PLEASE TYPE the UNIVERSITY of NEW SOUTH WALES Thesis/Dissertation Sheet

Exploring Cyclic Diguanylate Signalling in Marine Roseobacters

Raymond Sabio Regalia

A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy

School of Biotechnology and Biomolecular Sciences Faculty of Science The University of New South Wales Sydney, Australia

August 2015

PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet

Surname or Family name: REGALIA

First name: RAYMOND Other name/s: SABIO

Abbreviation for degree as given in the University calendar: PhD

School: BIOTECHNOLOGY AND BIOMOLECULAR Faculty: SCIENCE SCIENCES

Title: EXPLORING CYCLIC DIGUANYLATE SIGNALLING IN MARINE ROSEOBACTERS

Abstract 350 words maximum: (PLEASE TYPE)

The secondary messenger cyclic diguanosine monophosphate (cyclic diguanylate or cyclic-di-GMP) is regarded as a key regulator of traits involved in transition of bacteria from a motile to a sessile lifestyle. Cyclic-di-GMP signalling systems are well-studied and characterised in many terrestrial species of bacteria but remain largely unexplored in marine bacteria. This thesis explores the occurrence of cyclic-di-GMP signalling in marine roseobacters (the Roseobacter clade, Alpha-Proteobacteria), a bacterial group known for its metabolic diversity and ability to associate with eukaryotic hosts in the marine environment. Analysis of genomes of representative members of the Roseobacter clade uncovered the abundance of genes encoding for diguanylate cyclases (DGC) and phosphodiesterases (PDE), enzymes that are involved in cyclic-di-GMP synthesis and degradation, respectively, as well as genes that encode for proteins involved in cyclic-di-GMP binding. Analysis of the domain structure further revealed that many proteins contain N-terminal sensor domains that potentially link specific environmental cues to the cyclic-di-GMP pathway. Mass spectrometry measurements detected cyclic-di-GMP in all Roseobacter clade strains studied here, which was consistent with the abundance of synthesis genes. Furthermore, many strains apparently possess higher levels of cyclic-di-GMP in planktonic cells than in attached cells, a finding that expands the existing paradigm that high levels of cyclic-di-GMP promote attachment and biofilm formation, while low levels promote motility. The function of specific DGCs and PDEs was also studied in Nautella italica R11, a member of the Roseobacter clade that lives in association with marine red algae. Attachment and motility were affected by the deletion of specific genes encoding DGCs or PDEs in N. italica R11 suggesting that cyclic-di-GMP-dependent pathways are involved in the regulation of these cellular processes. In general, this thesis provides baseline information on the occurrence of cyclic-di-GMP signalling in marine bacteria, specifically, the marine Roseobacter clade, further expanding our knowledge of the genomic traits of marine roseobacters and contributing to the on-going research on the Roseobacter clade to understand their ecological success in the marine environment.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

………………………………………………… ……………………………………..…… ……….……………………... Signature Witness Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award:

THIS SHEET IS TO BE GLUED TO THE INSIDE FRONT COVER OF THE THESIS

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed:

Date: 31 August 2015

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed:

Date: 31 August 2015

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed:

Date: 31 August 2015

Abstract

Roseobacter clade uncovered the abundance of genes encoding for diguanylate cyclases

(DGC) and phosphodiesterases (PDE), enzymes that are involved in cyclic-di-GMP synthesis and degradation, respectively, as well as genes that encode for proteins involved in cyclic-di-GMP binding. Analysis of the domain structure further revealed that many proteins contain N-terminal sensor domains that potentially link specific environmental cues to the cyclic-di-GMP pathway. Mass spectrometry measurements detected cyclic-di-GMP in all Roseobacter clade strains studied here, which was consistent with the abundance of synthesis genes. Furthermore many strains apparently possess higher levels of cyclic-di-GMP in planktonic cells than in attached cells, a finding that expands the existing paradigm that high levels of cyclic-di-GMP promote attachment and biofilm formation, while low levels promote motility. The function of specific DGCs and PDEs was also studied in Nautella italica R11, a member of the

Roseobacter clade that lives in association with marine red algae. Attachment and motility were affected by the deletion of specific genes encoding DGCs or PDEs in N. italica R11 suggesting that cyclic-di-GMP-dependent pathways are involved in the

i regulation of these cellular processes. In general, this thesis provides baseline information on the occurrence of cyclic-di-GMP signalling in marine bacteria, specifically, the marine Roseobacter clade, further expanding our knowledge of the genomic traits of marine roseobacters and contributing to the on-going research on the

Roseobacter clade to understand their ecological success in the marine environment.

List of Conference Proceedings

Regalia, R. S., Barraud, N., Harder, T., Thomas, T. Kjelleberg, S. Potential Role of GGDEF Domain-Containing Proteins in the Red Algal-Associated Marine Bacterium, Nautella italica R11. The 14th International Symposium on Microbial Ecology (ISME 14), Copenhagen Denmark, 19-24 August 2012

iii

Acknowledgement

The journey towards a Ph.D. degree is not complete without significant people who became a part of the success of such once-in-a-lifetime endeavour.

I am exceptionally grateful to my wonderful supervisors Prof. Staffan Kjelleberg and Dr. Torsten Thomas who mentored me throughout these years.

Thank you Staffan, first and foremost, for accepting me as your Ph.D. student and for granting me the opportunity to work at the Centre for Marine Bio-Innovation (CMB). Thank you for your enduring patience, guidance, support and encouragement throughout the course of my Ph.D. studies. I am truly grateful for the freedom and trust you have given me to explore and be creative with my research project and as such, made me to appreciate science even more. You remained enthusiastic with my work and you never ceased to bring a positive outlook at the times when I am struggling. I will always remember that a discussion session with you always brought me back on track and kept me motivated to continue working on my experiments. I also sincerely thank you for organising my visiting studentship to the Singapore Centre on Environmental Life Sciences Engineering (SCELSE) and for the generous funding for the extension of my Ph.D. studies. I also thank you for the providing the much needed advice and feedback during the writing stages of my thesis. Indeed, I am greatly privileged and honoured to have one of the leading biofilm scientists in the world as my supervisor and mentor.

Thank you Torsten for your patience, unwavering support and guidance throughout the course of my Ph.D. studies, in particular during the conduct of my experiments. Thank you for instilling in me the capacity to examine experimental results with “German precision”, so to speak. Your attention to details is indeed uncanny! Thank you also for your prompt response to my queries however trivial they may be and for the excellent feedback on my thesis drafts. You were such a cool supervisor! It was an honour to have you as my co-supervisor and mentor.

I sincerely thank the members of my thesis panel, Dr. Tilmann Harder and Dr. Nicolas Barraud for your excellent suggestions on the project. Tilmann, thank you also for your kind assistance with the mass spectrometry analyses; Nic, thank you also for providing the much needed expression plasmids and for the much needed guidance on the cyclic-di-GMP experiments.

Huge thanks to all the brilliant, engaging and fun people at the CMB. I immensely enjoyed my stay at the CMB because of all of you: Mel G, you are the “goddess of molecular microbiology”! Thank you sparing time with me during the cloning work or was it “cloning woes” with the challenge that is R11; Neil, Janice and Brendan, thank you also for your kind assistance with cloning and PCR troubleshooting. Shaun, thanks for all the help with experimental design and stats; Becca and Tamsin, thank you for bringing Delisea plants and tons of seawater for me when I was doing the colonisation assays. Gee, for help with confocal microscopy; Michael, for helping me with the FISH trials; Thank you to people from the Level 6 lab – Carla, for all the help in setting-up biofilm flow cells, Tran, for teaching me the on-line biofilm monitoring system; Vanessa, Pej, Chao, Amy for help with access to the chemicals, reagents and consumables and help with lab equipment and resources; Jan, thanks for all help at the CMB chemistry lab; thanks to Nural for some guidance on graduate research school queries and concerns; Francesco, your “iigghhly unacceptable” expression always made us re-think our own experiments to be at par with your standards; Nigel, it was just fun having you drop by the 304 lab, hear you discuss current events, and who wouldn’t forget your impressions of CMB people! Melani, thank you for your constant prayers and encouragement; Thank you also to the all the members of the Level 6 lab, the Level 5 lab,members of Torsten’s lab and Mike’s lab and the past honours and international exchange students and iv visiting students for all the assistance and help extended to me. Thank you to the brilliant CMB postdocs, Alex, Ziggy, Tim, Martina, Anne Mai and Ross who shared their expertise in marine ecology and microbial ecology; To our fantastic mentors Su, Scott, Diane, Mike, Matt, Lachlan and Peter, many thanks for the inspiration to do CMB science; Special thanks to Adam Abdool who shared his time to help me with the graduate school administrative and financial matters of my candidacy; the CMB Admin support staff - Kirsty, Esra and Leena, who have greatly helped me with all the laboratory and travel matters.

I am exceptionally grateful to my “nerdizzles” Mar, Nas and especially Vipra - thank you for your constant support and encouragement all throughout these years, for keeping me company during late night experiments, for the lengthy discussions and “critical analyses” (or make that laugh at each other’s failed experiments!), for the small favours like sending me journal articles I needed while writing from home, for “remotely” running gels for me and for the help with the final manuscript; for being there to cheer me up when I’m down (even if it was on Gchat or WhatsApp!). Indeed, distance does not matter for enduring friendships.

This PhD endeavour would not have been possible without the funding support of the Australian Agency for International Development (AusAID), through the Australian Leadership Awards (ALA) scholarship. Thank you to Ms. Milalin Javellana , Mr. Mark Flores, Mr. John Alikpala and Mr. Paolo Marfori of the Philippines-Australia Human Resource and Organisational Development Facility (PAHRODF) who were instrumental in facilitating my academic journey to Australia. Thank you to my ALA batchmates, Marc Jim Mariano, Ricardo Sunga III, Lemuel Lopez, Jem Baldisimo, Ember Corpuz, Michelle Leonardo, Virgilio Linis, Alice Acejas and Aurelia Gomez, for the wonderful memories during the ALA Leadership Training Program in Canberra. It was a great privilege to be with such achievers in their respective fields. To the AusAid ALA and ADS scholars from all over the world, it was a pleasure meeting you all.

My sincere thanks to a number of people from UNSW: Thank you to Matthew Byron, Andrei Efendi and Tatjana Kroll of the Student Development International (SDI) and Tamara Rouse of the former International Student Services (ISS) at UNSW for the kind assistance and help with AusAID matters. Thank you to Kylie Jones and Avril Clarkson of the BABS School Office for help and assistance with the Graduate Research School (GRS) matters; Penny Hamilton for access to pens and stationeries and to Prof. Ruiting Lan and Prof. Li Zhang for approving my extension and leave of absence. Thank you also to the BABS Prep Room Staff, Sharon, Kim and Lily and for the small favours granted. To the UNSW Histology and Microscopy Unit staff, Dr. Maria Sarris, Hayley, Susan and Fei, thank you for the help with my Delisea specimens. Thank you to Elizabeth Martens and Jonathan Russell of the UNSW Graduate Research School (GRS) for guidance and assistance on matters regarding my PhD candidacy.

Thank you to Dr. Grace Chong, Melly Chua and Dr. Sharon Longford for facilitating my visit to SCELSE at Nanyang Technological University (NTU) in Singapore. Thank you also Sharon for sparing some time to read and check the final manuscript. Thank you to Dr. Victor Nesati of the National University of Singapore - Environmental Research Institute (NERI), for the kind help and assistance in generating the mass spectrometry data.

My Australian academic adventure would not have been memorable without the support and encouragement from my fellow Filo Ph.D. buddies, Patrick Garcia, Lemuel Toledano and Alfred Presbitero Jr.: I truly appreciate the times you endured my rants about my failed experiments while enjoying dinner at our fave Korean resto. Pat and Lem, I will not forget the “Pinoy Power” we forged at the UNSW Village! It was fun times with you both. Alfred, thank you for being an awesome companion during the weekends - when I needed a break from the lab (especially when Pat and Lem moved to ANU). Thanks heaps for always cheering me up. Big thanks as well for the treats during my visit to NTU; Rajiv Amarnani, it was effortless to v banter with you about microbiology and molecular biology; I am looking forward to catching up with you guys soon! Special thanks to Prof. Simon Restubog, for the thought-provoking insights into the PhD and academic world early on in my candidacy.

Nahid Sultana and Lawrence Delina, thank you for warmly accommodating me at Barker’s when I had nowhere to stay during my last month in Sydney (in the winter season at that!) and for the free food! ; Alex Kozloff, it was great to have you, a fellow Ph.D. student as a flatmate in my last year of stay at the UNSW Village.

A big shout out to my support group at the UP Marine Science Institute (UP MSI) – Seaweed Chemistry Lab, Seaweed Biodiversity and Ecology Lab and Marine Molecular Genetics Lab - Dang, James, Crimson, Ayi, Ate Ma, Faye, Joie, Kat, Denise, and the rest of the MSI RAs past and present, thank you all for the encouragement. I am forever grateful to my former mentors National Scientist and Emeritus Professor Gavino C. Trono Jr., Dr. Arturo Lluisma and Dr. Ernelea Cao – for the inspiration to pursue graduate studies. Also thank you for your recommendation letters – it paved the way not only for my acceptance as a postgraduate student at UNSW but also for the successful outcome of the AusAID ALA scholarship grant. Special thanks to Nanay Ed, Sir Coke for your utmost support on this endeavour and to Mommy Trono, for your constant prayers. To the illustrious Senior Faculty Staff of the UP MSI, thank you for the inspiration to do marine science.

I specially thank my good friend Bing not only for funding my flight to Singapore but also for spending valuable time with me to discuss my mass spectrometry data. Thank you also for looking after my well-being and for the much needed emotional support during my stay in the city and for your prayers. To the ToxicPipol, Cathy and Machel thank you for the encouragement.

To Jeow and my Cecille, I can’t promise a full-paged acknowledgement for you guys, but you know how much I am enormously grateful for pushing me hard to finish my Ph.D. Thank you for sharing your expertise in molecular biology, microbiology and biochemistry, for your excellent suggestions on writing about science and most of all thank you for constantly reminding me that I can do it; for always being there at times when I’m down and thinking of quitting. Indeed, it was all worth it!

To my extended family back home in Albay, The Philippines – the Regalias, the Ariños, the Sabaybays, the Sarions, the Salinels – my aunties and uncles, my lolos and lolas, my nephews and nieces, you were my number one fans! Thank you all for your continued prayers and support.

Most of all, I humbly dedicate this work to my Papa, Mama and Lola. Papa, I am tremendously grateful for your unwavering support all throughout this endeavour, for understanding, for caring, for your countless sacrifices and for the enduring love; Mama and Lola, you may not be physically present, but I know you are my angels guiding me from up above. I offer you with much love all my successes in life.

Table of Contents

Abstract ...... i

List of Conference Proceedings ...... iii

Acknowledgement ...... iv

Table of Contents ...... vii

List of Tables ...... xi

List of Figures ...... xii

List of Abbreviations ...... xiv

CHAPTER 1 ...... 1

General Introduction and Literature Review...... 1

1.1. LIFESTYLE DECISION-MAKING IN BACTERIA AND THE RISE OF THE BACTERIAL NUCLEOTIDE SECOND MESSENGER, CYCLIC DIGUANYLATE (CYCLIC-DI-GMP) ...... 1 1.2. CYCLIC-DI-GMP METABOLISM IN BACTERIA: SYNTHESIS, DEGRADATION AND BINDING ...... 3 1.2.1. Cyclic-di-GMP Synthesis ...... 4 1.2.2. Cyclic-di-GMP Degradation ...... 6 1.2.3. Cyclic-di-GMP Receptor or Binding Proteins...... 11 1.2.4. Bacterial Sensor Domains: Integrating Environmental Signals Into Cyclic- di-GMP Signalling ...... 14 1.2.5. Tools for Detection and Quantification of Cyclic-di-GMP in Bacterial Cells ...... 16 1.3. CYCLIC-DI-GMP REGULATION OF “STICK-OR-SWIM” LIFESTYLE ...... 18 1.3.1. Cyclic-di-GMP Regulation of Motility and Chemotaxis...... 19 1.3.2. Cyclic-di-GMP Regulation of Exopolysaccharide Production ...... 22 1.3.3. Cyclic-di-GMP Regulation of Biofilm Dispersal ...... 24 1.3.4. Cyclic-di-GMP Regulation of Bacterial Virulence ...... 27 1.4. EXPLORING CYCLIC-DI-GMP METABOLISM IN MARINE BACTERIA: FOCUS ON THE MARINE ROSEOBACTER CLADE ...... 29 1.4.1. The Marine Roseobacter Clade ...... 29 1.4.2. “Swim-or-Stick” Lifestyle Traits in Marine Roseobacters that are potentially impacted by Cyclic-di-GMP ...... 31 1.5. THESIS AIMS ...... 35

CHAPTER 2 ...... 37

vii

Identification and Characterisation of Cyclic-di-GMP Signalling Genes in Nautella italica R11 ...... 37

2.1. INTRODUCTION ...... 37 2.2. MATERIAL AND METHODS ...... 39 2.2.1. Identification of Genes Encoding Proteins with GGDEF, EAL, HD-GYP and PilZ Domains in N. italica R11...... 39 2.2.2. Determination of Domain Structure or Architecture ...... 40 2.2.3. Determination of Motif Conservation by Multiple Sequence Alignment ...... 40 2.3. RESULTS ...... 41 2.3.1. GGDEF and EAL Domain Proteins in N. italica R11 ...... 41 2.3.2. HD-GYP Domain Proteins in N. italica R11 ...... 43 2.3.3. PilZ Domain Proteins in N. italica R11 ...... 45 2.3.4. Multiple Sequence Alignment of GGDEF Domain Proteins in N. italica R11 ...... 46 2.3.5. Multiple Sequence Alignment of EAL Domain Proteins ...... 48 2.3.6. Multiple Sequence Alignment of HD-GYP Domain Proteins in N. italica R11 ...... 50 2.3.7. Multiple Sequence Alignment of PilZ Domain Proteins in N. italica R11 .... 52 2.4. DISCUSSION ...... 53 2.4.1. GGDEF Domain Proteins in N. italica R11 are Potential Diguanylate Cyclases ...... 53 2.4.2. RxxD motif of N. italica R11 GGDEF Domains Are Potential Allosteric Sites for Cyclic-di-GMP ...... 54 2.4.3. EAL and HD-GYP Domains Proteins in N. italica R11 Are Potential Cyclic- di-GMP Phosphodiesterases ...... 55 2.4.4. PilZ Domain Proteins are Potential Cyclic-di-GMP Binding Proteins in .... 57 2.4.5. Sensor Domains Associated with the GGDEF and EAL Domains Potentially Link Environmental Signals to Cyclic-di-GMP Pathway in N. italica R11 ...... 58

CHAPTER 3 ...... 61

Deletion of Genes Involved in Cyclic-di-GMP Metabolism in Nautella italica ...... 61

3.1 INTRODUCTION ...... 61 3.2. MATERIALS AND METHODS ...... 64 3.2.1 Construction of N. italica R11 Cyclic-di-GMP Gene Deletion Strains ...... 64 3.2.3. Phenotypic Characterisation of N. italica R11 Cyclic-di-GMP Gene Deletion Strains ...... 73 3.2.4. Determination of Cyclic-di-GMP Levels in Planktonic and Attached Cells . 75 3.3. RESULTS ...... 78 3.3.1. N. italica R11 Cyclic-di-GMP Gene Deletion Strains ...... 78 3.3.2. N. italica R11 Cyclic-di-GMP Complemented Strains ...... 84 3.4. DISCUSSION ...... 89 3.4.1. Cyclic-di-GMP Synthesis in N. italica R11 ...... 89 3.4.2. Manipulation of Cyclic-di-GMP Genes N. italica R11 ...... 89 3.4.3. Insights into the Potential Role of Cyclic-di-GMP in N. italica R11 ...... 95

viii

CHAPTER 4 ...... 98

Exploring Cyclic-di-GMP Signalling in Representative Marine Roseobacter Strains ... 98

4.1. INTRODUCTION ...... 98 4.2. MATERIALS AND METHODS ...... 99 4.2.1. Marine Roseobacter Strains Used in the Study ...... 99 4.2.2. Identification of Putative Diguanylate Cyclases and Phosphodiesterases in Sequenced Genomes of Representative Marine Roseobacter Strains ...... 101 4.2.3. Determination of Motif Conservation by Multiple Sequence Alignment ..... 102 4.2.4. Phylogenetic Analysis of GGDEF/EAL Domain Proteins ...... 103 4.2.5. Determination of Cyclic-di-GMP Levels in Planktonic Cells and Attached Cells ...... 103 4.3. RESULTS ...... 107 4.3.1. Genes Encoding DGCs and PDEs ...... 107 4.3.2. Genes Encoding PilZ-type Cyclic-di-GMP binding Proteins ...... 108 4.3.3. Sensor Domains or Accessory Protein Domains in the Predicted GGDEF and HD-GYP Domains Proteins ...... 108 4.3.4. Sequence Motif Conservation of the Predicted GGDEF, HD-GYP and PilZ Domains...... 116 4.3.5. Phylogeny of GGDEF and EAL Domain Proteins ...... 117 4.3.6. Surface Attachment ...... 119 4.3.7. Detection and Quantification of Cyclic-di-GMP in Planktonic and Attached Cells ...... 120 4.4. DISCUSSION ...... 122 4.4.1. Diversity, Abundance and Distribution of Cyclic-di-GMP Domain Proteins in Representative Marine Roseobacter Strains ...... 123 4.4.2. Spatial Localisation of Sensor and Accessory Domains in Predicted GGDEF Domain Proteins in Representative Marine Roseobacter Strains ...... 125 4.4.3. Cyclic-di-GMP Production in Representative Marine Roseobacter Strains ...... 127

CHAPTER 5 ...... 132

General Discussion, Future Perspectives and Concluding Remarks ...... 132

5.1. EXPLORING GENES INVOLVED IN CYCLIC-DI-GMP METABOLISM ...... 132 5.1.1. Abundance and Diversity of Genes Involved in Cyclic-di-GMP Signalling in Marine Roseobacters ...... 132 5.1.2. Identification of Sensor Domains that Link Environmental Cues to Cyclic-di- GMP Signalling in Marine Roseobacters ...... 134 5.1.3. Identification of Conserved Sequence Motifs in Predicted DGCs and PDEs ...... 134 5.1.4. Deletion and Overexpression of DGCs and PDEs ...... 135 5.1.5. Detection and Quantification of Cyclic-di-GMP Levels...... 136 5.2. INSIGHTS INTO THE ECOLOGICAL RELEVANCE OF CYCLIC-DI-GMP SIGNALLING IN THE MARINE ROSEOBACTERS ...... 137 5.2.1. Cyclic-di-GMP Production in Marine Roseobacters ...... 137 5.2.2. Linking Environmental Cues to Cyclic-di-GMP Signalling in Marine Roseobacters ...... 138

5.3. INSIGHTS INTO THE POTENTIAL ROLE OF CYCLIC-DI-GMP ON TRAITS RELEVANT FOR SURFACE COLONISATION IN MARINE ROSEOBACTERS ...... 140 5.3.1 Chemotaxis and Motility ...... 140 5.3.2. Secondary Metabolite Production ...... 141 5.4. FUTURE PERSPECTIVES AND DIRECTIONS: BIOTECHNOLOGICAL PROSPECTS FROM CYCLIC-DI-GMP SIGNALLING IN MARINE BACTERIA ...... 142 5.4.1. Biofilm Promotion Technologies ...... 142 5.4.2. Biofilm Dispersal Technologies ...... 143 5.5. CONCLUDING REMARKS ...... 144

Literature Cited ...... 146

Appendix I ...... 169

Appendix II ...... 170

Appendix III ...... 172

Appendix IV ...... 174

Appendix V ...... 175

Appendix VI ...... 180

Appendix VII ...... 184

Appendix VIII ...... 185

Appendix IX ...... 187

Appendix X ...... 189

Appendix XI ...... 196

Appendix XII ...... 199

Appendix XIII ...... 201

Appendix XIV ...... 202

Appendix XV ...... 204

Appendix XVI ...... 205

Appendix XVII ...... 207

List of Tables

Table 2.1. Predicted GGDEF and EAL Domain Proteins in the N. italica R11 Genome ...... 42

Table 2.2. Predicted HD-GYP Domain Proteins in the N. italica R11 Genome ...... 44

Table 2.3. Predicted PilZ Domain Proteins in the N. italica R11 Genome ...... 45

Table 2.4. Sequence Motif Conservation of the GGDEF Domain Proteins in N. italica R11 .... 47

Table 2.5. Sequence Motif Conservation of the Predicted EAL domain proteins in N. italica R11 ...... 50

Table 2.6. Sequence Motif Conservation of the HD-GYP Domain Proteins in N. italica R11 .. 52

Table 2.7. Sequence Motif Conservation of the PilZ Domain Proteins in N. italica R11 ...... 53

Table 3.1. Bacterial Strains and Plasmids Used ...... 64

Table 3.2. Primers for PCR Amplification of N. italica R11 DGCs and PDEs...... 67

Table 3.3. PCR Primers for Confirmation of N. italica R11 Gene Deletion Strains ...... 71

Table 3.4. PCR Primers for Confirmation of N. italica R11 Complemented Strains ...... 72

Table 4.1. List of Representative Marine Roseobacter Strains Used ...... 100

Table 4.2. Predicted Cyclic-di-GMP Protein Domains in Representative Marine Roseobacter Strains ...... 108

Table 4.3. Domain Structure of GGDEF Domain Proteins...... 111

Table 4.4. Domain Structure of HD-GYP Domain Proteins...... 114

Table 4.5. Domain Structure of PilZ Domain Proteins...... 116

List of Figures

Figure 1.1. The chemical structure of cyclic-di-GMP...... 2

Figure 1.2. Schematic diagram of the synthesis and degradation of cyclic-di-GMP...... 5

Figure 1.3. Multiple sequence alignment of GGDEF domain proteins showing conservation of sequence motifs or amino acid residues...... 6

Figure 1.4. Multiple sequence alignment of EAL domain proteins showing conservation of sequence motifs or amino acid residues...... 7

Figure 1.5. Classification of EAL domain proteins...... 8

Figure 1.6. Multiple sequence alignment of HD-GYP domain proteins showing conservation of sequence motifs or amino acid residues...... 10

Figure 1.7. Multiple sequence alignment of PilZ domain proteins showing conservation of sequence motifs or amino acid residues...... 12

Figure 2.1. Domain organisation of the predicted GGDEF and EAL domain proteins in N. italica R11...... 43

Figure 2.2. Domain organisation of the predicted HD-GYP domain proteins in N. italica R11. 44

Figure 2.3. Domain organisation of the predicted PilZ domain proteins in N. italica R11...... 45

Figure 2.4. Multiple sequence alignment of the putative diguanylate cyclases from N. italica R11 with representative DGCs from other bacteria: ...... 47

Figure 2.5. Multiple sequence alignment of the putative cyclic-di-GMP phosphodiesterases from N. italica R11 with representative cyclic-di-GMP phosphodiesterases from other bacteria: ...... 50

Figure 2.6. Multiple sequence alignment of the putative HD-GYP domain proteins from N. italica R11 with representative HD-GYP proteins from other bacteria: ...... 51

Figure 2.7. Sequence alignment of the putative PilZ domain proteins from N. italica R11 with representative PilZ domain proteins from other bacteria: ...... 52

Figure 3.1. Schematic diagram of the Splice Overlap Extension PCR (SOE-PCR) strategy. .... 69

Figure 3.2. PCR confirmation of N. italica R11 gene deletion strains...... 79

Figure 3.3. Growth characteristics of N. italica R11 WT and mutant strains...... 80

xii

Figure 3.4. Surface attachment of N. italica R11 gene deletion strains...... 81

Figure 3.5. Swimming motility of N. italica R11 gene deletion strains...... 82

Figure 3.6. Calcofluor White Plate Assay...... 83

Figure 3.7. Cyclic-di-GMP level of planktonic and attached cells of N. italica R11 cyclic-di- GMP gene deletion strains...... 84

Figure 3.8. PCR confirmation of the N. italica R11 complemented strain, ΔR11cdg3- pMCScdg3...... 85

Figure 3.9. Growth characteristics of N. italica R11 complemented strain ΔR11cdg3-pMCS cdg3...... 86

Figure 3.10. Surface attachment of N. italica R11 complemented strain...... 87

Figure 3.11. Motility of N. italica R11 complemented strain...... 88

Figure 4.1. Phylogenetic tree of the GGDEF and EAL domain proteins of representative marine Roseobacter strains...... 119

Figure 4.2. Surface attachment on 96-wells polystyrene plates...... 120

Figure 4.3. Cyclic-di-GMP levels in planktonic and attached cells of the representative marine Roseobacter strains...... 122

xiii

List of Abbreviations

% percent 35EXOc 3’-5’ exonuclease ACT aspartate kinase, chorismate mutase and TyrA ALA aminolevulinic acid AM TRP ammonium transporter AMP adenosine monophosphate ANOVA Analysis of Variance ATCC American Type Culture Collection BCA bicinchoninic acid BLASTP Basic Local Alignment Search Tool - Protein bp base pair

C20H24N10O14P2 cyclic-di-GMP cAMP cyclic adenosine monophosphate CBS cystathionine-beta-synthase CCW counterclockwise Cellulose_synt cellulose synthase CHASE cyclase/histidine kinases-associated sensing extracellular CID chemical identification cNMP cyclic nucleotide monophosphate CO carbon monoxide CW clockwise cXMP xanthosine- 3', 5'- cyclic monophosphate cyclic-di-AMP cyclic diadenosine monophosphate cyclic-di-AMP-GMP cyclic diadenosine monophosphate diguanosine monophosphate cyclic-di-GMP cyclic diguanosine monophosphate DGC diguanylate cyclase DNA deoxyribonucleic acid DOE US Department of Energy DSF diffusible signal factor EAL glutamic acid-alanine-leucine EPS exopolysaccharide

xiv

ESPript Easy Sequencing in PostScript FRET fluorescence resonance energy transfer g gravity GAF cGMP-specific phosphodiesterases, adenylyl cyclases and FhlA GEMM Genes for the Environment, for Membranes and for Motility GFP green fluorescent protein GGDEF glycine-glycine-aspartatic-glutamic acid-phenylalanine GlnD_UR-UTase GlnD_PII uridylyltransferase Glycos_transf_2 glycosyltransferase GMP guanosine monophosphate GOI gene or interest GTP guanosine triphosphate HAMP histidine kinases, adenylyl cyclases, methyl binding proteins, phosphatases HD histidine-aspartic acid HD_assoc HD-associated HD-GYP histidine-aspartic acid-glycine-tyrosine-proline HMA half-strength Marine Agar HMAGm half-strength Marine Agar with gentamicin HMB half-strength Marine Broth HMBGm half-strength Marine Broth with gentamicin HPLC high performance liquid chromatography HTCC High Throughput Culture Collection ICL Imperial College London IMG-ER Integrated Microbial Genomes Expert Review LB Luria-Bertani LC-MS liquid chromatography-mass spectrometry LC-MS/MS liquid chromatography-tandem mass spectrometry m/z mass to charge ratio MALDI-TOF matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry MHYT methionine, histidine, and tyrosine NaCl sodium chloride

NO nitric oxide NSS Nine Salts Solution NTP_transf_2 nucleotidyltransferase NTU Nanyang Technological University oC degrees Celsius OD optical density ORF open reading frame PAC motifs C-terminal to PAS PAS period circadian protein, aryl hydrocarbon receptor nuclear translocator protein, single-minded protein PBD Protein Data Bank PCR polymerase chain reaction PDE phosphodiesterase Pfam Protein Family PGA poly-β-1,6-N-acetyl-D-glucosamine pGpG 5-phosphoguanylyl-(3 -5)-guanosine POLAc DNA polymerase A REC receiver domain RNA ribonucleic acid rpm rotations per minute SCELSE Singapore Centre on Environmental Life Sciences Engineering SD standard deviation SEM standard error of the mean SMART Simple Modular Architecture Research Tool SOE-PCR splice overlap extension PCR T3SS Type III secretion system TCST two component signal transduction TDA tropodithietic acid TLC thin layer chromatography TM transmembrane tRNA aminoacyl-transfer ribonucleic acid tRNA-synt_1b aminoacyl-tRNA synthase UNSW University of New South Wales

xvi

VPS Vibrio polysaccharide WT wild type X-gluc 5-bromo-4-chloro-3-indoxy l-b-D-glucuronide XTT 2, 3-bis (2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5- carboxanilide

xvii

CHAPTER 1

General Introduction and Literature Review

1.1. Lifestyle Decision-Making in Bacteria and the Rise of the Bacterial Nucleotide

Second Messenger, Cyclic Diguanylate (Cyclic-di-GMP)

In their natural environment, bacteria can exist as free-living, motile individual cells or as attached, surface-associated sessile consortia or biofilms [1]. The free-living, planktonic state allows them to move around in search for nutrients necessary for growth or move away from predatory organisms, while the attached, sessile or biofilm state allows them to form associations and coordinate their activities with other cells of the same species (or of other species) enabling community metabolism and communal interactions, as well as deriving benefits such as protection from predators and other physical and chemical stresses in the environment [1-4].

The transition from the planktonic to the biofilm mode of life in bacteria is considered a highly complex process. While some of the aspects controlling this process have been elucidated, much still remains to be discovered about the key elements and molecular mechanisms underlying this transition, including the differences between planktonic and sessile cells and the genes and pathways that are involved [5]. Crucial to this lifestyle-decision making in bacteria is the ability to sense a signal or cue from the extracellular environment, transduce the signal intracellularly and then respond accordingly by adapting and changing their behaviour. This complex signalling cascade is characteristic of small molecule two-component signal transduction systems (TCST) that to date have been well-studied in several bacterial systems [6-9].

Among the many TCSTs in bacteria, signalling based on bacterial nucleotide second messenger such as cyclic-di-GMP (bis-(3′-5′)-cyclic dimeric guanosine monophosphate; cyclic-diguanylic acid; cyclic diguanylate) (Figure 1.1) has received much attention due to the accumulating evidence that cyclic-di-GMP is a key regulator of traits and behaviour in bacteria, in particular those that are relevant to the transition from a planktonic mode to a biofilm mode of life. In general, low levels of cyclic-di-GMP promote motility while high levels promote attachment to surfaces, production of exopolysaccahrides and biofilm formation. In addition, cyclic-di-GMP controls virulence of plant and animal pathogens [10].

Figure 1.1. The chemical structure of cyclic-di-GMP. (Chemical Formula: C20 H24 N10 O14 P2; Molecular Weight: 690.410684 g/mol; Pubchem CID: 6323195; http://pubchem.ncbi.nlm.nih.gov/compound/6323195); (Figure adapted from [11])

Whole genome sequencing and metagenomics have revealed not only the abundance and diversity of genes involved in cyclic-di-GMP metabolism in the bacterial domain

[10, 12, 13] but also their importance in bacterial functional community assembly and trophic strategies [14, 15]. Further interrogation of sequenced genomes also uncovered the abundance and diversity of sensory input domains including two-component

2 response regulators linked to cyclic-di-GMP protein domains which indicated that a wide range of environmental cues or stimuli can modulate levels of cyclic-di-GMP [16-

20]. The enzymes involved in cyclic-di-GMP turnover and the targets and specific outputs impacted by cyclic-di-GMP have now been well-characterised in several bacterial model systems [10].

Indeed, this research field rapidly progressed since its discovery more than two decades ago by Moshe Benziman and coworkers [21]. Numerous studies exploring the complex cyclic-di-GMP signalling system in various bacterial species have now emerged and are summarized in several excellent and comprehensive reviews that kept track of the progress in the field [10, 22-29].

1.2. Cyclic-di-GMP Metabolism in Bacteria: Synthesis, Degradation and Binding

Crucial to exploring and dissecting a cyclic-di-GMP network in a particular bacterial strain is the understanding of how cyclic-di-GMP is produced and degraded, as well as knowledge about its target effectors. This section reviews the fundamental and prevailing aspects of cyclic-di-GMP synthesis and degradation (Sections 1.2.1 and

1.2.2.). A section describing various cyclic-di-GMP receptors or effector proteins is also presented (Section 1.2.3). The synthesis and degradation of cyclic-di-GMP affects the intracellular pool of the molecule inside the cell. Various tools and methods are used to monitor these changes in concentration in the cell. This is briefly described in a succeeding section (Section 1.2.4)

1.2.1. Cyclic-di-GMP Synthesis

Cyclic-di-GMP is synthesised from two molecules of GTP by diguanylate cyclases

(DGC) [21] (Figure 1.2). Genetic and biochemical evidence have shown that diguanylate cyclases possess the active site (A-site) characterised by the conserved

GGDEF (Gly-Gly-Asp-Glu-Phe) or GGEEF (Gly-Gly-Glu-Glu-Phe) motif which binds

GTP and confers its enzymatic activity [30-36]. Functional conservation of the GGDEF motif has been demonstrated by mutational studies of the GGDEF motif of WspR from

Pseudomonas fluorescens, which showed that any mutation along this functional domain abolished DGC activity [37]. DGC proteins also possess an inhibitory site (I- site) characterized by an RxxD motif, where x is any amino acid residue [38] (Figure

1.3). Binding of cyclic-di-GMP to the I-site allosterically controls the intracellular concentration of cyclic-di-GMP in the cell [38]. GGDEF domains can exist in tandem with EAL domains (described below) (i.e. GGDEF-EAL) and have been found in abundance in bacterial genomes [12, 19, 39]. These hybrid domain proteins may have dual activities, i.e. both as DGCs and PDEs, or only one of the domains possesses an enzymatic activity [12, 40, 41].

Figure 1.2. Schematic diagram of the synthesis and degradation of cyclic-di- GMP. Cyclic-di-GMP is synthesised from two molecules of GTP by diguanylate cyclases (DGC) [21]; Cyclic-di-GMP is degraded into two molecules of GMP by cyclic-di-GMP phosphodiesterases (PDE). Cyclic-di-GMP PDEs either contain an EAL domain or an HD-GYP domain. EAL domains cleave cyclic-di-GMP into an intermediate, pGpG (5-phosphoguanylyl-(3 -5)-guanosine), and further into two molecules of GMP (guanosine monophosphate) [21, 42] while the HD-GYP domain directly hydrolyses cyclic-di-GMP into GMP [43].

Figure 1.3. Multiple sequence alignment of GGDEF domain proteins showing conservation of sequence motifs or amino acid residues. Amino acid residues in white on a red or blue background are active sites (A-site) required for the diguanylate cyclase activity of the GGDEF domain. Residues with yellow shading represent the allosteric site (I-site). Shown in bold are conserved residues in the vicinity of the active sites. (Figure adapted from [10]).

1.2.2. Cyclic-di-GMP Degradation

Cyclic-di-GMP is degraded into two molecules of GMP by cyclic-di-GMP phosphodiesterases (PDE). Cyclic-di-GMP PDEs either contain an EAL domain or an

HD-GYP domain. EAL domains cleave cyclic-di-GMP into an intermediate, pGpG (5- phosphoguanylyl-(3 -5)-guanosine) and further into two molecules of GMP (guanosine monophosphate) [21, 42] while the HD-GYP domain directly hydrolyses cyclic-di-

GMP into GMP [43] (Figure 1.2). Manganese (Mn2+) or magnesium (Mg2+) ions are required for cyclic-di-GMP specific PDE activity [41] while calcium (Ca2+) and zinc

(Zn2+) are potent inhibitors of the activity [44]. Genetic evidence has shown that the

EAL domain itself is sufficient for cyclic-di-GMP PDE activity [35, 44]. Biochemical evidence has further shown that the PDE activity is linked to the EAL domain [41, 42,

44, 45]. A study of the EAL domain containing protein RocR from Pseudomonas aeuginosa revealed that an extended conserved motif DDFG(T/A)GYSS was found 6 essential for enzymatic activity [46]. The amino acids of this motif form “Loop 6” and mutation of the catalytic residues led to a complete loss of enzymatic activity [46]. EAL domain proteins can be categorised into three classes: Class 1 EAL domains possess conserved catalytic residues and a conserved Loop 6; Class 2 EAL domains contain conserved catalytic residues and a degenerate Loop 6, and Class 3 EAL domains lack one or more of the catalytic residues and have a degenerate Loop 6. Proteins with Class

I and Class II EAL domains have cyclic-di-GMP specific phosphodiesterase activity, respectively, while proteins with Class III EAL domains lack this activity [46-48]

(Figure 1.4, Figure 1.5)

Figure 1.4. Multiple sequence alignment of EAL domain proteins showing conservation of sequence motifs or amino acid residues. Amino acid residues in white on a red or blue background are the enzyme active sites (A-site) required for the cyclic-di-GMP phosphodiesterase activity of the EAL domain (Figure adapted from [10]).

Figure 1.5. Classification of EAL domain proteins. Class 1 EAL domains are shown with conserved catalytic residues and a conserved Loop 6; Class 2 EAL domains are shown with conserved catalytic residues and a degenerate Loop 6, and Class 3 EAL domains are shown lacking one or more of the catalytic residues and possessing a degenerate Loop 6 [46-48]. Amino acid residues directly involved in magnesium (Mg2+) binding are shown in light green; residues involved in magnesium (Mg2+) binding indirectly are shown in dark green; amino acids involved in substrate binding are shown in blue. The glutamate serving as the general base catalyst is shown in red, and the glutamate stabilizing Loop 6 is shown in pink (Figure adapted from [48]).

The HD-GYP domain [49] is a subset of the larger HD superfamily of metal-dependent phosphohydrolases [50] and was predicted to have cyclic-di-GMP specific PDE activity

[16, 49]. Studies on the HD-GYP domain containing protein RpfG from Xanthomonas campestris pv. campestris (Xcc) confirmed this prediction and showed that RpfG has

PDE activity in vitro and that it could replace an EAL domain as a PDE [43]. The latter study further showed that the product of cyclic-di-GMP hydrolysis is GMP and not pGpG, common to PDEs with EAL domains. The PDE specific activity of the HD-GYP domain has also been demonstrated in Pseudomonas aeruginosa [51] and Borrelia burgdorferi [52]. HD-GYP domains are characterised by highly conserved residues,

8 particularly the HD dyad and the GYP motif (hence, HD-GYP), the latter which is also part of a larger motif sequence HDXGK and HHEXXDGXGYP [49] (Figure 1.6). The link between the conservation of the HD and GYP motif and the specific PDE activity of the domain has yet to emerge, although several studies have provided some insights to date. The YN-GYP variant from P. aeruginosa has no activity against cyclic-di-GMP

[51]. Similarly, the HD-GYP domain protein Bd1817 from Bdellovibrio bacterivorus which lacks a conserved GYP motif also does not possess activity against cyclic-di-

GMP [53]. The availability of the crystal structure of Bd1817 [53] and more recently of the HD-GYP domain protein PmGH from Persephonella marina [54] are expected to provide more mechanistic insights into the catalytic activity of the domain.

Figure 1.6. Multiple sequence alignment of HD-GYP domain proteins showing conservation of sequence motifs or amino acid residues. Conserved residues are boxed in white font on a red background, and partially conserved residues are boxed in red font on a white background. Metal-liganding and phosphate-liganded residues are indicated by blue triangles and magenta ovals, respectively. Secondary structure elements for Bd1817 are given above the alignment, corresponding to the HD-GYP domain only. (Figure adapted from [53]).

1.2.3. Cyclic-di-GMP Receptor or Binding Proteins

For cyclic-di-GMP to exert its action on diverse bacterial cellular functions, it must bind to certain receptors. Several cyclic-di-GMP binding proteins (receptors or effectors) have been identified to date. These include proteins with PilZ domain, enzymatically inactive GGDEF and EAL domains, transcription factors and RNA riboswitches [10,

27, 29, 55].

The PilZ domain protein was initially identified through bioinformatic analysis as a conserved protein domain in the C-terminus of the BcsA subunit of G. xylinus [39]. The domain name “PilZ” originated from a P. aeruginosa protein (PA2960), encoded by the pilZ gene and is involved in Type IV fimbrial biosynthesis [56]. Several other PilZ domain proteins have been recognised in other bacterial species and have been experimentally verified to bind cyclic-di-GMP in vitro at high specificities, such as

YcgR from E. coli [57], DgrA from Caulobacter crescentus [58], and PlzC and PlzD from Vibrio cholerae [59]. Structural studies of PilZ domain proteins [60] have revealed that cyclic-di-GMP binding is dependent on residues RxxxR and D/NxSxxG sequence motifs conserved in PilZ domains (Figure 1.7).

Figure 1.7. Multiple sequence alignment of PilZ domain proteins showing conservation of sequence motifs or amino acid residues. Conserved hydrophobic residues are shaded; other conserved residues are shown in bold. Proteins are listed by their gene names, UniProt entry names, or PDB codes. Secondary structure assignments are from the VCA0042 structure (PDB: 1YLN); arrows indicate β- strands, the cylinder indicates an α-helix (Figure adapted from [39]).

Cyclic-di-GMP can also bind to enzymatically inactive GGDEF domain proteins at their

I sites. One such example is the PelD protein which controls the Pel polysaccharide biosynthesis in P. aeruginosa [61, 62]. Other examples include the CdgA protein involved in predatory behaviour in B. bacteriovorous [63] and PopA which is involved in cell cycle progression in C. crescentus [64].

Some EAL domains which have lost their PDE activities can also bind cyclic-di-GMP.

Examples of such proteins include FimX, which controls twitching motility in P. aeruginosa, with high affinity binding of cyclic-di-GMP [65-67]. LapD from P. flourescens which controls the adhesin LapA has inactive GGDEF and EAL domains and binds cyclic-di-GMP to the EAL domain at high affinities [68, 69]. 12

FleQ in P. aeruginosa [70], VpsT in V. cholera [71], Clp in X. campestris [72, 73] and

Bcam1349 in B. cenocepacia [74] are examples of transcriptional regulators that can bind cyclic-di-GMP. FleQ has been demonstrated to activate expression of flagellar biosynthesis genes as well as repress transcription of genes including the pel operon involved in EPS biosynthesis [70]. Full length and truncated versions of FleQ bind cyclic-di-GMP and relieves the repression of pel expression [70]. Clp from X. campestris is similar to the cyclic AMP (cAMP) binding proteins Crp and Vfr and includes a conserved cyclic nucleotide monophosphate (cNMP) binding domain, which contains a glutamic acid residue that was found to be essential for cyclic-di-GMP binding. Binding of cyclic-di-GMP induces intensive allosteric conformational changes in Clp and subsequently inhibits the binding to Clp to the engXCA promoter and thus the expression of the major endoglucanase in X. campestris [72, 73]. In V. cholerae,

VpsT is required for the expression of vps biosynthesis genes and the development of the rugose colony morphology [75]. Binding of cyclic-di-GMP promotes oligomerisation of VpsT that has been found critical for VpsT function [71]. The

Bcam1349 protein in B. cenocepacia has been shown to regulate the production of cellulose and fimbriae necessary for wrinkly colony morphology, pellicle and biofilm formation in this strain. Bcam1349 binds cyclic-di-GMP at the cNMP binding domain of the protein [74].

Riboswitches represent yet another type of cyclic-di-GMP receptors. Riboswitches are structured noncoding RNA domains that selectively bind metabolites [76]. Cyclic-di-

GMP riboswitches have been discovered from the highly conserved RNA domain called

GEMM (Genes for the Environment, for Membranes and for Motility) residing

13 upstream of the open reading frames (ORFs) for DGC and PDE proteins in some organisms and residing upstream of some genes that are controlled by cyclic di-GMP

[77]. Two classes of cyclic-di-GMP riboswitches have been reported, i.e. cyclic-di-

GMP I riboswitch and cyclic-di-GMP II riboswitch [77, 78]. Structural studies of the cyclic-di-GMP riboswitch (Vc2) from V. cholerae revealed that the interactions formed between the riboswitch and cyclic-di-GMP display a very high binding affinity (Kd approximately 10 pM). This binding is so far considered the highest affinity for any cyclic-di-GMP receptor and the tightest RNA-small molecule interaction [79]. More recently, a novel cyclic-di-GMP binding protein, GIL, which has a GGDEF I-site like domain has been discovered in the cellulose synthase operon protein BcsE purified from

E. coli, S. enterica and K. pneumoniae [80]

1.2.4. Bacterial Sensor Domains: Integrating Environmental Signals Into Cyclic-di-

GMP Signalling

How are environmental signals or cues perceived by bacterial cells and linked to cyclic- di-GMP signalling? Although some are found as single domain proteins, GGDEF and

EAL domains typically exist as multidomain proteins [10]. Sensory input domains such as PAS, GAF, MHYT, and REC, among others, are often found N-terminal to GGDEF or EAL domains which are capable of acquiring a variety of signals from the external environment [16-20, 81, 82]. PAS (period circadian protein; aryl hydrocarbon receptor nuclear translocator protein; single-minded protein) and GAF (cGMP-specific phosphodiesterases, adenylyl cyclases and FhlA) domains can bind small molecules

[83-85]. In addition, the GAF domain may be involved in light sensing [86]. The

MHYT (methionine, histidine, and tyrosine) domain can sense oxygen (O2), carbon monoxide (CO) and nitric oxide (NO) [87]. The receiver (REC), or the CheY-like 14 phosphoacceptor domain, is a common module of response regulators and receives the signal from the sensor partner in two-component systems [81]. It undergoes conformational changes upon phosphorylation and affects the properties of the C- terminal DNA-binding domain resulting in the regulation of gene expression [13, 81,

88, 89]. The availability of protein databases such as SMART (http://smart.embl- heidelberg.de/) [90-92] and PFAM (http://pfam.xfam.org/) [93] facilitates the prediction and identification of these sensor domains in sequenced genomes.

Genetic and biochemical studies revealed that these sensor domains modulate the function of the GGDEF or EAL domain proteins. For example, the rbdA gene in P. aeruginosa encodes a GGDEF-EAL domain protein that has a PAS-PAC domain.

Deletion of the PAS domain or substitution of its key residues with alanine abrogated the phosphodiesterase activity of RbdA and affected biofilm dispersal [94]. In

Xanthomonas campestris pv. campestris (Xcc), RavR-RavS is a two-component system that is required for full virulence of Xcc. Mutation in the GGDEF-EAL domain containing response regulator RavR decreased Xcc virulence factor production. In addition, mutation of the PAS domain of the sensor RavS also showed similar decrease in virulence production as a mutation in the ravS gene [95].

The proteins MucR (PA1727) and NbdA (PA3311, NO-induced bioﬁlm dispersion locus A) are membrane-bound proteins in P. aeruginosa consisting of MHYT-GGDEF-

EAL. Both proteins possess PDE activities and mutations in either mucR and nbdA impaired biofilm dispersion in this strain upon exposure to NO [96]. More recently,

MucR was shown to be involved in nitrate-dependent regulation of alginate production

15 in P. aeruginosa. Site-directed mutagenesis of MucR revealed that a second MHYT domain (MHYT II) is involved in nitrate sensing. [97].

The REC domain of the GGDEF domain protein PleD in C. crescentus is required for activation of its DGC activity. In vitro phosphorylation assays showed that PleD is phosphorylated through its sensor kinases DivJ and PleC. Phosphorylated PleD then dynamically localises to the stalked pole during swarmer to stalk cell differentiation in

C. crescentus [30]. In the plant pathogen, Xylella fastidiosa, a mutation in XhpT, a response regulator with receiver (REC) domain and a histidine phosphotransferase output domain, was found to lead to altered surface attachment, cell–cell aggregation, exopolysaccharide (EPS) production and virulence in grapevine [98].

1.2.5. Tools for Detection and Quantification of Cyclic-di-GMP in Bacterial Cells

Various techniques have been developed to detect and quantify cyclic-di-GMP in bacterial cells. These techniques have proven useful in confirming and establishing the levels of cyclic-di-GMP in strains with a mutation in a gene encoding a DGC or a PDE or in strains overexpressing a DGC or a PDE. These techniques range from chemical and radioactive-based methods such as thin-layer chromatography (TLC and 2D-TLC)

[34, 38, 40, 41, 69, 99-103] to instrumental methods such as high performance liquid chromatography (HPLC) [30, 32, 35, 43, 104-107] and mass spectrometry [matrix- assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF) and liquid chromatography-mass spectrometry (LC-MS) or liquid chromatography- tandem mass spectrometry LC-MS/MS)] [21, 43, 107-115]. Because of its high sensitivity and specificity, the current and most widely used method is mass 16 spectrometry, in particular LC-MS or LC-MS/MS. To detect cyclic-di-GMP in bacterial cells, nucleotide fractions are extracted from cultures using a combination of solvents.

Extracted fractions are dried up, re-solubilised and separated through a liquid chromatography unit coupled and passed on to a mass spectrometer (LC-MS). Detection of cyclic-di-GMP is based on the detection of a peak corresponding to the mass to charge ratio (i.e. 691 m/z) of cyclic-di-GMP [21, 105, 111, 116]. Quantification is based on extrapolation from a linear standard curve generated using a synthetic, commercially available cyclic-di-GMP [110, 116]. Cyclic-di-GMP concentrations at nanomolar to femtomolar ranges can be detected in bacterial cellular extracts [105, 110, 116].

While providing sensitivity and specificity, it is acknowledged among researchers in the field that a major drawback of mass spectrometry-based methods is the need to perform nucleotide extractions from bacterial cells and the subsequent processing prior to the separation step by liquid chromatography. A simpler extraction procedure consisting of lysis by sonication followed by an ultracentrifugation step could minimise the processing time for bacterial cells [117].

Alternative methods of detection have also been developed which offer sensitivity at single-cell resolutions. A genetically-encoded fluorescence resonance energy transfer

(FRET)–based biosensor has been used to visualise fluctuations of cyclic-di-GMP in single bacterial cells [118]. Also, a fluorophore-labelled biosensor has been designed to respond to cyclic-di-GMP at submicromolar sensitivity in real-time [119]. Moreover, a green fluorescent protein (GFP) reporter based on a transcriptional fusion of the cyclic- di-GMP responsive cdrA promoter to GFP genes have been used to gauge cyclic-di-

GMP levels in P. aeruginosa [120]. Intercalator-based assay systems to detect and

17 quantify cyclic-di-GMP have also been described. Thiazole orange, a commercially available shelf-stable reagent has been shown to become highly fluorescent when complexed with cyclic-di-GMP [121]. Although this assay system provides a simple colorimetric detection of cyclic-di-GMP, the sensitivity is however low (5 mM). The discovery of the cyclic-di-GMP riboswitch also prompted the development of engineered cyclic-di-GMP sensing ribozymes that can detect nanomolar levels of the molecule [122, 123]. Relatively lower sensitivity of these sensor-based methods remains a major drawback but their potential for high-throughput application in future research is a possibility.

1.3. Cyclic-di-GMP Regulation of “Stick-or-Swim” Lifestyle

The main question arising from the discovery of a cyclic-di-GMP signalling pathway in any bacterial strain is: what role does it play? Indeed, the ubiquity of cyclic-di-GMP signalling components in various bacterial species prompted studies to explore the specific regulatory functions of the molecule. It is now well-established that cyclic-di-

GMP has varied roles in the regulation of bacterial traits. In general, the existing paradigm is that low levels of cyclic-di-GMP promote a motile lifestyle and high levels of cyclic-di-GMP promote a sessile mode of life [10]. Within this current paradigm, cyclic-di-GMP exerts effects on specific cellular and behavioural processes in bacteria.

This section reviews the involvement of cyclic-di-GMP in cellular processes relevant to the transition from the motile state to the sessile state, such as motility and chemotaxis

(Section 1.3.1), exopolysaccharide production (Section 1.3.2), and biofilm dispersal

(Section 1.3.3.). Furthermore, the role of cyclic-di-GMP in bacterial virulence is also briefly discussed (Section 1.3.4). 18

1.3.1. Cyclic-di-GMP Regulation of Motility and Chemotaxis

Critical to colonisation and subsequent establishment of mature biofilms is the initial attachment of cells on the surface. But before a bacterial cell can attach to a surface, it must be able to find and translocate to the site of colonisation. The movement towards and away from a chemical gradient is termed chemotaxis [124]. Chemotactic behaviour and the chemotactic signalling pathway have been well-described in bacteria [125, 126].

For example, in plant-associated bacteria, such as Agrobacterium tumefaciens,

Pseudomonas fluorescens and Bacillus amyloliquefaciencs, chemotaxis has been shown to play a role in surface attachment, root colonisation and biofilm formation [127-130] and cells of these species sense and respond directly to plant and plant-derived exudates.

Swimming motility is facilitated by flagellar motors which rotate in a counter clockwise

(CCW) or clockwise (CW) fashion. CCW rotation mediates coalescence of the flagellar filaments into a bundle and propels the cell forward resulting in “running” or “smooth swimming”, while CW rotation disrupts the bundle and causes the cells to tumble. This

CCW-CW bias in flagellar motor rotation is regulated by the chemotaxis response regulator, CheY which upon phosphorylation binds to the switch protein of the flagellar motor FliM and causes reversal in the direction of motor rotation [131, 132]. Thus, flagella can respond to chemotactic signals.

Cyclic-di-GMP has been shown to play a role in chemotaxis-mediated swimming motility. In the free-living diazotroph Azospirillum brasilense, the chemotaxis and aerotaxis (movement in oxygen gradients) transducer Tlp1 serves as an energy taxis transducer and enhances motility and promotes colonisation of plant roots [133]. Tlp1 has a C-terminal PilZ domain which binds cyclic-di-GMP. Binding of cyclic-di-GMP to 19

Tlp1 promotes increased swimming velocity and decreased reversal frequency in cells in response to oxygen gradients via the Che1 pathway [134]. In the spirochete B. burgdorferi, CheX is a CheY-P phosphatase which efficiently dephosphorylates CheY-

P in vitro [135]. PlzA, the only PilZ domain cyclic-di-GMP binding protein in this strain, has been proposed to bind to and activate CheX promoting smooth swimming motility [52].

Cyclic-di-GMP has also been shown to affect swarming motility. Swarming motility allows cells to move across surfaces [136]. In P. aeruginosa PA14, a complex interplay of the proteins SadC, SadB and BifA influences swarming motility, flagellar reversal and EPS production. SadC is an inner membrane DGC. Overexpression of SadC was found to increase cyclic-di-GMP levels and decrease swarming motility while the deletion of the sadC gene resulted in an increased swarming motility [137]. Similarly, inactivation of sadB, which encodes a cytoplasmically localised protein, resulted in increased swarming and a viscosity-dependent defect in flagella reversals. The decrease in flagellar reversal has been shown to be associated with a decrease in the production of the Pel–dependent polysaccharide [138, 139]. Deletion of the PDE BifA resulted in increased levels of cyclic-di-GMP, a severe swarming motility defect and an increase in

Pel polysaccharide biosynthesis that led to a hyperbiofilm phenotype [101]. Further genetic studies have shown that SadB acts upstream of pelA, which is required for production of the Pel polysaccharide, and pilJ, a member of the CheIV chemotaxis cluster [138]. These studies led to a proposed model of a pathway wherein SadC and

BifA coregulate swarming motility in P. aeruginosa via modulation of the levels of cyclic-di-GMP with SadB coordinating the production of the Pel polysaccharide via a chemotaxis-like pathway [137, 138]. In V. parahaemolyticus, a bifunctional GGDEF-

EAL domain protein ScrC regulates lateral flagellar (laf) expression, swarming motility and capsular polysaccharide (cps) production [40, 140, 141]. The scrC gene is part of the three-gene scrABC operon [141]. ScrC acts as a DGC in the absence of ScrA and

ScrB leading to increased cyclic-di-GMP levels and concomitant cps production and increased swarming motility. In the presence of ScrA and ScrB, ScrC acts as a PDE leading to decreased cyclic-di-GMP levels resulting in enhanced flagellar gene expression and decreased swarming motility [40, 140]

Cyclic-di-GMP can also control twitching motility facilitated by the Type IV pili (Tfp).

In P. aeruginosa, FimX, a GGDEF-EAL domain containing protein is shown to have a regulatory role in Tfp assembly. fimX mutants, although found to express normal levels of pilin, exhibited low levels of surface pili. Complementation of the mutant restored normal twitching motility [142]. FimX has been shown to only possess PDE activity through the degenerate EAL domain, although both the GGDEF and EAL domains are required for FimX function i.e. the degenerate GGDEF domain further activates PDE activity when bound to GTP [65]. Interestingly, structural studies revealed that the degenerate EAL domain of FimX bind cyclic-di-GMP [66]

Cyclic-di-GMP control of another type of non-flagellar mediated motility has been shown in the predatory bacterium Bdellovibrio bacteriovorus. This bacterium uses gliding motility to scout for prey bacteria on surfaces and to exit exhausted prey cells

[143]. Four of the five GGDEF domain proteins encoded in the genome, possess DGC activities and are specifically involved in distinct predatory behaviour. Among the four

DGCs, DgcA has been shown to be involved in gliding motility. Deletion of dgcA resulted in a strain that is incapable of gliding motility. In addition, although capable of

21 invading the prey, the dgcA mutant strain remained motionless and is unable to leave the exhausted prey [63].

1.3.2. Cyclic-di-GMP Regulation of Exopolysaccharide Production

Following attachment, cells committed to a surface begin further developmental processes leading to the production of exopolysaccharides (EPS). The secreted EPSs along with proteins, nucleic acids, lipids and other substances produced by the cells contribute to the development of the biofilm matrix. In addition to providing structural integrity and nutrient availability, the biofilm matrix offers cells encased in it enhanced survival and protection from various environmental stresses such as dessication, ultraviolet light, predation and bactericides [1-3, 144, 145].

The role of cellulose in attachment and biofilm formation has been well-studied in a wide range of bacteria such as G. xylinus and S. typhimurium, Agrobacterium tumefaciens, Rhizobium leguminosarum, Pseudomonas putida, Erwinia chrysanthemii and Dickeya dadantii [11, 146, 147]. The polysaccharide VPS is overproduced by the rugose wild-type strain of V. cholerae and has been shown as a major component of biofilm matrix [148]. Along with its role in the production of three-dimensional biofilms, the VPS polysaccharide is also essential for V. cholerae in vivo colonisation and infection [149]. Colanic acid produced by E. coli K12, while not required for initial attachment, is found to be essential for establishing the complex three-dimensional biofilm structure on abiotic surfaces [150]. The polysaccharide adhesin, (poly-β-1,6-N- acetyl-D-glucosamine, PGA [or PAG or PNAG]) has been shown to be essential for permanent attachment in E. coli K12. In P. aeruginosa, the PAO1 strain produces both

Pel and Psl exopolysaccharides, while PA14 produces only the Pel polysaccharide 22

[151]. In strain PA14, the Pel polysaccharide has been shown to be crucial for maintaining cell-to-cell interactions in addition to contributing to the biofilm matrix. In strain PAO1, both Pel and Psl can serve as primary biofilm matrix polysaccharide. In addition, Pel has a secondary protective role by enhancing resistance to aminoglycoside antibiotics [152, 153]. Recently, Pel and Psl were shown to have distinct physical properties and functional roles during biofilm formation. Particle-tracking microrheology revealed that Psl favours the development of elastic biofilms and is highly cross-linked within the biofilm [154]. Pel, on the other hand, favours viscoelastic and loose biofilms and is less effectively cross-linked within the mature biofilm [154].

These observations are consistent with the observed shift in the production of the dominant polysaccharide from Psl to Pel, i.e. Psl in the early biofilm stage and Pel in the mature stage [154].

Evidence has accumulated for the role of cyclic-di-GMP in EPS production in bacteria and this role is well-characterised in G. xylinus, S. typhimurium, V. cholerae, and P. aeruginosa. Interestingly, while cyclic-di-GMP regulation seems to be direct in G. xylinus, it is more complex in the other mentioned strains because regulation occurs at both the transcriptional and translational level. In G. xylinus, the cellulose synthase

BcsA contains a C-terminal PilZ domain which binds cyclic-di-GMP [57] further confirming the early observations that cyclic-di-GMP allosterically regulates cellulose synthesis in this strain [155]. Additional regulatory input has been observed in G. xylinus DGC and PDE isoforms with the presence of the oxygen sensing and redox sensing PAS domain [156, 157]. The rdar (red, dry and rough) colony morphotype is characteristic of cellulose and curli fimbriae production in S. typhimurium [158].

Complex and hierarchical regulation of the rdar morphotype involves the master

23 regulator CsgD and multiple DGCs and PDEs [108, 159-161]. In V. cholerae, the rugose colony morphotype is indicative of the Vps polysaccharide expression and is regulated by multiple DGCs and PDEs. [99, 162-164]. In P. aeruginosa, several cyclic- di-GMP proteins are also involved in the regulation of Pel, Psl or alginate polysaccharide synthesis.

One of the best characterised DGCs is the response regulator WspR. Phosphorylation activates WspR, a response regulator of the Wsp chemosensory system leading to cyclic-di-GMP synthesis [31]. A transcriptomic analysis of a P. aeruginosa wild type and a wspF mutant indicated that c-di-GMP positively regulates the transcription of both the psl and pel operons [31]. FleQ, a cyclic-di-GMP receptor protein regulates Pel expression in response to cyclic-di-GMP and acts as a repressor or activator. In the absence of cyclic-di-GMP, FleQ represses expression of the pel and psl operon whereas the presence of cyclic-di-GMP relieves the repression [70]. Alginate, which is the polysaccharide overproduced in mucoid strains of P. aeruginosa isolated from lungs of cystic fibrosis patients, is regulated by Alg44, also a cyclic-di-GMP binding protein.

Specific binding of cyclic-di-GMP at the PilZ domain of Alg44 modulates activity of the protein and regulates alginate production [165]. Alg44 has been shown to be required for alginate polymerisation in vivo [166].

1.3.3. Cyclic-di-GMP Regulation of Biofilm Dispersal

When conditions become unfavourable within the maturing biofilm, cells commence detachment or dispersal from the biofilm. Cells sense a range of signals or cues from the surrounding microenvironment that can induce dispersal. These signals or cues include nutrient limitation and starvation, oxygen limitation, low and non-toxic metabolic by- 24 products (e.g. nitric oxide, NO) and bacterially-derived signals (e.g. quorum sensing molecules) [26, 167]. Following sensing of an environmental cue, distinct events take place such as the degradation of the biofilm matrix, induction of motility, surfactant production and cell death and lysis [167]. Cyclic-di-GMP-specific PDEs and sensor domains are often involved in the dispersal mechanisms.

Recent studies have demonstrated that cyclic-di-GMP is involved in biofilm dispersal.

In P. putida, dissolution of the biofilm occurs in response to carbon starvation and involves the periplasmic protein PP0164 and the GGDEF-EAL domain protein PP0165

[168]. Further studies showed that LapG (PP0164) is involved in P. putida OUS82 biofilm dispersal through modification of the outer membrane-associated protein LapA in response to low cyclic-di-GMP levels [169]. Moreover, overexpression of an EAL domain protein YhjH from E. coli induced dispersion of established P. putida biofilms

[168]

Pioneering work by Barraud and coworkers established the link between nitric oxide

(NO) and cyclic-di-GMP signalling in the dispersal of P. aeruginosa biofilms [110, 170,

171]. Low, non-lethal dose of NO stimulates PDE activity which leads to reduced cyclic-di-GMP levels. The NO-mediated dispersal involves the chemotaxis regulator

BdlA (biofilm dispersion locus A) [110, 172]. BldA and two other PAS-domain containing PDE proteins (DipA and RbdA) together forms a regulatory network required for biofilm dispersion in P. aeruginosa in response to glutamate, succinate, heavy metals and NO [172-176]. More recently, the proteins NbdA and MucR with identical MHYT-GGDEF-EAL domain have been further implicated in NO-mediated dispersal in P. aeruginosa [96]. While PDEs are mostly implicated, the DGCs NicD and

GcbA have recently also been linked to the BldA-mediated dispersal in P. aeruginosa

[177, 178]. NO-induced modulation of cyclic-di-GMP levels has been shown in

Legionella pneumophila [179] and Shewanella woodyi [180], however, their exact role in biofilm dispersal has yet to be elucidated. Similarly, NO-induced dispersal has been shown for several clinically and industrially relevant biofilm-forming bacteria including

S. marcescens, V. cholerae, E. coli, F. nucleatum, B. licheniformis, S. epidermidis and the yeast, C. albicans [170]. These strains have been shown to respond to a specific NO concentration. The detailed mechanisms and regulatory pathways of NO-sensing remain to be explored.

Quorum sensing-based cell-cell signalling systems controlling dispersal have been described in several strains of bacteria such as in P. aeruginosa [181], S. marcescens

[182], S. aureus [183], V. cholerae [184] and X. campestris pv. campestris (Xcc) [185].

Among these systems, while the interconnection between the quorum sensing system and cyclic-di-GMP pathway has been described for P. aeruginosa [186] and V. cholerae

[187], the pathway from signal sensing and signal transduction leading to biofilm dispersal has been examined in detail in X. campestris. In Xcc, a signal referred to as a

“diffusible signal factor” (DSF) is perceived by the DSF/Rpf system which includes the sensor protein RpfC and the HD-GYP domain protein, RpfG. DSF is involved in activating the response regulator RpfG leading to lower cyclic-di-GMP levels due to its phosphodiesterase activity promoting dispersal of aggregates [43, 55, 188, 189]. The

Xcc DSF signal has also been shown to be involved in virulence (discussed in Section

1.3.4.). A DSF-like signal has been described in P. aeruginosa that mediates dispersal

[190] but is not linked to a cyclic-di-GMP pathway.

1.3.4. Cyclic-di-GMP Regulation of Bacterial Virulence

The regulation of virulence traits in bacteria has been the subject of long-standing research efforts. Several studies have now emerged that extend cyclic-di-GMP regulation of virulence in a number of plant, animal and human bacterial pathogens.

These studies further indicate that cyclic-di-GMP can be a universal regulator of virulence mechanisms in bacterial pathogenesis.

One of the most well characterised model systems detailing the regulatory role of cyclic-di-GMP in virulence is that of the plant pathogen X. campestris pv. campestris

(Xcc). Interestingly, studies have linked cyclic-di-GMP signalling to an extracellular signalling mechanism now known as DSF (diffusible signal factor) signalling. In Xcc, as previously described above (Section 1.3.3), the two-component system Rpf/DSF, consisting of a sensor kinase RpfC and a response regulator containing a HD-GYP domain RpfG, is implicated in the perception and signal transduction of the cell-to-cell signal via the DSF signal. Perception of the DSF signal by the sensor (RpfC) leads to phosphorylation of RpfG resulting in its activation as a PDE. The consequent alteration of cyclic-di-GMP levels affects the synthesis of virulence factors, including the extracellular enzyme endoglucanase, the extracellular polysaccharide xanthan, and pilus-dependent motility [43, 55, 191-194].

DSF-mediated signalling mechanism linked to cyclic-di-GMP regulation of virulence is also seen in Xylella fastidiosa [195-198], Burkholderia cenocepacia [199-201] and

Stenotrophomonas maltophila [202]. In Erwinia amylovora, the causative agent of fireblight disease, three active DGCs (EdcA, EdcC and EdcE) positively regulate the secretion of the main exopolysaccharide amylovoran that leads to increased biofilm 27 formation [114]. In Dickeya dadantii, cyclic-di-GMP regulates pectate lyase production and the Type III secretion factor (T3SS). Deletion of the genes encoding the GGDEF-

EAL domain protein EcpB and the EAL-domain protein EcpC reduced expression of

T3SS genes and reduced production of pectate lyase [203].

Cyclic-di-GMP regulation of virulence in the Lyme disease spirochete, Borrelia burgdorferi, represents a fully functional regulatory network and shows the role of cyclic-di-GMP in pathogen transmission. B. burgdorferi encodes a sole GGDEF domain-containing response regulator Rrp1 which has been shown to regulate the spirochete’s core biology. Rrp1 regulates the expression of almost 140 genes (8% of the genome) involved in core cellular functions including chemotaxis and flagella biosynthesis, cell envelope, transport, intermediary metabolism and nucleotide metabolism [204]. More interestingly, Rrp1 is shown to be upregulated during tick feeding indicating a role of Rrp1 in the regulation of genes required for the transition from the tick to mammalian environment [204]. B. burgdorferi also encodes a cyclic-di-

GMP binding protein, PlzA. PlzA specifically binds cyclic-di-GMP and is expressed during the tick as well as the mammalian stages of the enzootic cycle [205].

Yet another novel role of cyclic-di-GMP is revealed from studies of the intracellular pathogens Anaplasma phagocytophilum and Erlichia chaffeensis. Cyclic-di-GMP has been shown to regulate invasion and intracellular infection in these human immune cell pathogens. Both strains encode a functional sensor kinase PleC and a functional response regulator, PleD which has a DGC activity [206, 207] Moreover, in both strains, PleC and PleD are expressed during infection of human leukocytes concomitant with increased intracellular aggregation (morulae formation). Cells treated with a

28 cyclic-di-GMP analog induced dispersion of the morulae, degradation of the inclusion matrix, and bacterial intra-inclusion movement [206, 207].

1.4. Exploring Cyclic-di-GMP Metabolism in Marine Bacteria: Focus on the

Marine Roseobacter Clade

While cyclic-di-GMP signalling has been well studied and characterised in many species of terrestrial bacteria, it remains relatively unknown in the marine realm. So far, it has been discovered in only a few strains of marine bacteria, including Vibrio fischeri

[208, 209], Vibrio vulnificus [210], Shewanella woodyii [180, 211] and

Pseudoalteromonas atlantica [212]. In addition, very little is known about how marine bacteria utilise cyclic-di-GMP in the transition from a motile, planktonic state to a sessile, attached state. Thus, there is clearly a need to explore this signalling mechanism in a broader range of bacterial strains, especially those that are ecologically restricted to the marine environment. These studies will further the understanding of the molecular mechanisms that govern the cellular processes and behaviour of bacteria in the marine environment. Such studies will also further add to the “near universality” concept of cyclic-di-GMP signalling in the entire bacterial domain.

1.4.1. The Marine Roseobacter Clade

The Roseobacter clade (Alpha-Proteobacteria) represents one of the most abundant and ubiquitous bacterial groups in the marine environment [213-216]. Members of the clade exhibit diverse physiological and metabolic capabilities including the capacity for 29 sulphur metabolism [217-220], utilisation of aromatic compounds [221], phototrophy

[222-224], methylotrophy and mixotrophy [220, 225, 226]. Some members of the clade also exhibit varying morphological features such as the formation of holdfasts [227] and rosette structures [228, 229] while others possess gas vacuoles [230] and polyhydroxubutyrate (PHB) granules [231]. Furthermore, members of the Roseobacter clade are found associated with phytoplankton such as marine diatoms and dinoflagellates [232-235], marine fish and invertebrates such as scallops, oysters, cephalopods, sponges and corals [236-245], and marine plants, including seagrasses and seaweeds [246-252].

The ability to associate with other organisms is considered an inherent trait of the members of the Roseobacter clade. It has been suggested that roseobacters employ a biphasic “swim-or-stick” lifestyle [253]. However, little is understood about the underlying mechanisms employed by roseobacters in transitioning from a motile, planktonic state to a sessile, attached state. Given previous studies in other bacteria implicating cyclic-di-GMP as a key regulator of lifestyle shifts, it is therefore hypothesised in this thesis that cyclic-di-GMP may also play a role in determining the behavior of roseobacters.

To date, several representative members have been cultured and more than forty (40) roseobacter genomes have been sequenced [215] providing a suitable platform to explore and further investigate the genomic and phenotypic traits of this group. Several insights into the traits relevant for surface colonisation have emerged from comparative genomic studies of 21 representative strains [254], which provided baseline information on the traits wherein cyclic-di-GMP signalling might have a role. The succeeding

30 section (1.4.2) briefly discusses the relevant traits that potentially are impacted by cyclic-di-GMP.

1.4.2. “Swim-or-Stick” Lifestyle Traits in Marine Roseobacters that are potentially impacted by Cyclic-di-GMP

1.4.2.1. Chemotaxis and Motility

Chemotaxis has since long been recognised as an important trait in marine bacteria, including in response to algal extracellular products and toxic chemicals [255, 256].

Chemotactic behaviour by marine bacteria is generally expected as the marine environment is a repository of nutrients and chemical gradients derived from organic and inorganic sources even at the microscale level [257, 258]. Chemotaxis to chitin and chitin oligosaccharides of Vibrio furnissi [259-262], for example, involves a well- characterised mechanism that links chemotactic behaviour and surface attachment. In marine roseobacters, chemotactic behaviour is less well understood [254]. Among members of the Roseobacter clade, only Silicibacter sp. TM1040 has been characterised to exhibit chemotaxis towards the algal osmolyte dimethylsulfoniopropionate (DMSP), produced by the dinoflagellate Pfiesteria piscicida [263-265] and found in exudates of other phytoplankton species [266]. Genomic evidence also firmly established the relevance of this trait in Silicibacter sp.TM1040 by the abundance of genes encoding more than 20 chemoreceptor proteins (methyl-accepting chemotaxis proteins [MCPs]) and multiple copies of cytoplasmic chemotaxis proteins (Che) [253, 267].

In roseobacters, flagellar motility also appears to be an inherent trait, as deduced from studies of several well-characterised strains belonging to the genera Roseobacter,

Silicibacter, Dinoroseobacter, and Ruegeria [217, 224, 236, 237, 263, 268].

Comparative genomic evidence has also demonstrated the presence of gene clusters for flagellar synthesis [254] and the experimental evidence showing that motile roseobacters rapidly attach to artificial surfaces [228] or to natural surfaces and form biofilms [269] exemplify the role of flagella in surface attachment in roseobacters. In addition to flagella and pili, some members of the Roseobacter clade (Sagitulla stellata

E-37) [227] possess holdfast structures similar to Caulobacter crescentus and other aquatic members of aquatic Alpha-Proteobacteria [270]. Recently, spinae or tubular surface appendages have been described for Roseobacter sp. strain YSCB [271] that may have, in addition to facilitating attachment to surfaces, yet to be discovered unique functions in this strain.

1.4.2.2. Biofilm Formation and Secondary Metabolite Production

The formation of biofilms is known for some representative strains under laboratory conditions, for example, Phaeobacter gallaeciencis 2.10, which forms robust biofilms on the surface of Ulva australis [248, 269], and Nautella italica R11 forming substantial biofilms on the surface of a chemically-undefended Delisea pulchra [251, 252].

Interestingly, the formation of structures described as “rosettes” have been observed in attached cells of Roseobacter and Silicibacter strains [228]. Rosettes are star-shaped aggregates of cells that have been previously described in Roseobacter clade members

Stappia stellulata and Ruegeria atlantica [272, 273]. The ability to attach and form biofilms is linked to the formation of rosettes in Phaeobacter 24-7 [229, 274].

Subsequent studies on other Roseobacter strains revealed that culture conditions affect rosette formation and that pigment production and antibacterial activity in Phaeobacter

24-7 and Ruegeria sp. TM1040 co-occur with the formation of rosettes [228, 229].

Also, akin to the ability of roseobacters to attach and form biofilms is the ability to produce secondary metabolites. Tropodithietic acid (TDA) was subsequently identified as the compound conferring antimicrobial activity in Phaeobacter 24-7. Further studies have also shown that TDA from surface-attached Phaeobacter 27-4 can antagonise the fish pathogen Vibrio anguillarum [275]. The antagonistic activity of P. gallaciencis

2.10 to other bacteria and other marine organisms such as marine fungi, algal spores and gametes and invertebrate larvae from colonizing solid surfaces has also been attributed to the production of TDA [248, 269, 276].

The genetics and regulatory pathway of TDA production in roseobacters have now been elucidated [277-280]. Using Phaeobacter 24-7 and Ruegeria sp. TM1040 as model strains, twelve genes (tdaA-H, paaI-K, cysI and malY) were uncovered through transposon mutagenesis as critical for TDA synthesis [280]. Interestingly, in TM1040, it was found that tda genes reside in a plasmid [280]. Subsequent studies in TM1040 have shown that TDA can act as an autoinducer and thus can use TDA as a quorum signal

[278]. Similarly, in P. gallaciencis 2.10, TDA production is controlled by an N-acyl homoserine lactone signal, N-3-hydroxydecanoylhomoserine lactone (3OHC10-HSL) and through a response regulator PgaR [281]. In both TM1040 and P. gallaciencis,

TDA synthesis is linked to the phenylacetyl-coA pathway [279, 280]. Interestingly, a recent study has now demonstrated that cyclic-di-GMP controls TDA synthesis in a

Ruegeria mobilis strain [282].

In addition to TDA, recent studies have also unravelled other antagonistic bioactive compounds produced by surface-attached roseobacters, such as indigoidine from

Phaeobacter Y41 [283] and algicidal lactones from Ruegeria pomeroyi [284]. The blue 33 pigment indigoidine is produced by Phaeobacter strain Y41 via a non-ribosomal peptide synthase (NRPS)-based biosynthetic pathway and has broad antagonistic activity against multiple competing species such as V. fischeri, V. anguillarum, R. lacuscaerulensis, and C. albicans [283]. The algicidal lactones were identified from

Ruegeria pomeroyi DSS-3 cultured on agar plates and have been shown to have specific activity against algae but not other bacteria nor fungi [284].

Overall, these traits, among many others that remain to be uncovered, allow members of the Roseobacter clade to form associations with host surfaces. Understanding further the molecular mechanisms that regulate these traits and thus enable the marine roseobacters to transition from a motile to a sessile mode of life may broaden the knowledge about the ecological fitness of this diverse group of marine bacteria. Specifically, unveiling the potential role of cyclic nucleotides such as cyclic-di-GMP as one of the molecular mechanisms involved in the lifestyle switch in these organisms may expand the existing baseline information of this ubiquitous signalling molecule in bacteria.

1.5. Thesis Aims

The primary aim of this thesis is to explore the occurrence and potential role of cyclic- di-GMP in marine bacteria, particulary in the marine Roseobacter clade.

The thesis study initially focused on Nautella italica sp. R11, a Roseobacter clade member found to form biofilms and cause bleaching in the red alga, Delisea pulchra.

Since its isolation [251], research has been aimed at understanding the molecular mechanisms that allow R11 to colonise and invade the alga. Genome sequencing of R11 revealed traits that are essential for surface colonisation and virulence and the capacity to switch from a motile to a sessile pathogenic lifestyle [252]. The availability of the sequenced genome thus served as a platform to explore cyclic-di-GMP signalling, among other molecular mechanisms that were proposed to regulate colonisation and virulence traits in R11. Studies on R11 primarily comprise two chapters of this thesis study (Chapters 2 and 3).

Chapter 2 describes the identification of genes involved in cyclic-di-GMP metabolism in R11. The genes encoding putative diguanylate cyclases (DGCs) and phosphodiesterases (PDEs) were further characterised by domain structure analysis to determine the organisation of protein domains associated with the predicted DGCs and

PDEs. In addition, the conservation of sequence motifs necessary for catalytic activity of the proteins was determined through multiple sequence alignment with sequences of known and experimentally verified DGCs and PDEs.

In Chapter 3, gene deletion studies were conducted to determine phenotypic effects of the mutations in genes encoding DGCs and PDEs on motility and attachment of R11. In addition, overexpression studies of a functional DGC i.e. WspR and a functional PDE i.e. PA2133. These studies were performed in an attempt to manipulate cyclic-di-GMP levels in R11 and observe their corresponding effects in motility and attachment.

Changes in the levels of cyclic-di-GMP in the cells were determined by mass spectrometry.

Chapter 4 extends the preliminary findings from Chapter 2 and 3 to further explore cyclic-di-GMP metabolism in other representative members of the marine Roseobacter clade. Genes encoding for DGCs, PDEs and cyclic-di-GMP binding proteins were also identified and further characterised by domain structure analysis and by multiple sequence alignment. To confirm the occurrence of genes encoding the catalytic enzymes, the production of cyclic-di-GMP in these strains was determined by mass spectrometry. Cyclic-di-GMP levels were obtained from planktonic and from attached cells to gain insight into the differences in levels of the molecule in these distinct growth phases.

Finally in Chapter 5, a general discussion of the research study and its outcomes is presented. Future research activities on this re-emerging and exciting field of second messenger signalling mechanisms are also proposed.

CHAPTER 2

Identification and Characterisation of Cyclic-di-GMP

Signalling Genes in Nautella italica R11

2.1. INTRODUCTION

Nautella italica R11 is a member of the Roseobacter Clade of Alpha-Proteobacteria.

This strain was isolated from the thallus of the temperate red alga Delisea pulchra.

Strain R11 forms biofilms in vitro and on the surface of chemically-undefended D. pulchra [251]. Whole genome sequencing and analysis revealed the presence of genes necessary for epiphytic fitness, persistence and pathogenic potential of R11 on the surface of the alga [252]. The genome of strain R11 also encodes several chemotaxis receptors and the structural genes for flagellar biosynthesis essential for chemotaxis and motility [252]. In addition, the strain R11 genome encodes for proteins involved in the synthesis of exopolysaccharides (e.g. cellulose and succinoglycan) and proteins related to the assembly of Type IV pili or fimbriae, traits that are essential for surface colonisation [252]. Moreover, the genome encodes for catalases and peroxidases necessary for oxidative stress response as well as genes for the production of ammonia, urease, cytolytic toxins and indole acetic acid (IAA) which are essential for intracellular invasion of the host cells and progression of the bleaching disease in D. pulchra [252].

The mechanisms regulating these virulence factors in R11 are not yet fully elucidated.

The strain R11 genome further possesses several two-component signal transduction

(TCST) systems, which could mediate regulatory control of the expression of the colonisation and virulence factor expression in R11. Interestingly, a RpfC/RpfG TCST 37 system is present among the TCST systems encoded in the strain R11 genome [252].

The RpfC/RpfG system comprising the sensor kinase RpfC and the HD-GYP domain regulator RpfG is implicated in the perception and signal transduction of the cell to cell signal DFS (diffusible signal factor) [43, 285, 286]. The HD-GYP domain of RpfG acts as a cyclic-di-GMP phosphodiesterase and influences extracellular enzyme synthesis and biofilm formation in Xcc. [55, 189, 193, 194, 285-287]. The presence of a

RpfC/RpfG TCST system in R11 may indicate yet unexplored cyclic-di-GMP pathways to the regulation of colonisation traits and virulence in this strain.

Cyclic-di-guanosine monophosphate, or cyclic-di-GMP, has emerged as an important universal second messenger in bacteria. It regulates a variety of functions in bacteria, such as biofilm formation and dispersal, motility, virulence, cell differentiation and other cellular processes [9, 10, 22, 26, 158, 288-291]. Intracellular levels of cyclic-di-

GMP are determined by the activities of the enzymes diguanylate cyclase (DGCs) and phosphodiesterases (PDEs). Diguanylate cyclases synthesise cyclic-di-GMP from GTP, while phosphodiesterases degrade cyclic-di-GMP into pGpG or GMP [11, 21, 155].

Most diguanylate cyclases contain the GGDEF domain, whereas most phosphodiesterases contain the EAL or HD-GYP domain [16, 33, 104, 192]. Cyclic-di-

GMP exert its effects through binding to PilZ domain proteins and other effector proteins [10, 39, 57, 292].

Sequencing of bacterial genomes has shown that genes encoding for proteins containing

GGDEF, EAL or HD-GYP domains are abundant and widespread, which indicates that cyclic-di-GMP metabolism is a universal signalling system in bacteria [10, 17, 19].

Defining the presence and abundance of GGDEF or EAL domain-containing proteins in

38 newly sequenced genomes also provide insights into the possible involvement of cyclic- di-GMP metabolism in the regulation of bacterial developmental processes and behaviour.

In this study, the presence of a cyclic-di-GMP signalling system in strain R11 is explored by querying its genome for genes encoding putative cyclic-di-GMP metabolising enzymes, such as DGCs and PDEs and potential cyclic-di-GMP binding

PilZ domain proteins. Furthermore, the respective sequences of the predicted DGCs and

PDEs are further analysed and characterised to reveal their potential function and role in strain R11.

2.2. MATERIAL AND METHODS

2.2.1. Identification of Genes Encoding Proteins with GGDEF, EAL, HD-GYP and

PilZ Domains in N. italica R11.

The Nautella italica R11 (IMG-ER Taxon ID: 647533206; NCBI Taxon ID: 439497) genome sequence is available online at the IMG-ER database of the DOE Joint Genome

Institute (https://img.jgi.doe.gov/cgi-bin/er/main.cgi) [293]. To predict genes that encode for proteins with GGDEF and EAL domain proteins or those that encode putative DGCs or cyclic-di-GMP PDEs, the “Gene Search” tool was used using a keyword search “diguanylate cyclase” or “phosphodiesterase”. In addition, to further retrieve putative reference amino acid sequences, the representative diguanylate cyclases PleD (NP_421265.1) and WspR (NP_252391.1) were used in a protein blast

(BLASTP) as queries. To identify unique hits and exclude redundant hits, the query hits were manually screened for the presence of PFAM identifiers related to cyclic-di-GMP signalling. These include “pfam00990” (GGDEF domain), “pfam00563” (EAL domain) and “pfam00072” (response regulator receiver domain).

To predict genes that encode for proteins with HD-GYP domain, the PFAM identifier,

“pfam01966” (HD domain) was used as the search query. Furthermore, to predict genes that encode for proteins with PilZ domain, the PFAM identifier, “pfam07238” (PilZ domain) was used in the search query.

2.2.2. Determination of Domain Structure or Architecture

To determine the domain structure or organisation of each of the predicted proteins, the respective amino sequences were submitted to the SMART database (http://smart.embl- heidelberg.de/). SMART (or Simple Modular Architecture Research Tool) is a web- based tool, which provides annotation of protein domains or architecture [90].

2.2.3. Determination of Motif Conservation by Multiple Sequence Alignment

To determine the motif conservation of the predicted GGDEF, EAL, HD-GYP and PilZ domain proteins, respectively, a multiple sequence alignment was performed using T-

Coffee (http://tcoffee.crg.cat/apps/tcoffee/do:regular), a web-based multiple sequence alignment tool [294]. For GGDEF, EAL and HD-GYP domain proteins, the amino acid sequences of known DGCs or PDEs were included in the alignment. For the PilZ domain proteins, the amino acid sequences of known PilZ domain cyclic-di-GMP binding proteins were included. The alignment results in the ClustalW format were saved and submitted to the ESPript server using default parameters

(http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). The ESPript server generates an output of the aligned sequences showing blocked and colour-coded residues according to their similarity or conservation [295].

2.3. RESULTS

2.3.1. GGDEF and EAL Domain Proteins in N. italica R11

A total of nine genes were predicted to encode GGDEF and EAL domain proteins in the

N. italica R11 genome (Table 2.1). Most of them were annotated as diguanylate cyclase

(DGC) or phosphodiesterase (PDE) enzymes in the IMG database. Three of the predicted DGC/PDEs (RR11_749, RR11_868, RR11_1454) have transmembrane domains. Two proteins have signal peptides (RR11_868 and RR11_1454). Domain organisation or architecture of the putative DGCs/PDEs was predicted from the

SMART database (Figure 2.1). Two of the nine predicted DGCs were tandem GGDEF-

EAL domain-containing proteins (RR11_749 and RR11_868), five were GGDEF- domain-only proteins (RR11_1340, RR11_1454, RR11, 1147, RR11_774 AND

RR11_3152) and two were EAL domain only proteins (RR11_1896 and RR11_2876).

Five of the 9 predicted GGDEF and EAL domains contain associated sensor domains

(Figure 1). RR11_868 contains an MHYT domain, RR11_1340 contains a REC domain,

RR11_1147 contains a CBS domain. RR11_1454 contains a GAF domain, while

RR11_774 contains a PAS/GAF domain. No sensor domains were associated neither with the sole GGDEF-only domain protein (RR11_3152) nor with the two EAL domain-only proteins (RR11_1896 and RR11_2876).

Table 2.1. Predicted GGDEF and EAL Domain Proteins in the N. italica R11 Genome

Locus Tag Product Name Signal Transmembrane Peptide Helices RR11_749 diguanylate No Yes cyclase/phosphodiesterase RR11_868 diguanylate Yes Yes cyclase/phosphodiesterase RR11_1340 putative response No No regulator PleD RR11_1454 diguanylate cyclase, Yes Yes putative RR11_1147 response regulator PleD No No

RR11_774 GGDEF domain/pas/pac No No and gaf sensor domain protein RR11_3152 diguanylate cyclase No No

RR11_1896 diguanylate No No cyclase/phosphodiesterase RR11_2876 diguanylate No No phosphodiesterase

Figure 2.1. Domain organisation of the predicted GGDEF and EAL domain proteins in N. italica R11. Legend: GGDEF (GGDEF domain, PF00990); EAL (EAL domain, PF00563); REC (cheY-homologous receiver domain, SMART Acc.No. SM00448); PAS (PAS domain, PF00989); GAF (GAF (GAF domain, PF01590); CBS (CBS domain, PF00571); Response_reg (response regulator receiver domain, PF00702); MHYT (bacterial signalling protein N-terminal repeat, PF03707); TM (transmembrane region).

2.3.2. HD-GYP Domain Proteins in N. italica R11

Four genes were predicted to encode HD-GYP domain proteins in the strain R11 genome (Table 2.2). Three of the genes were predicted to encode proteins with hydrolase activities. None of the predicted proteins contain signal peptides or transmembrane domains. Domain structure analysis showed that all four predicted proteins possess HD domains (Figure 2). One of them is a sole HD domain protein

(RR11_360) and the other two (RR11_2820 and RR11_2887) have HD-associated

43 domains (“HD_5” and “HD_assoc”, respectively). Interestingly, in RR11_698, the HD domain is linked to transferase domains.

Table 2.2. Predicted HD-GYP Domain Proteins in the N. italica R11 Genome

Locus Tag Product Name Signal Transmembrane Peptide Helices RR11_360 conserved hypothetical No No protein RR11_2887 deoxyguanosinetriphosph No No ate triphosphohydrolase RR11_2820 metal-dependent No No phosphohydrolase, HD subdomain RR11_698 protein-P-II No No uridylyltransferase

Figure 2.2. Domain organisation of the predicted HD-GYP domain proteins in N. italica R11.Legend: HDc (HD domain, metal-dependent phosphohydrolase, PF 01966); HD_5 (HD domain, PF13487); HD_assoc (HD domain, phosphohydrolase-associated domain, PF13286); NTP_transf_2 (nucleotidyltransferase domain, PF01909); GlnD_UR_UTase (GlnD_PII uridylyltransferase, PF08335); ACT (ACT domain, PF01842).

2.3.3. PilZ Domain Proteins in N. italica R11

Only two genes were predicted to encode PilZ domain proteins in the strain R11 genome (Table 2.3). Interestingly, one was found associated with Type IV pilus assembly, while the other one was found associated with cellulose synthase. Both have transmembrane domains, while only the predicted PilZ protein has a signal peptide.

(Figure 2.3). Domain structure analysis showed that the predicted proteins possess the

PilZ domains. The SMART prediction further confirmed that RR11_2632 has a cellulose synthase and the glycosyl transferase 2 family domains.

Table 2.3. Predicted PilZ Domain Proteins in the N. italica R11 Genome

Locus Tag Product Name Signal Transmembrane Peptide Helices RR11_3318 Type IV pilus assembly Yes Yes protein PilZ RR11_2632 putative cellulose No Yes synthase catalytic subunit protein

Figure 2.3. Domain organisation of the predicted PilZ domain proteins in N. italica R11. Legend: PilZ (PilZ domain, cyclic-di-GMP binding domain, PF07238); Cellulose_synt (Cellulosa synthase, PF03552); Glycos_transf_2 (Glycosyl transferase family 2, PF00535); TM (transmembrane region).

2.3.4. Multiple Sequence Alignment of GGDEF Domain Proteins in N. italica R11

Analysis of the conservation of the sequence motifs or key residues is important in assigning or conferring potential enzymatic activity, hence, the amino acid sequences of the predicted GGDEF domain proteins N. italica R11 were aligned with known DGCs or PDEs. Initially, all the R11 sequences were used for the alignment, however, only seven of the predicted GGDEF-containing proteins aligned. No significant alignment was obtained for the EAL- only domain proteins RR11_1896 and RR11_2876 when they were included in the dataset, so therefore they were analysed in a separate alignment.

Alignment of the GGDEF-domain containing proteins in strain R11 with known DGCs showed the “GGDEF” or “GGEEF” motif (Figure 2.4 and Table 2.4). Furthermore, the alignment also showed the putative cyclic-di-GMP allosteric site (I-site) or the RxxD motif (Figure 3). Most of the predicted GGDEF domain proteins in strain R11 have conserved “GGDEF” or “GGEEF” motif except for RR11_749, which has a degenerate

“SDSRF” motif. The RxxD motif is conserved in four of the seven proteins (Figure 2.4 and Table 2.4). In general, it was observed that, while some of the proteins have both conserved GGDEF and RxxD motifs, others either have a degenerate GGDEF, but a conserved RxxD motif (RR11_749), and some have conserved GGDEF motifs with degenerate RxxD motifs.

RxxD GG[D/E]F

Figure 2.4. Multiple sequence alignment of the putative diguanylate cyclases from N. italica R11 with representative DGCs from other bacteria: PleD from Caulobacter crescentus (AAA87378.1), AdrA from Salmonella typhimurium (NP_459380.1), ScrC from Vibrio parahaemolyticus (AAK08640.1), WspR from Pseudomonas aeruginosa (NP_252391.1), DGC1 from Gluconacetobacter xylinus (AAC61684.1), HmsT from Yersinia pestis (AAD25088.1), TM1163 from Thermotoga maritima (YP_008991738.1), SLR1143 from Synechocystis sp. (BAA17300.1), STM4551 from Salmonella enterica (WP_000211214.1), CD1420 from Clostridium difficile (YP_001087922.1), DRB0044 from Deinococcus radiodurans (AAF12589.1), BifA from Pseudomonas aeruginosa (AAG07755.1). Identical residues are white characters in red boxes; homologous residues are red characters in white boxes; differing residues are black characters. ). “GG[D/E]F” and “RxxD” sequence motifs are shown respectively.

Table 2.4. Sequence Motif Conservation of the GGDEF Domain Proteins in N. italica R11

Locus Tag GGDEF Motif RxxD Motif RR11_749 SDSRF RPQD RR11_868 GGDEF EEGE RR11_774 GGEEF RNGE RR11_1340 GGEEF RPVD RR11_3152 GGDEF RQND RR11_1454 GGEEF DGDE RR11_1147 GGEEF RTVD

2.3.5. Multiple Sequence Alignment of EAL Domain Proteins

The predicted standalone EAL domain proteins in strain R11 (RR11_1876 and

RR11_2876) were aligned with the amino acid sequences of known EAL domain proteins from other bacteria. The respective sequences of the tandem GGDEF-EAL domains RR11_749 and RR11_868 were included in the alignment to further characterise their respective EAL domains. For the standalone EAL domains, the resulting alignment showed that the EAL motif is truncated in RR11_1896, while

RR11_2876 has a degenerate EAL motif (“EGY”). The EAL motifs of the tandem domain proteins RR11_749 and RR11_868 are conserved (Figure 2.5 and Table 2.5).

Furthermore, the alignment also showed the consensus “Loop 6” motif

(DDFG(T/A)GYSS) essential for catalytic activity [42, 46, 296]. Only RR11_868 showed a conserved Loop 6 motif. Based on a classification scheme of EAL domain proteins suggested by Rao and coworkers [46, 296], RR11_868 is classified as a Class I

EAL domain (i.e. conserved catalytic residues; conserved Loop 6) and RR11_749 is classified as a Class II EAL domain (i.e. conserved catalytic residues; degenerate Loop

6). The standalone RR11_1896 and RR11_2876 are classified as Class III EAL domains

(i.e. lack one or more catalytic residues; degenerate Loop 6) (Figure 2.5 and Table 2.5).

Figure 2.5. Multiple sequence alignment of the putative cyclic-di-GMP phosphodiesterases from N. italica R11 with representative cyclic-di-GMP phosphodiesterases from other bacteria: RocR from Pseudomonas aeruginosa (NP_252636.1), VieA from Vibrio cholerae (YP_001217202.1), PDEA1 from Gluconacetobacter xylinum (BAD36772.1) and YciR from Escherichia coli (YP_004953921.1); DGC2 from Gluconacetobacter xylinum (AAC61687.1), YkuI from Bacillus sp. (2W27.A), YhjH from Escherichia coli (AAC76550), YahA from Escherichia coli (YP_008570252); YdiV from Salmonella typhimurium (NP460310.1), LapD from Pseudomonas fluorescens (AB154127.1) and CsrD from Eschericia coli (YP_005276193). Identical residues are white characters in red boxes; homologous residues are red characters in white boxes; differing residues are black characters. ). “ExL” and “DDFGTGYSS” sequence motifs are shown underlined, respectively. Residues suggested to confer potential catalytic activity based on RocR studies [46, 296] are shown underlined. Residues important for Mg2+ binding are indicated in red.

Table 2.5. Sequence Motif Conservation of the Predicted EAL domain proteins in N. italica R11

Locus Tag EAL DDFGTGYSS RR11_1896 --- DDFGTGHAS RR11_2876 EGY DNFGAAATA RR11_749 EAL DDFGTGHAS RR11_868 EVL DDFGTGYSS

2.3.6. Multiple Sequence Alignment of HD-GYP Domain Proteins in N. italica R11

The predicted HD-GYP domain proteins in strain R11 (RR11_2820, RR11_360,

RR11_698 and RR11_2887) were aligned with the amino acid sequences of known HD-

GYP domains from other bacteria. The resulting alignment showed that the HD motif is conserved in all four proteins from R11. However, only RR11_2820 showed a conserved GYP motif (Figure 2.6 and Table 2.6).

Figure 2.6. Multiple sequence alignment of the putative HD-GYP domain proteins from N. italica R11 with representative HD-GYP proteins from other bacteria: RpfG from Xanthomonas campestris (3MTD_A), Bd1817 from Bdellovibrio bacteriovorus (QUU85), PA4108 from Pseudomonas aeruginosa (NP_252797), PA4781 from Pseudomonas aeruginosa (NP_253469), VC_A0681 from Vibrio cholerae (AAF96581), BP3508 from Bordetella pertussis (NP_882026), KPK_3322 from Klebsiella pneumoniae (ACI09878), SCO5218 from Streptomyces coelicolor (NP_629365). Identical residues are white characters in red boxes; homologous residues are red characters in white boxes; differing residues are black characters). “HD” and “GYP” sequence motifs are shown respectively.

Table 2.6. Sequence Motif Conservation of the HD-GYP Domain Proteins in N. italica R11

Locus Tag HD Motif GYP Motif RR11_360 HD --- RR11_2887 HD R-A RR11_2820 HD GYP RR11_698 HD G-H

2.3.7. Multiple Sequence Alignment of PilZ Domain Proteins in N. italica R11

The predicted PilZ domain proteins in R11 (RR11_3318 and RR11_2632) were aligned with the amino acid sequences of known PilZ domains from other bacteria. The resulting alignment showed that only RR11_2632 has a conserved RxxxR motif.

However, the DZSxxG motifs in both proteins are conserved (Figure 2.7 and Table 2.7).

RxxxR

DZSxxG

Figure 2.7. Sequence alignment of the putative PilZ domain proteins from N. italica R11 with representative PilZ domain proteins from other bacteria: PA4608 from Pseudomonas aeruginosa (2L74_A), PP4397 from Pseudomonas putida (3KYF_A), VCA0042 from Vibrio cholera (2RDE_A), YcgR from Salmonella typhimurium (Q8ZP19.1), DgrA from Caulobacter crescentus (AAK23578.1) and DgrB from Caulobacter crescentus (ACL96733.2). RxxxR and DZSxxG sequence motifs are shown respectively; “Z” is any hydrophobic amino acid and “x” is any residue. 52

Table 2.7. Sequence Motif Conservation of the PilZ Domain Proteins in N. italica R11

Locus Tag RxxxR Motif DZSxxG Motif RR11_3318 ARRKR DISQEG RR11_2632 RSEER DMSLNG

2.4. DISCUSSION

The aim of this study was to explore the genomic potential for cyclic-di-GMP signalling in the red-seaweed pathogen Nautella italica R11. This study revealed that several genes encoding GGDEF, EAL, HD-GYP and PilZ domain proteins are encoded in the genome and subsequent sequence analyses and further characterisation of these proteins indicate that they are likely to function as enzymes involved in cyclic-di-GMP synthesis, degradation and binding. Furthermore, the analyses indicate that several cellular processes and behaviour in strain R11 could be linked to a cyclic-di-GMP pathway

2.4.1. GGDEF Domain Proteins in N. italica R11 are Potential Diguanylate

Cyclases

Cyclic-di-GMP is synthesised in the cell by the enzyme diguanylate cyclases [21]. In most DGCs, the GGDEF motif confers the catalytic activity although a variation in the motif such as the replacement of the third aspartate (D) to a glutamate (E) has been shown to retain the catalytic activity of the protein [30-36]. Based on sequence analyses, all of the predicted GGDEF domain proteins in strain R11 could be expected to have

53 diguanylate cyclase activities, respectively, except for one (RR11_749), which has a degenerate GGDEF motif and therefore could be enzymatically inactive. However, despite possessing a degenerate motif, an alternative function for the GGDEF domain of

RR11_749 could exist as it was previously shown that a GGDEF domain protein in C. crescentus is enzymatically inactive but can still bind GTP [38]. Interestingly,

RR11_749 is one of two predicted proteins (the other being RR11_868) that is coupled to an EAL domain. Both comprise the tandem GGDEF-EAL domain proteins in strain

R11. “Tandem” GGDEF-EAL domains are often found in sequenced genomes [10, 16] and it has been previously recognised that most tandem GGDEF-EAL domain proteins have intact active sites [12]. Only a few of these tandem domains have been characterised as bifunctional i.e. possessing both DGC and PDE activities under certain conditions, including the BphG1 from Rhodobacter sphaeroides [297], ScrC from

Vibrio parahaemolyticus [40], MSDGC-1 from Mycobacterium smegmatis [298] and the Lpl0329 from Legionella pneumophila [299]. In contrast, the tandem GGDEF-EAL domain proteins in Gluconacetobacter xylinus were found to only possess either a DGC activity or a PDE activity [104, 156]. RR11_868 has an intact GGDEF domain, but a degenerate EAL domain (discussed further below) indicating that this protein may be catalytically functional only for the DGC activity. As previously mentioned RR11_749 has a degenerate GGDEF domain, but its EAL domain is conserved (discussed further below).

2.4.2. RxxD motif of N. italica R11 GGDEF Domains Are Potential Allosteric Sites for Cyclic-di-GMP

Sequence analysis with known DGCs also revealed the RxxD motif. In many GGDEF domain proteins, the allosteric or inhibitory site (I-site) is characterised by the RxxD 54 motif (x is any amino acid). The I-site is involved in feedback inhibition through binding of cyclic-di-GMP [38, 300, 301]. Among the predicted GGDEF domain proteins in strain R11, the RxxD motif is conserved, except for RR11_868 and

RR11_1454. These observations suggest that while most of the strain R11 GGDEF domain could function as DGCs, they are also possibly involved in feedback inhibition of cyclic-di-GMP. The degenerate RxxD motif in RR11_868 and RR11_1454 possibly indicates a non-functional I-site. Interestingly, despite lacking an I-site, these R11 proteins could still be competitively inhibited. A GGDEF domain protein XCC4471 of

Xanthomonas campetris lacks an I-site and structural studies have revealed that cyclic- di-GMP binds to and is semi-intercalated in the active site [302].

2.4.3. EAL and HD-GYP Domains Proteins in N. italica R11 Are Potential Cyclic- di-GMP Phosphodiesterases

The presence of genes encoding EAL domain proteins indicate that strain R11 is potentially capable of producing cylic-di-GMP phosphodiesterases. Two EAL domains are in tandem with GGDEF domains (RR11_749 and RR11_868), while two are standalone EAL domains (RR11_1896 and RR11_2876). Further sequence analysis with known EAL domains revealed that these proteins are classified as Class I

(RR11_868), Class II (RR11_749) and Class III (RR11_1896 and RR11_2876) EAL domains consistent with the classification scheme by Rao and coworkers [46, 47].

Based on this classification, it is expected that the EAL domains in RR11_868 and

RR11_749 may have potential PDE activities, while neither RR11_1896 nor

RR11_2876 would exhibit any PDE activities. Interestingly, despite the fact that these proteins lack the potential for PDE activity, they may have alternative functions, as exemplified by several studied Class III EAL domain proteins. YcgF, a BLUF-EAL 55 protein from E. coli has a degenerate EAL domain and did not exhibit PDE activity, but is involved in a protein-protein interaction as an anti-repressor under blue-light conditions [303]. Another standalone EAL-domain protein, which lacks the signature motif, is the STM1344 (YdiV) from S. enterica serovar Typhimurium [304]. STM1344 did not show any PDE activity, but positively affects the regulation of CsgD protein responsible for the rdar morphotype in S. enterica serovar Typhimurium [304].

Degenerate EAL domain proteins can also bind cyclic-di-GMP as shown by the protein

LapD from P. fluorescens [68, 69]. Moreover, degenerate EAL domain proteins can bind RNA as shown by CsrD in E. coli. [305]. Given these instances, while only two

EAL domain proteins (i.e. RR11_868 and RR11_749) could have cyclic-di-GMP- dependent PDE activities in strain R11, the remaining EAL domain proteins may have the potential to perform functions independent of the cyclic-di-GMP pathway.

The presence of predicted HD-GYP domains encoded in the genome further indicates that an alternative cyclic-di-GMP degradation pathway exists in strain R11. The specialised HD-GYP domain [49] belongs to a widespread HD superfamily [50] of metal-dependent phosphohydrolases. The HD residues forming the dyad have been shown to be essential for catalytic activity including metal-dependent 2',3'-cyclic phosphodiesterase, 2'-nucleotidase, and phosphatase activities [306]. Among the predicted HD-GYP domains in strain R11, only RR11_2820 has the conserved HD-

GYP motif and is expected to function as a cyclic-di-GMP PDE. The other predicted

HD-GYP domains with conserved HD motif, but with missing and degenerate GYP motifs, are probably involved in other enzymatic activities defined for the HD superfamily [50].

2.4.4. PilZ Domain Proteins are Potential Cyclic-di-GMP Binding Proteins in N. italica R11

Two putative PilZ-domain proteins (RR11_3318 and RR11_2632) are encoded in the genome of strain R11. More interestingly, these PilZ domain proteins are associated with genes encoding for cellulose synthase (RR11_2632) and Type IV pilus assembly protein (RR11_3318) [252]. The presence of a PilZ domain in RR11_2632 suggests that potential binding of cyclic-di-GMP could regulate the cellulose synthase activity of this protein similar to the PilZ-domain containing cellulose synthase BcsA in G. xylinus [21,

39]. Likewise, as previously demonstrated in P. aeruginosa and N. gonorrheae [56], the presence of a PilZ domain in RR11_3318 suggest that potential binding of cyclic-di-

GMP could regulate the Type IV pilus or fimbriae assembly proteins in R11 which includes the Flp pilus assembly proteins CpaA (protease), CpaB (pilus assembly), CpaC

(secretin), an ATPase protein (CpaF) and the Type IV fimbriae expression regulatory protein PilR [252].

Structural studies have shown that cyclic-di-GMP binding is dependent on the RxxxR and DZSxxG (Z any amino acid) motifs with the RxxxR as the primary binding Loop that wraps around cyclic-di-GMP [60]. Mutations in these motifs have been shown to abrogate low micromolar to low nanomolar affinity binding of cyclic-di-GMP as previously observed in other PilZ domain proteins, such as YcgR from E. coli [57],

DgrA from C. crescentus [58] or Alg44 from P. aeruginosa [165]. Sequence alignment of the strain R11 PilZ domain proteins showed that although both have conserved

DZSxxG motif, only RR11_2632 has the conserved RxxxR motif indicating the affinity

57 for cyclic-di-GMP of this protein and thus the potential for cyclic-di-GMP-dependent regulation of cellulose synthesis in strain R11.

2.4.5. Sensor Domains Associated with the GGDEF and EAL Domains Potentially

Link Environmental Signals to Cyclic-di-GMP Pathway in N. italica R11

A variety of sensor domains are found associated with the strain R11 DGCs and PDEs, which include PAS (Per-ARNT-Sim), GAF (cGMP-specific phosphodiesterases, adenylyl cyclases and FhlA), MHYT (methionine, histidine, and tyrosine), REC

(receiver domain) and CBS (cystathionine-beta-synthase)domains. PAS and GAF domains both bind small molecules [83-85]. In addition, the GAF domain may be involved in light sensing [86]. The MHYT domain senses oxygen (O2), carbon monoxide (CO) and nitric oxide (NO) [87]. The REC domain represents the response regulator receiver domain belonging to the CheY family and receives the signal from the sensor partner in two-component systems [88, 89]. CBS domains can act as binding domains of adenosine derivatives and may regulate the activity of the attached enzymatic or other domains and may also act as sensors of cellular energy status by being activated by AMP and inhibited by ATP [307, 308]. These various sensor domains associated with GGDEF and EAL domains in strain R11 suggest that sensing of distinct environmental cues is linked to cyclic-di-GMP signaling. Among the predicted proteins, worth noting is the membrane-bound GGDEF domain protein that has an MHYT domain (RR11_868). This protein in particular could be involved in sensing oxygen availability or sensing oxidative stress on the surface of D. pulchra. In marine macroalgae, an oxidative burst or the production of reactive oxygen species

(ROS) is elicited as a response to a pathogen attack on the surface of the thallus [309].

These ROS, in the form of superoxide or hydrogen peroxide, can cause cellular damage to the invading pathogen by affecting essential macromolecules such as DNA, lipids and proteins [310]. Bacterial pathogens on one hand are able to counteract this stress by producing enzymes including as catalases and peroxidases to counteract such oxidative stress [311]. In response to the oxygen availability or oxidative stress, strain R11 could utilise this protein to modulate cyclic-di-GMP levels and perhaps facilitate the expression of genes encoding catalases or peroxidases [252]. This could be a critical mechanism involved in the interaction of strain R11 with D. pulchra. Another predicted membrane-bound GGDEF domain protein RR11_1454, which has an associated GAF domain, could potentially be involved in binding novel small molecules [83, 85, 312].

In addition, it could also be involved in GAF domain-facilitated light sensing [86]. The other GGDEF domain proteins with associated sensor domains were predicted to be localised in the cytoplasm and hence could be involved in intracellular sensing.

RR11_1340 is a predicted REC-GGDEF domain protein and is related to PleD of C. cresentus. The REC (CheY-like phosphoacceptor or receiver) domain is a common regulatory module in a variety of bacterial response regulators [81]. The DGC activity of the GGDEF domain in PleD is stimulated by phosphorylation of the conserved aspartate in the REC domain subsequently promoting a transition from swarming to stalk formation in C. crescentus [30].

Overall, the sequenced genome of N. italica R11 provided the means to explore the potential for cyclic-di-GMP signalling mechanisms in this strain. Further insights were provided by bioinformatic approaches to facilitate the characterisation and analyses of the domain structure and motif conservation of the predicted proteins as well as their associated domains. The presence of genes involved encoding for proteins with

GGDEF, EAL, HD-GYP domains and PilZ domains indicate that a cyclic-di-GMP signalling pathway exists in strain R11 and could be a mechanism that controls colonisation traits and virulence.

CHAPTER 3

Deletion of Genes Involved in Cyclic-di-GMP Metabolism in

Nautella italica R11

3.1 INTRODUCTION

Determining how bacteria modulate intracellular cyclic-di-GMP levels and what the outcomes are of the cyclic-di-GMP modulation is important for understanding the relevance of cyclic-di-GMP in bacterial cell signalling, lifestyle and adaptation. Genetic studies involving deletion or overexpression of genes encoding DGCs and PDEs have unambiguously elucidated the specific role of GGDEF and EAL domain proteins in cyclic-di-GMP signalling in several bacterial species [313] [34, 36, 44, 104, 156, 208,

314]. Several studies in genetically tractable strains have demonstrated successful deletion of genes encoding GGDEF or EAL domains and thus identified the genes with specific roles in cyclic-di-GMP signalling. For example, in Vibrio cholerae, in-frame deletion mutants were generated for all genes predicted to encode proteins with GGDEF and EAL domains and subsequent screening of 42 mutants revealed two DGCs (CdgH and CdgH) that control rugosity and biofilm formation [162]. In Salmonella enteritidis, cyclic-di-GMP signalling was elucidated by constructing a strain lacking all genes encoding the GGDEF domain and then by producing derivatives to restore one protein at the time [107]. It was found that complete deletion of 12 genes encoding GGDEF- domain proteins that resulted in a null mutant strain ΔXII, abolished virulence, motility, long-term survival, and cellulose and fimbriae synthesis [107]. Twelve derivatives of

ΔXII were then created, each containing a chromosomal copy of a single gene encoding

GGDEF domain protein in the original wild type genomic location. Of these 61 derivatives, a unique strain ΔXII+stm4551 restored most of the phenotypes missing in

ΔXII. In addition, three strains (ΔXII+stm1987, ΔXII+yegE, and ΔXII+yfiN) recovered the ability to form biofilms [107]. While deletion of all GGDEF domain proteins in S. enteritidis resulted in a observable phenotypic effect, in Legionella pneumophila, the deletion of all genes involved in cyclic-di-GMP signalling did not result in any observable defect in vitro or inside host cells [315].

Sequential deletion of one gene at a time is an alternative approach to uncover the specific role of putative DGC- and PDE-encoding genes in a specific cellular process or behaviour, such as motility or biofilm formation. For example, in E. coli, deletion of a

PDE resulted in elevated cyclic-di-GMP levels and the induction of a strong counter clockwise (CCW) bias in flagellar rotation leading to smooth swimming [316]. In P. aeruginosa, a deletion of the DGC gene sadC increased swarming motility and caused a defective biofilm formation [137]. In contrast, deletion of the PDE BifA resulted in a severe swarming motility defect and a hyper-biofilm phenotype [101]. These few examples illustrate the effects that deletion of DGC or PDE can have on bacterial behaviour.

Overexpression of DGC or PDE encoding genes can also facilitate the elucidation of their respective roles in cellular or behavioural processes. In most cases, overexpression experiments have been used to complement deletion experiments. For example, in P. aeruginosa the deletion of the DGC sadC promoted hyper-swarming and caused defective biofilm formation, while overexpression of sadC promotes sessility [137]. In

E. coli, deletion of the DGC gene yddV negatively affected poly-N-acetylglucosamine

(PNAG)-mediated biofilm formation, while overexpression of the yddV stimulated

PNAG production and promoted biofilm formation [317]. Heterologous or ectopic overexpression of genes encoding DGCs or PDEs has also been used. For example, several cyclic-di-GMP protein encoding genes from Clostridium difficile were overexpressed in V. cholerae. Most of the heterologously expressed DGCs decreased cell motility and increased biofilm formation in the V. cholerae model confirming the predicted activity of the proteins [318].

In Chapter 2 of this thesis, genes encoding putative diguanylate cyclases (DGCs) and cyclic-di-GMP phosphodiesterases (PDEs) were identified in the genome of N. italica

R11. Multiple sequence analyses further revealed that a number of these proteins have conserved sequence motif (i.e. GGDEF or EAL) that is necessary for catalytic activity.

In addition, domain structure analysis showed that a number of these proteins have associated sensor domains that allow perception of environmental signals or cues.

These findings suggest that R11 is capable of a cyclic-di-GMP signalling mechanism.

This chapter further explores the role of the genes encoding DGCs and PDEs in R11 using two approaches; 1.) by deletion of genes encoding the GGDEF/EAL domain proteins and 2.) by overexpression of a functionally-verified DGC (WspR) and a PDE

(PA2133) respectively in R11. WspR (PA3702) is a response regulator of the Wsp

(wrinkly spreader phenotype) chemosensory system in P. aeruginosa that has a conserved REC-GGDEF domain [319]. The GGDEF domain of WspR has diguanylate cyclase activity and has been shown to produce cyclic-di-GMP [31, 37]. PA2133 is a

EAL-domain protein which has been shown as an active cyclic-di-GMP phosphodiesterase [31, 165, 313]. It was hypothesised that the loss of a DGC or a PDE

63 gene and, conversely, the expression of a known DGC or a known PDE could alter the cyclic-di-GMP levels and exerts an effect on colonisation traits in R11.

3.2. MATERIALS AND METHODS

3.2.1 Construction of N. italica R11 Cyclic-di-GMP Gene Deletion Strains

3.2.1.1. Strains and Plasmids Used

The bacterial strains and plasmids used in the study are shown in Table 3.1. The N. italica strains were grown in half-strength Marine Broth (HMB; 18.7 g Marine Broth

2216 (Difco) dissolved in 1L milliQ water) at 25oC and 180 rpm. The E. coli strains were grown in LB Broth (tryptone, 10 g; yeast extract, 5 g; NaCl, 10 g; dissolved in 1L milliQ water) at 35oC and 180 rpm. The antibiotics chloramphenicol (2.5 μg/ml), kanamycin (85 μg/ml), and gentamicin (50 μg/ml) were added to the cultures where appropriate.

Table 3.1. Bacterial Strains and Plasmids Used

STRAINS DESCRIPTION/GENOTYPE REFERENCE Nautella italica Nautella italica Nautella italica R11, Wild Type strain Case et al., 2011 R11WT Nautella italica Knockout mutant strain A of RR11_868, This Study ΔR11cdg1A diguanlyate cyclase/phosphodiesterase, KanR, CmR Nautella italica Knockout mutant strain B of RR11_868, This Study ΔR11cdg1B diguanylate cyclase/phosphodiesterase, KanR, CmR, Nautella italica Knockout mutant strain of RR11_749, This Study ΔR11cdg2 diguanylate cyclase/phosphodiesterase, KanR, CmR Nautella italica Knockout mutant strain of RR11_1340, This Study ΔR11cdg3 putative response regulator PleD, KanR, CmR Nautella italica Complemented knockout mutant This Study ΔR11cdg3- ΔR11cdg3, KanR, CmR, pMCScdg3 64

STRAINS DESCRIPTION/GENOTYPE REFERENCE Nautella italica N. Italica R11 strain containing the This Study R11-pJN105 plasmid backbone, GmR Nautella italica N. italicaR11 strain containing the This Study R11-pwspR plasmid harbouring the wspR gene, GmR Nautella italica N. Italica R11 strain containing the This Study R11-pPA2133 plasmid harbouring the PA2133 gene, GmR

Escherichia coli E. coli S17-1 Conjugation donor strain Genotype: S17- Thoma and 1ΔhemA thi pro hsdR - M - with Schobert, 2009 chromosomal integrated [RP4-2 Tc::Mu:Km r ::Tn7, Tra+ TriR, StrR ] Pseudomonas aeruginosa PAO1-pN105 P. aeruginosa PAO1 strain containing the Nicolas Barraud, plasmid backbone, GmR , PAO1 (MA67) CMB, UNSW pJN105 (Gm 50) PAO1-pwspR P. aeruginosa PAO1 strain containing the Nicolas Barraud, plasmid harbouring the wspR gene, GmR CMB, UNSW , PAO1 (MA67) pJN105-wspR.3.1 (Gm 50) PAO1-pPA2133 P. aeruginosa PAO1 strain containing the Nicolas Barraud, plasmid harbouring the PA2133 gene, CMB, UNSW GmR, PAO1 (MA67) pJN105- PA2133.4.1 (Gm 50) PLASMIDS pKmobGII Broad host range mobilizable suicide Katzen et al. vector KanR 1999 pKmobGII- Knockout construct of RR11_868, This Study R11cdg1 diguanlyate cyclase/phosphodiesterase, KanR, CmR pKmobGII- Knockout construct of RR11_749, This Study R11cdg2 diguanlyate cyclase/phosphodiesterase, KanR, CmR pKmobGII- Knockout construct of RR11_1340, This Study R11cdg3 putative response regulator PleD, KanR, CmR pKmobGII- Knockout construct of RR11_774, This Study R11cdg4 GGDEF domain, PAS/PAC/GAF sensor domain, KanR, CmR pKmobGII- Knockout construct of RR11_1454, This Study R11cdg5 putative diguanylate cyclase, KanR, CmR pJN105 Broad-host-range vector carrying the Alain Filloux, araBAD promoter, GmR ICL pJN105-wspR wspR cloned into pJN105, GmR Alain Filloux, ICL pJN105-PA2133 PA2133 cloned into pJN105, GmR Alan Filloux,

STRAINS DESCRIPTION/GENOTYPE REFERENCE ICL pBBR1MCS5-Gm Broad host range mobilizable vector, Kovach et al. containing the gentamicin resistance gene 1995 cassette, GmR

3.2.1.2. PCR Amplification of DGC and PDE Genes and the Chloramphenicol

Resistance Gene Cassette

To amplify the gene of interest (GOI), the R11 wild type strain was grown overnight in

10 ml of Marine Broth 2216 (Difco) at 30oC with shaking at 180 rpm. To amplify the

Cam cassette, an overnight culture of an E. coli strain containing the plasmid pBBRMCS1-CamR was grown in LB broth with chloramphenicol at 35oC and 180 rpm.

One microliter (1μl) each of the respective cultures was used subsequently in individual

PCR reactions (50 µl) containing 1x Phusion® High-Fidelity PCR Master Mix with HF

Buffer (New England Biolabs) and 0.5 µl each of the respective UP and DOWN primers

(10 ρmol) of the GOIs (Table 3.2). For the chloramphenicol resistance gene cassette, the respective forward and reverse primer sequences were: CamF: 5’-

GCTGCATTAAATCGGCCA-3’ (Tm: 68oC) and 5’- CamR:

GAATAAATACCTGTGACGGAAGATCACTTC-3’ (Tm: 67oC). The amplification reaction consisted of the following: initial denaturation: 98°C for 3 min; then 30 cycles each of denaturation: 98°C for 30 seconds; annealing: 61°C for 30 seconds; extension:

72°C for 1.5 min. A final extension step was done at 72°C for 10 min. The PCR products were first purified using the MinElute PCR purification kit (Qiagen) and then visualised on 0.85% agarose gel.

Table 3.2. Primers for PCR Amplification of N. italica R11 DGCs and PDEs. (UP_F and DN_R) and for SOE-PCR of Knockout Constructs (UP_FO and DN_RO); UP_F: forward primer; DN_R: reverse primer; UP_FO: UP forward overhang; DN_RO: down reverse overhang. The sequences in bold and italics correspond to the overhang sequences which are complementary to the up and down regions respectively of the chloramphenicol resistance gene cassette.

GENE IMG PRIMERS PRIMER SEQUENCES (5' - 3') Tm NAME LOCUS (oC) TAG R11 RR11_868 UP_F ACCCTCGATACGGATTGCGT 54 cdg1 UP_RO TGGCCGATTCATTAATGCAGC 71 GCGATGTGCAGATAGGCTCC DN_FO GAAGTGATCTTCCGTCACAGG 72 TATTTATTC GGTGGTGGAGCCGGTCGATTTT DN_R ATTGCCCTTTCGCCCGGTTG 56 R11 RR11_749 UP_F TGAACCTGTTCCACGGCGGT 56 cdg2 UP_RO TGGCCGATTCATTAATGCAGC 70 CCATCCACGGAAATCGGTTC DN_FO GAAGTGATCTTCCGTCACAGG 69 TATTTATTC TGATGGAACGGCTCAGTGAA DN_R TGCGAGAAGAAGGTTCTTGT 50 R11 RR11_1340 UP_F CGAATTTGCCCCGTTTGCCA 54 cdg3 UP_RO GAAGTGATCTTCCGTCACAGG 71 TATTTATTC TCGGTGACCAGGGCAACCAT DN_FO TGGCCGATTCATTAATGCAGC 70 GGTTTCAACGTCGCAGAGCT DN_R AGGGGGCTTTGCAGGACCAT 56 R11 RR11_774 UP_F ACCCGACAAGCTGACAGATG 54 cdg4 UP_RO TGGCCGATTCATTAATGCAGC 70 CTGTTCCTTGGCAAGCATCG DN_FO GAAGTGATCTTCCGTCACAGG 70 TATTTATTC ACCGTGGGCCTTTTGCATGT DN_R AAGAGCGGATCGACTCTGGC 56 R11 RR11_1454 UP_F GCCGGTCATCAGCAGATGCA 56 cdg5 UP_RO GAAGTGATCTTCCGTCACAGG 71 TATTTATTC TCAGCGCCCCAAGAAGCATC DN_FO TGGCCGATTCATTAATGCAGC 71 AACCGTGGGCCTGATGCATC DN_R CGTGCAGGATGGAAGGAAGA 54

3.2.1.3. Splice Overlap Extension PCR (SOE-PCR)

Following PCR amplification of the GOIs and the Cam cassette, respectively, SOE-PCR was used to combine the respective UP and DOWN regions of the GOI with the Cam cassette. The first reaction step (Figure 3.1) consisted of a reaction to splice the individual PCR products. This was facilitated by the overhangs on the UP and DOWN regions that overlapped the Cam cassette The individual PCR reactions (50 ul) consisted of the following: 1x Phusion® High-Fidelity PCR Master Mix with HF Buffer

(New England Biolabs) and approximately 20-50 ng of the purified UP and DOWN products. The SOE-PCR program consisted of the following: initial denaturation, 98°C for 3 min; then 10 cycles of denaturation, 98°C for 10 seconds; annealing, 63°C for 30 seconds and extension, 72°C for 45 seconds. The reaction tubes were kept at 4oC prior to the second reaction step. The second reaction step (Figure 3.1) amplifies the entire knockout construct. The forward primer (10 pmol) of the UP fragment and the reverse primer (10 pmol) of the DOWN fragment (Table 3.2) were added to the reaction tubes under ice. The PCR program then consisted of the following: initial denaturation, 98°C for 3 min followed by 30 cycles of denaturation, 98°C for 30; annealing 61°C for 30 seconds and extension, 72°C for 1.5 min, then a final extension step at 72°C for 10 min. The resulting PCR products were then visualised on a 0.85% agarose gel. The band corresponding to the correct size of the construct was excised from the gel and purified using the QIAEX II Gel Extraction Kit (Qiagen).

A. UP_F DN_FO B. CamF

GOI CmR

UP_RO DN_R CamR

C. UP DN + CmR

UP_F

D. UP CmR DN

DN_R

Figure 3.1. Schematic diagram of the Splice Overlap Extension PCR (SOE- PCR) strategy. The first step involves the amplification of the UP and DOWN region of the gene of interest, GOI, respectively (A) and the chloramphenicol resistance gene cassette, CmR (B). Primer pairs used to amplify the UP and DOWN region respectively, contain 5’overhang sequences that overlap with the complementary overhang sequences in the chloramphenicol resistance cassette (i.e. UP_RO, blue line; DN_FO, red line). This resulted in the UP and DOWN fragments containing complementary regions to the chloramphenicol resistance cassette (red and blue bars). A second intermediate reaction combines the three separate fragments (C). A final PCR reaction amplifies the entire knockout construct.

3.2.1.4. Cloning of the Knockout Constructs into a Suicide Vector

The purified knockout construct was then cloned into the broad-host-range suicide plasmid vector, pKmobGII [320]. Briefly, approximately 5 µg of plasmid DNA was digested with SmaI (New England Biolabs) according to the manufacturer’s instructions. Respective inserts were phosphorylated using T4 polynucleotide kinase and the blunt-ended vector was then dephosphorylated using Antarctic Phosphatase

(New England Biolabs) according to manufacturer’s instructions. A 5:1 insert:vector ratio was used to ligate the knockout construct into the vector using T4 DNA ligase

(New England Biolabs) according to the manufacturer’s instructions. The ligation products were purified using the MinElute PCR purification kit (Qiagen).

3.2.1.5. Transformation of the Donor Strain

The donor strain E. coli ST18 [321] was then transformed by electroporation using an

Eppendorf electroporator system (Eppendorf 2510) with approximately 10 ng of the ligation product. Following electroporation, cells were resuspended in 1 ml LB Broth with 50 μg/ml aminolevulinic acid (ALA, Sigma) and incubated with gentle shaking (50 rpm) for 1 hour at 35oC. The culture was then spread plated on LB Agar plates supplemented with chloramphenicol. Recombinant clones were selected and confirmed by PCR.

3.2.1.6. Conjugation of Donor and Recipient Strain and Screening of

Transconjugants

The plasmid constructs were transferred from E. coli ST18 (donor strain) to R11

(recipient strain) by conjugation following a modification of the protocol by Tanja et al.

2009. The donor strain was grown in LB broth with gentamicin (50 μg/ml), kanamycin

(50 μg/ml) and ALA (50 μg/ml) at 35oC for 24 hours. The recipient strain was grown in half MB (HMB) at 25oC for 24 hours. One ml portions of the cultures were obtained after culturing. Donor cells were washed with plain LB and the recipient cells were washed with HMB. Donor and recipient cells were then mixed in a microfuge tube at a

1:5 ratio (i.e. 100 µl ST18 cells: 500 µl R11 cells) and incubated statically for 1 hour

25oC. The cell suspension was then centrifuged at 5000 x g for 2 minutes. Five hundred microliters of the spent supernatant was removed and the cells were resuspended in the remaining volume of the supernatant. The cell suspension (100 µl) was then spot-plated

70 on the air-dried surface of HMB plates and incubated at 25oC for 3 days. After incubation, the colony growing on the surface of the plate was scraped and transferred to 1 ml of HMB broth. The cell suspension was diluted up to 10-3 and 100 µl of each dilution was plated onto HMA plates supplemented with 50 µg/mL kanamycin and 50

µg/mL of X-gluc (5-bromo-4-chloro-3-indoxy l-b-D-glucuronide) (Sigma). The presence of X-gluc allowed the blue/white screening of the transconjugants and the absence of ALA prevented the growth of the auxotrophic E. coli ST18 donor strain.

Putative mutant strains were confirmed by PCR using primers (Table 3.3) that targeted the respective gene knockout construct and a region on the R11 chromosome flanking the knockout construct.

Table 3.3. PCR Primers for Confirmation of N. italica R11 Gene Deletion Strains

GENE DESCRIPTION PRIMERS PRIMER Tm NAME SEQUENCES (5' - 3') (oC)

R11 cdg1 diguanylate cyclase/ ConUP_F GTTTGTTTTTCATCGCA 48 phosphodiesterase TCC ConDN_R ACGCCCTTAAGTGCCT 52 CTTT R11 cdg2 diguanylate cyclase/ ConUP_F CGGGGGCGGGAAAAA 61 phosphodiesterase GATATACCAG ConDN_R ACCTACAGCATCGTGA 52 TGGA R11 cdg3 putative response ConUP_F CAAAATCGAAAAGTGT 48 regulator PleD TCCG ConDN_R GAACCTGATCGTGGTT 56 GGGG R11 cdg4 GGDEF ConUP_F CTTCAGAGCCGTCAAA 54 domain/pas/pac and GGAC gaf sensor domain protein ConDN_R GCCCAGCTTGGCCATG 58 ATCG R11 cdg5 diguanylate cyclase, ConUP_F TGGTCGTCGGTGTCCA 54 putative GAAT ConDN_R CCGTCAGCACCAACCC 60 GGTG

GENE DESCRIPTION PRIMERS PRIMER Tm o CamRNAME chloramphenicol CamF GCTSEQUENCES GCA TTA ATG(5' - 3')AAT 68( C) resistance cassette CGG CCA CamR GAA TAA ATA CCT 67 GTG ACG GAA GAT CAC TTC

3.2.1.7. Complementation of N. italica R11 Gene Deletion Strains

The respective genes of interest (GOI) from the R11 WT were PCR amplified using primer pairs (UP_F and DN_R; Table 3.2) and using the PCR reaction profile previously described above. The PCR products were visualised on agarose gel and column purified as described above. The purified PCR products were then cloned into the SmaI site of the plasmid vector pBBR1MCS-5 following standard molecular biology procedures (Ausubel et al. 1999). The plasmid vector was transferred to the donor strain, E. coli ST18 by electroporation as described above. Recombinant clones were verified by PCR after which the conjugation of the donor strain and the recipient R11 mutant strains (ΔR11cdg1A, ΔR11cdg1B, ΔR11cdg2, ΔR11cdg3) was carried out as described above. Transconjugants were selected on HMA plates supplemented with chloramphenicol (2.5 µg/ml) and gentamicin (50 µg/ml). PCR confirmation of the transconjugants was done using the primers targeting either the UP (UP_F) or DOWN

(DN_R) region of the gene of interest in combination with either of the primers targeting the gentamicin resistance cassette (Table 3.4)

Table 3.4. PCR Primers for Confirmation of N. italica R11 Complemented Strains

GENE DESCRIPTION PRIMERS PRIMER SEQUENCES Tm NAME (5' - 3') (oC)

R11 cdg1 diguanylate cyclase/ cdg1_UPF ACCCTCGATACGGA 54 phosphodiesterase TTGCGT cdg1_DNR ATTGCCCTTTCGCCC 56 GGTTG 72

GENE DESCRIPTION PRIMERS PRIMER SEQUENCES Tm o R11NAME cdg2 diguanylate cyclase/ cdg2_UPF TGAACCTGTTCCACG(5' - 3') (56C) phosphodiesterase GCGGT cdg2_DNR TGCGAGAAGAAGGT 50 TCTTGT R11 cdg3 putative response cdg3_UPF CGAATTTGCCCCGTT 54 regulator PleD TGCCA cdg3_DNR AGGGGGCTTTGCAG 56 GACCAT GmR gentamicin resistance Gm_F GACGCACACCGTG 49 casette GAAA Gm_R GCGGCGTTGTGAC 48 AATTT VanR N. Italica sp. R11 R11VanR_F ATCGCCTTTCAAACCA 48 luxR gene ATCT R11VanR_R CAACCGCATTCCAAG 52 TAACC

3.2.3. Phenotypic Characterisation of N. italica R11 Cyclic-di-GMP Gene Deletion

Strains

3.2.3.1. Determination of Growth Characteristics

N. italica R11 strains were grown overnight in 10 ml HMB (R11 wild type strain) or 10 ml HMB with chloramphenicol (R11 gene deletion strains and complemented strains) in

50 ml centrifuge tubes at 25oC with shaking at 180 rpm. One hundred microliters of each of the cultures were added to 100 ml of HMB in 250 ml-capacity side-arm flasks.

The flasks were then incubated at 25oC with shaking at 180 rpm. The optical density

(OD600) of the cultures was obtained using a spectrophotometer taken at 1 hour intervals for 12 hours. The specific growth rate (μ) and generation time (t) was calculated from the optical density readings. Statistical analysis was performed using PRISM 6.01 and significance was evaluated using one-way analysis of variance (ANOVA).

3.2.3.2. 96-well Attachment Assay

N. italica R11 strains were grown overnight in 10 ml HMB (R11 wild type strain) or 10 ml HMB with chloramphenicol (R11 gene deletion strains and complemented strains) or

10 ml HMB with gentamicin (R11 overexpression strains) in 50 ml centrifuge tubes at

25oC with shaking at 180 rpm. The optical density of the cultures were then adjusted to approximately OD600 ~ 0.2 with HMB. One hundred fifty microliters of the adjusted cultures were then added to individual wells of a flat-bottom 96-well plate (Sarstedt, N.

82.1581.001). The plates were then incubated at 25oC with shaking at 200 rpm for 24 hours. After incubation, the spent media from each well were carefully removed. The wells were then washed once with 150 µl of 1X Nine Salts Solution (1X NSS). After washing, 150 µl of XTT [2, 3-Bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5- carboxanilide] solution (0.5 grams/L) in 1X NSS were added to the wells. The plates were covered in aluminium foil and then incubated further at 25oC with shaking at 200 rpm for 24 hours. After incubation, the absorbance readings at 490 nm were obtained for each well using a Wallac Victor2 1420 Spectrophotometer (Perkin Elmer).

Statistical analysis was performed using PRISM 6.01 and significance was evaluated using one-way analysis of variance (ANOVA).

3.2.3.4. Motility Assay

N. italica R11 strains were grown overnight in 10 ml HMB (R11 wild type strain) or 10 ml HMB with chloramphenicol (R11 gene deletion strains and complemented strains) or

10 ml HMB with gentamicin (R11 overexpression strains) in 50 ml centrifuge tubes at

25oC with shaking at 180 rpm. The optical density of the cultures were then adjusted to

OD600 ~ 0.2 with HMB. Two microliters (2 μl) of the adjusted culture were point- inoculated at the center of a half-strength Marine Agar (HMA) plate supplemented with

0.2% agar (Difco). The plates were incubated statically at 25oC for 24 hours. After 74 incubation, the zone of diameter was measured using a ruler. Statistical analysis was performed using PRISM 6.01 and significance was evaluated using one-way analysis of variance (ANOVA).

3.2.3.5. Calcofluor White Plate Assay

The Calcofluor White plate assay was used to qualitatively determine exopolysaccharide production by R11 and mutant strains. N. italica R11 strains were grown overnight in 10 ml HMB (R11 wild type strain) or 10 ml HMB with chloramphenicol (R11 gene deletion strains and complemented strains) in 50 ml centrifuge tubes at 25oC with shaking at 180 rpm. A Loopful of the overnight culture was streak-plated on the surface of HMA supplemented with 25 µg/ml Fluorescent

Brightener 28 (Calcofluor White M2R, (Sigma, F3543). The plates were incubated at

25oC for 3-5 days. After incubation, the plates Calcofluor white is known to bind to cellulose and higher accumulation of the polysaccharide results in increased fluorescence or brightness upon long wave UV exposure [322].

3.2.4. Determination of Cyclic-di-GMP Levels in Planktonic and Attached Cells

3.2.4.1. Batch Planktonic and Attached Cultures

Batch cultures were set up to obtain planktonic and attached cells, respectively. N. italica R11 strains were grown overnight in 10 ml HMB (R11 wild type strain) or 10 ml

HMB with chloramphenicol (R11 gene deletion strains) in 50 ml centrifuge tubes at

25oC with shaking at 180 rpm. These strains were grown in 10 ml HMB. To set up planktonic cultures, 1 ml of the overnight culture was added to 20 ml of HMB in 50 ml centrifuge tubes. The tubes were incubated horizontally at 25oC with shaking at 50 rpm for 24 hours. To set-up the attached cultures, 1 ml of the overnight culture was added to 75

20 ml of HMB in Cellstar® petri dishes (No. 664160, Grenier Bio One). Four petri dish cultures per strain were set up. The plates were incubated at 25oC with shaking at 50 rpm for 24 hours. Cells from planktonic phase cultures were obtained by centrifugation at 6000 rpm for 5 mins. Cells were washed once with 1X NSS. Washed cell pellets were stored at -80oC until extraction. Cells from attached cultures were obtained from the

Cellstar® petri dish after carefully removing the spent medium. Cells were washed once with 1X NSS. To obtain the cells attached to the bottom of and the sides of the petri dish, 2 ml of 1X NSS was added to the petri dish and a sterile cotton swab was used to swab-scrape the cells. Cells obtained from the other petri dishes of the same strain were combined in 15 ml centrifuge tubes. Cell pellets were obtained following centrifugation at 6000 rpm for 5 mins, washed once with 1x NSS and stored at -80oC until extraction.

Biomass determination (from 1 ml cell pellets obtained separately) was done using the

Bicinchoninic Acid (BCA) Assay protocol (Sigma) following the manufacturer’s instructions.

3.2.4.2. Extraction of Cyclic-di-GMP

Cyclic-di-GMP was extracted from the cell pellets following an established protocol

[111] with slight modifications. Cell pellets were resuspended in 300 µl of ice-cold extraction solvent (acetonitrile:methanol:water; 40:40:20 v:v:v) containing the internal standard cXMP (xanthosine- 3', 5'- cyclic monophosphate) (100 nM final concentration). The cell suspension was homogenized by passing five times through a syringe with a 26G needle. Following homogenisation, the cell suspension was then sonicated for 15 minutes at 40 kHz using a water bath sonicator (Ultrasonics, Australia).

After sonication, the suspension was centrifuged at 20,000 x g for 5 minutes at 4oC. The resulting supernatant (300 µl) was then transferred to a 15 ml ice-cold centrifuge tube.

The remaining pellet was again resuspended in the extraction solvent and the homogenisation and sonication steps described above was done twice. The resulting supernatants from these successive extractions were combined (700 µl total volume).

The tubes containing the supernatants were transferred to a cold centrivap (Labconco) and the solvent evaporated until the sample has dried. The resulting residue was then resuspended in 200 µl of milliQ water and transferred to LC-MS vials. The vials were stored at -80oC until analysis.

3.2.4.3. Detection and Quantification of Cyclic-di-GMP by Mass Spectrometry

Mass spectrometry measurements were performed at the Singapore Centre on

Environmental Life Sciences Engineering (SCELSE), Nanyang Technological

University (NTU), Singapore, in collaboration with Dr. Victor Nesati. To detect cyclic- di-GMP in cell-free lysates, reverse-phase high pressure liquid chromatography on a

Nucleodur Pyramid C18 column (2 X 50 mm, 3 μm particle size; Macherey-Nagel) coupled with the use of a hybrid ion-trap mass spectrometer in positive ionisation mode was performed with the LTQ Orbitrap Velos Pro system (Thermo-Scientific). The mobile phases were: 10 mM ammonium acetate in water with 0.1% formic acid (Phase

A) and acetonitrile with 0.1% formic acid (Phase B). The gradient program was initiated with 100% Phase A at a flow rate of 200 µl/minute. After 3 minutes, the portion of Phase A was decreased to 90% and then to 15% from 4 to 5 minutes. Then the portion of Phase A was restored to 100% at 5 minutes, 50 seconds until completion of the cycle time for 10 minutes. The temperature was set at 35oC and the sample injection volume was set at 20 µl. Authentic cyclic-di-GMP (BioLog Life Science

Institute, Bremen, Germany) was used to detect and identify the molecule in the cell

77 extracts based on (a.) elution at 4.1 minutes and (b.) mass of the molecular ion (691 m/z) using the Xcalibur® software (Appendix I). To quantify cyclic-di-GMP in the samples, a standard curve consisting of defined concentrations (0.1 nM, 1.0 nM, 10 nM,

100 nM, 1000 nM) was established. The peak area values were used to estimate the concentration of the molecule by extrapolation.

3.3. RESULTS

3.3.1. N. italica R11 Cyclic-di-GMP Gene Deletion Strains

3.3.1.1. PCR Confirmation of Gene Deletion Strains

Transconjugant colonies were successfully obtained from the conjugation plates containing the E. coli donor strains with the knockout constructs for genes included in the study i.e. RR11_749, RR11_868, RR11_1340, RR11_774 and RR11_1454.

However, the strains containing the knockout constructs_ RR11_774 and RR11_1454 did not survive subsequent maintenance culturing in glycerol stocks and in selection plates. Therefore, only four mutant strains were obtained and used for further studies.

Following confirmatory colony PCR (Figure 3.2,), these mutant strains were subsequently designated as R11 cyclic-di-GMP (“cdg”) gene (“R11cdg”) mutants. For gene R11cdg1 (RR11_868), predicted as a DGC or PDE protein, two mutant strains were obtained as single-crossover mutants (Figure 2A and 2B) and were designated as

ΔR11cdg1A and ΔR11cdg1B, for the single-crossover on the up and down regions of the gene, respectively. For gene R11cdg2 (RR11_749), predicted as a DGC or PDE protein, a single-crossover mutation on the down region of the gene was obtained

(Figure 2C) and was designated as ΔR11cdg2. Another single-crossover mutant was obtained from the gene predicted as a putative response regulator PleD (RR11_1340) with a single-crossover mutation at the up region (Figure 2D) and this was designated as

ΔR11cdg3. Conversion of the respective strains from single-crossover mutation to a double-crossover mutation by successive subculturing for 10 days in HMB with chloramphenicol was unsuccessful.

6000 bp 3000 bp

1000 bp

Figure 3.2. PCR confirmation of N. italica R11 gene deletion strains. M, 1 kb ladder; 1, R11 WT CUF/CamR; 2, R11cdg1A CUF/CamR; 3, R11 WT CDR/CamF; 4, R11cdg1A CDR/CamF (B). M, 1 kb ladder; 1, R11 WT CUF/CamR; 2, R11cdg1B CUF/CamR; 3, R11 WT CDR/CamF; 4, R11cdg1B CDR/CamF; (C). M, 1 kb ladder; 1, R11 WT CUF/CamR; 2, R11cdg2 CUF/CamR; 3, R11 WT CDR/CamF; 4, R11cdg2 CDR/CamF; (D). M, 1 kb ladder; 1, R11 WT CUF/CamR; 2, R11cdg3 CUF/CamR; 3, R11 WT CDR/CamF; 4, R11cdg3CDR/CamF; CUF, confirmatory UP forward primer; CDR, confirmatory DOWN primer; CamF, chloramphenicol forward primer; CamR, chloramphenicol reverse primer.

3.3.1.2. Growth Characteristics

Growth curve experiments were performed to determine whether there is a difference in growth rates between the wild type strain and the mutant strains. The strains showed similar growth characteristics. A lag phase was observed from the onset of the culture to about 4 hours. Exponential growth (log phase) was observed after 6 to 9 hours of incubation. The cultures entered stationary phase of growth after about 10 hours of

79 incubation (Figure 3.3A). There was no observed difference in the specific growth rate

(µ) (Figure 3.3B) and the generation time (t) (Figure 3.3C), respectively, between the wild type and the mutant strains (p<0.05).

Figure 3.3. Growth characteristics of N. italica R11 WT and mutant strains. Growth curve (A), Growth was plotted as optical density (OD600) readings taken every hour for 12 hours. Specific growth rate, (μ) (B) and generation time (C) were calculated from representative points at the log phase of culture and represented as bars with the standard error of mean (SEM) (n = 3 technical replicates).

3.3.1.3. Surface Attachment

Surface attachment was assessed from cultures growing on 96-well polystyrene plates for 24 hours. Among the four mutant strains, two strains, ΔR11cdg1B and ΔR11cdg3, exhibited enhanced attachment to the bottom of the wells of the 96-well plates compared to the wild type strain (p<0.05) (Figure 3.4).

Figure 3.4. Surface attachment of N. italica R11 gene deletion strains. R11 WT and mutants strains (ΔR11cdg1A, ΔR11cdg1B, ΔR11cdg2, ΔR11cdg3) were inoculated onto wells of a 96-well polystyrene plate and incubated for 24 hours at 25oC with shaking at 200 rpm. Surface attachment is presented as the mean absorbance at 490nm (A490) with error bars representing the standard error of mean (SEM) (n = 3). Asterisks indicate significant difference from wild type strain (Tukey’s, p<0.05).

3.3.1.4. Swimming Motility

Swimming motility assays on soft agar plates revealed that among the four mutant strains, two strains ΔR11cdg1B and ΔR11cdg3 exhibited smaller colony diameter, hence reduced swimming motilities compared to the wild type strain (p<0.05) (Figure

3.5).

Figure 3.5. Swimming motility of N. italica R11 gene deletion strains. R11 WT and mutants strains (ΔR11cdg1A, ΔR11cdg1B, ΔR11cdg2, ΔR11cdg3) were point inoculated onto HMA plates with 0.2% agar and incubated for 24hours at 25oC. Motility is presented as the mean colony diameter (mm) with error bars representing the standard error of mean (SEM) (n = 3). Asterisks indicate significant difference from wild type strain (Tukey’s, p<0.05). Images presented are representative plates from three independent experiments.

3.3.1.5. Qualitative EPS/Cellulose Production

No difference in fluorescence or brightness was observed between the R11 wild type and the mutant strains after the initial 3-5 days of incubation (Figure 3.6).

Figure 3.6. Calcofluor White Plate Assay. R11 WT and mutant strains (ΔR11cdg1A, ΔR11cdg1B, ΔR11cdg2, ΔR11cdg3) were streaked on HMA plates containing Calcofluor White (25ug/ml) and incubated for 3-5 days at 25oC. Growth on plates was exposed to long wave UV light and observed for bright blue fluorescence.

3.3.1.6. Cyclic-di-GMP Levels in Planktonic and Attached Cells

Cyclic-di-GMP was detected in both planktonic and attached cells of the R11 wild type strain (Figure 3.7). Among the mutant strains, cyclic-di-GMP was detected in attached cells from all four strains, while only two strains (ΔR11cdg1A and ΔR11cdg2) showed detectable levels from planktonic cells (Figure 3.7). In the R11 WT strain, cyclic-di-

GMP in planktonic cells was considerably lower (0.017 ± 0.004 fmol μg protein-1) compared to the levels in attached cells (0.441 ± 0.343 fmol μg protein-1). In the mutant strains, planktonic cyclic-di-GMP levels appeared to be very low (~ 0.01 fmol μg protein-1) as shown in (ΔR11cdg1A and ΔR11cdg2) to non-detectable as shown in

ΔR11cdg1B and ΔR11cdg3. While cyclic-di-GMP level in attached cells of strain

ΔR11cdg1A (0.245 ± 0.231 fmol μg protein-1) is comparable to that of the wild type strain, the cyclic-di-GMP levels in attached cells in the other mutant strains were also considerably low (~0.01 fmol μg protein-1) (Figure 3.7). The cyclic-di-GMP concentration from planktonic cells reported here for mutant strains ΔR11cdg1A and

ΔR11cdg2 and, likewise, the cyclic-di-GMP concentration from attached cells of mutant strains ΔR11cdg2 and ΔR11cdg3 was obtained from only one of the three replicates.

The other two replicates showed levels that were below the detection limit.

Figure 3.7. Cyclic-di-GMP level of planktonic and attached cells of N. italica R11 cyclic-di-GMP gene deletion strains. Cell-free lysates from planktonic cells and attached cells were obtained from R11 WT and mutants strains (ΔR11cdg1A, ΔR11cdg1B, ΔR11cdg2, ΔR11cdg3) respectively. Data is represented as mean cyclic-di-GMP (fmol μg protein-1) with error bars representing the standard deviation (SD).

3.3.2. N. italica R11 Cyclic-di-GMP Complemented Strains

3.3.2.1. PCR Confirmation of the N. italica R11 Complemented Strain

A single transconjugant colony was observed on the plate containing the mutant

ΔR11cdg3 while transconjugant colonies were not observed on the plates containing the mutants ΔR11cdg1A, ΔR11cdg1B and ΔR11cdg2. To confirm successful

84 complementation of the mutant strain ΔR11cdg3, PCR was done using the primers specific for R11cdg3, Gm resistance cassette and VanR (Table 3.4) PCR amplification of a 2012 bp band using primers targeting the R11cdg3 gene and the chloramphenicol resistance cassette confirmed that the strain has the correct R11cdg3 mutation (Figure

3.8A and 3.8B). In addition, PCR amplification of a 3544 band targeting the gentamicin resistance cassette on the plasmid vector and a region of cloned R11cdg3 gene confirmed the presence of the complementation plasmid (Figure 3.8C). Thus, among the four mutant strains included in this study, only ΔR11cdg3 was successfully complemented with the plasmid harbouring the wild type R11cdg3 gene. This strain was subsequently designated as ΔR11cdg3-pMCS cdg3.

Figure 3.8. PCR confirmation of the N. italica R11 complemented strain, ΔR11cdg3-pMCScdg3. (A) Gel showing confirmation of correct mutation of mutant strain ΔR11cdg3 using primers R11cdg3ConUPF/CamF (2012 bp): M: 1 kb ladder, 1:Negative control, 2: R11 WT, 3: ΔR11cdg3 Clone 1, 4: ΔR11cdg3 Clone 2, 5: ΔR11cdg3 Clone 3; (B) Gel showing confirmation of correct mutation of the complemented strain ΔR11cdg3-pMCScdg3 using primers R11cdg3 ConUPF/CamF (2012 bp): M: 1 kb ladder, 1:Negative control, 2: R11 WT, 3: E. coli ST18-pMCScdg3, 4: Complemented strain ΔR11cdg3-pMCScdg3 Clone 1, 5: Complemented strain ΔR11cdg3-pMCScdg3 Clone 2, 6: Complemented strain ΔR11cdg3-pMCScdg3 Clone 3; (C) Gel showing confirmation of the gentamicin cassette in the complemented strain ΔR11cdg3-pMCScdg3 using primers GmR/R11cdg3 DNR (3544 bp): M: 1 kb ladder, 1:Negative control, 2: R11 WT, 3: E. coli ST18-pMCScdg3, 4: Complemented strain ΔR11cdg3-pMCScdg3 Clone 1, 5: Complemented strain ΔR11cdg3-pMCScdg3 Clone 2, 6: Complemented strain ΔR11cdg3-pMCScdg3 Clone 3.

3.3.2.2. Growth Characteristics

Growth characteristics of the R11 complemented strain ΔR11cdg3-pMCS cdg3 was compared to the R11 WT and the R11 cyclic-di-GMP mutant strain ΔR11cdg3 to determine whether there is a difference in growth rate and generation time between the strains. The strains showed similar growth characteristics. Lag phase was observed from the onset of the culture to about 4 hours. Exponential growth (log phase) was observed from 6 to 9 hours of incubation. The cultures enter the stationary phase at about 10 hours of incubation (Figure 3.9A). There was no observed difference in the specific growth rate (µ) (Figure 3.9B) and the generation time (t) (Figure 3.9C) respectively between the wild type and the mutant strains (p<0.05).

Figure 3.9. Growth characteristics of N. italica R11 complemented strain ΔR11cdg3-pMCS cdg3. Growth Curve (A), Growth was plotted as optical density (OD600) readings taken every hour for 12 hours. Specific Growth Rate, (μ) (B) and Generation Time (C) were calculated from representative points at the log phase of culture and represented as bars with the standard error of mean (SEM) (n = 3 technical replicates). 86

3.3.2.3. Surface Attachment

Similar to the results obtained from the previous experiment (Figure 3.4), R11 mutant strain ΔR11cdg3 showed enhanced attachment compared to the R11 wild type strain

(p<0.05). On the other hand, the complemented strain ΔR11cdg3-pMCScdg3 demonstrated attachment similar to that of the mutant strain and different to the wild type strain (p<0.05) (Figure 3.10).

Figure 3.10. Surface attachment of N. italica R11 complemented strain. The R11 WT, the R11cdg3 mutant strain (ΔR11cdg3) and the R11 complemented strain (ΔR11cdg3-pMCScdg3) were inoculated onto wells of a 96-well polystyrene plate and incubated for 24 hours at 25oC with shaking at 200 rpm. Surface attachment is presented as the mean absorbance at 490nm (A490) with error bars representing the standard error of mean (SEM). Asterisks indicate significant difference of the mutant strain from wild type strain (*) and the complemented strain from the wild type strain (**) (Tukey’s, p<0.05) (n=3).

3.3.2.4. Swimming Motility

Similar to the results obtained from the previous experiment (Figure 3.5), R11 mutant strain, ΔR11cdg3 exhibited a smaller colony diameter, hence reduced swimming motility, compared to the wild type strain (p<0.05). Surprisingly, the complemented strain ΔR11cdg3-pMCScdg3 demonstrated a further reduction in swimming motility compared to both the wild type strain and the mutant strain (p<0.05) (Figure 3.11).

Figure 3.11. Motility of N. italica R11 complemented strain. The R11 WT, the R11cdg3 mutant strain (ΔR11cdg3) and the R11 complemented strain (ΔR11cdg3- pMCScdg3) were point inoculated onto HMA plates with 0.2% agar and incubated for 24 hours at 25oC. Motility is presented as mean colony diameter (mm) with error bars representing the standard error of mean (SEM) (n = 3). Asterisks indicate significant difference from wild type strain (*) and from both WT and mutant strain (**) (Tukey’s, p<0.05). Images presented are representative plates from three independent experiments.

3.4. DISCUSSION

3.4.1. Cyclic-di-GMP Synthesis in N. italica R11

This study shows that N. italica R11 produces cyclic-di-GMP, consistent with predictions made in Chapter 2 that R11 possesses genes encoding diguanylate cyclases

(DGCs). In the R11 WT strain, low levels of cyclic-di-GMP are produced by planktonically-grown cells, while elevated levels are found in attached cells. The increase in cyclic-di-GMP levels in attached cells observed in the R11 WT strain (30- fold) is comparable to the levels obtained for the related strain Ruegeria mobilis F1926

[282], and consistent with the existing paradigm that low cyclic-di-GMP levels are associated with the planktonic lifestyle and high levels being indicative of a sessile cells

[10].

3.4.2. Manipulation of Cyclic-di-GMP Genes N. italica R11

Two experimental approaches (gene deletion and gene overexpression) were undertaken in this thesis study to attempt to manipulate cyclic-di-GMP levels in R11 and to subsequently observe phenotypes that might be affected by altered levels of cyclic-di-

GMP. The five genes (RR11_749, RR11_868, RR11_1340, RR11_774 and RR11_1454) were selected because they represent potential diguanylate cyclases and or cyclic-di-GMP phosphodiesterases predicted to vary in terms of whether they are single or tandem GGDEF domains, whether they have transmembrane domains or are localised in the cytoplasm and whether they contain associated sensor domains. In addition, the gene deletions also attempted to determine the specific function of the predicted genes in R11. Of the nine predicted cyclic-di-GMP genes in R11, gene deletion mutants were obtained for three genes: (1) R11cdg1 (RR11_868), a transmembrane, tandem GGDEF-EAL domain with a MHYT sensor domain predicted as a DGC or PDE; (2) R11cdg2 (RR11_749), also a

89 transmembrane, tandem GGDEF-EAL domain, predicted only as a PDE; and (3)

R11cdg3 (RR11_1340), a REC-containing GGDEF domain, predicted as “response regulator PleD”.

It was generally expected that a mutation in a DGC gene would lead to a lower level of cyclic-di-GMP and a mutation in a PDE gene would lead to an elevated level of cyclic- di-GMP. In addition, the increase in cyclic-di-GMP levels would correspond to an enhanced surface attachment and diminished motility, while the decrease in cyclic-di-

GMP levels would reflect enhanced motility and reduced surface attachment [10].

Consistent with this model paradigm, two (ΔR11cdg1B and ΔR11cdg3) of the four mutant strains exhibited these phenotypes (Figure 3.4, Figure 3.5). Deletion of these

DGC genes in R11 however did not alter the cyclic-di-GMP levels. Cyclic-di-GMP levels remained elevated in attached cells and lower in planktonic cells (Figure 3.7).

Functional redundancy of cyclic-di-GMP proteins in bacteria is commonly observed given the existence of multiple GGDEF and EAL domain proteins in sequenced bacterial genomes [10, 17, 19, 323]. R11 cdg1 and R11cdg3 genes respectively represent only a fraction of the predicted DGCs and PDEs in R11. Based on the findings presented in Chapter 2 of this thesis, following sequence alignment and motif conservation, R11 possesses 6 potential DGCs and 3 potential cyclic-di-GMP specific

PDEs. If indeed all are functional DGCs or PDEs in R11, then the mutant strains produced in this study represent strains that have mutations in only one of the DGCs

(ΔR11cdg1B) or one of the PDEs (ΔR11cdg2). Hence, deletion of the DGC-encoding

GGDEF domain protein (R11cdg1 and R11 cdg3, respectively) may not have significantly altered cyclic-di-GMP levels, because other DGCs could still be

90 participating in the intracellular pool of cyclic-di-GMP. Likewise, deletion of the PDE- encoding gene R11cdg2 may also have little effect in diminishing the cyclic-di-GMP pool. While this premise is supported by the findings presented here, it may still be informative to further address the level of specificity of the genes R11cdg1 and

R11cdg3 in regulating attachment and motility in R11. The mutation in the gene

R11cdg1, a putative DGC, and the mutation in R11cdg3, a putative response regulator with a REC-GGDEF domain, appeared to have collectively impacted motility and attachment in R11, a finding that is consistent with earlier observations that multiple

DGCs can be functionally related and hierarchically involved in regulating a specific cellular process such as motility and biofilm formation [68, 159, 313, 322]. As such, the genes R11cdg1 and R11cdg3 may have relevant roles in R11, in particular the regulation of colonisation traits through cyclic-di-GMP. The cyclic-di-GMP regulatory cascade or pathway involving these genes however remains to be elucidated.

The complementation of the mutant strain with the WT copy of R11cdg3 resulted in an unexpected motility phenotype. Swimming motility was further reduced in the complemented strain ΔR11cdg3-pMCScdg3 compared to the mutant strain. Rather than restoring the motility phenotype to that of the wild type, the resulting phenotype seems to be an “overexpression” of the R11cdg3 gene in the complemented strain. Two scenarios explaining this observation may be proposed. One possibility is that the gene may have been “overexpressed” given its cloning into a broad-host-range plasmid vector pBBR1MCS. The multicopy nature of pBBR1MCS [324, 325] may have provided increased copies of R11cdg3 in the complemented strain. For example, in

Brucella melitensis, pBBR1MCS is stably maintained at about 10 copies per cell [326].

Similarly, in Erwinia carotovora strain Ea1189, deletion of the DGCs edcC and edcE

91 resulted in increased motility compared to the wild type. Complementation of the mutant strains, ΔedcC and ΔedcE, with the wild type genes cloned into pBBR1MCS-1 and pBBR1MCS-5, respectively, resulted in lower motility than that of the wild type due to the expression of the complementing genes on multicopy plasmids [114]. A similar observation of the “overexpression” phenotype from a complementation experiment has also been reported in the study of flagellin genes in Aeromonas caviae

[327]. Deletion of the gene encoding a motility-associated factor (maf1) resulted in a strain that is non-motile and lacks polar flagella. Complementation of the Δmaf1 strain only partially restores motility to approximately 50% of the wild type levels (Parker et al., 2012). It is thus conceivable that the expression of the R11cdg3 gene in multiple numbers through the multicopy plasmid increases the pool of DGCs in the complemented strain. This possibility is consistent with the paradigm that active DGCs result in increased cyclic-di-GMP concentration that leads to inhibition of motility and promotion of biofilm formation (Romling et al., 2013). While requiring further investigation, this line of thought also partially suggests the potential function of

R11cdg3 as a DGC.

Another possibility for the unexpected phenotypic effect in the complemented strain

(i.e. further reduced swimming motility compared to the mutant strain) could be a polar effect of the mutation in R11cdg3 in R11. Detailed genetic studies are required to determine whether the mutation exerts an effect on other genes or operons within the vicinity of R11cdg3.

The R11cdg3 gene is predicted as a DGC similar to PleD in C. crescentus. The PleD protein in C. crescentus is required during the swarmer-to-stalked cell transition (i.e. the

92 motile to sessile switch) for flagellar ejection and stalk biogenesis [36]. However, it is not known whether flagellar synthesis was impaired and resulted in further alteration in swimming motility in the complemented strain. Microscopy studies to confirm a possible defect in flagella were not performed here. Also, studies to determine the cyclic-di-GMP level or the DGC activity should be conducted to provide further information on the complemented strain.

An overexpression experiment utilising a known diguanylate cyclase (WspR) and a known cyclic-di-GMP phosphodiesterase gene (PA2133) was attempted in strain R11 but was unsuccessful. WspR (PA3702), a REC-GGDEF domain response regulator controls biofilm formation and other adaptive phenotypes in P. aeruginosa and P. fluorescens

[31, 328]. Overexpression of WspR causes hyper-biofilm formation and deletion of the gene wspR results in reduced biofilm formation and cytotoxicity [313]. In addition, the wspR gene has been shown to be required for autoaggregation and biofilm formation in

LB medium by P. aeruginosa PAO1 [31, 319]. PA2133, an EAL- domain protein, was previously characterised as a cyclic-di-GMP PDE in P. aeruginosa [31]. Expression of the gene PA2133 in the wild type PAO1 abolished surface attachment ability of the strain and resulted in undetectable levels of cyclic-di-GMP [31].

The use of functionally verified DGC such as WspR) and PDE such as PA2133 an overexpression study is to ensure that a DGC or a PDE activity occurs and will lead to previously observed phenotypes that correspond to such enzymatic activities, i.e. DGC expression leads to elevated cyclic-di-GMP levels and promotes attachment and biofilm-related phenotypes while PDE expression leads to diminished levels of cyclic- di-GMP and enhances motility-related phenotypes [31, 313, 319].

Heterologous overexpression of GGDEF or EAL domains has also been successful in other strains, including the heterologous expression of GGDEF and EAL domain proteins from S. typhimurium in Aeromonas sobria [329]. Similarly, the GGDEF- domain protein HmsT from Y. pestis was overproduced and found to restore cellulose synthesis in S. typhimurium ardA mutant. On the other hand, adrA was able to replace the function of hmsT in Y. pestis Hms-dependent biofilm formation. These observations indicate the interchangeability of cyclic-di-GMP domain proteins between strains [105], implying that overexpression experiments in marine bacteria, such as R11 are challenging. Future studies along this line of experiments, however, seem promising following a recent report that genes encoding a DGC (yedQ) and PDE (yhjH) from E. coli were successfully introduced in the strain Ruegeria mobilis F1926 [282]. The genes yedQ and yhjH were cloned into the broad host-range plasmids pK404A and pBBRMCS-3, respectively [282]. Rather than utilising the pJN105 plasmid to bear the desired DGC or PDE protein, it would then be worthwhile to explore the suitability of these plasmids for future overexpression studies in R11.

Another alternative and promising approach would be to heterologously overexpress the predicted cyclic-di-GMP genes of R11 in bacterial strains with easily observable and characteristic phenotypes associated with variations in intracellular concentrations of cyclic-di-GMP rather than in the R11 strain itself. As an example of this alternative approach, Bordelleau and coworkers [318] recognised the challenges of working with

Clostridium difficile and the lack of observable phenotypes regulated by cyclic-di-GMP in this bacterium. Thus, in order to study all 31 putative DGC and PDE genes in C. difficile, they heterologously expressed these genes in V. cholerae. As expected, ectopic expression of most of the DGCs from C. difficile decreased cell motility and increased

94 biofilm formation in V. cholerae confirming their respective function as DGCs [318]. It is further suggested that a quantitative analysis of mRNA levels, following an induction experiment, may provide further insights into the expression DGC or PDE genes in

R11.

3.4.3. Insights into the Potential Role of Cyclic-di-GMP in N. italica R11

Under the experimental conditions utilised in this study, the level of cyclic-di-GMP in the R11 WT strain is higher in attached cells compared to planktonic cells. The results obtained provide preliminary baseline information on cyclic-di-GMP production in

R11. This study suggests that two of the predicted DGC genes in R11, R11cdg1

(RR11_868) and R11cdg3 (RR11_1340) may have a role in the lifestyle change in R11, although, their specific involvement in the transition from a motile to a sessile lifestyle remains to be further explored.

More significantly, the data presented here also suggest that cyclic-di-GMP could impact the traits relevant to attachment and colonisation of R11 [252]. R11 possesses proteins related to the assembly of Type IV pili as well as to exopolysaccharide synthesis [252]. Interestingly, PilZ domain proteins [39, 57, 60] have been identified in

R11 (Chapter 2) to be associated with the Type IV pilus assembly protein (RR11_3318) and the putative cellulose synthase catalytic subunit protein (RR11_2632). Both of the predicted proteins possess the primary cyclic-di-GMP binding site RxxxR [60] indicating that cyclic-di-GMP has binding specificity for these proteins. Cellulose production was assessed in the R11 WT and the mutant strains by plating on agar supplemented with Calcoflour White, a fluorescent dye that is known to bind to cellulose fibrils [330]. There was no observable difference in fluorescence intensities of

95 the R11 WT and the mutant strains. In certain species, such a Rhizobium spp. and

Klebsiella pneumoniae, it has been shown that cellulose is not produced under laboratory conditions. [33, 331]. Moreover, it has also been demonstrated that cellulose is only produced by P. fluorescens SBW25 when the bacterial cells are associated with the plant surface [332]. Thus, the culture conditions utilised in the experiments reported here may not be optimal for the R11 strains and hence further studies may be required.

It is important to recognise that cyclic-di-GMP in R11 was detected and quantified in this study for cells growing on plastic (polystyrene) surfaces. It would be interesting to determine cyclic-di-GMP levels in R11 under more relevant environmental conditions, such as when cells are growing planktonically in seawater or when they are attached or maintained as biofilms on the surface of D. pulchra [251]. In addition, there is a need to explore specific environmental cues that can modulate cyclic-di-GMP levels in R11.

Interestingly, a breakthrough recent study has revealed the specific role of DGCs in temperature modulation of cyclic-di-GMP in V. cholerae [333]. It has been previously shown that R11 cells form biofilms and invaded furanone-free D. pulchra thalli at high temperature (i.e. 24oC) [251]. Elucidating the role of temperature in modulating cyclic- di-GMP levels in R11 may thus be a worthwhile research endeavour to pursue.

Lastly, it is also important to consider that cyclic-di-GMP in R11 in this study was determined at two distinct growth stages i.e. for planktonic and attached cells, and only at a single and specific incubation period (24h). It would be necessary to further explore dynamic changes in cyclic-di-GMP levels in R11 cells as they transition from the planktonic to the attached or biofilm mode of life. This will entail time-series experiments and will likely require sensitive and specific intracellular fluorescence- 96 based sensors [118-120, 122, 123]. The use of the CdrA-GFP sensor [120] was initially attempted in this study with the goal to determine cyclic-di-GMP levels in the R11 WT and mutant strains (data not shown). This endeavour was not further pursued, because the available sensor at the time is a stable GFP sensor and it was expected that it may not monitor the dynamic changes of cyclic-di-GMP in the cell [120]. The availability of

GFP sensors would also allow investigation of the dynamic changes in intracellular levels of cyclic-di-GMP in R11 at different temperatures.

Overall, the results obtained in the present study provide baseline information for the genetic manipulation of genes involved in cyclic-di-GMP metabolism in R11. Further genetic work and subsequent biochemical analyses are thus required to unequivocally ascertain the specific role and function of the predicted cyclic-di-GMP genes in N. italica R11.

CHAPTER 4

Exploring Cyclic-di-GMP Signalling in Representative

Marine Roseobacter Strains

4.1. INTRODUCTION

The marine Roseobacter clade is one of the predominant bacterial groups in the marine environment. Member of this clade are found in most marine niches, from coastal water and sediments to marine plants and animals. Most of the species in this lineage exhibit diverse metabolic and physiological traits, such as photosynthesis [222-224], sulphur metabolism [217, 219, 220], carbon monoxide oxidation [220], degradation of aromatic compounds [221] and secondary metabolite production [228, 334]

One of the well-known traits of marine roseobacters is that they are effective colonisers of surfaces and are often found as biofilms in association with marine algae [248, 269,

276], dinoflagellates [263-265], sponges [242], cephalopods [241] and scallop larvae

[237, 335]. In addition, many roseobacter species have been observed to undergo a biphasic “swim-or-stick” lifestyle that has been postulated to enable them to associate with a surface or host organism [253].

Comparative genomic analysis of culturable Roseobacter strains has provided several insights into the prevalence and conservation of functions that are relevant for colonisation [254]. However, there is limited knowledge about the molecular mechanisms that roseobacters utilise to associate themselves with surfaces or hosts.

In many proteobacteria, cyclic-di-GMP has been recognised as a key regulator for the switch between motile and sessile lifestyles in bacteria, controlling traits such as flagellar motility and exopolysaccharide production [10, 25, 289-291]. It is likely that cyclic-di-GMP may thus have a potential role in the regulation of motility and surface attachment in most of the Roseobacter species.

The discovery of the abundance of cyclic-di-GMP signalling protein and evidence of cyclic-di-GMP production in pathogenic member of the Roseobacter clade, N. italica

R11 (Chapter 2 and 3), prompted the motivation to further explore cyclic-di-GMP signalling in other members of the Roseobacter clade. It was primarily hypothesised that other Roseobacter strains possess cyclic-di-GMP genes in their genomes and that a number of these genes are potentially functional thus facilitating the synthesis or degradation of cyclic-di-GMP. To address these hypotheses, sequenced genomes of the representative Roseobacter clade members were interrogated for the presence of genes encoding diguanylate cyclases (DGCs) and phosphodiesterases (PDEs). Following functional prediction, sequence analyses were carried out to assess conservation of motifs required for catalytic activity. Finally, the intracellular concentrations of cyclic- di-GMP in planktonic and attached cells of the Roseobacter clade were determined.

4.2. MATERIALS AND METHODS

4.2.1. Marine Roseobacter Strains Used in the Study

The marine Roseobacter strains included are listed in Table 4.1. In addition, two strains of Nautella italica (N. italica LMG 24365T and N. italica LMG 24364) were also studied, although their genomes are not available. The strains used belong to four of

99 five major Roseobacter sub-clades previously described [336]: Clade 1: Phaeobacter gallaeciensis 2.10, Phaeobacter gallaeciensis BS107, Phaeobacter sp. LSS9, Ruegeria pomeroyi DSS-3, Ruegeria sp. TM1040 and Rhodobacter sphaeroides ATCC 17029;

Clade 2: Sulfitobacter sp. EE-36; Clade 3: Roseovarius nubinhibens ISM and Clade 4:

Oceanicola granulosus HTCC 2516.

Table 4.1. List of Representative Marine Roseobacter Strains Used

Organism/ IMG NCBI Source of Reference Genome Genome Taxon ID Isolation Laboratory ID Clade 1 Phaeobacter 251006502 383629 Surface of green T. Thomas, CMB, gallaeciensis 8 alga Ulva UNSW, Sydney, 2.10 lactuca, Sydney Australia Phaeobacter 641380432 391619 Seawater from T. Brinkhoff, gallaeciensis larval cultures University BS107 of scallop Oldenburg, Pecten maximus Germany Phaeobacter sp. 250217117 681157 Surface of red T. Thomas, CMB, LSS9 9 macro alga UNSW, Sydney, Delisea pulchra, Australia Sydney Ruegeria 637000267 246200 Coastal Georgia M. Moran, pomeroyi DSS-3 seawater University of Georgia, USA

Ruegeria sp. 637000268 292414 Phycosphere of M. Moran, TM1040 the University of dinoflagellate Georgia, USA Pfiesteria piscicida Rhodobacter 640069328 349101 Delft, Holland, S. Kaplan, sphaeroides and California University of ATCC 17029 from enrichment Texas, USA cultures Nautella italica Genome Marine P. Vandamme, LMG not yet electroactive University of 24354 sequenced biofilm Ghent, Belgium

100

Nautella italica Genome Marine P. Vandamme, LMG 24365T not yet electroactive University of sequenced biofilm Ghent, Belgium

Clade 2 Sulfitobacter sp. 638341211 52598 Salt marsh on M. Moran, EE-36 the coast of University of Georgia, USA Georgia, USA Clade 3 Roseovarius 638341183 89187 Surface waters M. Moran, nubinhibens ISM of the Caribbean University of sea Georgia, USA Clade 4 Oceanicola 638341140 314256 Sargasso Sea, S. Giovannoni, granulosus Atlantic Ocean Oregon State HTCC2516 University , USA

4.2.2. Identification of Putative Diguanylate Cyclases and Phosphodiesterases in

Sequenced Genomes of Representative Marine Roseobacter Strains

Representative Roseobacter strains with complete genome sequences (Table 4.1) were queried from the IMG-ER database of the DOE Joint Genome Institute

(https://img.jgi.doe.gov/cgi-bin/er/main.cgi) [293]. To predict genes that encode for proteins with GGDEF and EAL domain proteins or those that encode putative DGCs or cyclic-di-GMP PDEs, the “Gene Search” tool was used using a keyword search

“diguanylate cyclase” or “phosphodiesterase”. In addition, to further retrieve putative reference amino acid sequences of the representative diguanylate cyclases, PleD

(NP_421265.1) and WspR (NP_252391.1) were used as queries in a protein blast

(BLASTP). In order to identify unique hits and exclude redundant hits, the query hits were manually screened for the presence of PFAM identifiers related to cyclic-di-GMP signalling. These include “pfam00990” (GGDEF domain); “pfam00563” (EAL domain) and “pfam00072” (response regulator receiver domain). To predict genes that encode

101 for proteins with a HD-GYP domain, the PFAM identifier, “pfam01966” (HD domain), was used as the search query. Furthermore, to predict genes that encode for proteins with a PilZ domain, the PFAM identifier, “pfam07238” (PilZ domain), was employed.

Further details of the query hits from these respective searches were exported from the database. Also the respective amino acid sequences of the query hits were retrieved for further analyses. To predict genes that encode for proteins with a HD-GYP domain, the

PFAM identifier, “pfam01966” (HD domain), was used as the search query.

Furthermore, to predict genes that encode for proteins with a PilZ domain in the search, the PFAM identifier, “pfam07238” (PilZ domain), was selected. To determine the domain structure or organisation of each of the predicted proteins, the amino sequences were submitted to the SMART database (http://smart.embl-heidelberg.de) [90].

4.2.3. Determination of Motif Conservation by Multiple Sequence Alignment

To determine the motif conservation of the predicted GGDEF, EAL, HD-GYP and PilZ domain proteins, respectively, a multiple sequence alignment was performed using T-

Coffee (http://tcoffee.crg.cat/apps/tcoffee/do:regular; [294]. For GGDEF, EAL and HD-

GYP domain proteins, the amino acid sequences of known DGCs or PDEs were included in the alignment. For the PilZ domain proteins, the amino acid sequences of known PilZ domain cyclic-di-GMP binding proteins were included. The alignment results in the ClustalW format were saved and submitted to the ESPript server using default parameters (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). The ESPript server generates and output figure of the aligned sequences showing blocked and colour-coded residues according to their similarity or conservation [295]

102

4.2.4. Phylogenetic Analysis of GGDEF/EAL Domain Proteins

The amino acid sequences of the respective predicted GGDEF/EAL domain proteins were exported from IMG-ER. N. italica R11 GGDEF/EAL domain protein sequences

(Chapter 2) were also included in the dataset, as were representative sequences of known diguanylate cyclases: WspR [Pseudomonas aeruginosa PAO1] (NP_252391.1),

PleD [Caulobacter crescentus CB15](AAA87378.1), AdrA [Salmonella enterica subsp. enterica serovar Typhimurium str. LT2] (NP_459380.1), ScrC [Vibrio parahaemolyticus] (AAK08640.1), DGC1 [Gluconacetobacter xylinus] (AAC61684.1),

BifA [Pseudomonas aeruginosa PAO1] (AAG07755.1), HmsT [Yersinia pestis]

(AAD25088.1), STM4551 [Salmonella enterica] (WP_000211214.1), DRB0044

[Deinococcus radiodurans R1] (AAF12589.1), SLR1143 [Synechocystis sp. PCC 6803]

(BAA17300.1), TM1163 [Thermotoga maritima MSB8] (YP_008991738.1), and

CD1420 [Clostridium difficile 630] (YP_001087922.1). Multiple sequence alignments were performed using ClustalW as implemented in MEGA 5.0 [337] with default parameters. Furthermore, a phylogenetic tree was generated using the Neighbour-

Joining Method with default parameters as implemented in MEGA 5.0. The evolutionary distances were calculated with Poisson substitution model for amino acids and bootsrapped with 1000 replications.

4.2.5. Determination of Cyclic-di-GMP Levels in Planktonic Cells and Attached

Cells

4.2.5.1. Batch Planktonic and Attached Cultures

Batch cultures were set up to obtain planktonic and attached cells, respectively. The

Roseobacter strains were grown overnight in 10 ml Half-Strength Marine Broth (HMB)

103 in 50 ml centrifuge tubes at 25oC with shaking at 180 rpm. To set up planktonic cultures, 1 ml of the overnight culture was added to 20 ml of HMB in 50 ml centrifuge tubes. The tubes were incubated horizontally at 25oC with shaking at 50 rpm for 24 hours. To set-up the attached cultures, 1 ml of the overnight culture was added to 20 ml of HMB in Cellstar® petri dishes (No. 664160, Grenier Bio One). Four petri dish cultures per strain were incubated at 25oC with shaking at 50 rpm for 24 hours. Cells from planktonic phase cultures were obtained by centrifugation at 8000 x g for 5 mins.

Cells were washed once with 1X Nine Salts Solution (1X NSS). Washed cell pellets were stored at -80oC until extraction. Cells from attached cultures were obtained from the Cellstar® petri dish after carefully removing the spent medium. Cells were washed once with NSS. To obtain the cells attached to the bottom of and the sides of the petri dish, 2 ml of NSS were added to the petri dish and a sterile cotton swab was used to swab-scrape the cells. Cells obtained from the other petri dishes of the same strain were combined in 15 ml centrifuge tubes. Cell pellets were obtained following centrifugation at 8000 x g for 5 mins, washed once with NSS and stored at -80oC until extraction.

Biomass determination (from 1 ml cell pellets obtained separately) was done using the

Bicinchoninic Acid (BCA) Assay protocol (Sigma) following the manufacturer’s instructions.

4.2.5.2. Extraction of Cyclic-di-GMP

Cyclic-di-GMP was extracted from the cell pellets following an established protocol

(100 nM final concentration). The cell suspension was homogenized by passing five

104 times through a syringe with a 26G needle. Following homogenisation, the cell suspension was sonicated for 15 minutes using a water bath sonicator and the suspension was centrifuged at 20,000 x g for 5 minutes at 4oC. The resulting supernatant (300 µl) was then transferred to a 15 ml ice-cold centrifuge tube. The remaining pellet was again resuspended in the extraction solvent and the homogenisation and sonication steps described above were performed twice. The resulting supernatants from these successive extractions were combined (700 µl total volume). The tubes containing the supernatants were transferred to a cold centrivap

(Labconco) and the solvent evaporated until the sample had dried. The resulting residue was then resuspended in 200 µl of milliQ water and transferred to LC-MS vials. The vials were stored at -80oC until analysis.

4.2.5.3. Detection and Quantification of Cyclic-di-GMP by Mass Spectrometry

Mass spectrometry measurements were performed at the Singapore Centre on

Environmental Life Sciences Engineering (SCELSE), Nanyang Technological

University (NTU), Singapore, in collaboration with Dr. Victor Nesati. To detect cyclic- di-GMP in cell-free lysates, reverse-phase high pressure liquid chromatography on a

Nucleodur Pyramid C18 column (2 x 50 mm, 3 μm particle size; Macherey-Nagel) coupled with the use of a hybrid ion-trap mass spectrometer in positive ionisation mode was performed with the LTQ Orbitrap Velos Pro system (Thermo-Scientific). The mobile phases were: 10 mM ammonium acetate in water with 0.1% formic acid (Phase

105 of the cycle time for 10 minutes. The temperature was set at 35oC and the sample injection volume was set at 20 µl. Authentic cyclic-di-GMP (BioLog Life Science

Institute, Bremen, Germany) was used to detect and identify the molecule in the cell extracts based on (a.) elution at 4.1 minutes and (b.) mass of the molecular ion (691 m/z) using the Xcalibur® software. To quantify cyclic-di-GMP in the samples, a standard curve consisting of defined concentrations (0.1 nM, 1.0 nM, 10 nM, 100 nM,

1000 nM) was established. The peak area values were used to estimate the concentration of the molecule by extrapolation.

4.2.6. 96-well Attachment Assay

The Roseobacter strains were grown overnight in 10 ml HMB in 50 ml centrifuge tubes at 25oC with shaking at 180 rpm. The optical density of the cultures were then adjusted to approximately OD600 ~ 0.2 with HMB. One hundred fifty microliters of the adjusted cultures were then added to individual wells of a flat-bottom 96-well plate (Sarstedt N.

The plates were covered in aluminium foil and then incubated further at 25oC with shaking at 200 rpm for 24 hours. After incubation, the absorbance readings at 490 nm were obtained for each well using a Wallac Victor2 1420 Spectrophotometer (Perkin

Elmer).

106

4.3. RESULTS

4.3.1. Genes Encoding DGCs and PDEs

Genes encoding putative DGCs (GGDEF domains) and PDEs (EAL and HD-GYP domains) were found in all Roseobacter genomes included in the study (Table 4.2,

Appendix II). Among the Roseobacter strains, a higher number of predicted DGCs and

PDEs were observed from closely related Clade 1 members. R. sphaeroides ATCC

17029 contains the highest number of predicted DGC/PDE genes (n=12) followed by

Ruegeria sp. TM1040 (n=9), Phaeobacter gallaeciencis (n=6), Phaeobacter sp. LSS9

(n = 5) and R. pomeroyi (n = 4). While the Clade 3 member Roseovarius nubinhibens

ISM has five predicted DGC/PDE genes, the Clade 2 and Clade 4 members,

Sulfitobacter EE-36 and O. granulosus HTCC2516, respectively, have the least number of these genes (n = 2-3) (Table 4.2, Appendix II). Interestingly, while most of the genes are chromosomally-encoded, a predicted DGC from Ruegeria sp. TM1040

(TM1040_3132) resides in a megaplasmid (Appendix II).

Domain structure prediction (Appendix V) revealed that the Roseobacter genomes encode mostly GGDEF only domains and sometimes tandem GGDEF-EAL domains

(Table 4.3, Appendix II). In Ruegeria sp. TM1040, Sulfitobacter sp. EE-36 and O. granulosus HTCC2516, the predicted DGCs are encoded by GGDEF only domains. All

Roseobacter genomes included in the study were found not to encode any standalone

EAL domain proteins (Table 4.2). HD-GYP domain proteins are encoded in all

Roseobacter genomes; with Ruegeria sp. TM1040 having the most (six) and the remaining strains encoding two to four HD-GYP proteins (Appendix III).

107

4.3.2. Genes Encoding PilZ-type Cyclic-di-GMP binding Proteins

Among the Roseobacter genomes studied, only P. inhibens 2.10, P. gallaciencis BS107,

Phaeobacter sp. LSS9 and R. sphaeroides ATCC 17029 encode a PilZ domain protein.

(Table 4.2, Appendix IV). Notably, the predicted PilZ domain protein in P. inhibens

2.10 (PGA2_c17600) is associated with bacterial type IV pilus assembly (PilZ) protein- like protein, while in R. sphaeroides ATCC 17029 (Rsph17029_1978) it is associated with a cellulose synthase domain (Table 4.5, Appendix IV)

Table 4.2. Predicted Cyclic-di-GMP Protein Domains in Representative Marine Roseobacter Strains

Organism/Genome Number of Predicted Cyclic-di-GMP Domain Proteins GGDEF GGDEF HD- PilZ Total -EAL GYP Oceanicola granulosus HTCC2516 0 3 2 0 5 Phaeobacter inhibens 2.10 2 4 4 1 11 Phaeobacter gallaeciensis BS107 2 4 4 1 11 Phaeobacter sp. LSS9 2 3 3 1 9 Rhodobacter sphaeroides ATCC 4 8 2 2 16 17029 Roseovarius nubinhibens ISM 1 4 3 0 8 Ruegeria pomeroyi DSS-3 0 4 5 0 9 Ruegeria sp. TM1040 5 4 6 0 15 Sulfitobacter sp. EE-36 0 2 2 0 4

4.3.3. Sensor Domains or Accessory Protein Domains in the Predicted GGDEF and

HD-GYP Domains Proteins

Domain structure analysis revealed a variety of sensor domain proteins to be associated with the predicted GGDEF or tandem GGDEF-EAL domain proteins in the Roseobacter

108 genomes. These sensor proteins include PAS (Per-ARNT-Sim) and (cGMP-specific phosphodiesterases, adenylyl cyclases and FhlA) [83, 85, 312], MHYT [87], REC

(receiver domain) [81, 88, 89], CHASE (cyclase/histidine kinases-associated sensing extracellular) [338-340] and HAMP (histidine kinases, adenylyl cyclases, methyl binding proteins, phosphatases) [341].

In the closely related strains P. inhibens 2.10, P. gallaeciencis BS107 and Phaeobacter sp. LSS9, REC, PAS, GAF and MHYT domains are the most commonly associated sensor domains (Table 4.3, Appendix V). In Ruegeria sp. TM1040, only GAF, MHYT and HAMP domains were observed. In R. sphaeroides ATCC 17029, a number of proteins contain GAF, PAS and PAC domains as well as HAMP and CHASE domains.

Of the two GGDEF domain proteins in Sulfitobacter sp. EE-36, one has an associated

REC domain. R. nubinhibens ISM has five proteins with a GGDEF domain, but only two have a REC and a PAS domain, respectively. In O. granulosus HTCC2516, a GAF domain is associated with a protein containing a GGDEF domain (Table 4.3, Appendix

V). With the exception of Sulfitobacter sp. EE-36, membrane-bound GGDEF domain proteins were also common among the Roseobacter strains studied (Table 4.3,

Appendix V).

Interestingly, an ammonium transporter domain is associated with the predicted tandem

GGDEF-EAL domain proteins in P. inhibens 2.10, Phaeobacter sp. LSS9 and Ruegeria sp. TM1040 (Table 4.3, Appendix V). Moreover, a 3’-5’ exonuclease domain

(35EXOc) and a DNA polymerase A domain (POLAc) are associated with the predicted

GGDEF domain protein in Phaeobacter sp. LSS9 (Table 4.3, Appendix V)

109

Domain structure analysis of the predicted HD-GYP domain proteins revealed that most of them possess the conserved HDc domain (Table 4.4, Appendix VI). Most of the predicted HD-GYP domain proteins also possess at least one of the HD-associated domains (“HD_5” and “HD_assoc”, respectively). An ACT domain is associated in one of the predicted HD-GYP domain proteins from all the Roseobacter strains, except in R. pomeroyi DSS3. Moreover, those proteins predicted to have ACT domains also have transferase domains (NTP_transf_2 and GlnD_UR_UTase) (Table 4.4, Appendix II).

Interestingly, one of the predicted HD-GYP domain proteins from Phaeobacter sp.

LSS9 further possess an aminoacyl-tRNA synthetase domain (tRNA-synt_1b) and a cold shock protein (CSP) domain. (Table 4.4, Appendix VI).

110

Table 4.3. Domain Structure of GGDEF Domain Proteins. GGDEF (GGDEF domain, PF00990); EAL (EAL domain, PF00563); REC (cheY-homologous receiver domain, SMART Acc.No. SM00448); PAS (PAS domain, PF00989); GAF (GAF domain, PF01590); CBS (CBS domain, PF00571); MHYT (bacterial signalling protein N-terminal repeat, PF03707); TM (transmembrane region); HAMP (HAMP domain, PF00672); CHASE (CHASE domain, PF03924); AM TRP (ammonium transporter, PF00909); 35EXOc (3'-5' exonuclease domain, SMART Acc.No. SM00474); POLAc (DNA polymerase A domain, SMART Acc.No. SM00482)

Gene_OID/Locus GGDEF- T Sensor Domains or Accessory Domains GGDEF EAL M Tag REC PAS PAC GAF MHYT HAMP CHASE Others Phaeobacter inhibens 2.10 2501766528 AM 2501767459 TRP 2501765727 2501766534 2501768368 2501766643 Phaeobacter gallaeciensis BS107 RGBS107_11352 RGBS107_15471 RGBS107_04606 RGBS107_11382 RGBS107_01883 RGBS107_11767 Phaeobacter sp. LSS9 2502321359 35EX POL 2502320617 Oc Ac 2502320043 AM

111

Gene_OID/Locus GGDEF- T Sensor Domains or Accessory Domains GGDEF EAL M Tag REC PAS PAC GAF MHYT HAMP CHASE Others TRP 2502321364 2502321321 Ruegeria pomeroyi DSS-3 SPO2753 SPO2747 SPO2840 SPO1173 Ruegeria sp. TM1040 TM1040_2174 TM1040_3136 AM TM1040_2156 TRP TM1040_3132 TM1040_0172 TM1040_2229 TM1040_1169 TM1040_1035 TM1040_2169 Rhodobacter sphaeroides ATCC 17029 Rsph17029_2069 Rsph17029_3047 Rsph17029_3828 Rsph17029_1659 Rsph17029_1980 Rsph17029_3013

112

Gene_OID/Locus GGDEF- T Sensor Domains or Accessory Domains GGDEF EAL M Tag REC PAS PAC GAF MHYT HAMP CHASE Others Rsph17029_2064 Rsph17029_2995 Rsph17029_3046 Rsph17029_1974 Rsph17029_3158 5TM- Rsph17029_2060 5TMR_LYT Sulfitobacter sp. EE-36 EE36_12198 EE36_12218 Roseovarius nubinhibens ISM ISM_05685 ISM_00215 ISM_11995 ISM_12050 ISM_12405 Oceanicola granulosus HTCC2516 OG2516_15214 OG2516_17141 OG2516_04351

113

Table 4.4. Domain Structure of HD-GYP Domain Proteins. HDc (HD domain, metal-dependent phosphohydrolase, PF 01966); HD_5 (HD domain, PF13487); HD_assoc (HD domain, phosphohydrolase-associated domain, PF13286); NTP_transf_2 (nucleotidyltransferase domain, PF01909); GlnD_UR_UTase (GlnD_PII uridylyltransferase, PF08335); ACT (ACT domain, PF01842)

Associated Domains Gene ID Locus Tag tRNA- HDc HD_Assoc ACT NTP_transf_2 GlnD_UR_Utase HD HD5 GlnE synth_1b CSP Phaeobacter inhibens 2.10 2510175868 PGA2_c10960 2510176387 PGA2_c16150 2510177249 PGA2_c24780 2510177294 PGA2_c25230 Phaeobacter gallaeciensis BS107 641474906 RGBS107_15266 641475293 RGBS107_02043 641475342 RGBS107_02288 641478033 RGBS107_12662 Phaeobacter sp. LSS9 2502319345 2502320276 2502321184 Ruegeria pomeroyi DSS-3 637287758 SPO0266 637287889 glnD 637288125 SPO0638 637289976 SPO2505 637290846 SPO3381

114

Associated Domains Gene ID Locus Tag tRNA- HDc HD_Assoc ACT NTP_transf_2 GlnD_UR_Utase HD HD5 GlnE synth_1b CSP Ruegeria sp. TM1040 638004690 TM1040_3187 638005439 TM1040_0145 638005473 TM1040_0179 638005629 TM1040_0334 638005742 TM1040_0446 638006204 TM1040_0902 Rhodobacter sphaeroides ATCC 17025 640482022 Rsph17025_0469 640482755 Rsph17025_1197 Sulfitobacter sp. EE-36 638830819 EE36_16022 638832599 EE36_08788 Roseovarius nubinhibens ISM 638837208 ISM_08380 638838289 ISM_16440 638838598 ISM_09991 Oceanicola granulosus HTCC2516 639046404 OG2516_02099 639047167 OG2516_16966

115

Table 4.5. Domain Structure of PilZ Domain Proteins. PilZ (PilZ domain, cyclic-di-GMP binding domain, PF07238); Cellulose_synt (Cellulose synthase, PF03552); Glycos_transf_2 (Glycosyl transferase family 2, PF00535); TM (transmembrane region)

Gene_OID/ Associated Domains Genome TM PilZ Locus Tag Glycos_transf_2 Cellulose_synt Phaeobacter inhibens 2.10 PGA2_c17600 Phaeobacter gallaeciensis BS107 RGBS107_16051 Phaeobacter sp. LSS9 2502319019 Rhodobacter sphaeroides ATCC 17029 Rsph17029_1978

4.3.4. Sequence Motif Conservation of the Predicted GGDEF, HD-GYP and PilZ

Domains.

Multiple sequence alignment with known GGDEF domain proteins (Appendix VIII)

revealed that most of the predicted GGDEF domain proteins from the Roseobacter

strains investigated in this study have the conserved “GGDEF” or “GGEEF” motifs. In

contrast two predicted proteins from R. sphaeroides ATCC 17029 (Rsph17029_1980)

and from O. granulosus HTCC 2516 (OG2516_04351) were found to have degenerate

“SADEF” and “GVEEF” motifs, respectively (Appendix XII). The conservation of the

allosteric site RxxD varied across all strains (Appendix XII). Only two of the predicted

GGDEF domain proteins from strains P. inhibens 2.10, R. gallaeciencis BS107, and

Phaeobacter sp. LSS9 are conserved. Five of the 12 predicted GGDEF domains from

R. sphaeroides ATCC 17029, three of five GGDEF domain proteins from R.

nubinhibens ISM, and two of three GGDEF domain proteins from O. granulosus

HTCC 2516 have a conserved RxxD motif. Both of the predicted GGDEF domain

proteins from Sulfitobacter sp. EE-36 are conserved, while none of the predicted 116

GGDEF domain proteins from R. pomeroyi DSS-3 have conserved RxxD motifs

(Appendix VIII, Appendix XII).

Multiple sequence alignment of tandem GGDEF-EAL domains present in some of the

Roseobacter strains with known Class I EAL domain proteins (Appendix IX) showed that all EAL domain components have the conserved EAL (“EAL” or “EVL”) motif and the Loop 6 (“DDFGTGYSS”) motif (Appendix XIII). Multiple sequence alignment of the predicted HD-GYP domain proteins with known HD-GYP domain proteins

(Appendix X) revealed that only one each from P. inhibens 2.10 (PGA2_c16150) and P. gallaciencis BS107 (RGBS107_15266) possess the conserved “HD-GYP” motif

(Appendix XIV). Lastly, multiple sequence alignment of the predicted PilZ domain proteins with known PilZ domain proteins (Appendix XI) showed that all of the predicted PilZ domain proteins from P. inhibens 2.10, P. gallaciencis BS107,

Phaeobacter sp. LSS9 and R. sphaeroides possess the conserved “RxxxR” and

“DZSxxG” motif (Appendix XV).

4.3.5. Phylogeny of GGDEF and EAL Domain Proteins

Phylogenetic analysis of the DGC sequences of the representative marine Roseobacter strains revealed that proteins predicted as sole GGDEF domain protein cluster together as those predicted to have a tandem GGDEF-EAL domains (Figure 4.1). Although there was no distinct clustering based on Roseobacter sub-clades, the DGCs of closely related

Phaeobacter strains (2.10, BS107 and LSS9) were found to cluster together with high confidence (bootstrap values). Moreover, strains where the GGDEF domain is

117 associated with or possesses any of the sensor domains (e.g. REC, PAS, PAC, GAF,

MHYT, AM TRP) also cluster together.

24 PleD Caulobacter crescentus REC-REC-GGDEF

8 Ruegeria TM1040 1169 AdrA Salmonella typhimurium 3TM-GGDEF 4 48 Ruegeria pomeroyi SPO2840 WspR Pseudomonas aeruginosa REC-GGDEF STM4551 Salmonella typhimurium 5TM-GGDEF 0 28 99 HmsT Yersinia pestis 5TM-GGDEF Roseovarius nubinhibens ISM 11995

46 Rhodobacter sphaeroides Rsph17029 2069 48 Oceanicola granulosus OG2516 15214

73 Sulfitobacter EE36 12198 Ruegeria pomeroyi SPO2753 0 90 REC-GGDEF Ruegeria TM1040 2174 84 Nautella italica RR11 1340 85 Phaeobacter gallaeciencis PG210 2501766528 99 99 Phaeobacter PLLS9 2502321359 76 Phaeobacter gallaeciencis RGBS107 11352 0 Nautella italica RR11 1147 Rhodobacter sphaeroides Rsph17029 1974 24 GGDEF 87 Rhodobacter sphaeroides Rsph17029 3158 Rhodobacter sphaeroides Rsph17029 2060 25 TM-GGDEF Roseovarius nubinhibens ISM 12405

0 Ruegeria TM1040 1035 Oceanicola granulosus OG2516 17141 1 Rhodobacter sphaeroides Rsph17029 3013 7 0 Oceanicola granulosus OG2516 04351 39 Phaeobacter gallaeciencis PG210 2501768368 99 PAS-GAF-GGDEF 76 Phaeobacter gallaeciencis RGBS107 01883

58 Ruegeria pomeroyi SPO1173 Nautella italica RR11 1454 99 Phaeobacter PLSS9 2502321321 80 GAF-GGDEF 99 Phaeobacter gallaeciencis PG210 2501766643 4 97 Phaeobacter gallaeciencis RGBS107 11767 Rhodobacter sphaeroides Rsph17029 3046

17 Roseovarius nubinhibens ISM 00215 20 DRB0044 Deinococcus radiodurans GAF-GGDEF

50 CD1420 Clostridium difficile GGDEF 15 TM1163 Thermotoga maritima TM-GAF-GGDEF Rhodobacter sphaeroides Rsph17029 2995 0 SLR1143 Synechocystis GAF-GGDEF 17 ScrC Vibrio parahaemolyticus 3TM-GGDEF-EAL Phaeobacter gallaeciencis RGBS107 11382 2 95 Phaeobacter PLSS9 2502321364 99 Phaeobacter gallaeciencis PG210 2501766534 62 Nautella italica RR11 3152 97 Ruegeria TM1040 2169 GGDEF 95 Ruegeria pomeroyi SPO2747

99 Roseovarius nubinhibens ISM 12050 61 Sulfitobacter EE36 12218 19 Rhodobacter sphaeroides Rsph17029 2064 Ruegeria TM1040 3136 GGDEF-EAL 48 Ruegeria TM1040 2229

34 Rhodobacter sphaeroides Rsph17029 3828 7 2 Rhodobacter sphaeroides Rsph17029 1659

99 Phaeobacter gallaeciencis PG210 2501767459 99 Phaeobacter gallaeciencis RGBS107 15471 2 AMM TRP-GGDEF-EAL 99 Phaeobacter PLSS9 2502320043 Ruegeria TM1040 2156

17 Roseovarius nubinhibens ISM 05685 6 Ruegeria TM1040 0172 28 Nautella italica RR11 868 99 Phaeobacter gallaeciencis PG210 2501765727 99 14 Phaeobacter gallaeciencis RGBS107 04606 TM-MHYT-GGDEF-EAL 99 Phaeobacter PLLS9 2502320617 DGC1 Gluconacetobacter xylinum PAS-PAC-GGDEF-EAL Rhodobacter sphaeroides Rsph17029 3047 Rhodobacter sphaeroides Rsph17029 1980 Ruegeria TM1040 3132 BifA Pseudomonas-aeruginosa 2TM-GGDEF-EAL 23 Nautella italica RR11 749

0.1

118

Figure 4.1. Phylogenetic tree of the GGDEF and EAL domain proteins of representative marine Roseobacter strains. The phylogenetic tree was generated by the Neighbour-Joining Method. Bootstrap values (%) are based on 1000 bootstrap replicates. The scale bar indicates the number of amino acid substitutions per site. Specific clusters are annotated by the predicted domain structure: GGDEF (GGDEF domain, PF00990); EAL (EAL domain, PF00563); REC (cheY- homologous receiver domain, SMART Acc.No. SM00448); PAS (PAS domain, PF00989); GAF (GAF domain, PF01590); MHYT (bacterial signalling protein N- terminal repeat, PF03707); TM (transmembrane region); AM TRP (ammonium transporter, PF00909).

4.3.6. Surface Attachment

To assess attachment to plastic (i.e. polystyrene) and to compare attachment abilities of the representative marine Roseobacter strains, a 96-well attachment assay was performed. The respective strains showed variable abilities to attach after a 24-hour incubation period. The Phaeobacter strains, Phaeobacter inhibens 2.10, Phaeobacter gallaciencis BS107 and Phaeobacter sp. LSS9 showed strong attachment. Among the

Ruegeria and related Nautella strains, Ruegeria pomeroyi DSS-3 showed attachment with levels similar to the Phaeobacter strains and higher than Ruegeria sp. TM1040,

Nautella italica LMG 24365T and Nautella italica LMG 24364. The remaining strains,

Rhodobacter sphaeroides ATCC 17029, Sulfitobacter sp. EE-36, Roseovarius nubinhibens ISM and Oceanicola granulosus HTCC 2516 exhibited low attachment levels (Figure 4.2).

119

Figure 4.2. Surface attachment on 96-wells polystyrene plates. Representative marine Roseobacter strains were inoculated onto wells of a 96-well polystyrene plate and incubated for 24 hours at 25oC with shaking at 200 rpm. Surface attachment is presented as the mean absorbance at 490nm (A490) with error bars representing the standard error of mean (SEM).

4.3.7. Detection and Quantification of Cyclic-di-GMP in Planktonic and Attached

Cells

Cyclic-di-GMP was extracted from planktonically grown and attached cells, respectively, to assess and compare the levels of this signal in the two modes of growth.

“Planktonic” samples were obtained from cells suspended in broth cultures while

“attached” samples were obtained from cells scraped from the bottom of a petri dish after removing the bulk culture medium. Cyclic-di-GMP levels were generally higher in planktonic cells than in attached cells for most strains except Nautella italica LMG

24364 (Figure 4.3).

120

In planktonic cells, high levels of cyclic-di-GMP were recorded for Oceanicola granulosus HTCC 2516 (18.1 ± 12.1 fmol μg protein -1), Roseovarius nubinhibens ISM

(9.2 ± 15.1 fmol μg protein -1), Phaeobacter gallaciencis BS107 (7.7 ± 12.8 fmol μg -1),

Rhodobacter sphaeroides ATCC 17029 (4.8 ± 5.4 fmol μg protein -1) and Phaeobacter sp. LSS9 (4.0 ± 5.3 fmol μg protein -1). Relatively low levels of cyclic-di-GMP in planktonic cells were obtained from Ruegeria pomeroyi DSS-3 (1.0 ± 1.2 fmol μg protein -1), Phaeobacter gallaeciencis 2.10 (0.4 ± 0.03 fmol μg protein -1), Sulfitobacter sp. EE-36 (0.2 ± 0.2 fmol μg protein -1) and Ruegeria sp. TM1040 (0.1 ± 0.0 fmol μg protein -1). Cyclic-di-GMP level lower than 0.01 fmol μg protein -1 was obtained in

Nautella italica LMG 24364 (0.004 ± 0.000 pM μg protein -1). In N. italica LMG

24365T, the level of cyclic-di-GMP was below the detection limit (Figure 4.3).

In attached cells, relatively high levels of cyclic-di-GMP were found for Oceanicola granulosus HTCC 2516 (7.2 ± 4.0 fmol μg protein -1), Rhodobacter sphaeroides ATCC

17029 (6.3 ± 1.4 fmol μg protein -1) and Roseovarius nubinhibens ISM (2.8 ± 3.0 fmol

μg protein -1). Low levels of cyclic-di-GMP in planktonic cells were obtained from

Ruegeria pomeroyi DSS-3 (0.5 ± 0.3 fmol μg protein -1), Nautella italica LMG 24364

(0.3 ± 0.2 fmol μg protein -1), Phaeobacter gallaciencis BS107 (0.2 ± 0.2 fmol μg protein -1), and Sulfitobacter sp. EE-36 (0.1 ± 0.0 fmol μg protein -1). Cyclic-di-GMP level lower than 0.1 fmol μg protein -1 was observed for Ruegeria sp. TM1040 (0.05 ±

0.01 fmol μg protein -1) and Phaeobacter gallaeciencis 2.10 (0.02 ± 0.00 pM μg protein

-1). The cyclic-di-GMP levels in attached cells of Phaeobacter sp. LSS9 and in N. italica LMG 24365T were below the detection limit (Figure 4.3).

121

Figure 4.3. Cyclic-di-GMP levels in planktonic and attached cells of the representative marine Roseobacter strains. Cell-free lysates from planktonic cells and attached cells were obtained respectively from the individual Roseobacter strains. Data is presented as mean cyclic-di-GMP (fmol μg protein-1) with error bars representing the standard deviation (SD), (n = 3).

4.4. DISCUSSION

This chapter aimed to explore the occurrence of cyclic-di-GMP genes in the members of the Roseobacter group to further gain insights into the potential role of cyclic-di-GMP

122 signalling in their lifestyle. Nine members of the Roseobacter group with sequenced genomes representing four of the five sub-clades were studied.

4.4.1. Diversity, Abundance and Distribution of Cyclic-di-GMP Domain Proteins in Representative Marine Roseobacter Strains

Genes for cyclic-di-GMP synthesis and degradation were found in all marine

Roseobacter species analysed here, which indicate that potential cyclic-di-GMP dependent pathways operate in these representative strains. Similar to a previous study

[254], the cyclic-di-GMP genes predicted from the Roseobacter strains varied in numbers. While Slightom and Buchan [254] focussed only on DGC/PDE abundance, the current study further advanced the findings by characterising the predicted proteins in terms of structure and organisation and in addition, sequence motif conservation of the respective domains.

In all of the Roseobacter strains studied, the predicted DGC genes mostly possess a conserved “GGDEF” or “GGEEF”, which indicates that these domains are catalytically active and could function as DGCs [30-35]. While not all of the predicted GGDEF domains have a conserved allosteric site (I-site), RxxD, the presence of at least one in each strain indicates that feedback inhibition of cyclic-di-GMP can occur in these strains [30, 38]. The presence of multiple DGCs in each of the Rosoebacter genomes suggests that they can redundantly contribute to the cellular pool of cyclic-di-GMP in the cell [10].

Phylogenetic analysis of the GGDEF domain proteins indicates that the DGC proteins are highly diverse. Although a few sequences cluster with previously identified DGCs,

123 the majority of the Roseobacter sequences appear to form their own clusters and are associated with different domains or domain architectures, which indicate that

Roseobacter species have greatly diversified their DGC complement. This could be seen as an adaptation to various microhabitats or as a mechanism that enables them to fine tune their responses to the changes in conditions in the marine environment [216]

(further discussed in Section 5.4.2.).

It is also interesting to note that no stand alone EAL domain proteins are encoded in the

Roseobacter genomes, which suggests that a purely cyclic-di-GMP-specific phosphodiesterase activity may be lacking in the Roseobacter genomes. However, the

EAL components are found in tandem with a number of GGDEF domains. Motif conservation analysis of the EAL domains showed that they are conserved in both EAL motif and the Loop 6 motif, indicating that they are Class I cyclic-di-GMP phosphodiesterases [106, 296]. Hence, in the Roseobacter genomes, which have such domains (P. inhibens 2.10, P. gallaeciencis BS107, Phaoebacter sp. LSS9, Ruegeria sp.

TM1040, R. sphaeroides ATCC 17029 and R. nubinhibens ISM), it is likely that the proteins specifically have both DGC and PDE activities and could thus be bi-functional

[40, 297-299].

The abundance of predicted HD-GYP domain proteins in all of the Roseobacter genomes also initially suggested that alternative cyclic-di-GMP-specific phosphodiesterase activity may be driven by these domains in lieu of the apparent lack of standalone EAL domain proteins. However, motif conservation analysis showed that only P. inhibens 2.10 and P. gallaciencis BS107 possess the conserved HD-GYP domains and thus only these two strains may display PDE activities through the HD-

124

GYP domains (CITE). Strains with non-conserved HD-GYP domains are likely to function as phosphohydrolases [30, 38] independent of the cyclic-di-GMP pathway.

Only four Roseobacter strains (P. inhibens 2.10, P. gallaeciencis BS107, Phaeobacter sp. LSS9 and R. sphaeroides ATCC 17029) possess PilZ domain proteins and motif conservation analysis showed that their respective RxxxR and DZxSxxG motifs are highly conserved, indicating that these proteins specifically bind cyclic-di-GMP [60].

The presence of the PilZ-type cyclic-di-GMP binding proteins further suggests that a complete cyclic-di-GMP pathway could exist in these strains. This study, however, only predicted PilZ-type cyclic-di-GMP binding proteins. It is known that other non-PilZ type proteins can bind cyclic-di-GMP, including proteins with degenerate GGDEF or

EAL domains, GGDEF domain proteins with degenerate RxxD motifs, transcription regulators that are not predicted by bioinformatics, and cyclic-di-GMP riboswitches [10,

68, 69, 292, 342]. Hence, the strains without any predicted PilZ domain proteins could still have other cyclic-di-GMP binding components.

4.4.2. Spatial Localisation of Sensor and Accessory Domains in Predicted GGDEF

Domain Proteins in Representative Marine Roseobacter Strains

This study also revealed the diversity of sensor domains associated with the GGDEF domains, indicating that the Roseobacter strains can sense and respond to certain signals or cues. A number of these sensor domains were found in GGDEF domain proteins that are membrane-bound, which indicate that these proteins can respond to extracellular signals and link these signals to cyclic-di-GMP signalling. Other sensor domains were found associated with GGDEF domain proteins localised in the cytoplasm, which suggest that these proteins may detect intracellular cues and can also link such cues to 125 cyclic-di GMP signalling. The distribution of these proteins in the membrane and in the cytoplasm facilitates co-localisation of DGCs and their targets. It also renders signalling specificity of cyclic-di-GMP proteins [10].

MHYT and GAF domains were found in membrane-bound GGDEF domain proteins in

Clade I Roseobacters. In P. inhibens 2.10, P. gallaeciencis BS107 and Phaeobacter sp.

LSS9, R. pomeroyi DSS-3 and Ruegeria sp. TM1040 suggesting that these strains can respond to oxygen (O2), carbon monoxide (CO) and nitric oxide through the MHYT domains [87]. In addition, these strains can also sense small molecules or ligands through the GAF domains [83, 312, 343]. GAF domains have been suggested to be involved in light sensing [86] and these Roseobacter strains may therefore have the capability to respond to light signals and link it to a cyclic-di-GMP pathway. While

MHYT and GAF domains are common membrane-bound sensors in this group of rosebacters, REC, PAS and interestingly, ammonium transporter domains were found in

GGDEF domains localised in the cytoplasm. Similar to GAF domains, PAS domains also bind small molecules or ligands [83, 312, 343]. The REC domain is a common receiver domain in response regulators of bacterial two-component systems [81, 88, 89].

Diguanylate cyclase activity of the GGDEF domain proteins require phosphorylation as exemplified for example in the REC-GGDEF domain protein PleD [30].

In R. sphaeroides ATCC 17029, the CHASE domain was found associated with a membrane-bound GGDEF domain. The CHASE domain has been suggested to bind diverse low-molecular weight ligands, such as cytokinin-like adenine derivatives or peptides [339]. In Sulfitobacter EE-36, R. nubinhibens ISM and O. granulosus 2516, sensor domains REC, PAS and GAF were only found in GGDEF domain proteins

126 localised in the cytoplasm, which indicates that these strains can modulate cyclic-di-

GMP only from intracellular signals.

A rather surprising and interesting finding was the discovery of a predicted ammonium transporter domain linked to a tandem GGDEF-EAL domain in the closely related strains Phaeobacter inhibens 2.10 (2501767459), Phaeobacter gallaeciencis BS107

(RGBS107_15471) and Phaeobacter LSS9 (2502320043) and Ruegeria sp. TM1040.

Initially studied in the yeast Saccharomyces cervisiae [344], ammonium transporters belong to the ammonium transport (Amt) family of proteins and have been found in bacteria, archaea, fungi, plants and animals [345]. In bacteria and fungi, they are involved in scavenging ammonium and recapturing ammonium lost from cells through the membrane [345]. The ammonium transporter found in strains 2.10, BS107, LSS9 and TM1040 were predicted to be cytoplasmic. This suggests that intracellular ammonium ions could potentially modulate the activity of the GGDEF domains in these strains. It was also surprising that in Phaeobacter sp. LSS9, a 3’-5’ exonuclease domain

(35EXOc) and a DNA polymerase A domain (POLAc) were found associated with the predicted GGDEF domain protein in Phaeobacter sp. LSS9, which may suggest a link between DNA polymerase activity and cyclic-di-GMP in this strain. Such findings warrant further experimental studies to verify a potentially novel role for cyclic-di-GMP for these Roseobacter members.

4.4.3. Cyclic-di-GMP Production in Representative Marine Roseobacter Strains

The detection of cyclic-di-GMP in planktonic and attached cells of the representative

Roseobacter strains confirms that the predicted GGDEF domain proteins are functional and can synthesise cyclic-di-GMP under the experimental conditions utilised in the

127 study. Along with the findings for N. italica R11 (Chapter 2), this study provides convincing baseline evidence that members of the Roseobacter clade can produce cyclic-di-GMP. To date and to the best of my knowledge, cyclic-di-GMP production has only been demonstrated in Ruegeria mobilis [282].

Consistent with the results obtained for N. italica R11 (Chapter 2), the cyclic-di-GMP level in N. italica LMG 24364 was also found to be elevated in attached cells compared to planktonic cells. While the respective genomes of the LMG strains remain to be sequenced, it is plausible that potentially conserved GGDEF domain proteins and hence, functional DGCs exist in N. italica LMG 24364. Given that the LMG strains are closely related, it is also plausible that strain LMG 24635T may possess functional DGCs too.

The non-detection of cyclic-di-GMP in N. italica LMG 24365T may imply that the levels of the molecule were probably below the detection limit (i.e. less than 0.1 fmol) or that production of cyclic-di-GMP in this strain occurs under conditions not tested here.

Surprisingly, the present study showed that all Roseobacter strains, except for N. italica

LMG 24364, had higher cyclic-di-GMP levels in planktonic cells when compared to attached cells. This is in contrast to the existing paradigm that high intracellular cyclic- di-GMP levels promote a sessile lifestyle concomitant with surface attachment and exopolysaccharide production and low level promote a planktonic lifestyle concomitant with flagellar gene expression and increased motility [10, 24, 25].

These results, however, are consistent with several lines of evidence that have accumulated recently. For example, increased cyclic-di-GMP levels promoting motility

128 has been demonstrated in the alphaproteobacterium Azospirillum brasilense. A. brasilense cells respond to changes in oxygen concentration by temporarily increasing in cyclic-di-GMP levels. The major aerotaxis/chemotaxis receptor Tlp1 binds cyclic-di-

GMP and promotes increased swimming velocity and decreased reversal frequency to allow cells to navigate low oxygen gradients [134]. In addition, recent studies in E. coli and P. aeruginosa demonstrated low cyclic-di-GMP levels promote early biofilm formation or biofilm dispersal [177, 346]. In E. coli, inactivation of the DGCs YeaI,

YedQ and YfiN led to the reduction of cyclic-di-GMP levels and actually promoted initial biofilm formation [346]. In P. aeruginosa, a signalling cascade involving the three proteins (a DGC, NicD, a chemotaxis transducer protein, BldA and a PDE, DipA) leads to low levels of cyclic-di-GMP and promotes nutrient-induced biofilm dispersal

[177]. Here, dispersal is induced by the addition of glutamate in the culture. Glutamate addition is sensed by the NicD and results in dephosphorylation of NicD.

Desphosphorylation of NicD results in increased cyclase activity leading to increased cyclic-di-GMP levels. The enhanced cyclic-di-GMP levels lead to the phosphorylation of the chemotaxis transducer protein BdlA. Phosphorylated BdlA then interacts with the

PAS region of the PDE DipA resulting in its activation as a PDE which then leads to the reduction of cyclic-di-GMP and subsequently induction of biofilm dispersal [177].

These paradigm-shifting findings have now been acknowledged to reconsider the more dynamic nature of cyclic-di-GMP signalling [10, 347]. These above-mentioned studies, therefore, may provide some perspectives to partly explain the low cyclic-di-GMP obtained from attached cells and higher cyclic-di-GMP levels seen for planktonic cells.

Romling (2013) further suggested that cyclic-di-GMP dependent motility regulation does not always result in a motility-to-sessility transition and that a distinction needs to

129 be made between transient increases and decreases in cyclic-di-GMP levels and more permanent changes in intracellular cyclic-di-GMP concentrations.

It is also worthwhile considering the limitations of the experimental set-up utilised in this study. One is the batch experimental set-up utilised in the study which was limited by the fact that specific stages of attachment or biofilm formation were not pre- determined for the individual Roseobacter strains. Another limitation was that cells used for cyclic-di-GMP measurements were obtained from only a single time point (i.e.

24-hour). As such, following the paradigm-shifting perspective mentioned above, the following possibilities may explain the low cyclic-di-GMP levels in attached cells: (1) the cells analysed here were obtained from a relatively early stage of biofilm formation, and (2) the cells may have been at the biofilm dispersal stage. Hence, if the cells sampled from the petri dishes for extraction and mass spectrometry analysis represented any of these stages of the biofilm life cycle, low cyclic-di-GMP levels similar to what has been reported for E. coli [346] and P. aeruginosa [177], respectively, would be expected. Conversely, when planktonically-grown cells were harvested, cells could have increased their cyclic-di-GMP levels as a response to the limiting conditions of the batch culture. Thus, it is crucial to first establish the biofilm lifecycle of a particular strain prior to conducting cyclic-di-GMP measurements. Such experiments will ascertain that the levels measured correlate well and are reflective of the specific stage of the biofilm lifecycle in question. In addition, while unequivocally providing sensitivity and specificity, mass spectrometry seems to have an inherent limitation in this kind of experiments where cyclic-di-GMP levels obtained are reflective of the entire population of cells. In vivo single-cell techniques utilising fluorescent sensors

130 should provide a more robust and accurate measurement of the levels of cyclic-di-GMP in the cells.

Overall, the results obtained in this study suggest that cyclic-di-GMP production is common in members of the Roseobacter clade. While cyclic-di-GMP production is apparent in the strains studied here, the observed differences in cyclic-di-GMP levels in planktonic and attached cells require further investigation. In addition, there is also a need to further explore the production of this signalling molecule under specific environmental conditions that reflect the lifestyle of individual Roseobacter species.

Moreover, this study has also provided clues about the specific environmental signals that members of the Roseobacter clade are able to perceive and link to a cyclic-di-GMP signalling pathway. Further studies to confirm how these signals are perceived and tranduced in the cell, and how these signals mediate cyclic-di-GMP signalling, are worth pursuing.

131

CHAPTER 5

General Discussion, Future Perspectives and Concluding

Remarks

Since its discovery, research on the bacterial secondary messenger cyclic-di-GMP has significantly progressed in the last two decades. Along with many developments in this field, the work described in this thesis contributes to the continuing research on cyclic- di-GMP signalling in bacteria. In addition, my work also contributes to the on-going research on the Roseobacter clade to understand their molecular mechanisms of surface colonisation. While the research on cyclic-di-GMP has significantly advanced with respect to several bacteria, such as E. coli, and species of Salmonella, Vibrio and

Pseudomonas, little is known about this signalling mechanism in marine bacteria. This thesis primarily addressed the latter topic by exploring cyclic-di-GMP signalling in representative members of the Roseobacter group and initially focussed on studies on N. italica R11, a pathogenic Roseobacter strain that is associated with bleaching in the red seaweed Delisea pulchra (Chapter 2 and 3), and progressed to study other representative Roseobacter strains (Chapter 4).

5.1. Exploring Genes Involved in Cyclic-di-GMP Metabolism

5.1.1. Abundance and Diversity of Genes Involved in Cyclic-di-GMP Signalling in

Marine Roseobacters

Whole genome sequencing of bacterial genomes has revealed the abundance of genes encoding for proteins with GGDEF, EAL, HD-GYP and PilZ domains, which are all

132 involved in cyclic-di-GMP metabolism [10, 12, 13]. The present study revealed that the genomes of N. italica R11 (Chapter 2) and other representative Roseobacter species

(Chapter 4) contain genes encoding diguanylate cyclases (DGCs) and phosphodiesterases (PDEs), enzymes that are involved in the synthesis and degradation of cyclic-di-GMP, respectively [21, 42, 43, 46, 47]. The abundance and frequency of these genes were found to vary between the organisms studied (Chapter 2, Chapter 4), a finding that is consistent with earlier surveys from genomes of terrestrial or non-marine strains [12, 16-19, 39]. Furthermore, the present study also revealed the presence of cyclic-di-GMP binding proteins in the form of PilZ-type domain proteins [21, 39, 56] in some of the representative genomes. Overall, these findings suggest that along with their terrestrial counterparts, cyclic-di-GMP signalling appears to be common in marine roseobacters, and indeed further establishing the possibly near universality of this signalling molecule in the bacterial domain.

As shown in Chapter 2 and Chapter 4, the initial survey and identification of DGCs and

PDEs need to be followed up by further bioinformatic approaches including domain structure analysis and multiple sequence alignment with known and functionally verified DGC/PDE proteins. These further analyses are crucial and can reveal more insights into the characteristics of these proteins. Thus, taken together with the initial and preliminary survey and findings by Slightom and Buchan [254], the work presented in this thesis adds to and expands the existing findings on the genomic traits of marine roseobacters.

133

5.1.2. Identification of Sensor Domains that Link Environmental Cues to Cyclic-di-

GMP Signalling in Marine Roseobacters

Bacterial sensor domains were discovered early on from surveys of bacterial genomes and they were found associated with bacterial signal transduction pathways [16, 19, 20].

In Chapter 2 and Chapter 4, domain structure analysis revealed that the predicted DGCs and PDEs from the representative Roseobacter strains have diverse structure or organisation and that they are often found associated with sensor domains such as PAS,

GAF, MHYT, REC [16, 83-89]. The presence of such domains indicates that these proteins can sense various signals from the environment and link these signals to cyclic- di-GMP dependent signalling pathways (discussed further in Section 5.2.2).

5.1.3. Identification of Conserved Sequence Motifs in Predicted DGCs and PDEs

In the present study, multiple sequence alignment with known DGCs and PDEs revealed the conservation of the sequence motifs that are necessary for catalytic activity

[30-36, 46, 47, 49, 60, 306]. While several predicted DGCs and PDEs possess conserved sequence motifs, a number of these proteins have degenerate motifs

(Chapters 2 and 4). Although this observation leads to the assumption that these proteins are non-catalytically active, their role as potential cyclic-di-GMP binding proteins remains a possibility [10].

The identification of conserved sequence motif is equally crucial in ascertaining the potential function of the predicted DGCs, PDEs and cyclic-di-GMP binding PilZ domain proteins. It is now clear that this analysis is able to provide further bioinformatic leads in order to shortlist the DGCs or PDEs for further genetic or biochemical studies

134 rather than proceeding to perform KO or overexpression studies of all predicted DGCs or PDEs, which can be laborious and time-consuming. Inclusion of this step in my research would likely have facilitated the work reported in Chapters 2 and 3.

5.1.4. Deletion and Overexpression of DGCs and PDEs

In many studies, particularly in well-characterised bacterial model systems, such as E. coli, and Pseudomonas, Vibrio and Salmonella species, the elucidation of the specific role of a predicted DGC or PDE or manipulation of the intracellular levels of cyclic-di-

GMP has been achieved through mutational and overexpression studies [101, 107, 137,

162, 313, 316, 317]. Interestingly, however, deletion or overexpression of a gene does not lead to an “all or nothing” phenotype [10, 23], owing to functional redundancy of these genes [10, 348]. Indeed, as shown in Chapter 3, deletion or overexpression of

DGC or PDE genes in R11 did not result in distinct phenotypes that correlate well with the genetic manipulation of genes encoding DGCs or PDEs. Thus, at this point, functional characterisation of these genes in R11 remains to be further investigated. Due to the challenging task of mutating or overexpressing genes, systems biology or genome-wide “global” approaches, such as transcriptomics, proteomics and metabolomics, could address the limitations of the classical genetic approach in exploring potential functions of genes involved in cyclic-di-GMP metabolism.

Functional characterisation of cyclic-di-GMP binding proteins lags behind studies of

DGCs and PDEs. PilZ-type cyclic-di-GMP binding proteins [21, 39, 57, 58, 165] are easily predicted through bioinformatic approaches as shown in N. italica R11 (Chapter

2) and in some Roseobacter species (Chapter 4). The presence of these PilZ proteins thus indicates a specific target output for cyclic-di-GMP signalling in these bacteria.

135

However, other non-PilZ type cyclic-di-GMP proteins, including other transcription factors [292], may also be present and thus remains to be explored. Also, relevant findings from structural studies [24, 55, 60, 62, 166, 349-357] should facilitate further structure-function characterisation of these potential cyclic-di-GMP binding proteins.

5.1.5. Detection and Quantification of Cyclic-di-GMP Levels

The present study utilised mass spectrometry (MS) to detect and quantify the levels of cyclic-di-GMP in cells that have mutations in certain DGCs or PDEs (Chapter 3) or cells harbouring plasmids containing a known DGC or PDE (Chapter 3). In addition,

MS was used to differentiate cyclic-di-GMP levels in planktonic and in attached cells

(Chapters 3 and 4). In these experiments, MS is proven to be an invaluable and an excellent tool for the direct measurement of cyclic-di-GMP in cells. Detection of the molecule is very specific and quantification of the levels is indeed very sensitive at the picomolar range (Chapters 3 and 4). Recent advances in methods and protocols have now emerged that allow the rapid and efficient extraction of the molecule from bacterial cells [117]. While MS remains as an efficient tool, such single-cell tools and methods that determine in situ dynamic changes in intracellular cyclic-di-GMP levels might be very useful. MS measurements potentially capture the whole population of cells at various metabolic states and data obtained represents the “average” of the population.

Fluorescence-based sensors [118, 120, 358] can be promising tools in accomplishing cyclic-di-GMP measurements in single cells.

136

5.2. Insights into the Ecological Relevance of Cyclic-di-GMP Signalling in the

Marine Roseobacters

5.2.1. Cyclic-di-GMP Production in Marine Roseobacters

One of the findings in the present study is that cyclic-di-GMP appears to be produced in a range of marine Roseobacter species (Chapters 2 and 4). While there is a need to further explore cyclic-di-GMP production and signalling in other members of the

Roseobacter group, the ecological relevance of this signalling molecule in members analysed in this study can be reasonably ascertained. In general, genes encoding for diguanylate cyclases (DGCs) are more abundant in strains that are efficient colonisers on surfaces, such as is the case for P. inhibens 2.10, R. gallaciencis BS107,

Phaeobacter sp. LSS9, R. pomeroyi DSS-3, and Ruegeria sp. TM1040, compared to those bacteria that are predominantly planktonic, such as R. nubinhibens ISM, O. granulosus HTCC 2516 and Sulfitobacter EE-36 (Chapter 4). Thus, among colonising roseobacters, cyclic-di-GMP signalling could be relevant in enabling the cells to switch from a motile, planktonic mode of growth to a sessile and attached mode of growth

(Romling et al., 2013). In the N. italica R11 strain, cyclic-di-GMP level was found higher in attached cells than in planktonic cells (Chapter 3). This finding thus indicates that cyclic-di-GMP is relevant when R11 colonises and form biofilms on the surface of

D. pulchra. In this case, it appears that N. italica R11 follows the perceived model.

However, among the other Roseobacter strains studied, cyclic-di-GMP appeared to be elevated in planktonic as compared to attached cells (Chapter 4). This rather surprising finding indeed contradicts the current paradigm that high levels of cyclic-di-GMP promote attachment and biofilm formation, while low levels promote motility (Romling et al., 2013). While these observations point to a possible novel role for cyclic-di-GMP among the roseobacters analysed, it is reasonable not to form definite conclusions at this 137 stage because the results obtained derive from a single time point experiment (Chapters

3 and 4). Given this limitation in the experimental set-up, it is possible that the cyclic- di-GMP levels obtained were transient levels. Indeed, additional work remains to be done, for example, studies that elucidate the complete biofilm life cycle of individual

Roseobacter clade strains are still lacking. Once this is established, dynamic changes in cyclic-di-GMP concentration could be monitored at each stage of the biofilm life cycle and could firmly establish the exact role of cyclic-di-GMP in these organisms.

5.2.2. Linking Environmental Cues to Cyclic-di-GMP Signalling in Marine

Roseobacters

The present study has uncovered the occurrence of sensor domains associated with potential DGCs and PDEs in all of the strains studied (Chapters 2 and 4). In addition, the sensor domains can be found localised to the membrane or to the cytoplasm

(Chapters 2 and 4). These findings are congruent with the notion that spatial localisation of the cyclic-di-GMP metabolising enzymes is a mechanism to ensure separation of their respective activities and thus confer specificity in function [10, 12].

Transmembrane (TM)-bound sensor domains were commonly found in representative

Clade 1 members (P. inhibens 2.10, P. gallaciencis BS107, Phaeobacter sp. LSS9, R. pomeroyi DSS-3, Ruegeria sp. TM1040, and N. italica R11) implying that cyclic-di-

GMP signalling is involved in the transduction of environmental signals in these strains.

The sensor domains in representative Clade 2 (Sulfitobacter sp. EE-36), Clade 3 (R. nubinhibens ISM) and Clade 4 (O. granulosus HTCC2516) strains, were not commonly found in association with transmembrane domains and are likely to be cytoplasmic. This implies that these strains utilise a different signal transduction pathway other than cyclic-di-GMP signalling to tranduce the signals from their environment.

138

Environmental cues or signals that potentially modulate cyclic-di-GMP signalling in roseobacters remain obscure. However, the findings presented in this study provide some clues as to which signals most of the representative Roseobacter clade strains analysed in this study would likely respond to. The presence of GAF and MHYT domains associated with transmembrane GGDEF domain proteins (Chapters 2 and 4) indicates that oxygen (O2), carbon monoxide (CO) and nitric oxide (NO), small molecules or ligands and light [83-87] are among the signals that can be perceived by these strains. These findings further suggest the potential versatility and responsiveness of roseobacters in dealing with various ecological conditions.

Interestingly, evidence has recently emerged that temperature affects cyclic-di-GMP signalling and biofilm formation in V. cholerae [333] . In the latter study, multiple

DGCs in V. cholerae increase cyclic-di-GMP levels in response to low temperature leading to repression of motility and promotion of biofilm formation. The role of temperature as an environmental signal, however, remains to be investigated in marine roseobacters. In N. italica R11, however, it has been previously demonstrated that it forms biofilms on the surface of furanone-depleted plants of the red alga Delisea pulchra at elevated (24oC), but not at low (19oC) temperature [251]. In Chapter 3 of this thesis, the incubation temperature was set at 25oC for R11 and attached cells produced high levels of cyclic-di-GMP. It is tempting to speculate at this point whether elevated temperature can modulate cyclic-di-GMP levels in strain R11. In Chapter 4, under the same temperature conditions, the other Roseobacter strains produced elevated cyclic-di-

GMP in planktonic cells compared to attached cells. It is also tempting to speculate whether temperature could be a factor modulating cyclic-di-GMP in planktonic cells in these strains. These assumptions require further experimental studies to unequivocally

139 establish the role of temperature in the colonisation traits and virulence of R11 and in other Roseobacter strains. It would also be of interest to further explore how roseobacters sense and perceive temperature as a signal and determine which specific phenotypic characteristic it affects.

5.3. Insights into the Potential Role of Cyclic-di-GMP on Traits Relevant for

Surface Colonisation in Marine Roseobacters

It is generally known that marine roseobacters are capable of surface colonisation, but the mechanisms that they employ to associate themselves with a surface are relatively unknown [254]. The genotypic and phenotypic comparative analyses of representative

Roseobacter clade strains [254] have provided insights into characteristic features that contribute to the colonisation success of this group including motility, chemotaxis, quorum sensing, secondary metabolite production and intracellular signalling. The present study has shown that cyclic-di-GMP is produced among representative

Roseobacter clade strains (Chapters 3 and 4) and it is reasonable to make several assumptions on how cyclic-di-GMP signalling is potentially linked to these traits.

5.3.1 Chemotaxis and Motility

Cyclic-di-GMP has been shown to be relevant for chemotactic behaviour in species such as A. brasilense [133], B. burgdorferi [52], P. aeruginosa [359], E. coli and S. typhimurium [360]. It seems that cyclic-di-GMP might not be directly linked to chemotactic behaviour in some Roseobacter species. Chemotactic behaviour, however, is not yet well-understood in marine roseobacters [254]. Insight into this process among some members of the Roseobacter clade has been uncovered from genomic analyses. 140

Among strains analysed in the present study, only P. inhibens 2.10, P. gallaciencis

BS107, O. granulosus HTCC2516 and Ruegeria sp. TM1040 have the genomic capacity for chemotactic behaviour owing to the presence of genes encoding for methyl- accepting chemotaxis proteins (MCPs) and a conserved cassette of che genes [254].

Among these strains, Ruegeria sp. TM1040 has been shown to display chemotaxis towards its host dinoflagellate products, including DMSP [263, 265]. However, based on available data that show a loose correlation between flagella production and chemotaxis among members of the rosebacters, Slightom and Buchan [254] contend that many roseobacters are not capable of chemotaxis signal transduction, except for

Ruegeria sp. TM1040, which possesses genes essential for both traits. In this line of thought, cyclic-di-GMP could be relevant only to those strains that are motile and possess the necessary chemotaxis machinery.

Motility is inherent in many Roseobacter strains [217, 224, 237, 254, 263, 336]. It has been previously demonstrated that cyclic-di-GMP regulates multiple levels of flagellum-based motility [361]. Although the exact mechanisms of flagellar control among Roseobacter strains remain to be uncovered, it is plausible that cyclic-di-GMP is linked to this processes. For the non-motile strains, such as R. nubinhibens ISM and O. granulosus HTCC 2516, cyclic-di-GMP could be linked to traits other than motility.

5.3.2. Secondary Metabolite Production

The production of secondary metabolites or antibiotics is a common trait for several members of the Roseobacter group and confers competitive advantage in their respective ecological niches [228, 276, 334, 362, 363]. Among these bioactive metabolites, the production of tropodithietic acid (TDA) has been well-characterised in

141 some Roseobacter strains [277-280, 362]. Interestingly, cylic-di-GMP has been shown to control the production of TDA in a Ruegeria mobilis strain [282] and this has expanded the role of cyclic-di-GMP other than regulating motility and biofilm formation. The present study has shown that cyclic-di-GMP is produced in strains that produce inhibitory compounds, including P. gallaeciensis 2.10, P. gallaeciensis BS107,

R. pomeroyi DSS-3, Ruegeria sp. TM1040 and R. nubinhibens ISM [254]. It remains to be explored whether cyclic-di-GMP controls the production of the inhibitory compounds in these strains. Such findings would be relevant in establishing whether cyclic-di-GMP has a central and universal role as well in the regulation of secondary metabolite production in marine roseobacters.

5.4. Future Perspectives and Directions: Biotechnological Prospects from Cyclic- di-GMP Signalling in Marine Bacteria

It widely accepted that cyclic-di-GMP is widespread in bacteria and that it may control biofilm formation and dispersal through the regulation of motility and extracellular polysaccharide production in many of those organisms [10, 26]. Within this context, the exploration and subsequent knowledge of cyclic-di-GMP signalling pathways in marine bacteria could lead to the development of various technological platforms for biofilm promotion or biofilm dispersal. These potential technologies are briefly discussed below.

5.4.1. Biofilm Promotion Technologies

Biofilm-promotion technologies may utilise diguanylate cyclase activity in certain marine bacterial strains to enhance the formation of biofilms and bioactive molecules.

142

For example, DGC activity could be enhanced in marine bacterial strains that produce bioactive molecules when associated with a surface or grown as a biofilm [269, 364-

366]. This has now been demonstrated in Ruegeria mobilis where heterologous expression a DGC enhanced biofilm formation and subsequently TDA biosynthesis

[282]. Such genetic approaches to modulate the antibiotic production may, however, be limited to the laboratory or biologically contained large-scale operations.

Marine bacteria are also an untapped source of novel extracellular polysaccharides

(EPS) [367-371]. Thus, enhancing EPS production through modulation of DGC activity via specific signals or cues may be of potential industrial interest. This would enable medium to large-scale production of desirable bacterial polysaccharides for various industrial and medical applications. DGC activity could also be modulated in marine bacterial strains that produce biofilms, which promote and enhance larval settlement

[372-375]. Such an approach may find relevant applications in the aquaculture industry.

5.4.2. Biofilm Dispersal Technologies

Biofilm dispersal technologies may utilise the cyclic-di-GMP specific phosphodiesterases (PDE). The work on nitric oxide (NO) conducted by Barraud and coworkers demonstrated that a low, non-lethal, dose of NO stimulates PDE activity, which led to reduced cyclic-di-GMP levels and subsequently mediated dispersal of P. aeruginosa biofilms and other relevant biofilm-forming bacteria [110, 170, 171]. While

NO-based technologies have found applications in biofouling control [376] and bacterial biofilms involved in infectious diseases [377], NO-induced biofilm dispersal is relatively less known in marine bacteria and therefore a promising area of future research.

143

5.5. Concluding Remarks

Research on cyclic-di-GMP in marine bacteria, in particular marine roseobacters has apparently lagged behind their terrestrial counterparts. This thesis has addressed this knowledge gap by exploring the cycli-di-GMP signalling mechanism in representative strains of the marine Roseobacter clade. The discovery that the representative strains produce cyclic-di-GMP under planktonic or attached conditions further confirmed the earlier predictions of the genomic capacity of these strains for this particular signalling pathway. The present study thus contributes to the limited knowledge of intracellular signalling mechanisms governed by nucleotide second messengers in marine roseobacters.

On a more general note, research on bacterial second messengers in bacteria is indeed expected to maintain a strong interest with the on-going research on novel cyclic- nucleotides, such as cyclic-di-AMP and cyclic-AMP-GMP [10, 378] and the recent discovery of novel functions for cyclic-di-GMP, including as a cell cycle oscillator driving chromosome replication in C. crescentus [379, 380], and more interestingly, as an extracellular signal mediating stalk formation in the social amoeba Dictyostelium discoideum [381]. These new discoveries are expanding the roles of cyclic dinucleotides beyond the regulation of motility and biofilm formation in bacteria.

Furthermore, the discovery of novel bacterial species and subsequent genome sequencing of these strains are expected to further reveal enzymes with novel domain structure and organisation that would be involved in cyclic nucleotide metabolism.

Also, novel methods and tools to detect and quantify intracellular concentration of these

144 cyclic nucleotides are expected to emerge. Finally, it is expected that research in this field will reveal the long sought after understanding of the complex interplay of molecular mechanisms regulating biofilm formation and dispersal in bacteria.

145

Literature Cited

1. Costerton, J.W., Z. Lewandowski, D.E. Caldwell, D.R. Korber, and H.M. Lappin- Scott, Microbial biofilms. Annual Reviews in Microbiology, 1995. 49(1): p. 711-745. 2. O'Toole, G., H.B. Kaplan, and R. Kolter, Biofilm formation as microbial development. Annual Reviews in Microbiology, 2000. 54(1): p. 49-79. 3. Davey, M.E. and G.A. O'toole, Microbial biofilms: from ecology to molecular genetics. Microbiology and Molecular Biology Reviews, 2000. 64(4): p. 847-867. 4. Stoodley, P., K. Sauer, D. Davies, and J.W. Costerton, Biofilms as complex differentiated communities. Annual Reviews in Microbiology, 2002. 56(1): p. 187-209. 5. Kjelleberg, S. and M. Givskov, The biofilm mode of life: mechanisms and adaptations. 2007: Horizon Scientific Press. 6. Pesavento, C. and R. Hengge, Bacterial nucleotide-based second messengers. Current Opinion in Microbiology, 2009. 12(2): p. 170-176. 7. Laub, M.T. and M. Goulian, Specificity in two-component signal transduction pathways. Annual Review of Genetics, 2007. 41: p. 121-145. 8. Camilli, A. and B.L. Bassler, Bacterial small-molecule signaling pathways. Science, 2006. 311(5764): p. 1113-6. 9. D'Argenio, D.A. and S.I. Miller, Cyclic di-GMP as a bacterial second messenger. Microbiology-Sgm, 2004. 150: p. 2497-2502. 10. Romling, U., M.Y. Galperin, and M. Gomelsky, Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger. Microbiology and Molecular Biology Reviews, 2013. 77(1): p. 1-52. 11. Ross, P., R. Mayer, and M. Benziman, Cellulose Biosynthesis and Function in Bacteria. Microbiological Reviews, 1991. 55(1): p. 35-58. 12. Seshasayee, A.S., G.M. Fraser, and N.M. Luscombe, Comparative genomics of cyclic-di-GMP signalling in bacteria: post-translational regulation and catalytic activity. Nucleic Acids Research, 2010. 38(18): p. 5970-81. 13. Galperin, M.Y., Diversity of structure and function of response regulator output domains. Current Opinion in Microbiology, 2010. 13(2): p. 150-159. 14. Lauro, F.M., D. McDougald, T. Thomas, T.J. Williams, S. Egan, S. Rice, M.Z. DeMaere, L. Ting, H. Ertan, J. Johnson, S. Ferriera, A. Lapidus, I. Anderson, N. Kyrpides, A.C. Munk, C. Detter, C.S. Han, M.V. Brown, F.T. Robb, S. Kjelleberg, and R. Cavicchioli, The genomic basis of trophic strategy in marine bacteria. Proceedings of the National Academy of Sciences of the United States of America, 2009. 106(37): p. 15527-15533. 15. Burke, C., P. Steinberg, D. Rusch, S. Kjelleberg, and T. Thomas, Bacterial community assembly based on functional genes rather than species. Proceedings of the National Academy of Sciences of the United States of America, 2011. 108(34): p. 14288-14293. 16. Galperin, M.Y., A.N. Nikolskaya, and E.V. Koonin, Novel domains of the prokaryotic two-component signal transduction systems. FEMS Microbiology Letters, 2001. 203(1): p. 11-21. 17. Galperin, M.Y., R. Higdon, and E. Kolker, Interplay of heritage and habitat in the distribution of bacterial signal transduction systems. Mol Biosyst, 2010. 6(4): p. 721-8. 18. Galperin, M.Y., A census of membrane-bound and intracellular signal transduction proteins in bacteria: bacterial IQ, extroverts and introverts. BMC Microbiology, 2005. 5: p. 35. 19. Galperin, M.Y., Bacterial signal transduction network in a genomic perspective. Environmental Microbiology, 2004. 6(6): p. 552-67. 20. Zhulin, I.B., A.N. Nikolskaya, and M.Y. Galperin, Common extracellular sensory domains in transmembrane receptors for diverse signal transduction pathways in Bacteria and Archaea. Journal of Bacteriology, 2003. 185(1): p. 285-294. 146

21. Ross, P., H. Weinhouse, Y. Aloni, D. Michaeli, P. Weinberger-Ohana, R. Mayer, S. Braun, E. de Vroom, G.A. van der Marel, J.H. van Boom, and M. Benziman, Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature, 1987. 325(6101): p. 279-81. 22. Jenal, U. and J. Malone, Mechanisms of cyclic-di-GMP signaling in bacteria. Annual Review of Genetics, 2006. 40: p. 385-407. 23. Römling, U., M. Gomelsky, and M.Y. Galperin, C‐di‐GMP: the dawning of a novel bacterial signalling system. Molecular Microbiology, 2005. 57(3): p. 629-639. 24. Schirmer, T. and U. Jenal, Structural and mechanistic determinants of c-di-GMP signalling. Nature Reviews Microbiology, 2009. 7(10): p. 724-735. 25. Hengge, R., Principles of c-di-GMP signalling in bacteria. Nature Reviews Microbiology, 2009. 7(4): p. 263-273. 26. McDougald, D., S.A. Rice, N. Barraud, P.D. Steinberg, and S. Kjelleberg, Should we stay or should we go: mechanisms and ecological consequences for biofilm dispersal. Nature Reviews Microbiology, 2012. 10(1): p. 39-50. 27. Boyd, C.D. and G.A. O'Toole, Second Messenger Regulation of Biofilm Formation: Breakthroughs in Understanding c-di-GMP Effector Systems. Annual Review of Cell and Developmental Biology, Vol 28, 2012. 28: p. 439-462. 28. Krasteva, P.V., K.M. Giglio, and H. Sondermann, Sensing the messenger: The diverse ways that bacteria signal through c-di-GMP. Protein Science, 2012. 21(7): p. 929-948. 29. Kalia, D., G. Merey, S. Nakayama, Y. Zheng, J. Zhou, Y. Luo, M. Guo, B.T. Roembke, and H.O. Sintim, Nucleotide, c-di-GMP, c-di-AMP, cGMP, cAMP,(p) ppGpp signaling in bacteria and implications in pathogenesis. Chemical Society Reviews, 2013. 42(1): p. 305-341. 30. Paul, R., S. Weiser, N.C. Amiot, C. Chan, T. Schirmer, B. Giese, and U. Jenal, Cell cycle-dependent dynamic localization of a bacterial response regulator with a novel diguanylate cyclase output domain. Genes & Development, 2004. 18(6): p. 715-727. 31. Hickman, J.W., D.F. Tifrea, and C.S. Harwood, A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(40): p. 14422-14427. 32. Ryjenkov, D.A., M. Tarutina, O.V. Moskvin, and M. Gomelsky, Cyclic diguanylate is a ubiquitous signaling molecule in bacteria: Insights into biochemistry of the GGDEF protein domain. Journal of Bacteriology, 2005. 187(5): p. 1792-1798. 33. Ausmees, N., R. Mayer, H. Weinhouse, G. Volman, D. Amikam, M. Benziman, and M. Lindberg, Genetic data indicate that proteins containing the GGDEF domain possess diguanylate cyclase activity. FEMS Microbiology Letters, 2001. 204(1): p. 163- 167. 34. Tischler, A.D. and A. Camilli, Cyclic diguanylate (c-di-GMP) regulates Vibrio cholerae biofilm formation. Molecular Microbiology, 2004. 53(3): p. 857-869. 35. Simm, R., M. Morr, A. Kader, M. Nimtz, and U. Romling, GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Molecular Microbiology, 2004. 53(4): p. 1123-1134. 36. Aldridge, P., R. Paul, P. Goymer, P. Rainey, and U. Jenal, Role of the GGDEF regulator PleD in polar development of Caulobacter crescentus. Molecular Microbiology, 2003. 47(6): p. 1695-1708. 37. Malone, J.G., R. Williams, M. Christen, U. Jenal, A.J. Spiers, and P.B. Rainey, The structure-function relationship of WspR, a Pseudomonas fluorescens response regulator with a GGDEF output domain. Microbiology-Sgm, 2007. 153: p. 980-994. 38. Christen, B., M. Christen, R. Paul, F. Schmid, M. Folcher, P. Jenoe, M. Meuwly, and U. Jenal, Allosteric control of cyclic di-GMP signaling. Journal of Biological Chemistry, 2006. 281(42): p. 32015-32024. 39. Amikam, D. and M.Y. Galperin, PilZ domain is part of the bacterial c-di-GMP binding protein. Bioinformatics, 2006. 22(1): p. 3-6. 147

40. Ferreira, R.B.R., L.C.M. Antunes, E.P. Greenberg, and L.L. McCarter, Vibrio parahaemolyticus ScrC modulates cyclic dimeric GMP regulation of gene expression relevant to growth on surfaces. Journal of Bacteriology, 2008. 190(3): p. 851-860. 41. Christen, M., B. Christen, M. Folcher, A. Schauerte, and U. Jenal, Identification and characterization of a cyclic di-GMP-specific phosphodiesterase and its allosteric control by GTP. Journal of Biological Chemistry, 2005. 280(35): p. 30829-30837. 42. Schmidt, A.J., D.A. Ryjenkov, and M. Gomelsky, The ubiquitous protein domain EAL is a cyclic diguanylate-specific phosphodiesterase: Enzymatically active and inactive EAL domains. Journal of Bacteriology, 2005. 187(14): p. 4774-4781. 43. Ryan, R.P., Y. Fouhy, J.F. Lucey, L.C. Crossman, S. Spiro, Y.W. He, L.H. Zhang, S. Heeb, M. Camara, P. Williams, and J.M. Dow, Cell-cell signaling in Xanthomonas campestris involves an HD-GYP domain protein that functions in cyclic di-GMP turnover. Proceedings of the National Academy of Sciences of the United States of America, 2006. 103(17): p. 6712-6717. 44. Tamayo, R., A.D. Tischler, and A. Camilli, The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase. Journal of Biological Chemistry, 2005. 280(39): p. 33324-33330. 45. Bobrov, A.G., O. Kirillina, and R.D. Perry, The phosphodiesterase activity of the HmsP EAL domain is required for negative regulation of biofilm formation in Yersinia pestis. FEMS Microbiology Letters, 2005. 247(2): p. 123-130. 46. Rao, F., Y. Yang, Y.N. Qi, and Z.X. Liang, Catalytic mechanism of cyclic Di-GMP- specific phosphodiesterase: a study of the EAL domain-containing RocR from Pseudomonas aeruginosa. Journal of Bacteriology, 2008. 190(10): p. 3622-3631. 47. Rao, F., Y.N. Qi, H.S. Chong, M. Kotaka, B. Li, J.M. Li, J. Lescar, K. Tang, and Z.X. Liang, The Functional Role of a Conserved Loop in EAL Domain-Based Cyclic di-GMP-Specific Phosphodiesterase. Journal of Bacteriology, 2009. 191(15): p. 4722- 4731. 48. Romling, U., Rationalizing the Evolution of EAL Domain-Based Cyclic di-GMP- Specific Phosphodiesterases. Journal of Bacteriology, 2009. 191(15): p. 4697-4700. 49. Galperin, M.Y., D.A. Natale, L. Aravind, and E.V. Koonin, A specialized version of the HD hydrolase domain implicated in signal transduction. Journal of Molecular Microbiology and Biotechnology, 1999. 1(2): p. 303-305. 50. Aravind, L. and E.V. Koonin, The HD domain defines a new superfamily of metal- dependent phosphohydrolases. Trends in Biochemical Sciences, 1998. 23(12): p. 469- 472. 51. Ryan, R.P., J. Lucey, K. O'Donovan, Y. McCarthy, L. Yang, T. Tolker-Nielsen, and J.M. Dow, HD-GYP domain proteins regulate biofilm formation and virulence in Pseudomonas aeruginosa. Environmental Microbiology, 2009. 11(5): p. 1126-1136. 52. Sultan, S.Z., J.E. Pitzer, T. Boquoi, G. Hobbs, M.R. Miller, and M.A. Motaleb, Analysis of the HD-GYP Domain Cyclic Dimeric GMP Phosphodiesterase Reveals a Role in Motility and the Enzootic Life Cycle of Borrelia burgdorferi. Infection and Immunity, 2011. 79(8): p. 3273-3283. 53. Lovering, A.L., M.J. Capeness, C. Lambert, L. Hobley, and R.E. Sockett, The Structure of an Unconventional HD-GYP Protein from Bdellovibrio Reveals the Roles of Conserved Residues in this Class of Cyclic-di-GMP Phosphodiesterases. MBio, 2011. 2(5). 54. Wigren, E., Z.X. Liang, and U. Romling, Finally! The structural secrets of a HD- GYP phosphodiesterase revealed. Molecular Microbiology, 2014. 91(1): p. 1-5. 55. Ryan, R.P., Y. McCarthy, P.A. Kiely, R. O'Connor, C.S. Farah, J.P. Armitage, and J.M. Dow, Dynamic complex formation between HD-GYP, GGDEF and PilZ domain proteins regulates motility in Xanthomonas campestris. Molecular Microbiology, 2012. 86(3): p. 557-567. 56. Alm, R.A., A.J. Bodero, P.D. Free, and J.S. Mattick, Identification of a novel gene, pilZ, essential for type 4 fimbrial biogenesis in Pseudomonas aeruginosa. Journal of Bacteriology, 1996. 178(1): p. 46-53. 148

57. Ryjenkov, D.A., R. Simm, U. Romling, and M. Gomelsky, The PilZ domain is a receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in enterobacteria. Journal of Biological Chemistry, 2006. 281(41): p. 30310-4. 58. Christen, M., B. Christen, M.G. Allan, M. Folcher, P. Jeno, S. Grzesiek, and U. Jenal, DgrA is a member of a new family of cyclic diguanosine monophosphate receptors and controls flagellar motor function in Caulobacter crescentus. Proceedings of the National Academy of Sciences of the United States of America, 2007. 104(10): p. 4112-7. 59. Pratt, J.T., R. Tamayo, A.D. Tischler, and A. Camilli, PilZ domain proteins bind cyclic diguanylate and regulate diverse processes in Vibrio cholerae. Journal of Biological Chemistry, 2007. 282(17): p. 12860-70. 60. Benach, J., S.S. Swaminathan, R. Tamayo, S.K. Handelman, E. Folta-Stogniew, J.E. Ramos, F. Forouhar, H. Neely, J. Seetharaman, A. Camilli, and J.F. Hunt, The structural basis of cyclic diguanylate signal transduction by PilZ domains. EMBO Journal, 2007. 26(24): p. 5153-5166. 61. Lee, V.T., J.M. Matewish, J.L. Kessler, M. Hyodo, Y. Hayakawa, and S. Lory, A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Molecular Microbiology, 2007. 65(6): p. 1474-1484. 62. Whitney, J.C., K.M. Colvin, L.S. Marmont, H. Robinson, M.R. Parsek, and P.L. Howell, Structure of the Cytoplasmic Region of PelD, a Degenerate Diguanylate Cyclase Receptor That Regulates Exopolysaccharide Production in Pseudomonas aeruginosa. Journal of Biological Chemistry, 2012. 287(28): p. 23582-23593. 63. Hobley, L., R.K. Fung, C. Lambert, M.A. Harris, J.M. Dabhi, S.S. King, S.M. Basford, K. Uchida, R. Till, R. Ahmad, S. Aizawa, M. Gomelsky, and R.E. Sockett, Discrete cyclic di-GMP-dependent control of bacterial predation versus axenic growth in Bdellovibrio bacteriovorus. PLoS Pathogens, 2012. 8(2): p. e1002493. 64. Duerig, A., S. Abel, M. Folcher, M. Nicollier, T. Schwede, N. Amiot, B. Giese, and U. Jenal, Second messenger-mediated spatiotemporal control of protein degradation regulates bacterial cell cycle progression. Genes & Development, 2009. 23(1): p. 93- 104. 65. Kazmierczak, B.I., M.B. Lebron, and T.S. Murray, Analysis of FimX, a phosphodiesterase that governs twitching motility in Pseudomonas aeruginosa. Molecular Microbiology, 2006. 60(4): p. 1026-1043. 66. Navarro, M.V.A.S., N. De, N. Bae, Q. Wang, and H. Sondermann, Structural Analysis of the GGDEF-EAL Domain-Containing c-di-GMP Receptor FimX. Structure, 2009. 17(8): p. 1104-1116. 67. Qi, Y.N., M.L.C. Chuah, X.M. Dong, K.L. Xie, Z. Luo, K. Tang, and Z.X. Liang, Binding of Cyclic Diguanylate in the Non-catalytic EAL Domain of FimX Induces a Long-range Conformational Change. Journal of Biological Chemistry, 2011. 286(4): p. 2910-2917. 68. Newell, P.D., S. Yoshioka, K.L. Hvorecny, R.D. Monds, and G.A. O'Toole, Systematic Analysis of Diguanylate Cyclases That Promote Biofilm Formation by Pseudomonas fluorescens Pf0-1. Journal of Bacteriology, 2011. 193(18): p. 4685-4698. 69. Newell, P.D., R.D. Monds, and G.A. O'Toole, LapD is a bis-(3 ',5 ')-cyclic dimeric GMP-binding protein that regulates surface attachment by Pseudomonas fluorescens Pf0-1. Proceedings of the National Academy of Sciences of the United States of America, 2009. 106(9): p. 3461-3466. 70. Hickman, J.W. and C.S. Harwood, Identification of FleQ from Pseudomonas aeruginosa as ac‐di‐GMP‐responsive transcription factor. Molecular Microbiology, 2008. 69(2): p. 376-389. 71. Krasteva, P.V., J.C. Fong, N.J. Shikuma, S. Beyhan, M.V. Navarro, F.H. Yildiz, and H. Sondermann, Vibrio cholerae VpsT regulates matrix production and motility by directly sensing cyclic di-GMP. Science, 2010. 327(5967): p. 866-8. 72. Chin, K.H., Y.C. Lee, Z.L. Tu, C.H. Chen, Y.H. Tseng, J.M. Yang, R.P. Ryan, Y. McCarthy, J.M. Dow, A.H.J. Wang, and S.H. Chou, The cAMP Receptor-Like 149

Protein CLP Is a Novel c-di-GMP Receptor Linking Cell-Cell Signaling to Virulence Gene Expression in Xanthomonas campestris. Journal of Molecular Biology, 2010. 396(3): p. 646-662. 73. Tao, F., Y.W. He, D.H. Wu, S. Swarup, and L.H. Zhang, The Cyclic Nucleotide Monophosphate Domain of Xanthomonas campestris Global Regulator Clp Defines a New Class of Cyclic Di-GMP Effectors. Journal of Bacteriology, 2010. 192(4): p. 1020- 1029. 74. Fazli, M., A. O'Connell, M. Nilsson, K. Niehaus, J.M. Dow, M. Givskov, R.P. Ryan, and T. Tolker‐Nielsen, The CRP/FNR family protein Bcam1349 is ac‐di‐GMP effector that regulates biofilm formation in the respiratory pathogen Burkholderia cenocepacia. Molecular Microbiology, 2011. 82(2): p. 327-341. 75. Casper-Lindley, C. and F.H. Yildiz, VpsT is a transcriptional regulator required for expression of vps biosynthesis genes and the development of rugose colonial morphology in Vibrio cholerae O1 El Tor. Journal of Bacteriology, 2004. 186(5): p. 1574-1578. 76. Breaker, R.R., Riboswitches and the RNA world. Cold Spring Harbor Perspectives in Biology, 2012. 4(2): p. a003566. 77. Sudarsan, N., E.R. Lee, Z. Weinberg, R.H. Moy, J.N. Kim, K.H. Link, and R.R. Breaker, Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science, 2008. 321(5887): p. 411-413. 78. Lee, E.R., J.L. Baker, Z. Weinberg, N. Sudarsan, and R.R. Breaker, An Allosteric Self-Splicing Ribozyme Triggered by a Bacterial Second Messenger. Science, 2010. 329(5993): p. 845-848. 79. Smith, K.D., S.V. Lipchock, T.D. Ames, J. Wang, R.R. Breaker, and S.A. Strobel, Structural basis of ligand binding by a c-di-GMP riboswitch. Nature Structural & Molecular Biology, 2009. 16(12): p. 1218-1223. 80. Fang, X., I. Ahmad, A. Blanka, M. Schottkowski, A. Cimdins, M.Y. Galperin, U. Romling, and M. Gomelsky, GIL, a new c-di-GMP-binding protein domain involved in regulation of cellulose synthesis in enterobacteria. Molecular Microbiology, 2014. 93(3): p. 439-52. 81. Galperin, M.Y., Structural classification of bacterial response regulators: Diversity of output domains and domain combinations. Journal of Bacteriology, 2006. 188(12): p. 4169-4182. 82. Nikolskaya, A.N., A.Y. Mulkidjanian, I.B. Beech, and M.Y. Galperin, MASE1 and MASE2: Two novel integral membrane sensory domains. Journal of Molecular Microbiology and Biotechnology, 2003. 5(1): p. 11-16. 83. Ponting, C.P. and L. Aravind, PAS: a multifunctional domain family comes to light. Current Biology, 1997. 7(11): p. R674-R677. 84. Martinez, S.E., J.A. Beavo, and W.G. Hol, GAF domains: two-billion-year-old molecular switches that bind cyclic nucleotides. Mol Interv, 2002. 2(5): p. 317-23. 85. Henry, J.T. and S. Crosson, Ligand-Binding PAS Domains in a Genomic, Cellular, and Structural Context. Annual Review of Microbiology, Vol 65, 2011. 65: p. 261-286. 86. Su, Y.-s. and J.C. Lagarias, Light-independent phytochrome signaling mediated by dominant GAF domain tyrosine mutants of Arabidopsis phytochromes in transgenic plants. The Plant Cell Online, 2007. 19(7): p. 2124-2139. 87. Galperin, M.Y., T.A. Gaidenko, A.Y. Mulkidjanian, M. Nakano, and C.W. Price, MHYT, a new integral membrane sensor domain. FEMS Microbiology Letters, 2001. 205(1): p. 17-23. 88. Pao, G.M. and M.H. Saier, Jr., Response regulators of bacterial signal transduction systems: selective domain shuffling during evolution. Journal of Molecular Evolution, 1995. 40(2): p. 136-54. 89. Stock, A.M., V.L. Robinson, and P.N. Goudreau, Two-component signal transduction. Annual Review of Biochemistry, 2000. 69(1): p. 183-215. 90. Letunic, I., T. Doerks, and P. Bork, SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Research, 2012. 40(Database issue): p. D302-5. 150

91. Letunic, I., L. Goodstadt, N.J. Dickens, T. Doerks, J. Schultz, R. Mott, F. Ciccarelli, R.R. Copley, C.P. Ponting, and P. Bork, Recent improvements to the SMART domain-based sequence annotation resource. Nucleic Acids Research, 2002. 30(1): p. 242-4. 92. Ponting, C.P., J. Schultz, F. Milpetz, and P. Bork, SMART: identification and annotation of domains from signalling and extracellular protein sequences. Nucleic Acids Research, 1999. 27(1): p. 229-32. 93. Finn, R.D., A. Bateman, J. Clements, P. Coggill, R.Y. Eberhardt, S.R. Eddy, A. Heger, K. Hetherington, L. Holm, and J. Mistry, Pfam: the protein families database. Nucleic Acids Research, 2013: p. gkt1223. 94. An, S.W., J.E. Wu, and L.H. Zhang, Modulation of Pseudomonas aeruginosa Biofilm Dispersal by a Cyclic-Di-GMP Phosphodiesterase with a Putative Hypoxia-Sensing Domain. Applied and Environmental Microbiology, 2010. 76(24): p. 8160-8173. 95. He, Y.W., C. Boon, L. Zhou, and L.H. Zhang, Co-regulation of Xanthomonas campestris virulence by quorum sensing and a novel two-component regulatory system RavS/RavR. Molecular Microbiology, 2009. 71(6): p. 1464-1476. 96. Li, Y., S. Heine, M. Entian, K. Sauer, and N. Frankenberg-Dinkel, NO-induced biofilm dispersion in Pseudomonas aeruginosa is mediated by an MHYT domain- coupled phosphodiesterase. Journal of Bacteriology, 2013. 195(16): p. 3531-42. 97. Wang, Y., I.D. Hay, Z.U. Rehman, and B.H. Rehm, Membrane-anchored MucR mediates nitrate-dependent regulation of alginate production in Pseudomonas aeruginosa. Applied Microbiology and Biotechnology, 2015: p. 1-13. 98. Voegel, T.M., H. Doddapaneni, D.W. Cheng, H. Lin, D.C. Stenger, B.C. Kirkpatrick, and M.C. Roper, Identification of a response regulator involved in surface attachment, cell–cell aggregation, exopolysaccharide production and virulence in the plant pathogen Xylella fastidiosa. Molecular Plant Pathology, 2013. 14(3): p. 256-264. 99. Beyhan, S., A.D. Tischler, A. Camilli, and F.H. Yildiz, Transcriptome and phenotypic responses of Vibrio cholerae to increased cyclic di-GMP level. Journal of Bacteriology, 2006. 188(10): p. 3600-3613. 100. Monds, R.D., P.D. Newell, R.H. Gross, and G.A. O'Toole, Phosphate-dependent modulation of c-di-GMP levels regulates Pseudomonas fluorescens Pf0-1 biofilm formation by controlling secretion of the adhesin LapA. Molecular Microbiology, 2007. 63(3): p. 656-679. 101. Kuchma, S.L., K.M. Brothers, J.H. Merritt, N.T. Liberati, F.M. Ausubel, and G.A. O'Toole, BifA, a cyclic-di-GMP phosphodiesterase, inversely regulates biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. Journal of Bacteriology, 2007. 189(22): p. 8165-8178. 102. Tamayo, R., S. Schild, J.T. Pratt, and A. Camilli, Role of cyclic Di-GMP during el tor biotype Vibrio cholerae infection: characterization of the in vivo-induced cyclic Di- GMP phosphodiesterase CdpA. Infection and Immunity, 2008. 76(4): p. 1617-27. 103. Merritt, J.H., D.G. Ha, K.N. Cowles, W. Lu, D.K. Morales, J. Rabinowitz, Z. Gitai, and G.A. O'Toole, Specific control of Pseudomonas aeruginosa surface-associated behaviors by two c-di-GMP diguanylate cyclases. MBio, 2010. 1(4). 104. Tal, R., H.C. Wong, R. Calhoon, D. Gelfand, A.L. Fear, G. Volman, R. Mayer, P. Ross, D. Amikam, H. Weinhouse, A. Cohen, S. Sapir, P. Ohana, and M. Benziman, Three cdg operons control cellular turnover of cyclic di-GMP in Acetobacter xylinum: Genetic organization and occurrence of conserved domains in isoenzymes. Journal of Bacteriology, 1998. 180(17): p. 4416-4425. 105. Simm, R., J.D. Fetherston, A. Kader, U. Romling, and R.D. Perry, Phenotypic convergence mediated by GGDEF-domain-containing proteins. Journal of Bacteriology, 2005. 187(19): p. 6816-6823. 106. Rao, F., Y. Yang, Y. Qi, and Z.X. Liang, Catalytic mechanism of cyclic di-GMP- specific phosphodiesterase: a study of the EAL domain-containing RocR from Pseudomonas aeruginosa. Journal of Bacteriology, 2008. 190(10): p. 3622-31. 151

107. Solano, C., B. Garcia, C. Latasa, A. Toledo-Arana, V. Zorraquino, J. Valle, J. Casals, E. Pedroso, and I. Lasa, Genetic reductionist approach for dissecting individual roles of GGDEF proteins within the c-di-GMP signaling network in Salmonella. Proceedings of the National Academy of Sciences of the United States of America, 2009. 106(19): p. 7997-8002. 108. Simm, R., A. Lusch, A. Kader, M. Andersson, and U. Romling, Role of EAL- containing proteins in multicellular behavior of Salmonella enterica serovar typhimurium. Journal of Bacteriology, 2007. 189(9): p. 3613-3623. 109. Meissner, A., V. Wild, R. Simm, M. Rohde, C. Erck, F. Bredenbruch, M. Morr, U. Romling, and S. Haussler, Pseudomonas aeruginosa cupA-encoded fimbriae expression is regulated by a GGDEF and EAL domain-dependent modulation of the intracellular level of cyclic diguanylate. Environmental Microbiology, 2007. 9(10): p. 2475-2485. 110. Barraud, N., D. Schleheck, J. Klebensberger, J.S. Webb, D.J. Hassett, S.A. Rice, and S. Kjelleberg, Nitric Oxide Signaling in Pseudomonas aeruginosa Biofilms Mediates Phosphodiesterase Activity, Decreased Cyclic Di-GMP Levels, and Enhanced Dispersal. Journal of Bacteriology, 2009. 191(23): p. 7333-7342. 111. Spangler, C., A. Bohm, U. Jenal, R. Seifert, and V. Kaever, A liquid chromatography-coupled tandem mass spectrometry method for quantitation of cyclic di-guanosine monophosphate. Journal of Microbiological Methods, 2010. 81(3): p. 226- 231. 112. Moscoso, J.A., H. Mikkelsen, S. Heeb, P. Williams, and A. Filloux, The Pseudomonas aeruginosa sensor RetS switches Type III and Type VI secretion via c-di- GMP signalling. Environmental Microbiology, 2011. 13(12): p. 3128-3138. 113. Jain, R., A.J. Behrens, V. Kaever, and B.I. Kazmierczak, Type IV Pilus Assembly in Pseudomonas aeruginosa over a Broad Range of Cyclic di-GMP Concentrations. Journal of Bacteriology, 2012. 194(16): p. 4285-4294. 114. Edmunds, A.C., L.F. Castiblanco, G.W. Sundin, and C.M. Waters, Cyclic Di-GMP Modulates the Disease Progression of Erwinia amylovora. Journal of Bacteriology, 2013. 195(10): p. 2155-2165. 115. Koestler, B.J. and C.M. Waters, Bile Acids and Bicarbonate Inversely Regulate Intracellular Cyclic di-GMP in Vibrio cholerae. Infection and Immunity, 2014. 82(7): p. 3002-3014. 116. Simm, R., M. Morr, U. Remminghorst, M. Andersson, and U. Romling, Quantitative determination of cyclic diguanosine monophosphate concentrations in nucleotide extracts of bacteria by matrix-assisted laser desorption/ionization-time-of- flight mass spectrometry. Analytical Biochemistry, 2009. 386(1): p. 53-8. 117. Chua, S.L., Y. Liu, J.K. Yam, Y. Chen, R.M. Vejborg, B.G. Tan, S. Kjelleberg, T. Tolker-Nielsen, M. Givskov, and L. Yang, Dispersed cells represent a distinct stage in the transition from bacterial biofilm to planktonic lifestyles. Nat Commun, 2014. 5: p. 4462. 118. Christen, M., H.D. Kulasekara, B. Christen, B.R. Kulasekara, L.R. Hoffman, and S.I. Miller, Asymmetrical distribution of the second messenger c-di-GMP upon bacterial cell division. Science, 2010. 328(5983): p. 1295-1297. 119. Ho, C.L., S.L. Koh, M.L.C. Chuah, Z. Luo, W.J. Tan, D.K.S. Low, and Z.X. Liang, Rational Design of Fluorescent Biosensor for Cyclic di-GMP. ChemBioChem, 2011. 12(18): p. 2753-2758. 120. Rybtke, M.T., B.R. Borlee, K. Murakami, Y. Irie, M. Hentzer, T.E. Nielsen, M. Givskov, M.R. Parsek, and T. Tolker-Nielsen, Fluorescence-Based Reporter for Gauging Cyclic Di-GMP Levels in Pseudomonas aeruginosa. Applied and Environmental Microbiology, 2012. 78(15): p. 5060-5069. 121. Nakayama, S., I. Kelsey, J.X. Wang, K. Roelofs, B. Stefane, Y.L. Luo, V.T. Lee, and H.O. Sintim, Thiazole Orange-Induced c-di-GMP Quadruplex Formation Facilitates a Simple Fluorescent Detection of This Ubiquitous Biofilm Regulating Molecule. Journal of the American Chemical Society, 2011. 133(13): p. 4856-4864. 152

122. Gu, H., K. Furukawa, and R.R. Breaker, Engineered allosteric ribozymes that sense the bacterial second messenger cyclic diguanosyl 5′-monophosphate. Analytical Chemistry, 2012. 84(11): p. 4935-4941. 123. Nakayama, S., Y. Luo, J. Zhou, T.K. Dayie, and H.O. Sintim, Nanomolar fluorescent detection of c-di-GMP using a modular aptamer strategy. Chemical Communications (Cambridge, England), 2012. 48(72): p. 9059-61. 124. Springer, M.S., E.N. Kort, S.H. Larsen, G.W. Ordal, R.W. Reader, and J. Adler, Role of methionine in bacterial chemotaxis: requirement for tumbling and involvement in information processing. Proceedings of the National Academy of Sciences of the United States of America, 1975. 72(11): p. 4640-4. 125. Wadhams, G.H. and J.P. Armitage, Making sense of it all: bacterial chemotaxis. Nature Reviews: Molecular Cell Biology, 2004. 5(12): p. 1024-37. 126. Baker, M.D., P.M. Wolanin, and J.B. Stock, Signal transduction in bacterial chemotaxis. Bioessays, 2006. 28(1): p. 9-22. 127. Broek, A.V. and J. Vanderleyden, The role of bacterial motility, chemotaxis, and attachment in bacteria-plant interactions. Molecular Plant-Microbe Interactions, 1995. 8: p. 800-810. 128. Merritt, P.M., T. Danhorn, and C. Fuqua, Motility and chemotaxis in Agrobacterium tumefaciens surface attachment and biofilm formation. Journal of Bacteriology, 2007. 189(22): p. 8005-8014. 129. de Weert, S., H. Vermeiren, I.H. Mulders, I. Kuiper, N. Hendrickx, G.V. Bloemberg, J. Vanderleyden, R. De Mot, and B.J. Lugtenberg, Flagella-driven chemotaxis towards exudate components is an important trait for tomato root colonization by Pseudomonas fluorescens. Molecular Plant-Microbe Interactions, 2002. 15(11): p. 1173-1180. 130. Yaryura, P.M., M. Leon, O.S. Correa, N.L. Kerber, N.L. Pucheu, and A.F. Garcia, Assessment of the role of chemotaxis and biofilm formation as requirements for colonization of roots and seeds of soybean plants by Bacillus amyloliquefaciens BNM339. Current Microbiology, 2008. 56(6): p. 625-32. 131. Armitage, J.P., Bacterial tactic responses. Advances in Microbial Physiology, 1999. 41: p. 229-289. 132. Bren, A. and M. Eisenbach, How signals are heard during bacterial chemotaxis: protein-protein interactions in sensory signal propagation. Journal of Bacteriology, 2000. 182(24): p. 6865-73. 133. Greer-Phillips, S.E., B.B. Stephens, and G. Alexandre, An energy taxis transducer promotes root colonization by Azospirillum brasilense. Journal of Bacteriology, 2004. 186(19): p. 6595-6604. 134. Russell, M.H., A.N. Bible, X. Fang, J.R. Gooding, S.R. Campagna, M. Gomelsky, and G. Alexandre, Integration of the second messenger c-di-GMP into the chemotactic signaling pathway. MBio, 2013. 4(2): p. e00001-13. 135. Motaleb, M., M.R. Miller, C. Li, R.G. Bakker, S.F. Goldstein, R.E. Silversmith, R.B. Bourret, and N.W. Charon, CheX is a phosphorylated CheY phosphatase essential for Borrelia burgdorferi chemotaxis. Journal of Bacteriology, 2005. 187(23): p. 7963-7969. 136. Harshey, R.M., Bees aren't the only ones: swarming in Gram‐negative bacteria. Molecular Microbiology, 1994. 13(3): p. 389-394. 137. Merritt, J.H., K.M. Brothers, S.L. Kuchma, and G.A. O'Toole, SadC reciprocally influences biofilm formation and swarming motility via modulation of exopolysaccharide production and flagellar function. Journal of Bacteriology, 2007. 189(22): p. 8154-8164. 138. Caiazza, N.C., J.H. Merritt, K.M. Brothers, and G.A. O'Toole, Inverse regulation of biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. Journal of Bacteriology, 2007. 189(9): p. 3603-3612.

153

139. Caiazza, N.C. and G.A. O'Toole, SadB is required for the transition from reversible to irreversible attachment during biofilm formation by Pseudomonas aeruginosa PA14. Journal of Bacteriology, 2004. 186(14): p. 4476-4485. 140. Kim, Y.K. and L.L. McCarter, ScrG, a GGDEF-EAL protein, participates in regulating swarming and sticking in Vibrio parahaemolyticus. Journal of Bacteriology, 2007. 189(11): p. 4094-4107. 141. Guvener, Z.T. and L.L. McCarter, Multiple regulators control capsular polysaccharide production in Vibrio parahaemolyticus. Journal of Bacteriology, 2003. 185(18): p. 5431-41. 142. Huang, B.X., C.B. Whitchurch, and J.S. Mattick, FimX, a multidomain protein connecting environmental signals to twitching motility in Pseudomonas aeruginosa. Journal of Bacteriology, 2003. 185(24): p. 7068-7076. 143. Lambert, C., A.K. Fenton, L. Hobley, and R.E. Sockett, Predatory Bdellovibrio bacteria use gliding motility to scout for prey on surfaces. Journal of Bacteriology, 2011. 193(12): p. 3139-3141. 144. Flemming, H.-C., T.R. Neu, and D.J. Wozniak, The EPS matrix: the “house of biofilm cells”. Journal of Bacteriology, 2007. 189(22): p. 7945-7947. 145. Flemming, H.-C. and J. Wingender, The biofilm matrix. Nature Reviews Microbiology, 2010. 8(9): p. 623-633. 146. Römling, U., Molecular biology of cellulose production in bacteria. Research in Microbiology, 2002. 153(4): p. 205-212. 147. Römling, U. and M.Y. Galperin, Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions. Trends in Microbiology, 2015. 148. Yildiz, F.H. and G.K. Schoolnik, Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation. Proceedings of the National Academy of Sciences, 1999. 96(7): p. 4028-4033. 149. Fong, J.C., K.A. Syed, K.E. Klose, and F.H. Yildiz, Role of Vibrio polysaccharide (vps) genes in VPS production, biofilm formation and Vibrio cholerae pathogenesis. Microbiology, 2010. 156(9): p. 2757-2769. 150. Danese, P.N., L.A. Pratt, and R. Kolter, Exopolysaccharide production is required for development of Escherichia coli K-12 biofilm architecture. Journal of Bacteriology, 2000. 182(12): p. 3593-3596. 151. Ryder, C., M. Byrd, and D.J. Wozniak, Role of polysaccharides in Pseudomonas aeruginosa biofilm development. Current Opinion in Microbiology, 2007. 10(6): p. 644- 648. 152. Colvin, K.M., V.D. Gordon, K. Murakami, B.R. Borlee, D.J. Wozniak, G.C.L. Wong, and M.R. Parsek, The Pel Polysaccharide Can Serve a Structural and Protective Role in the Biofilm Matrix of Pseudomonas aeruginosa. PLoS Pathogens, 2011. 7(1). 153. Colvin, K.M., Y. Irie, C.S. Tart, R. Urbano, J.C. Whitney, C. Ryder, P.L. Howell, D.J. Wozniak, and M.R. Parsek, The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environmental Microbiology, 2012. 14(8): p. 1913-1928. 154. Chew, S.C., B. Kundukad, T. Seviour, J.R. Van der Maarel, L. Yang, S.A. Rice, P. Doyle, and S. Kjelleberg, Dynamic remodeling of microbial biofilms by functionally distinct exopolysaccharides. MBio, 2014. 5(4): p. e01536-14. 155. Ross, P., R. Mayer, H. Weinhouse, D. Amikam, Y. Huggirat, M. Benziman, E. de Vroom, A. Fidder, P. de Paus, L.A. Sliedregt, and et al., The cyclic diguanylic acid regulatory system of cellulose synthesis in Acetobacter xylinum. Chemical synthesis and biological activity of cyclic nucleotide dimer, trimer, and phosphothioate derivatives. Journal of Biological Chemistry, 1990. 265(31): p. 18933-43. 156. Chang, A.L., J.R. Tuckerman, G. Gonzalez, R. Mayer, H. Weinhouse, G. Volman, D. Amikam, M. Benziman, and M.-A. Gilles-Gonzalez, Phosphodiesterase A1, a

154

regulator of cellulose synthesis in Acetobacter xylinum, is a heme-based sensor. Biochemistry, 2001. 40(12): p. 3420-3426. 157. Qi, Y., F. Rao, Z. Luo, and Z.X. Liang, A flavin cofactor-binding PAS domain regulates c-di-GMP synthesis in AxDGC2 from Acetobacter xylinum. Biochemistry, 2009. 48(43): p. 10275-85. 158. Romling, U., Characterization of the rdar morphotype, a multicellular behaviour in Enterobacteriaceae. Cellular and Molecular Life Sciences, 2005. 62(11): p. 1234-1246. 159. Kader, A., R. Simm, U. Gerstel, M. Morr, and U. Romling, Hierarchical involvement of various GGDEF domain proteins in rdar morphotype development of Salmonella enterica serovar Typhimurium. Molecular Microbiology, 2006. 60(3): p. 602-616. 160. Zakikhany, K., C.R. Harrington, M. Nimtz, J.C.D. Hinton, and U. Romling, Unphosphorylated CsgD controls biofilm formation in Salmonella enterica serovar Typhimurium. Molecular Microbiology, 2010. 77(3): p. 771-786. 161. Grantcharova, N., V. Peters, C. Monteiro, K. Zakikhany, and U. Römling, Bistable expression of CsgD in biofilm development of Salmonella enterica serovar typhimurium. Journal of Bacteriology, 2010. 192(2): p. 456-466. 162. Beyhan, S., L.S. Odell, and F.H. Yildiz, Identification and Characterization of Cyclic Diguanylate Signaling Systems Controlling Rugosity in Vibrio cholerae. Journal of Bacteriology, 2008. 190(22): p. 7392-7405. 163. Beyhan, S. and F.H. Yildiz, Smooth to rugose phase variation in Vibrio cholerae can be mediated by a single nucleotide change that targets c-di-GMP signalling pathway. Molecular Microbiology, 2007. 63(4): p. 995-1007. 164. Shikuma, N.J., J.C. Fong, and F.H. Yildiz, Cellular levels and binding of c-di-GMP control subcellular localization and activity of the Vibrio cholerae transcriptional regulator VpsT. PLoS Pathogens, 2012. 8(5): p. e1002719. 165. Merighi, M., V.T. Lee, M. Hyodo, Y. Hayakawa, and S. Lory, The second messenger bis-(3'-5')-cyclic-GMP and its PilZ domain-containing receptor Alg44 are required for alginate biosynthesis in Pseudomonas aeruginosa. Molecular Microbiology, 2007. 65(4): p. 876-95. 166. Oglesby, L.L., S. Jain, and D.E. Ohman, Membrane topology and roles of Pseudomonas aeruginosa Alg8 and Alg44 in alginate polymerization. Microbiology, 2008. 154(Pt 6): p. 1605-15. 167. Karatan, E. and P. Watnick, Signals, Regulatory Networks, and Materials That Build and Break Bacterial Biofilms. Microbiology and Molecular Biology Reviews, 2009. 73(2): p. 310-+. 168. Gjermansen, M., P. Ragas, and T. Tolker-Nielsen, Proteins with GGDEF and EAL domains regulate Pseudomonas putida biofilm formation and dispersal. FEMS Microbiology Letters, 2006. 265(2): p. 215-224. 169. Gjermansen, M., M. Nilsson, L. Yang, and T. Tolker‐Nielsen, Characterization of starvation‐induced dispersion in Pseudomonas putida biofilms: genetic elements and molecular mechanisms. Molecular Microbiology, 2010. 75(4): p. 815-826. 170. Barraud, N., M.V. Storey, Z.P. Moore, J.S. Webb, S.A. Rice, and S. Kjelleberg, Nitric oxide-mediated dispersal in single- and multi-species biofilms of clinically and industrially relevant microorganisms. Microbial Biotechnology, 2009. 2(3): p. 370-378. 171. Barraud, N., D.J. Hassett, S.H. Hwang, S.A. Rice, S. Kjelleberg, and J.S. Webb, Involvement of nitric oxide in biofilm dispersal of Pseudomonas aeruginosa. Journal of Bacteriology, 2006. 188(21): p. 7344-7353. 172. Morgan, R., S. Kohn, S.H. Hwang, D.J. Hassett, and K. Sauer, BdlA, a chemotaxis regulator essential for biofilm dispersion in Pseudomonas aeruginosa. Journal of Bacteriology, 2006. 188(21): p. 7335-43. 173. Li, Y., O.E. Petrova, S. Su, G.W. Lau, W. Panmanee, R. Na, D.J. Hassett, D.G. Davies, and K. Sauer, BdlA, DipA and induced dispersion contribute to acute

155

virulence and chronic persistence of Pseudomonas aeruginosa. PLoS Pathogens, 2014. 10(6): p. e1004168. 174. Roy, A.B., O.E. Petrova, and K. Sauer, The Phosphodiesterase DipA (PA5017) Is Essential for Pseudomonas aeruginosa Biofilm Dispersion. Journal of Bacteriology, 2012. 194(11): p. 2904-2915. 175. Petrova, O.E. and K. Sauer, PAS Domain Residues and Prosthetic Group Involved in BdlA-Dependent Dispersion Response by Pseudomonas aeruginosa Biofilms. Journal of Bacteriology, 2012. 194(21): p. 5817-5828. 176. Petrova, O.E. and K. Sauer, Dispersion by Pseudomonas aeruginosa requires an unusual posttranslational modification of BdlA. Proceedings of the National Academy of Sciences, 2012. 109(41): p. 16690-16695. 177. Basu Roy, A. and K. Sauer, Diguanylate cyclase NicD‐based signalling mechanism of nutrient‐induced dispersion by Pseudomonas aeruginosa. Molecular Microbiology, 2014. 94(4): p. 771-793. 178. Petrova, O.E., K.E. Cherny, and K. Sauer, The diguanylate cyclase GcbA facilitates Pseudomonas aeruginosa biofilm dispersion by activating BdlA. Journal of Bacteriology, 2015. 197(1): p. 174-87. 179. Carlson, H.K., R.E. Vance, and M.A. Marletta, H-NOX regulation of c-di-GMP metabolism and biofilm formation in Legionella pneumophila. Molecular Microbiology, 2010. 77(4): p. 930-942. 180. Liu, N., Y. Xu, S. Hossain, N. Huang, D. Coursolle, J.A. Gralnick, and E.M. Boon, Nitric oxide regulation of cyclic di-GMP synthesis and hydrolysis in Shewanella woodyi. Biochemistry, 2012. 51(10): p. 2087-99. 181. Boles, B.R., M. Thoendel, and P.K. Singh, Rhamnolipids mediate detachment of Pseudomonas aeruginosa from biofilms. Molecular Microbiology, 2005. 57(5): p. 1210- 1223. 182. Rice, S.A., K.S. Koh, S.Y. Queck, M. Labbate, K.W. Lam, and S. Kjelleberg, Biofilm formation and sloughing in Serratia marcescens are controlled by quorum sensing and nutrient cues. Journal of Bacteriology, 2005. 187(10): p. 3477-3485. 183. Boles, B.R. and A.R. Horswill, Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathogens, 2008. 4(4): p. e1000052. 184. Hammer, B.K. and B.L. Bassler, Quorum sensing controls biofilm formation in Vibrio cholerae. Molecular Microbiology, 2003. 50(1): p. 101-104. 185. Crossman, L. and J.M. Dow, Biofilm formation and dispersal in Xanthomonas campestris. Microbes Infect, 2004. 6(6): p. 623-9. 186. Ueda, A. and T.K. Wood, Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathogens, 2009. 5(6): p. e1000483. 187. Waters, C.A., W.Y. Lu, J.D. Rabinowitz, and B.L. Bassler, Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic Di-GMT levels and repression of vpsT. Journal of Bacteriology, 2008. 190(7): p. 2527-2536. 188. Dow, J.M., L. Crossman, K. Findlay, Y.-Q. He, J.-X. Feng, and J.-L. Tang, Biofilm dispersal in Xanthomonas campestris is controlled by cell–cell signaling and is required for full virulence to plants. Proceedings of the National Academy of Sciences, 2003. 100(19): p. 10995-11000. 189. Ryan, R.P. and J.M. Dow, Cell-cell signal dependent dynamic interactions between HD-GYP and GGDEF domain proteins mediate virulence in Xanthomonas campestris. Virulence, 2010. 1(5): p. 404-408. 190. Davies, D.G. and C.N.H. Marques, A Fatty Acid Messenger Is Responsible for Inducing Dispersion in Microbial Biofilms. Journal of Bacteriology, 2009. 191(5): p. 1393-1403. 191. Barber, C., J. Tang, J. Feng, M. Pan, T. Wilson, H. Slater, J. Dow, P. Williams, and M. Daniels, A novel regulatory system required for pathogenicity of Xanthomonas

156

campestris is mediated by a small diffusible signal molecule. Molecular Microbiology, 1997. 24(3): p. 555-566. 192. Slater, H., A. Alvarez-Morales, C.E. Barber, M.J. Daniels, and J.M. Dow, A two- component system involving an HD-GYP domain protein links cell-cell signalling to pathogenicity gene expression in Xanthomonas campestris. Molecular Microbiology, 2000. 38(5): p. 986-1003. 193. Ryan, R.P., Y. Fouhy, J.F. Lucey, B.L. Jiang, Y.Q. He, J.X. Feng, J.L. Tang, and J.M. Dow, Cyclic di-GMP signalling in the virulence and environmental adaptation of Xanthomonas campestris. Molecular Microbiology, 2007. 63(2): p. 429-442. 194. Ryan, R.P., Y. McCarthy, M. Andrade, C.S. Farah, J.P. Armitage, and J.M. Dow, Cell-cell signal-dependent dynamic interactions between HD-GYP and GGDEF domain proteins mediate virulence in Xanthomonas campestris. Proceedings of the National Academy of Sciences of the United States of America, 2010. 107(13): p. 5989-5994. 195. Ionescu, M., C. Baccari, A.M. Da Silva, A. Garcia, K. Yokota, and S.E. Lindow, Diffusible signal factor (DSF) synthase RpfF of Xylella fastidiosa is a multifunction protein also required for response to DSF. Journal of Bacteriology, 2013. 195(23): p. 5273-5284. 196. Beaulieu, E.D., M. Ionescu, S. Chatterjee, K. Yokota, D. Trauner, and S. Lindow, Characterization of a diffusible signaling factor from Xylella fastidiosa. MBio, 2013. 4(1): p. e00539-12. 197. de Souza, A.A., M. Ionescu, C. Baccari, A.M. da Silva, and S.E. Lindow, Phenotype Overlap in Xylella fastidiosa Is Controlled by the Cyclic Di-GMP Phosphodiesterase Eal in Response to Antibiotic Exposure and Diffusible Signal Factor-Mediated Cell- Cell Signaling. Applied and Environmental Microbiology, 2013. 79(11): p. 3444-3454. 198. Baccari, C., N. Killiny, M. Ionescu, R.P.P. Almeida, and S.E. Lindow, Diffusible Signal Factor–Repressed Extracellular Traits Enable Attachment of Xylella fastidiosa to Insect Vectors and Transmission. Phytopathology, 2013. 104(1): p. 27-33. 199. Ryan, R.P., Y. McCarthy, S.A. Watt, K. Niehaus, and J.M. Dow, Intraspecies signaling involving the diffusible signal factor BDSF (cis-2-dodecenoic acid) influences virulence in Burkholderia cenocepacia. Journal of Bacteriology, 2009. 191(15): p. 5013-5019. 200. Deng, Y., A. Lim, J. Wang, T. Zhou, S. Chen, J. Lee, Y.H. Dong, and L.H. Zhang, Cis-2-dodecenoic acid quorum sensing system modulates N-acyl homoserine lactone production through RpfR and cyclic di-GMP turnover in Burkholderia cenocepacia. BMC Microbiology, 2013. 13: p. 148. 201. Deng, Y., N. Schmid, C. Wang, J. Wang, G. Pessi, D. Wu, J. Lee, C. Aguilar, C.H. Ahrens, C. Chang, H. Song, L. Eberl, and L.H. Zhang, Cis-2-dodecenoic acid receptor RpfR links quorum-sensing signal perception with regulation of virulence through cyclic dimeric guanosine monophosphate turnover. Proceedings of the National Academy of Sciences of the United States of America, 2012. 109(38): p. 15479-84. 202. Ryan, R.P., Y. Fouhy, B.F. Garcia, S.A. Watt, K. Niehaus, L. Yang, T. Tolker‐Nielsen, and J.M. Dow, Interspecies signalling via the Stenotrophomonas maltophilia diffusible signal factor influences biofilm formation and polymyxin tolerance in Pseudomonas aeruginosa. Molecular Microbiology, 2008. 68(1): p. 75-86. 203. Yi, X.A., A. Yamazaki, E. Biddle, Q.A. Zeng, and C.H. Yang, Genetic analysis of two phosphodiesterases reveals cyclic diguanylate regulation of virulence factors in Dickeya dadantii. Molecular Microbiology, 2010. 77(3): p. 787-800. 204. Rogers, E.A., D. Terekhova, H.M. Zhang, K.M. Hovis, I. Schwartz, and R.T. Marconi, Rrp1, a cyclic-di-GMP-producing response regulator, is an important regulator of Borrelia burgdorferi core cellular functions. Molecular Microbiology, 2009. 71(6): p. 1551-1573. 205. Freedman, J.C., E.A. Rogers, J.L. Kostick, H. Zhang, R. Iyer, I. Schwartz, and R.T. Marconi, Identification and molecular characterization of a cyclic-di-GMP effector protein, PlzA (BB0733): additional evidence for the existence of a functional

157

cyclic-di-GMP regulatory network in the Lyme disease spirochete, Borrelia burgdorferi. FEMS Immunology and Medical Microbiology, 2010. 58(2): p. 285-94. 206. Kumagai, Y., J. Matsuo, Y. Hayakawa, and Y. Rikihisa, Cyclic di-GMP Signaling Regulates Invasion by Ehrlichia chaffeensis of Human Monocytes. Journal of Bacteriology, 2010. 192(16): p. 4122-4133. 207. Lai, T.H., Y. Kumagai, M. Hyodo, Y. Hayakawa, and Y. Rikihisa, The Anaplasma phagocytophilum PleC Histidine Kinase and PleD Diguanylate Cyclase Two- Component System and Role of Cyclic Di-GMP in Host Cell Infection. Journal of Bacteriology, 2009. 191(3): p. 693-700. 208. O'Shea, T.M., A.H. Klein, K. Geszvain, A.J. Wolfe, and K.L. Visick, Diguanylate cyclases control magnesium-dependent motility of Vibrio fischeri. Journal of Bacteriology, 2006. 188(23): p. 8196-8205. 209. Bassis, C.M. and K.L. Visick, The Cyclic-di-GMP Phosphodiesterase BinA Negatively Regulates Cellulose-Containing Biofilms in Vibrio fischeri. Journal of Bacteriology, 2010. 192(5): p. 1269-1278. 210. Nakhamchik, A., C. Wilde, and D.A. Rowe-Magnus, Cyclic-di-GMP regulates extracellular polysaccharide production, biofilm formation, and rugose colony development by Vibrio vulnificus. Applied and Environmental Microbiology, 2008. 74(13): p. 4199-4209. 211. Liu, N., T. Pak, and E.M. Boon, Characterization of a diguanylate cyclase from Shewanella woodyi with cyclase and phosphodiesterase activities. Molecular Biosystems, 2010. 6(9): p. 1557-1560. 212. Arora, D.P. and E.M. Boon, Nitric oxide regulated two-component signaling in Pseudoalteromonas atlantica. Biochemical and Biophysical Research Communications, 2012. 421(3): p. 521-526. 213. Buchan, A., J.M. Gonzalez, and M.A. Moran, Overview of the marine Roseobacter lineage. Applied and Environmental Microbiology, 2005. 71(10): p. 5665-5677. 214. Wagner-Dobler, I. and H. Biebl, Environmental biology of the marine Roseobacter lineage. Annual Review of Microbiology, 2006. 60: p. 255-280. 215. Brinkhoff, T., H.A. Giebel, and M. Simon, Diversity, ecology, and genomics of the Roseobacter clade: a short overview. Archives of Microbiology, 2008. 189(6): p. 531- 539. 216. Luo, H. and M.A. Moran, Evolutionary Ecology of the Marine Roseobacter Clade. Microbiology and Molecular Biology Reviews, 2014. 78(4): p. 573-587. 217. Gonzalez, J.M., J.S. Covert, W.B. Whitman, J.R. Henriksen, F. Mayer, B. Scharf, R. Schmitt, A. Buchan, J.A. Fuhrman, R.P. Kiene, and M.A. Moran, Silicibacter pomeroyi sp nov and Roseovarius nubinhibens sp nov., dimethylsulfoniopropionate- demethylating bacteria from marine environments. International Journal of Systematic and Evolutionary Microbiology, 2003. 53: p. 1261-1269. 218. Sorokin, D.Y., Sulfitobacter Pontiacus Gen-Nov, Sp-Nov - a New Heterotrophic Bacterium from the Black-Sea, Specialized on Sulfite Oxidation. Microbiology, 1995. 64(3): p. 295-305. 219. Moran, M.A., J.M. Gonzalez, and R.P. Kiene, Linking a bacterial taxon to sulfur cycling in the sea: Studies of the marine Roseobacter group. Geomicrobiology Journal, 2003. 20(4): p. 375-388. 220. Moran, M.A., A. Buchan, J.M. Gonzalez, J.F. Heidelberg, W.B. Whitman, R.P. Kiene, J.R. Henriksen, G.M. King, R. Belas, C. Fuqua, L. Brinkac, M. Lewis, S. Johri, B. Weaver, G. Pai, J.A. Eisen, E. Rahe, W.M. Sheldon, W.Y. Ye, T.R. Miller, J. Carlton, D.A. Rasko, I.T. Paulsen, Q.H. Ren, S.C. Daugherty, R.T. Deboy, R.J. Dodson, A.S. Durkin, R. Madupu, W.C. Nelson, S.A. Sullivan, M.J. Rosovitz, D.H. Haft, J. Selengut, and N. Ward, Genome sequence of Silicibacter pomeroyi reveals adaptations to the marine environment. Nature, 2004. 432(7019): p. 910-913. 221. Buchan, A., L.S. Collier, E.L. Neidle, and M.A. Moran, Key aromatic-ring-cleaving enzyme, protocatechuate 3,4-dioxygenase, in the ecologically important marine 158

Roseobacter lineage. Applied and Environmental Microbiology, 2000. 66(11): p. 4662- 4672. 222. Shiba, T., Y. Shioi, K. Takamiya, C. Wilkinson, D. Sutton, N. Wakao, and Y. Nishimura, Ecology of aerobic phototrophic bacteria. Trends in Microbial Ecology, 1993: p. 55-58. 223. Shiba, T., Effects of 5-Aminolevulinate and N-Methyl-Protoporphyrin Dimethyl Ester on Bacteriochlorophyll Synthesis in Aerobic-Bacteria. Journal of General and Applied Microbiology, 1992. 38(5): p. 439-446. 224. Shiba, T., Roseobacter-Litoralis Gen-Nov, Sp-Nov, and Roseobacter-Denitrificans Sp- Nov, Aerobic Pink-Pigmented Bacteria Which Contain Bacteriochlorophyll-A. Systematic and Applied Microbiology, 1991. 14(2): p. 140-145. 225. Schaefer, J.K., K.D. Goodwin, I.R. McDonald, J.C. Murrell, and R.S. Oremland, Leisingera methylohatidivorans gen. nov., sp nov., a marine methylotroph that grows on methyl bromide. International Journal of Systematic and Evolutionary Microbiology, 2002. 52: p. 851-859. 226. Swingley, W.D., S. Sadekar, S.D. Mastrian, H.J. Matthies, J. Hao, H. Ramos, C.R. Acharya, A.L. Conrad, H.L. Taylor, L.C. Dejesa, M.K. Shah, M.E. O'Huallachain, M.T. Lince, R.E. Blankenship, J.T. Beatty, and J.W. Touchman, The complete genome sequence of Roseobacter denitrificans reveals a mixotrophic rather than photosynthetic metabolism. Journal of Bacteriology, 2007. 189(3): p. 683-690. 227. Gonzalez, J.M., F. Mayer, M.A. Moran, R.E. Hodson, and W.B. Whitman, Sagittula stellata gen. nov, sp. nov, a lignin-transforming bacterium from a coastal environment. International Journal of Systematic Bacteriology, 1997. 47(3): p. 773-780. 228. Bruhn, J.B., L. Gram, and R. Belas, Production of antibacterial compounds and biofilm formation by Roseobacter species are influenced by culture conditions. Applied and Environmental Microbiology, 2007. 73(2): p. 442-450. 229. Bruhn, J.B., J.A.J. Haagensen, D. Bagge-Ravn, and L. Gram, Culture conditions of Roseobacter strain 27-4 affect its attachment and biofilm formation as quantified by real-time PCR. Applied and Environmental Microbiology, 2006. 72(4): p. 3011-3015. 230. Gosink, J.J., R.P. Herwig, and J.T. Staley, Octadecabacter arcticus gen nov, sp nov, and O-antarcticus, sp nov, nonpigmented, psychrophilic gas vacuolate bacteria from polar sea ice and water. Systematic and Applied Microbiology, 1997. 20(3): p. 356- 365. 231. Cho, J.C. and S.J. Giovannoni, Oceanicola granulosus gen. nov., sp nov and Oceanicola batsensis sp nov., poly-beta-hydroxybutyrate-producing marine bacteria in the order 'Rhodobacterales'. International Journal of Systematic and Evolutionary Microbiology, 2004. 54: p. 1129-1136. 232. Grossart, H.P., F. Levold, M. Allgaier, M. Simon, and T. Brinkhoff, Marine diatom species harbour distinct bacterial communities. Environmental Microbiology, 2005. 7(6): p. 860-873. 233. Alavi, M.R., Predator/Prey interaction between Pfiesteria piscicida and Rhodomonas mediated by a marine alpha proteobacterium. Microbial Ecology, 2004. 47(1): p. 48- 58. 234. Zubkov, M.V., B.M. Fuchs, S.D. Archer, R.P. Kiene, R. Amann, and P.H. Burkill, Rapid turnover of dissolved DMS and DMSP by defined bacterioplankton communities in the stratified euphotic zone of the North Sea. Deep-Sea Research Part Ii-Topical Studies in Oceanography, 2002. 49(15): p. 3017-3038. 235. Jasti, S., M.E. Sieracki, N.J. Poulton, M.W. Giewat, and J.N. Rooney-Varga, Phylogenetic diversity and specificity of bacteria closely associated with Alexandrium spp. and other phytoplankton. Applied and Environmental Microbiology, 2005. 71(7): p. 3483-3494. 236. Porsby, C.H., K.F. Nielsen, and L. Gram, Phaeobacter and Ruegeria Species of the Roseobacter Clade Colonize Separate Niches in a Danish Turbot (Scophthalmus maximus)-Rearing Farm and Antagonize Vibrio anguillarum under Different Growth Conditions. Applied and Environmental Microbiology, 2008. 74(23): p. 7356-7364. 159

237. Ruiz-Ponte, C., V. Cilia, C. Lambert, and J.L. Nicolas, Roseobacter gallaeciensis sp. nov., a new marine bacterium isolated from rearings and collectors of the scallop Pecten maximus. International Journal of Systematic Bacteriology, 1998. 48: p. 537- 542. 238. Sandaa, R.A., L. Gomez-Consarnau, J. Pinhassi, L. Riemann, A. Malits, M.G. Weinbauer, J.M. Gasol, and T.F. Thingstad, Viral control of bacterial biodiversity-- evidence from a nutrient-enriched marine mesocosm experiment. Environmental Microbiology, 2009. 11(10): p. 2585-97. 239. Boettcher, K.J., K.K. Geaghan, A.P. Maloy, and B.J. Barber, Roseovarius crassostreae sp nov., a member of the Roseobacter clade and the apparent cause of juvenile oyster disease (JOD) in cultured Eastern oysters. International Journal of Systematic and Evolutionary Microbiology, 2005. 55: p. 1531-1537. 240. Barbieri, E., B.J. Paster, D. Hughes, L. Zurek, D.P. Moser, A. Teske, and M.L. Sogin, Phylogenetic characterization of epibiotic bacteria in the accessory nidamental gland and egg capsules of the squid Loligo pealei (Cephalopoda : Loliginidae). Environmental Microbiology, 2001. 3(3): p. 151-167. 241. Grigioni, S., R. Boucher-Rodoni, A. Demarta, M. Tonolla, and R. Peduzzi, Phylogenetic characterisation of bacterial symbionts in the accessory nidamental glands of the sepioid Sepia officinalis (Cephalopoda : Decapoda). Marine Biology, 2000. 136(2): p. 217-222. 242. Taylor, M.W., P.J. Schupp, I. Dahllof, S. Kjelleberg, and P.D. Steinberg, Host specificity in marine sponge-associated bacteria, and potential implications for marine microbial diversity. Environmental Microbiology, 2004. 6(2): p. 121-130. 243. Webster, N.S., L.D. Smith, A.J. Heyward, J.E. Watts, R.I. Webb, L.L. Blackall, and A.P. Negri, Metamorphosis of a scleractinian coral in response to microbial biofilms. Applied and Environmental Microbiology, 2004. 70(2): p. 1213-21. 244. Cooney, R.P., O. Pantos, M.D. Le Tissier, M.R. Barer, A.G. O'Donnell, and J.C. Bythell, Characterization of the bacterial consortium associated with black band disease in coral using molecular microbiological techniques. Environmental Microbiology, 2002. 4(7): p. 401-13. 245. Pantos, O., R.P. Cooney, M.D. Le Tissier, M.R. Barer, A.G. O'Donnell, and J.C. Bythell, The bacterial ecology of a plague-like disease affecting the Caribbean coral Montastrea annularis. Environmental Microbiology, 2003. 5(5): p. 370-82. 246. Ashen, J.B. and L.J. Goff, Molecular and ecological evidence for species specificity and coevolution in a group of marine algal-bacterial symbioses. Applied and Environmental Microbiology, 2000. 66(7): p. 3024-3030. 247. Weidner, S., W. Arnold, E. Stackebrandt, and A. Puhler, Phylogenetic analysis of bacterial communities associated with leaves of the seagrass Halophila stipulacea by a culture-independent small-subunit rRNA gene approach. Microbial Ecology, 2000. 39(1): p. 22-31. 248. Rao, D., J.S. Webb, C. Holmstrom, R. Case, A. Low, P. Steinberg, and S. Kjelleberg, Low densities of epiphytic bacteria from the marine alga Ulva australis inhibit settlement of fouling organisms. Applied and Environmental Microbiology, 2007. 73(24): p. 7844-7852. 249. Tujula, N.A., G.R. Crocetti, C. Burke, T. Thomas, C. Holmstrom, and S. Kjelleberg, Variability and abundance of the epiphytic bacterial community associated with a green marine Ulvacean alga. Isme Journal, 2010. 4(2): p. 301-311. 250. Campbell, A.H., T. Harder, S. Nielsen, S. Kjelleberg, and P.D. Steinberg, Climate change and disease: bleaching of a chemically defended seaweed. Global Change Biology, 2011. 17(9): p. 2958-2970. 251. Case, R.J., S.R. Longford, A.H. Campbell, A. Low, N. Tujula, P.D. Steinberg, and S. Kjelleberg, Temperature induced bacterial virulence and bleaching disease in a chemically defended marine macroalga. Environmental Microbiology, 2011. 13(2): p. 529-537.

160

252. Fernandes, N., R.J. Case, S.R. Longford, M.R. Seyedsayamdost, P.D. Steinberg, S. Kjelleberg, and T. Thomas, Genomes and Virulence Factors of Novel Bacterial Pathogens Causing Bleaching Disease in the Marine Red Alga Delisea pulchra. PloS One, 2011. 6(12). 253. Belas, R., E. Horikawa, S.I. Aizawa, and R. Suvanasuthi, Genetic Determinants of Silicibacter sp TM1040 Motility. Journal of Bacteriology, 2009. 191(14): p. 4502-4512. 254. Slightom, R.N. and A. Buchan, Surface Colonization by Marine Roseobacters: Integrating Genotype and Phenotype. Applied and Environmental Microbiology, 2009. 75(19): p. 6027-6037. 255. Bell, W. and R. Mitchell, Chemotactic and growth responses of marine bacteria to algal extracellular products. Biological Bulletin, 1972: p. 265-277. 256. Young, L. and R. Mitchell, Negative chemotaxis of marine bacteria to toxic chemicals. Applied Microbiology, 1973. 25(6): p. 972-975. 257. Stocker, R. and J.R. Seymour, Ecology and physics of bacterial chemotaxis in the ocean. Microbiology and Molecular Biology Reviews, 2012. 76(4): p. 792-812. 258. Stocker, R., Marine microbes see a sea of gradients. Science, 2012. 338(6107): p. 628- 633. 259. Yu, C., B. Bassler, and S. Roseman, Chemotaxis of the marine bacterium Vibrio furnissii to sugars. A potential mechanism for initiating the chitin catabolic cascade. Journal of Biological Chemistry, 1993. 268(13): p. 9405-9409. 260. Bassler, B., P. Gibbons, C. Yu, and S. Roseman, Chitin utilization by marine bacteria. Chemotaxis to chitin oligosaccharides by Vibrio furnissii. Journal of Biological Chemistry, 1991. 266(36): p. 24268-24275. 261. Bassler, B., C. Yu, Y. Lee, and S. Roseman, Chitin utilization by marine bacteria. Degradation and catabolism of chitin oligosaccharides by Vibrio furnissii. Journal of Biological Chemistry, 1991. 266(36): p. 24276-24286. 262. Keyhani, N.O. and S. Roseman, Physiological aspects of chitin catabolism in marine bacteria. Biochimica et Biophysica Acta (BBA)-General Subjects, 1999. 1473(1): p. 108-122. 263. Miller, T.R., K. Hnilicka, A. Dziedzic, P. Desplats, and R. Belas, Chemotaxis of Silicibacter sp strain TM1040 toward dinoflagellate products. Applied and Environmental Microbiology, 2004. 70(8): p. 4692-4701. 264. Miller, T.R. and R. Belas, Dimethylsulfoniopropionate metabolism by Pfiesteria- associated Roseobacter spp. Applied and Environmental Microbiology, 2004. 70(6): p. 3383-3391. 265. Miller, T.R. and R. Belas, Motility is involved in Silicibacter sp TM1040 interaction with dinoflagellates. Environmental Microbiology, 2006. 8(9): p. 1648-1659. 266. Stocker, R., J.R. Seymour, A. Samadani, D.E. Hunt, and M.F. Polz, Rapid chemotactic response enables marine bacteria to exploit ephemeral microscale nutrient patches. Proceedings of the National Academy of Sciences, 2008. 105(11): p. 4209- 4214. 267. Moran, M.A., R. Belas, M.A. Schell, J.M. Gonzalez, F. Sun, S. Sun, B.J. Binder, J. Edmonds, W. Ye, B. Orcutt, E.C. Howard, C. Meile, W. Palefsky, A. Goesmann, Q. Ren, I. Paulsen, L.E. Ulrich, L.S. Thompson, E. Saunders, and A. Buchan, Ecological genomics of marine roseobacters. Applied and Environmental Microbiology, 2007. 73(14): p. 4559-4569. 268. Biebl, H., M. Allgaier, B.J. Tindall, M. Koblizek, H. Lünsdorf, R. Pukall, and I. Wagner-Döbler, Dinoroseobacter shibae gen. nov., sp. nov., a new aerobic phototrophic bacterium isolated from dinoflagellates. International Journal of Systematic and Evolutionary Microbiology, 2005. 55(3): p. 1089-1096. 269. Rao, D., J.S. Webb, and S. Kjelleberg, Microbial colonization and competition on the marine alga Ulva australis. Applied and Environmental Microbiology, 2006. 72(8): p. 5547-5555.

161

270. Ong, C.J., M. Wong, and J. Smit, Attachment of the adhesive holdfast organelle to the cellular stalk of Caulobacter crescentus. Journal of Bacteriology, 1990. 172(3): p. 1448-1456. 271. Bernadac, A., L.F. Wu, C.L. Santini, C. Vidaud, J.N. Sturgis, N. Menguy, P. Bergam, C. Nicoletti, and T. Xiao, Structural properties of the tubular appendage spinae from marine bacterium Roseobacter sp strain YSCB. Scientific Reports, 2012. 2. 272. Uchino, Y., A. Hirata, A. Yokota, and J. Sugiyama, Reclassification of marine Agrobacterium species: Proposals of Stappia stellulata gen. nov., comb. nov., Stappia aggregata sp. nov., nom. rev., Ruegeria atlantica gen. nov., comb. nov., Ruegeria gelatinovora comb. nov., Ruegeria algicola comb. nov., and Ahrensia kieliense gen. nov., sp. nov., nom. rev. Journal of General and Applied Microbiology, 1998. 44(3): p. 201-210. 273. Rüger, H.-J. and M.G. Höfle, Marine Star-Shaped-Aggregate-Forming Bacteria: Agrobacterium atlanticum sp. nov.; Agrobacterium meteori sp. nov.; Agrobacterium ferrugineum sp. nov., nom. rev.; Agrobacterium gelatinovorum sp. nov., nom. rev.; and Agrobacterium stellulatum sp. nov., nom. rev.†. International Journal of Systematic Bacteriology, 1992. 42(1): p. 133-143. 274. Bruhn, J.B., K.F. Nielsen, M. Hjelm, M. Hansen, J. Bresciani, S. Schulz, and L. Gram, Ecology, inhibitory activity, and morphogenesis of a marine antagonistic bacterium belonging to the Roseobacter clade. Applied and Environmental Microbiology, 2005. 71(11): p. 7263-7270. 275. D'Alvise, P.W., J. Melchiorsen, C.H. Porsby, K.F. Nielsen, and L. Gram, Inactivation of Vibrio anguillarum by Attached and Planktonic Roseobacter Cells. Applied and Environmental Microbiology, 2010. 76(7): p. 2366-2370. 276. Rao, D., J.S. Webb, and S. Kjelleberg, Competitive interactions in mixed-species biofilms containing the marine bacterium Pseudoalteromonas tunicata. Applied and Environmental Microbiology, 2005. 71(4): p. 1729-1736. 277. Geng, H.F. and R. Belas, TdaA Regulates Tropodithietic Acid Synthesis by Binding to the tdaC Promoter Region. Journal of Bacteriology, 2011. 193(15): p. 4002-4005. 278. Geng, H.F. and R. Belas, Expression of Tropodithietic Acid Biosynthesis Is Controlled by a Novel Autoinducer. Journal of Bacteriology, 2010. 192(17): p. 4377-4387. 279. Berger, M., N.L. Brock, H. Liesegang, M. Dogs, I. Preuth, M. Simon, J.S. Dickschat, and T. Brinkhoff, Genetic Analysis of the Upper Phenylacetate Catabolic Pathway in the Production of Tropodithietic Acid by Phaeobacter gallaeciensis. Applied and Environmental Microbiology, 2012. 78(10): p. 3539-3551. 280. Geng, H., J.B. Bruhn, K.F. Nielsen, L. Gram, and R. Belas, Genetic dissection of tropodithietic acid biosynthesis by marine roseobacters. Applied and Environmental Microbiology, 2008. 74(5): p. 1535-45. 281. Berger, M., A. Neumann, S. Schulz, M. Simon, and T. Brinkhoff, Tropodithietic Acid Production in Phaeobacter gallaeciensis Is Regulated by N-Acyl Homoserine Lactone-Mediated Quorum Sensing. Journal of Bacteriology, 2011. 193(23): p. 6576- 6585. 282. D'Alvise, P.W., O. Magdenoska, J. Melchiorsen, K.F. Nielsen, and L. Gram, Biofilm formation and antibiotic production in Ruegeria mobilis are influenced by intracellular concentrations of cyclic dimeric guanosinmonophosphate. Environmental Microbiology, 2014. 16(5): p. 1252-66. 283. Cude, W.N., J. Mooney, A.A. Tavanaei, M.K. Hadden, A.M. Frank, C.A. Gulvik, A.L. May, and A. Buchan, Production of the Antimicrobial Secondary Metabolite Indigoidine Contributes to Competitive Surface Colonization by the Marine Roseobacter Phaeobacter sp Strain Y4I. Applied and Environmental Microbiology, 2012. 78(14): p. 4771-4780. 284. Riclea, R., J. Gleitzmann, H. Bruns, C. Junker, B. Schulz, and J.S. Dickschat, Algicidal lactones from the marine Roseobacter clade bacterium Ruegeria pomeroyi. Beilstein Journal of Organic Chemistry, 2012. 8: p. 941-950.

162

285. Fouhy, Y., J.F. Lucey, R.P. Ryan, and J.M. Dow, Cell-cell signaling, cyclic di-GMP turnover and regulation of virulence in Xanthomonas campestris. Research in Microbiology, 2006. 157(10): p. 899-904. 286. Dow, J.M., R. Ryan, Y. Foully, J. Lucey, Y.Q. He, J.X. Feng, and J.L. Tang, Cyclic di-GMP signalling in the virulence and environmental adaptation of Xanthomonas campestris. Phytopathology, 2006. 96(6): p. S136-S136. 287. Ryan, R.P. and J.M. Dow, Communication with a growing family: diffusible signal factor (DSF) signaling in bacteria. Trends in Microbiology, 2011. 19(3): p. 145-152. 288. Jenal, U., Cyclic di-guanosine-monophosphate comes of age: a novel secondary messenger involved in modulating cell surface structures in bacteria? Current Opinion in Microbiology, 2004. 7(2): p. 185-91. 289. Romling, U. and R. Simm, Prevailing Concepts of c-di-GMP Signaling. Bacterial Sensing and Signaling, 2009. 16: p. 161-181. 290. Jonas, K., O. Melefors, and U. Romling, Regulation of c-di-GMP metabolism in biofilms. Future Microbiology, 2009. 4(3): p. 341-358. 291. Romling, U. and D. Amikam, Cyclic di-GMP as a second messenger. Current Opinion in Microbiology, 2006. 9(2): p. 218-228. 292. Ryan, R.P., T. Tolker-Nielsen, and J.M. Dow, When the PilZ don’t work: effectors for cyclic di-GMP action in bacteria. Trends in Microbiology, 2012. 20(5): p. 235-242. 293. Markowitz, V.M., I.M. Chen, K. Chu, E. Szeto, K. Palaniappan, Y. Grechkin, A. Ratner, B. Jacob, A. Pati, M. Huntemann, K. Liolios, I. Pagani, I. Anderson, K. Mavromatis, N.N. Ivanova, and N.C. Kyrpides, IMG/M: the integrated metagenome data management and comparative analysis system. Nucleic Acids Research, 2012. 40(Database issue): p. D123-9. 294. Di Tommaso, P., S. Moretti, I. Xenarios, M. Orobitg, A. Montanyola, J.M. Chang, J.F. Taly, and C. Notredame, T-Coffee: a web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucleic Acids Research, 2011. 39(Web Server issue): p. W13-7. 295. Gouet, P., X. Robert, and E. Courcelle, ESPript/ENDscript: Extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Research, 2003. 31(13): p. 3320-3. 296. Rao, F., Y. Qi, H.S. Chong, M. Kotaka, B. Li, J. Li, J. Lescar, K. Tang, and Z.X. Liang, The functional role of a conserved loop in EAL domain-based cyclic di-GMP- specific phosphodiesterase. Journal of Bacteriology, 2009. 191(15): p. 4722-31. 297. Tarutina, M., D.A. Ryjenkov, and M. Gomelsky, An unorthodox bacteriophytochrome from Rhodobacter sphaeroides involved in turnover of the second messenger c-di-GMP. Journal of Biological Chemistry, 2006. 281(46): p. 34751-34758. 298. Bharati, B.K., I.M. Sharma, S. Kasetty, M. Kumar, R. Mukherjee, and D. Chatterji, A full-length bifunctional protein involved in c-di-GMP turnover is required for long-term survival under nutrient starvation in Mycobacterium smegmatis. Microbiology-Sgm, 2012. 158: p. 1415-1427. 299. Levet-Paulo, M., J.C. Lazzaroni, C. Gilbert, D. Atlan, P. Doublet, and A. Vianney, The Atypical Two-component Sensor Kinase Lpl0330 from Legionella pneumophila Controls the Bifunctional Diguanylate Cyclase-Phosphodiesterase Lpl0329 to Modulate Bis-(3 '-5 ')-cyclic Dimeric GMP Synthesis. Journal of Biological Chemistry, 2011. 286(36): p. 31136-31144. 300. Chan, C., R. Paul, D. Samoray, N.C. Amiot, B. Giese, U. Jenal, and T. Schirmer, Structural basis of activity and allosteric control of diguanylate cyclase. Proceedings of the National Academy of Sciences of the United States of America, 2004. 101(49): p. 17084-17089. 301. Ishii, S., D.L. Hansen, R.E. Hicks, and M.J. Sadowsky, Beach sand and sediments are temporal sinks and sources of Escherichia coli in Lake Superior. Environmental Science & Technology, 2007. 41(7): p. 2203-9. 302. Yang, C.Y., K.H. Chin, M.L.C. Chuah, Z.X. Liang, A.H.J. Wang, and S.H. Chou, The structure and inhibition of a GGDEF diguanylate cyclase complexed with (c-di- 163

GMP)(2) at the active site. Acta Crystallographica Section D-Biological Crystallography, 2011. 67: p. 997-1008. 303. Tschowri, N., S. Busse, and R. Hengge, The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli. Genes & Development, 2009. 23(4): p. 522-534. 304. Simm, R., U. Remminghorst, I. Ahmad, K. Zakikhany, and U. Romling, A Role for the EAL-Like Protein STM1344 in Regulation of CsgD Expression and Motility in Salmonella enterica Serovar Typhimurium. Journal of Bacteriology, 2009. 191(12): p. 3928-3937. 305. Timmermans, J. and L. Van Melderen, Post-transcriptional global regulation by CsrA in bacteria. Cellular and Molecular Life Sciences, 2010. 67(17): p. 2897-2908. 306. Yakunin, A.F., M. Proudfoot, E. Kuznetsova, A. Savchenko, G. Brown, C.H. Arrowsmith, and A.M. Edwards, The HD domain of the Escherichia coli tRNA nucleotidyltransferase has 2',3'-cyclic phosphodiesterase, 2'-nucleotidase, and phosphatase activities. Journal of Biological Chemistry, 2004. 279(35): p. 36819-27. 307. Scott, J.W., S.A. Hawley, K.A. Green, M. Anis, G. Stewart, G.A. Scullion, D.G. Norman, and D.G. Hardie, CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. Journal of Clinical Investigation, 2004. 113(2): p. 274-84. 308. Ignoul, S. and J. Eggermont, CBS domains: structure, function, and pathology in human proteins. American Journal of Physiology-Cell Physiology, 2005. 289(6): p. C1369-C1378. 309. Weinberger, F., Pathogen-induced defense and innate immunity in macroalgae. The Biological Bulletin, 2007. 213(3): p. 290-302. 310. Cabiscol, E., J. Tamarit, and J. Ros, Oxidative stress in bacteria and protein damage by reactive oxygen species. International Microbiology, 2010. 3(1): p. 3-8. 311. Mishra, S. and J. Imlay, Why do bacteria use so many enzymes to scavenge hydrogen peroxide? Archives of Biochemistry and Biophysics, 2012. 525(2): p. 145-160. 312. Martinez, S.E., J.A. Beavo, and W.G. Hol, GAF Domains: Two–Billion–Year–Old Molecular Switches that Bind Cyclic Nucleotides. Molecular Interventions, 2002. 2(5): p. 317. 313. Kulesekara, H., V. Lee, A. Brencic, N. Liberati, J. Urbach, S. Miyata, D.G. Lee, A.N. Neely, M. Hyodo, Y. Hayakawa, F.M. Ausubel, and S. Lory, Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3 '-5 ')-cyclic-GMP in virulence. Proceedings of the National Academy of Sciences of the United States of America, 2006. 103(8): p. 2839-2844. 314. Kirillina, O., J.D. Fetherston, A.G. Bobrov, J. Abney, and R.D. Perry, HmsP, a putative phosphodiesterase, and HmsT, a putative diguanylate cyclase, control Hms- dependent biofilm formation in Yersinia pestis. Molecular Microbiology, 2004. 54(1): p. 75-88. 315. Levi, A., M. Folcher, U. Jenal, and H.A. Shuman, Cyclic Diguanylate Signaling Proteins Control Intracellular Growth of Legionella pneumophila. MBio, 2011. 2(1). 316. Girgis, H.S., Y.C. Liu, W.S. Ryu, and S. Tavazoie, A comprehensive genetic characterization of bacterial motility. PLoS Genetics, 2007. 3(9): p. 1644-1660. 317. Tagliabue, L., D. Antoniani, A. Maciag, P. Bocci, N. Raffaelli, and P. Landini, The diguanylate cyclase YddV controls production of the exopolysaccharide poly-N- acetylglucosamine (PNAG) through regulation of the PNAG biosynthetic pgaABCD operon. Microbiology-Sgm, 2010. 156: p. 2901-2911. 318. Bordeleau, E., L.C. Fortier, F. Malouin, and V. Burrus, c-di-GMP Turn-Over in Clostridium difficile Is Controlled by a Plethora of Diguanylate Cyclases and Phosphodiesterases. PLoS Genetics, 2011. 7(3). 319. D'Argenio, D.A., M.W. Calfee, P.B. Rainey, and E.C. Pesci, Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. Journal of Bacteriology, 2002. 184(23): p. 6481-6489.

164

320. Katzen, F., A. Becker, M.V. Ielmini, C.G. Oddo, and L. Ielpi, New mobilizable vectors suitable for gene replacement in gram-negative bacteria and their use in mapping of the 3' end of the Xanthomonas campestris pv. campestris gum operon. Applied and Environmental Microbiology, 1999. 65(1): p. 278-82. 321. Thoma, S. and M. Schobert, An improved Escherichia coli donor strain for diparental mating. FEMS Microbiology Letters, 2009. 294(2): p. 127-32. 322. Garcia, B., C. Latasa, C. Solano, F.G. Portillo, C. Gamazo, and I. Lasa, Role of the GGDEF protein family in Salmonella cellulose biosynthesis and biofilm formation. Molecular Microbiology, 2004. 54(1): p. 264-277. 323. Gomelsky, M. and M.Y. Galperin, Bacterial second messengers, cGMP and c-di- GMP, in a quest for regulatory dominance. EMBO Journal, 2013. 32(18): p. 2421-3. 324. Kovach, M.E., P.H. Elzer, D.S. Hill, G.T. Robertson, M.A. Farris, R.M. Roop, and K.M. Peterson, Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene, 1995. 166(1): p. 175-176. 325. Kovach, M., R. Phillips, P. Elzer, R. Roop 2nd, and K. Peterson, pBBR1MCS: a broad-host-range cloning vector. Biotechniques, 1994. 16(5): p. 800. 326. Elzer, P.H., M.E. Kovach, R.W. Phillips, G.T. Robertson, K.M. Peterson, and R.M. Roop, In vivo and in vitro stability of the broad-host-range cloning vector pBBR1MCS in six Brucella species. Plasmid, 1995. 33(1): p. 51-57. 327. Parker, J.L., M.J. Day‐Williams, J.M. Tomas, G.P. Stafford, and J.G. Shaw, Identification of a putative glycosyltransferase responsible for the transfer of pseudaminic acid onto the polar flagellin of Aeromonas caviae Sch3N. MicrobiologyOpen, 2012. 1(2): p. 149-160. 328. Goymer, P., S.G. Kahn, J.G. Malone, S.M. Gehrig, A.J. Spiers, and P.B. Rainey, Adaptive divergence in experimental populations of Pseudomonas fluorescens. II. Role of the GGDEF regulator WspR in evolution and development of the wrinkly spreader phenotype. Genetics, 2006. 173(2): p. 515-526. 329. Rahman, M., R. Simm, A. Kader, E. Basseres, U. Romling, and R. Mollby, The role of c-di-GMP signaling in an Aeromonas veronii biovar sobria strain. FEMS Microbiology Letters, 2007. 273(2): p. 172-9. 330. Herth, W. and E. Schnepf, The fluorochrome, calcofluor white, binds oriented to structural polysaccharide fibrils. Protoplasma, 1980. 105(1-2): p. 129-133. 331. Zogaj, X., W. Bokranz, M. Nimtz, and U. Romling, Production of cellulose and curli fimbriae by members of the family Enterobacteriaceae isolated from the human gastrointestinal tract. Infection and Immunity, 2003. 71(7): p. 4151-8. 332. Gal, M., G.M. Preston, R.C. Massey, A.J. Spiers, and P.B. Rainey, Genes encoding a cellulosic polymer contribute toward the ecological success of Pseudomonas fluorescens SBW25 on plant surfaces. Molecular Ecology, 2003. 12(11): p. 3109-21. 333. Townsley, L. and F.H. Yildiz, Temperature affects c‐di‐GMP signalling and biofilm formation in Vibrio cholerae. Environmental Microbiology, 2015. 334. Lafay, B., R. Ruimy, C.R. Detraubenberg, V. Breittmayer, M.J. Gauthier, and R. Christen, Roseobacter-Algicola Sp-Nov, a New Marine Bacterium Isolated from the Phycosphere of the Toxin-Producing Dinoflagellate Prorocentrum-Lima. International Journal of Systematic Bacteriology, 1995. 45(2): p. 290-296. 335. Ruiz-Ponte, C., J.F. Samain, J.L. Sanchez, and J.L. Nicolas, The Benefit of a Roseobacter species on the survival of scallop larvae. Marine Biotechnology, 1999. 1(1): p. 52-59. 336. Newton, R.J., L.E. Griffin, K.M. Bowles, C. Meile, S. Gifford, C.E. Givens, E.C. Howard, E. King, C.A. Oakley, C.R. Reisch, J.M. Rinta-Kanto, S. Sharma, S.L. Sun, V. Varaljay, M. Vila-Costa, J.R. Westrich, and M.A. Moran, Genome characteristics of a generalist marine bacterial lineage. Isme Journal, 2010. 4(6): p. 784-798.

165

337. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar, MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 2011. 28(10): p. 2731-9. 338. Anantharaman, V. and L. Aravind, The CHASE domain: a predicted ligand-binding module in plant cytokinin receptors and other eukaryotic and bacterial receptors. Trends in Biochemical Sciences, 2001. 26(10): p. 579-582. 339. Mougel, C. and I.B. Zhulin, CHASE: an extracellular sensing domain common to transmembrane receptors from prokaryotes, lower eukaryotes and plants. Trends in Biochemical Sciences, 2001. 26(10): p. 582-4. 340. Mascher, T., J.D. Helmann, and G. Unden, Stimulus perception in bacterial signal- transducing histidine kinases. Microbiology and Molecular Biology Reviews, 2006. 70(4): p. 910-938. 341. Aravind, L. and C.P. Ponting, The cytoplasmic helical linker domain of receptor histidine kinase and methyl-accepting proteins is common to many prokaryotic signalling proteins. FEMS Microbiology Letters, 1999. 176(1): p. 111-116. 342. Yang, C.Y., K.H. Chin, M.L. Chuah, Z.X. Liang, A.H. Wang, and S.H. Chou, The structure and inhibition of a GGDEF diguanylate cyclase complexed with (c-di- GMP)(2) at the active site. Acta Crystallographica. Section D: Biological Crystallography, 2011. 67(Pt 12): p. 997-1008. 343. Henry, J.T. and S. Crosson, Ligand binding PAS domains in a genomic, cellular, and structural context. Annual Review of Microbiology, 2011. 65: p. 261. 344. Marini, A.M., S. Vissers, A. Urrestarazu, and B. Andre, Cloning and expression of the MEP1 gene encoding an ammonium transporter in Saccharomyces cerevisiae. EMBO Journal, 1994. 13(15): p. 3456-63. 345. von Wirén, N. and M. Merrick, Regulation and function of ammonium carriers in bacteria, fungi, and plants, in Molecular mechanisms controlling transmembrane transport. 2004, Springer. p. 95-120. 346. Sanchez-Torres, V., H.B. Hu, and T.K. Wood, GGDEF proteins YeaI, YedQ, and YfiN reduce early biofilm formation and swimming motility in Escherichia coli. Applied Microbiology and Biotechnology, 2011. 90(2): p. 651-658. 347. Wood, T.K., Biofilm dispersal: deciding when it is better to travel. Molecular Microbiology, 2014. 94(4): p. 747-50. 348. Simm, R., Prevailing concepts of c-di-GMP signaling. Contributions to microbiology, 2009. 16: p. 161-181. 349. Hou, Y., F. Li de, and C. Wang da, Crystallization and preliminary X-ray analysis of the flagellar motor `brake' molecule YcgR with c-di-GMP from Escherichia coli. Acta Crystallographica. Section F: Structural Biology and Crystallization Communications, 2013. 69(Pt 6): p. 663-5. 350. Guzzo, C.R., G. Dunger, R.K. Salinas, and C.S. Farah, Structure of the PilZ- FimXEAL-c-di-GMP Complex Responsible for the Regulation of Bacterial Type IV Pilus Biogenesis. Journal of Molecular Biology, 2013. 425(12): p. 2174-97. 351. Chin, K.H., W.T. Kuo, Y.J. Yu, Y.T. Liao, M.T. Yang, and S.H. Chou, Structural polymorphism of c-di-GMP bound to an EAL domain and in complex with a type II PilZ-domain protein. Acta Crystallographica Section D-Biological Crystallography, 2012. 68: p. 1380-1392. 352. Liao, Y.T., K.H. Chin, W.T. Kuo, M.L. Chuah, Z.X. Liang, and S.H. Chou, Crystallization and preliminary X-ray diffraction characterization of the XccFimX(EAL)-c-di-GMP and XccFimX(EAL)-c-di-GMP-XccPilZ complexes from Xanthomonas campestris. Acta Crystallographica. Section F: Structural Biology and Crystallization Communications, 2012. 68(Pt 3): p. 301-5. 353. Chou, S.H., Delicate conformational changes of a protein in the CRP family lead to dramatic functional changes via binding of an alternate secondary messenger molecule. Virulence, 2011. 2(2): p. 152-157.

166

354. Ko, J., K.S. Ryu, H. Kim, J.S. Shin, J.O. Lee, C. Cheong, and B.S. Choi, Structure of PP4397 reveals the molecular basis for different c-di-GMP binding modes by Pilz domain proteins. Journal of Molecular Biology, 2010. 398(1): p. 97-110. 355. Guzzo, C.R., R.K. Salinas, M.O. Andrade, and C.S. Farah, PILZ Protein Structure and Interactions with PILB and the FIMX EAL Domain: Implications for Control of Type IV Pilus Biogenesis. Journal of Molecular Biology, 2009. 393(4): p. 848-866. 356. Guzzo, C.R. and C.S. Farah, Expression, crystallization and preliminary crystallographic analysis of PilZ(XAC1133) from Xanthomonas axonopodis pv. citri. Acta Crystallographica Section F-Structural Biology and Crystallization Communications, 2009. 65: p. 304-306. 357. Li, T.N., K.H. Chin, H.L. Shih, A.H. Wang, and S.H. Chou, Crystallization and preliminary X-ray diffraction characterization of an essential protein from Xanthomonas campestris that contains a noncanonical PilZ signature motif yet is critical for pathogenicity. Acta Crystallographica. Section F: Structural Biology and Crystallization Communications, 2009. 65(Pt 10): p. 1056-9. 358. Ho, C.L., S.L. Koh, M.L. Chuah, Z. Luo, W.J. Tan, D.K. Low, and Z.X. Liang, Rational design of fluorescent biosensor for cyclic di-GMP. ChemBioChem, 2011. 12(18): p. 2753-8. 359. Guvener, Z.T. and C.S. Harwood, Subcellular location characteristics of the Pseudomonas aeruginosa GGDEF protein, WspR, indicate that it produces cyclic-di- GMP in response to growth on surfaces. Molecular Microbiology, 2007. 66(6): p. 1459- 1473. 360. Paul, K., V. Nieto, W.C. Carlquist, D.F. Blair, and R.M. Harshey, The c-di-GMP binding protein YcgR controls flagellar motor direction and speed to affect chemotaxis by a “backstop brake” mechanism. Molecular Cell, 2010. 38(1): p. 128-139. 361. Wolfe, A.J. and K.L. Visick, Get the message out: Cyclic-Di-GMP regulates multiple levels of flagellum-based motility. Journal of Bacteriology, 2008. 190(2): p. 463-475. 362. Brinkhoff, T., G. Bach, T. Heidorn, L. Liang, A. Schlingloff, and M. Simon, Antibiotic production by a Roseobacter clade-affiliated species from the German Wadden Sea and its antagonistic effects on indigenous isolates. Applied and Environmental Microbiology, 2004. 70(4): p. 2560-5. 363. Martens, T., T. Heidorn, R. Pukall, M. Simon, B.J. Tindall, and T. Brinkhoff, Reclassification of Roseobacter gallaeciensis Ruiz-Ponte et al. 1998 as Phaeobacter gallaeciensis gen. nov., comb. nov., description of Phaeobacter inhibens sp nov., reclassification of Ruegeria algicola (Lafay et al. 1995) Uchino et al 1999 as Marinovum algicola gen. nov., comb. nov., and emended descriptions of the genera Roseobacter, Ruegeria and Leisingera. International Journal of Systematic and Evolutionary Microbiology, 2006. 56: p. 1293-1304. 364. Thomas, T., F.F. Evans, D. Schleheck, A. Mai-Prochnow, C. Burke, A. Penesyan, D.S. Dalisay, S. Stelzer-Braid, N. Saunders, J. Johnson, S. Ferriera, S. Kjelleberg, and S. Egan, Analysis of the Pseudoalteromonas tunicata Genome Reveals Properties of a Surface-Associated Life Style in the Marine Environment. PloS One, 2008. 3(9). 365. Egan, S., T. Thomas, and S. Kjelleberg, Unlocking the diversity and biotechnological potential of marine surface associated microbial communities. Current Opinion in Microbiology, 2008. 11(3): p. 219-225. 366. Penesyan, A., S. Kjelleberg, and S. Egan, Development of Novel Drugs from Marine Surface Associated Microorganisms. Marine Drugs, 2010. 8(3): p. 438-459. 367. Delbarre-Ladrat, C., C. Sinquin, L. Lebellenger, A. Zykwinska, and S. Colliec- Jouault, Exopolysaccharides produced by marine bacteria and their applications as glycosaminoglycan-like molecules. Frontiers in chemistry, 2014. 2. 368. Mitra, S. and J. Mukherjee, Biofilms of Marine and Intertidal Microbes: Ecology and Biotechnology. Advances in Biochemical Engineering/Biotechnology, 2013. 369. Poli, A., G. Anzelmo, and B. Nicolaus, Bacterial exopolysaccharides from extreme marine habitats: production, characterization and biological activities. Marine Drugs, 2010. 8(6): p. 1779-1802. 167

370. Saravanan, P. and S. Jayachandran, Preliminary characterization of exopolysaccharides produced by a marine biofilm-forming bacterium Pseudoalteromonas ruthenica (SBT 033). Letters in Applied Microbiology, 2008. 46(1): p. 1-6. 371. Chi, Z. and Y. Fang, Exopolysaccharides from marine bacteria. Journal of Ocean University of China, 2005. 4(1): p. 67-74. 372. Siboni, N., D. Abrego, C.A. Motti, J. Tebben, and T. Harder, Gene expression patterns during the early stages of chemically induced larval metamorphosis and settlement of the coral Acropora millepora. PloS One, 2014. 9(3): p. e91082. 373. Tebben, J., D.M. Tapiolas, C.A. Motti, D. Abrego, A.P. Negri, L.L. Blackall, P.D. Steinberg, and T. Harder, Induction of larval metamorphosis of the coral Acropora millepora by tetrabromopyrrole isolated from a Pseudoalteromonas bacterium. PloS One, 2011. 6(4): p. e19082. 374. Lachnit, T., M. Wahl, and T. Harder, Isolated thallus-associated compounds from the macroalga Fucus vesiculosus mediate bacterial surface colonization in the field similar to that on the natural alga. Biofouling, 2010. 26(3): p. 247-55. 375. Nielsen, S.J., T. Harder, and P.D. Steinberg, Sea urchin larvae decipher the epiphytic bacterial community composition when selecting sites for attachment and metamorphosis. FEMS Microbiology Ecology, 2015. 91(1): p. 1-9. 376. Luo, J., J. Zhang, R.J. Barnes, X. Tan, D. McDougald, A.G. Fane, G. Zhuang, S. Kjelleberg, Y. Cohen, and S.A. Rice, The application of nitric oxide to control biofouling of membrane bioreactors. Microbial Biotechnology, 2015. 8(3): p. 549-560. 377. Barraud, N., M. J Kelso, S. A Rice, and S. Kjelleberg, Nitric oxide: a key mediator of biofilm dispersal with applications in infectious diseases. Current Pharmaceutical Design, 2015. 21(1): p. 31-42. 378. Commichau, F.M., A. Dickmanns, J. Gundlach, R. Ficner, and J. Stulke, A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP. Molecular Microbiology, 2015. 379. Nunes-Alves, C., Bacterial physiology: Linking cell differentiation and growth. Nature Reviews Microbiology, 2015. 380. Lori, C., S. Ozaki, S. Steiner, R. Bohm, S. Abel, B.N. Dubey, T. Schirmer, S. Hiller, and U. Jenal, Cyclic di-GMP acts as a cell cycle oscillator to drive chromosome replication. Nature, 2015. 381. Chen, Z.H. and P. Schaap, Secreted cyclic-di-GMP induces stalk cell differentiation in the eukaryote Dictyostelium discoideum. Journal of Bacteriology, 2015.

168

Appendix I

Mass Spectrometry Profile of Cyclic-di-GMP Standards Base peak chromatogram (A) showing retention time (RT) and peak area (AA) of the cyclic-di- GMP standards, (0.1 nM, 1 nM, 10 nM, 100 nM, 1000 nM); mass spectrum (B) of the standards showing the 691.1 m/z characteristic of the mass of cyclic-di-GMP.

169

Appendix II

Predicted Diguanylate Cyclases (DGCs) and Phosphodiesterases (PDEs) in Representative Marine Roseobacter Strains

Gene_OID Locus Tag Product Name Phaeobacter inhibens 2.10 (n = 6) 2501766528 160714402 diguanylate cyclase, putative/response regulator 2501767459 160716226 ammonium transporter 2501765727 160712822 aspartate-semialdehyde dehydrogenase 2501766534 160714414 diguanylate cyclase 2501768368 160718004 diguanylate cyclase, putative 2501766643 160714618 diguanylate cyclase, putative Phaeobacter gallaeciensis BS107 (n = 6) 641477043 RGBS107_11352 diguanylate cyclase 641474949 RGBS107_15471 hypothetical protein 641477731 RGBS107_04606 aspartate-semialdehyde dehydrogenase 641477049 RGBS107_11382 diguanylate cyclase 641475261 RGBS107_01883 glutamyl-tRNA synthetase 641477130 RGBS107_11767 diguanylate cyclase, putative Phaeobacter sp. LSS9 (n = 5) 2502321359 diguanylate cyclase, putative/response regulator 2502320617 DNA polymerase I 2502320043 ammonium transporter 2502321364 Sensory box/GGDEF family protein 2502321321 diguanylate cyclase, putative Ruegeria pomeroyi DSS-3 (n = 4) 637290220 SPO2753 diguanylate cyclase, putative/response regulator 637290214 SPO2747 diguanylate cyclase, putative 637290308 SPO2840 GGDEF domain protein 637288659 SPO1173 diguanylate cyclase, putative Ruegeria sp. TM1040 (n = 9) 638007496 TM1040_2174 diguanylate cyclase 638004639 TM1040_3136 diguanylate cyclase/phosphodiesterase 638007476 TM1040_2156 diguanylate cyclase/phosphodiesterase 638004635 TM1040_3132 diguanylate cyclase/phosphodiesterase, megaplasmid 638005466 TM1040_0172 diguanylate cyclase/phosphodiesterase 638007551 TM1040_2229 diguanylate cyclase/phosphodiesterase 638006475 TM1040_1169 diguanylate cyclase with GAF sensor 638006339 TM1040_1035 diguanylate cyclase 638007491 TM1040_2169 diguanylate cyclase Rhodobacter sphaeroides ATCC 17029 (n = 12) 170

Gene_OID Locus Tag Product Name

640112663 Rsph17029_2069 response regulator receiver modulated diguanylate cyclase 640113649 Rsph17029_3047 diguanylate cyclase/phosphodiesterase with PAS/PAC and GAF sensor(s) 640114432 Rsph17029_3828 diguanylate cyclase/phosphodiesterase 640112252 Rsph17029_1659 diguanylate cyclase/phosphodiesterase with PAS/PAC and GAF sensor(s) 640112574 Rsph17029_1980 diguanylate cyclase/phosphodiesterase with PAS/PAC sensor(s) 640113615 Rsph17029_3013 diguanylate cyclase 640112658 Rsph17029_2064 diguanylate cyclase 640113597 Rsph17029_2995 diguanylate cyclase 640113648 Rsph17029_3046 diguanylate cyclase 640112568 Rsph17029_1974 diguanylate cyclase 640113760 Rsph17029_3158 diguanylate cyclase 640112654 Rsph17029_2060 diguanylate cyclase Sulfitobacter sp. EE-36 (n = 2) 638831198 EE36_12198 diguanylate cyclase, putative/response regulator 638831202 EE36_12218 diguanylate cyclase, putative Roseovarius nubinhibens ISM (n = 5) 638836659 ISM_05685 hypothetical protein 638835550 ISM_00215 hypothetical protein 638837385 ISM_11995 diguanylate cyclase, putative/response regulator 638837396 ISM_12050 diguanylate cyclase, putative 638837471 ISM_12405 GGDEF Oceanicola granulosus HTCC2516 (n = 3) 639049283 OG2516_15214 two component diguanylate cyclase 639047202 OG2516_17141 putative signal transduction protein 639048096 OG2516_04351 diguanylate cyclase, putative

171

Appendix III

Predicted HD-GYP Domain Proteins in Representative Marine Roseobacter Strains

Gene ID Locus Tag Gene Product Name Phaeobacter gallaeciensis 2.10 2510175868 PGA2_c10960 putative deoxyguanosinetriphosphate triphosphohydrolase 2510176387 PGA2_c16150 putative metal dependent phosphohydrolase 2510177249 PGA2_c24780 UTP--GlnB (protein PII) uridylyltransferase, GlnD 2510177294 PGA2_c25230 metal dependent phosphohydrolases-like protein Phaeobacter gallaeciensis BS107 641474906 RGBS107_15266 hypothetical protein 641475293 RGBS107_02043 UTP--GlnB (protein PII) uridylyltransferase, GlnD 641475342 RGBS107_02288 hypothetical protein 641478033 RGBS107_12662 Deoxyguanosinetriphosphate triphosphohydrolase Phaeobacter sp. LSS9 2502319345 UTP--GlnB (protein PII) uridylyltransferase, GlnD/tryptophanyl-tRNA synthetase (EC 6.1.1.2) 2502320276 Metal dependent phosphohydrolase, HD region 2502321184 Deoxyguanosinetriphosphate triphosphohydrolase (EC 3.1.5.1) Ruegeria pomeroyi DSS-3 637287758 SPO0266 HD domain protein 637287889 SPO0397 UTP--GlnB (protein PII) uridylyltransferase, GlnD 637288125 SPO0638 metal dependent phosphohydrolase 637289976 SPO2505 deoxyguanosinetriphosphate triphosphohydrolase, putative 637290846 SPO3381 hypothetical protein Ruegeria sp. TM1040 638004690 TM1040_3187 metal dependent phosphohydrolase 638005439 TM1040_0145 Deoxyguanosinetriphosphate triphosphohydrolase 638005473 TM1040_0179 metal dependent phosphohydrolase 638005629 TM1040_0334 hypothetical protein 638005742 TM1040_0446 UTP--GlnB (protein PII) uridylyltransferase, GlnD 638006204 TM1040_0902 Deoxyguanosinetriphosphate triphosphohydrolase Sulfitobacter sp. EE-36 638830819 EE36_16022 deoxyguanosinetriphosphate triphosphohydrolase, putative 638832599 EE36_08788 UTP--GlnB (protein PII) uridylyltransferase, GlnD Roseovarius nubinhibens ISM 638837208 ISM_08380 hypothetical protein 638838289 ISM_16440 deoxyguanosinetriphosphate triphosphohydrolase, putative 638838598 ISM_09991 UTP--GlnB (protein PII) uridylyltransferase, GlnD 172

Oceanicola granulosus HTCC2516 639046404 OG2516_02099 deoxyguanosinetriphosphate triphosphohydrolase, putative 639047167 OG2516_16966 UTP--GlnB (protein PII) uridylyltransferase, GlnD

173

Appendix IV

Predicted PilZ Domain Proteins in Representative Marine Roseobacter Strains

Gene ID Locus Tag Gene Product Name Phaeobacter gallaeciensis 2.10 251017653 PGA2_c17600 bacterial type IV pilus assembly (PilZ) protein-like 1 protein Phaeobacter gallaeciensis BS107 641475067 RGBS107_1605 hypothetical protein 1 Phaeobacter sp. LSS9 250231901 3-oxoacyl-(acyl carrier protein) synthase( EC:2.3.1.41 9 ) Rhodobacter sphaeroides ATCC 17029 640112572 Rsph17029_197 Cellulose synthase (UDP-forming) 8

174

Appendix V

Domain Structure Prediction of Predicted GGDEF and EAL Domain Proteins in Representative Marine Roseobacter Strains: GGDEF (GGDEF domain, PF00990); EAL (EAL domain, PF00563); REC (cheY-homologous receiver domain, SMART Acc.No. SM00448); PAS (PAS domain, PF00989); GAF (GAF domain, PF01590); CBS (CBS domain, PF00571); MHYT (bacterial signalling protein N-terminal repeat, PF03707); TM (transmembrane region); HAMP (HAMP domain, PF00672); CHASE (CHASE domain, PF03924); AM TRP (ammonium transporter, PF00909); 35EXOc (3'-5' exonuclease domain, SMART Acc.No. SM00474); POLAc (DNA polymerase A domain, SMART Acc.No. SM00482)

175

176

177

178

179

Appendix VI

Domain Structure Prediction of Predicted Predicted HD-GYP Domain Proteins in Representative Marine Roseobacter Strains: HDc (HD domain, metal-dependent phosphohydrolase, PF 01966); HD_5 (HD domain, PF13487); HD_assoc (HD domain, phosphohydrolase-associated domain, PF13286); NTP_transf_2 (nucleotidyltransferase domain, PF01909); GlnD_UR_UTase (GlnD_PII uridylyltransferase, PF08335); ACT (ACT domain, PF01842)

180

181

182

183

Appendix VII

Domain Structure Prediction of PilZ Domain Proteins in Representative Marine Roseobacter Strains: PilZ (PilZ domain, cyclic-di-GMP binding domain, PF07238); Cellulose_synt (Cellulose synthase, PF03552); Glycos_transf_2 (Glycosyl transferase family 2, PF00535); TM (transmembrane region)

184

Appendix VIII

Multiple Sequence Alignment of the Putative Diguanylate Cyclases (DGCs) from the Representative Marine Roseobacter Strains with Representative DGCs from other Bacteria: PleD from Caulobacter crescentus (AAA87378.1), AdrA from Salmonella typhimurium (NP_459380.1), ScrC from Vibrio parahaemolyticus ( AAK08640.1), WspR from Pseudomonas aeruginosa (NP_252391.1), DGC1 from Gluconacetobacter xylinus (AAC61684.1), HmsT from Yersinia pestis (AAD25088.1), TM1163 from Thermotoga maritima (YP_008991738.1), SLR1143 from Synechocystis sp. (BAA17300.1), STM4551 from Salmonella enterica (WP_000211214.1), CD1420 from Clostridium difficile (YP_001087922.1), DRB0044 from Deinococcus radiodurans (AAF12589.1), BifA from Pseudomonas aeruginosa (AAG07755.1). Identical residues are white characters in red boxes; homologous residues are red characters in white boxes; differing residues are black characters. ). “GG[D/E]F” and “RxxD” sequence motifs are shown respectively.

185

186

Appendix IX

Multiple Sequence Alignment of Predicted Tandem GGDEF-EAL Domain Proteins in Representative Marine Roseobacter Strains with Known Class 1 EAL Proteins: RocR from Pseudomonas aeruginosa (NP_252636.1), VieA from Vibrio cholerae (YP_001217202.1), PDEA1 from Gluconacetobacter xylinum (BAD36772.1) and YciR from Escherichia coli (YP_004953921.1); Identical residues are white characters in red boxes; homologous residues are red characters in white boxes; differing residues are black characters. ). “ExL” and “DDFGTGYSS” sequence motifs are shown underlined, respectively. Residues suggested to confer potential catalytic activity based on RocR studies (Rao et al 2008; 2009) are also shown underlined. Residues important for Mg2+ binding are indicated in red.

187

188

Appendix X

Multiple Sequence Alignment of Predicted HD-GYP Domain Proteins in Representative Marine Roseobacter Strains with representative HD-GYP Proteins from other Bacteria: RpfG from Xanthomonas campestris (3MTD_A), Bd1817 from Bdellovibrio bacteriovorus (QUU85), PA4108 from Pseudomonas aeruginosa (NP_252797), PA4781 from Pseudomonas aeruginosa (NP_253469), VC_A0681 from Vibrio cholerae (AAF96581), BP3508 from Bordetella pertussis (NP_882026), KPK_3322 from Klebsiella pneumoniae (ACI09878), SCO5218 from Streptomyces coelicolor (NP_629365). Identical residues are white characters in red boxes; homologous residues are red characters in white boxes; differing residues are black characters). “HD” and “GYP” sequence motifs are shown respectively.

189

190

191

192

193

194

195

Appendix XI

Multiple Sequence Alignment of Predicted PilZ Domain Proteins in Representative Marine Roseobacter Strains with Representative PilZ Domain Proteins from other Bacteria; PA4608 from Pseudomonas aeruginosa (2L74_A), PP4397 from Pseudomonas putida (3KYF_A), VCA0042 from Vibrio cholera (2RDE_A), YcgR from Salmonella typhimurium (Q8ZP19.1), DgrA from Caulobacter crescentus (AAK23578.1) and DgrB from Caulobacter crescentus (ACL96733.2). Respectively shown are the sequence motifs RxxxR and DZSxxG, where “Z” is any hydrophobic amino acid and “x” is any residue.

196

197

198

Appendix XII

Sequence Motif Conservation of the GGDEF Domain Proteins in the Representative Marine Roseobacter Strains

Gene_OID Locus Tag GGDEF RxxD Phaeobacter inhibens 2.10 2501766528 160714402 GGEEF RPVD 2501767459 160716226 GGDEF QDRGD 2501765727 160712822 GGDEF EKDE 2501766534 160714414 GGDEF RQND 2501768368 160718004 GGEEF HNGE 2501766643 160714618 GGEEF DGDE Phaeobacter gallaeciensis BS107 641477043 RGBS107_11352 GGEEF RPVD 641474949 RGBS107_15471 GGDEF QDGRD 641477731 RGBS107_04606 GGDEF EKDE 641477049 RGBS107_11382 GGDEF RQND 641475261 RGBS107_01883 GGEEF DGDE 641477130 RGBS107_11767 GGEEF RNGE Phaeobacter sp. LSS9 2502321359 GGEEF RPVD 2502320617 GGDEF EKDE 2502320043 GGDEF RDGRD 2502321364 GGDEF RQND 2502321321 GGEEF DGEE Ruegeria pomeroyi DSS-3 637290220 SPO2753 GGEEF MRPG 637290214 SPO2747 GGDEF TRGD 637290308 SPO2840 GGEEF SLPE 637288659 SPO1173 GGEEF CDRE Ruegeria sp. TM1040 638007496 TM1040_2174 GGEEF RGCD 638004639 TM1040_3136 GGDEF GPDD 638007476 TM1040_2156 GGDEF RTGRD 638004635 TM1040_3132 GGDEF RPGI 638005466 TM1040_0172 GGDEF GEGE 638007551 TM1040_2229 GGDEF KAGD 638006475 TM1040_1169 GGEEF GDSG 638006339 TM1040_1035 GGEEF GPED 638007491 TM1040_2169 GGDEF RKSD Rhodobacter sphaeroides ATCC 17029 640112663 Rsph17029_2069 GGEEF RPGD 640113649 Rsph17029_3047 GGDEF GADC

199

Gene_OID Locus Tag GGDEF RxxD 640114432 Rsph17029_3828 GGDEF RETD 640112252 Rsph17029_1659 GGDEF RSTD 640112574 Rsph17029_1980 SADEF QDGG 640113615 Rsph17029_3013 GGEEF RQGL 640112658 Rsph17029_2064 GGDEF RTGD 640113597 Rsph17029_2995 GGDEF AETN 640113648 Rsph17029_3046 GGEEF PEGA 640112568 Rsph17029_1974 GGEEF RRGD 640113760 Rsph17029_3158 GGEEF GPAD 640112654 Rsph17029_2060 GGEEF RPGD Sulfitobacter sp. EE-36 638831198 EE36_12198 GGEEF RPLD 638831202 EE36_12218 GGDEF RDID Roseovarius nubinhibens ISM 638836659 ISM_05685 GGDEF GPDD 638835550 ISM_00215 GGDEF IERD 638837385 ISM_11995 GGEEF RDCD 638837396 ISM_12050 GGDEF RKED 638837471 ISM_12405 GGEEF REDD Oceanicola granulosus HTCC 2516 639049283 OG2516_15214 GGEEF RPGD 639047202 OG2516_17141 GGDEF RQDD 639048096 OG2516_04351 GVEEF EEGW

200

Appendix XIII

Sequence Motif Conservation of the EAL Domain from the Predicted Tandem GGDEF- EAL Domain Proteins in the Representative Marine Roseobacter Strains

Gene_OID Locus Tag ExL DDFGTGYSS Phaeobacter inhibens 2.10 2501767459 160716226 EVL DDFGTGHAS 2501765727 160712822 EVL DDFGTGYSS Phaeobacter gallaeciensis BS107 641474949 RGBS107_15471 EVL DDFGTGHAS 641477731 RGBS107_04606 EVL DDFGTGYSS Phaeobacter sp. LSS9 2502320043 EVL DDFGTGHAS Ruegeria sp. TM1040 638004639 TM1040_3136 EAL DDFGTGHAS 638007476 TM1040_2156 EAL DDFGTGHAS 638004635 TM1040_3132 EAL DDFGTGYSS 638005466 TM1040_0172 EVL DDFGTGYSS 638007551 TM1040_2229 EVL DDFGTGHAS Rhodobacter sphaeroides ATCC 17029 640113649 Rsph17029_3047 EAL DDFGTGYAS 640114432 Rsph17029_3828 EAL DDFATGQSL 640112252 Rsph17029_1659 EAL DDFGTGYSS 640112574 Rsph17029_1980 EAL DDFGTGFSS Roseovarius nubinhibens ISM 638836659 ISM_05685 EAL DDFGTGYAG

201

Appendix XIV

Sequence Motif Conservation of the HD-GYP Domain Proteins in in the Representative Roseobacter Strains

Gene ID Locus Tag HD GYP Phaeobacter gallaeciensis 2.10 2510175868 PGA2_c10960 HD RAE 2510176387 PGA2_c16150 HD GYP 2510177249 PGA2_c24780 HD GHP 2510177294 PGA2_c25230 HD ... Phaeobacter gallaeciensis BS107 641474906 RGBS107_15266 HD GYP 641475293 RGBS107_02043 HD GHP 641475342 RGBS107_02288 HD ... 641478033 RGBS107_12662 HD R.. Phaeobacter sp. LSS9 2502319345 KT RWP 2502320276 .. ... 2502321184 HD R.. Ruegeria pomeroyi DSS-3 637287758 SPO0266 HD SFS 637287889 glnD HD GDP 637288125 SPO0638 HD YYN 637289976 SPO2505 HD R.. 637290846 SPO3381 HD ... Ruegeria sp. TM1040 638004690 TM1040_3187 HD YYN 638005439 TM1040_0145 GD F.N 638005473 TM1040_0179 HD ... 638005629 TM1040_0334 HD ... 638005742 TM1040_0446 HD R.. 638006204 TM1040_0902 HD R.. Rhodobacter sphaeroides ATCC 17025 640482022 Rsph17025_0469 HD KAQ 640482755 Rsph17025_1197 HD RSG Sulfitobacter sp. EE-36 638830819 EE36_16022 HD RAC 638832599 EE36_08788 HL RAE Roseovarius nubinhibens ISM 638837208 ISM_08380 HD PYF 638838289 ISM_16440 HD RAK

202

Gene ID Locus Tag HD GYP Oceanicola granulosus HTCC2516 639046404 OG2516_02099 HD RAE 639047167 OG2516_16966 HD ...

203

Appendix XV

Sequence Motif Conservation of the PilZ Domain Proteins in the Representative Marine Roseobacter Strains

Gene ID Locus Tag RxxxR DzSxxG Phaeobacter inhibens 2.10 2510176531 PGA2_c17600 RTAER DISQEG Phaeobacter gallaeciensis BS107 641475067 RGBS107_16051 RTAER DISQEG Phaeobacter sp. LSS9 2502319019 RTAER DISQEG Rhodobacter sphaeroides ATCC 17029 640112572 Rsph17029_1978 RTAPR DASTRG

204

Appendix XVI

Mass Spectrometric Profile of Nucleotide Extracts from Planktonic Cells of Representative Marine Roseobacter Strains. P. sp. LSS9 (Phaeobacter LSS9), O.g. 2516 (Oceanicola granulosus HTCC 2516), P.g. 2.10 (Phaeobacter gallaeciencis 2.10), P.g. BS107 (Phaeobacter gallaeciencis BS107), R. s. 17029 (Rhodobacter sphaeroides ATCC 17029), R. n. ISM (Roseovarius nubinhibens ISM), R. p. DSS3 (Ruegeria pomeroyi DSS3) ), R. sp. TM1040 (Ruegeria sp. TM1040), S. sp. EE-36 (Sulfitobacter sp. EE-36), N.i. LMG24365T (Nautella italica LMG 25365T), N.i. LMG24364 (Nautella italica LMG 24364). Panels 1-3 each represent the replicate run.

205

1 2 3 SM: 15G SM: 15G SM: 15G 691.1014 NL: 1.64E4 691.0764 NL: 2.10E3 691.1429 NL: 3.44E4 100 100 100 691.3067 8p#941 RT: 4.19 8p#925 RT: 4.12 8p#995 RT: 4.43 P. g. 2.10 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 691.3444 [650.00-730.00] [650.00-730.00] [650.00-730.00]

0 0 0 691.2778 NL: 4.23E3 691.0770 NL: 9.70E3 691.1434 NL: 2.56E5 100 100 100 9p#944 RT: 4.21 9p#982 RT: 4.38 9p#1016 RT: 4.53 P. g.BS107 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p 691.1029 ESI Full ms ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00]

0 0 0 RelativeAbundance 691.2997 NL:RelativeAbundance 8.98E4 691.0767 RelativeAbundance NL: 6.46E3 691.1429 NL: 9.01E4 100 100 100 16p#1122 RT: 5.00 691.2766 2p#991 RT: 4.42 2p#1008 RT: 4.49 P. sp. LSS9691.8143 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00]

0 0 0 691.3024 NL: 1.83E4 691.2786 NL: 8.86E3 691.1435 NL: 5.11E4 100 100 100 16p#917 RT: 4.09 691.0775 16p#928 RT: 4.13 16p#994 RT: 4.43 R. p. DSS3 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p 691.1014 ESI Full ms ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.3428 0 0 0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 m/z m/z m/z

SM: 15G SM: 15G SM: 15G NL: 0 691.0784 NL: 4.85E3 691.3073 NL: 2.02E4 100 100 100 17p#919 RT: 4.09 17p#963 RT: 4.29 17p#921 RT: 4.10 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 R. sp. TM1040 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.2789

0 0 0 NL: 3.41E3 NL: 0 691.2786 NL: 4.73E4 691.2817 100 100 100 19p#955 RT: 4.26 19p#921 RT: 4.10 19p#919 RT: 4.09 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms N. i. LMG 24365T ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00] 0 0 RelativeAbundance NL: 0 0 RelativeAbundance 691.0769 NL: 6.57E2 RelativeAbundance 691.2793 NL: 1.63E4 100 100 100 20p#954 RT: 4.25 20p#934 RT: 4.16 20p#1002 RT: 4.46 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 N. i. LMG 24364 50 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.1017 0 0 0 NL: 4.45E4 691.1434 NL: 1.65E5 691.1027 NL: 4.26E4 691.0790 100 100 100 12p#958 RT: 4.27 12p#929 RT: 4.14 12p#936 RT: 4.17 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms R. s. 17029 ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.2806 691.3494 691.3348 0 0 0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 m/z m/z m/z

SM: 15G SM: 15G SM: 15G NL: 7.28E3 NL: 2.50E4 691.3073 NL: 2.02E4 691.0773 691.1432 100 100 18p#993 RT: 4.42 100 17p#921 RT: 4.10 18p#1011 RT: AV: 1 T: FTMS + p AV: 1 T: FTMS + p 4.50 AV: 1 T: 80 80 ESI Full ms 80 ESI Full ms FTMS + p ESI Full [650.00-730.00] 60 [650.00-730.00] 60 ms 60 [650.00-730.00] 691.3511 40 S. sp. EE-36 40 40 20 20 20 0 0 0 NL: 2.67E4 NL: 2.14E4 691.1012 NL: 8.64E5 691.0781 691.1417 100 100 14p#963 RT: 4.29 100 14p#925 RT: 4.12 14p#926 RT: AV: 1 T: FTMS + p AV: 1 T: FTMS + p 4.13 AV: 1 T: 80 80 ESI Full ms 80 ESI Full ms FTMS + p ESI Full [650.00-730.00] 60 [650.00-730.00] 60 ms 60 [650.00-730.00] 40 R. n. ISM 40 40 20 20 20 RelativeAbundance RelativeAbundance

RelativeAbundance 691.3001 691.6017 0 0 NL: 1.74E5 0 NL: 1.01E6 691.0764 NL: 2.13E5 691.1416 691.1012 100 100 7p#956 RT: 4.26 100 7p#927 RT: 4.13 7p#919 RT: 4.09 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p 80 80 ESI Full ms 80 ESI Full ms ESI Full ms [650.00-730.00] 60 O. g. 2516 [650.00-730.00] 60 [650.00-730.00] 60 40 40 40 20 20 20 691.2758 691.3440 691.3013 691.6025 691.8135 0 0 0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 m/z m/z m/z

206

Appendix XVII

Mass Spectrometric Profile of Nucleotide Extracts from Attached Cells of Representative Marine Roseobacter Strains. P. sp. LSS9 (Phaeobacter LSS9), O.g. 2516 (Oceanicola granulosus HTCC 2516), P.g. 2.10 (Phaeobacter gallaeciencis 2.10), P.g. BS107 (Phaeobacter gallaeciencis BS107), R. s. 17029 (Rhodobacter sphaeroides ATCC 17029), R. n. ISM (Roseovarius nubinhibens ISM), R. p. DSS3 (Ruegeria pomeroyi DSS3) ), R. sp. TM1040 (Ruegeria sp. TM1040), S. sp. EE-36 (Sulfitobacter sp. EE-36), N.i. LMG24365T (Nautella italica LMG 25365T), N.i. LMG24364 (Nautella italica LMG 24364). Panels 1-3 each represent the replicate run.

207

1 2 3 SM: 15G SM: 15G SM: 15G 691.1011 NL: 2.86E3 NL: 0 NL: 0 100 100 100 8b#920 RT: 4.10 8B#931 RT: 4.15 8b#955 RT: 4.26 P. g. 2.10 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 691.2886 691.7874 [650.00-730.00] [650.00-730.00] [650.00-730.00]

0 0 0 691.2629 NL: 2.03E3 691.0749 NL: 7.58E3 691.1430 NL: 2.31E4 100 100 100 9b#912 RT: 4.06 9b#906 RT: 4.04 9b#958 RT: 4.27 P. g.BS107 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] 691.8097 [650.00-730.00] [650.00-730.00] 691.3265

0 0 0 RelativeAbundance NL: RelativeAbundance0 NL: RelativeAbundance0 NL: 0 100 100 100 2b#922 RT: 4.11 2b#936 RT: 4.17 2b#961 RT: 4.28 P. sp. LSS9 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00]

0 0 0 691.3265 NL: 2.03E4 691.0777 NL: 8.52E3 691.1444 NL: 6.06E3 100 100 100 16b#925 RT: 4.12 16b#924 RT: 4.12 16b#944 RT: 4.21 R. p. DSS3 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.1021 0 0 0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 m/z m/z m/z

SM: 15G SM: 15G SM: 15G 691.1033 NL: 3.92E3 691.0767 NL: 1.03E3 691.1451 NL: 9.39E2 100 100 100 17b#925 RT: 4.12 17b#929 RT: 4.14 17b#980 RT: 4.37 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 R. sp. TM1040 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.2838 0 0 0 691.2877 NL: 4.24E3 NL: 0 NL: 0 100 100 100 19b#924 RT: 4.12 19b#928 RT: 4.13 19b#941 RT: 4.19 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 N. i. LMG 24365T 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.7915 0 0 0 RelativeAbundance 691.1042 NL:RelativeAbundance 7.33E3 691.0793 NL: RelativeAbundance1.14E4 691.1438 NL: 9.42E3 100 100 100 20b#918 RT: 4.09 20b#941 RT: 4.19 20b#940 RT: 4.19 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 50 50 N. i. LMG 24364 [650.00-730.00] [650.00-730.00] [650.00-730.00] 691.7850 691.2814 0 0 0 691.1039 NL: 1.56E5 691.0764 NL: 1.62E5 691.1445 NL: 1.86E5 100 100 100 12b#932 RT: 4.15 12b#923 RT: 4.11 12b#951 RT: 4.24 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p ESI Full ms ESI Full ms ESI Full ms 50 R. s. 17029 50 50 [650.00-730.00] [650.00-730.00] [650.00-730.00]

691.3612 691.6065 0 0 0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 m/z m/z m/z

SM: 15G SM: 15G SM: 15G NL: 3.88E3 691.1011 NL: 1.38E3 691.0792 NL: 5.91E2 691.3448 100 18b#994 RT: 4.43 100 18b#989 RT: 4.41 100 18b#931 RT: 4.15 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p 80 ESI Full ms 80 ESI Full ms 80 ESI Full ms 691.1445 [650.00-730.00] 60 S. sp. EE-36 [650.00-730.00] 60 [650.00-730.00] 60 40 40 40 20 20 20 0 0 0 NL: 1.58E4 691.1028 NL: 4.09E4 691.0769 NL: 2.68E4 691.1470 100 14b#954 RT: 4.25 100 14b#920 RT: 4.10 100 14b#943 RT: 4.20 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p 80 ESI Full ms 80 ESI Full ms 80 ESI Full ms [650.00-730.00] 60 R. n. ISM [650.00-730.00] 60 [650.00-730.00] 60 40 40 40 20 20 20 RelativeAbundance RelativeAbundance RelativeAbundance 0 0 0 NL: 6.59E4 691.1027 NL: 7.54E4 691.0767 NL: 4.91E4 691.1452 100 7b#954 RT: 4.25 100 7b#919 RT: 4.09 100 7b#927 RT: 4.13 AV: 1 T: FTMS + p AV: 1 T: FTMS + p AV: 1 T: FTMS + p 80 ESI Full ms 80 ESI Full ms 80 ESI Full ms [650.00-730.00] 60 O. g. 2516 [650.00-730.00] 60 [650.00-730.00] 60 40 40 40 20 20 20 0 0 0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 691.0 691.1 691.2 691.3 691.4 691.5 691.6 691.7 691.8 691.9 692.0 m/z m/z m/z

208

209