Agabus alexandrae sp. n. from Morocco, with a molecular phylogeny of the Western Mediterranean species of the A. guttatus group (Coleoptera: Dytiscidae)

IGNACIO RIBERA, CARLES HERNANDO and PEDRO AGUILERA

A new species of the Agabus guttatus group, A. alexandrae sp. n., is described from the Moyen Atlas in Morocco.A phylogeny of most of the Western Mediterraneanspecies of the group based on Cytochrome Oxydase I and 16S rRNA sequences (approximately 1,250 bp) shows that A. alexandrae sp. n. is sister to the remaining species of the group. The evolution- ary history of the species of the group is tentatively reconstructed, based on a Maximum Likelihood estimate of divergence time of approximately2% per MY for the combined 16S and COI genes, similar to other estimates of evolutionaryrates of the mitochondrialDNA of Coleoptera. I. Ribera, Departmentof Entomology,The Natural History Museum, CromwellRoad, London SW7 5BD, U.K. C. Hernando & P. Aguilera, Museu de Zoologia, P.O. Box 593, 08080 Barcelona, Spain.

Introduction medially; posterolateral row of punctures on The genus Agabus, with ca. 180 species (Nilsson pronotum with a sublateral gap; metatibia with 2000), is one of the most diverse of the family anteroventral row of punctures complete and Dytiscidae. It has a Holarctic distribution, with almost continuous; and male mesotarsomere 3 some isolated species in the Oriental and without adhesive setae. Twenty-five species are Ethiopian regions (Nilsson 1992; 2000). The phy- currently recognised within this group, with a logenetic position of the genus within the tribe strict Palaearctic distribution centred in the Agabini, and of the species relationships within Mediterranean (Nilsson 2000). Most species are the genus, are still largely unknown, partly due to rheofilous, living in mountain streams and the paucity of morphological characters suitable springs, often in habitats with a reduced amount of for a phylogenetic analysis. In its most recent water (Foster & Bilton 1997). redefinition, the genus Agabus itself could only be A couple of specimens of an undescribed characterised by a single sinapomorphy, the con- species of the group were found in the lake tinuous bead on the front margin of the clypeus Afenourir, in the Moroccan Moyen Atlas, in 1999. (Nilsson 2000). The place had been visited by the authors in 1997 Within the genus Agabus three subgenera are and 1998, and was revisited again in spring 2000, currently recognised, each of them with several but no further specimens of the species were species groups. The Agabus guttatus group as found, despite intensive search (that resulted in a defined by Nilsson & Holmen (1995) is part of the list of ca. 100 species of aquatic Coleoptera). In an subgenus Gaurodytes (species with parameters attempt to establish the relationships of this new stylate, Nilsson 2000). It includes species with species a molecular phylogeny of most of the pronotum without anterior beading, most species Western Mediterranean species of the group was with anterior row of punctures broadly interrupted constructed using the mitochondrial genes 16S 254 rRNA and Cytochrome Oxydase I (COI). The ca. 510 bp, using primers 16Sa (5' evolutionary history of the lineage is also dis- ATGTTTTTGTTAAACAGGCG) for the 5' end cussed based on the present distribution of the of the gene, and 16Sb (5' CCGGTCTGAACTCA- species and the estimated time of divergence GATCATGT) for the 3' end. A single fragment of among them. ca. 720 bp of COI (from the middle of the region E3 to the COOH end, Lunt et al. 1996) was ampli- fied the CAACATT- Material and methods using primers 'Jerry' (5' TATTTTGATTTTTTGG) for the 5' end of the Taxon sampling. - All the Western Mediterranean gene, and 'Pat' (5' TCCAATGCACTAATCTGC- species of the A. guttatus group were included in CATATTA) for the 3' end (Simon et al. 1994). All the phylogenetic analysis (Tab. 1), with the excep- sequences generated in this study were deposited tion of A. picotae Foster & Bilton 1997 (very in GenBank (Acc. Nos AY039257-AY039277, closely related to A. heydeni), A. africanus Tab. 1). Pederzani & Schizzerotto, 1998 (closely related to The following cycling conditions were used: 1 A. binotatus), A. cephalotes Reiche, 1861, and A. to 2 min at 95°C; 30 seconds at 94°C, 30 seconds maderensis Wollaston, 1854 (Nilsson 2000). The at 47-50°C (depending on the melting tempera- phylogenetic relationships among the species of tures of the primer pair used), and 1-2 min at 72°C the group are unknown, as well as the possible (repeated for 35 to 40 cycles); 10 min at 72°C. monophyly of the Western Mediterranean species. Amplification products were purified using a For most of the species more than one specimen GeneClean II kit (Bio 101, Inc.) Automated DNA from different populations were included, in par- sequencing reagents were supplied by Perkin ticular for A. biguttatus (the most widespread Elmer Applied BioSystems Ltd. (ABI PRISM Big species, and the most similar morphologically to Dye Terminator Cycle Sequencing Ready the new species), for which ten specimens from Reaction Kit). Sequencing reactions were purified south Spain, Morocco and the Canary Islands by ethanol precipitation and were electrophoresed were included (Tab. 1). Outgroup sequences were on an ABI3700 sequencer. In all cases both obtained from Ribera et al. (2001) (with the strands of the gene were sequenced, and sequenc- exception of Agabus aubei), and include several ing errors/ambiguities were edited in the species of Agabini, of the genera Agabus, Ilybius, Sequencher 3.0 software package (Gene Codes Ilybiosoma and Platambus (Tab. 1). Corporation). Within the A. guttatus group, the species con- sidered to be 'A. nitidus' by Milldn et al. (1992) Phylogenetic analysis. - Sequences were not was included as a separate entity. In Foster & length variable for the ingroup, with the exception Bilton (1997) and Nilsson (2000) A. nitidus is of a deletion of a single 'T' in the 16S rRNA of considered to be a synonymy of A. biguttatus, Agabus dilatatus in position 325. 16S rRNA based mostly in the examination of northern and sequences of the outgroup differed in length only central European material. At present it is minimally, with a maximum difference of only unknown weather 'A. nitidus' from SE Spain cor- four base pairs (see Results). Alignment therefore responds to the true A. nitidus, but due to its well was performed manually, by maximising characterised morphology and genetic differentia- sequence similarities. Phylogenetic analysis was tion (even in coexisting populations, note that one performed with PAUP4.0 (Swofford 1999), using of the specimens of A. biguttatus included in the parsimony procedures for tree reconstruction, and analysis was collected in the same locality and using gaps as a missing character. Constraint trees date as 'A. nitidus') it was included as a separate for determining Bremer Support values (Bremer species. 1994) and partitioned Bremer Support values were generated with Treerot (Sorenson 1996). The DNA extraction, PCR and sequencing. - Spe- significance of the Incongruence Length cimens were collected in absolute ethanol, and Difference (ILD) (Farris et al. 1994) was assessed some muscular tissue was used for DNA isolation with the Partition Homogeneity Test as imple- using a Phenol-Chlorophorm extraction as mented in PAUP (using a heuristic search with described in Vogler et al. (1993). Sequences of 100 random-addition replicates). 16S rRNA were amplified in a single fragment of To estimate divergence times branch lengths for 255

Table 1. Material included in the molecular phylogeny,with locality data, haplotype and GenBank accession num- bers.

the ingroup only were fitted using Maximum Modeltest 3.04 (Posada & Crandall 1998). To Likelihood (ML) as implemented in PAUP. estimate node ages we fitted ML branch lengths Optimum ML models were selected using assuming a molecular clock and compared the 256 likelihood to that obtained assuming no clock of male dilated, with adhesive setae. Anterior (Felsenstein 1981). As the ML ratio was not sig- claws elongated, falcifom; interior claw slightly nificant (see Results), an ultrametric tree was esti- longer, with a medial tooth. Last abdominal ster- mated enforcing a molecular clock. nite with strongly impressed longitudinal striae. To calibrate the branch lengths two of the most Penis regularly curved in lateral view, asymmetri- extreme published estimations of the evolutionary cal in dorsal view (Fig. 2, 4). rate of insect mitochondrial DNA were used. The Etymology. - Named after Alexandra 'Ali' Cieslak, for faster rate estimation was the standard approxi- her enthusiasm to collect Agabus and Hydroporus. mately 2% divergence per million years (MY) for Lac mitochondrial DNA (Brower 1994), Typelocality. - Afenourir, Moyen Atlas, Morocco, correspon- 33°17'12.4"N 5°15'09.8"W, 1,800 m a.s.l. ding to a base rate (per branch) of 0.01 substitu- tions/site/R4Y. The slower rate estimation was that Typematerial. - Holotypea (Natural History Museum, of Gomez-Zurita et al. (2000) for the gene 16S London): '8 MOROCCO 9.4.1999 / Azrou: Lac Afenourir/ I. Ribera (IR Coll.), 19, same rRNA, estimated for the northern leg.'. Paratype split among locality and data as holotype. Genomic DNA extraction Moroccan and south Iberian species of the genus of both specimens stored in the collection of the Timarcha (Coleoptera, Chrysomelidae), with a Molecular Systematic Laboratory, Department of rate of 0.0038 substitutions/site/MY (0.76% diver- Entomology,Natural History Museum, under reference numbers IR212 (holotype0") and IR213 (paratype9). gence per MY). Ecology. - The two known specimens were col- lected in a temporary, well vegetated shallow Agabus alexandrae sp. n. pond close to the main lake Afenourir. This sug- (Fig. 2, 4) gests the possibility that the ancestral habitat of the A. guttatus group could be stagnant rather than 9.5 mm 9.7 mm Description. - Length (male) running water, with an early transition to running maximum width 5.3 mm 5.4 mm (female), (male) waters (see the phylogenetic analysis below). head with (female). Body oval, vey convex, black, However, these two specimens could also have two rufous Antenna last spots. brown, segments been vagrants from some of the nearby streams - a darkened at of last apex. Palpi black, apex seg- more typical habitat of the species of the group. ment brown. black. with weak medio- Legs Elytra More captures will be necessary to establish with lateral and subapical yellow spots. certainty the habitat of A. alexandrae sp. n. Body surface very shiny; surface of head and pronotum finely rugose; elytra with polygonal, Remarks. - Among the Western Mediterranean weakly impressed irregular meshes, more species, the external morphology of A. alexandrae impressed apically, most of meshes with interior sp. n. seems most similar to that of A. bigutattus, punctures. Elytral apex with sparse, irregular from which can be differentiated by its more reg- punctures. Three well impressed, irregular series ular oval shape, with the maximum width in a of setiferous punctures in each elytron. Anterior more rear position. The edeagus is however clear- and posterior submarginal transverse rows of ly different, more regularly curved in lateral view, punctures of pronotum widely interrupted in the and less asymmetrical in dorsal view (Fig. 1-4). middle, irregular. Metacoxal plates coarsely retic- The shape of the aedeagus, as well as the gen- ulated, with irregular polygonal meshes. eral body shape and colour, allows a clear differ- Abdominal stemites with progressively transverse entiation from the examined Central and Eastern striae towards apex; stemites 2 to 4 with a medial Mediterranean species of the group (A. balcanicu.s row of setiferous punctures. Hlisnikovsky, 1955; A. brandti Harold, 1880; A. Clypeus finely but continuously bordered. freudi Gueorguiev, 1975; A. glazunovi (Zaitzev, Lateral beads of pronotum of uniform width; hind 1953); A. lobonyx Guignot, 1952; A. ommani angle slightly obtuse. Elytral margins finely bor- Zaitzev, 1908 and A. svenhedini (Falkenström, dered. Prostemal apophysis lanceolate, pointed, 1932) could not be examined, although because of with continuous lateral beads. Metastemal wings the characters given in the original descriptions broad. Apical metatibial spur shorter than first and the distribution of the species - most of them metatarsomere. from the Eastern Palaearctic - any confusion is First two tarsomeres of anterior and middle legs most unlikely). 257

Figures 1-4. Aedeagus of Agabus biguttatus (1, 3) and A. alexandrae sp. n. (2, 4), lateral and dorsal views, traced from photographs.Scale bar 0.5 mm.

Phylogeny of the Western Mediterranean rected 'p' distance 0.008, corresponding to 4 bp). species of the A. guttatus group The maximum ingroup distance was that of A. heydeni - A. biguttatus 2 (p = 0.025, correspon- 16S rRNA. - All the ingroup sequences of the 16S ding to 13 bp). The maximum overall distance was rRNA fragment had the same length, 512 bp. between P. maculatus and L angustior (p = 0.11, Among the outgroups, the longest were I. albar- corrresponding to 54 bp). racinensis and L chalconatus (513 bp), and the A Tree-Bisection-Reconnection (TBR) search shortest L lugens (508). of 1,000 replicas produced 32 trees of a consisten- All specimens of A. biguttatus had the same cy index (CI) of 0.62 and a length of 181 steps. haplotype, with the exception of the ones from the The topology of the strict consensus tree was com- Canary Islands (Gomera and Tenerife, Tab. 1). patible with that of the combined analysis (see The two specimens of A. binotatus, A. heydeni and below), with the only difference of the sister rela- A. alexandrae had the same haplotype respective- tionship between A. heydeni and A. binotatus. The ly (Tab. 1). position of A. aubei, A. didymus and A. bipustula- The aligned sequences had 515 characters, of tus among the outgroups, and A. guttatus, A. which 418 were constant and 63 parsimony dilatatus and A. alexandrae within the ingroup, informative. Minimum distance within the was unresolved (i.e. forming a polytomy at the ingroup corresponded to 'A. nitidus' - A. bigutta- base of the genus Agabus and the A. guttatus tus 1 (see Tab. 1 for the haplotype codes) (uncor- group respectively). 258

Figure 5. Phylogram of one of the two most parsimonioustrees of the combined (16S rRNA + COI) analysis (in the strict consensus tree node 15 is collapsed).In square brackets, node numbers. Bootstrap support values (> 50%) on top left of the nodes (see Tab. 2 for Bremer support values). 259

Cytochrome Oxydase L - All the studied se- Homogeneity Test was not significant (p = 0.72, quences had 723 base pairs, with no length varia- 100 random-addition replicates), indicating a high tion. Of them, 494 were constant and 171 parsi- congruence between both genes. mony informative. In the combined tree all included genera are Both specimens of A. alexandrae and A. bino- monophyletic, with the possible exception of tatus had the same haplotype, and there were four Agabus (the position of A. didymus is unresolved). different haplotypes within A. biguttatus (Tab. l ). The species formerly included in the Agabus chal- The minimum distance within the ingroup cor- conatus and A. erichsoni groups (L subtilis, L responded to A. biguttatus 1 and 2 (p = 0.0014, albarracinensis and L chalconatus), and trans- corresponding to 1 bp). The maximum distance ferred to flybius by Nilsson (2000), were placed as within the ingroup corresponded to A. dilatatus - sister to L angustior. A. biguttatus 2 (p = 0.07, 54 bp). The maximum The species of the A. guttatus group were mono- distance overall corresponded to P. maculatus - L phyletic and closest to A. bipustulatus. Within the angustior (p = 0.15, 112 bp). group, A. alexandrae was basal, and sister to two A TBR search of 1,000 replicas resulted in a main clades: that formed by the species with a single tree of 628 steps with a CI = 0.51. The denticle in the apex of the aedeagus (A. guttatus topology of the ingroup was the same as that of complex: A. dilatatus, A. binotatus, A. heydeni and the combined analysis (i.e. with A. guttatus sister A. guttatus, see Foster & Bilton 1997), and that to A. binotatus), but the relationships among the formed by the A. biguttatus complex (A. bigutta- outgroups were slightly different (mainly the posi- tus sensu lato and A. `nitidus'). tion of the other species of Agabus). When gaps were considered as a 5th character, the search resulted in 4 trees of 830 steps and a CI Combined analysis. - A TBR search with 1,000 of 0.53. The topology was identical, with the ex- replicas on the combined data set (all characters ception of the collapse of nodes 8 and 9 (Fig. 5) equally weighted) resulted in two trees of 815 (i.e., the position of A. dilatatus was unresolved, steps and a CI = 0.53 (Fig. 5). The Partition resulting in a polytomy at the base of the A. gutta- tus gr.). Table 2. Bremer Partitioned Support values for the values were for most of the nodes of one of the two combined rRNA + Bootstrap very high ( 16S COI) nodes Bremer values were trees. See Fig. 5 for the number of the nodes. Values (Fig. 5). Support equal- refer to the relative Bremer Support Value (i.e. the dif- ly high for most of the nodes (Tab. 2). Partitioned ference between the value obtained for the constrained Bremer Support values were negative (i.e. indicat- node and the value obtained for the unconstrained tree, ing that the gene in question did not supported the for each gene separatelyand for the combined analysis). Unresolved nodes in the strict consensus tree have a final topology) for the sister relationship between Bremer Support Value of 0 (node 15). A. guttatus and A. binotatus (node 5); the position of A. dilatatus (node 9) and for the position of A. didymus (node 15). The highest support values (other that for haplotypes of the same species) were those of the genera Ilybiosoma (node 13) and Ilybius (node 12), and the A. guttatus gr. (node 18). The genus Agabus (node 15) had no support, due to the inconsistency in the position of A. didymus.

Rate of evolution. - For the combined data set (ingroup only), the optimal ML model as selected by Modeltest used the observed base frequencies, an estimated substitution model and equal rates of variation for all sites. Estimations for both genes independently gave similar models, with the dif- ference of unequal rates for COI. The maximum likelihood of the single combined tree under the assumption of a molecular clock was not signifi- cantly different to that of the same tree and model 260

Figure 6. Ultrametric tree obtained with a Maximum Likelihood model on the combined data set. Numbers above branchesrefer to branch lengths.The scale shows an estimatedrate of evolutionfor the combined data set of approx- imately 0.01 substitutions/site/MY(see text). without enforcing a molecular clock (-logL (no 9 degrees of freedom, p = 0.18). Both when the clock) = 2597.6; -LogL (clock) = 2603.9; 2 x dif- model estimated for the combined data was ference in LogL has a chi-square distribution with applied to the genes separately, and when the 261 models estimated for each gene separately were species, Fig. 6) and for the fact that both coexist applied to the combined data set, there were no (although it would be necessary to study more significant differences between the likelihood specimens to be certain). Similarly, differences enforcing and not enforcing a molecular clock. A between the populations of A. biguttatus from single ultrametric tree was thus produced using Gomera and Tenerife and that of Morocco and the the ML estimated model for the combined data set Iberian Peninsula seem to be deep enough to war- (Fig. 6). rant a specific status, to which the name A. con- The use of the standard 2% divergence per mil- sanguineus Woollaston, 1864 could be applied. lion years (MY) for insect mitochondrial DNA According to Machado (1987) two forms can be (Brower 1994) gives a minimum estimated age of found in the Canary Islands, A. nitidus and A. the A. guttatus group of 3.6 MY (Fig. 6). The ori- biguttatus. More data is necessary to assess the gin of the species (with the exception of A. alexan- possible differences between the two, and if any, drae) would be much younger, 2.3 MY for A. to which would correspond A. consanguineus. nitidus, and ca. 1.7 MY for A. biguttatus, A. bino- tatus, A. guttatus and A. heydeni. The use of the Evolutionary history. -According to the estimated much slower estimate of Gomez-Zurita et al. rates, the split between A. alexandrae and the (2000) for the genus Timarcha gives an age of the remaing species of the group would correspond to divergence of A. alexandrae of 9.4 MY, and an ca. 3.5 MY. This is younger that the age of the end approximate age of the most recent species of ca. of Messinian crisis, with the separation of the 4.2 MY. However, this latter estimate was based Iberian Peninsula and north Morocco after the re- on the gen 16S rRNA, which has a much lower opening of the Gibraltar straits (5.33 MY, evolutionary rate than Cytochrome Oxydase I. If Krijgsman et al. 1999) (which was used by only the gene 16S is taken into account, the esti- Gomez-Zurita et al. 2000 as a calibration point for mated branch length of A. alexandrae is 0.013, their estimation). If we accept this estimation, all which would correspond to 3.4 MY - much closer speciation events across the Mediterranean (and in to the 3.6 MY obtained with the standard rate. islands) would be the result of colonisation, either from Europe or North Africa (depending on the of the the Discussion geographical origin group). Similarly, separation of the populations of A. heydeni from Phylogenetic analysis. - The phylogenetic rela- Morocco and Central Spain would have taken tionships of some of the Western Mediterranean place approximately 100,000 years BP, even if the species not included in the analysis can be species can be considered a mountain specialist deduced from their morphology. Agabus and has so far never been recorded to fly. cephalotes has an apical tooth in the aedeagus Similarly, our data suggest that the large range (Foster & Bilton 1997), and it is likely to be of A. biguttatus (the most extense of the group) is included in the A. guttatus complex. Similarly, A. the result of a recent expansion. Differences africanus has been hypothesised to be sister to A. among COI haplotypes were small (with the binotatus (Pederzani & Schizzeroto 1998). The exception of the populations in the Canary position of A. maderensis is less clear, although it Islands, with an estimated age of isolation of no seems likely to be a member of the A. biguttatus less than 1.6 MY), but had some geographical complex, probably close to A. biguttatus. structure: all Iberian Specimens had the same hap- The south Portugese A. picotae is undoubtedly lotype, and all Moroccan specimens another one closely related to A. heydeni (Foster & Bilton with the exception of A. biguttatu.s 8, with a 1997), a species with a scattered distribution in unique haplotype (Tab. 1). The topology of the Iberia and Morocco, with main populations in tree suggests the paraphyly of the Moroccan pop- central Spain, north and central Portugal and ulations, although the small amount of variation Sierra Nevada (Rico et al. 1990). Until more (between 1 and 3 base pairs) does not allow any molecular data is available it is not possible to strong conclusion. ascertain their taxonomic status. According to our evolutionary hypotheses, A. The specific identity of A. 'nitidus' is clear, both binotatus would have a continental origin, with a for the age of the separation with A. biguttatus posterior colonisation of the Mediterranean (similar or older to that of other well defined islands (the present distribution includes Corsica, 262

Sardinia, Sicily and mainland Italy, Franciscolo Millán, A., Velasco, J. & Soler, A. G. (1992) Los The is too to have been coleópteros Hydradephaga de la cuenca del rio 1979). species young orig- de la Peninsula faunís- inated as a Corsican or Sardinian endemic a Segura (SE Ibérica). Aspectos by ticos más relevantes (Coleoptera). Anales de Bio- vicariant split. The last connection of Corsica with logía, Universidadde Murcia 18: 39-45. mainland was at the end of the Messinian crisis Nilsson, A. N. (1992) A revision of AfrotropicalAgabus 5.33 MY as seen and the Leach (Coleoptera,Dytiscidae), and the evolution of ago, above, geological Entomol- of the islands dates 12- tropicoalpine super specialists. Systematic formation approximately ogy 17: 155-179. 15 MY (see e.g. Steinfartz et al. 2000 and refer- Nilsson, A. N. (2000) A new view on the generic classi- ences therein). fication of the Agabus-group of genera of the Agabini, aimed at solving the problem with a para- phyletic Agabus (Coleoptera:Dytiscidae). Koleopte- Acknowledgements rologischeRundschau 70: 17-36. A. N. & Holmen, M. The We thank Hans S. Ericsson and Anders Nilsson, (1995) aquatic Fery (Berlin), Adephaga (Coleoptera) of Fennoscandia and Den- Nilsson (Umea)and Keith Miller (Cyprus)for providing mark. II. Fauna scandina- some and Alfried Txus G6mez- Dytiscidae. entomologica specimens, Vogler, vica 32: 188 pp. E. J. Brill, Leiden. Zurita and Andr6s Millan for comments and sugges- F. & A. of tions. Grant was NERC GR9/4735 to Pederzani, Schizzeroto, (1998) Description support through Agabus (Dichonectes) africanus n. sp. from north- Alfried Vogler (NHM). IR is a Leverhulme Special west Tunisia and notes on the of Research Fellow. cohabiting species Hydradephaga (Coleoptera Haliplidae, Gyrinidae & Dytiscidae). Atti dell'Accademia Roveretana degli Agiati (7) 8B: 87-95. Posada, D. & Crandall, K. A. (1998) Modeltest: testing Bremer, K. (1994) Branch support and tree stability. the model of DNA substitution. Bioinformatics 14: Cladistics 10: 295-304. 817-818. Brower, A. V. Z. (1994) Rapid morphologicalradiation Ribera, I., Barraclough,T. G. & Vogler,A. P. (2001) The and convergence among races of the butterfly effect of habitat type on speciation rates and range Heliconius erato inferred from patterns of mitochon- movements in aquatic beetles: inferences from spe- drial DNA evolution. Proceedings of the National cies-level phylogenies. Molecular Ecology 10: 721- Academyof Sciences,USA 91: 6491-6495. 735. Farris, J. S., Källersjö, M., Kluge, A. G. & Bult, C. Rico, E., Pérez, L. C. & Montes, C. (1990) Lista faunís- (1994) Testing significance of incongruence. tica y bibliográfica de los Hydradephaga (Coleop- Cladistics 10: 315-320. tera : Haliplidae, Hygrobiidae, Gyrinidae, Noteridae, Felsenstein,J. (1981) Evolutionarytrees from DNA se- Dytiscidae) de la Peninsula Ibérica e islas Baleares. quences :a maximumlikelihood approach.Journal of Asociación Espanola de Limnologia, Listas de la Molecular Evolution 17: 368-376. Flora y Fauna de las Aguas Continentalesde la Pen- Foster, G. N. & Bilton, D. T. (1997) A new species of insula Ibérica n° 7, Madrid. Agabus from south-west Portugal (Coleoptera: Simon, C., Frati, F., Beckenbach,A. T., Crespi, B., Liu, Dytiscidae). KoleopterologischeRundschau 67: 113- H. & Flook, P. (1994) Evolution,weighting, and phy- 118. logenetic utility of mitochondrialgene sequencesand Franciscolo, M. E. (1979) Coleoptera Haliplidae, a compilationof conservedpolymerase chain reaction Hygrobiidae, Gyrinidae, Dytiscidae. Fauna d'Italia primers.Annals of theEntomological Society of Amer- 14: 804 pp. Edizioni Calderini, Bologna. ica 87: 651-701. Gómez-Zurita,J., Juan, C. & Petitpierre,E. (2000) The Sorenson, M. D. (1996) TreeRot.University of Michi- evolutionaryhistory of the genus Timarcha (Coleop- gan, Ann Arbor. tera, Chrysomelidae) inferred from Mitochondrial Steinfartz, S., Veith, M. & Tautz, D. (2000) COII gene and partial 16S rDNA sequences Molec- Mitochondrialsequence analysis of Salamandra taxa ular Phylogeneticsand Evolution4: 304-317. suggests old splits of major lineages and postglacial Krijgsman, W., Hilgen, F. J., Raffi, I., Sierro, F. J. & recolonizations of Central Europe from distinct Wilson,D. S. (1999) Chronology,causes and progres- source populations of Salamandra salamandra. sion of the Messinian salinity crisis. Nature 400: 652- Molecular Ecology 9: 397-410. 655. Swofford, D. L. (1999) PAUP*: PhylogeneticAnalysis Lund, D. H., Zhang, D. X., Szymura,J. M. & Hewitt, G. using Parsimony. Version4.0b2a. SinauerAssociates, M. (1996) The insect cytochrome oxidase I gene: Sunderland,Massachusetts. evolutionarypatterns and conservedprimers for phy- Vogler,A. P., DeSalle, R., Assmann,T., Knisley,C. B. & logeneticstudies.InsectMolecularBiology 5 :153-165. Schultz, T. D. (1993) Molecular population genetics Machado,A. (1987) Los ditiscidos de las Islas Canarias of the endangered tiger beetle, Cicindela dorsalis (Coleoptera, Dytiscidae). Instituto de Estudios (Coleoptera: Cicindelidae). Annals of the Entomo- Canarios, La Laguna. logical Societyof America86: 142-152.