeredbacteriophage as functioning as a seed for nucleating amyloid formation by a this phrase is defined herein. second amyloidogenic polypeptide. 0127. The term “higher ordered’ refers to an aggregate of 0.130 Amyloid fibers have a characteristic morphology at least 10 polypeptide Subunits, or in some embodiments at under electron microscopy, are B-sheet rich, typically non least 15 polypeptide Subunits, or in some embodiments at branching, and react characteristically with certain amyloid least 25 polypeptide subunits and is meant to exclude the specific dyes such as thioflavin T (ThT) and Congo red. Such many proteins that are known to include polypeptide dimers, dyes may be used to identify and/or detect amyloid fibers and tetramers, or other Small numbers of polypeptide subunits in thus serve as indicators of the formation or presence of Such an active complex, although the peptides and polypeptides fibers in certain embodiments of the invention. In certain may form such complexes as well. The term “higher-ordered embodiments of interest herein, amyloid fibers are composed aggregate' also is meant to exclude random agglomerations of two different polypeptide species, e.g., CsgA and CsgB. In of denatured proteins that can form in non-physiological con Some embodiments amyloid fibers are composed of more ditions. Higher ordered aggregates of interestherein are com than two polypeptide species. The ratio of first polypeptide to monly referred to in scientific literature by terms such as second polypeptide in the fiber can vary. In some embodi "amyloid”, “amyloid fibers”, “amyloid fibrils, or simply as ments, the fiber is composed largely of the second amy “fibers’ or “fibrils, and those terms are used interchangeably loidogenic polypeptide. For example, in some embodiments herein. The term “higher-ordered aggregate' is also used the second polypeptide species constitutes at least 70%, at interchangeably herein with the noun "aggregate'. Polypep least 80%, at least 90%, or more of the fiber by weight, or, in tides that assemble to form amyloid fibers are referred to some embodiments by number, of subunits. In other embodi herein as "amyloidogenic'. It will be understood that many ments, the first polypeptide species constitutes at least 70%, polypeptides that participate in formation of higher-ordered at least 80%, at least 90%, or more of the fiber by weight, or, aggregates can exist in at least two conformational states, in Some embodiments by number, of subunits. In one aspect, only one of which is typically found in the ordered aggregates peptides that are derived from a first amyloidogenic polypep or fibrils. Stated another way, high-ordered aggregates com tide, and to which a second amyloidogenic polypeptide hav US 2012/03.01433 A1 Nov. 29, 2012
ing a different sequence to the first amyloidogenic polypep least 8-10 amino acids long. In some embodiments, a CsgA tide binds to form a higher ordered aggregate are provided. In peptide is at least 8-10amino acids long of a variantofa CsgA Some embodiments the first and second polypeptides are at polypeptide. In some embodiments, a CsgA peptide is at least least 50%, 60%, 70%, 80%, 90%, or up to 95% identical. In 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 Some embodiments the first and second amyloidogenic amino acids long of a naturally occurring CsgA polypeptide polypeptides are no more than 50% identical, e.g., between or a variant of a CsgA polypeptide. In some embodiments, a 20% and 40% identical. In some embodiments, the presence CsgA peptide is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, of the first polypeptide or an aggregation domain derived 19, 20 or more than 20 amino acids long of a naturally occur from the first polypeptide greatly accelerates or is required for ring CsgA polypeptide where at least one amino acid has been formation of an amyloid comprising the second polypeptide. modified (i.e. by substitution, deletion or addition of an amino Either or both of the polypeptides may contain multiple acid or amino acid analogue). In some embodiments, a CsgA aggregation domains, which can be identical or different in peptide is at least 7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, Sequence. 20 or more than 20 amino acids long of a naturally occurring 0131 The term "amyloid associated disorder is used CsgA polypeptide where at least 1, 2, 3, 4, 5 or more than 5 interchangeably herein with the term "amyloidosis' and amino acids has been modified (i.e. by substitution, deletion refers to any of a number of disorders which have as a symp or addition of an amino acid oramino acid analogue). In some tom or as part of its pathology the accumulation or formation embodiments, a CsgA peptide is at least 7, 8, 9, 10, 11, 12, 13, of plaques or amyloid plaques or amyloid protein aggregates 14, 15, 16, 17, 18, 19, 20 or more than 20 amino acids long of in a specific tissue or a various different tissues. The abnormal a naturally occurring CsgA polypeptide where at least 1, 2, 3, protein aggregates, also called deposits are called "amyloid'. 4, 5 or more than 5 amino acids has been added to the N-ter or "amyloid plaques' are extracellular deposits comprised minus or C-terminus or both of the CsgA peptide. In some mainly of proteinaceous fibrils. Generally, the fibrils are com embodiments a CsgA polypeptide is wild type at one, more, posed of a dominant protein or peptide; however, the plaque or all of the following positions: 49, 54, 139, 144 (where may also include additional components that are peptide or amino acid numbering is based on the E. coli CsgA non-peptide molecules. These protein aggregates damage the sequence). In some embodiments the CsgA polypeptide has a tissues and interfere with the function of the involved organ. Substitution at one or more of the foregoing positions. An amyloid associated disorder or amyloidosis occurs in 0.136 The term “CsgB polypeptide' as used herein multiple forms: Spontaneous, hereditary, and also in some encompasses any polypeptide whose sequence comprises or instances is a result from a cancer of the blood cells called consists of the sequence of a naturally occurring bacterial myeloma. Hereditary amyloidosis is an inherited form, and in CsgB polypeptide (SEQ ID NO:2). The term also encom Some occasions is transmitted as an autosomal dominant trait. passes polypeptides that are variants of a polypeptide whose 0132) The term "AL amyloidosis' as used herein refers to sequence comprises or consists of the sequence of a naturally the disease or disorder from AL amyloid deposits, or the occurring bacterial CsgB polypeptide. Such variants are formation of amyloid deposits comprising monoclonal referred to as "CsgB polypeptide variants”. In some embodi immunoglobulin light chain. ments a CsgB polypeptide variant is at least 30%, 40%, 50%, 0133. An "amyloid component' is any molecular entity 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or that is present in an amyloid plaque including antigenic por 100% identical to or similar to a naturally occurring polypep tions of such molecules. Amyloid components include but are tide across the length of the CsgB polypeptide variant (SEQ not limited to proteins, peptides, proteoglycans, and carbo ID NO:2). In some embodiments, a CsgB polypeptide variant hydrates. A 'specific amyloid component” refers to a molecu is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, lar entity that is found primarily or exclusively in the amyloid 95%, 96%, 97%, 98%, 99%, or 100% identical to or similar to plaque of interest. a half (or 50%) of the length of a naturally occurring CsgB 0134. The term "CsgA polypeptide' as used herein polypeptide (SEQID NO:2). encompasses any polypeptide whose sequence comprises or 0.137 In some embodiments a “CsgB peptide' is also used consists of the sequence of a naturally occurring bacterial interchangeably herein as a "CsgB polypeptide fragment' is CsgA polypeptide (SEQ ID NO:1). The term also encom at least 5% or 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, passes polypeptides that are variants of a polypeptide whose 90%. 95%, 98%, or 100% as long as a naturally occurring sequence comprises or consists of the sequence of a naturally CsgB polypeptide. In some embodiments a CsgB peptide is at occurring bacterial CsgA polypeptide, which are referred to least 8-10 amino acids long. In some embodiments, a CsgB as "CsgA polypeptide variants. In some embodiments a peptide is at least 8-10amino acids long of a variant of a CsgB CsgA polypeptide variant is at least 20%, 30%, 40%, 50%, polypeptide. In some embodiments, a CsgB peptide is at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 100% identical to or similar to a naturally occurring CsgA amino acids long of a naturally occurring CsgB polypeptide polypeptide (SEQ ID NO: 1) across the length of the CsgA or a variant of a CsgB polypeptide. In some embodiments, a polypeptide variant. In some embodiments, a CsgA polypep CsgB peptide is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, tide variant is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 19, 20 or more than 20 amino acids long of a naturally occur 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to ring CsgB polypeptide where at least one amino acid has been or similar to a half (or 50%) of the length of a naturally modified (i.e. by substitution, deletion or addition of an amino occurring CsgA polypeptide (SEQID NO:1). acid or amino acid analogue). In some embodiments, a CsgB 0135) In some embodiments a "CsgA peptide' is also used peptide is at least 7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, interchangeably herein as a "CsgA polypeptide fragment' is 20 or more than 20 amino acids long of a naturally occurring at least 5% or 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, CsgB polypeptide where at least 1, 2, 3, 4, 5 or more than 5 90%. 95%, 98%, or 100% as long as a naturally occurring amino acids has been modified (i.e. by substitution, deletion CsgA polypeptide. In some embodiments a CsgA peptide is at or addition of an amino acid oramino acid analogue). In some US 2012/03.01433 A1 Nov. 29, 2012
embodiments, a CsgB peptide is at least 7, 8, 9, 10, 11, 12, 13, 0143. The term “secretion” refers to the process of, elabo 14, 15, 16, 17, 18, 19, 20 or more than 20 amino acids long of rating and releasing agents or chemicals from a cell, or an a naturally occurring CsgA polypeptide where at least 1, 2, 3, agent expressed by the cell. In contrast to excretion, the 4, 5 or more than 5 amino acids has been added to the N-ter Substance may have a certain function, rather than being a minus or C-terminus or both of the CsgB peptide. In some waste product. embodiments the CsgA or CsgB polypeptide variant lacks 0144. The term “infection' or “microbial infection' which about 10-20 amino acids from the N-terminus, C-terminus, or are used interchangeably herein refers to in its broadest sense, both, as compared with a naturally occurring CsgA or CsgB any infection caused by a microorganism and includes bac polypeptide. terial infections, fungal infections, yeast infections and pro 0.138. The term “anti-amyloid peptide' as used herein toZoal infections. refers to any amyloid peptide which can inhibit the formation 0145 The term “biological sample' as used herein refers or maintenance of a high order aggregate. An anti-amyloid to a cell or population of cells or a quantity of tissue or fluid peptide is any peptide which results in inhibition of amyloid from a subject. Most often, the sample has been removed formation by at least about 30% or at least about 40%, or at from a subject, but the term “biological sample' can also refer least about 50% or at least about 60% or at least about 70% or to cells or tissue analyzed in vivo, i.e. without removal from more than 70%, or any integer between 30% and 70% or the subject. Often, a “biological sample' will contain cells more, as compared to in the absence of the anti-amyloid from the animal, but the term can also refer to non-cellular peptide. The term anti-amyloid peptides encompasses all biological material. Such as non-cellular fractions of blood, peptides that inhibit or reduce the formation or maintenance saliva, or urine, that can be used to measure gene expression of protein aggregates, and are typically, for example but not levels. Biological samples include, but are not limited to, limited to, short proteins, generally between 12 and 50 amino whole blood, plasma, serum, urine, semen, saliva, aspirates, acids long, however larger proteins are also encompassed as cell culture, or cerebrospinal fluid. Biological samples also anti-amyloid peptides in the present invention. include tissue biopsies, cell culture. A biological sample or tissue sample can refers to a sample of tissue or fluid isolated 0.139. The term “pro-amyloid peptide' as used herein from an individual, including but not limited to, for example, refers to any amyloid peptide which can increase the forma blood, plasma, serum, tumor biopsy, urine, stool, sputum, tion or promote the maintenance of a high order aggregate. A spinal fluid, pleural fluid, nipple aspirates, lymph fluid, the pro-amyloid peptide is any peptide which results in an external sections of the skin, respiratory, intestinal, and geni increase in amyloid formation by at least about 10% or at least tourinary tracts, tears, saliva, milk, cells (including but not about 20% or at least about 30% or at least about 40%, or at limited to blood cells), tissue biopsies, scrapes (e.g. buccal least about 50% or at least about 60% or at least about 70% or scrapes), tumors, organs, and also samples of in vitro cell more than 70%, or any integer between 10% and 70% or culture constituent. In some embodiments, where the sample more, as compared to in the absence of the pro-amyloid is solid, it can be liquidized and homogenized into a liquid peptide. The term pro-amyloid peptides encompasses all pep sample for use in the device and systems as disclosed herein. tides that increase or promote the formation or maintenance In some embodiments, the sample is from a resection, bron of protein aggregates, and are typically, for example but not choscopic biopsy, or core needle biopsy of a primary or limited to, short proteins, generally between 12 and 50 amino metastatic tumor, or a cellblock from pleural fluid. In addi acids long, however larger proteins are also encompassed as tion, fine needle aspirate samples are used. Samples may be pro-amyloid peptides in the present invention. either paraffin-embedded or frozen tissue. The sample can be 0140. The term "agent” as used herein and throughout the obtained by removing a sample of cells from a subject, but can application is intended to refer to any means such as an also be accomplished by using previously isolated cells (e.g. organic or inorganic molecule, including modified and isolated by another person), or by performing the methods of unmodified nucleic acids such as antisense nucleic acids, the invention in vivo. Biological sample also refers to a RNAi, such as siRNA or shRNA, peptides, peptidomimetics, sample of tissue or fluid isolated from an individual, includ receptors, ligands, and antibodies, aptamers, polypeptides, ing but not limited to, for example, blood, plasma, serum, nucleic acid analogues or variants thereof. In some embodi tumor biopsy, urine, stool, sputum, spinal fluid, pleural fluid, ments of interest, the term 'agent” as used herein and nipple aspirates, lymph fluid, the external sections of the skin, throughtout the application can refer to an engineered bacte respiratory, intestinal, and genitourinary tracts, tears, saliva, riopahge as disclosed herein. milk, cells (including but not limited to blood cells), tumors, 0141. The term “microorganism’ includes any micro organs, and also samples of invitro cell culture constituent. In scopic organism or taxonomically related macroscopic Some embodiments, the biological samples can be prepared, organism within the categories algae, bacteria, fungi, yeast for example biological samples may be fresh, fixed, frozen, or and protozoa or the like. It includes Susceptible and resistant embedded in paraffin. microorganisms, as well as recombinant microorganisms. 0146. As used herein, the term “treating and “treatment' Examples of infections produced by Such microorganisms are refers to administering to a Subject an effective amount of a provided herein. In one aspect of the invention, an anti-amy composition so that the Subject as a reduction in at least one loid peptide is used to target microorganisms in order to symptom of the disease oran improvement in the disease, for prevent and/or inhibit their growth, and/or for their use in the example, beneficial or desired clinical results. For purposes of treatment and/or prophylaxis of an infection caused by the this invention, beneficial or desired clinical results include, microorganism, for example multi-drug resistant microor but are not limited to, alleviation of one or more symptoms, ganisms and/or gram-negative microorganisms. diminishment of extent of disease, Stabilized (e.g., not wors 0142. The term “release' or “released from the host cell ening) state of disease, delay or slowing of disease progres means that the expressed anti-amyloid peptide is moved to the Sion, amelioration or palliation of the disease state, and remis external of the bacterial cell. sion (whether partial or total), whether detectable or US 2012/03.01433 A1 Nov. 29, 2012
undetectable. In some embodiments, treating can refer to tenance. In some embodiments, an effective amount of the prolonging Survival as compared to expected Survival if not anti-amyloid peptide engineered bacteriophage to reduce or receiving treatment. Thus, one of skill in the art realizes that inhibit amyloid formation or maintenance, is an amount of a treatment may improve the disease condition, but may not anti-amyloid peptide engineered bacteriophage which be a complete cure for the disease. As used herein, the term decreases the amount of amyloid, or inhibiting the formation “treatment includes prophylaxis. Alternatively, treatment is of amyloid by a statistically significant amount as compared “effective' if the progression of a disease is reduced or halted. to in the absence of the anti-amyloid peptide engineered In some embodiments, the term “treatment can also mean peptide. The term “effective amount’ as used herein can also prolonging Survival as compared to expected Survival if not or alternately refer to that amount of composition comprising receiving treatment. Those in need of treatment include those an anti-amyloid peptide engineered bacteriophage necessary already diagnosed with a disease or condition, as well as those to achieve the indicated effect, i.e. a reduction of the amount likely to develop a disease or condition due to genetic sus of amyloid, as a non-limiting example, a reduction in the ceptibility or other factors which contribute to the disease or amount of curliformation by bacteria, by at least 5%, at least condition, Such as a non-limiting example, weight, diet and 10%, by at least 20%, by at least 30%, at least 35%, at least health of a subject are factors which may contribute to a 50%, at least 60%, at least 90% or any integer of a reduction subject likely to develop diabetes mellitus. Those in need of of the amount of amyloid (e.g. curli amount by a bacteria) in treatment also include Subjects in need of medical or Surgical 5% and 90% or more. As used herein, in some embodiments, attention, care, or management. The Subject is usually ill or the effective amount of an anti-amyloid peptide engineered injured, or at an increased risk of becoming ill relative to an bacteriophage as disclosed herein is the amount Sufficient to average member of the population and in need of Such atten inhibit the formation or inhibit the maintenance of amyloid, tion, care, or management. Evidence of treatment may be as a non-limiting example, an inhibition of the amount of curli clinical or Sub-clinical. In some embodiments, treatment is formation by bacteria, by at least 5%, at least 10%, by at least prophylactic treatment. Prophylactic treatment refers to com 20%, by at least 30%, at least 35%, at least 50%, at least 60%, plete or partial prevention of development of high ordered at least 90% or any integer of an inhibition of formation or aggregates, or prevention of a disease or disorder as a result of maintenance of amyloid (e.g. curliformation or maintenance amyloid formation. The methods as disclosed herein can be by a bacteria) in 5% and 90% or more. The “effective amount” used prophylatically, for example in instances where, a Sub or “effective dose” will, obviously, vary with such factors, in ject is susceptible for an amyloid related disorder, or likely to particular, the Strain of bacteria being treated, the strain of have amyloid formation, such as having or likely to have an bacteriophage being used, the genetic modification of the infection with a species of bacteria which forms a biofilm. For bacteriophage being used, the specific anti-amyloid peptide, example, microbial infections such as bacterial infections as well as the particular condition being treated, the physical Such those giving rise to biofilms can occur on any Surface condition of the subject, the type of subject being treated, the where sufficient moisture and nutrients are present. In some duration of the treatment, the route of administration, the type embodiments, preventive treatment can be used on a Surface of anti-amyloid peptide and/or enhancer of anti-amyloid pep of implanted medical devices, such as catheters, heart Valves tide, the nature of concurrent therapy (if any), and the specific and joint replacements. In particular, catheters are associated formulations employed, and the level of expression and level with infection by many biofilm forming organisms such as of secretion of the anti-amyloid peptide from the anti-amy Staphylococcus epidermidis, Staphylococcus aureus, loid peptide engineered bacteriophage components to each Pseudomonas aeruginosa, Enterococcus faecalis and Can other. The term “effective amount' when used in reference to dida albicans which frequently result in generalized blood administration of the compositions comprising an anti-amy stream infection. In a subject identified to have a catheter loid peptide engineered bacteriophage as disclosed herein to infected with bacteria, such as for example, a bacterial a Subject refers to the amount of the compositions to reduce or infected central venous catheter (CVC), the subject can have stop at least one symptom of the disease or disorder, for the infected catheter removed and can be treated by the meth example a symptom or disorder of the microorganism infec ods and compositions as disclosed herein comprising an engi tion, such as bacterial infection. For example, an effective neered bacteriophage and anti-amyloid peptide to eliminate amount using the methods as disclosed herein would be con the bacterial infection. Furthermore, on removal of the sidered as the amount Sufficient to reduce a symptom of the infected catheter and its replacement with a new catheter, the disease or disorder of the bacterial infection by at least 10% or Subject can also be administered the compositions compris more. An effective amount as used herein would also include ing engineered bacteriophages and anti-amyloid peptides as an amount Sufficient to prevent or delay the development of a disclosed hereinona prophylaxis basis to prevent re-infection symptom of the disease, alter the course of a symptom disease or the re-occurrence of the bacterial infection. Alternatively, a (for example but not limited to, slow the progression of a Subject can be administered the compositions as disclosed symptom of the disease), or reversea symptom of the disease. herein comprising engineered bacteriophages and anti-amy An effective amount as used herein also includes an amount loid peptides on a prophylaxis basis on initial placement of sufficient to inhibit the biofilm formation or bacterial infec the catheter to prevent any antimicrobial infection Such as a tion on a solid Surface or in a fluid sample. bacterial biofilm infection. The effect can be prophylactic in 0.148. As used herein, the term “pharmaceutically accept terms of completely or partially preventing a disease or sign able carrier” means a pharmaceutically acceptable material, or symptom thereof, and/or can be therapeutic in terms of a composition or vehicle. Such as a liquid or solid filler, diluent, partial or complete cure of a disease. excipient, solvent, Suspending agent or encapsulating mate 0147 As used herein, the term “effective amount” is rial, involved in carrying or transporting the Subject agents meant an amount of an anti-amyloid peptide engineered bac (i.e. anti-amyloid peptide engineered bacteriophages). The teriophage effective to yield a desired decrease in amyloid carrier can be liquid or solid and is selected with the planned amount, or a desired inhibition of amyloid formation or main manner of administration in mind. The carrier or excipient US 2012/03.01433 A1 Nov. 29, 2012
generally does not provide any pharmacological activity to rate of formation of, or the amount of amyloid. However, for the formulation, though it may provide chemical and/or bio avoidance of doubt, “inhibit” means statistically significant logical stability, release characteristics, and the like. Exem decrease in the amount of a targeted amyloid by at least about plary formulations can be found, for example, in Remington's 10% as compared to in the absence of an anti-amyloid pep Pharmaceutical Sciences, 19" Ed., Grennaro, A., Ed., 1995. tide, for example a decrease by at least about 20%, at least The carrier or excipient can be used to carry the anti-amyloid about 30%, at least about 40%, at least about 50%, or least peptide engineered bacteriophages from one organ, orportion about 60%, or least about 70%, or least about 80%, at least of the body, to another organ, or portion of the body. Each carrier must be “acceptable' in the sense of being compatible about 90% or more, up to and including a 100% inhibition, or with the other ingredients of the formulation and non injuri any decrease in the amount of amyloid between 10-100% as ous to the subject. The term “pharmaceutically acceptable compared to in the absence of an anti-amyloid peptide. carrier is used interchangeably with a “pharmaceutical car 0153. The terms “increased, “increase' or “enhance' or “activate” or “promote' are all used herein to generally mean rier'. an increase by a statically significant amount; for the avoid 0149. The terms “patient”, “subject” and “individual” are ance of any doubt, the terms “increased, “increase' or used interchangeably herein, and refer to an animal, particu "enhance' or “activate” means an increase of at least 10% as larly a human, to whom treatment including prophylaxis compared to a reference level, for example an increase of at treatment is provided. The term “subject' as used herein least about 20%, or at least about 30%, or at least about 40%, refers to human and non-human animals. The term “non or at least about 50%, or at least about 60%, or at least about human animals' and “non-human mammals' are used inter 70%, or at least about 80%, or at least about 90% or up to and changeably herein includes all vertebrates, e.g., mammals, including a 100% increase or any increase between 10-100% Such as non-human primates, (particularly higher primates), as compared to a reference level, or at least about a 2-fold, or sheep, dog, rodent (e.g. mouse or rat), guinea pig, goat, pig, at least about a 3-fold, or at least about a 4-fold, or at least cat, rabbits, cows, and non-mammals such as chickens, about a 5-fold or at least about a 10-fold increase, or any amphibians, reptiles etc. In one embodiment, the Subject is increase between 2-fold and 10-fold or greater as compared to human. In another embodiment, the Subject is an experimen a reference level. tal animal or animal Substitute as a disease model. Suitable mammals also include members of the orders Primates, 0154 The term “formation used herein refers an appear Rodenta, Lagomorpha, Cetacea, Homo sapiens, Carnivora, ance of protein aggregates, such as amyloid or amyloid-asso Perissodactyla and Artiodactyla. Members of the orders ciated aggregates. The term “formation' also means an Perissodactyla and Artiodactyla are included in the invention increase in the amount of amyloid aggregates. In some because of their similar biology and economic importance, embodiments, the term “formation” refers to an appearance for example but not limited to many of the economically of a biofilm caused by bacterial infection. It can also mean an important and commercially important animals such as goats, increase in the density or thickness of a biofilm. sheep, cattle and pigs have very similar biology and share 0155 The term “maintenance' used herein means keeping high degrees of genomic homology. the amount of protein aggregates such as amyloid or amyloid 0150. The term “gene' used herein can be a genomic gene associated aggregates at a constant level. In some embodi comprising transcriptional and/or translational regulatory ments, the term “maintenance” means preventing develop sequences and/or a coding region and/or non-translated ment of biofilm resulted from bacterial infection. sequences (e.g., introns, 5'- and 3'-untranslated sequences 0156 The term “biofilm' used herein refers to an aggre and regulatory sequences). The coding region of agene can be gation of microorganisms (e.g. bacteria) encapsulated in a a nucleotide sequence coding for an amino acid sequence or polymeric matrix, Such as amyloid plaque, and adherent to a functional RNA, such as tRNA, rRNA, catalytic RNA, each other and/or to a surface of the host. siRNA, miRNA and antisense RNA. A gene can also be an (O157. The term “nucleic acid” or “oligonucleotide' or mRNA or cDNA corresponding to the coding regions (e.g. "polynucleotide' used herein can mean at least two nucle exons and miRNA) optionally comprising 5'- or 3' untrans otides covalently linked together. As will be appreciated by lated sequences linked thereto. A gene can also be an ampli those in the art, the depiction of a single strand also defines the fied nucleic acid molecule produced in vitro comprising all or sequence of the complementary strand. Thus, a nucleic acid a part of the coding region and/or 5'- or 3'-untranslated also encompasses the complementary Strand of a depicted sequences linked thereto. single strand. As will also be appreciated by those in the art, 0151. The term “gene product(s) as used herein refers to many variants of a nucleic acid can be used for the same include RNA transcribed from a gene, or a polypeptide purpose as a given nucleic acid. Thus, a nucleic acid also encoded by a gene or translated from RNA. encompasses Substantially identical nucleic acids and 0152 The terms “lower”, “reduce”, “reduction', complements thereof. As will also be appreciated by those in “decrease”, “inhibit”, “disrupt”, or “eliminate” are all used the art, a single strand provides a probe for a probe that can herein generally to mean a decrease by a statistically signifi hybridize to the target sequence under Stringent hybridization cant amount. The terms “inhibit or “reduced' or “reduce” or conditions. Thus, a nucleic acid also encompasses a probe “decrease' or “disrupt” or "eliminate' as used herein gener that hybridizes under stringent hybridization conditions. ally means to inhibit or decrease the amount of protein aggre 0158 Nucleic acids can be single stranded or double gation by a statistically significant amount relative to in the Stranded, or can contain portions of both double Stranded and absence of an anti-amyloid peptide or anti-amyloid peptide single stranded sequence. The nucleic acid can be DNA, both engineered bacteriophage. The term “inhibition” or “inhibit” genomic and cDNA, RNA, or a hybrid, where the nucleic acid or “reduce when referring to the activity of an anti-amyloid can contain combinations of deoxyribo- and ribo-nucle peptide oran anti-amyloid peptide engineered bacteriophage otides, and combinations of bases including uracil, adenine, as disclosed herein refers to prevention of, or reduction in the thymine, cytosine, guanine, inosine, Xanthine hypoxanthine, US 2012/03.01433 A1 Nov. 29, 2012
isocytosine and isoguanine. Nucleic acids can be obtained by intramuscular, intraarterial, intrathecal, intraventricular, int chemical synthesis methods or by recombinant methods. racapsular, intraorbital, intracardiac, intradermal, intraperito 0159. A nucleic acid will generally contain phosphodi neal, transtracheal. Subcutaneous, Subcuticular, intraarticular, ester bonds, although nucleic acid analogs can be included Sub capsular, Subarachnoid, intraspinal, intracerebro spinal, that can have at least one different linkage, e.g., phosphora and intrasternal injection and infusion. The phrases “systemic midate, phosphorothioate, phosphorodithioate, or O-meth administration.” “administered systemically.” “peripheral ylphosphoroamidite linkages and peptide nucleic acid back administration” and “administered peripherally' as used bones and linkages. Other analog nucleic acids include those herein mean the administration of a compound, bacterioph with positive backbones; non-ionic backbones, and non-ri age, drug or other material other than directly into the central bose backbones, including those described in U.S. Pat. Nos. nervous system, Such that it enters the animal's system and, 5,235,033 and 5,034,506, which are incorporated by refer thus, is Subject to metabolism and other like processes, for ence. Nucleic acids containing one or more non-naturally example, Subcutaneous administration. occurring or modified nucleotides are also included within (0163 The term “tissue’ is intended to include intact cells, one definition of nucleic acids. The modified nucleotide ana blood, blood preparations such as plasma and serum, bones, log can be located for example at the 5'-end and/or the 3'-end joints, muscles, Smooth muscles, and organs. of the nucleic acid molecule. Representative examples of 0164. The term “vectors' is used interchangeably with nucleotide analogs can be selected from Sugar- or backbone “plasmid' to refer to a nucleic acid molecule capable of modified ribonucleotides. It should be noted, however, that transporting another nucleic acid to which it has been linked also nucleobase-modified ribonucleotides, i.e. ribonucle A vector can be a plasmid, bacteriophage, bacterial artificial otides, containing a non naturally occurring nucleobase chromosome or yeast artificial chromosome. A vector can be instead of a naturally occurring nucleobase Such as uridines a DNA or RNA vector. A vector can be either a self replicating or cytidines modified at the 5-position, e.g. 5-(2-amino)pro extrachromosomal vector or a vector which integrate into a pyl uridine, 5-bromo uridine; adenosines and guanosines host genome. Vectors capable of directing the expression of modified at the 8-position, e.g. 8-bromo guanosine; deaza genes and/or nucleic acid sequence to which they are opera nucleotides, e.g. 7 deaza-adenosine; O- and N-alkylated tively linked are referred to herein as “expression vectors'. In nucleotides, e.g. N6-methyl adenosine are suitable. The 2 general, expression vectors of utility in recombinant DNA OH group can be replaced by a group selected from H.O.R. techniques are often in the form of "plasmids” which refer to R. halo, SH, SR, NH, NHR, NR or CN, wherein R is C C6 circular double stranded DNA loops which, in their vector alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. Modifica form are not bound to the chromosome. Other expression tions of the ribose-phosphate backbone can be done for a vectors can be used indifferent embodiments of the invention, variety of reasons, e.g., to increase the stability and half-life for example, but are not limited to, plasmids, episomes, bac of such molecules in physiological environments or as probes teriophages or viral vectors, and Such vectors can integrate on a biochip. Mixtures of naturally occurring nucleic acids into the host's genome or replicate autonomously in the par and analogs can be made; alternatively, mixtures of different ticular cell. Otherforms of expression vectors known by those nucleic acid analogs, and mixtures of naturally occurring skilled in the art which serve the equivalent functions can also nucleic acids and analogs can be made. be used. Expression vectors comprise expression vectors for 0160 A “pharmaceutical composition” refers to a chemi stable or transient expression encoding the DNA. cal or biological composition, including anti-amyloid peptide 0.165. The terms “polypeptide' and “protein’ are used engineered bacteriophages or pro-amyloid peptide engi interchangeably herein. A "peptide' is a relatively short neered bacteriophages Suitable for administration to a mam polypeptide, typically between 2 and 60 amino acids in malian individual. Such compositions may be specifically length, e.g., between 5 and 50 amino acids in length. Polypep formulated for administration via one or more of a number of tides (typically over 60 amino acids in length) and peptides routes, including but not limited to, oral, parenteral, intrave described herein may be composed of standard amino acids nous, intraarterial, Subcutaneous, intranasal, Sublingual, (i.e., the 20 L-alpha-amino acids that are specified by the intraspinal, intracerebroVentricular, and the like. genetic code, optionally further including selenocysteine 0161. As used herein, the terms “administering, and and/or pyrrolysine). Polypeptides and peptides may comprise “introducing are used interchangeably and refer to the place one or more non-standard amino acids. Non-standard amino ment of an anti-amyloid peptide engineeredbacteriophage, or acids can be amino acids that are found in naturally occurring a pro-amyloid peptide engineered bacteriophage as disclosed polypeptides, e.g., as a result of post-translational modifica herein onto the surface infected by bacteria or into a subject, tion, and/or amino acids that are not found in naturally occur Such as a Subject which is at risk of an amyloid associated ring polypeptides. Polypeptides and peptides may comprise disorder as disclosed herein, by any method or route which one or more amino acid analogs known in the art can be used. results in at least partial localization of an anti-amyloid pep Beta-amino acids or D-amino acids may be used. One or more tide engineered bacteriophage at a desired site. The compo of the amino acids in a polypeptide or peptide may be modi sitions as disclosed herein can be administered by any appro fied, for example, by the addition of a chemical entity Such as priate route which results in the effective reduction or a carbohydrate group, a phosphate group, a fatty acid group, inhibition of the growth of the bacteria. Administration also a linker for conjugation, functionalization, etc. A polypeptide refers to placement of an anti-amyloid peptide engineered that has a non-polypeptide moiety covalently or non-co bacteriophage or pro-amyloid peptide engineered bacte valently associated may still be referred to as a “polypeptide'. riophage on a surface, or in a fluid sample, e.g. water. Polypeptides may be purified from natural sources, produced 0162 The term “parenteral administration' and “admin in vitro or in vivo in Suitable expression systems using recom istered parenterally as used herein means modes of admin binant DNA technology, synthesized through chemical istration other than enteral and topical administration, usually means Such as conventional Solid phase peptide synthesis by injection, and includes, without limitation, intravenous, and/or using methods involving chemical ligation of synthe US 2012/03.01433 A1 Nov. 29, 2012 20 sized peptides. The term “polypeptide sequence' or “peptide naturally occurring polypeptide. In some embodiments, not sequence' or "amino acid sequence' as used herein can refer more than 1%. 5%, 10%, or 20% of the amino acids in a to the polypeptide material itselfor the peptide material itself peptide, polypeptide or fragment thereofare insertions, dele and/or to the sequence information (i.e. the Succession of tions, or Substitutions relative to the original polypeptide. In letters or three letter codes used as abbreviations for amino Some embodiments, guidance in determining which amino acid names) that biochemically characterizes a polypeptide. acid residues may be replaced, added, or deleted without Polypeptide sequences herein are presented in an N-terminal eliminating or Substantially reducing activities of interest, to C-terminal direction unless otherwise indicated. may be obtained by comparing the sequence of the particular 0166 The term “analog as used herein refers to a com polypeptide with that of orthologous polypeptides from other position that retains the same structure or function (e.g., bind organisms and avoiding sequence changes in regions of high ing to a receptor) as a polypeptide or nucleic acid herein. conservation or by replacing amino acids with those found in Examples of analogs include peptidomimetics, peptide orthologous sequences since amino acid residues that are nucleic acids, Small and large organic or inorganic com conserved among various species may more likely be impor pounds, as well as derivatives and variants of a polypeptide or tant for activity than amino acids that are not conserved. nucleic acid herein. The term “analog as used herein of 0.168. The term “derivative” as used herein refers to pep anti-amyloid peptide, such as an anti-amyloid peptide immu tides which have been chemically modified by techniques nogens as disclosed herein, for example SEQID NOs: 11-18 Such as adding additional side chains, ubiquitination, label and 27-90 or any peptide derived from SEQ ID NO:1 or 2 ing, pegylation (derivatization with polyethylene glycol), and refers to a molecule similar in function to either the entire insertion, deletion or Substitution of amino acids, including molecule of a fragment thereof. The term “analogue' is insertion, deletion and Substitution of amino acids and other intended to include allelic, species and variants. Analogs molecules (such as amino acid mimetics or unnatural amino typically differ from naturally occurring peptides at one or a acids) that do not normally occur in the peptide sequence that few positions, often by virtue of conservative substitutions. is basis of the derivative, for example but not limited to Analogs typically exhibit at least 80 or 90% sequence identity insertion of ornithine which do not normally occur in human with the natural peptides or the peptide sequence they are an proteins. The term "derivative' is also intended to encompass analogue of. In some embodiments, analogs also include all modified variants of the anti-amyloid peptide, variants, unnatural amino acids or modifications of N or C terminal functional derivatives, analogues and fragments thereof, as amino acids. Examples of unnatural amino acids are acedis well as peptides with substantial identity as compared to the ubstituted amino acids, N-alkyl amino acids, lactic acid, reference peptide to which they refer to. The term derivative 4-hydroxyproline, Y-carboxyglutamate, e-N.N.N-trimethyll is also intended to encompassaptamers, peptidomimetics and ysine, e-N-acetyllysine, O-phosphoserine, N-acetylserine, retro-inverso peptides of the reference peptide to which it N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, refers to. Amino acid Substitutions include alterations in 8-N-methylarginine. Fragments and analogs can be screened which an amino acid is replaced with a different naturally for prophylactic or therapeutic efficacy or ability to inhibit or occurring or a non-conventional amino acid residue. Such reduce maintenance of amyloid formation as described herein substitutions may be classified as “conservative', in which in the Examples. The terms “analogs' and “analogues' are case an amino acid residue contained in a polypeptide is used interchangeably herein. replaced with another naturally occurring amino acid of simi 0167. The term “variant' as used herein refers to any lar character either in relation to polarity, side chain function polypeptide or peptide differing from a naturally occurring ality or size. polypeptide by amino acid insertion(s), deletion(s), and/or 0169. Substitutions encompassed by the present invention Substitution(s), created using, e.g., recombinant DNA tech may also be “non conservative', in which an amino acid niques. In some embodiments amino acid “Substitutions are residue which is present in a peptide is substituted with an the result of replacing one amino acid with another amino amino acid having different properties. Such as naturally acid having similar structural and/or chemical properties, i.e., occurring amino acid from a different group (e.g., Substitut conservative amino acid replacements. “Conservative' ing a charged or hydrophobic amino; acid with alanine), or amino acid Substitutions may be made on the basis of simi alternatively, in which a naturally-occurring amino acid is larity in any of a variety or properties Such as side chain size, Substituted with a non-conventional amino acid. In some polarity, charge, Solubility, hydrophobicity, hydrophilicity, embodiments amino acid Substitutions are conservative. and/or amphipathicity of the residues involved. For example, 0170 A “retro-inverso peptide' refers to a peptide with a the non-polar (hydrophobic) amino acids include alanine, reversal of the direction of the peptide bond on at least one leucine, isoleucine, Valine, glycine, proline, phenylalanine, position, i.e., a reversal of the amino- and carboxy-termini tryptophan and methionine. The polar (hydrophilic), neutral with respect to the side chain of the amino acid. Thus, a amino acids include serine, threonine, tyrosine, asparagine, retro-inverso analogue has reversed termini and reversed and glutamine. The positively charged (basic) amino acids direction of peptide bonds while approximately maintaining include arginine, lysine and histidine. The negatively charged the topology of the side chains as in the native peptide (acidic) amino acids include aspartic acid and glutamic acid. sequence. The retro-inverso peptide can contain L-amino In some embodiments cysteine is considered a non-polar acids or D-amino acids, or a mixture of L-amino acids and amino acid. In some embodiments insertions ordeletions may D-amino acids, up to all of the amino acids being the D-iso range in size from about 1 to 20 amino acids, e.g., 1 to 10 mer. Partial retro-inverso peptide analogues are polypeptides amino acids. In some instances larger domains may be in which only part of the sequence is reversed and replaced removed without substantially affecting function. In certain with enantiomeric amino acid residues. Since the retro-in embodiments, the sequence of a variant can be obtained by Verted portion of Such an analogue has reversed amino and making no more than a total of 1, 2, 3, 5, 10, 15, or 20 amino carboxyl termini, the amino acid residues flanking the retro acid additions, deletions, or Substitutions to the sequence of a inverted portion are replaced by side-chain-analogous C-Sub US 2012/03.01433 A1 Nov. 29, 2012 stituted geminal-diaminomethanes and malonates, respec the term “consisting essentially of refers to those elements tively. Retro-inverso forms of cell penetrating peptides have required for a given embodiment. The term permits the pres been found to work as efficiently in translocating across a ence of elements that do not materially affect the basic and membrane as the natural forms. Synthesis of retro-inverso novel or functional characteristic(s) of that embodiment of peptide analogues are described in Bonelli, F. et al., IntJ Pept the invention. Protein Res. 24(6):553-6 (1984); Verdini, A. and Viscomi, G. 0176). As used herein the term “consisting essentially of C. J. Chem. Soc. Perkin Trans. 1:697-701 (1985); and U.S. refers to those elements required for a given embodiment. The Pat. No. 6,261,569, which are incorporated herein in their term permits the presence of additional elements that do not entirety by reference. Processes for the solid-phase synthesis materially affect the basic and novel or functional character of partial retro-inverso peptide analogues have been istic(s) of that embodiment of the invention. described (EP97994-B) which is also incorporated herein in 0177. The term “consisting of refers to compositions, its entirety by reference. methods, and respective components thereof as described 0171 As used herein, the terms “homologous' or “homo herein, which are exclusive of any element not recited in that logues' are used interchangeably, and when used to describe description of the embodiment. a polynucleotide or polypeptide, indicates that two poly 0.178 The term “statistically significant’ or “signifi nucleotides or polypeptides, or designated sequences thereof, cantly refers to statistical significance and generally means a when optimally aligned and compared, for example using two standard deviation (2 SD) below normal, or lower, BLAST, version 2.2.14 with default parameters for an align amount of the amyloid aggregates or incidence of biofilm ment (see herein) are identical, with appropriate nucleotide formation caused by bacteria infection. The term refers to insertions or deletions or amino-acid insertions or deletions, statistical evidence that there is a difference. It is defined as in at least 70% of the nucleotides or amino acid residues, the probability of making a decision to reject the null hypoth usually from about 75% to 99%, and more preferably at least esis when the null hypothesis is actually true. The decision is about 98 to 99% of the nucleotides or amino acid residues. often made using the p-value. The term “homolog’ or “homologous' as used herein also 0179. Other than in the operating examples, or where oth refers to homology with respect to structure and/or function. erwise indicated, all numbers expressing quantities of ingre With respect to sequence homology, sequences are homologs dients or reaction conditions used herein should be under if they are at least 50%, at least 60 at least 70%, at least 80%, stood as modified in all instances by the term “about.” The at least 90%, at least 95% identical, at least 97% identical, or term “about when used in connection with percentages can at least 99% identical. Determination of homologs of the meant 1%. genes or peptides of the present invention can be easily ascer 0180. The contents of all references cited throughout this tained by the skilled artisan. Homologous sequences can be application, as well as the figures and tables are incorporated the same functional gene in different species. herein by reference. 0172. The term “substantial identity” as used herein refers 0181. It should be understood that this invention is not to two peptide sequences, when optimally aligned. Such as by limited to the particular methodology, protocols, and the programs GAP or BESTFIT using default gap weights, reagents, etc., described herein and as Such can vary. The share at least about 65%, at least about 70%, at least about terminology used herein is for the purpose of describing 80%, at least about 90% sequence identity, at least about 95% particular embodiments only, and is not intended to limit the sequence identity or more (e.g., 99% sequence identity or scope of the present invention, which is defined solely by the higher). In some embodiments, residue positions which are claims. not identical differ by conservative amino acid substitutions. 0173 A glycoprotein’ as use herein is protein to which at Anti-Amyloid Peptides and Pro-Amyloid Peptides least one carbohydrate chain (oligopolysaccharide) is 0182 Some aspects of the invention encompasses an anti covalently attached. A "proteoglycan as used herein is a amyloid peptide engineered bacteriophage which express at glycoprotein where at least one of the carbohydrate chains is least one anti-amyloid peptide that inhibit amyloid aggrega a glycosaminoglycan, which is a long linear polymer of tion or express at least one variant of anti-amyloid peptides repeating disaccharides in which one member of the pair that inhibits amyloid aggregation. usually is a Sugar acid (uronic acid) and the other is an amino 0183) One aspect of the present invention relates to anti Sugar. amyloid peptide engineered bacteriophages which express at 0.174. The articles “a” and “an are used herein to refer to least one anti-amyloid peptide whose sequence comprises or one or to more than one (i.e., at least one) of the grammatical consists of a fragment of the sequence of a naturally occurring object of the article. By way of example, “an element’ means bacterial CsgA polypeptide or a CsgB polypeptide, and com one element or more than one element. Thus, in this specifi positions and uses thereof. In another aspect, the present cation and the appended claims, the singular forms 'a'an.” invention relates to anti-amyloid peptide engineered bacte and “the include plural references unless the context clearly riophages which express at least one anti-amyloid peptide dictates otherwise. Thus, for example, reference to a pharma whose sequence comprises or consists of a variant of a frag ceutical composition comprising “an agent' includes refer ment of the sequence of a naturally occurring bacterial CsgA ence to two or more agents. polypeptide or a CsgB polypeptide, and compositions and 0.175. As used herein, the term “comprising means that uses thereof. other elements can also be present in addition to the defined 0184. In another aspect, the present invention relates to elements presented. The use of "comprising indicates inclu anti-amyloid peptide engineered bacteriophages which sion rather than limitation. The term “consisting of refers to express at least one anti-amyloid peptide whose sequence compositions, methods, and respective components thereof comprises or consists of a fragment of the sequence of a as described herein, which are exclusive of any element not variant of a CsgA polypeptide or a variant of a CsgB polypep recited in that description of the embodiment. As used herein tide, and compositions and uses thereof. US 2012/03.01433 A1 Nov. 29, 2012 22
0185. Such amyloid peptide, e.g., an anti-amyloid peptide 0187. In nature, curli are assembled by a process in which or a pro-amyloid peptide expressed by an anti-amyloid pep the major curli Subunit polypeptide, CsgA, is nucleated into a tide engineered bacteriophages or pro-amyloid peptide may fiber by the minor curli subunit polypeptide, CsgB.CsgA and bind to a polypeptide, e.g., a CsgA polypeptide, and where the CsgB are about 30% identical at the amino acid level and amyloid peptide is a anti-amyloid peptide, prevent the CsgA contain five-fold internal symmetry characterized by con polypeptide from being added to a growing aggregate or the served polar residues. The assembly process is believed to anti-amyloid peptide can bind to polypeptides within a grow involve addition of soluble polypeptides to the growing fiber ing aggregate and thereby inhibit binding of additional tip. Thus both subunits are incorporated into the fiber, polypeptides to the aggregate. An anti-amyloid peptide although CsgA is the major protein constituent and CsgB is expressed by the bacteriophage is a moiety that inhibits or the nucleating polypeptide. Sequences of CsgA and CsgB disrupts aggregate formation, e.g., fiber assembly. In alterna from a large number of bacteria have been identified. Exem tive embodiments, where the amyloid peptide is a pro-amy plary CsgA and CsgB amino acid sequences are shown in loid peptide, the pro-amyloid peptide promotes addition of FIGS. 4A (SEQID NO: 1) and 5A (SEQID NO: 2), respec the CsgA polypeptide to a growing aggregate or the pro tively. One of skill in the art will readily be able to find CsgA amyloid peptide can bind to polypeptides within a growing and CsgB sequences by searching databases Such as Gen aggregate and thereby increase the occurance of binding of Bank publicly available through the National Center for Bio additional polypeptides to the aggregate. A pro-amyloid pep technology Information (NCBI) (see ncbi.nlm.nih.gov), and tide expressed by the bacteriophage is a moiety that increases they are encompassed for use in generating anti-amyloid aggregate formation, e.g., increases fiber assembly. peptides to inhibit curliformation in the methods and bacte 0186. In some embodiments, an anti-amyloid peptide riophages as disclosed herein. engineered bacteriophage as disclosed herein expresses an 0188 The present invention is based in part on the discov anti-amyloid peptide which inhibits amyloid formation on ery that small peptides of bacterial CsgB can be used to inhibit biofilms, where for example, the anti-amyloid is derived curli fiber formation. Further, it was found that these from, or is a modified version of a peptide derived from a sequence elements mimic the in Vivo assembly of curli fibers polypeptide that promotes the formation of a biofilm. In some in that, peptides whose sequence is found within the sequence embodiments, an anti-amyloid peptide engineered bacte of CsgB or CsgA efficiently nucleated assembly of CsgA into riophage as disclosed herein expresses an anti-amyloid pep amyloid. As described in the Examples, specific peptides tide derived from a first or a second amyloidogenic polypep within E. coli CsgB and CsgA inhibited amyloid fiberforma tide, where the first and second amyloidogenic polypeptides tion when they were expressed on the surface of bacterioph are at least 70%, 80%, 85%, 90%, or 95% identical to ages. Accordingly, the inventors demonstrated that short pep polypeptides that assemble to form amyloids present in bio tide portions of bacterial biofilm forming proteins bind films e.g., bacterial polypeptides that assemble to form amy directly to full length polypeptides and inhibit form higher loid fibers such as curli. Curli are the major proteinaceous order aggregates, e.g., fibrils. Notably, the results demon component of a complex extracellular matrix produced by strate that specific anti-amyloid peptides can be expressed by many bacteria, e.g., many Enterobacteriaceae such as E. coli a bacteriophage and effectively used to inhibit amyloid fiber and Salmonella spp. (Barnhart MM, Chapman M. R. Annu assembly. These anti-amyloid peptide engineered bacte Rey Microbiol., 60:131-47, 2006). Other biofilm-forming riophages, compositions comprising the anti-amyloid peptide bacteria of interest include Klebsiella, Pseudomonas, Entero engineeredbacteriophages, and uses thereofare aspects of the bacter, Serratia, Citrobacter; Proteus, Yersinia, Citrobacter, invention. Shewanella, Agrobacter, Campylobacter, etc. Curli fibers are 0189 The invention also provide a plurality of different involved in adhesion to Surfaces, cell aggregation, and biofilm anti-amyloid peptide engineered bacteriophages, and related formation. Curlialso mediate host cell adhesion and invasion, compositions and methods disclosed herein, wherein anti and they are potent inducers of the host inflammatory amyloid peptide engineered bacteriophages expresses at least response. Curli exhibit structural and biochemical properties one CsgB peptide and/or at least one CsgA peptide, as those of amyloids, e.g., they are nonbranching, B-sheet rich fibers terms are defined herein. that are resistant to protease digestion and denaturation by 1% 0190. In some embodiments, an anti-amyloid peptide SDS and bind to amyloid-specific moieties such as thioflavin engineered bacteriophage expresses at least one CsgA pep T, which fluoresces when bound to amyloid, and Congo red, tide, which is a peptide whose sequence comprises a portion which produces a unique spectral pattern (“red shift’) in the of a CsgA polypeptide sequence (SEQ ID NO:1) and/or presence of amyloid. Polypeptides that assemble to form curli expresses at least one CsgB peptide, which is a peptide whose are of interest at least in part because of their association with sequence comprises a portion of CsgB polypeptide sequence animal and human disease. Bacterial polypeptides that pro (SEQ ID NO: 2). Examples of such peptide are listed in mote formation of biofilms present in a variety of natural Tables 3 (SEQ ID NO: 11-18) and 4 respectively (SEQ ID habitats are also of interest. For example, in a recent study NO: 27-34). Examples of variants of CsgA peptides include, bacteria producing extracellular amyloid adhesins were iden but are not limited to SEQ ID NO:35-58, and examples of tified within several phyla: Proteobacteria (Alpha-, Beta-, variants of CsgB peptides include, but are not limited to SEQ Gamma- and Deltaproteobacteria), Bacteriodetes, Chlorof ID NO: 59-90, as disclosed in Table 5. lexi and Actinobacteria (Larsen, P., et al., Environ Microbiol. 0191 In certain embodiments, in addition to a portion of a 9(12):3077-90, 2007). Particularly in drinking water bio CsgA or CsgB polypeptide sequence, a CsgA peptide and/or films, a high number of amyloid-positive bacteria were iden CsgB peptide can further comprise one or more additional tified. Bacteria of interest may be gram-negative or gram amino acids, e.g., one or more alanine or lysine residues (e.g., positive. In some embodiment bacteria of interest are rods. In a double alanine tag, a double lysine tag, etc.), which may be Some embodiments they are aerobic. In some embodiments located at the N- or C-terminus of the portion of the CsgA or they are facultative anaerobes or anaerobes. CsgB sequence. Without limitation, such additional residues US 2012/03.01433 A1 Nov. 29, 2012
may be useful for expression and/or secretion of the anti shown in FIG. 8A. In other embodiments, an anti-amyloid amyloid peptide (i.e. CsgA and/or CsgB peptide) or attaching peptide engineered bacteriophage encodes at least one anti the anti-amyloid peptides (i.e. CsgA and/or CsgB peptide) to amyloid peptide, wherein the anti-amyloid peptide is derived the Surface of the bacteriophage. Examples of Such variant from any polypeptide listed in FIG.8B or 8C, or any fragment CsgA peptides and CsgB peptide which can be expressed by of a protein involved in biofilm formation as shown in FIG. the bacteriophage are listed in Table 5 (SEQID NO:35-90). 8B or 8C. 0.192 In some embodiments, a CsgA peptide and/or CsgB 0200. In addition to CsgA and CsgB, curliformation likely peptide can comprise a portion of a CsgA or CsgB polypep involves activities of several additional polypeptides encoded tide where at least one amino acid is modified (i.e. substituted by other Csg genes (CsgD, CsgE, CsgF, CsgG) in living or added or deleted). Without limitation, such modified amino bacteria, but these polypeptides are not required for curli acids enhance the efficacy of the anti-amyloid peptide to formation in vitro. Thus, in Some embodiments, an anti-amy inhibit the formation or maintenance of amyloids. Examples loid peptide engineered bacteriophage can encode at least a of such variant CsgA peptides and CsgB peptide which can be fragment of a different Csg polypeptide selected from the expressed by the bacteriophage are listed in Table 5 (SEQID group comprising CsgD, CsgR, CsgF and CsgG polypep NO:35-90). tides. 0193 In some embodiments an anti-amyloid peptide engi 0201 The invention also provides a composition compris neered bacteriophage encodes at least one anti-amyloid pep ing at least one anti-amyloid peptide engineered bacterioph tide. Such as a CsgA peptide ora CsgB peptide, where a CsgA age expressing at least one CsgA peptide and/or at least one peptide is selected from SEQID NOs: 11-18 or SEQID NOs: CsgB peptide as disclosed herein. 35-58 or variants or modified variants thereof, and a CsgB 0202 The invention provides compositions comprising at peptide is selected from SEQID NOS: 27-34 or SEQID NOs: least one anti-amyloid peptide engineered bacteriophage 59-90, or variants or modified variants thereof. expressing any of the foregoing CsgA peptides or CsgB pep 0194 In some embodiments an anti-amyloid peptide engi tides. neered bacteriophage encodes at least one anti-amyloid pep 0203 FIGS. 4A and 5A show certain CsgA and CsgB tide. Such as a CsgA peptide ora CsgB peptide, where a CsgA sequences of use in the present invention and accession num peptide is selected from the group of SEQID NOs: 83 to 130, bers thereof. Anti-amyloid peptides encompassed to be or variants or modified variants thereof. expressed by the anti-amyloid peptide engineered bacte 0.195. In some embodiments an anti-amyloid peptide engi riophages comprise or consist of these amino acid sequences neered bacteriophage encodes at least one anti-amyloid pep or portions thereof which are capable of nucleating aggrega tide. Such as a CsgA peptide ora CsgB peptide, where a CsgA tion of CsgA. It will be appreciated that peptides of interest peptide is selected from any of the group of SEQID NOs: 12, can, in certain embodiments, encompass the minimal nucle 16, 52 or 53 and the CsgB peptide is selected from any of SEQ ating sequences and additional sequences on one or both ID NOs: 29, 33 or 61-65. ends. 0196. In some embodiments an anti-amyloid peptide engi 0204 Exemplary CsgB peptides to be expressed by an neered bacteriophage encodes at least one anti-amyloid pep anti-amyloid peptide engineered bacteriophage have a tide. Such as a CsgA peptide ora CsgB peptide, where a CsgA sequence that comprises or consists of a sequence falling peptide is selected from the CsgA III class of peptides (SEQ within amino acids 50-90 or 120-160 of E. coli CsgB, or ID NO: 52-53), or from the CsgAIIb class of peptides (SEQ within the corresponding amino acids within CsgB from ID NOS:35, 36,39-41, 45, 49-51), or from the CsgAIIa class other bacterial species. Exemplary CsgB peptide sequences of peptide (SEQID NO: 11 and 12) or from the CsgAI class includeamino acids 55-75 or 125-155 of CsgB, or a portion of of peptides (SEQID NOs: 42, 44, 46, 57 and 58). the afore-mentioned sequences. Specific examples of 25 0197) In some embodiments an anti-amyloid peptide engi amino acid CsgB peptides include, e.g., peptides having the neered bacteriophage encodes at least one anti-amyloid pep sequence of amino acids 57-81, 58-82, 59-83, 60-84, 61-85, tide. Such as a CsgA peptide ora CsgB peptide, where a CsgA 62-86, 63-87, 125-149, 126-150, 127-151, 128-152, 129-153, peptide is selected from selected from the CsgBIII class of 130-154, etc., of CsgB. Specific examples of 23 amino acid peptides (SEQID NOs: 61-65) or from the CsgBIIb class of CsgB peptides include, e.g., peptides having the sequence of peptides (SEQID NOs: 59, 60, 69, 75,81,93 and 94) or from amino acids 58-80, 59-81, 60-82, 61-83, 62-84, 63-87, 127 the CsgBIIa class of peptides (SEQID NO: 29) or from CsgBI 149, 128-150, 129-151, 130-152, 131-153, 132-154, etc., of class of peptides (SEQ ID NOs: 66-68 and 70-72). CsgB. Specific examples of 22 amino acid CsgB peptides 0198 In a preferred embodiment, an anti-amyloid peptide include, e.g., peptides having the sequence of amino acids engineered bacteriophage encodes at least one anti-amyloid 59-80, 60-81, 61-82, 62-83, 129-150, 130-151,131-152, etc., peptide. Such as a CsgA peptide or a CsgB peptide, where a of CsgB. Specific examples of 21 amino acid CsgB peptides CsgA peptide is selected from the CsgAIII group of peptides include, e.g., peptides having the sequence of amino acids (SEQ ID NO: 52, 53) or CsgBIII peptides (SEQ ID NOs: 59-79, 60-80, 61-81, 62-82, 129-149, 130-150, 131-151, etc., 61-65). of CsgB. Specific examples of 20 amino acid CsgB peptides 0199. In some embodiments an anti-amyloid peptide engi include, e.g., peptides having the sequence of amino acids neered bacteriophage encodes at least one anti-amyloid pep 60-79, 61-80, 62-81, 130-149, 131-150, etc., of CsgB tide, wherein the anti-amyloid peptide comprises a fragment polypeptide. of at least 5, or at least 6 or at least 7 concecutive amino acids 0205 The following CsgB peptides to be expressed by a from SEQID NO: 1 or SEQID NO: 2. In other embodiments, bacteriophage are exemplary: (i) LROGGSKLLAVVA an anti-amyloid peptide engineered bacteriophage encodes at QEGSSNRAK (SEQID NO: 202)(CsgB 60-81); (ii) GTQK least one anti-amyloid peptide, wherein the anti-amyloid pep TAIVVQRQSQMAIRVT (SEQ ID NO: 250) (CsgB 130 tide is derived from any of SEQID NOs: 61, 62, 63, 64 or 65, 149). In some embodiments a peptide comprises at least or any fragment of a protein involved in biofilm formation as AIVVQ (SEQ ID NO: 228) and, optionally, one or more US 2012/03.01433 A1 Nov. 29, 2012 24 additional amino acids found in CsgB at locations N- or “fibrils.” or “prions.” It will be understood than many proteins C-terminal to AIVVO. In some embodiments a peptide com that will self-coalesce into higher-ordered aggregates can prises at least LAVVAQ (SEQID NO:220) and, optionally, 1, exist in at least two conformational states, only one of which 2, 3, 4, 5, 6, or more additional amino acids found in CsgB at is typically found in the ordered aggregates or fibrils. The locations N- or C-terminal to LAVVAQ (SEQID NO: 220), term “self-coalesces’ refers to the property of the polypeptide i.e., the peptide could be extended in either or both directions. such as those described herein or known in the art to form For example, one such peptide is GGSKLLAVVAQEGSSN ordered aggregates with polypeptides having an identical (SEQ ID NO: 221). Peptides can comprise KLLAVVAQE amino acid sequence under appropriate conditions and is not (SEQ ID NO: 222) or KTAIVVQR (SEQ ID NO: 223) and, intended to imply that the coalescing will naturally occur optionally, one or more additional amino acids found in CsgB under every concentration or every set of conditions. at locations N- or C-terminal to such peptides, i.e., the peptide 0209. In certain embodiments the polypeptide is not could be extended in either or both directions by, for example, Sup35 or a region thereof at least 40 amino acids long, e.g., 1, 2, 3, 4, 5, or 6 amino acids. For example, one such peptide the N. M. or NM domain. In some embodiments the polypep is TQKTAIVVQRQSQMAIR (SEQ ID NO: 224). In some tide is not SEQ ID NO: 131 of PCT/US2006/022460 (WO embodiments a peptide is between 5 and 25 amino acids long, 2006/135738). In certain embodiments the peptides are not e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 176, 18, 19, 20, 21, derived from the foregoing polypeptides. 22, 23, 24, or 25 amino acids long. 0210. In other embodiments, an anti-amyloid peptide 0206. It will be appreciated that SEQID NOs: 1 and 2 are engineered bacteriophage can comprise a portions of a found in certain E. coli strains. Minor differences may be polypeptide that is prone to aggregation under appropriate encountered in other E. coli strains or in CsgA and CsgB conditions (i.e. an “aggregation-prone') polypeptide. In one polypeptides from different bacterial genera. Peptides that are embodiment, the aggregation-prone polypeptide is a yeast or orthologs of the afore-mentioned peptides (SEQID NOs: 12, fungal prion protein. In another embodiment, the aggrega 16, 27-34 or SEQID NO:52, 53, and 61-65) in any particular tion-prone polypeptide is a mammalian prion protein. In bacterial strain, species, genus, or family are encompassed to another embodiment, the aggregation-prone polypeptide is be expressed by the anti-amyloid peptide engineered bacte any polypeptide knownto self-aggregate in vitro or in vivo. In riophage. One of skill in the art will be able to identify such one embodiment the polypeptide is any polypeptide that orthologs based on sequence comparisons. Also provided are forms amyloid. In one embodiment the polypeptide is any variants of any of the afore-mentioned peptides (SEQID NO: polypeptide wherein aggregates formed from the polypeptide 11-18, 27-90). In some embodiments, a variant of a particular and/or from fragments of the polypeptide play a role in dis CsgA peptide or CsgB peptide may have 1, 2, or 3 amino acid CaSC. Substitutions, additions, and/or deletions relative to the origi 0211 Polypeptides and diseases of interest include amy nal peptide. In some embodiments a Substitution is a conser loid B protein, associated with Alzheimer's disease; immuno Vative Substitution. In some embodiments a polar or hydro globulin light chain fragments, associated with primary sys philic amino acid is added or substituted. Optionally the temic amyloidosis; serum amyloid A fragments, associated peptides further comprise a tag, detectable moiety, etc. CsgA with secondary systemic amyloidosis; transthyretin and tran and/or CsgB peptides may be tested using the methods sthyretin fragments, associated with senile systemic amyloi described herein in the Examples to select those CsgA and/or dosis and familial amyloid polyneuropathy I; cystatin C frag CsgB peptides or variants or orthologs thereof that may be ments, associated with hereditary cerebral amyloid preferable for use in inhibiting amyloid formation or inhibi angiopathy. B2-microglobulin, associated with hemodialy tion of protein aggregation in a Subject. The optimal CsgA sis-related amyloidosis; apolipoprotein A-I fragments, asso and/or CsgB peptide may differ depending on various factors ciated with familial amyloid polyneuropathy II; a 71 amino such as the subject to be treated, the particular bacteria, or the acid fragment of gelsolin, associated with Finnish hereditary type of amyloid formation, etc. systemic amyloidosis; islet amyloid polypeptide fragments, 0207 Each of the CsgA and/or CsgB peptides as described associated with Type II diabetes; calcitonin fragments, asso herein is encompassed for expression by an anti-amyloid ciated with medullary carcinoma of the thyroid; prion protein peptide engineered bacteriophage. In some embodiments an and fragments thereof, associated with spongiform encepha anti-amyloid peptide engineered bacteriophage expresses at lopathies; atrial natriuretic factor, associated with atrial amy least one CsgA and/or CsgC and/or CsgD and/or CsgE and/or loidosis; lysozyme and lysozyme fragments, associated with CsgF, and/or CsgB peptide. hereditary non-neuropathic systemic amyloidosis; insulin, 0208. Other anti-amyloid peptides are encompassed for associated with injection-localized amyloidosis; and fibrino use in anti-amyloid peptide engineered bacteriophages as gen fragments, associated with hereditary renal amyloidosis. disclosed herein. For example, without limitation, such anti The polypeptide which can be used to derive an anti-amyloid amyloid peptides include those disclosed in WO2008/ peptide can be a full length polypeptide or a fragment thereof 033451, which is incorporated herein by reference. In other that self-assembles to form an aggregate. embodiments, amino acid sequences which can be used to 0212. Otheranti-amyloid peptides to be expressed by anti derive anti-amyloid peptides include Self-Coalesces into amyloid peptide engineered bacteriophages as disclosed Higher-Ordered AggreCates (SCHAG) sequences as that herein can be derived from any amyloid protein or polypep term is used in U.S. Ser. No. 11/004,418, which is incorpo tide or any polypeptide which makes up a high ordered aggre rated herein by reference. By “SCHAGamino acid sequence' gate as that term is defined herein. For example, high ordered is meant any amino acid sequence which, when included as aggregates which can be used to derived anti-amyloid pep part or all of the amino acid sequence of a protein, can cause tides to be expressed by an anti-amyloid peptide engineered the protein to coalesce with like proteins into higher ordered bacteriophages as disclosed include polypeptides such as aggregates commonly referred to in Scientific literature by Sup35 proteins, Ure2 proteins, New 1 proteins, Rnd1 pro terms such as "amyloid, "amyloid fibers.” “amyloid fibrils.” teins, mammalian prion proteins, amyloid precursor protein, US 2012/03.01433 A1 Nov. 29, 2012
AB40, AB42, immunoglobulin (Ig) light chain, serum amyoid tide sequence, e.g., 30-100%, 40-100%, 50-100%, 60-100%, A, wildtype or variant transthyretin, lysozyme, Bn., cyStatin 70-100%, 80-100%, or 90-100% of the total sequence. C, B2-microglobulin, apoliprotein A1, gelsolin or a mutant 0219. A plurality of anti-amyloid peptide engineered bac thereof, lactotransferrin, islet amyloid polypeptide, fibrino teriophage, or pro-amyloid peptide engineered bacteriophage gen, prolactin, insulin, calcitonin, atrial natriuretic factor, can comprise, e.g., up to 10, 50, 100, 150, 200, 250, or more C-synuclein, Huntingtin, Superoxide dismutase, or C.1-chy different amyloid peptides, e.g., an anti-amyloid peptide or a motrypsin. pro-amyloid peptides. Collectively and as an illustrative example only, in various embodiments, anti-amyloid pep 0213. One of skill in the art will readily be able to identify tides of a plurality of different anti-amyloid peptide engi the full length sequences of these or any other aggregation neered bacteriophages can encompass between 20-100% of a prone polypeptide which can be used to derive an anti-amy total polypeptide sequence, e.g., 30-100%, 40-100%, loid peptide to be expressed by an anti-amyloid peptide engi 50-100%, 60-100%, 70-100%, 80-100%, or 90-100% of a neered bacteriophages as disclosed herein by reference to polypeptide sequence from which the anti-amyloid peptides public databases as well as the Scientific and patent literature. encoded by an anti-amyloid peptide engineered bacterioph For example, the sequence of Sc Sup35 is provided in U.S. ages are derived. Ser. No. 11/004,418. 0220. In some embodiments, an anti-amyloid peptide 0214 Aggregation domains of the yeast prion proteins encoded by an anti-amyloid peptide engineered bacterioph Saccharomyces cerevisiae (Sc) Sup35 and Candida albicans age can be, e.g., 6-12, 8-15, 10-20, 10-30, 20-30, 30-40, or (Ca) Sup 35 are useful to derive anti-amyloid peptides to be 40-50 amino acids in length. In some embodiments, anti expressed by the anti-amyloid peptide engineered bacte amyloid peptides encoded by a plurality of anti-amyloid pep riophages as disclosed herein. In some embodiments, a vari tide engineered bacteriophages can overlap in sequence by ety of peptides located between amino acids 1-40 of Sc Sup35 between, e.g., 1-25 residues, e.g., between 5-20 residues, or are capable of binding to full length Sc Sup35 (but not Ca between 10-15 residues. In some embodiments, an anti-amy Sup35) to form higher ordered aggregates, and thus are loid peptide encoded by an anti-amyloid peptide engineered encompassed for use as anti-amyloid peptide to be expressed bacteriophage can 'scan at least a portion of the polypeptide, by an anti-amyloid peptide engineered bacteriophages as dis i.e., the starting positions of the peptides with respect to the closed herein. In another embodiment, anti-amyloid peptide polypeptide are displaced from one another ('staggered) by to be expressed by an anti-amyloid peptide engineered bac X residues where X is, for example, between 1-10 residues or teriophages consists of amino acids 10-29 of Sc Sup35. In between 1-6 residues or between 1-3 residues. In one embodi another embodiment, anti-amyloid peptide to be expressed by ment, the starting positions of anti-amyloid peptides encoded an anti-amyloid peptide engineered bacteriophages includes by a plurality of anti-amyloid peptide engineered bacterioph amino acids 69-76 of Ca Sup35 which is capable of binding to ages with respect to the amyloid polypeptide sequence from full length Ca Sup35 (but not to Sc Sup35) to form higher which it is derived is staggered by 1 amino acid. For example, ordered aggregates. a first anti-amyloid peptide corresponds to amino acids 1-20; 0215. In another aspect, a protein aggregation domain of a second anti-amyloid peptide corresponds to amino acids an amyloid polypeptide is useful to derive an anti-amyloid 2-21; a third anti-amyloid peptide corresponds to amino acids peptide to be expressed by an anti-amyloid peptide engi 3-22, etc. In another embodiment, the starting positions of neered bacteriophages as described herein. A protein aggre anti-amyloid peptides encoded by a plurality of anti-amyloid gation domain may be located N-terminal or C-terminal to an peptide engineered bacteriophages with respect to the amy amyloid polypeptide of interest. A protein aggregration loid polypeptide sequence from which it is derived is stag domain of an amyloid polypeptide is region of any polypep gered by 2 amino acids. For example, a first anti-amyloid tide which contacts a second polypeptide to form a high order peptide corresponds to amino acids 1-20; a second anti-amy aggregate. loid peptide corresponds to amino acids 3-22; a third anti 0216. In some embodiments, an anti-amyloid peptide amyloid peptide corresponds to amino acids 5-23, etc. expressed by an anti-amyloid peptide engineered bacterioph 0221) A plurality of anti-amyloid peptides encoded by a age is a peptide derived from an amyloid polypeptide where plurality of anti-amyloid peptide engineered bacteriophages there is a commercial, therapeutic, prophylactic or practical need not include the N-terminal or C-terminal amino acid of interest to prevent amyloid formation. Exemplary amyloid the amyloid polypeptide. In some embodiments, a plurality of polypeptides from which an anti-amyloid peptide can be anti-amyloid peptide encoded by an anti-amyloid peptide derived includes any polypeptide whose aggregation is asso engineered bacteriophage can span any N-terminal, C-termi ciated with a mammalian disease or amyloid associated dis nal, or internal portion of an amyloid polypeptide. The anti order. amyloid peptides could include or further include a detectable 0217. The term "derived from as used herein means that label, a reactive moiety, a tag, a spacer, a crosslinker, etc. The the amyloid peptide, e.g., an anti-amyloid peptide or a pro anti-amyloid peptides encoded by a plurality of anti-amyloid amyloid peptide is a fragment of the polypeptide or is suffi peptide engineered bacteriophages need not all be the same ciently similarin sequence to a fragment of the polypeptide to length and need not all fall within any single range of lengths. nucleate self-assembly of the polypeptide to form an aggre gate. Attachment or Expression of the Anti-Amyloid Peptide on 0218. The length of the fragment may be, e.g., between 10 the Surface of a Bacteriophage amino acids up to the full length of the polypeptide, e.g., at 0222. In one embodiment, the invention provides a bacte least 10, 20, 50, 100, 200, 300, or 500 amino acids, etc., riophage that has been genetically engineered to express at provided that the fragment contains a domain that mediates least one amyloid peptide, e.g., an anti-amyloid peptide or a self-assembly to form higher ordered aggregates. The frag pro-amyloid peptide on their surface. The theoretical bound ment may encompass between 20-100% of the total polypep aries of the expression of a amyloid peptide, e.g., an anti US 2012/03.01433 A1 Nov. 29, 2012 26 amyloid peptide or a pro-amyloid peptide copy number per Subsequently cleaved as the amyloid peptide, e.g., an anti phage depend primarily on the size of the anti-amyloid pep amyloid peptide or a pro-amyloid peptide is secreted from the tide, and the type of bacteriophage and the number of capsid host bacteria to render the mature amyloid peptide in its active proteins per phage. Generally, the number of anti-amyloid form without the signal sequence. In some embodiments, peptides or pro-amyloid peptides displayed on the phage is multiple bacteriophage expressing an amyloid peptide, e.g., dependent on the number of capsid protein of the phage. For an anti-amyloid peptide or a pro-amyloid peptide at their example in T7, one can use one fusion protein in the case of a surface are released following lysis of a bacterial cell infected large amyloid peptide, e.g., an anti-amyloid peptide or a pro by the bacterophage. amyloid peptide, or as many as 415 in the case of a small 0225. One particular benefit of an anti-amyloid peptide amyloid peptide, e.g., an anti-amyloid peptide or a pro-amy engineered bacteriophage expressing an anti-amyloid pep loid peptide. Preferably, each phage has multiple copies of the tide, and a method of using it according to methods disclosed amyloid peptide, e.g., an anti-amyloid peptide or a pro-amy herein is the presence of the anti-amyloid in the immediate loid peptide on their Surface. The phage can carry, for locality of the bacteriophage, thus the anti-amyloid peptide is example, 1 copy, 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, released from bacterial host cells infected with the bacte 17, 18, 19, 20 copies, 20-50, 50-100, 100-200, 200-300,300 riophage, via either lysis or being secreted, allowing the anti 400, 400-500 or more, of anti-amyloid peptide on their sur amyloid peptide to inhibit the formation of, or maintainance face. Wild type T7 has a capsid that is composed of 10% of of amyloid. Additionally, another advantage of delivering the 10B, a small capsid protein. One can make a fusion protein anti-amyloid peptides by being expressed by a bacteriophage with this capsid protein and the anti-amyloid peptide. For is that it enables the anti-amyloid peptides to come into con example, 10B plus about 40 to 50 amino acids encoding tact with amyloids which may not be accessible using con anti-amyloid peptide. In an alternative embodiment, one ventional methods, for example it allows the anti-amyloid could theoretically replace every capsid protein provided the peptides to be within the locality of biofilms in difficult to anti-amyloid peptide does not sterically hinder the capsid reach places due to the bacteria being located in a difficult to protein formation. Typically, the anti-amyloid peptide engi access location, Such as a small space or between two pieces neered bacteriophage carries at least about 5-15 copies of of material. As such, another advantage of the present inven anti-amyloid peptide on its Surface. For example, in one tion is an improved genetically engineered bacteriophage embodiment, the anti-amyloid peptide is a fusion protein with which express anti-amyloid peptides within the near vicinity 10B capsid protein So it can be displayed on the phage Sur of amyloids, such as curli amyloid in biofilms produced by face. bacterial cells, which may not be accessible to anti-amyloid 0223) The fusion protein could comprise a single amyloid peptides delivered by other means. peptide, e.g., an anti-amyloid peptide or a pro-amyloid peptide or a plurality of amyloid peptides, e.g., anti-amyloid peptides Signal Sequence: or pro-amyloid peptides, which could be the same or different 0226. Without wishing to be bound to theory, when pro in sequence. The amyloid peptides, e.g., an anti-amyloid pep teins are expressed by a cell, including a bacterial cell, the tide or a pro-amyloid peptide could be derived from a single proteins are targeted to a particular part in the cell or secreted bacterial polypeptide, e.g., E. coli CsgB, or from multiple from the cell. Thus, protein targeting or protein sorting is the different bacterial polypeptides. For example, a fusion pro mechanism by which a cell transports proteins to the appro tein could comprise a first anti-amyloid peptide derived from priate positions in the cell or outside of it. Sorting targets can a first bacterial species or genus and a second anti-amyloid be the inner space of an organelle, any of several interior peptide derived from a second bacterial species or genus. membranes, the cell's outer membrane, or its exterior via Such anti-amyloid-capsid fusion proteins, and nucleic acids secretion. This delivery process is carried out based on infor encoding Such fusion proteins, are aspects of the invention. mation contained in the protein itself. Correct sorting is cru Secretion of an Anti-Amyloid Peptide from the Host Bacte cial for the cell; errors can lead to diseases. rial Cell 0227. With some exceptions, bacteria lack membrane 0224. In some embodiments, the amyloid peptide, e.g., an bound organelles as found in eukaryotes, but they may anti-amyloid peptide or a pro-amyloid peptide expressed assemble proteins onto various types of inclusions such as gas from the host bacterial cell is released when the bacterial host vesicles and storage granules. Also, depending on the species cell lyses in the lytic cycle process of bacteriophage infection. of bacteria, bacteria may have a single plasma membrane In alternative embodiment, the expressed amyloid peptide, (Gram-positive bacteria), or both an inner (plasma) mem e.g., an anti-amyloid peptide or a pro-amyloid peptide is brane and an outer cell wall membrane, with an aqueous released from the bacterial host cell by the bacterial host cell space between the two called the periplasm (Gram-negative via the secretory pathway. In Such an embodiment, the amy bacteria). Proteins can be secreted into the environment, loid peptide, e.g., an anti-amyloid peptide or a pro-amyloid according to whether or not there is an outer membrane. The peptide expressed from the bacteriophage-infected host bac basic mechanism at the plasma membrane is similar to the terial cell also contains a signal peptide Such as a secretory eukaryotic one. In addition, bacteria may target proteins into signal sequence. Such a secretory signal sequence allows or across the outer membrane. Systems for secreting proteins intracellular transport of the amyloid peptide, e.g., an anti across the bacterial outer membrane may be quite complex amyloid peptide or a pro-amyloid peptide to the bacterial cell and play key roles in pathogenesis. These systems may be plasma membrane for its secretion from the bacteria. Accord described as type I Secretion, type II secretion, etc. ingly, in Such an embodiment, the expressed amyloid peptide, 0228. In most Gram-positive bacteria, certain proteins are e.g., an anti-amyloid peptide or a pro-amyloid peptide is targeted for export across the plasma membrane and Subse expressed as a pro-amyloid peptide comprising the signal quent covalent attachment to the bacterial cell wall. A spe sequence and an amyloid peptide, e.g., an anti-amyloid pep cialized enzyme, Sortase, cleaves the target protein at a char tide or a pro-amyloid peptide, where the signal sequence is acteristic recognition site near the protein C-terminus, such as US 2012/03.01433 A1 Nov. 29, 2012 27 an LPXTG (SEQ ID NO: 197) motif (where X can be any and proteins into the host which develops the crown gall amino acid), then transfers the protein onto the cell wall. An (tumor). Helicobactor pylori uses a type IV Secretion sys system analogous to Sortase/LPXTG, termed exoSortase/ tem to deliver CagA into gastric epithelial cells. Bordetella PEP-CTERM, is proposed to exist in a broad range of Gram pertussis, the causative agent of whooping cough, secretes the negative bacteria. pertussis toxin partly through the type IV system. Legionella 0229. A. Secretion in Gram Negative Bacteria pneumophila, the causing agent of legionellosis (Legion 0230 By way of background but not wishing to be bound naires disease) utilizes type IV secretion system, known as by theory, secretion is present in bacteria and archaea as well. the icm/dot (intracellular multiplication/defect in organelle ATPbinding cassette (ABC) type transporters are common to trafficking genes) system, to translocate numerous effector all the three domains of life. The secretory system in bacteria, proteins into its eukaryotic host. (Cascales et al., (2003), Nat also referred to in the art as the “Sec system’ is a conserved Rev Microbiol 1 (2): 137-149). The prototypic Type IV secre secretion system which generally requires the presence of an tion system is the VirB complex of Agrobacterium tumefa N-terminal signal peptide on the secreted protein. Gram nega ciens (Christie et al. 2005: Ann Rev. Microbiol 59: 451-485). tive bacteria have two membranes, thus making secretion 0239 5. Type V Secretion System (T5SS): topologically more complex. There are at least six specialized 0240 Also know in the art as the “autotransporter system' secretion systems (Type I-VI) in Gram negative bacteria. (Thanassi, et al., 2005: Mol. Membrane. Biol. 22(1): 63-72). 0231 1. Type I Secretion System (T1SS or TOSS): type V secretion involves use of the Sec system for crossing 0232. It is similar to the ABC transporter, however it has the inner membrane. Proteins which use this pathway have additional proteins that, together with the ABC protein, form the capability to form a beta-barrel with their C-terminus a contiguous channel traversing the inner and outer mem which inserts into the outer membrane, allowing the rest of branes of Gram-negative bacteria. It is a simple system, which the peptide (the passenger domain) to reach the outside of the consists of only three protein subunits: the ABC protein, cell. Often, autotransporters are cleaved, leaving the beta membrane fusion protein (MFP), and outer membrane pro barrel domain in the outer membrane and freeing the passen tein (OMP). Type I secretion system transports various mol ger domain. ecules, from ions, drugs, to proteins of various sizes (20-900 0241 6. Type VI Secretion System (T6SS): kDa). The molecules secreted vary in size from the small 0242 Proteins secreted by the type VI system lack N-ter Escherichia coli peptide colicin V. (10kDa) to the Pseudomo minal signal sequences and therefore presumably do not enter nas fluorescens cell adhesion protein LapA of 900 kDa. The the Sec pathway. (Pukatzki et al., (2006), PNAS 103 (5): best characterized are the RTX toxins and the lipases. Type I 1528-33; Mougous et al., (2006) Science 312 (5779): 1526 secretion is also involved in export of non-proteinaceous Sub 30). Type VI secretion systems are now known to be wide strates like cyclic B-glucans and polysaccharides. Many spread in Gram-negative bacteria. (Bingle et al., 2008: Curr. secreted proteins are particularly important in bacterial Opin. Microbiol. 11 (1): 3-8; Cascales E (2008), EMBO pathogenesis. Wooldridge K (2009). Bacterial Secreted Pro Reports 9 (8): 735-741). teins: Secretory Mechanisms and Role in Pathogenesis. 0243 7. Twin-Arginine Translocation: Caister Academic Press 0244 Bacteria as well as mitochondria and chloroplasts 0233 2. Type II Secretion System (T2SS): also use many other special transport systems such as the 0234 Proteins secreted through the type II system, or main twin-arginine translocation (Tat) pathway which, in contrast terminal branch of the general Secretory pathway, depend on to Sec-depedendent export, transports fully folded proteins the Sec system for initial transport into the periplasm. Once across the membrane. The signal sequence requires two con there, they pass through the outer membrane via a multimeric secutive arginines for targeting to this system. complex of secretin proteins. In addition to the secretin pro 0245 8. Release of Outer Membrane Vesicles: tein, 10-15 otherinner and outer membrane proteins compose 0246. In addition to the use of the multiprotein complexes the full secretion apparatus, many with as yet unknown func listed above, Gram-negative bacteria possess another method tion. Gram-negative type IV piliuse a modified version of the for release of material: the formation of outer membrane type II system for their biogenesis, and in some cases certain vesicles. Chatterjee, et al., J. Gen. Microbiol.” “49”: 1-11 proteins are shared between a pilus complex and type II (1967); Kuehn et al., Genes Dev. 19(22):2645-55 (2005). system within a single bacterial species. Portions of the outer membrane pinch off, forming spherical 0235 3. Type III Secretion System (T3SS or TTSS): structures made of a lipid bilayer enclosing periplasmic mate 0236. It is homologous to bacterial flagellar basal body. It rials. Vesicles from a number of bacterial species have been is like a molecular syringe through which a bacterium (e.g. found to contain virulence factors, some have immunomodu certain types of Salmonella, Shigella, Yersinia) can inject latory effects, and some can directly adhere to and intoxicate proteins into eukaryotic cells. The low Ca" concentration in host cells. While release of vesicles has been demonstrated as the cytosol opens the gate that regulates T3SS. One such a general response to stress conditions, the process of loading mechanism to detect low calcium concentration has been cargo proteins seems to be selective. McBroom, et al., Mol. illustrated by the lcrV (Low Calcium Response) antigen uti Microbiol. 63(2):545-58 (2007) lized by Y. pestis, which is used to detect low calcium con 0247 B. Secretion in Gram Positive Bacteria centrations and elicits T3SS attachment. (Salyers et al., 2002: 0248 Proteins with appropriate N-terminal targeting sig Bacterial Pathogenesis: A Molecular Approach, 2nd ed., nals are synthesized in the cytoplasm and then directed to a Washington, D.C.: ASM Press) specific protein transport pathway. During, or shortly after its 0237 4. Type IV Secretion System (T455 or TFSS): translocation across the cytoplasmic membrane, the protein is 0238. It is homologous to conjugation machinery of bac processed and folded into its active form. Then the translo teria (and archaeal flagella). It is capable of transporting both cated protein is either retained at the extracytoplasmic side of DNA and proteins. It was discovered in Agrobacterium tume the cell or released into the environment. Since the signal faciens, which uses this system to introduce the Tiplasmid peptides that target proteins to the membrane are key deter US 2012/03.01433 A1 Nov. 29, 2012 28 minants for transport pathway specificity, these signal pep 0249. In some embodiments, the signal sequence useful in tides are classified according to the transport pathway to the present invention is Omp A Signal sequence, however any which they direct proteins. Signal peptide classification is signal sequence commonly known by persons of ordinary based on the type of signal peptidase (SPase) that is respon skill in the art which allows the transport and secretion of sible for the removal of the signal peptide. The majority of anti-amyloid peptide outside the bacteriophage infected cell exported proteins are exported from the cytoplasm via the are encompassed for use in the present invention. general "Secretory (Sec) pathway'. Most well known viru lence factors (e.g. exotoxins of Staphylococcus aureus, pro 0250 Signal sequence that direct secretion of proteins tective antigen of Bacillus anthracia, lysteriolysin O of List from bacterial cells are well known in the art, for example as eria monocytogenes) that are secreted by Gram-positive disclosed in International application WO2005/071088, pathogens have a typical N-terminal signal peptide that would which is herein incorporated in its entirety by reference. lead them to the Sec-pathway. Proteins that are secreted via 0251 For example, one can use some of the non-limited this pathway are translocated across the cytoplasmic mem examples of signal peptide shown in Table 1 which can be brane in an unfolded State. Subsequent processing and folding attached to the amino-terminus or carboxyl terminus of the of these proteins takes place in the cell wall environment on antimicrobial peptide to be expressed by the anti-amyloid the trans-side of the membrane. In addition to the Sec system, peptide engineered bacteriophage. Attachment can be via Some Gram-positive bacteria also contain the Tat-system that fusion or chimera composition with selected anti-amyloid is able to translocate folded proteins across the membrane. peptides resulting in the Secretion from the bacterium Pathogenic bacteria may contain certain special purpose infected with the anti-amyloid peptide engineered bacte export systems that are specifically involved in the transport riophage.
TABL E 1. Some exemplary signal peptides to direct sec retion of an anti-amyloid peptide out of a bacteria cell. Signal peptidase Sectretion Signal Peptide Amino Acid sequence Site (cleavage site Pathway (NH-CO2) represented by Gene Genus/Species SecA1 KKIMLVITLILVSPIAOOTEAKD TEA'KD (SEQ Hly (LLO) Listeria (SEQ ID NO: 228) ID NO. 238) monocytogenes KKKIISAILMSTWILSAAAPLSGWYA WYA'DT (SEQ Usp45 actococcus DT (SEO ID NO: 229) ID NO: 239) lactis KKRKWLIPLMALSTILWSSTGNLEWI IQA'EW (SEQ ID Pag Bacillus QAEW (SEQ ID NO: 230) NO: 24 O) (protective anthracis antigen)
SecA2 NMKKATIAATAGIAWTAFAAPTIAS ASA'ST (SEO ID Iap (invasion- Listeria AST (SEQ ID NO: 231) NO: 241) associated monocytogenes protein p 60) OKTRKERILEALOEEKKNKKSKKF WSA'DE (SEO ID NamA Listeria KTGATIAGWTAIATSITWPGIEWIWSAD NO: 242) Imd2 691 monocytogenes E (SEQ ID NO: 232) (autolysin) KKLKMASCALWAGLMFSGLTPNAF AFA'ED (SEO ID *BA 0281 Bacillus AED (SEQ ID NO: 233) NO: 243) (NLP/P60 anthracis family) AKKFNYKLPSMWALTLWGSAWTAH WQA'AE (SEQ atl Staphylococcus QWOAAE (SEQ ID NO: 234) ID NO: 244) (autolysin) eS
Tat TDKKSENOTEKTETKENKGMTRRE DKA' LT (SEO ID ImdC367 Listeria LKLSAWAGTGIAWGATGIGTILNWW NO: 245) monocytogenes DQVDKALT (SEQ ID NO: 235) AYDSRFDEWVOKLKEESFONNTFD Pho) Bacillus subtillis RRKFIOGAGKIAGLGLGLTIAQSVGA (alkaline FG (SEQ ID NO: 236) phosphatase) of only a few proteins. For example, several gene clusters 0252. In alternative embodiments, one of ordinary skill in have been identified in mycobacteria that encode proteins that the art can use synthetic bacterial sequences, such as those are secreted into the environment via specific pathways discussed in Clérico et al., Biopolymers. 2008; 90(3):307-19, (ESAT-6) and are important for mycobacterial pathogenesis. which is incorporated herein by reference. Alternatively, one Specific ATP-binding cassette (ABC) transporters direct the export and processing of Small antibacterial peptides called can use methods to secrete peptides without the use of signal bacteriocins. Genes for endolysins that are responsible for the (or secretory) sequences, such as the methods disclosed in onset of bacterial lysis are often located near genes that International Application WO2007/018853, which is incor encode for holin-like proteins, Suggesting that these holins porated herein by reference. Bacterial protein secretion is are responsible for endolysin export to the cell wall. Wool discussed in Driessen et al., Nat Struct Biol. 2001 June; dridge K (2009). Bacterial Secreted Proteins: Secretory 8(6):492-8, which is incorporated herein by reference. The Mechanisms and Role in Pathogenesis. Caister Academic localization of signal sequences, such as secretory signal Press sequences can be located anywhere on the peptide, so long as US 2012/03.01433 A1 Nov. 29, 2012 29 the signal is exposed on the peptide and its placement does not 3-5, and include, but are not limited to, lambda phages, M13. disrupt the inhibitory effect of the anti-amyloid peptide For T7, T3, and T-even and T-even like phages, such as T2, and example, it can be placed at the carboxy or amino terminus or T4, and RB69; also phages such as Pfl. Pfa, Bacteroides even sometimes within the peptide, providing it satisfies the fragilis phage B40-8 and coliphage MS-2 can be used. For above conditions. Some signal sequences which can be used example, lambda phage attacks E. coli by attaching itself to are disclosed in Table 7 of U.S. Pat. No. 6,072,039 which is the outside of the bacteria and injecting its DNA into the incorporated herein in its entirety by reference. bacteria. Once injected into its new host, a bacteriophage uses E. coli's genetic machinery to transcribe its genes. Any of the Modification of an Anti-Amyloid Peptide or Pro-Amyloid known phages can be engineered to express an anti-amyloid Engineered Bacteriophage peptide as described herein. 0253) In another embodiment, an anti-amyloid peptide 0258. In some embodiments, bacteriophages which have engineered bacteriophage can be further be modified to com been engineered to be more efficient cloning vectors or natu prise nucleic acids which encode enzymes which assist in rally lack a gene important in infecting all bacteria, Such as breaking down or degrading the biofilm matrix, for example male and female bacteria can be used to generate an anti any gene known as encoding a biofilm degrading enzyme by amyloid peptide engineered bacteriophage as disclosed persons of ordinary skill in the art, such as, but not limited to herein. Typically, bacteriophages that have been engineered Dispersin Daminopeptidase, amylase, carbohydrase, carbox to lack genes for infecting all variants and species of bacteria ypeptidase, catalase, cellulase, chitinase, cutinase, cyclodex can have reduced capacity to replicate in naturally occurring tringlycosyltransferase, deoxyribonuclease, esterase, alpha bacteria thus limiting the use of such phages in degradation of galactosidase, beta-galactosidase, glucoamylase, alpha biofilm produced by the naturally occurring bacteria. glucosidase, beta-glucosidase, haloperoxidase, invertase, 0259 For example, the capsid protein of phage T7, gene laccase, lipase, mannosidase, oxidase, pectinolytic enzyme, 10, comes in two forms, the major product 10A (36 kDa) and peptidoglutaminase, peroxidase, phytase, polyphenoloxi the minor product 10B (41 kDa) (Condron, B.G., Atkins, J. dase, proteolytic enzyme, ribonuclease, transglutaminase, F., and Gesteland, R. F. 1991. Frameshifting in gene 10 of Xylanase or lyase. In other embodiments, the enzyme is bacteriophage T7. J. Bacteriol. 173:6998-7003). Capsid pro selected from the group consisting of cellulases, such as tein 10B is produced by frameshifting near the end of the glycosyl hydroxylase family of cellulases, such as glycosyl coding region of 10A. NOVAGENR modified gene 10 in T7 hydroxylase 5 family of enzymes also called cellulase A: to remove the frameshifting site so that only 10B with the polyglucosamine (PGA) depolymerases; and colonic acid attached user-introduced peptide for surface display is pro depolymerases, such as 1,4-L-fucodise hydrolase (see, e.g., duced (U.S. Pat. No. 5,766,905. 1998. Cytoplasmic bacte Verhoef R. et al., Characterisation of a 1,4-beta-fucoside riophage display system, which is incorporated in its entirety hydrolase degrading collanic acid, Carbohydr Res. 2005 Aug. herein by reference). The 10B-enzyme fusion product is too 15:340(11):1780-8), depolymerazing alginase, and DNase I, large to make up the entire phage capsid because the enzymes or combinations thereof, as disclosed in the methods as dis that are typically introduced into phages, such as T7, are large closed in U.S. patent application Ser. No. 1 1/662,551 and (greater thana few hundredamino acids). As a result, T7 select International Patent Application WO2006/137847 and provi 10-3b must be grown in host bacterial strains that produce sional patent application 61/014,518, which are specifically wild-type 10A capsid protein, such as BLT5403 or BLT5615, incorporated herein in their entirety by reference. so that enough 10A is available to be interspersed with the 0254. In another embodiment, an anti-amyloid peptide 1OB-enzyme fusion product to allow replication of phage engineered bacteriophage or a pro-amyloid engineered bac (U.S. Pat. No. 5,766,905. 1998. Cytoplasmic bacteriophage teriophage can be further be modified in a species-specific display system, which is incorporated in its entirety herein by manner, for example, one can modify or select the bacterioph reference). However, because most biofilm-forming E. coli age on the basis for its infectivity of specific bacteria. do not produce wild-type 10A capsid protein, this limits the 0255. In another embodiment, an anti-amyloid peptide ability of T7select 10-3b displaying large enzymes on their engineered bacteriophage or a pro-amyloid engineered bac Surface to propagate within and lyse some important Strains of teriophage can be further modified to comprise nucleic acids E. coli. Accordingly, in some embodiments, the present which encodes enzymes or sequences for other beneficial invention provides genetically anti-amyloid peptide engi purposes such as, but not limited to, a fluorescent protein tag neered bacteriophages that in addition to comprising a for visualization, or an aptamer for treatment of complica nucleic acid encoding an anti-amyloid peptide and being tions induced by amyloid-associated disorders. capable of expressing and secreting the gene product (i.e. the 0256 A bacteriophage to be engineered or developed into anti-amyloid peptide nucleic acid and/or antimicrobial pro an anti-amyloid peptide engineered bacteriophage or a pro tein or peptide), also express all the essential genes for virus amyloid engineered bacteriophage can be any bacteriophage replication in naturally occurring bacterial strains. In one as known by a person of ordinary skill in the art. In some embodiment, the invention provides an engineered T7 select embodiments, an anti-amyloid peptide engineered bacte 10-3b phage that expresses both cellulase and 10A capsid riophage is derived from any or a combination of bacterioph protein. ages listed in Tables 3-5. 0260. It is known that wild-type T7 does not productively 0257. In some embodiments, a bacteriophage which is infect male (F plasmid-containing) E. coli because of inter engineered to become an anti-amyloid peptide engineered actions between the F plasmid protein PifA and T7 genes 1.2 bacteriophage or a pro-amyloid engineered bacteriophage as or 10 (Garcia, L. R., and Molineux, I.J. 1995. Incomplete disclosed herein is a lytic bacteriophage or lysogenic bacte entry of bacteriophage T7 DNA into F plasmid-containing riophage, or any bacteriophage that infects E. coli, P. aerigi Escherichia coli. J. Bacteriol. 177:4077-4083.). F plasmid nosa, S. aureaus, E. facalis and the like. Such bacteriophages containing E. coli infected by T7 die but do not lyse or release are well known to one skilled in the art and are listed in Tables large numbers of T7 (Garcia, L. R., and Molineux, I.J. 1995. US 2012/03.01433 A1 Nov. 29, 2012 30
Incomplete entry of bacteriophage T7 DNA into F plasmid amyloid peptide or a pro-amyloid peptide is regulated by a containing Escherichia coli. J. Bacteriol. 177:4077-4083). promoter to which the nucleic acid is operatively linked. In Wild-type T3 grows normally on male cells because of T3's Some embodiments, a promoter is a bacteriophage promoter. gene 1.2 product (Garcia, L. R., and Molineux, I.J. 1995. Id.). One can use any bacteriophage promoter known by one of When T3 gene 1.2 is expressed in wild-type T7. T7 is able to ordinary skill in the art, for example but not limited to, any productively infect male cells (Garcia, L. R., and Molineux, I. promoter listed in Table 10 or disclosed in world-wide web J. 1995. Id). site "partsregistry.org/cgi/partsdb/pgroup. 0261 Because many biofilm-producing E. coli contain the cgi?pgroup other regulator&show=1. F plasmid (Ghigo, et al., 2001. Natural conjugative plasmids 0265. In some embodiments, an amyloid peptide, e.g., an induce bacterial biofilm development. Nature. 412:442-445), anti-amyloid peptide or a pro-amyloid peptide is a peptide as it is important, although not necessary, for an anti-amyloid disclosed herein. In Such embodiments a bacteriophage can peptide engineered bacteriophage to be able to productively be engineered to become an anti-amyloid peptide engineered infect also male cells. Therefore, in addition to an anti-amy bacteriophage or a pro-amyloid peptide engineered bacte loid peptide engineered bacteriophage expressing and secret riophage and, in Some embodiments, to express a secretable ing the anti-amyloid peptide, one can also engineer it to form of an amyloid peptide, e.g., an anti-amyloid peptide or a express the gene necessary for infecting the male bacteria. For pro-amyloid peptide. In some embodiments, a bacteriophage example, one can use the modification described by Garcia can be engineered to become an anti-amyloid peptide engi and Molineux (Garcia, L. R., and Molineux, I. J. 1995. neered bacteriophage to express an anti-amyloid peptide at Incomplete entry of bacteriophage T7 DNA into F plasmid the Surface of the bacterophage. In some embodiments, the containing Escherichia coli. J. Bacteriol. 177:4077-4083) to naturally occurring bacteriophage promoter is replaced in express T3 gene 1.2 in T7. whole or in part with all or part of a heterologous promoter So 0262. In some embodiments, an engineered anti-amyloid that the bacteriophage and/or the bacteriophage infected-host bacteriophage or a pro-amyloid engineered bacteriophage cell expresses a high level of the secretable amyloid peptide, that lacks one or more genes important or essential for viral e.g., an anti-amyloid peptide or a pro-amyloid peptide. In replication in a naturally occurring bacterial strain is admin Some embodiments, a heterologous promoter is inserted in istered or used together with a second bacteriophage that such a manner that it is operatively linked to the desired expresses all essential genes for virus replication in a natu nucleic acid encoding the agent. See, for example, PCT Inter rally occurring bacterial strain. The second bacteriophage national Publication No. WO 94/12650 by Transkaryotic could be a non-engineered bacteriophage or a different engi Therapies, Inc., PCT International Publication No. WO neered bacteriophage. 92/20808 by Cell Genesys, Inc., and PCT International Pub lication No. WO 91/09955 by Applied Research Systems, Promoters for Expression of the Anti-Amyloid Peptide by an which are incorporated herein in their entirety by reference. Anti-Amyloid Peptide Engineered Bacteriophage 0266. In some embodiments, a bacteriophage can be engi 0263. In some embodiments, an anti-amyloid peptide or a neered as disclosed hereinto express an amyloid peptide, e.g., pro-amyloid peptide can be attached to the Surface of a bac an anti-amyloid peptide or a pro-amyloid peptide, under the teriophage by methods as disclosed herein and other methods control of inducible regulatory elements, in which case the known by an artisan of ordinary skill in the art. In all other regulatory sequences of the endogenous gene can be replaced embodiments all aspects described herein, an anti-amyloid by homologous recombination. Gene activation techniques peptide engineered bacteriophage can express an anti-amy are described in U.S. Pat. No. 5.272,071 to Chappel; U.S. Pat. loid peptide. In some embodiments, a pro-amyloid engi No. 5,578.461 to Sherwin et al.; PCT/US92/09627 (WO93/ neered bacteriophage can express a pro-amyloid peptide. In 09222) by Selden et al.; and PCT/US90/06436 (WO91/ Some embodiments, the expressed anti-amyloid peptide or 06667) by Skoultchietal, which are all incorporated herein in pro-amyloid peptide is as a fusion protein to a coat protein to their entirety by reference. be on the surface of the bacteriophages, and in other embodi 0267. Other exemplary examples of promoter which can ments, the anti-amyloid peptide or pro-amyloid peptide be used include, for example but not limited, Anhydrotetra expressed by the bacteriophage is released from the bacte cycline(aTc) promoter, PLtetO-1 (Pubmed Nucleotidei riophage (e.g. by lysis or secretion). In this aspect and all U66309), Arabinose promoter (PBAD), IPTG inducible pro aspects as described herein, the anti-amyloid peptide or pro moters PTAC (in vectors such as Pubmed Accession amyloid peptide can be linked to a signal sequence (also #EU546824), PTrc-2. Plac (invectors such as Pubmed Acces known in the art as a signal peptide). Such as a secretion sion #EU546816), PLlacO-1, PA1 lacO-1, and Arabinose and sequence, allowing translocation of the anti-amyloid peptide, IPTG promoters, such as Placfara-a. Examples of these pro or pro-amyloid peptide to the bacterial cell Surface or plasma moters are as follows: membrane and Secretion of the anti-amyloid peptide out or 0268 Anhydrotetracycline (aTc) promoter, such as pro-amyloid peptide of the bacterial cell. An anti-amyloid PLtetO-1 (Pubmed Nucleotide# U66309): GCATGCTC peptide or pro-amyloid peptide which comprises a signal CCTATCAGTGATAGAGATTGACATC sequence allows it to be secreted from the host bacterial cell CCTATCAGTGATAGAGATACTGAGCACATCAGCA is referred to herein as a “secretable amyloid peptide'. In GGACGCACTGACCAGGA (SEQID NO: 246); Arabinose Some embodiments, the signal sequence is a Omp secretion promoter (PBAD): or modified versions which can be found sequence. Thus, the nucleic acid encoding an amyloid pep at world-wide web site: partsregistry.org/wiki/index. tide, e.g., an anti-amyloid peptide or a pro-amyloid peptide is php?title=Part:BBa I13453" AAGAAACCAATTGTC operatively linked to the nucleic acid encoding the signal CATATTGCATCAGACATTGCCGTCACT Sequence. GCGTCTTTTACTGGCTCTTCTCGCTA 0264. In all aspects of the invention, gene expression from ACCAAACCGGTAACCCCGCTTAT the nucleic acid encoding an amyloid peptide, e.g., an anti TAAAAGCATTCTGTAACAAAGCGGGAC US 2012/03.01433 A1 Nov. 29, 2012
CAAAGCCATGACAAAA ACGCGTAACAAAAGTGTC human organs, such as colon or lungs and other organs in a TATAATCACGGCAGAAAAGTCCACATTGATTATTT subject prone to bacterial infection associated with a bacterial GCACGGCGTCACAC TTTGCTATGCCATAGCATTTT biofilm. TATCCATAAGATTAGCGGATCCTACCT 0272 Another aspect relates to a pharmaceutical compo GACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATA sition comprising at least one anti-amyloid peptide engi (SEQ ID NO: 247); IPTG promoters: (i) PTAC (in vectors neered bacteriophage. In some embodiments of this and all such as Pubmed Accession #EU546824, which is incorpo aspects described herein, the composition comprising an anti rated herein by reference), (ii) PTrc-2: CCATCGAATGGCT amyloid peptide engineered bacteriophage can be adminis GAAATGAGCTGTTGACAATTAATCATC tered as a co-formulation with one or more other antimicro CGGCTCGTATAATGTGTGGAATTGTGA bial, non-antimicrobial or other therapeutic agents. In some GCGGATAACAATTTCACACAGGA (SEQ ID NO: 248) embodiments, a pharmaceutical composition comprises at and temperature sensitive promoters such as PLSlcon, least one pro-amyloid peptide engineered bacteriophage. GCATGCACAGATAACCATCTGCGGT 0273. In a further embodiment, the invention provides GATAAATTATCTCTGGCGGTGTTGACAT. methods of administration of the compositions and/or phar AAATACCACTGGCG GTtATAaTGAGCACATCAG maceutical formulations comprising an anti-amyloid peptide CAGG/GTATGCAAAGGA (SEQ ID NO: 249) and engineered bacteriophage and include any means commonly modified variants thereof. known by persons skilled in the art. In some embodiments, the Subject is any organism, including for example a mam Modification of Engineered Bacteriophages. malian, avian or plant. In some embodiments, the mammalian is a human, a domesticated animal and/or a commercial ani 0269. In some embodiments of all aspects described mal. herein, an anti-amyloid peptide engineered bacteriophage or 0274. In one embodiment, the compositions and/or phar pro-amyloid peptide engineered bacteriophage can also be maceutical formulations comprising an anti-amyloid peptide designed for example, for optimal expression of amyloid engineered bacteriophage or a pro-amyloid peptide engi peptide, e.g., an anti-amyloid peptide or a pro-amyloid pep neered bacteriophage are administered into or onto Solid Sur tide, or to delay cell lysis or using multiple phage promoters faces, e.g. water pipes, water containers, catheters, fluid to allow for increased production of amyloid peptide, e.g., an samples, food products and other Surfaces infected by bacte anti-amyloid peptide or a pro-amyloid peptide, or for target ria and susceptible to having a bacterial biofilm. ing multiple biofilm components with different amyloid pep 0275 Non-lytic and non-replicative phage have been tide, e.g., with different an anti-amyloid peptides or different engineered to kill bacteria while minimizing endotoxin pro-amyloid peptides. In some embodiments, one can also release. Accordingly, the present invention encompasses target multi-species biofilm with a cocktail of different spe modification of an anti-amyloid peptide engineered bacte cies-specific anti-amyloid peptide engineered bacteriophage riophage or a pro-amyloid peptide engineered bacteriophage or pro-amyloid peptide engineered bacteriophages, and com with minimal endotoxin release or toxin-free bacteriophage bination therapy with other agents that are well known to one preparation. skilled in the art and phage to improve the efficacy of both 0276. The specificity of phage for host bacteria allows types of treatment. human cells as well as innocuous bacteria to be spared, poten 0270. In some embodiments of all aspects described tially avoiding serious issues such as drug toxicity. Antibiotic herein, an anti-amyloid peptide engineered bacteriophage therapy is believed to alter the microbial flora in the colon due can also be used together with other antibacterial or bacterio to lack of target specificity, and in Some instances allowing film degrading agents or chemicals such as EGTA, a calcium resistant C. difficile to proliferate and cause disease such as specific chelating agent, effected the immediate and Substan diarrhea and colitis. tial detachment of a P. aeruginosa biofilm without affecting 0277 For host specificity, if desired, a skilled artisan can microbial activity, NaCl, CaCl- or MgCl, surfactants and generate a well-characterized library of anti-amyloid peptide lea. engineered bacteriophages or pro-amyloid engineered bacte 0271 Phage therapy or bacteriophage therapy has begun riophages, where specific anti-amyloid peptide engineered to be accepted in industrial and biotechnological settings. For bacteriophage or pro-amyloid peptide engineered bacte example, the FDA has previously approved the use of phage riophage can be selected and for specific types of bacterial targeted at Listeria monocytogenes as a food additive. Phage infection. therapy has been used Successfully for therapeutic purposes 0278 While one aspect of the present invention provides a in Eastern Europe for over 60 years, and the development and method to increase (i.e. broadening) the ability of bacterioph use of phage therapy in clinical settings in Western medicine, ages to target and be effective against multiple bacterial spe in particular for treating mammals such as humans, is of great cies, the diversity of bacterial infections may result in some interest. In some embodiments of the invention, long-circu instances where a single anti-amyloid peptide engineered lating phage that can avoid reticulo-endothelial (RES) clear bacteriophage as disclosed herein is not effective at killing or ance for increased in vivo efficacy are engineered to express inhibiting biofilm formation or maintenance by all the differ anti-amyloid peptides. Accordingly, in all aspects described ent bacterial species in a given bacterial population. Thus, to herein, the methods of the present invention are applicable to circumvent this problem, one can administer a variety of human treatment. A skilled artisan can also develop and carry different anti-amyloid peptide engineered bacteriophage to a out an appropriate clinical trial for use inclinical applications, bacterial population in order to be effective in killing or Such as therapeutic purposes as well as in human Subjects. An inhibiting biofilm formation or maintenance by all the differ anti-amyloid peptide engineered bacteriophage as disclosed ent bacterial species in the heterogenous bacterial population. herein is also expected to be effective in inhibiting formation One can do this by having the same bacterial species express and/or dispersing biofilms, including biofilms present in ing different anti-amyloid peptides, or alternatively, generat US 2012/03.01433 A1 Nov. 29, 2012 32 ing different an anti-amyloid peptide engineered bacterioph gene or a toxin gene or a biofilm degrading gene. Such bac age from the same bacteriophage species expressing the same teriophages are encompassed for use in the methods and anti-amyloid peptide. In this way, one of ordinary skill in the compositions as disclosed herein. art can use a combination of anti-amyloid peptide engineered 0283. In some embodiments, the anti-amyloid peptide bacteriophages as disclosed herein to be effective at killing or engineered bacteriophages and methods and compositions inhibiting biofilm formation or maintenance by a bacterial provided herein can be used to inhibit biofilm formation or population comprising multiple different bacterial strains. maintenance and/or that disrupt biofilms that have already Accordingly, in one embodiment, the invention provides use formed. Such anti-amyloid peptide engineered bacterioph of a variety of different engineered bacteriophages in combi ages and methods and compositions are useful for compo nation (i.e. a cocktail of engineered bacteriophages discussed nents of washes or disinfectant solutions (e.g., in combination herein) to cover a range of target bacteria. with a suitable carrier Such as water), to impregnate cleaning 0279. One skilled in the art can generate a collection or a Supplies such as sponges, wipes, or cloths, or as components library of the anti-amyloid peptide engineered bacterioph of Surface coatings (e.g., in combination with a suitable car ages or pro-amyloid peptide engineered bacteriophages as rier Such as a polymeric material or a carrier for slow release disclosed herein by new cost-effective, large-scale DNA of the bacteriophage) for a variety of medical devices. Addi sequencing and DNA synthesis technologies. Sequencing tionally, anti-amyloid peptide engineered bacteriophages and technologies allows the characterization of collections of methods and compositions can be added to existing disinfec natural phage that have been used in phage typing and phage tant or anti-microbial compositions. In certain embodiments, therapy for many years. Accordingly, a skilled artisan can use anti-amyloid peptide engineered bacteriophages and compo synthesis technologies as described herein to add different sitions thereofare useful as prophylactic ortherapeutic agents anti-amyloid peptides to produce a variety of new anti-amy in individuals who are susceptible to infection, infected (e.g., loid peptide engineered bacteriophages. by biofilm-forming bacteria), and/or have an indwelling or 0280 Furthermore, rational engineering methods with implantable device, or are immunocompromised (e.g., indi new synthesis technologies can be employed to broaden an viduals Suffering from HIV, individuals taking immunosup anti-amyloid peptide engineered bacteriophage host range. pressive medication, or individuals with immune system defi For example, a T7 anti-amyloid peptide engineered bacte ciencies or dysfunction), or are allergic to antibiotics, or are riophage can be modified to express K1-5 endosialidase, hospitalized, or have an implanted prosthetic or medical allowing it to effectively replicate in E. coli that produce the device (e.g., an artificial heart valve, joint, stent, orthopedic K1 polysaccharide capsule. In some embodiments, the gene appliance, etc.). Biofilms are often associated with cystic 1.2 from phage T3 can be used to extend an anti-amyloid fibrosis, endocarditis, osteomyelitis, otitis media, urinary peptide engineered bacteriophage to be able to transfect a tract infections, oral infections, and dental caries, among host range to include E. coli that contain the F plasmid, thus other conditions. In some instances a biofilm-associated demonstrating that multiple modifications of a phage genome infection is a nosocomial infection. In some cases a biofilm can be done without significant impairment of the phage's associated infection is a mixed infection, comprising multiple ability to replicate. Bordetella bacteriophage use a reverse different microorganisms. In some cases an individual Suffer transcriptase-mediated mechanism to produce diversity in ing from a biofilm-associated infection is at increased risk of host tropism which can also be used according to the methods contracting a second infection. of the present invention to create an anti-amyloid peptide 0284. In some embodiments, an anti-amyloid peptide engineered bacteriophage, and is lytic to the target bacterium engineered bacteriophages and compositions thereofare use or bacteria. The many biofilm-promoting factors required by ful as a component of a coating the Surface of medical devices E. coli K-12 to produce a mature biofilm are likely to be to prevent biofilm formation, for example, medical devices shared among different biofilm-forming bacterial strains and Such as a catheter, Stent, valve, pacemaker, conduit, cannula, are thus also targets for an anti-amyloid peptide engineered appliance, Scaffold, central line, IV line, pessary, tube, drain, bacteriophage as disclosed herein. trochar or plug, implant, a rod, a screw, or orthopedic or implantable prosthetic device or appliance. In some embodi Uses of the Engineered Bacteriophages ments, the anti-amyloid peptide engineered bacteriophages 0281. Accordingly, the inventors have demonstrated that can be coated on the Surfaces of Such medical devices Such an anti-amyloid peptide engineered bacteriophage as dis that they are slowly released from the surface. In another closed herein is effective at reducing amyloid formation, and embodiment, an anti-amyloid peptide engineered bacterioph decreasing the amyloid amount in biofilms produced by bac ages and compositions thereof can be used as a component of teria as compared to a bacteriophage which has not been a coating for a conduit, pipelining, a reactor, filter, vessel, or engineered to express and secrete an anti-amyloid peptide. equipment which comes into contact with a beverage or food, 0282. The inventors have also discovered that an anti e.g., intended for human oranimal consumption or treatment, amyloid peptide engineered bacteriophage can be adapted to or water or other fluid intended for consumption, cleaning, express a variety of different anti-amyloid peptides, and can agricultural, industrial, or other use. In some embodiments an be further optionally modified, for example to express other anti-amyloid peptide engineered bacteriophages and compo biofilm-degrading enzymes to target a wide range of bacteria sitions thereof can be used as a component of a wound dress and bacteria biofilms. In some embodiments, an anti-amyloid ing, bandage, toothpaste, cosmetic, etc. peptide engineeredbacteriophage can be used in combination 0285. In another embodiment, an anti-amyloid peptide with at least one other an anti-amyloid peptide engineered engineered bacteriophages and compositions thereof can be bacteriophage as disclosed herein, and optionally a different used to remove CsgA and/or CsgB polypeptides from a solu bacteriophage (engineered or non-engineered) or a different tion. The Solution may be, e.g., water or a body fluid Such as anti-amyloid peptide engineered bacteriophage, as well as a blood, plasma, serum, etc. The fluid is contacted with an bacteriophage which is modified to express a therapeutic anti-amyloid peptide engineered bacteriophage or composi US 2012/03.01433 A1 Nov. 29, 2012
tions thereof. In some embodiments, the concentration of an than 1x107 PFU/ml. In some embodiments, where an anti anti-amyloid peptide engineered bacteriophage to be effec amyloid peptide engineered bacteriophage is used to treat a tive at inhibiting amyloid formation, for example, biofilm Subject, Such as a human Subject with amyloidoses, an anti formation in solution is about at least 1x10° PFU/ml, or about amyloid peptide engineered bacteriophage can be adminis at least 1x10 PFU/ml, or about at least 1x10" PFU/ml, or tered multiple times (i.e. repeated doses). Should the bacte about at least 1x10 PFU/ml, or about at least 1x10° PFU/ml, riophage/peptide? amyloid plaque complex to be or about at least 1x10° PFU/ml, or about at least 1x10 PFU/ immunogenic, then repeated dosing with the anti-amyloid ml, or about at least 1x10 PFU/ml, or about at least 1x10' peptide engineered bacteriophage would result in the plaques PFU/ml, or more than about at least 1x10' PFU/ml. In some being cleared from the system. Typically, anti-amyloid pep embodiments, if the anti-amyloid peptide engineered bacte tide engineered bacteriophage is used to treat a subject or riophage is a non-relicating bacteriophage (i.e. does not infect administered to a Subject are non-relicating bacteriophages. cells and proliferate in the host bacteria via lysis), then the Such bacteriophages are known to one of ordinary skill in the concentration of an anti-amyloid peptide engineered bacte art and are disclosed herein. riophage to be effective at inhibiting amyloid formation, for 0290. In some embodiments, where an engineered bacte example, biofilm formation in Solution is about at least riophage express an amyloid peptide which promotes the 1x107-1x10" PFU/ml, for example, at least 1x107 PFU/ml, formation or maintenance of protein aggregates, such a pro or about at least 1x10 PFU/ml, or about at least 1x1OPFU/ amyloid peptide engineered bacteriophage can be used to ml, or about at least 1x10' PFU/ml, or about at least 1x10'' promote or increase the formation of protein aggregates PFU/ml, or about at least 1x10' PFU/ml, or about at least which comprise of two or more different polypeptides, e.g., 1x10" PFU/ml, or about at least 1x10" PFU/ml, or about at “higher order aggregates', for example, which are useful to least 1x10" PFU/ml, or more than about at least 1x10' promote or increase bacteria and/or promote the formation of PFUAm1. a bacterial biofilms in environmental, industrial, and clinical 0286. In another embodiment, an anti-amyloid peptide settings by administering a composition comprising at least engineered bacteriophages and compositions thereof can be one pro-amyloid engineered bacteriophage as discussed used to decrease the presence of CsgA and/or CsgB polypep herein. Pro-amyloid peptides are useful in circimstsances tides for waste clean-up, or sterilization purposes, or other where it is desirable to encourage biofilm formation, Such as industrial waste-management purposes. for example but not limited to, establishing microbial bio 0287. In one embodiment, an anti-amyloid peptide engi films for remediation, microbial fuel cells, “beneficial bio neered bacteriophages and compositions thereofare useful in films that block “harmful' biofilms from forming on impor a method to treat a subject either ex vivo or in vivo. In one tant Surfaces, etc). embodiment, an anti-amyloid peptide engineered bacterioph 0291. Accordingly, in some applications, it is beneficial to age and a composition thereof can be used to inhibit protein encourage and stimulate biofilm formation. For example, as aggregation or remove amyloids from a Subject. In some described in Journal of Bioscience and Bioengineering Vol embodiments, the Subject is Suffering from, or at risk of ume 101, Issue 1 January 2006, Pages 1-8, "Biofilm forma developing an amyloid associated disorder. In some embodi tion by B. subtilis and related species permits the control of ments, an anti-amyloid peptide engineered bacteriophages infection caused by plant pathogens, the reduction of mild and compositions thereof are contacted with a blood product steel corrosion, and the exploration of novel compounds' from the Subject. In another embodiment, an anti-amyloid (which is incorporated herein in its entirety by reference). peptide engineered bacteriophages and compositions thereof Moreover, biofilms can be useful in environmental remedia are administered to a subject. In one embodiment an anti tion Such as cleaning wastewater, remediation of toxic com amyloid peptide engineered bacteriophages and composi pounds in contaminated soil or groundwater, and microbial tions thereof are contacted with the surface of an organ to be leaching of inorganic materials. In these cases, the biofilm transplanted into a Subject. The organ may be bathed in an provides a stable environment where bacteria can metabolize anti-amyloid peptide engineered bacteriophages and compo toxic compounds or process chemicals for useful industrial sitions thereof prior to transplantation. In one embodiment, purposes (see world wide web at: cs.montana.edu/ross/per methods, anti-amyloid peptide engineered bacteriophages Sonal/intro-biofilms-s3.htm). Accordingly, the pro-amyloid and compositions thereof can be used to remove protein peptide engineered bacteriophage, e.g., a bacteriophage aggregates and/or amyloids from a body fluid in a subject expressing T7-RRR-CsgB(133-142)-GGG (see FIG. 15 in undergoing dialysis. the Examples) can be used to promote the formation of bac 0288. In some embodiments, the concentration of anti teria biofilms for remediateion purposes, industrial purposes amyloid peptide engineered bacteriophage for treatment of a and clean-up purposes, controlling harmful or pathogenic Subject to remove amyloid plaques in Solution for example, bacterial infections and the like. Biofilm formation is also remove amyloid formation from a biological sample (such as beneficial in symbiotic plant root nodules where the bacteria blood or other biological solution) can be about at least provide nitrogen fixation capabilities for plants see world 1x107-1x10" PFU/ml, for example, at least 1x107 PFU/ml, wide web at: sysbio.org/research/bsi/biofilm/glucoseme or about at least 1x10 PFU/ml, or about at least 1x1OPFU/ tabolism.stm). In other situations, biofilms may be used to ml, or about at least 1x10' PFU/ml, or about at least 1x10'' house bacteria as environmental biosensors to detect environ PFU/ml, or about at least 1x10' PFU/ml, or about at least mental toxins or changes in environmental conditions. 1x10" PFU/ml, or about at least 1x10" PFU/ml, or about at Finally, it can be beneficial to establish “good’ biofilms in least 1x10' PFU/ml, or more than about at least 1x10' industrial settings that will not corrode pipes and will prevent PFUAm1. “bad” biofilms from forming, since the “bad” biofilms can 0289. In some embodiments, where an anti-amyloid pep lead to corrosion and biofouling that is unwanted. tide engineered bacteriophage is used to treat a subject, the 0292 Biofilms can be used to create microbial fuel cells to dose is at least 1x107 PFU/ml or in some embodiments higher produce energy from Sustainable sources (Biosensors and US 2012/03.01433 A1 Nov. 29, 2012 34
Bioelectronics 22 (2007) 1672-1679). In these cases, biofilms 0296. In some embodiments, the methods and composi can form on the electrodes or other materials to produce tions as disclosed herein can be used to kill or reduce the electrons or other forms of energy. Accordingly, the pro viability of a bacterium, for example a bacterium such as, but amyloid peptide engineered bacteriophage, e.g., a bacte not limited to: Bacillus cereus, Bacillus anbhracis, Bacillus riophage expressing T7-RRR-CsgB(133-142)-GGG (see cereus, Bacillus anthracis, Clostridium botulinum, FIG. 15 in the Examples) can be used to promote the forma Clostridium difficle, Clostridium tetani, Clostridium perfrin tion of bacteria biofilms for formation of environmental bio gens, Corynebacteria diptheriae, Enterococcus (Streptococ cus D), Lieteria monocytogenes, Pneumoccoccal infections sensors, detection of environmental conditions and toxins as (Streptococcus pneumoniae), Staphylococcal infections and well as reducing pathogenic biofilms such as biofouling, and Streptococcal infections; Gram-negative bacteria including for promoting biofilms in microbial fuel cells and the like. Bacteroides, Bordetella pertussis, Brucella, Campylobacter 0293. In some embodiments, engineered phage that infections, enterohaemorrhagic Escherichia coli (EHEC/E. express at least one pro-amyloid peptides can be also used to coli O157:17), enteroinvasive Escherichia coli (EIEC), stimulate amyloid assembly and biofilm formation. As shown enterotoxigenic Escherichia coli (ETEC), Haemophilus in FIG. 3B, bacteriophages phages that expressed the native influenzae, Helicobacter pylori, Klebsiella pneumoniae, CsgA or CsgB sequences lack the C- and N-terminal “beta Legionella spp., Moraxella catarrhalis, Neisseria gonnor breaking residues, such as arginines (R) and/or prolines (P) rhoeae, Neisseria meningitidis, Proteus spp., Pseudomonas at the N- and C-terminal respectively, and have demonstrated aeruginosa, Salmonella spp., Shigella spp., Vibrio cholera to nucleate amyloid formation at low doses, such as bacte and Yersinia; acid fast bacteria including Mycobacterium riophages expressing SEQID NO: 12 and SEQID NO: 29 as tuberculosis, Mycobacterium avium-intracellulare, Myobac shown in FIG. 3B. Moreover, as shown in FIG. 15, T7-RRR terium johnei, Mycobacterium leprae, atypical bacteria, CsgB(133-142)-GGG actually stimulated rather than inhib Chlamydia, Myoplasma, Rickettsia, Spirochetes, Treponema ited biofilm formation, demonstrating that at least one glycine pallidum, Borrelia recurrentis, Borrelia burgdorfii and Lep residue, or at least 2, or at least about 3 or at least about 4 or to spira icterohemorrhagiae, Actinomyces, Nocardia, P more glycine residies at the C-terminus of the peptide can aeruginosa, A. bumannii, Salmonella spp., Klebsiella pneu promote amyloid formation and increase the biofilm forma monia, Shigeila spp. and/or Stenotrophomonas maltophilia tion. and other miscellaneous bacteria. 0294 Thus, in some embodiments, pro-amyloid peptide 0297 Bacterial infections include, but are not limited to, engineered bacteriophage, e.g., a bacteriophage expressing infections caused by Bacillus cereus, Bacillus anbhracis, T7-RRR-CsgB(133-142)-GGG, or non-modified CsgA and Bacillus cereus, Bacillus anthracis, Clostridium botulinum, CsgB peptides lacking N- and C-terminal arginines and pro Clostridium difficle, Clostridium tetani, Clostridium perfrin lines (See FIG. 3B), can be used to induce amyloid assembly gens, Corynebacteria diptheriae, Enterococcus (Streptococ at low phage concentrations. Additionally, pro-amyloid pep cus D), Lieteria monocytogenes, Pneumoccoccal infections tide engineered bacteriophages which express amyloid pep (Streptococcus pneumoniae), Staphylococcal infections and tides comprising non-beta-breaker amino acids (such as gly Streptococcal infections/Gram-negative bacteria including cine) added to the C-terminal or N-terminal of the Bacteroides, Bordetella pertussis, Brucella, Campylobacter amyloidogenic or amyloid-nucleating domains can assist in infections, enterohaemorrhagic Escherichia coli (EHEC/E. biofilm formation, e.g., a bacteriophage expressing T7-RRR coli O157:17) enteroinvasive Escherichia coli (EIEC), entero CsgB(133-142)-GGG has been used to empirically demon toxigenic Escherichia coli (ETEC), Haemophilus influenzae, strate that particular amyloid peptides can stimulate amyloid Helicobacter pylori, Klebsiella pneumoniae, Legionella spp., formation and can lead to stimulation of biofilm formation Moraxella catarrhalis, Neisseria gonnorrhoeae, Neisseria (see FIG. 15). meningitidis, Proteus spp., Pseudomonas aeruginosa, Sal monella spp., Shigella spp., Vibrio cholera and Yersinia; acid Bacterial Infections fast bacteria including Mycobacterium tuberculosis, Myco 0295 One aspect of the present invention relates to the use bacterium avium-intracellulare, Myobacterium johnei, of the methods and compositions comprising an anti-amyloid Mycobacterium leprae, atypical bacteria, Chlamydia, Myo peptide engineeredbacteriophage to inhibit the growth and/or plasma, Rickettsia, Spirochetes, Treponema pallidum, Borre kill (or reduce the cell viability) of a microorganism, such as lia recurrentis, Borrelia burgdorfii and Leptospira icterohe a bacteria. In some embodiments, a pro-amyloid peptide morrhagiae and other miscellaneous bacteria, including engineered bacteriophage as disclosed herein can be used to Actinomyces and Nocardia. increase bacteria infection or increase the amount of biofilm 0298. In some embodiments, the microbial infection is of bacteria. In some embodiments of this aspect and all caused by gram-negative bacterium, for example, P aerugi aspects described herein, a microorganism is a bacterium. In nosa, A. bumannii, Salmonella spp., Klebsiella pneumonia, Some embodiments, the bacteria are gram positive or gram Shigeila spp. and/or Stenotrophomonas maltophilia. negative bacteria. In some embodiments, the bacteria are Examples of microbial infections include bacterial wound bacterium resistant to at least one drug. In further embodi infections, mucosal infections, enteric infections, septic con ments, the bacteria are polymyxin-resistant bacterium. In ditions, pneumonia, trachoma, onithosis, trichomoniasis and Some embodiments, the bacterium is a persister bacteria. salmonellosis, especially in Veterinary practice. Examples of gram-negative bacteria are for example, but not 0299| Examples of infections caused by P. aeruginosa limited to P. aeruginosa, A. bumannii, Salmonella spp., Kleb include: A) Nosocomial infections: 1. Respiratory tract infec siella pneumonia, Shigeila spp. and/or Stenotrophomonas tions in cystic fibrosis patients and mechanically-ventilated maltophilia. In one embodiment, the bacteria to be targeted patients; 2. Bacteraemia and sepsis; 3. Wound infections, using the phage of the invention include E. coli, S. epidermi particularly in burn wound patients; 4. Urinary tract infec dis, Yersina pestis and Pseudomonas fluorescens. tions: 5. Post-surgery infections on invasive devises 5. US 2012/03.01433 A1 Nov. 29, 2012
Endocarditis by intravenous administration of contaminated 0308 Of the cocci bacteria, micrococcusandstaphylococ drug Solutions; 7, Infections in patients with acquired immu cus species are commonly associated with the skin, and Strep nodeficiency syndrome, cancer chemotherapy, steroid tococcus species are commonly associated with tooth enamel therapy, hematological malignancies, organ transplantation, and contribute to tooth decay. Of the rods family, bacteria renal replacement therapy, and other situations with severe neutropenia. B) Community-acquired infections: 1. Commu Bacillus species produce endospores seen in various stages of nity-acquired respiratory tract infections; 2. Meningitis; 3. development in the photograph and B. cereus cause a rela Folliculitis and infections of the ear canal caused by contami tively mild food poisoning, especially due to reheated fried nated waters; 4. Malignant otitis externa in the elderly and food. Of the vibrio species, V. cholerae is the most common diabetics; 5. Osteomyelitis of the caleaneus in children: Eye bacteria and causes cholera, a severe diarrhea disease result infections commonly associated with contaminated contact ing from a toxin produced by bacterial growth in the gut. Of lens; 6. Skin infections such as nail infections in people the spiral bacteria, rhodospirillum and Treponema pallidum whose hands are frequently exposed to water, 7. Gatrointes are the common species to cause infection (e.g., Treponema tinal tract infections; 8. Muscoskeletal system infections. pallidum causes syphilis). Spiral bacteria typically grow in 0300 Examples of infections caused by A. baumannii shallow anaerobic conditions and can photosynthesize to include: A) Nosocomial infections 1. Bacteraemia and sepsis, obtain energy from Sunlight. 2. respiratory tract infections in mechanically ventilated 0309 Moreover, the present invention relates to the use of patients; 3. Post-Surgery infections on invasive devices; 4. an anti-amyloid peptide engineered bacteriophage, or a com wound infectious, particularly in burn wound patients; 5. position comprising an anti-amyloid peptide engineered bac infection in patients with acquired immunodeficiency syn teriophage to reduce the rate of growth and/or kill either gram drome, cancer chemotherapy, steroid therapy, hematological positive, gram negative, or mixed flora bacteria or other malignancies, organ transplantation, renal replacement microorganisms. In one embodiment, a composition consists therapy, and other situations with severe neutropenia; 6. uri essentially of an anti-amyloid peptide engineered bacterioph nary tract infections; 7. Endocarditis by intravenous admin age as disclosed herein for the use to reduce the rate of growth istration of contaminated drug solutions; 8. Cellulitis. B) Community-acquired infections: a, community-acquired and/or kill either gram positive, gram negative, or mixed flora pulmonary infections; 2. Meningitis; Cheratitis associated bacteria or other microorganisms. In another embodiment, with contaminated contact lens; 4. War-Zone community the composition contains at least one anti-amyloid peptide acquired infections. C) Atypical infections: 1. Chronic gas engineered bacteriophage as disclosed herein for the use to tritis. reduce the rate of growth and/or kill either gram positive, 0301 Examples of infections caused by Stenotrophomo gram negative, or mixed flora bacteria or other microorgan nas maltophilia include Bacteremia, pneumonia, meningitis, 1SS. wound infections and urinary tract infections. Some hospital 0310. Suchbacteria are for example, but are not limited to, breaks are caused by contaminated disinfectant Solutions, listed in Table 2. Further examples of bacteria are, for respiratory devices, monitoring instruments and ice example but not limited to Baciccis Antracis, Enterococcus machines. Infections usually occur in debilitated patients faecalis, Corynebacterium, diphtheriae, Escherichia coli, with impaired host defense mechanisms. Streptococcus coelicolor, Streptococcus pyogenes, Strepto 0302 Examples of infections caused by Klebsiella pneu bacillus "oniliformis, Streptococcus agalactiae, Streptococ moniae include community-acquired primary lobar pneumo cus pneurmoniae, Salmonella typhi; Salmonella paratyphi; nia, particularly in people with compromised pulmonary Salmonella schottmulleri, Salmonella hirshieldii; Staphylo function and alcoholics. It also caused wound infections, soft coccus epidermidis, Staphylococcus aureus, Klebsiella pZeu tissue infections and urinary tract infections. moniae, Legionella pneumophila, Helicobacter pylori; 0303 Examples of infections caused by Salmonella app. Mycoplasma pneumonia, Mycobacterium tuberculosis, are acquired by eating contaminated food products. Infec Mycobacterium leprae, Yersinia enterocolitica, Yersinia pes tions include enteric fever, enteritis and bacteremia. tis, Vibrio cholerae, Vibrio parahaemolyticus, Rickettsia pro 0304 Examples of infections caused by Shigella spp. wOzekii, Rickettsia rickettsii, Rickettsia akari; Clostridium include gastroenteristis (shigellosis). difficile, Clostridium tetani; Clostridium perfingens, 0305 The methods and compositions as disclosed herein Clostridianz novyi, Clostridianz Septicum, Clostridium comprising an anti-amyloid peptide engineered bacterioph botulinum, Legionella pneumophila, Hemophilus influenzue; age can also be used in various fields as where antiseptic Hemophilus parainfluenzue, Hemophilus aegyptus, Chlamy treatment or disinfection of materials it required, for example, dia psittaci, Chlamydia trachonzatis, Bordetella pertcsis, Surface disinfection. Shigella spp., Campylobacter jejuni; Proteus spp., Citro 0306 The methods and compositions as disclosed herein bacter spp.; Enterobacter spp., Pseudomonas aeruginosa, comprising an anti-amyloid peptide engineered bacterioph Propionibacterium spp.; Bacillus anthracia, Pseudomonas age can be used to treat microorganisms infecting a cell, syringae, Spirrillum minus, Neisseria meningitidis, Listeria group of cells, or a multi-cellular organism. monocytogenes, Neisseria gonorrheae, Treponema palli 0307. In one embodiment, an anti-amyloid peptide engi dum, Francisella tularensis, Brucella spp.; Borrelia recur neered bacteriophage as described herein can be used to rentis, Borrelia hermsii; Borrelia turicatue, Borrelia burg reduce the rate of proliferation and/or growth of microorgan dorferi, Mycobacterium avium, Mycobacterium smegmatis, isms. In some embodiments, the microorganism are either or Methicillin-resistant Staphyloccus aureus; Vanomycin-resis both gram-positive or gram-negative bacteria, whether Such tant enterococcus; and multi-drug resistant bacteria (e.g., bacteria are cocci (spherical), rods, vibrio (comma shaped), bacteria that are resistant to more than 1, more than 2, more or spiral. than 3, or more than 4 different drugs). US 2012/03.01433 A1 Nov. 29, 2012 36
production and arrangement is governed by quorum sensing TABLE 2 systems. The disruption of the quorum sensing system in bacteria Such as Paeruginosa is an importantanti-pathogenic Examples of bacteria. activity as it disrupts the biofilm formation and also inhibits Staphyloccoctisatiretts Nisseria menigintidis Helicbacter pylori alginate production Bacilius anthracis Nisseria gonerrhoeae Legioneiia Bacilius cereus Vibrio choierae pnemophia Bacilius subtilis Escherichia coi K12 Borrelia burgdorferi Pharmaceutical Formulations and Compositions Streptococci is phenonia Bartoneia henseiae Ehrlichia chafeensis Streptococci is pyogenes Haemophilus Treponema pallidiin 0316 The anti-amyloid peptide engineered bacteriophage Cliostridium tetani influenzae Chlamydia or pro-amyloid engineered bacteriophages as disclosed Listeria monocytogenes Salmonella typhi trachomatis Mycobacterium Shigella dysentriae herein can be formulated in combination with one or more tuberculosis Yeriniisa pestis pharmaceutically acceptable agents. In some embodiments, Staphyloccoctis Pseudomona combinations of differentananti-amyloid peptide engineered epidermidis aeruginosa bacteriophages or pro-amyloid engineered bacteriophages can be tailored to be combined, where different anti-amyloid 0311. In some embodiments, an anti-amyloid peptide peptide engineered bacteriophages or pro-amyloid engi engineered bacteriophage as described herein can be used to neered bacteriophages are designed to target different (or the treat an already drug resistant bacterial Strain such as Methi same) species of microorganisms or bacteria, which contrib cillin-resistant Staphylococcus aureus (MRSA) or Vancomy ute towards morbidity and mortality. A pharmaceutically cin-resistant enterococcus (VRE) of variant strains thereof. acceptable composition comprising an an anti-amyloid pep 0312. In some embodiments, the present invention also tide engineered bacteriophage as disclosed herein, are Suit contemplates the use and methods of use of an anti-amyloid able for internal administration to an animal, for example peptide engineered bacteriophage as described herein in all human. combinations with other agents, such as other anti-amyloid 0317. In some embodiments, an anti-amyloid peptide peptides and/orantibiotics to fight gram-positive bacteria that engineered bacteriophage or pro-amyloid engineered bacte maintain resistance to certain drugs. riophages as disclosed herein can be used for industrial ster 0313. In some embodiments, an anti-amyloid peptide ilizing, sterilizing chemicals such as detergents, disinfec engineered bacteriophage as disclosed herein can be used to tants, and ammonium-based chemicals (e.g. quaternary treat infections, for example bacterial infections and other ammonium compounds such as QUATAL, which contains conditions such as urinary tract infections, ear infections, 10.5% N-alkyldimethyl-benzlammonium HCl and 5.5% glu sinus infections, bacterial infections of the skin, bacterial teraldehyde as active ingredients, Ecochimie Ltée, Quebec, infections of the lungs, sexually transmitted diseases, tuber Canada), and can be used in concurrently with, or prior to or culosis, pneumonia, lyme disease, and Legionnaire's disease. after the treatment or administration of an anti-amyloid pep Thus any of the above conditions and other conditions result tide or agent which inhibits fiber association. Such sterilizing ing from a microorganism infection, for example a bacterial chemicals are typically used in the art for Sterilizing industrial infection or a biofilm can be prevented or treated by the work Surfaces (e.g. in food processing, or hospital environ compositions of the invention herein. ments), and are not suitable for administration to an animal. 0318. In some embodiments, an anti-amyloid peptide Biofilms engineered bacteriophage as disclosed herein can be used for 0314. Another aspect of the present invention relates to the household cleaning and sterilizing purposes. The anti-amy use of an anti-amyloid peptide engineered bacteriophage to loid peptide engineered bacteriophage can be used in combi eliminate or reduce a bacterial biofilm, for example a bacte nation with other cleaning and sterilizing chemicals, e.g. rial biofilm in a medical, or industrial, or biotechnological detergents or disinfectants, or it can be administered before, setting. Alternatively, in Some embodiments, the use of a after or concurrently with administration of other antibacte pro-amyloid peptide engineered bacteriophage can be used to rial agents capable of assisting in biofilm dispersion. increase the bacteria biofilm, for example to promote the 0319. In another aspect of the present invention relates to formation of bacteria biofilms for formation of environmental a pharmaceutical composition comprising an anti-amyloid biosensors, detection of environmental conditions and toxins peptide engineered bacteriophage and a pharmaceutically as well as reducing pathogenic biofilms such as biofouling, acceptable excipient. Suitable carriers for the an anti-amyloid and for promoting biofilms in microbial fuel cells, to promote peptide engineered bacteriophage of the invention, and their good bacteria to compete out harmful or pathogenic bacteria, formulations, are described in Remington's Pharmaceutical and other Such applications for promoting biofilm formation Sciences, 16' ed., 1980, Mack Publishing Co., edited by Oslo using engineered bacteriophages espressing pro-amyloid et al. Typically an appropriate amount of a pharmaceutically peptides. acceptable salt is used in the formulation to render the for 0315 For instance, some bacteria, including P aerugi mulation isotonic. Examples of the carrier include buffers nosa, actively form tightly arranged multi-cell structures in Such as saline, Ringer's solution and dextrose solution. The vivo known as biofilm. The production of biofilm is important pH of the solution is preferably from about 5 to about 8, and for the persistence of infectious processes such as seen in more preferably from about 7.4 to about 7.8. Further carriers pseudomonal lung-infections in patients with cystic fibrosis include Sustained release preparations such as semipermeable and diffuse panbronchiolitis and many other diseases. A biof matrices of Solid hydrophobic polymers, which matrices are lim is typically resistant to phagocytosis by host immune cells in the form of shaped articles, e.g. liposomes, films or micro and the effectiveness of antibiotics at killing bacteria in bio particles. It will be apparent to those of skill in the art that film structures can be reduced by 10 to 1000 fold. Bioflim certain carriers can be more preferable depending upon for US 2012/03.01433 A1 Nov. 29, 2012 37 instance the route of administration and concentration of an neered bacteriophages, such compositions can contain phar anti-amyloid peptide engineered bacteriophage being admin maceutically-acceptable carriers and other ingredients or istered. agents known to facilitate administration and/or enhance 0320 Administration to human can be accomplished by uptake (e.g., Saline, dimethyl Sulfoxide, lipid, polymer, affin means determined by the underlying condition. For example, ity-based cell specific-targeting systems). In some embodi if an anti-amyloid peptide engineered bacteriophage is to be ments, a pharmaceutical composition can be incorporated in delivered into lungs of an individual, inhalers can be used. a gel, Sponge, or other permeable matrix (e.g., formed as Such formulations can also include freeze-dried powders of pellets or a disk) and placed in proximity to the endothelium the engineered bacteriophage, for example, for administra for Sustained, local release. The composition comprising an tion of the anti-amyloid peptide engineered bacteriophage to anti-amyloid peptide engineered bacteriophage can be a subject by dry-powder inhalers or reconstitution for nebu lization. If the composition is to be delivered into any part of administered in a single dose or in multiple doses which are the gut or colon, coated tablets, suppositories or orally admin administered at different times. istered liquids, tablets, caplets and so forth can be used. A 0326 Pharmaceutical compositions comprising an anti skilled artisan will be able to determine the appropriate way amyloid peptide engineered bacteriophage or pro-amyloid of administering the phages of the invention in view of the engineered bacteriophage can be administered to a subject by general knowledge and skill in the art. any known route. By way of example, a composition com 0321 Compounds as disclosed herein, can be used as a prising an anti-amyloid peptide engineered bacteriophage medicament or used to formulate a pharmaceutical composi can be administered by a mucosal, pulmonary, topical, or tion with one or more of the utilities disclosed herein. They other localized or systemic route (e.g., enteral and can be administered in vitro to cells in culture, in vivo to cells parenteral). The phrases “parenteral administration' and in the body, or ex vivo to cells outside of a subject that can “administered parenterally as used herein means modes of later be returned to the body of the same subject or another administration other than enteral and topical administration, Subject. Such cells can be disaggregated or provided as Solid usually by injection, and includes, without limitation, intra tissue in tissue transplantation procedures. venous, intramuscular, intraarterial, intrathecal, intraven 0322 Compositions comprising at least one anti-amyloid tricular, intracapsular, intraorbital, intracardiac, intradermal, peptide engineered bacteriophage or pro-amyloid engineered intraperitoneal, transtracheal, Subcutaneous, Subcuticular, bacteriophages as disclosed herein can be used to produce a intraarticular, Sub capsular, Subarachnoid, intraspinal, intrac medicament or other pharmaceutical compositions. Use of erebro spinal, and intrasternal injection, infusion and other the compositions as disclosed herein comprising an anti injection or infusion techniques, without limitation. The amyloid peptide engineered bacteriophage can further com phrases “systemic administration.” “administered systemi prise a pharmaceutically acceptable carrier. The composition cally”, “peripheral administration' and “administered can further comprise other components or agents useful for peripherally as used herein mean the administration of the delivering the composition to a subject are known in the art. agents as disclosed herein Such that it enters the animal's Addition of such carriers and other components to the agents system and, thus, is subject to metabolism and other like as disclosed herein is well within the level of skill in this art. processes, for example, Subcutaneous administration. 0323 In some embodiments, the composition comprising 0327. The phrase “pharmaceutically acceptable' is an anti-amyloid peptide engineered bacteriophage is a com employed herein to refer to those compounds, materials, position for sterilization of a physical object that is infected compositions, and/or dosage forms which are, within the with bacteria, such as Sterilization of hospital equipment, Scope of sound medical judgment, Suitable for use in contact industrial equipment, medical devices and food products. In with the tissues of human beings and animals without exces another embodiment, a composition comprising an anti-amy sive toxicity, irritation, allergic response, or other problem or loid peptide engineered bacteriophage is a pharmaceutical complication, commensurate with a reasonable benefit/risk composition useful to treat a bacterial infection in a subject, ratio. for example a human or animal Subject. 0328. The phrase “pharmaceutically acceptable carrier' 0324. In some embodiments, a pharmaceutical composi as used herein means a pharmaceutically acceptable material, tion comprising an anti-amyloid peptide engineered bacte composition or vehicle. Such as a liquid or solid filler, diluent, riophage as disclosed herein can be administered as a formu excipient, solvent or encapsulating material, involved in car lation adapted for passage through the blood-brain barrier or rying or transporting the Subject agents from one organ, or direct contact with the endothelium, for example where the portion of the body, to another organ, or portion of the body. anti-amyloid peptide inhibits the formation or maintenance of Each carrier must be “acceptable' in the sense of being com B-amyloid plaques in Alzheimer's disease. In some embodi patible with the other ingredients of the formulation, for ments, the pharmaceutical composition comprising an anti example the carrier does not decrease the impact of the agent amyloid peptide engineered bacteriophage can be adminis on the treatment. In other words, a carrier is pharmaceutically tered as a formulation adapted for systemic delivery. In some inert. embodiments, the compositions can be administered as a 0329 Pharmaceutical compositions can also optionally formulation adapted for delivery to specific organs, for comprise include large, slowly metabolized macromolecules example but not limited to the liver, bone marrow, or systemic Such as proteins, polysaccharides, polylactic acids, polygly delivery. colic acids and copolymers (such as latex functionalized 0325 Alternatively, pharmaceutical compositions com Sepharose, agarose, cellulose, and the like), polymeric amino prising an anti-amyloid peptide engineered bacteriophage or acids, amino acid copolymers, and lipid aggregates (such as pro-amyloid engineered bacteriophages can be added to the oil droplets or liposomes). Additionally, these carriers can culture medium of cells ex vivo. In addition to an anti-amy function as immunostimulating agents (i.e., adjuvants), or loid peptide engineered bacteriophage or pro-amyloid engi targeting carries to target the immunogenic peptide to specific US 2012/03.01433 A1 Nov. 29, 2012 target cells or target organs, for example the bone marrow as 0336 A bolus of the pharmaceutical composition com a target organ or plasma cells as target cells. prising an anti-amyloid peptide engineered bacteriophage 0330 For parenteral administration, the immunogenic can be administered to a Subject over a short time, such as peptide of the present invention can be administered as inject once a day is a convenient dosing schedule. Alternatively, the effective daily dose can be divided into multiple doses for able dosages of a solution or Suspension of the Substance in a purposes of administration, for example, two to twelve doses physiologically acceptable diluent with a pharmaceutical car per day. Dosage levels of active ingredients in a pharmaceu rier which can be a sterile liquid Such as water oils, Saline, tical composition can also be varied so as to achieve a tran glycerol, or ethanol. Additionally, auxiliary Substances. Such sient or Sustained concentration of the composition in the as wetting or emulsifying agents, Surfactants, pH buffering Subject, especially in and around the area of the bacterial Substances and the like can be present in compositions. Other infection or infection with a microorganism, and to result in components of pharmaceutical compositions are those of the desired therapeutic response or protection. It is also within petroleum, animal, vegetable, or synthetic origin, for the skill of the art to start doses at levels lower than required example, peanut oil, soybean oil, and mineral oil. In general, to achieve the desired therapeutic effect and to gradually glycols such as propylene glycol or polyethylene glycol are increase the dosage until the desired effect is achieved. preferred liquid carriers, particularly for injectable solutions. 0337 The effective amount of a pharmaceutical composi 0331 Typically, compositions are prepared as injectables, tion comprising an anti-amyloid peptide engineered bacte either as liquid solutions or Suspensions; solid forms suitable riophage or pro-amyloid engineered bacteriophage to be for solution in, or Suspension in, liquid vehicles prior to administered to a Subject is dependent upon factors known to injection can also be prepared. The preparation also can be a persons of ordinary skill in the art such as bioactivity and emulsified or encapsulated in liposomes or micro particles bioavailability of the anti-amyloid peptide (e.g., half-life in Such as polylactide, polyglycolide, or copolymer for the body, stability, and metabolism of the engineered bacte enhanced adjuvant effect, as discussed above (see Langer, riophage); chemical properties of the anti-amyloid peptide Science 249, 1527 (1990) and Hanes, Advanced Drug Deliv (e.g., molecular weight, hydrophobicity, and solubility); ery Reviews 28,97-119 (1997). The agents of this invention route and Scheduling of administration, and the like. It will can be administered in the form of a depot injection or implant also be understood that the specific dose level of the compo preparation which can be formulated in Such a manner as to sition comprising an anti-amyloid peptide engineered bacte permita Sustained or pulsatile release of the active ingredient. riophage as disclosed herein to be achieved for any particular 0332. Additional formulations suitable for other modes of Subject can depend on a variety of factors, including age, administration include oral, intranasal, and pulmonary for gender, health, medical history, weight, combination with one mulations, Suppositories, and transdermal applications. For or more other drugs, and severity of disease, and bacterial Suppositories, binders and carriers include, for example, strain or microorganism the Subject is infected with, Such as polyalkylene glycols or triglycerides; such suppositories can infection with multi-resistant bacterial strains. be formed from mixtures containing the active ingredient in 0338. The term “treatment, with respect to treatment of a the range of 0.5% to 10%, preferably 1%-2%. Oral formula bacterial infection or bacterial colonization, inter alia, pre tions include excipients, such as pharmaceutical grades of venting the development of the disease, or altering the course mannitol, lactose, starch, magnesium Stearate, sodium sac of the disease (for example, but not limited to, slowing the charine, cellulose, and magnesium carbonate. These compo progression of the disease), or reversing a symptom of the sitions take the form of Solutions, Suspensions, tablets, pills, disease or reducing one or more symptoms and/or one or capsules, Sustained release formulations or powders and con more biochemical markers in a Subject, preventing one or tain 10%-95% of active ingredient, preferably 25%–70%. more symptoms from worsening or progressing, promoting 0333 Topical application can result in transdermal or recovery or improving prognosis, and/or preventing disease intradermal delivery. Topical administration can be facilitated in a subject who is free therefrom as well as slowing or by co-administration of the agent with cholera toxin or reducing progression of existing disease. detoxified derivatives or subunits thereof or other similar bacterial toxins (See Glenn et al., Nature 391, 851 (1998)). Treatment Regimes. Co-administration can be achieved by using the components Therapeutic Use as a mixture or as linked molecules obtained by chemical crosslinking or expression as a fusion protein. Selection of Subjects Administered a Composition Compris 0334 Alternatively, transdermal delivery can be achieved ing an Engineered Bacteriophage using a skin patch or using transferosomes (Paul et al., Eur. J. 0339. In some embodiments, an anti-amyloid peptide Immunol. 25, 3521-24 (1995); Cevc et al., Biochem. Bio engineered bacteriophage and compositions thereofare use phys. Acta 1368, 201-15 (1998)). ful in a method to treat a Subject with an amyloid associated 0335 Suitable choices in amounts and timing of doses, disease or disorder, which include for example but are not formulation, and routes of administration can be made with limited to, amyloid-related diseases, Alzheimer's Disease, the goals of achieving a favorable response in the Subject with Down's syndrome, vascular dementia or cognitive impair a bacterial infection or infection with a microorganism, for ment, type II diabetes mellitus, amyloid A (reactive), second example, a favorable response is killing or elimination of the ary amyloidosis, familial mediterranean fever, familial neph microorganism or bacteria, or control of or inhibition of rology with urtcaria and deafness (Muckle-wells Syndrome), growth of the bacterial infection in the subject or a subject at amyloid lambda L-chain or amyloid kappa L-chain (idio risk thereof (i.e., efficacy), and avoiding undue toxicity or pathic, multiple myeloma or macroglobulinemia-associated) other harm thereto (i.e., safety). Therefore, “effective' refers A beta 2M (chronic hemodialysis), ATTR (familial amyloid to Such choices that involve routine manipulation of condi polyneuropathy (Portuguese, Japanese, Swedish), familial tions to achieve a desired effect or favorable response. amyloid cardiomyopathy (Danish), isolated cardiac amyloid, US 2012/03.01433 A1 Nov. 29, 2012 39
(systemic senile amyloidosis) AIAPP or amylin insulinoma, amyloidosis which are commonly known by person skilled in atrial naturetic factor (isolated atrial amyloid), procalcitonin the art, and are encompassed for use in the present invention. (medullary carcinoma of the thyroid), gelsolin (familial amy These include measurement of including blood and urine loidosis (Finnish), cyctatin C (heredity cerebral hemorrhage tests, though blood or urine tests may detect an abnormal with amyloidosis (Icelandic), AApo-A-I (familial amy protein, which could indicate amyloidosis, the only definitive loidotic polyneuropathy—Iowa), AApo-A-II (accelerated test for amyloidosis is a tissue biopsy, in which the physical senescence in mice), fibrinogen-associated amyloid; Parkin analyses a small sample of tissue. The tissue sample may be son's disease, systemic amyloidoses (e.g., AL-, AA-, ATTR-. taken from one or more parts of the subject's body, for Abeta 2, microglobulin, IAPP/amylin amyloidosis) and Asor example abdominal fat, bone marrow or rectum, which is then examined under a microscope in a laboratory to check for or Pr P-27 (scrapie, Creutzfeld jacob disease, Gertsmann signs of amyloid. Occasionally, tissue samples may be taken Straussler-Scheinker syndrome, bovine spongiform encepha from other parts of your body, such as your liver or kidney, to litis) and Subjects who are homozygous for the apolipoprotein help diagnose the specific organ affected by amyloidosis. E4 allele. 0341 Primary Amyloidosis. 0340 Other types of amyloid associated disorders include, for example AL amyloidosis, for example primary 0342. This most common form of amyloidosis primarily amyloidosis, secondary amyloidosis and hereditary amyloi affects your heart, kidneys, tongue, nerves and intestines. dosis. Without being bound by theory, in AL-amyloidosis are Primary amyloidosis isn't associated with other diseases fibrils of AL amyloid deposits which are composed of mono except for multiple myeloma, in a minority of cases. The clonal immunoglobulin light chains or fragments thereof. cause of primary amyloidosis is unknown, but doctors do More specifically, the fragments are a region of the N-termi know that the disease begins in yourbone marrow. In addition nal region of the light chain (kappa or lambda), or derivatives to producing red and white blood cells and platelets, your thereof, and contain all or part of the variable (V) domain bone marrow makes antibodies, the proteins that protect you thereof. More specifically, the fragments do not contain a against infection and disease. After antibodies serve their region of the heavy chain of the variable region (V). Depos function, your body breaks them down and recycles them. its generally occur in the mesenchymal tissues, causing Amyloidosis occurs when cells in the bone marrow produce peripheral and autonomic neuropathy, carpal tunnel Syn antibodies that can’t be broken down. These antibodies then drome, macroglossia, restrictive cardiomyopathy, arthropa build up in your bloodstream. Ultimately, they leave your thy of large joints, immune dyscrasias, multiple myelomas, as bloodstream and can depositinyour tissues as amyloid, inter well as ocular dyscrasias. However, it should be noted that fering with normal function. almost any tissue, particularly visceral organs such as the 0343 Secondary Amyloidosis. heart, may be involved. In light chain amyloidosis (AL-amy 0344. This form occurs in association with chronic infec loidosis) a monoclonal immunoglobulin light chain forms the tious or inflammatory diseases, such as tuberculosis, rheuma amyloid deposits. See Glenner et al., Amyloid Fibril Proteins: toid arthritis or osteomyelitis, a bone infection. It primarily Proof of Homology with Immunoglobulin Light Chains by affects your kidneys, spleen, liver and lymph nodes, though Sequence Analyses, Science 172:1150-1151, 1971. Amyloid other organs may be involved. Treatment of the underlying fibrils from patients suffering AL-amyloidosis occasionally disease may help stop this form of amyloidosis. contain only intact light chains, but more often they are (0345 Hereditary Amyloidosis. formed by proteolytic fragments of the light chains which 0346. As the name implies, this form of amyloidosis is contain the VL domain and varying amounts of the constant inherited. This type often affects the nerves, heart and kid domain, or by a mixture of fragments and full-length light neyS. chains. Not all light chains from plasma cell dyscrasias form 0347 There are a variety of other forms of amyloid asso protein deposits; some circulate throughout the body at high ciated disease and disorders that are normally manifest as concentrations and are excreted with the subject's urine with localized deposits of amyloid. In general, these diseases are out pathological deposition of the protein in vivo. See probably the result of the localized production and/or lack of Solomon, Clinical Implications of Monoclonal Light Chains, catabolism of specific fibril precursors or a predisposition of Semin. OncoL 13:341-349, 1986; Buxbaum, Mechanisms of a particular tissue (Such as the joint) for fibril deposition. Disease: Monoclonal Immunoglobulin Deposition, Amyloi Examples of Such idiopathic deposition include nodular AL dosis, Light Chain Deposition Disease, and Light and Heavy amyloid, cutaneous amyloid, endocrine amyloid, and tumor Chain Deposition Disease, Hematol/Oncol. Clinics of North related amyloid. America 6:323-346, 1992; and Eulitz, Amyloid Formation 0348. In some types of hereditary amyloidoses, single from Immunoglobulin Chains, Biol. Chef Hoppe-Seyler 373: amino acid changes in normal human proteins are responsible 629-633, 1992. Subjects suffering from AL amyloidosis can for amyloid fibril formation See Natvig et al., Amyloid and be recognized from methods known by a physician of ordi Amyloidosis 1990. Dordrecht, The Netherlands: Kluwer nary skill, for example, typical symptoms of amyloidosis Academic Publishers, 1991, and references cited therein. It is depend on the organ affected and include a wide range of unlikely, however, that any single amino acid position or symptoms, for example but are not limited to at least one of substitution willfully explain the many different immunoglo the following or combinations of Swelling of your ankles and bulin light chain sequences associated with AL-amyloidosis. legs, weakness, weight loss, shortness of breath, numbness or Rather, several different regions of the light chain molecule tingling in your hands or feet, diarrhea, severe fatigue, an may sustain one or more Substitutions which affect a number enlarged tongue (macroglossia), skin changes, an irregular of biophysical characteristics, such as dimer formation, expo heartbeat, and difficulty Swallowing. In some instances, the sure of hydrophobic residues, solubility, and stability. Subject may not experience any of the symptoms listed but 0349 Heavy chain diseases are neoplastic plasma cell still has amyloidosis. In addition, a number of diagnostic tests dyscrasias characterized by the overproduction of homog are available for identifying Subjects at risk of, or having AL enous C. Y., and mu Ig heavy chains. These disorders result in US 2012/03.01433 A1 Nov. 29, 2012 40 incomplete monoclonal Igs. The clinical picture is more like 0353. In some embodiments, a subject with an amyloid lymphoma than multiple myeloma. associated disorder is a Subject having or likely to develop a 0350. In some embodiments, the present invention pro bacterial infection where the bacteria forma biofilm, or where vides methods to treat a disease and/or disorder associated the Subject has been non-responsive to prior therapy or with an amyloidogenic disease oran amyloid-associated dis administration with an anti-amyloid peptide. order. Amyloidogenic diseases and amyloid-associated dis 0354 Accordingly, in some embodiments, a subjects suf orders are diseases from the Secretion of a protein and/or fering from, or at risk of developing an amyloid-associated peptide that aggregates and forms a deposit and is character disorders is administered an anti-amyloid peptide engineered ized by amyloid deposits or fibril formation. The methods of bacteriophage. 0355. In some embodiments, a subject can be adminis the present invention provide use of anti-amyloid peptides for tered a composition comprising at an anti-amyloid peptide the treatment of Such amyloidogenic diseases or amyloid engineered bacteriophage which expresses, for example at associated disorders. Such amyloidogenic diseases and amy least one, 2, 3, or 4 or as many of 10 different anti-amyloid loid-associated disorders include, for example but is not lim peptides. In some embodiments, a Subject is administered at ited to, Alzheimer's disease, Parkinson's disease, Down's least one anti-amyloid peptide engineered bacteriophage, as syndrome, vascular dementia or cognitive impairment, type II disclosed herein, or a plurality anti-amyloid peptide engi diabetes mellitus, amyloid A (reactive), secondary amyloido neered bacteriophages, for example, for example at least 2, 3, sis, familial mediterranean fever, systemic amyloidoses (e.g., or 4 or as many of 10 different anti-amyloid peptide engi AL, AA, ATTR, A beta 2 microglobulin, IAPP/amylin), neered bacteriophage as disclosed herein. In some embodi familial nephrology with urtcaria and deafness (Muckle ments, the composition can comprise an anti-amyloid peptide wells Syndrome), amyloid lambda L-chain or amyloid kappa engineered bacteriophage with at least one or a variety of L-chain (idiopathic, multiple myeloma or macroglobuline different other bacteriophages, or different anti-amyloid pep mia-associated) A beta 2M (chronic hemodialysis), ATTR tide engineered bacteriophage. In alternative embodiments, (familial amyloid polyneuropathy (Portuguese, Japanese, the composition can comprise at least two, or at least 3, 4, 5 or Swedish), familial amyloid cardiomyopathy (Danish), iso as many of 10 different anti-amyloid peptide engineered bac lated cardiac amyloid, (systemic senile amyloidosis) AIAPP teriophage, wherein each of the anti-amyloid peptide engi or amylin insulinoma, atrial naturetic factor (isolated atrial neered bacteriophages comprise a nucleic acid which amyloid), procalcitonin (medullary carcinoma of the thy encodes at least different anti-amyloid peptide. Any combi roid), gelsolin (familial amyloidosis (Finnish), cyctatin C nation and mixture of anti-amyloid peptide engineered bac (heritiaty cerebral hemorrhage with amyloidosis (Icelandic), teriophages are useful in the compositions and methods of the AApo-A-I (familial amyloidotic polyneuropathy—Iowa). present invention. AApo-A-II (accelerated senescence in mice), fibrinogen-as 0356. In some embodiments, an anti-amyloid peptide sociated amyloid; and Asor or Pr P-27 (scrapie, Creutzfeld engineered bacteriophage is administered to a subject at the jacob disease, Gertsmann-Straussler-Scheinker syndrome, same time, prior to, or after the administration of an additional bovine spongiform encephalitis) and person who are agent. In some embodiments, an anti-amyloid peptide engi homozygous for the apolipoprotein E4 allele. neered bacteriophage can be formulated to a specific time 0351. As used herein, the terms “prevent,” “preventing release for activity, Such as the an anti-amyloid peptide engi and “prevention” refer to the avoidance or delay in manifes neered bacteriophage is present in a time-release capsule. In tation of one or more symptoms or measurable markers of a Such embodiments, an anti-amyloid peptide that is formu disease or disorder. Adelay in the manifestation of a symptom lated for time-release can be administered to a subject at the or marker is a delay relative to the time at which Such symp same time, concurrent with, or prior to, or after the adminis tom or marker manifests in a control or untreated Subject with tration of an additional agent, Such as an additional therapeu a similar likelihood or susceptibility of developing the disease tic, anti-amyloid peptide or agent which inhibits fiber asso or disorder. The terms “prevent.” “preventing” and “preven ciation. Methods of formulation of an anti-amyloid peptide tion' include not only the complete avoidance or prevention engineered bacteriophage for release in a time-dependent of symptoms or markers, but also a reduced severity or degree manner are disclosed herein as “sustained release pharmaceu of any one of those symptoms or markers, relative to those tical compositions' in the section entitled “pharmaceutical symptoms or markers arising in a control or non-treated indi formulations and compositions.” Accordingly, in Such vidual with a similar likelihood or susceptibility of develop embodiments, a time-release an anti-amyloid peptide engi ing the disease or disorder, or relative to symptoms or markers neered bacteriophage can be administered to a Subject at the likely to arise based on historical or statistical measures of same time (i.e. concurrent with), prior to or after the admin populations affected by the disease or disorder. By “reduced istration of an additional agent, such as an additional thera severity' is meant at least a 10% reduction in the severity or peutic agent or therapeutic agent. degree of a symptom or measurable disease marker, relative 0357. In some embodiments, an additional agent admin to a control or reference, e.g., at least 15%, 20%, 30%, 40%, istered at the same or different time as an anti-amyloid pep 50%. 60%, 70%, 80%, 90%. 95%, 99% or even 100% (i.e., no tide engineered bacteriophage can be a pro-drug, where it is symptoms or measurable markers). activated by a second agent. Accordingly, in Such embodi 0352. In some embodiments, a subject amenable for the ments, a pro-drug agent can be administered to a subject at the methods as described herein or for the administration with a same time, concurrent with, or prior to, or after the adminis composition comprising at least one anti-amyloid peptide tration of an anti-amyloid peptide engineered bacteriophage, engineered bacteriophage is selected based on the desired and administration of an agent which activates the pro-drug treatment regime. For instance, a subject is selected for treat into its active form can be administered the same time, con ment if the subject suffers from, or is at risk of an amyloid current with, or prior to, or after the administration of the associated disorder. anti-amyloid peptide engineered bacteriophage. US 2012/03.01433 A1 Nov. 29, 2012
0358. In some embodiments, a subject is selected for the APP to AB, particularly processing of APP to increased administration with the compositions comprising an anti amounts of the long form of A (i.e., AB 1-42 and AB 1-43). amyloid peptide engineered bacteriophage as disclosed Mutations in other genes, such as the presenilin genes, PS1 herein by identifying a Subject that needs a specific treatment and PS2, are thought indirectly to affect processing of APP to regimen, and is administered an anti-amyloid peptide engi generate increased amounts of long form AB (see Hardy, neered bacteriophage concurrently with, or prior to, or after TINS 20, 154 (1997)). These observations indicate that AB, administration with an additional therapeutic agent. and particularly its long form, is a causative element in Alzhe 0359. Using a subject with cystic fibrosis as an exemplary imer's disease. example, a Subject could be administered an anti-amyloid 0363 AB, also known as B-amyloid peptide, or A4 peptide peptide engineered bacteriophage to avoid chronic endobron (see U.S. Pat. No. 4,666,829; Glenner & Wong, Biochem. chial infections, such as those caused by pseudomonas Biophys. Res. Commun. 120, 1131 (1984)) in the art, is a aeruginosis or stentrophomonas peptide of 39-43 amino acids, is the principal component of 0360. As disclosed in the Example 9, the inventors discov characteristic plaques of Alzheimer's disease. AB is gener ered that the nucleating sequence of CsgB (e.g. CsgBalao) ated by processing of a larger protein APP by two enzymes, as TAIVVQR (SEQ ID NO: 196) can inhibit formation of termed Bandy secretases (see Hardy, TINS 20, 154 (1997)). amyloid from amyloid-fi nucleators, which a subset thereof Known mutations in APP associated with Alzheimer's dis contains a sequence, VVIA (SEQ ID NO: 198) exactly the ease occur proximate to the site off or Y-secretase, or within reverse of the critical nucleating sequence of CsgB, AIVV Af. For example, position 717 is proximate to the site of (SEQ ID NO: 199). Thus, in a certain embodiment, an anti Y-secretase cleavage of APP in its processing to AB, and amyloid peptide engineered bacteriophage expressing TAIV positions 670/671 are proximate to the site of B-secretase VQR (SEQ ID NO: 196) can be used for the treatment of cleavage. It is believed that the mutations cause AD disease by Alzheimer's disease. In another embodiment, an anti-amy interacting with the cleavage reactions by which AB is formed loid peptide engineered bacteriophage comprising an amino So as to increase the amount of the 42/43 amino acid form of acid sequence of AIVV (SEQID NO: 199) can also be used AB generated. for the treatment of Alzheimer's disease. In some embodi 0364 AB has the unusual property that it can fix and acti ments, the treatment is prophylactic treatment. vate both classical and alternate complement cascades. In particular, it binds to Cld and ultimately to C3bi. This asso Alzheimer's Disease ciation facilitates binding to macrophages leading to activa 0361 Alzheimer's disease (AD) is a progressive disease tion of B cells. In addition, C3bi breaks down further and then resulting in senile dementia. See generally Selkoe, TINS 16, binds to CR2 on B cells in a T cell dependent manner leading 403-409 (1993); Hardy et al., WO 92/13069; Selkoe, J. Neu to a 10,000 increase in activation of these cells. This mecha ropathol. Exp. Neurol. 53,438-447 (1994); Duffet al., Nature nism causes AB to generate an immune response in excess of 373,476-477 (1995); Games et al., Nature 373, 523 (1995). that of other antigens. Broadly speaking the disease falls into two categories: late 0365 Most therapeutic strategies for Alzheimer's disease onset, which occurs in old age (65+ years) and early onset, are aimed at reducing or eliminating the deposition of AB42 in which develops well before the senile period, i.e., between 35 the brain, typically via reduction in the generation of AB42 and 60 years. In both types of disease, the pathology is the from APP and/or some means of lowering existing AB42 same but the Babnormalities tend to be more severe and levels from sources that directly contribute to the deposition widespread in cases beginning at an earlierage. The disease is of this peptide in the brain (De Felice and Ferreira, 2002). A characterized at the macroscopic level by significant brain partial list of aging-associated causative factors in the devel shrinkage away from the cranial vault as seen in MRI images opment of sporadic Alzheimer's disease includes a shift in the as a direct result of neuronal loss and by two types of macro balance between A3 peptide production and its clearance scopic lesions in the brain, senile plaques and neurofibrillary from neurons that favors intracellular accumulation, tangles. Senile plaques are areas comprising disorganized increased secretion of AB peptides by neurons into the Sur neuronal processes up to 150 um across and extracellular rounding extracellular space, increased levels of oxidative amyloid deposits, which are typically concentrated at the damage to these cells, and global brain hypoperfusion and the center and visible by microscopic analysis of sections of brain associated compensatory metabolic shifts in affected neurons tissue. Neurofibrillary tangles are intracellular deposits of tau (Cohen et al., 1988; Higgins et al., 1990; Kalaria, 2000; protein consisting of two filaments twisted about each otherin Nalivaevaa et al., 2004; Teller et al., 1996; Wen et al., 2004). pairs. 0366. The AB42 that deposits within neurons and plaques 0362. The principal constituent of the plaques is a peptide could also originate from outside of the neurons (exogenous termed AB or B-amyloid peptide. A? peptide is an internal AB42) during Alzheimer's disease pathogenesis. Levels of fragment of 39-43 amino acids of a precursor protein termed soluble AB peptides in the blood are known to be much higher amyloid precursor protein (APP). Several mutations within than in the interstitial space and CSF in the brains of healthy the APP protein have been correlated with the presence of individuals (Seubert et al., 1992) with blood as a source of Alzheimer's disease. See, e.g., Goate et al., Nature 349, 704) exogenous AB peptides that eventually deposit in the Alzhe (1991) (valine''' to isoleucine); Chartier Harlanet al. Nature imer's disease brain (Zlokovic et al., 1993). 353,844 (1991)) (valine77 to glycine); Murrellet al., Science 0367 Genetic markers of risk toward Alzheimer's disease 254, 97 (1991) (valine.77 to phenylalanine); Mullan et al., include mutations in the APP gene, particularly mutations at glycine); Murrell et al., Science 254, 97 (1991) (valine77 to position 717 and positions 670 and 671 referred to as the phenylalanine); Mullanet al., Nature Genet. 1,345 (1992) (a Hardy and Swedish mutations respectively (see Hardy, TINS, double mutation changing lysine'-methionine' to aspar Supra). Other markers of risk are mutations in the presenilin agine-leucine). Such mutations are thought to cause genes, PS1 and PS2, and ApoE4, family history of Alzhe Alzheimer's disease by increased or altered processing of imer's disease, hypercholesterolemia or atherosclerosis. Sub US 2012/03.01433 A1 Nov. 29, 2012 42 jects presently suffering from Alzheimer's disease can be individuals in the control population have not received prior recognized from characteristic dementia, as well as the pres treatment and do not suffer from Altzhiemer's disease. Mea ence of risk factors described above. In addition, a number of sured values of beta amyloid in the CSF in a subject after diagnostic tests are available for identifying Subjects who administering an anti-amyloid engineered bacteriophages as have Alzheimer's disease. These include measurement of disclosed herein are then compared with the control value. A CSF tau and AB42 levels. Elevated tau and increased AB42 decrease in the beta amyloid in the CSF of the subject relative levels signify the presence of Alzheimer's disease. Individu to the control value (i.e. a decrease of at least 10% of beta als suffering from Alzheimer's disease can also be diagnosed amyloid in a Subject) signals a positive treatment outcome. A by MMSE or ADRDA criteria. The tissue sample for analysis lack of significant decrease signals a negative treatment out is typically blood, plasma, serum, mucus or cerebral spinal COC. fluid from the patient. The sample is analyzed for indicia of an 0371. In other methods, a control value of for example immune response to any forms of AB peptide, typically AB42. beta amyloid in the CSF is determined from a control popu The immune response can be determined from the presence lation of subjects who have undergone treatment with a thera of, e.g., antibodies or T-cells that specifically bind to AB peutic agent that is effective at reducing beta amyloid in the peptide. ELISA methods of detecting antibodies specific to CSF. Measured values of CSF beta amyloid in the subjectare A? are described in the Examples section. compared with the control value. 0368. In asymptomatic patients, treatment can begin at 0372. In other methods, a subject who is not presently any age (e.g., 10, 20, 30). Usually, however, it is not necessary receiving treatment with an anti-amyloid engineered bacte to begin treatment until a patient reaches 40, 50, 60 or 70. riophages as disclosed herein, but has undergone a previous Treatment typically entails at least one, or multiple dosages of course of treatment is monitored for beta amyloid in the CSF a composition comprising an anti-amyloid engineered bacte to determine whether a resumption of treatment is required. riophage over a period of time. Treatment can be monitored The measured value of CSF beta amyloid in the test subject by assaying the amount of A peptide, or the amount of AB can be compared with a level of the CSF beta amyloid in the peptide in the CSF over time. If the AB peptide is still present previously achieved in the subject after a previous course of in the CSF additional treatment with anti-amyloid engineered treatment. A significant decrease in CSF beta amyloid relative bacteriophages as disclosed herein are recommended, and/or to the previous measurement (i.e., a decrease of at least 10%) treatment of additional therapies for Alzheimer's disease. In is an indication that treatment can be resumed. Alternatively, the case of potential Down's syndrome patients, treatment the level of beta amyloid in the CSF in the subject can be with an anti-amyloid engineered bacteriophage can begin compared with a control level of CSF beta amyloid deter antenatally by administering therapeutic agent to the mother mined in a population of subjects after undergoing a course of or shortly after birth. treatment. Alternatively, the level of CSF beta amyloid in a 0369. In some embodiments, anti-amyloid engineered Subject can be compared with a control value in populations bacteriophages as disclosed herein are also useful in the treat of prophylatically treated subjects who remain free of symp ment of other neurodegenerative disorders with amyloid toms of disease, or populations of therapeutically treated deposits, e.g., Creutzfeldt-Jakob or mad cow disease, Hun Subjects who show amelioration of disease symptoms. tington's disease, multiple Sclerosis, Parkinson's disease, Pick disease and other brain storage disorders (e.g., amyloi Methods to Identify Subjects for Risk of or Having Alzhe dosis, gangliosidosis, lipid storage disorders, mucopolysac imer's Disease. charidosis). Thus, treatment with an anti-amyloid engineered 0373 Subjects amenable to treatment using the methods bacteriophage as disclosed herein can be directed to a subject as disclosed herein, Such as for the administration of a com who is affected with, yet asymptomatic of a neurodegenera position comprising an anti-amyloid engineered bacterioph tive disease characterized by amyloid deposits. The efficacy age, e.g., a bacteriophage expressing at least CsgBiss-142. of treatment can be determined by measuring the presence e.g., expressing RRR-CsgB-PPP, include Subjects at and amount of Tau or AB in the CSF. Some methods entail risk of a neurodegenerative disease, for example Alzheimer's determining a baseline value of for example the level of beta Disease but not showing symptoms, as well as Subjects show amyloid in the CSF of a subject before administering a dosage ing symptoms of the neurodegenerative disease, for example of an anti-amyloid engineered bacteriophage, and comparing subjects with symptoms of Alzheimer's Disease. this with a value for beta amyloid in the CSF after treatment 0374. Subjects can be screened for their likelihood of hav with an anti-amyloid engineered bacteriophages. A decrease, ing or developing Alzheimer's Disease based on a number of for example a 10% decrease in the level of beta amyloid in the biochemical and genetic markers. CSF indicates a positive treatment outcome (i.e., that admin 0375 One can also diagnose a subject with increased risk istration of the anti-amyloid engineered bacteriophage has of developing Alzheimer's Disease using genetic markers for achieved or augmented a decrease in the amount or level of Alzheimer's Disease. Genetic abnormality in a few families beta amyloid in the CSF). If the value for level of beta amyloid has been traced to chromosome 21 (St. George-Hyslop et al., in the CSF does not change significantly, or increases, a Science 235:885-890, 1987). One genetic marker is, for negative treatment outcome is indicated. In general, Subjects example mutations in the APP gene, particularly mutations at undergoing an initial course of treatment with an anti-amy position 717 and positions 670 and 671 referred to as the loid engineered bacteriophage are expected to show a Hardy and Swedish mutations respectively (see Hardy, TINS, decrease in beta amyloid in the CSF with successive dosages Supra). Other markers of risk are mutations in the presenilin of an anti-amyloid engineered bacteriophage as described genes, PS1 and PS2, and ApoE4, family history of Alzhe herein. imer's Disease, hypercholesterolemia or atherosclerosis. 0370. In other methods to determine efficacy of treatment, Subjects with APP PS1 or PS2 mutations are highly likely to a control value (i.e., a mean and standard deviation) of beta develop Alzheimer's disease. ApoE is a Susceptibility gene, amyloid is determined for a control population. Typically the and subjects with the e4 isoform of ApoE (ApoE4 isoform) US 2012/03.01433 A1 Nov. 29, 2012
have an increased risk of developing Alzheimer's disease. able” Alzheimer's Disease include (a) dementia established Test for subjects with ApoE4 isoform are disclosed in U.S. by clinical examination and documented by a test such as the Pat. No. 6,027,896, which is incorporated in its entirety Mini-Mental test (Foldstein et al., J. Psych. Res. 12:189-198, herein by reference. Other genetic links have been associated 1975); (b) deficits in two or more areas of cognition; (c) with increased risk of Alzheimer's disease, for example vari progressive worsening of memory and other cognitive func ances in the neuronal sortilin-related receptor SORL1 may tions; (d) no disturbance of consciousness; (e) onset between have increased likelihood of developing late-onset Alzhe ages 40 and 90, most often after age 65; and (f) absence of imer's disease (Rogaeva at al. Nat Genet. 2007 February; systemic orders or other brain diseases that could account for 39(2):168-77). Other potential Alzheimer disease suscepti the dementia. The criteria for definite diagnosis of Alzhe bility genes, include, for example ACE, CHRNB2, CST3, imer's Disease include histopathologic evidence obtained ESR1, GAPDHS, IDE, MTHFR, NCSTN, PRNP, PSEN1, from a biopsy, or after autopsy. Since confirmation of definite TF, TFAM and TNF and be used to identify subjects with Alzheimer's Disease requires histological examination from increased risk of developing Alzheimer's disease (Bertram et a brain biopsy specimen (which is often difficult to obtain), it al, Nat Genet. 2007 January: 39(1):17-23), as well as vari is rarely used for early diagnosis of Alzheimer's Disease. ences in the alpha-T catenin (VR22) gene (Bertram et al., J 0380. One can also use neuropathologic diagnosis of Med Genet. 2007 January; 44(1):eo3) and Insulin-degrading Alzheimer's Disease, where the numbers of plaques and enzyme (IDE) and Kim et al, J Biol Chem. 2007: 282:7825 tangles in the neurocortex (frontal, temporal, and parietal 32). lobes), hippocampus and amygdala are analyzed (Khacha 0376 One can also diagnose a subject with increased risk turian, Arch. Neurol. 42:1097-1105; Esiri, “Anatomical Cri of developing Alzheimer's disease on the basis of a simple eye teria for the Biopsy diagnosis of Alzheimer's Disease.” test, where the presence of cataracts and/or Abeta in the lens Alzheimer's Disease, Current Research in Early Diagnosis, identifies a subject with increased risk of developing Alzhe Becker and Giacobini (eds.), pp. 239-252, 1990). imer's Disease. Methods to detect Alzheimer's disease 0381. One can also use quantitative electroencephalo include using a quasi-elastic light scattering device (Gold graphic analysis (EEG) to diagnose Alzheimer's Disease. stein et al., Lancet. 2003: 12:361:1258-65) from Neuroptix, This method employs Fourier analysis of the beta, alpha, using Quasi-Elastic Light Scattering (QLS) and Fluorescent theta, and delta bands (Riekkinen et al., “EEG in the Diagno Ligand Scanning (FLS) and a NeuroptixTM QEL scanning sis of Early Alzheimer's Disease.” Alzheimer's Disease, Cur device, to enable non-invasive quantitative measurements of rent Research in Early Diagnosis, Becker and Giacobini amyloid aggregates in the eye, to examine and measure (eds.), pp. 159-167, 1990) for diagnosis of Alzheimer's Dis deposits in specific areas of the lens as an early diagnostic for CaSC. Alzheimer's disease. Method to diagnose a subject at risk of 0382 One can also diagnose Alzheimer's Disease by developing Alzheimers disease using Such a method of non quantifying the degree of neural atrophy, since Such atrophy is invasive eye test are disclosed in U.S. Pat. No. 7,107,092, generally accepted as a consequence of Alzheimer's Disease. which is incorporated in its entirety herein by reference. Examples of these methods include computed tomographic 0377 Individuals presently suffering from Alzheimer's scanning (CT), and magnetic resonance imaging (MRI) (Lee disease can be recognized from characteristic dementia, as dom and Miller, “CT, MRI, and NMR Spectroscopy in Alzhe well as the presence of risk factors described above. In addi imer's Disease.” Alzheimer's Disease, Current Research in tion, a number of diagnostic tests are available for identifying Early Diagnosis, Becker and Giacobini (eds.), pp. 297-313, individuals who have AD. These include measurement of 1990). CSF tau and AX3b242 levels. Elevated tau and decreased 0383. One can also diagnose Alzheimer's Disease by AX3b242 levels signify the presence of Alzheimer's Disease. assessing decreased cerebral blood flow or metabolism in the 0378. There are two alternative “criteria' which are uti posterior temporoparietal cerebral cortex by measuring lized to clinically diagnose Alzheimer's Disease: the DSM decreased blood flow or metabolism by positron emission IIIR criteria and the NINCDS-ADRDA criteria (which is an tomography (PET) (Parks and Becker, “Positron Emission acronym for National Institute of Neurological and Commu Tomography and Neuropsychological Studies in Dementia.” nicative Disorders and Stroke (NINCDS) and the Alzheimer's Alzheimer's Disease's, Current Research in Early Diagnosis, Disease and Related Disorders Association (ADRDA); see Becker and Giacobini (eds.), pp. 315-327, 1990), single pho McKhann et al., Neurology 34:939-944, 1984). Briefly, the ton emission computed tomography (SPECT) (Mena et al., criteria for diagnosis of Alzheimer's Disease under DSM “SPECT Studies in Alzheimer's Type Dementia Patients.” IIIR include (1) dementia, (2) insidious onset with a generally Alzheimer's Disease, Current Research in Early Diagnosis, progressive deteriorating course, and (3) exclusion of all Becker and Giacobini (eds.), pp. 339-355, 1990), and xenon other specific causes of dementia by history, physical exami inhalation methods (Jagust et al., Neurology 38:909-912: nation, and laboratory tests. Within the context of the DSM Prohovniketal., Neurology38:931-937; and Waldemaret al., IIIR criteria, dementia is understood to involve “a multifac Senile Dementias: II International Symposium, pp. 3994.07, eted loss of intellectual abilities. Such as memory, judgement, 1988). abstract thought, and other higher cortical functions, and 0384 One can also immunologically diagnose Alzhe changes in personality and behaviour.” (DSM-1IR, 1987). imer's disease (Wolozin, “Immunochemical Approaches to 0379. In contrast, the NINCDS-ADRDA criteria sets forth the Diagnosis of Alzheimer's Disease.” Alzheimer's Disease, three categories of Alzheimer's Disease, including “prob Current Research in Early Diagnosis, Becker and Giacobini able.” “possible.” and “definite” Alzheimer's Disease. Clini (eds.), pp. 217-235, 1990). Wolozin and coworkers (Wolozin cal diagnosis of “possible” Alzheimer's Disease may be made et al., Science 232:648-650, 1986) produced a monoclonal on the basis of a dementia syndrome, in the absence of other antibody “Alz50,” that reacts with a 68-kDa protein “A68.” neurologic, psychiatric or systemic disorders Sufficient to which is expressed in the plaques and neuron tangles of cause dementia. Criteria for the clinical diagnosis of “prob patients with Alzheimer's disease. Using the antibody Alz50 US 2012/03.01433 A1 Nov. 29, 2012 44 and Western blot analysis, A68 was detected in the cerebral 0388 Dementia diagnosis can be based the guidelines of spinal fluid (CSF) of some Alzheimer's patients and not in the the American Academy of Neurology Practice Parameter CSF of normal elderly patients (Wolozin and Davies, Ann. published in 2001. Diagnosis of Alzheimers disease can be Neurol. 22:521-526, 1987). based on the NINDS-ADRDA criteria. Diagnosis of vascular 0385 One can also diagnose Alzheimer's disease using dementia can be based on State of California AD Diagnostic neurochemical markers of Alzheimer's disease. Neurochemi and Treatment Centers criteria. One can communicate the cal markers which have been associated with Alzheimer's diagnostic conclusion to the patient and family at a Subse Disease include reduced levels of acetylcholinesterase (Gia quent meeting. If the diagnostic conclusion indicates that the cobini and Sugaya, “Markers of Cholinergic Dysfunction in patient or subject has or is likely to have dementia and/or Alzheimer's Disease.” Alzheimer's Disease, Current memory loss, a clinician can advise treatment administration Research in Early Diagnosis, Becker and Giacobini (eds.), with an effective amount of an anti-amyloid engineered bac pp. 137-156, 1990), reduced somatostatin (Tamming a et al., teriophage, e.g., a bacteriophage expressing at least CsgBiss Neurology 37:161-165, 1987), a negative relation between 142, e.g., expressing RRR-CsgB-PPP as disclosed serotonin and 5-hydroxyindoleacetic acid (Volicer et al., Arch herein. Often presence of a social worker at the subsequent Neurol. 42:127-129, 1985), greater probenecid-induced rise meeting can also aid and direct patient and their family with in homoVanyllic acid (Gibson et al., Arch. Neurol. 42:489 current and future needs. 492, 1985) and reduced neuron-specific enolase (Cutler et al., Arch. Neurol. 43:153-154, 1986). Assessment of Anti-Amyloid Engineered Bacteriophage, Methods to Identify Subjects for Risk of or Having Dementia E.G., a Bacteriophage Expressing at Least CsgBissa, or a and/or Methods for Memory Assesment. Modified Version E.G., Expressing RRR-CsgB-PPP in 0386 Current standard practice can be used to diagnose Models of Alzheimer's Disease. the various types of dementia and, once diagnosed, to monitor 0389. In some embodiments, an anti-amyloid engineered the progression of the disease, e.g., Alzheimer's disease over bacteriophage, e.g., a bacteriophage expressing at least an extended period of time. One such method includes at least CsgB-42, e.g., expressing RRR-CsgBiss-a-PPP2 (SEQ one of the following: (i) a memory assessment, (ii) an exten ID NO: 61) can be assessed in animal models for vascular sive neuropsychological exam, (iii) an examination by a geri dementia, permitting analysis of the effects of an anti-amy atric neurologist and (iv) MRI imaging of the brain. Disease loid engineered bacteriophage, e.g., a bacteriophage express progression is documented by changes in these parameters ing at least CsgBiss-142, e.g., expressing RRR-CsgBiss-42 over time. In some embodiments, changes in the parameters PPPonvascular dementia development and treatment, as well of at least one of these assessments can be used to assess the as assessment of drug dosages on the development, prognosis efficacy of an anti-amyloid engineered bacteriophage, e.g., a and recovery from vascular dementia. bacteriophage expressing at least CsgB1-42, e.g., express 0390 Animal models of vascular dementia includes, for ing RRR-CsgB-PPP in the subject over time. example occlusion of carotidarteries in rats. See, e.g., Sartiet 0387. A memory assessment can be used by one of ordi al., Persistent impairment of gait performances and working nary skill in the art, which is used to assess adult patients with memory after bilateral common carotid artery occlusion in complaint of short term memory and/or cognitive decline are the adult Wistar rat, BEHAVIOURAL BRAIN RESEARCH seen in the Memory Assessment Program, comprising evalu 136: 13-20 (2002). Thus, cerebrovascular white matter ation by Geriatric Neurology, Neuropsychology and Social lesions can be experimentally induced in the rat brain as a services. Patients can be both self-referred or directed from result of chronic cerebral hypoperfusion. This model is cre community clinicians and physicians on the Suspicion of a ated by permanent occlusion of both common carotidarteries. possible or probable memory disorder or dementia. In such a For example, Wistar rats can be anesthetized, the bilateral memory assessment, at the time of the initial evaluation, all of common carotid arteries are exposed through a midline cer the evaluations such as (i) memory assessment (ii) an exten Vical incision and the common carotid arteries are double sive neuropsychological exam, (iii) an examination by a geri ligated with silk sutures bilaterally. The cerebral blood flow atric neurologist and (iv) MRI imaging of the brain are per (CBF) then initially decreases by about 30 to 50% of the formed the same day. The neuropsychology assessment control after ligation. The CBF values later range from 40 to captures abroad inventory of cognitive function which aids in 80% of control after about 1 week to about 1 month. Blood determining the array and severity of deficits. These include brain barrier disruptions have also been observed as well as assessments of Judgement, Insight, Behavior, Orientation, increased matrix metalloproteinase activity in white matter Executive Control, General Intellectual Functioning, Visual lesions. These changes appear very similar to those in human spatial Function, Memory and New Learning Ability. Depres cerebrovascular white matter lesions. Moreover, these results Sion, if present, is identified. The neurological evaluation Suggest that inflammatory and immunologic reactions play a captures the history of cognitive alteration as well as the role in the pathogenesis of the white matter changes. general medical history, and typically a complete neurologi 0391 Such physiological changes are correlated with cal exam is performed. The neurological examination can learning and memory problems in the occluded carotid artery also comprise laboratory studies to exclude reversible causes rat model. Thus, the gait performance of rats with occluded of dementia including Vitamin B12. Folate, Basic Metabolic arteries declines over time in comparison with baseline, for Profile, CBC, TSH, ALT, AST, C-reactive protein, serum example, at and 90 days, rats with bilateral common carotid homocysteine, and RPR. The brain imaging provides a struc artery occlusion have decreased performances on object rec tural brain image. Such as brain MRI, although one can use ognition and Y maze spontaneous alternation test in compari other brain imaging methods known by persons of ordinary son with sham-operated rats. Thus, this rat model of experi skill in the art. The data matrix of history, neuropsychologic mental chronic cerebral hypoperfusion by permanent tests, neurologic examination, laboratory studies and neu occlusion of the bilateral common carotid arteries is useful as roimaging is used to formulate the diagnosis. a model for significant learning impairments along with rar US 2012/03.01433 A1 Nov. 29, 2012
efaction of the white matter. This model is a useful tool to 50-56), amyotrophic lateral sclerosis (Zhu et al., 2002, Nature assess the effectiveness of an anti-amyloid engineered bacte 417: 74-78), Pick's disease (Lee & Trojanowski, 2001, Neu riophage, e.g., a bacteriophage expressing at least CsgBiss rology 56 (Suppl. 4): S26-S30, and spongiform encephalo 142, e.g., expressing RRR-CsgB-PPP on the patho pathies (He et al., 2003, Science 299: 710-712) can be used to physiology of chronic cerebral hypoperfusion, and to provide evaluate the efficacy of an anti-amyloid engineered bacte data for determining optimal dosages and dosage regimens riophage, e.g., a bacteriophage expressing at least CsgB. for preventing the cognitive impairment and white matter 142, e.g., expressing RRR-CsgB-PPP as disclosed lesions in patients with cerebrovascular disease. herein in a similar manner. 0392 The effectiveness of an anti-amyloid engineered 0395 Animal models are not limited to mammalian mod bacteriophage, e.g., a bacteriophage expressing at least els. For example, Drosophila strains provide accepted models CsgB e.g., expressing RRR-CsgB-PPP for for a number of neurodegenerative disorders (reviewed in treating or preventing vascular dementia can therefore be Fortini & IBonini, 2000, Trends Genet. 16:161-167; Zoghbi determined by observing the gait performance, memory, & Botas, 2002, Trends Genet. 18: 463-471). These models learning abilities and the incidence and severity of white include not only flies bearing mutated fly genes, but also flies matter lesions in rats with carotid artery occlusions. Simi bearing human transgenes, optionally with targeted muta larly, the dosage and administration schedule of an anti-amy tions. Among the Drosophila models available are, for loid engineered bacteriophage, e.g., a bacteriophage express example, spinocerebellar ataxias (e.g., SCA-1 (see, e.g., WO ing at least CsgBiss-42, e.g., expressing RRR-CsgBiss-a- 02/058626), SCA-3 (Warricket al., 1998, Cell 93:939-949)), PPP can be adjusted pursuant to the memory and learning Huntington's disease (Kazemi-Esfarjani & Benzer, 2000, abilities of human patients being treated for vascular demen Science 287: 1837-1840), Parkinson's disease (Feany et al. tia. 2000, Nature 404: 394-398; Aulucket al., 2002, Science 295: 0393. In other embodiments, the optimum dosage of an 809-8 10), age-dependent neurodegeneration (Genetics, anti-amyloid engineered bacteriophage, e.g., a bacteriophage 2002, 161:4208), Alzheimer's disease (Selkoe et al., 1998, expressing at least CsgB-42, e.g., expressing RRR Trends Cell Biol. 8: 447-453;Yeet al., 1999, J. Cell Biol. 146: CsgB-PPP is one generating the maximum beneficial 1351-1364), amyotrophic lateral sclerosis (Parkes et al., effect on damaged tissue caused by arterial occlusion. An 1998, Nature Genet. 19: 171-174), and adrenoleukodystro effective dosage causes at least a statistically or clinically phy. significant attenuation of at least one marker, symptom, or 0396 The use of Drosophila as a model organism has histological evidence characteristic of vascular dementia. proven to be an important tool in the elucidation of human Markers, symptoms and histological evidence characteristic neurodegenerative pathways, as the Drosophila genome con of vascular dementia include memory loss, confusion, distur tains many relevant human orthologs that are extremely well bances in axonal transport, demyelination, induction of met conserved in function (Rubin, G. M., et al., Science 287: alloproteinases (MMPs), activation of glial cells, infiltration 2204-2215 (2000)). For example, Drosophila melanogaster of lymphocytes, edema and immunological reactions that carries a gene that is homologous to human APP which is lead to tissue damage and further vascular injury. Stabiliza involved in nervous system function. The gene, APP-like tion of symptoms or diminution of tissue damage, under (APPL), is approximately 40% identical to APP695, the neu conditions wherein control patients or animals experience a ronal isoform (Rosen et al., Proc. Natl. Acad. Sci. U.S.A. worsening of symptoms or tissue damage, is one indicator of 86:2478-2482 (1988)), and like human APP695 is exclu efficacy of a Suppressive treatment. sively expressed in the nervous system. Flies deficient for the APPL gene show behavioral defects which can be rescued by Assessment of an Anti-Amyloid Engineered Bacteriophage, the human APP gene, Suggesting that the two genes have E.G., a Bacteriophage Expressing at Least CsgB. E.G., similar functions in the two organisms (Luo et al., Neuron Expressing RRR-CsgB-PPP on Models of Neurode 9:595-605 (1992)). Drosophila models for Alzhiemers dis generative Diseases. ease are disclosed in U.S. Patent Applications 2004/0244064. 0394 The suitability of an anti-amyloid engineered bac 2005/0132425, 2005/0132424, 2005/0132423, 2005/ teriophage, e.g., a bacteriophage expressing at least CsgB. 0132422, 200/50132421, 2005/0108779, 2004/0255342, 142, e.g., expressing RRR-CsgB-PPP for the treatment 2004/0255341, 2004/0250302 which are incorporated herein of a neurodegenerative disease involving amyloid or fibril in their entirety by reference. accumulation can be assessed in any of a number of animal 0397. In addition, Drosophila models of polyglutamine models for neurodegenerative disease. For example, mice repeat diseases (Jackson, G. R., et al., Neuron 21:633-642 transgenic for an expanded polyglutamine repeat mutant of (1998); Kazemi-Esfarani, P. and Benzer, S., Science 287: ataxin-1 develop ataxia typical of spinocerebellar ataxia type 1837-1840 (2000): Fernandez-Funez et al., Nature 408:101-6 1 (SCA-1) are known (Burright et al., 1995, Cell 82:937-948; (2000)). Parkinson's disease (Feany, M. B. and Bender, W. Lorenzetti et al., 2000, Hum. Mol. Genet. 9: 779-785; Watase, W., Nature 404:394-398 (2000)) and other diseases have been 2002, Neuron 34:905-919), and can be used to determine the established which closely mimic the disease state in humans efficacy of an anti-amyloid engineered bacteriophage, e.g., a at the cellular and physiological levels, and have been Suc bacteriophage expressing at least CsgB1-42, e.g., express cessfully employed in identifying other genes that can be ing RRR-CsgB-PPP, for the treatment or prevention of involved in these diseases. The transgenic flies exhibit pro neurodegenerative disease. Additional animal models, for gressive neurodegeneration which can lead to a variety of example, for Huntington's disease (see, e.g., Mangiarini et altered phenotypes including locomotor phenotypes, behav al., 1996, Cell 87: 493-506, Lin et al., 2001, Hum. Mol. ioral phenotypes (e.g., appetite, mating behavior, and/or life Genet. 10: 137-144), Alzheimer's disease (Hsiao, 1998, Exp. span), and morphological phenotypes (e.g., shape, size, or Gerontol, 33: 883-889; Hsiao et al., 1996, Science 274: location of a cell, organ, or appendage; or size, shape, or 99-102), Parkinson's disease (Kim et al., 2002, Nature 418: growth rate of the fly).