Development of Gene Therapy for Achromatopsia Due to CNGA3 Mutations

Development of gene therapy for achromatopsia due to CNGA3 mutations

Takaaki Matsuki

University College London

A thesis submitted for the degree of Doctor of Philosophy

‘ I, Takaaki Matsuki confirm that the work presented in this report is my own. Where information has been derived from other sources, I confirm that this has been indicated in the report.' 14/12/2018

Abstract

Achromatopsia is an autosomal recessive retinal degenerative disease affecting 1 in 30,000 to 50,000 people for Caucasians, and its main symptoms are loss of daylight vision, colour blindness from birth, pendular nystagmus and photophobia. Mutations in the cone-specific cyclic nucleotide-gated alpha 3 (CNGA3) gene account for 1 in 4 patients with achromatopsia in Europe. This thesis describes the development of a gene therapy for the treatment of achromatopsia due to mutations in CNGA3. Since achromatopsia is a relatively stationary condition and retinal structure is relatively well preserved even in adults, the condition presents a long treatment-window and may thus be particularly amenable to gene therapy. To minimise off target expression of a transgene, development of an efficient cone photoreceptor cell-specific promoter was essential. Six novel green opsin promoter and three new GNB3 promoter constructs were evaluated in cultured human embryonic stem cell derived retinal organoids and the promoter that provided the strongest cone specific expression in all cone subtypes was selected. This promoter was used in combination with a codon-optimised human CNGA3 and AAV8 capsid to rescue a murine model of achromatopsia. To evaluate time window for gene therapy in the murine model, gene therapy at up to 12 months was conducted. Improvement of retinal sensitivity as determined by full-field electroretinography was seen at all ages, but gene therapy at up to 1 month of age showed more efficacy compared with that performed at the later age. However, superior retinal explants, where cone photoreceptor degeneration is relatively slow, from mice treated at 6 months of age showed similar sensitivity to wild type retina as determined by multielectrode array. Histological analysis of retinal connectivity demonstrated that the connectivity was relatively preserved at advanced stage and post-synaptic markers were restored following gene therapy up to treatment at 12 months of age.

Impact statement

The primary aim of the project was to develop a clinical gene therapy vector for achromatopsia due to CNGA3. Optimization of AAV capsid and transgene design is essential as a higher potency of AAV vector has the potential to achieve a higher therapeutic efficacy and makes it possible to minimize a dose to lower a risk of immune response. In this study, development of one of the most effective cone specific promoter together with codon optimization of human transgene and AAV capsid resulted in successful rescue in murine model. In addition, as the promoter activity and specificity were tested in human retinal culture, efficacy of the vector may be extrapolated to clinical use. The vector developed in this study is now in GMP manufacturing and a clinical trial using this vector is expected to start in 2019. The secondary aim of the project was to establish a new measurement to evaluate the retinal sensitivity and integrity in a preclinical study on an inherited retinal disease. The full-field electroretinography (ERG) has been gold standards to test an efficacy of gene therapy vector for retinal degenerative diseases. The ERG may tell overall retinal function, however, it would not possible to test retinal sensitivity of focal area. In this study, implementation of multielectrode array enabled to evaluate focal area where cone photoreceptor was slowly degenerating and proved that the gene therapy was able to restore retinal sensitivity to wild-type levels even at advanced stage of disease. To date, most of the preclinical gene therapy studies on inherited retinal did not check correction of connectivity in retinal circuits, although retinal circuit remodelling has been reported in many retinal degenerations. Since synaptic layers in the retina spread horizontally, conventional vertical sectioning of the retina is not ideal to study synaptic connectivity. Therefore, a novel fixation and immunohistochemical protocol for flat- mount retinas was developed to establish efficient and reliable immunohistochemistry as well as a gentle tissue clearing protocol that is able to preserve fine synaptic structures and endogenous fluorescent labelling and to acquire a synaptic levels of super-resolution image deep inside the tissue. This new protocol could demonstrate that the synaptic connectivity between surviving cone photoreceptors and bipolar cells were maintained even at advanced stage of disease and post-synaptic markers were restored following gene therapy up to treatment at 12 months of age. Those results was encouraging as future clinical trials will likely involve not new born babies but infants and adult patients.

Acknowledgements

I would like to thank the many people who have been of great help. Above all, I would like to thank my supervisors, Professor Robin Ali and Professor James Bainbridge, for their continuous academic support, guidance and encouragement throughout my PhD. I am especially grateful to Professor Robin Ali for awarding me the opportunity to work on this challenging and of great impact project. My sincerest gratitude also goes to Dr. Anastasios Georgiadis for all his expertise and help with molecular biology and for non-academic support as my mentor. I also would like to thank Dr. Matteo Rizzi for interesting discussion and his enthusiasm for science. I must also include special mentions for Dr. Alexander Smith for his insightful knowledge and guidance, which were essential to bring this project forward. In addition, I would like to thank Anai Gonzalez Cordero for her expertise and help with stem cell work and passion for science. For technical support, I would like to thank Dr. Kate Oversby Powell and Dr. Martha Robinson for developing, running and analysing MEA experiments, Robert Sampson for flow cytometry, Ryea Maswood, Olha Semenyuk, Areta Michacz and Selina Azam for virus production, Justin Hoke, Laura Abelleira Hervás and Yanai Duran for animal experiments, Joana Claudio Ribeiro for cryosectioning, Arifa Naeem and Milan Fernando for stem cell work. Finally, special thanks to my family, especially my wife for her patience and continuous support, and my children for their pure and innocent smiles.

Table of Contents

Abstract ………………………………………………………………………………………... 3 Impact statement ……………………………………………………………………………... 4 Acknowledgements …………………………………………………………………………... 5 Table of Contents ……………………………………………………………………………. 6 List of Figures ……………………………………………………………………………...... 12 List of Tables ……………………………………………………………………………...... 15 Abbreviations ……………………………………………………………………………...... 16 Chapter I. Introduction ...... 19

Visual pathway ...... 19

The eye ...... 19

I.2.1. The Retina ...... 20

The Cone and Rod photoreceptor ...... 22

The phototransduction cascade ...... 22

Achromatopsia ...... 23

I.3.1. Prevalence ...... 24

I.3.2. Clinical symptoms ...... 24

Complete and incomplete achromatopsia ...... 24

I.3.3. Genetics ...... 24

CNGA3 and CNGB3 ...... 25

I.3.3.1.1. The CNG channel ...... 25 I.3.3.1.2. Mutations in CNGA3 and CNGB3 genes ...... 25 GNAT2 ...... 26

PDE6C and PDE6H...... 26

ATF6 ...... 27

Relations of genotype and phenotype ...... 27

I.3.4. Ocular findings ...... 28

Anterior segment ...... 28

Posterior segment ...... 28

I.3.5. Psychophysical tests ...... 29

Visual acuity ...... 29

Visual fields ...... 29

Colour vision tests ...... 29

Dark adaptometry ...... 30

I.3.6. Full field Electroretinography ...... 31

Photopic ERG...... 31

Scotopic ERG ...... 32

I.3.7. Retinal imaging ...... 33

Fundus autofluorescence (FAF) ...... 33

I.3.7.1.1. FAF in normal and cone dystrophy subjects ...... 34 I.3.7.1.2. FAF in achromatopsia patients ...... 35 Optical coherence tomography (OCT) ...... 36

I.3.7.2.1. Foveal hypoplasia ...... 36 I.3.7.2.2. Foveal retinal thickness ...... 37 I.3.7.2.3. Change in photoreceptor reflectivity ...... 38 I.3.7.2.4. Association between OCT finding and retinal function ...... 40 Adaptive optics scanning laser ophthalmoscopy (AO-SLO) ...... 40

I.3.7.3.1. Cone photoreceptor density ...... 41 I.3.7.3.2. Reflectivity of cone photoreceptor ...... 41 I.3.7.3.3. AO-SLO imaging in achromatopsia ...... 42 I.3.8. Management and therapy ...... 43

Symptomatic treatment ...... 43

Gene therapy...... 43

Gene therapy ...... 43

I.4.1. Retroviral gene therapy ...... 43

Ex vivo hematopoietic stem cell targeted gene therapy ...... 45

Ex vivo T cell targeted gene therapy ...... 45

Ex vivo epidermal stem cell targeted gene therapy ...... 46

In vivo central nervous system gene therapy ...... 46

I.4.2. Adenoviral gene therapy ...... 46

I.4.3. Adeno-associated viral gene therapy ...... 47

AAV serotypes ...... 47

Recombinant adeno-associated viral vector (rAAV) ...... 48

Insertional mutagenesis by rAAV ...... 49

Packaging capacity of rAAV ...... 49

I.4.3.4.1. Minigene strategy to overcome the packaging capacity ...... 49 I.4.3.4.2. Dual AAV system to overcome the packaging capacity ...... 50 I.4.3.4.3. Gene editing to overcome the packaging capacity ...... 51 I.4.3.4.4. Protein trans-splicing ...... 51 AAV immunogenicity ...... 52

I.4.3.5.1. Innate immune response to AAV ...... 52 I.4.3.5.2. Adaptive immune response to AAV ...... 52 Optimization of AAV capsid and transgene design ...... 54

I.4.3.6.1. Capsid protein variants ...... 54 I.4.3.6.2. Transgene expression cassette ...... 55 In vivo liver targeted gene therapy ...... 56

In vivo lower motor neuron targeted gene therapy ...... 57

I.4.4. Gene therapy for retinal disease ...... 57

AAV-mediated in vivo retinal gene therapy ...... 58

Lentiviral in vivo retinal gene therapy ...... 59

Experimental models to test a clinical viral vector or construct targeting cone photoreceptor cells ...... 59

Aims ...... 61

Chapter II. Material and Methods ...... 62

Construction of plasmid vectors ...... 62

Adeno-associated virus vector production ...... 76

Titration of adeno-associated virus vectors ...... 78

Human embryonic body-derived retinoid (hEB) and viral infection ...... 78

Animals ...... 79

Subretinal injections to the rodent retina ...... 79

Electroretinographic recordings and analysis ...... 80

Immunohistochemistry ...... 80

II.4.1. Frozen sections ...... 80

II.4.2. Immunohistochemistry and clearing protocol of flat mount retinas for chapter V ...... 82

Dissection and Fixation ...... 82

Immunohistochemistry ...... 82

Clearing ...... 83

Confocal microscopy imaging ...... 84

II.5.1. Imaging for cryosections ...... 84

II.5.2. Imaging for flat mount retinas ...... 84

Flow cytometry analysis ...... 84

Multielectrode array (MEA) recording ...... 85

Statistical analysis...... 85

Chapter III. Development of Cone specific promoters ...... 86

Overview ...... 86

Cone arrestin promoter ...... 87

III.2.1. Rescue of cpfl5 mice with cone arrestin promoter ...... 87

III.2.2. hCAR promoter transduction profile in hEBs ...... 90

2.1kb red opsin promoter (PR2.1) ...... 92

III.3.1. PR2.1 promoter transduction profile in hEBs ...... 92

PR2.1 promoter with retinoic acid receptor-related orphan receptor response element (RORE) ...... 95

III.4.1. POPS promoter transduction profile in murine retina ...... 95

III.4.2. POPS promoter transduction profile in hEBs ...... 100

Guanine nucleotide-binding protein subunit beta-3 (GNB3) promoters...... 102

III.5.1. Construction of GNB3 promoters ...... 102

III.5.2. GNB3 promoter’s transduction profile in murine retina ...... 102

III.5.3. GNB3 promoter’s transduction profile in hEBs ...... 105

Truncation of 5’ region of LCR in PR2.1 (1.7L) ...... 106

III.6.1. 1.7L promoter transduction profile in hEBs ...... 107

Green opsin promoters ...... 109

III.7.1. Construction of novel green opsin promoters ...... 109

III.7.2. Green opsin promoters transduction profile in murine retina ...... 111

III.7.3. Green opsin promoters transduction profile in rat retina ...... 111

III.7.4. Green opsin promoter’s transduction profile in hEBs ...... 116

III.7.5. Quantitative analysis of opsin promoters with Flow cytometry ...... 120

Green opsin promoters and 1.7L red opsin promoter ...... 120

Green opsin promoter without 4 additional nucleotides ...... 126

Summary ...... 129

Chapter IV. Rescue of Cnga3-deficient (cpfl5) mice with vectors carrying green opsin promoters 130

Overview ...... 130

Single flash photopic ERG response of wild-type and untreated cpfl5 mice ...... 131

Codon optimisation of hCNGA3 cDNA ...... 134

Optimal time window of treatment ...... 137

AAV5 vs AAV8 ...... 139

Anc80L65 vs AAV8 ...... 139

AAV44.9 vs AAV8...... 142

Comparison of 1.45M M8 –ccat, 1.75M M8 –ccat and 1.7L promoters ...... 144

Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 in cpfl5 mice ...... 146

Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 in wild-type mice ...... 150

Summary ...... 152

Chapter V. Synaptic plasticity of cpfl5 mice retina following gene therapy ...... 153

Overview ...... 153

Survival of cone photoreceptor in young treated cpfl5 murine retinas ...... 153

Restoration of post-synaptic marker in treated retina ...... 163

V.3.1. Gpr179 staining in dendritic tips of ON cone bipolar cells ...... 163

Gpr179 staining in C57BL/6J or Nrl-GFP murine retina ...... 164

Gpr179 staining in cpfl5 murine retina ...... 172

Gpr179 staining in cpfl5 murine retina following human CNGA3 supplementation therapy ...... 172

V.3.2. Analyses of connections between cone or rod photoreceptors to ON bipolar cells ...... 172

Connections between cone photoreceptors and CBC7s ...... 173

Connections between cone photoreceptors and RBCs ...... 174

Late treatment in cpfl5 murine model ...... 182

V.4.1. Photopic ERG response in cpfl5 mice treated at advanced stage...... 182

V.4.2. Multielectrode array (MEA) ...... 186

Photopic Flicker response ...... 186

Histological analysis of retinas treated at advanced stage of disease ...... 188

V.5.1. Pre- and Post-synaptic marker of cone photoreceptors ...... 188

Presynaptic marker of cone photoreceptors ...... 188

Postsynaptic marker of cone photoreceptors...... 199

V.5.2. Connections between cone photoreceptors and RBCs ...... 202

V.5.3. Connection between cone photoreceptors and CBCs ...... 202

Summary ...... 215

Chapter VI. Discussion ...... 216

Development of a cone specific promoter ...... 216

Rescue of cpfl5 mice with vectors carrying green opsin promoters ...... 217

Synaptic plasticity in cpfl5 mouse retina ...... 218

Chapter VII. Future directions ...... 220

Characterization of degeneration in cpfl5 murine retina ...... 220

Expression of human CNGA3 transgene in treated retina ...... 220

Behaviour test following gene therapy on cpfl5 mice ...... 220

Further histological analysis of connectivity ...... 221

Chapter VIII. References ...... 222

List of Figures

Figure 1.1: Retinal layers ...... 21 Figure 2.1: The map of pGEM®-T Easy Vector-GNB3 promoter plasmid vector ...... 64 Figure 2.2: The map of pD10-2.0kb GNB3p-eGFP plasmid vector ...... 64 Figure 2.3: The map of pD10-1.0kb GNB3p-eGFP plasmid vector ...... 65 Figure 2.4: The map of pD10-0.4kb GNB3p-eGFP plasmid vector ...... 65 Figure 2.5: The map of pGEM®-T Easy Vector-OPN1MW promoter plasmid vector ... 66 Figure 2.6: The map of pD10-1.7kb red opsin promoter (1.7L)-eGFP plasmid vector . 67 Figure 2.7: The map of pD10-2.1kb red opsin promoter (2.1L)-eGFP plasmid vector . 67 Figure 2.8: The map of pD10-1.75kb green opsin promoter (1.75M)-eGFP plasmid vector ...... 68 Figure 2.9: The map of pD10-1.45kb green opsin promoter (1.45M)-eGFP plasmid vector ...... 68 Figure 2.10: The map of pD10-1.75kb green opsin promoter with M8 mutation (1.75M M8)-eGFP plasmid vector ...... 69 Figure 2.11: The map of pD10-1.45kb green opsin promoter with M8 mutation (1.45M M8)-eGFP plasmid vector ...... 70 Figure 2.12: Codon usage bias and GC content adjustment in human CNGA3 gene .. 71 Figure 2.13: The map of pD10-1.7kb red opsin promoter (1.7L)-codon optimized human CNGA3 plasmid vector ...... 72 Figure 2.14: The map of pD10-1.7kb red opsin promoter (1.7L)-non-codon optimized human CNGA3 plasmid vector ...... 72 Figure 2.15: The map of pAAV-1.75kb green opsin promoter with M8 mutation without CCAT (1.75M M8 -ccat)-codon optimized human CNGA3 plasmid vector...... 73 Figure 2.16: The map of pAAV-1.45kb green opsin promoter with M8 mutation without CCAT (1.45M M8 -ccat)-codon optimized human CNGA3 plasmid vector...... 74 Figure 2.17: The map of pD10-1.75kb green opsin promoter with M8 mutation without CCAT (1.75M M8 -ccat)-eGFP plasmid vector ...... 75 Figure 2.18: The map of pD10-1.75kb green opsin promoter with M8 mutation without CCAT (1.75M M8 -ccat)-eGFP plasmid vector ...... 75 Figure 2.19: The map of ShH10 plasmid vector ...... 76 Figure 2.20: The map of pHGTI plasmid vector ...... 77 Figure 3.1: ERG recording from a cpfl5 mouse of 1 month of age injected AAV8-hCAR- co hCNGA3 (A) or AAV8-Pops-co hCNGA3 (B)...... 89 Figure 3.2: hCAR promoter transduction profile in hEBs...... 91 Figure 3.3: Development of 2.1kb red opsin promoter (PR2.1)...... 93 Figure 3.4: PR2.1 promoter transduction profile in hEBs...... 94

Figure 3.5: PR2.1 promoter transduction profile in murine retina...... 96 Figure 3.6: POPS promoter transduction profile in murine retina...... 97 Figure 3.7: POPS promoter transduction profile in pure blue cones of murine retina. . 98 Figure 3.8: Transduction efficacy in pure blue cones of murine retina...... 99 Figure 3.9: POPS promoter transduction profile in hEBs...... 101 Figure 3.10: GNB3 promoter transduction profile in murine retina...... 103 Figure 3.11: GNB3 promoter transduction profile in hEBs...... 106 Figure 3.12: 1.7L promoter transduction profile in hEBs...... 108 Figure 3.13: Development of Green opsin promoters...... 110 Figure 3.14: Green opsin promoters’ transduction profile in murine retina...... 112 Figure 3.15: Green opsin promoters’ transduction profile in rat retina ...... 113 Figure 3.16: Green opsin promoters’ transduction profile in rat retina ...... 114 Figure 3.17: Green opsin promoters’ transduction profile in rat retina ...... 115 Figure 3.18: Green opsin promoters’ transduction profile in hEBs...... 117 Figure 3.19: Green opsin promoters’ transduction profile in cone photoreceptors of hEBs...... 118 Figure 3.20: Green opsin promoters’ transduction profile in hEBs...... 119 Figure 3.21: Gating for GFP negative cells with Flow cytometry ...... 121 Figure 3.22: Identification of GFPpositive cells with Flow cytometry...... 123 Figure 3.23: Quantitative analysis of opsin promoters with Flow cytometry...... 125 Figure 3.24: Quantitative analysis of opsin promoters with Flow cytometry...... 127 Figure 3.25: Quantitative analysis of opsin promoters with Flow cytometry...... 128 Figure 4.1: ERG recording from a wild-type (C57BL6/J) (A) or a cpfl5 (B) mouse of 8 weeks of age ...... 132 Figure 4.2: Time course of single flash photopic ERG response of wild-type (C57BL6/J) and cpfl5 mice ...... 133 Figure 4.3: ERG recording from a cpfl5 mouse of 1 month of age injected AAV8-1.7L promoter vectors with co hCNGA3 (A) or non-co hCNGA3 (B) ...... 135 Figure 4.4: Efficacy of codon optimised hCNGA3 ...... 136 Figure 4.5: Optimal time window of treatment of cpfl5 mice ...... 138 Figure 4.6: Comparison of AAV5 and AAV8 ...... 140 Figure 4.7: Comparison of Anc80L65 and AAV8 ...... 141 Figure 4.8: Comparison of AAV44.9 and AAV8 ...... 143 Figure 4.9: Comparison of green and red promoter efficacy ...... 145 Figure 4.10: Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 ...... 147 Figure 4.11: Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 in cpfl5 ...... 149 Figure 4.12: Dose de-escalation of AAV8 1.75M M8 –ccat co hCNGA3 in wild-type . 151 Figure 5.1: Survival of cone photoreceptor in young treated cpfl5 murine retinas...... 155

Figure 5.2: Survival of cone photoreceptor in young treated cpfl5 mouse retinas ...... 157 Figure 5.3: Survival of cone photoreceptor in young treated cpfl5 murine retinas...... 159 Figure 5.4: Survival of cone photoreceptor in young treated cpfl5 murine retinas...... 161 Figure 5.5: Gpr179 staining at cone pedicle bases in C57BL/6J murine retina ...... 165 Figure 5.6: Gpr179 staining at rod spherules in Nrl-GFP murine retina ...... 167 Figure 5.7: Gpr179 staining in C57BL/6J and young treated or untreated cpfl5 murine retinas ...... 169 Figure 5.8: Signal intensity of Gpr179 staining at cone pedicle bases in C57BL/6J and young treated or untreated cpfl5 murine retinas ...... 170 Figure 5.9: Connectivity of cone pedicles and type 7 cone bipolar cells ...... 175 Figure 5.10: Connectivity of cone pedicles and rod bipolar cells in C57BL/6J ...... 176 Figure 5.11: Connectivity of cone pedicles and rod bipolar cells in untreated cpfl5 ... 178 Figure 5.12: Connectivity of cone pedicles and rod bipolar cells in young treated cpfl5 ...... 180 Figure 5.13: ERG recording from a cpfl5 mouse of 6 months of age injected AAV8- 1.75M M8 -ccat-co hCNGA3 (A) or uninjected (B)...... 183 Figure 5.14: ERG recording from a cpfl5 mouse of 12 months of age injected with AAV8-1.75M M8 -ccat-co hCNGA3 (A) or uninjected (B)...... 184 Figure 5.15: Photopic ERG response in cpfl5 mice treated at advanced stage ...... 185 Figure 5.16: Multielectrode array data of C57BL/6J and cpfl5 mice treated or untreated with subretinal injection of AAV8-1.75M M8 –ccat-co hCNGA3 ...... 187 Figure 5.17: Cone pedicles in a C57BL/6J murine retina of 8-9 months of age ...... 189 Figure 5.18: Cone pedicles in a cpfl5 murine retina of 8-9 months of age ...... 191 Figure 5.19: Cone pedicles in a cpfl5 murine retina of 8-9 months of age treated at 6 months of age ...... 193 Figure 5.20: Cone pedicles in a cpfl5 murine retina of 14 months of age ...... 195 Figure 5.21: Cone pedicles in a cpfl5 murine retina of 14 months of age treated at 12 months of age ...... 197 Figure 5.22: Signal intensity of Gpr179 staining at cone pedicle bases in C57BL/6J and late treated or untreated cpfl5 murine retinas ...... 200 Figure 5.23: Connectivity of cone pedicles and rod bipolar cells in a C57BL/6J of 8-9 months of age ...... 203 Figure 5.24: Connectivity of cone pedicles and rod bipolar cells in an untreated cpfl5 of 8-9 months of age ...... 205 Figure 5.25: Connectivity of cone pedicles and rod bipolar cells in a treated cpfl5 of 8-9 months of age ...... 207 Figure 5.26: Connectivity of cone pedicles and type 7 cone bipolar cells in cpfl5-gus-gfp mice ...... 209

Figure 5.27: Connectivity of cone pedicles and type 7 cone bipolar cells in treated cpfl5-gus-gfp mice ...... 211 Figure 5.28: Connectivity of rod spherules and type 7 cone bipolar cells in cpfl5-gus-gfp mice ...... 213 Figure 5.29: Connectivity of rod spherules and type 7 cone bipolar cells in cpfl5-gus-gfp mice ...... 214

List of Tables

Table 2.1: Thermocycling conditions for genomic DNA extraction ...... 62 Table 2.2: Primer pair for extracting a 2kb GNB3 promoter fragment (2032 base pairs) ...... 62 Table 2.3: Primer pair for extracting an OPN1MW promoter fragment (689 base pairs) ...... 62 Table 2.4: Primer pair for introducing a XbaI site in 5’UTR of green opsin gene ...... 69 Table 2.5: Primer pair for removal of additional 4 nucleotides in 5’UTR of green opsin gene ...... 73 Table 2.6: A primer pair, probe and amplicon sequences for SV40 ...... 78 Table 2.7: A primer pair, probe and amplicon sequences for ITR ...... 78 Table 2.8: List of primary antibodies ...... 81 Table 2.9: List of Secondary antibodies (Alexa Fluor® dye conjugated) ...... 82 Table 2.10: List of primary antibodies for flat mount retina ...... 83 Table 2.11: List of Secondary antibodies (Alexa Fluor® dye conjugated) for flat mount retina ...... 83

Abbreviations

(r)AAV (recombinant) adeno associated virus AO-SLO Adaptive optics scanning laser ophthalmoscopy ATF6 Activating transcription factor 6A CAR Cone arrestin CMV Cytomegalovirus CNGA3 Cyclic nucleotide-gated alpha 3 CNGB3 Cyclic nucleotide-gated beta 3 co Codon optimized non-co Non- codon optimized Cpfl5 Cone photoreceptor function loss 5 DNA Deoxyribonucleic acid ERG Electroretinography hEB Human embryonic body-derived retinoid FAF Fundus autofluorescence FITC Fluorescein isothiocyanate GCL Ganglion cell layer (e)GFP (enhanced) Green Fluorescent Protein Gpr179 G Protein-Coupled Receptor 179 GNAT2 Guanine nucleotide binding protein subunit alpha transducin 2 GNAT3 Guanine nucleotide binding protein subunit alpha transducin 3 GNB3 Guanine nucleotide binding protein subunit beta 3 GNGT8 Guanine nucleotide binding protein subunit gamma transducin 8 GUS Gustducin or Gnat3 HEK 293T cell Human embryonic kidney 293 cell stably transfected with SV40 T- antigen INL Inner nuclear layer IPL Inner plexiform layer ITR Inverted terminal repeat LCR Locus control region LGB lateral geniculate body MEA Multielectrode array mRNA messenger Ribonucleic acid NIR-FAF Near infrared-wavelength fundus autofluorescence Nrl Neural retina leucine zipper gene OCT Optical coherence tomography ONL Outer nuclear layer

OPL Outer plexiform layer OPN1LW Long wave sensitive opsin (L opsin) or red cone opsin OPN1MW Middle wave sensitive opsin (M opsin) or green cone opsin OPN1SW Short wave sensitive opsin (S opsin) or blue cone opsin PBS Phosphate-buffered saline PCR Polymerase chain reaction PDE6C alpha subunit of cone cGMP-specific 3',5'-cyclic phosphodiesterase PDE6H gamma subunit of Cone cGMP-specific 3',5'-cyclic phosphodiesterase PKCα Protein kinase C alpha PFA Paraformaldehyde PNA Peanut agglutinin qRT-PCR quantitative real-time PCR RPE Retinal pigment epithelium RORE Retinoic acid receptor-related orphan receptor response element SW-FAF Short wavelength fundus autofluorescence UTR Untranslated region

Chapter I. Introduction

In this chapter, how vision is processed through the eye to the brain will be summarised, followed by signal transduction mechanisms in the retina. Secondly, clinical, genetical and physiological aspects of congenital achromatopsia will be characterised. Thirdly, the mechanism and clinical applications of gene therapy for eye and other organs will be reviewed. Subsequently, cone-specific promoters and their potential to be used in gene therapy will be discussed followed by preclinical gene therapy studies on achromatopsia animal models. Finally, the subject of synaptic connectivity between photoreceptors and bipolar cells in the murine retina will be explored.

Visual pathway As vision inputs about 80% of the information we perceive from the outside world, with the loss of visual information, we face significant difficulty in our daily lives, therefore it is essential to develop treatments to restore impaired visual function in patients to improve their quality of life. Vision is perceived through the eye by converting the light stimulus to an electrophysiological response. The response is transmitted to the lateral geniculate body (LGB) in the thalamus through the optic nerve, except for the response for pupillary response, saccades and circadian rhythms (non-image forming visual response) which directly outputs into the midbrain. In this process, the response from nasal visual field crosses at the optic chiasm and transmits to the contralateral LGB, whereas the response from the temporal visual field does not cross at the optic chiasm and transmits to the ipsilateral LGB. Those inputs to the LGB form a retinal mapping reflecting the position where the response comes from. And also, those responses will be classified and make inputs into relevant layers in LGB depending on the origin (ipsilateral or contralateral) and information (movement, depth, colour and shape) of the response. Then the LGB sends the visual information to the primary visual cortex followed by the visual association area, and finally the light stimulus will be perceived as an image.

The eye The eye consists of transparent media and a sensor of light. The former consists of the cornea and crystalline lens, and the latter is called the retina. The cornea and crystalline lens refract a light to be focused on the retina. The retina is the first place

the visual response is processed. Although the cornea and the lens can be replaced by allotransplantation or implantation of artificial lens to restore their function, the retina is difficult to replace following degeneration. Recently there have been reports of replacing the outermost layer of retina with cultured retinal cells differentiated from stem cells (Gonzalez-Cordero, Kruczek et al. 2017, Mandai, Fujii et al. 2017), however, their functional integrity with secondary neurons is uncertain. Therefore, gene therapy is a promising therapeutic strategy for relatively early degenerative stages where the retinal structure is still maintained.

I.2.1. The Retina The retina is mainly composed of three layers with the receptors of light located in the outermost cell layer, called photoreceptor cell layer (or outer nuclear layer (ONL)). The second cell (inner nuclear layer (INL)) layer consists of bipolar cells, horizontal cells and amacrine cells, and third cell layer (ganglion cell layer (GCL)) is composed of amacrine cells and ganglion cells. Synaptic contacts are made between adjacent cell layers, and their processes form the outer (OPL) or inner (IPL) plexiform layers. The main information streams vertically from the photoreceptor cells (outer nuclear layer) via bipolar cells to ganglion cells, and the different type of information (movement, depth, colour and shape) will be transmitted by the specific subtypes of bipolar cells and ganglion cells. The horizontal and amacrine cells serve to modify the response contacting laterally to photoreceptor cells and ganglion/bipolar cells, respectively (Figure 1.1).

Figure 1.1: Retinal layers Outer (ONL) or inner (INL) nuclear layer, outer (OPL) or inner (IPL) plexiform layers, ganglion cell layer (GCL), RGC (retinal ganglion cell). (Original published in Nature Reviews Neuroscience volume 15, pages 615–627 (2014). Copyright licence number:4487240498511)

The Cone and Rod photoreceptor The mammalian retina is able to perceive over 9 log units of light intensities by using two major distinct populations of photoreceptors (Ronning, Allina et al. 2018). One is rod photoreceptors for nocturnal (scotopic) vision and the other one is cone photoreceptors for diurnal (photopic) vision. Under the mesopic condition between scotopic and photopic conditions, both rod and cone photoreceptors contribute to vision. The rod photoreceptor is believed to have developed in order to adapt to dim light levels in the environment during a nocturnal bottleneck in evolutionary history of mammals (Heesy and Hall 2010). Although we now mostly spend our lives in a diurnal environment, human photoreceptors consist of 95% rod photoreceptors and only 5% cone photoreceptors. The rod photoreceptor has higher sensitivity at lower light levels and can operate down to single photon levels, whereas the cone photoreceptor cannot operate at such low levels of input due to larger noise within the cells. The rod photoreceptors are distributed mainly at the paracentral to peripheral areas of the retina and serve for peripheral vision in a nocturnal environment. On the other hand, the cone photoreceptors form a high density area called the fovea in the center of the visual axis, and especially in the central part of fovea called foveola (corresponds to 1.25 degree of visual angle), where photoreceptors are exclusively cone photoreceptors (Curcio, Sloan et al. 1990). Although the foveola is less than 1% of total retinal area, projection to visual cortex from the fovea occupies up to 16% of visual cortex surface area (Horton and Hoyt 1991, Hadjikhani and Tootell 2000, Baseler, Brewer et al. 2002). Also the structure of the foveola enables cone photoreceptor system to achieve high spatial acuity in central vision. Compared with the rod photoreceptor system, the cone photoreceptor system has features of trichromatic colour vision, high contrast sensitivity, high speed of response, fast adaptation and recovery to light stimulus. These features enable the cone photoreceptor system to operate in a diurnal environment, where the rod photoreceptor becomes saturated (Lamb 2016).

The phototransduction cascade The photoreceptor cell has four compartments: outer and inner segment, cell body and synaptic terminal. Within the outer segment, a light stimulus is processed and converted into an electrical signal. This process is called phototransduction and consists of several steps, starting from light stimulus onto an opsin molecule followed by activation of transducin, subsequent activation of phosphodiesterase (PDE), break- down of cyclic guanosine monophosphate (cGMP), closure of cyclic nucleotide-gated ion (CNG) channel, and hyperpolarization of the membrane potential.

At the photoreceptor synaptic terminal, the hyperpolarization of membrane potential leads to closure of voltage-gated calcium channels, decreased intracellular concentration of Ca2+ and reduced release rate of glutamate. The decrease rate of glutamate release happens in relation to the luminance change. In the end, the decreased rate of glutamate release depolarizes or hyperpolarizes the bipolar cells depending on the glutamate receptors expressed on the corresponding bipolar cells. Then the electrical signals are transmitted to LGB via the ganglion cells. Although the cone and rod photoreceptors have the same phototransduction cascade, using different isoforms of the proteins makes each type of photoreceptor kinetically distinct. In the case of cone phototransduction cascade, the following isoforms of proteins are used (Ingram, Sampath et al. 2016, Michalakis, Becirovic et al. 2018). Opsin (OPN1LW (red opsin), OPN1MW (green opsin), OPN1SW (blue opsin)) Transducin (GNAT2, GNB3, GNGT8) PDE6 (PDE6C, PDE6H) CNG (CNGA3+CNGB3) Since one of three spectrally distinct opsin proteins is exclusively used in each cone photoreceptor, photopic vision is able to distinguish colours by comparing inputs from different opsin expressing cone photoreceptors. In the murine retina, only green and blue opsins are used, but in human retina, red, green and blue opsins are used. Whereas scotopic vision only uses rhodopsin and is intrinsically colour blind.

Achromatopsia Inherited retinal disease is one of the major causes of blindness in developed countries and 1 in 3000 people are affected from progressive visual impairment (Bessant, Ali et al. 2001). Treatments have been developed for other major causes of blindness such as cataract, glaucoma, diabetic retinopathy and age-related macular degeneration, however there are no effective treatments for inherited retinal diseases. Therefore, development of new treatments for inherited retinal diseases is of great of interest. One of the experimental treatment strategies for inherited retinal diseases is gene therapy. In 2006, a few groups performed clinical trials of gene therapy for Leber Congenital Amaurosis (LCA) due to RPE65 gene mutations and observed primarily that it was safe with some behavioural test improvements following gene therapy (Bainbridge, Smith et al. 2008). However, for most studies the treatment effect was modest and had a relatively short-term duration (Bainbridge, Mehat et al. 2015, Petit, Khanna et al. 2016). These results could be explained by the theory that gene therapy could slow down the progression of the disease temporarily but could not stop the long- term degeneration. The question that arose from here was whether gene transduction

did not last long-term or gene supplementation levels were not high enough to halt degeneration. Long-term efficacy of gene therapy for inherited retinal disease might be more amenable for less progressive inherited retinal diseases such as achromatopsia.

I.3.1. Prevalence Achromatopsia is one of the cone dysfunction syndromes and an autosomal recessive disease that affects 1 in 30000 to 50000 for Caucasians (Sharpe LT 1999). Only limited information of prevalence for other ethnic groups is available. For example, the prevalence in Arab-Muslims in Jerusalem was reported to be 1 in 5000, but it was 1 in 45000 in the Jewish population in the same region (Zelinger, Cideciyan et al. 2015). In an extreme case, a high prevalence of 4 to 10 % was reported in an island of Pingelap due to a founder mutation in the CNGB3 gene (Brody, Hussels et al. 1970).

I.3.2. Clinical symptoms Achromatopsia is characterized by cone photoreceptor dysfunction, such as severe colour vision deficit, decreased visual acuity and photophobia. Pendular nystagmus becomes obvious within a month after birth and may be a main finding in infants, but it may be slightly less prominent later in life. In most cases, patients develop their symptoms in the first decade, thereafter progress of symptoms is thought to be relatively stable (Aboshiha, Dubis et al. 2014, Sundaram, Wilde et al. 2014, Zobor, Werner et al. 2017).

Complete and incomplete achromatopsia There are two subtypes of phenotypes in achromatopsia, complete and incomplete achromatopsia. Complete achromatopsia is also called rod monochromatism and characterized by a severe phenotype, complete loss of colour vision, lower visual acuity typically around 20/200 or less than that, and no photopic responses in electroretinography (ERG). Whereas incomplete achromatopsia is a rare subtype and characterized by a milder phenotype, residual colour vision, mild visual acuity loss ranged from 20/80 to 20/200, and a subtle photopic ERG response (Pokorny, Smith et al. 1982, Aboshiha, Dubis et al. 2016).

I.3.3. Genetics Recent progress in next generation sequencing allows to identify genetic causes more comprehensively and helps to increase our understanding on inherited diseases. Now in addition to Sanger single gene sequencing, multi gene sequencing panel and whole exome or genome sequencing are available (Hafler 2017, Duncan, Pierce et al. 2018). Recently, mutations in ATF6, encoding activating transcription factor 6A, were

identified to be pathogenic mutations in achromatopsia by whole exome sequencing (Kohl, Zobor et al. 2015). Achromatopsia is inherited in an autosomal recessive manner and six genes have been reported to cause congenital achromatopsia. Apart from ATF6, all the other genes are related to the cone phototransduction cascade, CNGB3, CNGA3, GNAT2, PDE6C and PDE6H. In particular, CNG channel gene mutations account for about 75% of all reported cases (50% and 25% for CNGB3 and CNGA3, respectively) (Remmer, Rastogi et al. 2015, Zobor, Zobor et al. 2015, Michalakis, Schon et al. 2017).

CNGA3 and CNGB3

I.3.3.1.1. The CNG channel The CNG channel belongs to the superfamily of pore-loop cation channels and is regulated by binding of cGMP to the cyclic nucleotide binding domain (CNBD). The Cone CNG channel forms heterotetramers with three α subunits and one β subunit, which are encoded by CNGA3 and CNGB3, respectively. CNGA3 gene locates in chromosomal locus of 2q11.2, is composed of eight exons and encodes a 694 amino acids long protein. On the other hand, CNGB3 gene locates in 8q21.3, is composed of 18 exons and encodes 809 amino acids long protein. Both CNG α and β subunits consist of six transmembrane α-helices, and the reentrant pore loop structure is formed between segments S5 and S6. N-terminus and C-terminus are located in cytosolic compartment and linked to S1 and S6, respectively. The CNBD is situated near the C- terminus and is connected to S6 by a C-linker. Binding of cGMP to the CNBD causes rotational and conformational change to the C-terminus including the C-linker and leads to open the channels pore (Michalakis, Becirovic et al. 2018). The CNG α subunit has more crucial role to form functional CNG channel than CNG β subunit. It has been shown in mice that α subunits by themselves can form low functional homotetramers CNG channel, whereas β subunits cannot form functional homotetramer channel but work as modulator of light response of heterotetramer channels (Shuart, Haitin et al. 2011, Ding, Thapa et al. 2016).

I.3.3.1.2. Mutations in CNGA3 and CNGB3 genes Reflecting this functional difference of CNG α and β subunits, the CNGA3 gene is likely to be less resistant to missense mutations which result in single amino acid substitution than the CNGB3 gene, and CNGB3 mutations are likely to cause null alleles in order to be pathogenic. In fact, among more than 80 mutations reported in CNGA3 in achromatopsia patients, up to 80% of mutations are missense mutations in a highly conserved region in other isotypes of CNG gene (ex. CNBD), and nonsense, insertion or deletion mutations are less frequent. Whereas, among more than 40 mutations

reported in CNGB3 in achromatopsia patients, more than 90% of mutations are small indels, splice site or nonsense mutations which cause severely less functional truncated channel proteins, and less than 10% are missense mutations or copy number variants. Especially, the c.1184delC mutation (p.Thr383IlefsTer13) is the most common mutation known and accounts for 70% of CNGB3 mutation alleles in achromatopsia patients and 40% of all reported mutation alleles in achromatopsia patients (Kohl, Jagle et al. 1993, Mayer, Van Cauwenbergh et al. 2017, Michalakis, Schon et al. 2017). Although mutations in CNGB3 gene are the most common in reported achromatopsia cases, this could be only true for Caucasians as the majority of reports had been from Europe and North America. Recently, a report from Jerusalem revealed that 84% (41/49) of families were affected by CNGA3 mutations and only 16% (8/49) of families were affected by CNGB3 mutations (Zelinger, Cideciyan et al. 2015). Another report from China showed CNGA3 mutations were identified in 80% (8/10) of families of achromatopsia (Liang, Dong et al. 2015). Therefore, further genetic studies from other regions and ethnic groups are expected to characterise the worldwide incidence and distribution of gene mutations in achromatopsia.

GNAT2 GNAT2 is the cone specific α subunit of transducin which is a type of heterotrimeric G- protein. The GNAT2 is a 694 amino acids long protein encoded by the GNAT2 gene located in chromosomal locus 1p13.3 and is composed of eight exons. The GNAT2 is a key component that modulates the kinetics of cone phototransduction. Following the light stimulus to the cone opsin, the GNAT2 dissociates from inhibitory βγ subunits and activates the PDE6 (Aligianis, Forshew et al. 2002, Kohl, Baumann et al. 2002). Ten different GNAT2 mutations in 9 unrelated families of achromatopsia have been reported and considered to account for less than 2% of all reported achromatopsia cases. Except the c.461+24G>A mutation, all the other reported mutations result in premature truncated proteins that lacks the domain interact with the opsin and PDE. On the other hand, the c.461+24G>A mutation was shown to cause an splice defect together with low production of normal spliced mRNA (Kohl, Jagle et al. 1993, Kohl, Baumann et al. 2002, Michaelides, Aligianis et al. 2003).

PDE6C and PDE6H PDE6 is composed of two catalytic α subunits (PDE6C) and two inhibitory γ subunits (PDE6H). The PDE6C, an 858 amino acid long protein, is encoded by PDE6C gene located in chromosomal locus of 10q23.33 which is comprised of 22 exons. The PDE6H, an 83 amino acid long protein, is encoded by PDE6H gene located in chromosomal locus of 12q12.3 which is comprised of 3 exons (Kohl, Jagle et al. 1993).

Nineteen different mutations in PDE6C gene of 13 unrelated families diagnosed with achromatopsia have been reported and mostly show complete achromatopsia phenotype (Chang, Grau et al. 2009). Whereas only one nonsense mutation of PDE6H gene in 2 unrelated families has been described so far. The phenotype of the patients were incomplete achromatopsia, although the mutation results in a 85% truncated protein which lacks a conserved transducin binding domain and PDE6 inhibitory domain (Kohl, Coppieters et al. 2012, Brennenstuhl, Tanimoto et al. 2015).

ATF6 ATF6 is a transcription factor to regulate the unfolded protein response and required for cellular endoplasmic reticulum homeostasis. As ATF6 is a ubiquitous protein, the mechanism that the defect in ATF6 causes cone photoreceptor specific dysfunction is unknown. However, a recent report suggested its role for directing mesodermal differentiation and it may have some role in the formation of the unique avascular zone in cone photoreceptor rich fovea and the formation of the fovea itself (Kohl, Zobor et al. 2015, Kroeger, Grimsey et al. 2018). ATF6, a 670 amino acid long protein, is encoded by ATF6 gene located in chromosomal locus 1q23.3 which is comprised of 16 exons. Ten different mutations in ATF6 gene of 12 unrelated families of achromatopsia have been reported. Eight mutations are nonsense, small insertions or deletions, or splice defects mutations and result in severely truncated protein. Two missense mutations also have been described and one of them are located in basic leucine zipper domain region which has a crucial role (Kohl, Jagle et al. 1993). Originally, a gene mutation in ATF6 gene was thought to only cause achromatopsia, but a recent report showed that the homozygous of c.1691A>G (p.Asp564Gly) mutations resulted in cone-rod dystrophy (Skorczyk-Werner, Chiang et al. 2017).

Relations of genotype and phenotype Although there is not much evidence on the difference of phenotype in CNGA3 and CNGB3 mutations as a whole group (Aboshiha, Dubis et al. 2014, Sundaram, Wilde et al. 2014), individual achromatopsia is heterogeneous not only genotypically but also phenotypically. Firstly, different gene mutations in the same gene (CNGB3, CNGA3 and GNAT2) can be the cause of complete and incomplete achromatopsia phenotypes (Kohl, Jagle et al. 1993, Aboshiha, Dubis et al. 2016). Other mutations in CNGB3, CNGA3, PDE6C and ATF6 were also associated with progressive cone-rod dystrophy (Kohl, Jagle et al. 1993, Wissinger, Gamer et al. 2001, Michaelides, Aligianis et al. 2004, Thiadens, den Hollander et al. 2009, Skorczyk-Werner, Chiang et al. 2017). These differences of

severity of phenotypes by different mutations in the same gene could be explained by how a mutation affects the functionality of the gene. For example, there is a clinical phenotype named oligocone trichromacy characterized by severe loss of photopic ERG response but almost normal colour vision. In the oligocone trichromacy patients, pendular nystagmus or photophobia are generally mild or absent, and visual acuity is ranged from 50/200 to 120/200, which looks like milder phenotypes of incomplete achromatopsia. The oligocone trichromacy is inherited by autosomal recessive manner, and hypomorphic mutations of CNGA3, CNGB3, PDE6C, GNAT2 have been claimed to be responsible (Andersen, Christoffersen et al. 2010, Michaelides, Rha et al. 2011, Aboshiha, Dubis et al. 2016). However, it has been described that the same gene mutation in a gene can be the cause of achromatopsia and cone dystrophy. For instance, the most common gene mutation in achromatopsia patients, the c.1184delC mutation (p.Thr383IlefsTer13), can be the cause of not only complete and incomplete achromatopsia but also progressive cone dystrophy. It was suggested that the difference in phenotypes by the identical mutations might be affected by other genetic modifiers of disease or environmental factors (Nishiguchi, Sandberg et al. 2005). Identification of the genetic modifiers of a disease may contribute to understand variation of phenotypes and lead to develop a novel therapeutic strategy (Duncan, Pierce et al. 2018).

I.3.4. Ocular findings

Anterior segment Achromatopsia patients are not reported to have abnormalities in anterior segment of the eye. Hyperopia (far-sightedness) has been reported as a typical refractive error (Aboshiha, Dubis et al. 2016). However, in a genetic study from China, seven out of 13 achromatopsia patients due to CNGA3 were myopic (short-sighted) <-2, and five out of 13 patients were hyperopic >2D (Liang, Dong et al. 2015) . Another genetic study from Netherlands also described that similar incidence was found of hyperopia >+2 diopter (31%) and myopia <-2 diopter (25%) in 79 achromatopsia patients (Thiadens, Slingerland et al. 2009). A different report from the same group suggested that the both hyperopia and myopia were present more frequently than the control group (Thiadens, Somervuo et al. 2010). Both side of refractive errors may be more frequent in achromatopsia patients, but the incidence could also be affected by the ethnic background of patients.

Posterior segment

Fundus appearance is typically normal or shows only reduced or absent foveal reflex. Mottling or pigmentation abnormalities of retinal pigment epithelium can be observed. Atrophic change in fovea may also be happened especially in older patients (Thiadens, Somervuo et al. 2010, Langlo, Patterson et al. 2016).

I.3.5. Psychophysical tests

Visual acuity Typical best corrected visual acuity (BCVA) is ranged from 20/200 or less in complete achromatopsia and from 50/200 to 20/200 in incomplete achromatopsia (Aboshiha, Dubis et al. 2016). It has been reported that BCVA got worse from infancy to adult in 12 % of a complete and incomplete achromatopsia patients (n = 79) (Thiadens, Slingerland et al. 2009), which indicates a progressive nature of achromatopsia.

Visual fields Visual fields can be tested by kinetic or static visual field testing. In either testing, fixation instability by nystagmus and photophobia could affect robustness and reproducibility of results and the results may be variable. As Goldman kinetic visual field testing is manually operated, it might be useful than automated visual field testing for the patients who have severe nystagmus or photophobia. Peripheral visual field is normal but a small central scotoma may be detected in some cases (Kohl, Jagle et al. 1993). For the detailed retinal sensitivity testing in the macula, microperimetry has been used in several studies and showed low or absent retinal sensitivity in the fovea (Genead, Fishman et al. 2011, Aboshiha, Dubis et al. 2014, Sundaram, Wilde et al. 2014, Zobor, Werner et al. 2017).

Colour vision tests As cone photoreceptors in achromatopsia patients are severely less functioning or non- functional and only rod photoreceptors are able to response to a light stimulus, any colour would be perceived as monochromatic without any neutral point and confusion colour, unlike in colour blindness. The brightest part of the spectrum would be matched to the maximum absorption wave length of rhodopsin, 507nm. Any spectrum as its wavelength gets apart from 507nm, would be perceived as darker, especially deep red. So patients may be able to judge a colour by the difference of brightness of an object that they perceive (Sharpe LT 1999). The pseudoisochromatic plate test (i.e. Ishihara test) is used for screening of colour vision defects. And the severity of the colour vision can be tested by hue discrimination/arrangement test (i.e. Panel D-15 test or Munsell 100-Hue test).

Complete achromatopsia patients typically are not able to identify any plates in Ishihara test except the first demonstration plate, and do not show any specific axis of colour confusion in Munsell 100-Hue test. But the patients may show a tendency of crossing errors to fall a scotopic (rod monochromacy) axis along 5 to 14 in Panel D-15 test. Whereas incomplete achromatopsia patients may discriminate some plates and show partially a certain colour confusion axis in hue tests (Kohl, Jagle et al. 1993). Rayleigh anomaloscope equation is used for definite diagnosis of red-green colour blindness. It is also used for achromatopsia patients but a similar pattern as with blue cone monochromacy patients may be found. Complete achromatopsia patients are able to colour match any mixture of red and green colour to yellow colour, and the luminosity match only occurs at the red shifted side as the longer wavelength is perceived darker. Whereas some incomplete achromatopsia patients may show colour match only at the side of the red shifted end (Smith, Pokorny et al. 1978, Kohl, Jagle et al. 1993, Genead, Fishman et al. 2011).

Dark adaptometry Dark adaptation curve is the time course of recovery of bleached opsins from exposure to a light stimulus. Normal dark adaptation curve is composed of two phase (biphasic curve). Early phase is related to fast recovery of cone photoreceptor system with low sensitivity, it reaches the cone plateau state in about 10 minutes. Late phase is related to slow recovery of rod photoreceptor system, which is not fully recovered and remains desensitised by the cone plateau state and will take another 30 minutes to reach up to 4000 fold higher sensitivity than the cone plateau. Transition from the cone plateau to late phase is called cone-rod break (Kohlrausch kink) (Lamb 2016). Since achromatopsia patients do not have cone photoreceptor system, the lack of early phase in the dark adaptation curve (monophasic curve) is reasonable, but there have been conflicting reports that achromatopsia patients had biphasic or monophasic curve (Hecht, Shlaer et al. 1948, Sloan 1954, Blackwell and Blackwell 1961, Sloan and Feiock 1972, Farkas Á 1999). It could be possible that some patients in those reports had some residual cone function and showed biphasic curve. Another disagreement is that the dark adaptation curve threshold of achromatopsia patients is higher than normal in some but not all reports. Aboshiha et.al. proposed that this disagreement might be due to the different position and size of the stimulus in the test, because the difference of the thresholds was not observed when the stimulus was smaller and more peripherally located where rod photoreceptor density is maximum. However, there is also a possibility that rod photoreceptors in achromatopsia patients have minor defects affected by surrounding cone photoreceptor degeneration. Overall, a protocol to measure dark adaptation curve needs to be standardized and assessment

of residual cone photoreceptor function should also be carefully evaluated to make a conclusion of these inconsistent reports (Aboshiha, Luong et al. 2014).

I.3.6. Full field Electroretinography Electroretinography (ERG) test measures neuronal electrical responses from the retina. Depending on the background (light intensity, spectrum) and stimulus condition (single flash, flicker (repetitive stimulation), light intensity, spectrum), responses derived from all or subsets of photoreceptor (red-green cone, blue cone and rod photoreceptor) to bipolar and ganglion cells can be recorded. In a single flash ERG recording, an initial negative response (a-wave) is originated from photoreceptor cell hyperpolarisation and the following positive response (b-wave) is believed to be from bipolar and Muller cells. Subsequently, a negative response from ganglion cells follows (scotopic threshold response (STR) or photopic negative response (PhNR) in scotopic or photopic conditions, respectively). And then gradual upward currents (c-wave) from the interaction of retinal epithelial cells and photoreceptors cells can be traced. Oscillatory potentials (OPs) on the upward slope of b-wave can be easily recorded in mesopic conditions. They are thought to be originated from amacrine cell activity (Sieving and Nino 1988, Perlman 1995, Wachtmeister 1998, Viswanathan, Frishman et al. 1999).

Photopic ERG In principle, ERG response from photopic background (photopic ERG) is deemed to be derived from only cone photoreceptors as rod photoreceptors are saturated on the bright background, whereas ERG response from scotopic background (scotopic ERG) is deemed to derive from only rod photoreceptors as cone photoreceptors are not sensitive enough on the dark background. ERG response from high frequency flicker stimulus on photopic background (i.e. 30Hz flicker ERG), which a rod photoreceptor is not able to follow due to its slower kinetics, is also thought to be originated exclusively from cone photoreceptors. In general, complete achromatopsia patients are not able to show photopic or flicker ERG response, whereas incomplete achromatopsia patients may exhibit severely reduced photopic or flicker ERG response depending on remaining cone photoreceptor function (Kohl, Jagle et al. 1993). However, it was shown that the 30Hz flicker ERG response was detected in all 36 achromatopsia patients due to CNGA3 and CNGB3 mutations tested by computer averaging of the recording, but was previously nonrecordable without computer averaging. This suggests that some residual cone photoreceptor function may remain even in complete achromatopsia patients, although there is a possibility that the computer averaging might pick up rod photoreceptor

activity in these conditions (Andreasson, Sandberg et al. 1988, Nishiguchi, Sandberg et al. 2005). One report showed that residual photopic ERG response of incomplete achromatopsia patients at middle age (37 and 51 years old) had lost their response after 12 or 6 years (Khan, Wissinger et al. 2007), indicating progressive loss of residual cone function in incomplete achromatopsia. Another report also described that the progressive photopic ERG response reduction in incomplete achromatopsia patients together with worsening of macular appearance and visual acuity from childhood to adult during a mean follow- up of 15 years (range: 5 to 25 years) (Thiadens, Slingerland et al. 2009). These two reports suggest that achromatopsia is actually progressive although it belongs to a clinical entity, cone dysfunction syndrome, which assumes a stationary nature of the disease.

Scotopic ERG Scotopic ERG response in achromatopsia patients can be either normal or subnormal, although there is no evidence of peripheral visual defects or progression of reduced scotopic ERG response in achromatopsia patients. A similar finding was also reported in blue cone monochromatism and cone dystrophy patients (Khan, Wissinger et al. 2007, Moskowitz, Hansen et al. 2009, Wang, Khan et al. 2012). Although the gene mutations in those patients specifically affect cone photoreceptors, the deficit in rod photoresponse suggests secondary rod photoreceptor dysfunction or loss. Actually reduced rod photoreceptor density was reported in achromatopsia patients (Carroll, Choi et al. 2008). Likewise, non-autonomous rod photoreceptor death in primary cone photoreceptor degeneration has been described in a mouse model of primary cone degeneration and a cone photoreceptor specific PDE deficient zebrafish model (Stearns, Evangelista et al. 2007, Cho, Haque et al. 2013). Also, there have been reports that proposed near normal scotopic ERG response in an achromatopsia mouse model due to a Gnat2 mutation (cpfl3) (Chang, Dacey et al. 2006) and reduced scotopic ERG response in an achromatopsia mouse model due to a Cnga3 gene knockout (Cnga3-/-) and Atf6 gene knockout (Atf6-/-) (Xu, Morris et al. 2012, Kohl, Zobor et al. 2015). However, in the latter mouse models, the reduced scotopic ERG response could only be seen at light stimulus intensity higher than -1.0 log cd/m2. Considering that the light stimulus intensity higher than -1.5 log cd/m2 under scotopic condition in mouse can generate response from cone photoreceptors as well (Tanimoto, Muehlfriedel et al. 2009), the reduction in scotopic ERG response in the Cnga3-/- might reflect the loss of cone photoreceptors and not necessarily a rod photoreceptor dysfunction. In the opposite situation, where rod photoreceptors primarily degenerate due to a rod photoreceptor specific gene mutation, non-autonomous loss of cone photoreceptors

has been well known as secondary cone photoreceptor dysfunction is commonly seen in retinitis pigmentosa patients (Cideciyan, Hood et al. 1998, Hartong, Berson et al. 2006, Bramall, Wright et al. 2010). The mechanisms for non-autonomous cone photoreceptor death have been proposed so far were loss of rod-derived cone viability factor (Leveillard, Mohand-Said et al. 2004), release of rod-derived toxic metabolites (Ripps 2002), loss of neurotrophic factor from vasculature (Otani, Dorrell et al. 2004), hyperoxia and oxidative stress (Shen, Yang et al. 2005, Komeima, Rogers et al. 2006, Punzo, Kornacker et al. 2009) and activation of microglia (Gupta, Brown et al. 2003). In case of the secondary rod photoreceptor death in primary cone photoreceptor degeneration, the mechanism for it has not been well characterized so far. To identify the mechanism would be beneficial for development of neuroprotective therapy for non- autonomous cell death, which is common phenomenon in neurodegenerative disease (Cho, Haque et al. 2013).

I.3.7. Retinal imaging The advent of non-invasive retinal imaging modalities makes more detailed pathological and morphological quantification of the retina possible in patients, which had never been possible by funduscopic examination alone. Association between topographical structural images acquired from the retinal imaging modalities and phenotype or retinal physiological function has been intensively studied. The retinal imaging modalities have been implemented to study pathogenesis, diagnose, follow up, make decision for and evaluate efficacy of treatment for retinal diseases. Also the retinal imaging modalities are believed to be useful to identify appropriate patients and evaluate the efficacy of treatment in gene therapy clinical trials for inherited retinal disease (Schmitz-Valckenberg, Holz et al. 2008, Gabriele, Wollstein et al. 2011, Yung, Klufas et al. 2016).

Fundus autofluorescence (FAF) It has been described that various tissues or substances in the eye have autofluorescence, for example the cornea and crystalline lens. And pathologically important fundus fluorophores are lipofuscin, melanin and melanolipofuscin in retinal pigment epithelium (RPE) or choroid, metabolic intermediates of lipofuscin in photoreceptor outer segments, and optic disc drusen. Clinically, blue light (488nm) or yellow-green light (510-585 nm) are used to excite lipofuscin, its metabolic intermediates and optic disc drusen. Whereas infra-red light (700-815nm) is used to excite melanin. The melanolipofuscin is excited by all of these lights as it has properties of both melanin and lipofuscin (Docchio, Boulton et al. 1991). The excited fluorophore will subsequently emit a light with longer wavelength than the excitation light during transition to ground state. In principal, FAF test evaluates retinal physiology through

pathological accumulation or loss of those fluorophores (Keilhauer and Delori 2006, Yung, Klufas et al. 2016). The FAF image acquired with blue or yellow-green light (Short wavelength fundus autofluorescence (SW-FAF)) mainly reflects lipofuscin in RPE and partly reflects metabolic intermediates of lipofuscin in photoreceptor outer segments. The lipofuscin is deposits in lysosomes of RPE originated from phagocytosed metabolic intermediates of the visual cycle in photoreceptor outer segments and it is known to accumulate with aging. In case of vitelliform lesions, it deposits in subretinal extracellular space (Sparrow, Gregory-Roberts et al. 2012). The lipofuscin is observed in a FAF image as highest autofluorescence at around 10 degree from the center of foveola decreasing toward peripheral and lowest in the foveola (Delori, Goger et al. 2001, Spaide and Klancnik 2005). On the other hand, the FAF image acquired with infra-red light (Near infrared- wavelength fundus autofluorescence (NIR-FAF) is thought to reflect melanin or melanolipofuscin in RPE or inner choroidal layer (Keilhauer and Delori 2006). The melanin is known to be an anti-oxidant and serve as photoprotection but decrease with age. On the other hand, the phototoxic lipofuscin and melanolipofuscin gradually accumulate. Especially the melanolipofuscin starts to deposit from middle age in contrast to decrease of melanin and is thought to be related to age related macular degeneration (Sarna 1992, Seagle, Rezai et al. 2005, Wang, Dillon et al. 2006, Rozanowski, Burke et al. 2008). The melanin or melanolipofuscin are observed in a FAF image as bright autofluorescence in the fovea.

I.3.7.1.1. FAF in normal and cone dystrophy subjects In the early stages of photoreceptor degeneration, the lipofuscin, melanolipofuscin or metabolic intermediates of lipofuscin are significantly accumulated in the lysosomes of RPE or photoreceptor outer segments, however in late or advanced stage of photoreceptor degeneration along with atrophy of RPE and photoreceptors, those deposits will be diminished. Accumulation of lipofuscin and melanolipofuscin in RPE or metabolic intermediates of lipofuscin in photoreceptor outer segments is observed as hyperfluorescence on the SW-FAF image, whereas loss of these deposits and melanin in atrophic retina results in hypofluorescence on both the SW-FAF and NIR-FAF (Spaide and Klancnik 2005, Yung, Klufas et al. 2016). It has been described that typically a hyperfluorescence in the fovea on the SW-FAF image expands annually from fovea to perifovea and may leave behind a hypofluorescence in the fovea as the progression of cone dystrophy or geographic atrophy (Holz, Bellman et al. 2001, Robson, Michaelides et al. 2008). And those FAF abnormalities have been shown to correlate with deficits in retinal function as measured by retinal sensitivity or electrophysiological response (Robson, Michaelides et al. 2008, Robson, Michaelides

et al. 2008, Oishi, Oishi et al. 2014). Therefore, FAF test is thought to predict photoreceptor viability and can be used as an indication for gene therapy in achromatopsia patients.

I.3.7.1.2. FAF in achromatopsia patients Similar to other imaging modalities, the FAF imaging is influenced by nystagmus, but also by photophobia due to the bright excitation lights used in the test. Although this may affect the rate of successful image acquisition in achromatopsia patients, a prospective longitudinal study was able to acquire set of FAF images from more than 80% of participants (Aboshiha, Dubis et al. 2014). And compared with the excitation light used in the SW-FAF imaging, the excitation light used in the NIR-FAF imaging is perceived less bright for achromatopsia patients, therefore the NIR-FAF imaging will contribute to successful and reproducible image acquisition (Matet, Kohl et al. 2018). The FAF image in the achromatopsia have been reported have similar pattern as had been observed in the cone dystrophy or geographic atrophy. On the SW-FAF image, the hyperfluorescence in the fovea is more likely to be observed in younger patients around 10 years old (Fahim, Khan et al. 2013, Aboshiha, Dubis et al. 2014, Matet, Kohl et al. 2018). Well-defined hypofluorescence in the fovea surrounded by parafoveal hyperfluorescence ring may be the most common feature on the SW-FAF image in the patients of following age. The hyperfluorescence ring likely to be less prominent in older age but mostly still remained (Fahim, Khan et al. 2013, Greenberg, Sherman et al. 2014, Matet, Kohl et al. 2018). And the area of the well- defined hypofluorescence in the fovea could be increase gradually with age (Aboshiha, Dubis et al. 2014). On the NIR-FAF image, usual hyperfluorescence in the fovea without central hypofluorescence is likely to be observed in younger patients (Matet, Kohl et al. 2018). The well-defined hypofluorescence in the fovea is also common finding as on the SW- FAF, however the surrounding hyperfluorescence ring may not be present. The size of the hypofluorescence in the fovea was reported to be larger age-dependently and also correlate with extent of disruption of cone outer or inner segments as determined by optical coherence tomography (Matet, Kohl et al. 2018). Whether a correlation exists or not between best corrected visual acuity (BCVA) or retinal sensitivity as measured by microperimetry (MP) under mesopic condition and the abnormal FAF image has been studied. The BCVA did not show a correlation with the abnormal FAF, possibly because the BCVA of achromatopsia patients tends to fall into small range due to cone photoreceptor dysfunction (Matet, Kohl et al. 2018). But MP under mesopic condition reflecting both cone and rod photoreceptor function was able to show significant difference of retinal sensitivity between patients who had hyperfluorescence and hypofluorescence in the fovea (Aboshiha, Dubis et al. 2014).

In summary, the FAF imaging provides information on the health of photoreceptor cells and the RPE. It is also able to show photoreceptor and RPE viability and possible correlation with mesopic retinal sensitivity in achromatopsia, which may allow to know the stage of the disease. Therefore the FAF imaging could be useful to follow the patients before and after a future gene therapy in order to observe biological changes in photoreceptor cells and RPE. Also the FAF imaging indicated progressive nature of achromatopsia as seen in cone dystrophy or geographic atrophy, although its progression rate is likely to be subtle (Aboshiha, Dubis et al. 2014).

Optical coherence tomography (OCT) Optical coherence tomography (OCT) is one of the most extensively used retinal image modalities after the advent of the first commercial model. The OCT non-invasively enables to visualize the integrity of laminar structure of the retina as well as choroidal layer, sclera and vitreous body at the level of a few micrometer axial resolution depending on bandwidth and centre wavelength of the imaging light source, which is not possible by funduscopic examination. (Kishi 2016, Kolb, Pfeiffer et al. 2018). Improvement in scan rate and in-build eye-tracking system makes it possible to acquire a sufficient quality of images from unstable eye movement patients including achromatopsia. Actually, in two independent longitudinal studies in achromatopsia patients, only 1 in 37 or 1 in 41 patient failed the OCT imaging. The OCT has similar mechanism to ultrasonography but instead of sounds used in the ultrasonography, the OCT uses lights. As the light has a shorter wavelength than the sound, it cannot visualise a thick non-transparent tissue but is able to achieve high axial resolution up to a few micrometers. The OCT provides information of reflectivity in the posterior segment of the eye. In general, a nerve fibre (synaptic) layer or membranous layer (ie. External limiting membrane (ELM) at the border of cell body and inner segment compartments of photoreceptor) are hyperreflective, whereas a cell layer is hyporeflective. Exceptions are hyporeflectivity in the Henle’s nerve fiber layer (long axons of cone photoreceptors in the fovea) as it runs more parallelly to the scanning light and RPE as it has hyperreflective melanin, or hyperreflectivity in the ellipsoid zone of inner segment (ISe) as outer half of the inner segment (ellipsoid zone) is packed with mitochondria and interdigitation zone where the outer segments of cone photoreceptors interdigitate with RPE (IZ) (Spaide and Curcio 2011, Staurenghi, Sadda et al. 2014). In particular, attenuation or absence of three hyperreflective bands of ELM, ISe and IZ from inner to outer segment of photoreceptor is a significant indicator of photoreceptor degeneration.

I.3.7.2.1. Foveal hypoplasia

One of the most common finding on the OCT of achromatopsia is fovea hypoplasia and could be found in 50 -80% of patients. At the foveola of patients with foveal hypoplasia, as well as shallow or absence of foveal pit, one or more retained inner retinal layers continuing from parafoveal retina are observed on the OCT image (Thiadens, Somervuo et al. 2010, Genead, Fishman et al. 2011, Thomas, Kumar et al. 2011, Sundaram, Wilde et al. 2014, Zobor, Werner et al. 2017). Particularly, all the achromatopsia patients due to ATF6 gene mutations were reported to have severe fovea hypoplasia compared with other genotypes, therefore the ATF6 gene was suggested to be associated to foveal development (Kohl, Zobor et al. 2015). In normal foveal development, the foveal pit starts to form by postnatal 1 week of age. The foveal inner retinal layers are gradually displaced peripherally behind the cone photoreceptor layer in the foveola. In parallel, cone photoreceptors migrate into the foveola and their axons elongate and form Henle’s nerve fibre layer. Finally, the fovea gets mature at around 15- 45 months of age (Hendrickson and Yuodelis 1984). Infants and young children with achromatopsia (mean age 40.6 months (range: 2.4 to 98.7), n = 10) were described to have fovea hypoplasia (in all patients) and follow up for on average 40.6 months (range: 1.4 to 120.9). The fovea hypoplasia persisted during the follow-up period but fovea developed more slowly than normal (Lee, Purohit et al. 2015). As the cone photoreceptor in achromatopsia faces cell death, dislocation of cell body, and malformation of outer segment (Harrison, Hoefnagel et al. 1960, Falls, Wolter et al. 1965), it is plausible that the integrity of photoreceptors in the fovea is affected and delayed or arrested foveal formation may happen.

I.3.7.2.2. Foveal retinal thickness Foveal total retinal (TR) thickness or outer nuclear layer + Henle’s nerve fiber layer (ONL+HL) thickness is often measured using an OCT image. A change in those thickness measurements may not necessarily indicate cone photoreceptor loss, because an achromatopsia patient could have variable degree of foveal hypoplasia and the length of HL can be shorter if the foveal hypoplasia is more severe. Although some reports have been treating ONL+HL thickness as ONL thickness, it is not possible to identify the border of ONL and HL as both layer have similar hyporeflectivity on an OCT image. It has been described that TR or ONL+HL thickness was significantly thinner and foveal depression was significantly shallower in achromatopsia patients compared with control subjects (Genead, Fishman et al. 2011, Thomas, Kumar et al. 2011, Yang, Michaels et al. 2014). And the ONL thinning in the achromatopsia patients was already found in comparison of infants and young children with achromatopsia or normal phenotype at mean age of around 40 months old (Lee, Purohit et al. 2015). Also ONL+HL thickness was reported to get thinner linearly with age in achromatopsia

patients (range: 4 to 64 years old). However, it is worth noting that this study only had 13 patients and except one patient aged 24 years old, all the other patients were either younger than 10 (mean age 7.3) or older than 40 (mean age 50) years old. Therefore the linear age-dependency could be misleading and cone photoreceptor degeneration was already completed in the first decade as classically believed, and thereafter the rate of thinning may be subtle. In fact, the same group published longitudinal follow up data and showed that children group (mean age 7.8, range: 5 to 9, n = 5) had mean reduction of TR or ONL+HL thickness around 10 to 12 µm during a mean follow-up period of 13 months (range: 11 to 17), whereas adult group (mean age 43, range: 42 to 45, n = 3) had only minimum variation around 0 µm during a mean follow-up period of 20 months (range: 13 to 25) (Thomas, McLean et al. 2012). Also three other reports from independent group showed no correlation between TR or ONL+HL thickness and age (Sundaram, Wilde et al. 2014, Langlo, Patterson et al. 2016, Zobor, Werner et al. 2017). However, there was a cross-sectional study in which the patient cohort had homogenous age distribution (range: 0 to 70 years old) and large number (n = 40) that showed age-dependent decrease of foveal photoreceptor layer (TR without inner retinal layer: PR) thickness. The cohort was unique in terms of homogeneous gene mutations, which was composed of CNGB3 gene mutations in 83% of patients (Thiadens, Somervuo et al. 2010). Also previously the most common gene mutation in the cohort was found out to be the c.1184delC mutation (p.Thr383IlefsTer13) in 80% of all patients (Thiadens, Slingerland et al. 2009). Considering that this homogenous gene mutation in the cohort and that this study was conducted in the Netherlands alone, it could assume that other genetic modifiers of disease or environmental factors was also relatively homogenous in the cohort than the other cohorts, therefore, the phenotype variation in each patient in each generation might be less than the other multinational cohorts with increased mutational heterogeneity and that resulted in the power to show the nature of age dependency in achromatopsia. Additionally, two recent longitudinal studies followed up for 20 or 13 months on average and did not show the age dependent decrease of TR or ONL+HL thickness in achromatopsia (Aboshiha, Dubis et al. 2014, Langlo, Erker et al. 2017), possibly due to the short follow up period relative to assumed slow progression rate in achromatopsia smaller than axial resolution of OCT imaging. Altogether, reduction of foveal retinal thickness in achromatopsia may be gradually progressive in adults, the small study sizes and short follow up periods, as well as variation in phenotypes make it difficult to conclude. A future longitudinal study with large sample size and longer follow up period is expected.

I.3.7.2.3. Change in photoreceptor reflectivity

Another common finding on the OCT of achromatopsia patients are changes in reflectivity related to cone photoreceptors and RPE as the cone photoreceptors degenerate primarily in achromatopsia (Harrison, Hoefnagel et al. 1960, Falls, Wolter et al. 1965) and may also secondarily induce RPE degeneration. Five different stages to categorize foveal OCT images from achromatopsia patients have been proposed. The five categories from 1 to 5 are continuous ISe, disruption of ISe, absence of ISe, optically empty hyporeflective zone (HRZ) below the ELM, and outer retinal atrophy including disruption of RPE (Sundaram, Wilde et al. 2014). The majority (85 to 100%) of achromatopsia patients showed ISe disruption in reported cohorts (Thiadens, Somervuo et al. 2010, Thomas, Kumar et al. 2011, Greenberg, Sherman et al. 2014, Sundaram, Wilde et al. 2014). Although there is a discrepancy among reports (Sundaram, Wilde et al. 2014), outer retinal atrophy with RPE disruption may be likely to be found in older patients and normal ISe may be more common in younger patients (Thiadens, Somervuo et al. 2010, Langlo, Patterson et al. 2016, Zobor, Werner et al. 2017). The presence of HRZ (category 4) is thought to be a characteristic change in the OCT image in achromatopsia (Thiadens, Somervuo et al. 2010, Thomas, Kumar et al. 2011) and it was indicated that the HRZ might also be developed age-dependently as the HRZ was less frequently in young patients (Thomas, Kumar et al. 2011, Yang, Michaels et al. 2014). However, the category 4 had overlap with other categories as the disruption or absence of ISe also results in the HRZ, therefore it may be better to simplify the classification without category 4 (Thomas and Gottlob 2014). There have been limited data on longitudinal change in OCT images in achromatopsia patients. Infants and young children with achromatopsia (mean age 40.6 months (range: 2.4 to 98.7)) were followed up for a mean of 40.6 months (range: 1.4 to 120.9), and five out of 14 eyes were described to have progression on a modified OCT category. However, five out of 14 eyes had both progression and regression on the modified OCT category during the follow-up. This suggested progressive nature of cone photoreceptor disruption in infants and young child with achromatopsia, but also raised the possibility of artefacts due to dislocation of scan position in each visit (Lee, Purohit et al. 2015). Another report also described that the children with achromatopsia (range: 5 to 9 years old, n = 5) showed higher incidence of progression than middle aged adults with achromatopsia (range: 42 to 45 years old, n=3) during a mean follow-up period of 16 months (range: 10-25 months). In this report, it was claimed that all five children had progression as indicated by OCT images, however, reflectivity changes in two of the OCT images seemed artefactual, which was mentioned in a different report (Aboshiha, Dubis et al. 2014). After all, three other children had expanded area of ISe disruption in the fovea, and three adults did not show changes on the OCT images (Thomas, McLean et al. 2012). Additionally, the two

recent larger longitudinal studies followed up for 20 or 13 months on average described that two out of 37 patients or seven out of 38 patients had changes on OCT image. The former study (age range: 6 to 52 years old) showed the progression on OCT image from category 1 (continuous ISe) to 2 (disruption of ISe) in 10 years old patient and from category 2 (disruption of ISe) to 4 (presence of HRZ) in 33 years old patient, although the progression was reported as subtle (Aboshiha, Dubis et al. 2014). Whereas the latter study (age range: 6 to 44 years old) not only showed the progression on OCT image from category 1 to 2 for three patients and from category 2 to 4 for 2 patients mainly in teenagers, but also showed the improvement on OCT image from category 2 to 1 and from 4 to 2 for one patient, respectively. Seeing the fact the one patient who had the progression in the second visit returned to baseline level in fourth visit on OCT image, raised the possibility of artefacts due to dislocation of scan position in each visit again (Langlo, Erker et al. 2017). Altogether, disruption of the outer retinal structure on OCT image may be gradually progressive dependent on age and longer follow-up periods may be required to validate the progression. Also, OCT image acquisition at the same location of the eye is crucial for longitudinal assessment, which is sometime difficult due to the nystagmus and extra-foveal fixation in achromatopsia patients. Several baseline image acquisitions and several follow up visits to exclude the fluctuation of the imaging may be necessary in order to judge the progression.

I.3.7.2.4. Association between OCT finding and retinal function None of the foveal OCT findings have been associated with visual acuity, retinal sensitivity or contrast sensitivity (Sundaram, Wilde et al. 2014, Zobor, Werner et al. 2017). This may not be surprising as cone photoreceptors are not functional in complete achromatopsia whether they are still alive or dead, and only rod photoreceptors are functional. Therefore, resultant retinal functional reflects the rod photoreceptors functionality and which should not be related to the structure change as observed by the foveal OCT image.

Adaptive optics scanning laser ophthalmoscopy (AO-SLO) It has been known that functional deterioration may be pronounced following extensive structural alteration. In glaucoma patients, 5 dB loss of retinal sensitivity was found after 20% loss of retinal ganglion cells (Quigley, Dunkelberger et al. 1989). In vivo imaging of individual cone photoreceptor had been expected because the cone photoreceptor function may be lost after significant loss of cone photoreceptors. However, the lateral resolution of OCT image is affected by the wavefront aberrations of the eye (Zawadzki, Jones et al. 2005). The resultant lateral resolution of commercially available OCTs are approximately 15 to 20 µm, whereas the diameter of

foveal cone inner segment have been reported to be down to 1.6 µm (Curcio, Sloan et al. 1990, Zawadzki, Jones et al. 2005). In order to compensate for these aberrations and visualize individual cone photoreceptors in the eye, adaptive optics techniques developed for astronomy were introduced to scanning laser ophthalmoscopy (AO-SLO) and a resolution of diffractive limit was achieved (Felberer, Kroisamer et al. 2014, Roorda and Duncan 2015). The AO-SLO achieves non-invasive in vivo visualization of a single cone photoreceptor at the center of fovea where the diameter of cone photoreceptor is smallest, which had not been done by any other retinal imaging modalities (Curcio, Sloan et al. 1990, Roorda and Duncan 2015, Litts, Cooper et al. 2017).

I.3.7.3.1. Cone photoreceptor density The most commonly used metric of AO-SLO image is cone photoreceptor density. It was shown that the density of cone photoreceptor near the center of fovea in the foveola (less than 1.0 degree of visual field) was well correlated with visual acuity in normal subjects (Rossi and Roorda 2010). Additionally, the cone photoreceptor density in the foveola as measured by the AO-SLO imaging was proved to be more sensitive and an earlier marker of cone photoreceptor degeneration than foveal function tests such as visual acuity or retinal sensitivity. In the foveola of retinal degeneration patients, the visual acuity or retinal sensitivity was found out to be normal up to 42-52% or 62% loss of cone photoreceptor density as measured by AO-SLO, respectively (Ratnam, Carroll et al. 2013, Foote, Loumou et al. 2018). Furthermore, the cone photoreceptor density as measured by AO-SLO imaging has been expected to be an indicator of disease progression and treatment efficacy. Actually, the AO-SLO imaging was applied for monitoring retinitis pigmentosa patients to test efficacy of ciliary neurotrophic factor treatment. The AO-SLO imaging reliably showed that the cone photoreceptor density in treated eyes was stable, whereas that in untreated eyes was decreased (Talcott, Ratnam et al. 2011).

I.3.7.3.2. Reflectivity of cone photoreceptor Another AO-SLO imaging metric which is deem to be useful is the reflectivity of cone photoreceptor. There are two distinct mode to acquire image on AO-SLO imaging, one is confocal AO-SLO and the other is split-detector AO-SLO. On the confocal AO-SLO imaging, a cone photoreceptor should have normal outer segment and interdigitate with apical processes of retinal epithelial cells to be visualized as a central bright spot in a dark rim. On the other hand, on the split-detector AO-SLO imaging, an inner segment of cone photoreceptor can be visualized as a bright spot irrespective of cone photoreceptor outer segment integrity. Therefore, existence or absence of the reflectivity from both imaging modes interprets as healthy or dead cone photoreceptor,

respectively, and existence of reflectivity on the split-detector AO-SLO imaging but absence of reflectivity on the confocal AO-SLO imaging means unhealthy but alive cone photoreceptor (Dubis, Cooper et al. 2014, Litts, Cooper et al. 2017).

I.3.7.3.3. AO-SLO imaging in achromatopsia In achromatopsia patients, the cone photoreceptor mosaic is disrupted and the density of cone photoreceptors is reduced significantly but with variable degree and no evidence of age-dependent reduction (Langlo, Patterson et al. 2016, Georgiou, Kalitzeos et al. 2018). A report showed that cone photoreceptor density in achromatopsia patients with CNGA3 or CNGB3 gene mutations was similar and corresponded to 19% of the density in normal subjects, whereas achromatopsia patients due to GNAT2 gene mutations retained 78% density of normal subjects (Dubis, Cooper et al. 2014). Similar finding as to relatively preserved cone photoreceptors in achromatopsia patients due to GNAT2 gene mutations was also reported from an independent group (Ueno, Nakanishi et al. 2017). In achromatopsia patients, the reflectivity of cone photoreceptor outer segments is variable from absent (dark) to subtle on the split-detector AO-SLO imaging, and this metric could be useful as an indicator for cone photoreceptor viability and an indication for a therapeutic intervention (Genead, Fishman et al. 2011). Additionally, it has been shown that all achromatopsia patients have reduced reflectivity in outer segments but achromatopsia patients due to GNAT2 gene mutations tend to have more normal reflectivity profile than CNGA3 or CNGB3 gene mutations (Dubis, Cooper et al. 2014).

As reviewed, the AO-SLO imaging is very promising as it provides data on the cone photoreceptor density which is more sensitive and earlier marker than fovea functional test (visual acuity and retinal sensitivity). Also the cone photoreceptor density is known to correlate well with the fovea function test, which was not clearly seen on other retinal imaging modalities. However, there is a limitation to implement the AO-SLO imaging in achromatopsia patients due to poor longitudinal repeatability and inter-observer reliability of cone photoreceptor density measurements (Abozaid, Langlo et al. 2016, Langlo, Erker et al. 2017). For example, in a study conducted on CNGB3 gene mutation-associated achromatopsia patients, the sufficient quality of data for baseline and follow-up visits (6 or 12 months later) was acquired from only 18 out of 41 (44%) patients, and resultant mean change was 1% ± standard deviation of 13% to 15%, which shows significantly greater variability compared with the change (Langlo, Erker et al. 2017). For AO-SLO to be used for longitudinal follow-up, these variations should be minimized. Firstly, improvement in scanning rate and automated eye-tracking system are essential because the nystagmus and extra-fovea fixation of the achromatopsia patients results in low quality imaging and ambiguous measurements.

Secondary, automated standardized system to measure the cone photoreceptor density would be ideal to reduce inter-observer reliability.

I.3.8. Management and therapy

Symptomatic treatment To date, achromatopsia has not been amenable to treatment and only symptomatic treatments are available. These are dark filter or red-tinted glasses or contact lenses to relieve photophobia and improve contrast sensitivity, and low vision aids such as high- powered magnifiers for reading (Kohl, Jagle et al. 1993).

Gene therapy As has been discussed in this chapter, achromatopsia may be gradually progressive but at a very slow rate, and the phenotypes are variable within the same generation. The number of remnant cone photoreceptors may be well preserved in some older patients, therefore there is a potential for therapeutic benefit not only in children but also in adults. A few groups have started Phase I/II clinical trials for gene supplementation therapy of achromatopsia due to CNGB3 and CNGA3 gene mutations based on the successful gene supplementation therapy in animal models of achromatopsia due to Cngb3 and Cnga3 gene mutations (Sengillo, Justus et al. 2017).

Gene therapy Since the discovery of the DNA genetic code and advent of molecular biology in the second half of the 20th century, gene supplementation therapy for monogenic recessive diseases has been expected to be a fundamental treatment. And the advent of gene editing with engineered site specific nucleases make the gene therapy potential for a monogenic dominant disease, where a mutant gene needs to be down- regulated due to the dominant negative effect of the mutant gene, also attenable. In order to deliver a transgene to target cells, there have been many attempts to develop non-viral vectors due to safe production and low risk of immunogenicity, however, the efficacy of the non-viral vectors has not been sufficient for therapeutic benefits so far due to low extracellular stability, and inefficient internalization and cellular trafficking (Chira, Jackson et al. 2015). On the other hand, viral vectors have been engineered and improved in safety and efficacy. To date, some viral vectors have been approved as therapeutic vectors by regulatory bodies.

I.4.1. Retroviral gene therapy

The retroviral vector is one the most successful viral vectors. It leads to stable gene expression due to integration of the transgene in dividing cells, lacks immunogenicity and has relatively large cargo space up to 18kb, although its efficacy is significantly reduced when the cargo exceeds 9kb (Kumar, Keller et al. 2001, Cante-Barrett, Mendes et al. 2016, Counsell, Asgarian et al. 2017). In 1992, the first gene therapy in humans was conducted for adenosine deaminase (ADA) - deficient severe combined immunodeficiency (SCID). Although initial trials were low in efficacy and the therapeutic benefit lasted only for short-term, gene therapy showed the safety and promising efficacy for genetic disease for the first time. The later trials with an improved regimen showed a sufficient and long-term effect. In May 2016, the European Medicines Agency approved the first ex vivo gene therapy for ADA-SCID (Strimvelis) (Ferrua and Aiuti 2017). Meanwhile, in the beginning of the 2000’s, ex vivo hematopoietic stem cell-targeted gene therapy clinical trials for other genetic immunodeficiency diseases such as X- Linked Severe Combined Immunodeficiency (X-SCID), X-linked chronic granulomatous disease (X-CGD) and Wiskott–Aldrich syndrome (WAS) were reported with efficacy. However, leukaemogenesis due to insertional gene activation from treated patients in those clinical trials temporarily halted all the following translation of gene therapy to the clinic (Wu and Dunbar 2011). The mechanisms of integration of gammaretroviral vector, which was commonly used in those clinical trials has been extensively characterized. The integration preferences of the gammaretroviral vector to transcriptionally active enhancer/ promoter regions is prone to cause insertional gene activation resulting in oncogenesis thorough the enhancer/promoter activity of U3 region of the long terminal repeats (LTR), which are located at both ends of the viral genome and mediate viral genome integration to host genomic DNA. And this tendency is enhanced by the use of a viral enhancer/ promoter rather than a cellular enhancer/ promoter. On the other hand, another retroviral vector, human immunodeficiency virus 1 (HIV-1)-derived lentiviral vector, preferentially integrates into a transcribed gene region and less likely to cause insertional gene activation. Moreover, the truncation of the U3 region of the LTR (self-inactivating LTR) was found out to be effective to minimise the insertional gene activation. Therefore the combination of lentiviral vector, self-inactivating LTR and cellular enhancer/ promoter is thought to be less oncogenetic than original components of gammaretroviral vectors (Cavazza, Moiani et al. 2013, Galy 2017). Further safety to avoid the replication of HIV-1 genome in the target cells was pursued by minimizing and separating the regulatory genes and accessory genes which are necessary for viral replication and virulence from the vector plasmid transcriptional unit in the third generation of the HIV-1 vectors. Those genes essential for replication,

infection and transduction, rev (regulatory gene for replication), gag (encoding structural proteins), pol (reverse transcriptase and integrase) and env (viral envelope glycoprotein genes, commonly pseudotyped with vesicular stomatitis virus G-protein (VSV-G) which recognize the low-density lipoprotein receptor for ubiquitous transduction) were separate into additional transcriptional units as packaging or envelope plasmids (Dull, Zufferey et al. 1998, Debyser 2003). Moreover, gammaretroviral vectors are not able to cross the nuclear envelop and only transduce in dividing cells, whereas lentiviral vector such as HIV-1 are able to cross the nuclear envelop and transduce non-dividing cells as well as dividing cells. Transduction in non-dividing cells may be beneficial in terms of having lower likeliness to cause insertional gene activation, because the dividing cells are reported to be more susceptible to the insertional gene activation than non-dividing cells. And targeting non- dividing T cells or stem cells may have more long-lasting clinical benefits than targeting dividing cells (Milone and O'Doherty 2018).

Ex vivo hematopoietic stem cell targeted gene therapy Based on the reason raised above, lentiviral vectors, such as HIV-1, are expected to be safer and more efficient with broader targets than gammaretroviral vectors, therefore it is expected that replacing gammaretroviral vectors in new ex vivo hematopoietic stem cell targeted gene therapy clinical trials will take place. With the application of self- inactivating third generation HIV-1, clinical trials for X-SCID, X-CGD, WAS, β- thalassemia, adrenoleukodystrophy and metachromatic leukodystrophy have been reported with clinical benefits but without oncogenesis (Naldini 2015). Although no oncogenesis has been reported to the self-inactivating third generation HIV-1 in human clinical trials so far, a relative increase of myeloid cells with a vector insertion in the HMGA2 was detected in one patient (Cavazzana-Calvo, Payen et al. 2010). Therefore the incidence of oncogenesis is lower with HIV-1 than gammaretrovirus, however, further development of vector design and modification as well as tracking vector insertion sites are necessary to ensure the safety of the retroviral gene therapy (Wu and Dunbar 2011, Milone and O'Doherty 2018).

Ex vivo T cell targeted gene therapy On the other hand, ex vivo T cell targeted gene therapy to evoke adoptive immune response by transducing T cell antigen receptor (TCR) or synthetic chimaeric antigen receptor (CAR) to a specific cancer associated antigen for acute or chronic lymphocytic leukemia (ALL or CLL) and B cell lymphoma (BCL) have been reported successfully with both gammaretroviral vectors and lentiviral vectors without oncogenesis. The CAR is thought to be improved in terms of HLA independent universal antigen recognition and efficacy compared with the TCR (Naldini 2015). Clinical trials with CAR T cells

(CAR-T) to various solid cancers have also been conducted but with less efficacy compared with haematological malignancies and further improvement of design of CAR is expected (Abken 2017). In August 2018, the European Medicines Agency approved the first ex vivo lentiviral CAR-T gene therapy for ALL, CLL and BCL, tisagenlecleucel (Kymriah®) (Milone and O'Doherty 2018) and it was followed by the approval of another CAR-T gene therapy for BCL, axicabtagene ciloleucel (Yescarta®).

Ex vivo epidermal stem cell targeted gene therapy Another example of ex vivo gammaretroviral vector application was for junctional epidermolysis bullosa and one patient was transplanted regenerated epidermis successfully leading permanent restoration of entire body epidermis without any clonal expansion of the transduced epidermal stem cells (Hirsch, Rothoeft et al. 2017).

In vivo central nervous system gene therapy Lentiviral gene therapy was also applied in vivo for non-dividing cells. A non-primate lentiviral vector derived from equine infectious anaemia virus (EIAV) was used in this clinical trial in order to further relieve the concern of recombination of human pathogenic lentiviral vector. To avoid the replication of EIAV in the target cells was pursued by minimizing and separating or omitting the regulatory genes and accessory genes which are necessary for viral replication and virulence from the vector plasmid as was done in the third generation of the HIV-1. The minimal self-inactivating EIAV derived vector is rev independent and gag, pol and env (pseudotyped with VSV-G) genes were separated into additional plasmids as packaging or envelope plasmids. The first in vivo retroviral vector gene therapy clinical trial with the EIAV derived lentiviral vector was conducted for Parkinson’s disease to supplement three genes which is essential and sufficient to produce dopamine in non-dopaminergic cells. The clinical trial proved the safety and some clinical efficacy of improvement in motor behaviour for four years in most of the 15 patients. The same group is preparing another clinical trial with more potent second generation of lentiviral vector (Palfi, Gurruchaga et al. 2014).

I.4.2. Adenoviral gene therapy A distinct strategy to avoid the viral vector derived oncogenesis is to use a viral vector which does not intrinsically involve integration of viral genome into host genomic DNA, such as an adenovirus (Ad). Although the transgene without the integration into host genomic DNA will be diluted as cells divide, this will not be an issue for non-dividing cells. Ad vector was considered a good candidate as a viral vector, as it promotes the epichromosomal state of the transgene, and leads to efficient transduction in broad range of cells and has a potentially large cargo space of 36 kb (Lee, Bishop et al.

2017). However, most of the Ad vectors are derived from human adenoviral vector serotype 5 (Ad5) and prevalence of circulating neutralizing antibodies for the Ad5 is relatively high in the population (Tatsis and Ertl 2004), and immunogenicity of the Ad vector can be severe compared with lentivirus or adeno-associated virus (Stilwell and Samulski 2004). In fact, one patient died due to systemic inflammatory response to the Ad vector in the gene therapy for ornithine transcarbamylase deficiency (Raper, Chirmule et al. 2003). Taking advantage of the intense immunogenicity of Ad vector and resultant short duration of its efficacy, applications of Ad vector are now limited in oncolytic virotherapy to induce cell death targeting cancer cells and in vaccine development for human immune deficiency viruses or Ebola viruses. Application for the former showed some clinical benefits but for the latter significant clinical benefits have not been yet reported (Duffy, Fisher et al. 2017, Lee, Bishop et al. 2017).

I.4.3. Adeno-associated viral gene therapy Adeno-associated virus (AAV) is one of the most common viral vector in human clinical trials due to its weak immunogenicity and high transduction efficacy in a broad range of cells. Wild-type AAV is intrinsically non-pathogenic and depends on co-infection of a helper virus, such as Ad or herpes virus, to replicate itself efficiently. Unlike retroviruses, the majority of wild-type AAV genomes remain at an epichromosomal state and only a fraction of it may be integrated into a specific site on chromosome 19 but any insertional mutation in human clinical trials has not been reported so far (Kotin, Siniscalco et al. 1990, Kotin, Menninger et al. 1991, Samulski, Zhu et al. 1991, Duan, Sharma et al. 1998). Based on these characteristics, AAV is considered to be an ideal viral vector for in vivo gene therapy for non-dividing cells. In November 2012, the European Medicines Agency approved the first in vivo AAV gene therapy for lipoprotein lipase deficiency (Alipogene tiparvovec (Glybera)) (Kotterman and Schaffer 2014).

AAV serotypes AAV belongs to the Parvoviridae family and does not bear an envelope, unlike retroviruses. The capsid proteins are the only proteins present in the viral particle that encapsulates the single-stranded DNA genome. Distinct receptor binding and intracellular trafficking of the capsid proteins results in different cellular/ tissue tropism and kinetics of transgene expression (Naso, Tomkowicz et al. 2017, Pillay and Carette 2017, Colella, Ronzitti et al. 2018). More than one hundred AAV variants have been isolated from human or non-human primate, and 13 distinct AAV serotypes as determined by serologic assay have been identified (AAV1 to AAV13) (Drouin and Agbandje-McKenna 2013). The similarity of amino acid sequence of viral capsid proteins among serotype 1 to 9 has been described around 45%, and hypervariable regions are located in the surface-exposed

amino acid sequence. Among those nine serotypes, AAV6 is quite similar to AAV1 with only six amino acids difference, whereas AAV5 or AAV4 differentiated early from other serotypes and have almost 40% difference in amino acid sequence compared with AAV1 or AAV2 (Gao, Alvira et al. 2003, Gao, Vandenberghe et al. 2004, Zincarelli, Soltys et al. 2008, Kotterman and Schaffer 2014, Zinn and Vandenberghe 2014). Attachment of AAV on the target cells is thought to be initially mediated by interaction between AAV and specific glycans or glyco-conjugates on the target cell membrane. Subsequent interaction between AAV and specific proteinaceous receptors on the target cell membrane is considered to trigger the internalization of AAV. The cellular/ tissue tropism is based on the profile of those glycans/ glyco-conjugates and proteinaceous receptors on the target cells. Three glycans or glyco-conjugates have been identified to associate with AAV attachment, and they are heparin sulfate proteoglycan for AAV2, AAV3 and AAV13, O-linked and N-linked silica acid moieties for AAV1, AAV4, AAV5 and AAV6, and N-linked galactose for AAV9. However, for AAV7, AAV8, AAV10, AAV11 and AAV12 any interaction with glycans or glyco- conjugates have not been identified so far (Huang, Halder et al. 2014, Pillay, Zou et al. 2017). Whereas, at least 9 different proteinaceous receptors for the AAV have been proposed (laminin receptor (αVβ5/ α5β1 integrin, 37/67-kDa laminin receptor), tetraspanin CD9, fibroblast growth factor receptor-1, hepatocyte growth factor receptor, platelet-derived growth factor receptor, epidermal growth factor receptor and Adeno- associated virus receptor (AAVR)), the impact of each receptor on the AAV transduction is unclear and each AAV may not be necessarily associate to a single type of receptor. On the contrary, a recent genome-wide screening proposed the AAVR could be a universal and essential receptor for AAVs (AAV1, AAV2, AAV3B, AAV5, AAV6, AAV8 and AAV9), which is in conflict with different cellular/ tissue tropism of each serotype (Pillay, Meyer et al. 2016). However, each serotype has preferential binding to three different AAVR ectodomains and may have distinct dependence on AAVR (Pillay, Zou et al. 2017). In addition, AAV4 was reported to be not dependent on AAVR (Dudek, Pillay et al. 2018). Better characterization of cellular attachment, internalization and intracellular trafficking of AAVs is expected to improve and engineer an rAAV to a specific targeting and efficient transduction (Grimm and Buning 2017).

Recombinant adeno-associated viral vector (rAAV) To minimize the risk of integration and avoid replication of AAV in the target cells, only the inverted terminal repeats (ITR) which are essential for the transduction in the target cells are kept at both ends of the vector plasmid. The other part of viral genome for replication (rep), capsid (cap) and assembly of capsid (assembly-activating protein (AAP)) are separated into a packaging plasmid. By transient transfection into mammalian cells along with helper genes commonly from Ad, a recombinant AAV

vector (rAAV) production system has been established (Grimm, Kern et al. 1998, Sonntag, Schmidt et al. 2010). The ITR and rep gene originated from AAV serotype 2 (AAV2) have been most characterized and commonly used, whereas the cap gene can be derived from any of the different serotypes. For example, if the cap gene from serotype 8 was used for production of recombinant AAV2, it is defined as rAAV2/8 (simply it can also be referred to as rAAV8 or AAV8). As the resultant vector plasmid doesn’t contain any viral regulatory, structural or accessory genes, the rAAV is thought to be one of the safest viral vectors. However, the ITR has been reported to have a promoter activity (Flotte, Afione et al. 1993), and there is an accumulation of evidence that the rAAV has potential to cause insertional gene activation as discussed below.

Insertional mutagenesis by rAAV The rAAV was expected not to cause integration into the genome of target cells as it lacks the rep gene which is associated with integration, however, several in vivo liver targeted rAAV gene therapies in mice have been shown that integration of rAAV genome into the host genome did occur without the specificity to the AAVS1 site on chromosome 19 that the wild type virus displays (Kotin, Siniscalco et al. 1990, Samulski, Zhu et al. 1991). And high incidence of hepatocellular carcinoma (HCC) following the rAAV gene therapy in mice was likely to be associated with insertional mutagenesis by rAAV. The proposed risk factors for HCC in the mouse are therapy at neonatal stage, high dose of vector and potentially the vector genome sequence that preferentially integrate into Mir341, a locus within Rian. Although this locus only exist in rodents and any insertional mutagenesis in human clinical trials has not been reported, rAAV transgene integration into nuclear and mitochondria genome was described in the gene therapy clinical trial for lipoprotein lipase deficiency (Kaeppel, Beattie et al. 2013). Moreover, the human ortholog of the Rian locus has been associated with prognosis of HCC patients, and an element downstream of 5’ ITR of wild-type AAV2 has been associated to the oncogenesis of HCC as discovered by biopsies of HCC patients (Colella, Ronzitti et al. 2018). Therefore, further characterization of rAAV integration will be needed to ensure the safety of rAAV gene therapy (Nakai, Montini et al. 2003, Berns and Muzyczka 2017, Chandler, Sands et al. 2017).

Packaging capacity of rAAV One of the major limitations of rAAV is a small cargo space of 4.7 to 5 kb. A vector genome larger than 5 kb will be fragmented and packaged into rAAV capsid (Lai, Yue et al. 2010, Wu, Yang et al. 2010). To broaden the application of rAAV gene therapy for conditions where the cDNA exceed 5 kb, several strategies have been attempted.

I.4.3.4.1. Minigene strategy to overcome the packaging capacity

One strategy to overcome this size limitation is to use a functional truncated transgene (minigene). For example, transduction of mini-dystrophin gene by rAAV was successful in animal models of muscular dystrophy and a human clinical trials with mini-dystrophin gene is ongoing (Harper, Hauser et al. 2002, Gawlik 2018). Whereas transduction of mini-CEP290 gene by rAAV in murine model of Leber congenital amaurosis resulted in less than 20-30% of wild-type level of electrophysiological response as measured by ERG and the short duration of treatment efficacy only for a few months in treated mice suggested the mini-CEP290 gene presumably has only hypomorphic function (Zhang, Li et al. 2018). Therefore designing a minigene is not always tolerated and may result in loss of some or all function. A detailed functional analysis of transgene is essential to ensure the truncated transgene remains fully functional.

I.4.3.4.2. Dual AAV system to overcome the packaging capacity Another approach to overcome the size limitation is to make use of an ability for AAV vector genome to form concatemers. AAV genome is known to form circular episomes or linear concatamers by recombination at intra- or inter-vector ITRs, respectively (Duan, Yue et al. 2003). Several groups have designed dual AAV systems to make a full transgene in the target cells from two independent vector genomes which have either half ends of the full transgene by Overlapping (homologous recombination), Trans-splicing (ITR mediated concatermerization followed by splicing) or Hybrid (homologous recombination followed by splicing). The Overlapping strategy did not mediate transgene expression in pig rod photoreceptor cells but it did in RPE, suggesting the efficiency of homologous recombination may be different in each cell type. On the other hand, the Trans-splicing or Hybrid strategies mediated in vivo reporter gene expression in rod photoreceptor cells of murine and pig retina as well, however, the reporter protein level was around 5% of single normal size AAV system (Trapani, Colella et al. 2014). One reason for this low protein level may be associated with low frequency of right direction inter-molecular recombination, because intra-molecular recombination (circular episome formation) is more likely to occur and there are other combinations of recombination, such as reverse direction inter-molecular recombination and two identical molecular recombination in either direction (Li, Sun et al. 2008). Another possible reason for this low protein level in dual AAV systems has been suggested to be related with the instability of a reconstituted long mRNA, as another study showed discrepancy between up to 60% mRNA level and up to 10% protein level by dual AAV system compared with single normal size AAV system (Feng and Niu 2007, Carvalho, Turunen et al. 2017). Although therapeutic benefits have been shown in murine model of Stargardt disease and Usher syndrome type 1B up to 8 months after the dual AAV gene therapy, whether such a low level of transduction is able to reach a therapeutic

level would be depend on the disease and further improvement may be required for clinical applications (Trapani, Colella et al. 2014, Auricchio, Trapani et al. 2015).

I.4.3.4.3. Gene editing to overcome the packaging capacity Since the advent of endonucleases which enable introduction of a double strand break at a specific site, such as zinc finger nucleases, transcription activator like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeat associated protein (CRISPR/Cas9), expectations for in vivo gene therapy using those endonucleases and subsequent gene correction by insertion, deletion or substitution of DNA sequence for genetic diseases have been growing. This concept can be applied for gene therapy not only for a dominant disease but also for a recessive disease whose mutated cDNA is too big to be accommodated within the cargo space of AAV. However, compared with stochastic indel mutations via non-homologous end joining (NHEJ) that can result in gene disruption, precise correction of the DNA sequence via homology directed repair (HDR) is inefficient in non-dividing cells (Suzuki and Izpisua Belmonte 2018). Attempts to improve the efficiency of HDR by a load of supplementation of donor template with rAAV has been recently reported and showed 10 to 30% of in vivo CRISPR/Cas9 mediated gene editing efficiency in murine brain (Nishiyama, Mikuni et al. 2017). Whereas another group focused on improving the precise correction via NHEJ pathway by supplementing directional donor DNA (HITI). The HITI showed 3-10% of in vivo gene editing efficiency in various murine organs but together with up to 3 times more indel mutations. A retinitis pigmentosa model of rodents, Royal College of Surgeons (RCS) rat, was treated by HITI mediated rAAV gene therapy and showed partial restoration of electrophysiological response as measured by ERG and absolute corrected transgene level was only 4.5% of wild-type level (Suzuki, Tsunekawa et al. 2016). Similar to the dual AAV system, such a low level of correction via HDR or HITI is able to reach a therapeutic level would be depend on the disease model and further improvement may be required for clinical application.

I.4.3.4.4. Protein trans-splicing Other approach to overcome the size limitation is to use protein trans-splicing mediated by intein sequences from bacteria. The protein trans-splicing is composed of three steps. First, two transgenes each encoding split two halves of a protein with intein polypeptide sequences are transduced by AAV and the two halves of a protein with intein polypeptide sequences are produced in the target cells. Second, split intein polypeptide sequences at C-terminal of N-terminal half of a protein and at N-terminal of C-terminal half of a protein are post-translationally ligate each other. Third, the reassembled intein polypeptide removes itself by its own enzymatic activity and leaves a reconstituted full length protein (Saleh and Perler 2006, Volkmann and Iwai 2010).

This approach was successfully applied to in vitro Cas9 system to overcome the size limitation of AAV (Truong, Kuhner et al. 2015). Moreover, this approach was also successfully applied to in vivo gene therapy for a mouse model of Duchenne muscular dystrophy and resulted in almost 100% efficiency of reconstitution of a full-length of dystrophin and showed therapeutic benefits as observed by muscle histology (Li, Sun et al. 2008). There are several disadvantages for protein trans-splicing. First, the split site has crucial impact on the efficiency of protein trans-splicing and it may be difficult to find a site in the middle of a protein. Second, the intein polypeptide sequences have a potential to elicit strong immune responses as they are originated from bacteria. Third, additional size available for a transgene is limited compared with the dual AAV system based on transgene recombination, because two regulatory and polyA sequences are required. Despite these disadvantages, the protein trans-splicing can be efficient method in some application, therefore it is worth consideration.

AAV immunogenicity Although the immunogenicity of AAV is less than other viral vectors (i.e. Ad), innate and adaptive immune response can be elicited by AAV vector component or transgene product unless the AAV is administrated to immunoprivileged organs, such as eye and central nervous system where the immune response is repressed to prevent the destruction of terminally differentiated neurons (Mingozzi and High 2013).

I.4.3.5.1. Innate immune response to AAV The innate immune response is the first line of defence. It has been described that the innate immune response was induced by AAV in preclinical trials in animals. Plasmacytoid dendritic cells detect the unmethylated CpG dinucleotides of single stranded DNA genome of AAV through Toll-like receptor 9 and subsequently secrets type I interferon. In addition, innate immune cells elicit NF-kappaB dependent cytokine and chemokine secretion by AAV. For example in mice, CpG deleted AAV was reported to improve persistence of transgene expression (Faust, Bell et al. 2013). However, acute phase response following systemic administration of AAV in any human clinical trials has not been reported so far, therefore the impact of innate immune response on the efficacy of AAV gene therapy has not been determined (Mingozzi and High 2013).

I.4.3.5.2. Adaptive immune response to AAV As the majority of population have already been exposed to wild-type AAV, the humoral response elicited by AAV capsid proteins results in high prevalence of circulating neutralizing or opsonizing antibodies for AAV in the populations, and has significant impact on efficacy of AAV gene therapy. Those neutralizing or opsonizing antibodies

that have been produced by memory B cells are circulating in the plasma, and upon re- infection, the neutralizing antibody (NAb) binds to AAV attachment molecules, subsequently preventing AAV absorption to the target cells. Whereas opsonizing antibody marks the AAV and eliminates it by phagocyte interaction. Even though AAV manages to escape from the humoral immune response, the cellular immune response can be elicited by AAV capsid proteins or transgene product. The infected cells presenting viral antigens through major histocompatibility complex class I are recognized by reactivated cytotoxic memory T cells to AAV antigens and led to apoptosis resulting in loss of therapeutic effect (Naso, Tomkowicz et al. 2017). The prevalence of anti-AAV IgG/ NAb has been reported to be higher in AAV2 (72%/ 59%) and AAV1 (67%/ 51%), medium in AAV6 (46%/ 37%) or AAV9 (47%/ 34%), whereas lower in AAV5 (40%/ 3.5%) and AAV8 (38%/ 19%). In addition, the titres of Nabs were higher (≥1:400) in 80% of AAV2-seropositive subjects, whereas lower (1:20) in majority of AAV5, AAV8 or AAV9-seropositive subjects (Boutin, Monteilhet et al. 2010). As it has been shown NAb titre more than 1:5 can circumvent liver transduction by AAV in human, non-human primates and murine, patients with Nab antibody (mostly more than 1:5) have been excluded from clinical trials. To overcome this high prevalence of NAb to AAV capsid, switching AAV serotype to less seropositive serotype such as AAV8 or newly engineered AAV can be a solution (Colella, Ronzitti et al. 2018). Another possible solution can be plasmapheresis to remove NAb prior to the administration of AAV vector, however high-titre NAb may be difficult to remove significantly (Monteilhet, Saheb et al. 2011). One experimental solution for local gene transfer would be transient substitution of plasma to saline solution to avoid contact of AAV with NAb, although this method could be invasive to the tissues (Mimuro, Mizukami et al. 2013). Another experimental solution is to use exosome-associated AAV to conceal capsid protein from NAb and it was effective for murine with low to moderate-titre NAb. As the exosome contains lipid bilayer and proteins from derived cells, safety and immunogenicity concerns have to be resolved for future clinical applications (Meliani, Boisgerault et al. 2017). On the other hand, the cellular immune response to AAV capsid proteins or transgene product was first indicated in the first in vivo liver-targeted gene therapy clinical trials. An elevation of liver enzymes and loss of therapeutic benefits after several weeks of treatment was described in a few patients (Manno, Pierce et al. 2006). Later in the trial, administration of immunosuppressant was implemented in patients who exhibited elevation of liver enzymes or loss of therapeutic benefits resulted in preservation of therapeutic benefits in some patients (Nathwani, Tuddenham et al. 2011). To relieve the cellular immune response, immunosuppressant has to be used, however, patients with latent or persistent infection, such as hepatitis viruses or

Mycobacterium infection should be excluded. And to avoid the cellular immune response to be elicited, administration of lower dose of viral vector with higher efficacy is ideal as the antigen presentation is dose dependent (Mingozzi and High 2013). In addition, use of proteasome inhibitor or ubiquitination resistant capsid mutant may be worth considering to reduce the chance of antigen presentation because the AAV capsid proteins need to be ubiquitinated and degraded by proteasomes for the antigen presentation (Zhong, Li et al. 2008, Finn, Hui et al. 2010).

Optimization of AAV capsid and transgene design In general, a higher dose of AAV vector has the potential to achieve a higher therapeutic efficacy, however, the higher dose may elicit a more intense immune response and may result in loss of transduced cells and therapeutic efficacy. There should be a range of appropriate doses for every vector and route of administration, however, the therapeutic benefits may not be sufficient to ameliorate a disease phenotype within the dose range. To maximize the therapeutic efficacy and minimize the adverse effect, improvement of potency of a vector through optimization of AAV capsid and transgene design is essential. In addition, it has been reported that autophagy pharmacological inducers (e.g. rapamycin) or co-infection of a certain virus (e.g. Hepatitis B virus) could potentiate the AAV transduction in hepatocyte in vivo (Hosel, Lucifora et al. 2014, Hosel, Huber et al. 2017).

I.4.3.6.1. Capsid protein variants The vector capsid structure (serotype) has a significant impact on cellular/ tissue tropism and kinetic of transgene expression. Therefore the selection of capsid (serotype) has a significant impact on therapeutic efficacy. In addition to wild type AAV serotypes, there have been engineered various AAV capsids to improve a cellular /tissue transduction further. A progress in understanding the biology of AAV led to engineered AAV capsid variants. For example, ubiquitination-proteasome degradation pathway resistant capsids have been engineered by substitution of serine, threonine or tyrosine residues located in surface exposed amino acid sequence to phenylalanine or alanine. Those substitutions not only slow down the degradation of AAV capsids but also reduce the possibility of cellular immune response via antigen presentation, and led to higher transduction efficacy (Kotterman and Schaffer 2014, Chira, Jackson et al. 2015). Another approach to engineer AAV variants is to test libraries of diversified AAV capsid variants in vivo under selective pressure and isolate the AAV variants that are able to transduce efficiently in targeted cells or escape from the recognition by neutralizing antibodies. For example, 7m8 AAV variant was isolated to transduce in photoreceptor cells from vitreous side without causing retinal detachment which may be risky

procedure in advanced retinal degeneration. Another example is ShH10 AAV variant that is able to transduce in glial cell in the retina efficiently than wild type AAVs (Klimczak, Koerber et al. 2009, Dalkara, Byrne et al. 2013, Kotterman and Schaffer 2014). Moreover, in silico synthetic design of AAV capsid variants has been implemented and led to the engineered Anc80L65 AAV variants that is presumably an ancestral AAV capsid of wild type AAV 1, 2, 8 and 9. The Anc80L65 showed rapid transduction kinetics compared with its descendants in murine retina in vivo. In addition, Anc80L65 showed comparable level of cone photoreceptor transduction to AAV8 (Zinn, Pacouret et al. 2015, Carvalho, Xiao et al. 2018).

I.4.3.6.2. Transgene expression cassette Optimization of transgene expression cassette is also crucial to potentiate the transgene expression or protein translation level. The transgene expression cassette is mainly composed of a protein coding region and regulatory or non-coding regions such as enhancer, promoter, untranslated region (UTR), intron, polyadenylation signal sequence and post-transcriptional regulatory element (PRE). One of the most significant determinants of transgene expression levels is promoter. Ubiquitous promoter, such as cytomegalovirus (CMV), human elongation factor 1α subunit (EF1α) and chicken β-actin (CBA), generally promotes high transgene expression levels, however it will also mediate off-target transgene expression that may increase a risk of immune response and cellular toxicity. And the CMV promoter, for instance, has been shown to be silenced in some neuronal tissues (Gray, Foti et al. 2011, Naso, Tomkowicz et al. 2017). On the other hand, cell-specific promoters can reduce those risks but tend to be less strong compared with ubiquitous promoters. Addition of enhancer elements (e.g. CMV enhancer) or introns between promoter and transgene (e.g. SV40 intron) may increase the strength of cell-specific promoter (Powell, Rivera-Soto et al. 2015). The 5’ or 3’ UTR of mRNA has been reported to have cis-regulatory elements or secondary structures that may affect protein translation level, and in fact mutations in the UTR have been associated to some human diseases (Chatterjee and Pal 2009, Gu, Xu et al. 2014). For example, the 3’UTR of hepatic factor IX has shown to increase protein translation level (Miao, Ohashi et al. 2000). Whereas the secondary structure of messenger RNA (mRNA) in 5’UTR may repress translation, therefore deletion of sequences to form the secondary structure may enhance translation level (Araujo, Yoon et al. 2012). The secondary structure is also associated to microRNA target sequence in 5’UTR that has been reported to downregulate protein translation in off- target cells, and has been applied to limit off-target protein translation (Xie, Mao et al. 2017). In addition, alternative open reading frames due to upstream start codons or

cryptic splice sites in the 5’UTRs may result in production of aberrant proteins and decrease the production of normal protein. There have been reported that the deletion of those upstream start codons or cryptic splice sites resulted in improved level of normal protein translation (Ronzitti, Bortolussi et al. 2016). Improved stability of mRNA and resultant improved protein translation level can also be acquired by the polyadenylation signal sequence in 3’UTR such as SV40 late or bovine growth hormone polyA signal sequence. And addition of post-transcriptional regulatory element (PRE) following those polyA signal sequence such as Woodchuck Hepatitis Viruses PRE (WPRE) may improve translational level if it is combined with a certain promoter (Powell, Rivera-Soto et al. 2015). Another common approach to increase the protein translation level is to optimize the codon usage of transgene for efficient translation by substituting rare codons to optimal codons used in human (Quax, Claassens et al. 2015). The optimized codon usage was also shown to stabilize mRNA and contributed to high level of translation (Presnyak, Alhusaini et al. 2015). Moreover, it has been reported that AAV transgene sequences that form short hairpin- like structure could result in truncated AAV genomes, therefore the deletion of those sequence from the transgene may improve the transgene expression level (Xie, Mao et al. 2017, Colella, Ronzitti et al. 2018). Lastly, use of self-complementary AAV may enhance the transgene expression levels and kinetics of expression. AAV genome is a single-stranded DNA and either sense or antisense strand is packaged into the capsid. Upon infection, the AAV genome is transported into the nucleus and the single-stranded DNA needs to be converted into double-stranded DNA for the transgene to be expressed. However, this step is not efficient and a rate limiting step that mainly depends on de novo DNA synthesis or alternatively depends on annealing of sense and antisense strands of infected AAV genome. The design of self-complementary AAV genome, which has both sense and antisense strand sequences in a single strand to form intramolecular annealing, make this step efficient resulting in faster kinetics and higher level of transgene expression. The limitations of self-complementary AAV is that the size of transgene expression cassette will be less than half the already limited AAV packaging capacity (McCarty 2008). The self-complementary AAV have been successfully used in clinical trials of Haemophilia and Spinal muscular atrophy, and it was also shown to be more efficient than single-stranded AAV in murine retinal transduction (Natkunarajah, Trittibach et al. 2008).

In vivo liver targeted gene therapy

AAV has been applied to in vivo liver targeted gene therapy for haemophilia patients. Severe haemophilia patients need to supplement coagulation factor VIII (FVIII) (haemophilia A) or factor IX (FIX) (haemophilia B) to maintain the activity of coagulation factor between 1 to 5% of normal level and reduce the risk of severe bleeding events. In in vivo liver targeted AAV gene therapy, inefficient transduction of the target tissue and immune response to the AAV capsid proteins or transgene products have been affecting efficacy. To overcome these issues, for example in a clinical trial for haemophilia B, self-complementary AAV and codon optimization of transgene were applied to achieve higher level of transduction and translation, and AAV2 pseudotyped with AAV8 capsid was adopted as AAV8 has less seroprevalence than AAV2. And transient elevation of liver enzymes was monitored and immunosuppressant was administered on demand (Nathwani, Tuddenham et al. 2011). Recent AAV based gene therapies have allowed the majority of haemophilia patients to reduce or stop prophylactic coagulation factor replacement therapy. Only transient elevation of liver enzymes has been reported and it was controllable by immunosuppressants. Any oncogenesis has not been reported so far (Chandler, Sands et al. 2017, George 2017, Nathwani, Davidoff et al. 2017, Doshi and Arruda 2018).

In vivo lower motor neuron targeted gene therapy AAV has also been applied to in vivo lower motor neuron targeted gene therapy for Spinal muscular atrophy type 1 patients. Spinal muscular atrophy type 1 is autosomal recessive disease due to the mutations in survival motor neuron 1 gene (SMN1). The defect of SMN1 gene results in degeneration of lower motor neurons and subsequent atrophy of skeletal muscles. Only 8% of patients are able to survive without permanent ventilation support by 20 months of age, and patients are never be able to sit unaided or walk. Self-complementary AAV9 vector was administrated intravenously to target the non-dividing lower motor neuron at the mean age of 4 months (range 0.9 to 7.9 month). Apart from transient elevation of liver enzymes, the treatment was tolerated with the use of oral prednisolone. All the patients treated survived without the aid of permanent ventilation by 20 months of age. Eleven of 12 patients received high dose of viral vectors could sit independently for more than 5 seconds and two of them could walk alone. Although no attenuation of those motor function had not been described up to 2 year follow-up, long-term follow-up is necessary to ensure the efficacy and safety of gene therapy. In addition, as patients treated when older tended to have less motor function improvement, the age of treatment should be further assessed (Mendell, Al- Zaidy et al. 2017).

I.4.4. Gene therapy for retinal disease

As the eye is an immunoprivileged organ, easy to access and follow up as it is able to examine directly anatomically and functionally, it has been considered to be an ideal target for gene therapy (Dalkara and Sahel 2014). Emergence of recombinant adeno associated virus (AAV) accelerated this as the AAV is less immunogenic, thought to be safer by not integrating into genomic DNA, and have good tropism in the retina. Pre- clinically, gene therapy for both recessive and autosomal dominant disease has been conducted, but also induction of AAV mediated antiagiogenic or neurotrophic factor has been tried. Especially some of the gene supplementation therapies for retinal autosomal recessive diseases were successful and had moved on to clinical trials.

AAV-mediated in vivo retinal gene therapy In 2006, the first clinical trial of gene therapy in retinal inherited disease was conducted for Leber Congenital Amaurosis due to RPE65 gene. Following initial visual function improvement and safety of gene therapy in retina, although the visual function improvement didn’t last for three years in two trials, efficacy and safety of gene therapy in retinal inherited disease was widely accepted (Aguirre 2017). To date, clinical trials for retinitis pigmentosa (MER proto-oncogene, tyrosine kinase (MERTK)), choroideremia (Rab escort protein 1 (REP1)), achromatosia (CNGB3, CNGA3), X-linked retinoschisis (retinoschisin 1 (RS1), X-linked retinitis pigmentosa (retinitis pigmentosa GTPase regulator (RPGR)), and Leber hereditary optic neuropathy (NADH dehydrogenase 4 (ND4)) have been conducted or are ongoing to evaluate safety and efficacy of gene therapy (DiCarlo, Mahajan et al. 2018, Trapani and Auricchio 2018). In the retinitis pigmentosa (MERTK) phase I trial, safety of the AAV gene therapy was confirmed, but initial visual acuity improvement was lost in two years (Ghazi, Abboud et al. 2016). In a choroideremia (REP1) phase I/II trial, small visual acuity improvement maintained up to 5 years post-treatment but with gradual retinal sensitivity loss at untreated eyes (Xue, Jolly et al. 2018), whereas no visual acuity improvement was observed over 2 year follow-up in another choroideremia (REP1) phase I clinical trial using the same AAV vector, suggesting that the gene therapy for choroideremia contributes to preservation of retinal function rather than improvement, although it is difficult to determine in such a short term follow-up (Dimopoulos, Hoang et al. 2018). In both choroideremia (REP1) clinical trials, surgical procedure related or inflammatory adverse events were reported in two of 14 or one of 6 patients, then automated vector delivery device and intraoperative monitoring system had implemented to improve the safety of surgical procedure. As oral corticosteroid was not sufficient to suppress immune response to AAV vector, local administration of corticosteroid may be considered in a future clinical trial.

Lentiviral in vivo retinal gene therapy Lentiviral vectors have been shown to be efficient in transducing the retinal pigment epithelial cells but not the neuronal cells in the retina including photoreceptor cells. Although the EIAV derived lentiviral vector was reported to be more efficient in transducing photoreceptor cells than the HIV-1 derived lentiviral vector, the transduction was weak and sparse (Balaggan, Binley et al. 2006). In addition, the risk of insertional mutagenesis has been another concern using lentiviral vectors. On the other hand, the larger cargo capacity of lentiviral vector than AAV vector is attractive and it has been shown that the transduction in photoreceptor cells of avian and non- human primate retinas was better than in photoreceptor cells of murine retina (Auricchio, Trapani et al. 2015). Based on the pre-clinical study that showed efficacy of EIAV derived lentiviral vectors for photoreceptor degeneration diseases, Usher syndrome 1B (myosin 7a (MYO7A)) and Stargardt disease (ATP-binding cassette subfamily A member 4 (ABCA4)), phase I/II trials are ongoing (Kong, Kim et al. 2008, Zallocchi, Binley et al. 2014, Cavalieri, Baiamonte et al. 2018).

Experimental models to test a clinical viral vector or construct targeting cone photoreceptor cells There is no experimental model to completely copy a human clinical situation, although many attempts to develop experimental models to mimic a human cell and organ have been made so far, including in vitro, ex vivo and in vivo models (Perel, Roberts et al. 2007). In vitro experimental models for cone photoreceptor cell was conventionally Weri-Rb-1 or Y79 cell line (human retinoblastoma cell line), or COS-7 cell line (African green monkey kidney cell line) (D.Oprian 1993, Zhu and Craft 2000), however those cell lines are only approximation of human photoreceptor cells as the gene expression profiles in those cell lines are not identical from in vivo cone photoreceptor cells (Fujimaki, Huang et al. 2004), therefore application and interpretation of the results from those cell lines to human clinical trials needs to be cautious. Instead of those cell line, human retinal explant culture as ex vivo models has been implemented to validate viral vector transduction efficacy and cellular tropism for the retina, however low availability, high likeliness of background diseases, and heterogenicity in terms of age, backgrounds and topography within the retina could result in high variation and low robustness of the results (Orlans, Edwards et al. 2018, Wiley, Burnight et al. 2018). Advent of three-dimensional culture techniques from embryonic stem cells or induced pluripotent stem cells to induce self-organizing retinal organoid enables to recapitulate

organogenesis and provide human photoreceptor cells that have similar gene expression profile to in vivo (Eiraku, Takata et al. 2011, Nakano, Ando et al. 2012, Shamir and Ewald 2014, Gonzalez-Cordero, Kruczek et al. 2017). The human photoreceptor cells from retinal organoids have been extensively explored to be replacement of degenerated photoreceptor cells in patient with retinal degeneration (Llonch, Carido et al. 2018, Jin, Gao et al. 2019). In addition, the retinal organoid has also been shown to be experimental models to test a viral vector transduction efficacy and cellular tropism (Gonzalez-Cordero, Goh et al. 2018). A concern to use the retinal organoids as in vitro model is that outer segments of photoreceptor cells are not supported by retinal pigment epithelium, which is crucial for metabolism and turnover of the outer segments. Consequently, the outer segments don’t grow properly, and opsin proteins dislocate in whole body of photoreceptor cells, which is not common in in vivo. Another concern is the formation and development of neuroepithelial layer in the retinal organoids has relatively high variation, so the content and maturity of photoreceptor cell in each retinal organoid may be heterogeneous. Those concern can be overcome by increase of number of experiments, although long induction period and high cost of production are still the issue. The human retinal organoid is the most histological approximation of human retina, however measuring light response derived from the organoids is still an unresolved issue (Augustyniak, Bertero et al. 2019, Dorgau, Felemban et al. 2019). Therefore, evaluation of efficacy of viral vector as determined by electrophysiological response is only possible to treat in vivo animal models. In the field of retinal gene therapy, murine, canine and sheep have been extensively explored due to availability of knockouts and natural occurring mutation models, however retinas in those animals lack cone-rich macula as in human or non-human primate retina (Zobor, Zobor et al. 2015, Aguirre 2017, Moshiri, Chen et al. 2019). Additionally, those animals have only two distinct (short and long/middle) wave sensitive opsins (dichromacy), whereas human or non- human primate has three distinct (short, middle and long) wave sensitive opsins (trichromacy). Moreover, in murine retina, topographical distribution of each cone opsin expressing cone photoreceptor cells has dorsal-ventral gradient, and each cone opsin is not exclusively expressed in each cone photoreceptor as in human retina (Wang, Smallwood et al. 1999, Haverkamp, Wassle et al. 2005, Wang, Weick et al. 2011). Therefore, the extrapolation of the results from those animal models to human needs to consider the difference of cone photoreceptor cell topographical distribution and cone opsin expression pattern. There are two distinct murine models for achromatopsia due to Cnga3 gene mutation. One is Cnga3 knockout (Cnga3 -/-) engineered by deletion of exon 7 which results in truncated CNGA3 protein, whereas cone photoreceptor function loss 5 (cpfl5) is a

naturally occurring missense mutation in exon 6 which results in a single amino acid substitution in a conserved region of CNGA3 protein (Biel, Seeliger et al. 1999, Pang, Deng et al. 2012). As majority of achromatopsia patients due to CNGA3 gene mutations have missense mutation, the cpfl5 strain may have more similarity to human patients compared to the Cnga3 -/- strain.

Aims Achromatopsia may be gradually progressive but at a very slow rate, and retinal structure can be relatively well preserved even in adults. Since there should be a wide time window for treatment, achromatopsia is a good candidate for gene therapy to demonstrate efficacy. In addition, as a mouse disease model of achromatopsia due to CNGA3 gene mutations has complete loss of cone photoreceptor function, unlike a corresponding model for CNGB3 gene mutations where residual cone photoreceptor response persists, the mouse model enables us to study synaptic plasticity following functional recovery of cone photoreceptors by gene supplementation therapy. This study focused on the following topics: (1) Development and characterization of a novel cone promoter to target all cone photoreceptor cells efficiently. (2) Development and evaluation of an AAV vector for gene supplementation therapy for achromatopsia due to CNGA3 deficiency in a murine model. (3) Evaluation of synaptic connectivity followed by the gene supplementation therapy to test synaptic plasticity between cone photoreceptor cells and subtypes of bipolar cells.

Chapter II. Material and Methods

Construction of plasmid vectorsHuman genomic DNA was extracted from human induced pluripotent stem cell line (IMR90–4, WiCell Research Institute) using QuickExtract™ DNA Extraction Solution (QE0905T, Lucigen). All the procedure in this subchapter were conducted according to the manufacturer’s protocol unless specified. DNA fragments of guanine nucleotide-binding protein subunit beta-3 (GNB3) promoter region and OPN1MW (green opsin) promoter region was amplified by polymerase chain reaction using GoTaq® G2 Master Mix (M7822, Promega). Thermocycling conditions and primer pairs (restriction enzyme sequences added at 5' of primers were shown in bold letters) were as follows (table 2.1- 2.3): Table 2.1: Thermocycling conditions for genomic DNA extraction Step Temperature Time Initial denaturation 98°C 3 minutes 98°C 15 seconds 54°C 15 seconds 35 cycles 1 minutes for GNB3 promoter 72°C 30 seconds for OPN1MW promoter Final extension 72°C 3 minutes Hold 4°C

Table 2.2: Primer pair for extracting a 2kb GNB3 promoter fragment (2032 base pairs) Name Sequence (5' → 3') Bold GNB3-2K-1 Forward ACGCGTAGTGGCCGAATCAACCCTAC MluI GNB3-2K-1 Reverse ACCGGTGGACAGGTCTGCCCCTATTG AgeI

Table 2.3: Primer pair for extracting an OPN1MW promoter fragment (689 base pairs) Name Sequence (5' → 3') Bold OPN1MWp Forw 2 GGATCCAATCGCAATTAGGTGGCCTG BamHI OPN1MWp Rev 2 CCATGGATGGCTATGGAAAGCCCTGT NcoI

The PCR products were loaded to 1% agarose gel and following gel electrophoresis the expected bands were excised and DNA was extracted using QIAquick Gel Extraction Kit (28704, QIAGEN). Purified PCR products were ligated into pGEM®-T Easy Vector Systems (A1360, Promega) using T4 DNA ligase (M1801, Promega). The ligation reactions were added to competent E.coli cells (α-Select Gold Competent Cells, BIO-85027, Bioline). Following heat shock at 42°C for 1 minutes and on ice for 5 minutes, the transformed E.coli were pre-incubated in S.O.C. medium (15544034, Invitorgen) at 37°C for 30 minutes, the transformed E.coli were seeded on LB (110285, VWR)) agar (1.5% w/v) plates with ampicillin (100mg/l) and incubated at 37°C for overnight. Colonies were picked up and inoculated in LB medium with ampicillin (100mg/l), then incubated at 37°C for overnight. Following minipreparation using GenElute™ Plasmid Miniprep Kit (PLN350-1KT, Sigma-Aldrich), the correct insertion of PCR products was confirmed by analysis of restriction enzymes digestion pattern. Different length of GNB3 promoter regions in pGEM®-T Easy Vector-GNB3 promoter (figure 2.1) were digested out by sequential or simultaneous enzymatic digestion and were ligated into one of the AAV plasmid, pD10 eGFP which was digested with AgeI (R7251, Promega) and EcoRV (R6351, Promega). For the construction of pD10-2.0kb GNB3p-eGFP plasmid, MluI (R6381, Promega) digestion was followed by blunting with DNA Polymerase I, Large (Klenow) Fragment (M0210S, New England Biolabs) to fill-in of 5’ overhangs to form blunt end, and AgeI digestion at the end (figure 2.2). For the construction of pD10-1.0kb GNB3p-eGFP plasmid, triple digestion with AgeI, BsrBI (R0102S, New England Biolabs) and KpnI (R6341, Promega) was performed (figure 2.3). Whereas pD10-0.4kb GNB3p-eGFP plasmid was constructed by the digestion of the pD10-2.0kb GNB3p-eGFP plasmid with BglII (R6081, Promega) followed by self- ligation (figure 2.4). 5’UTR of all three constructs were kept the same.

AatII ZraI SacII AgeI BsrBI XhoI NgoMIV BbsI NaeI Bsu36I DraIII PshAI BtgZI BglII PsiI BmtI NheI PpuMI BsrBI MscI

5000 XmnI 2.0 GNB3p PasI TatI BsrBI ScaI Bpu10I 1000 PmlI pGEM-T4000 Easy 2.0 GNB3p

5061 bps Van91I

NmeAIII 3000 2000 Acc65I AhdI KpnI

BspEI SnaBI SpeI SbfI PfoI AccI BstAPI HincII MluI SalI PciI BsrBI NdeI SapI MluI BsrBI NsiI

Figure 2.1: The map of pGEM®-T Easy Vector-GNB3 promoter plasmid vector 2.0 GNB3p: 2.0kb GNB3 promoter

SbfI BsiWI NsiI BstBI BglII SpeI SnaBI BspEI SphI

Van91I ITR PmlI PasI

PciI PpuMI 2.0 GNB3p BmtI NheI 6000 ApaI 1000 PspOMI

pD10 2.0 GNB3p eGFP BglII 5000

6754 bps 2000 PshAI Bsu36I BbsI 4000 3000 AgeI EGFP

SV40 polyA ITR ScaI XmnI BsrGI SspI NotI ZraI EagI AatII BsaBI MunI HincII HpaI PsiI AflII AvrII

Figure 2.2: The map of pD10-2.0kb GNB3p-eGFP plasmid vector 2.0 GNB3p: 2.0kb GNB3 promoter, ITR: Inverted Terminal Repeat

SpeI BstBI NsiI BsiWI SbfI PasI PpuMI BmtI NheI ApaI ITR PspOMI PshAI EcoNI 1.0 GNB3p AarI PciI Bsu36I AflIII BbsI AgeI BtgI 5000 NcoI 1000 pD10 1.0 GNB3p eGFP

5802 bps 4000 EGFP 2000

3000

SV40 BsrGI ITR NotI EagI BsaBI MunI HincII ScaI HpaI XmnI PsiI SspI AflII ZraI AvrII AatII Acc65I KpnI

Figure 2.3: The map of pD10-1.0kb GNB3p-eGFP plasmid vector 1.0 GNB3p: 1.0kb GNB3 promoter, ITR: Inverted Terminal Repeat

BglII PshAI SpeI Bsu36I BbsI AgeI

ITR

0.4 GNB3p

EGFP BsrGI 5000 NotI EagI BsaBI PciI MunI 1000 HincII pD104000 0.4 GNB3p eGFP HpaI SV40 5060 bps PsiI AflII ITR AvrII 3000 2000

AatII ZraI SspI XmnI ScaI

Figure 2.4: The map of pD10-0.4kb GNB3p-eGFP plasmid vector 0.4 GNB3p: 1.4kb GNB3 promoter, ITR: Inverted Terminal Repeat

Similarly, different length of green opsin promoter regions in pGEM®-T Easy Vector- OPN1MW promoter (figure 2.5) were digested out by sequential or double enzymatic digestion and were ligated into one of the AAV plasmid, pD10-1.7kb red opsin promoter-eGFP (figure2.6) (upstream sequence of NsiI site in the LCR was truncated from original 2.1kb red opsin promoter in the pD10-2.1kb red opsin promoter-eGFP (figure 2.7)) which was digested with BamHI (R6021, Promega) followed by blunting and digestion with NcoI-HF (R3193S, New England Biolabs) to remove the red opsin core promoter. For the construction of pD10-1.7kb green opsin promoter-eGFP plasmid (figure2.8), the cloning vector (figure 2.5) was digested with RsaI (ER1211, ThermoFisher) and NcoI-HF. For the construction of pD10-1.4kb green opsin promoter- eGFP plasmid (figure2.9), the cloning vector (figure 2.5) was digested with BseYI (R0635S, New England Biolabs) following by blunting and digestion with NcoI-HF.

SacII BamHI RsaI BseYI RsaI BseYI ApaI BglII PspOMI BseYI AatII BseYI ZraI BsaAI Tth111I SphI DraIII KasI ++ NcoI BtgZI SfoI ++ BseYI PsiI 0.7 OPN1MWp SpeI SrfI SbfI PstI 3500 BspMI NcoI AccI 500 HincII SalI 3000 NdeI pGEM-T Easy 0.7OPN1MWp Eco53kI SacI 1000 3718 bps MluI NsiI XmnI 2500

1500 SapI RsaI 2000 ScaI PciI

NmeAIII BsaI BseYI AhdI

Figure 2.5: The map of pGEM®-T Easy Vector-OPN1MW promoter plasmid vector 0.7 OPN1MWp: 0.7kb OPN1MW (green opsin) core promoter

SpeI BglII BstBI NsiI BbvCI

ITR

PciI truncated LCR DraIII

6000 Van91I BamHI 1000 pD10 1.7L eGFP 5000 red opsin core promoter 6416 bps 2000

4000 NaeI NgoMIV 3000 eGFP NcoI

SV40 polyA ScaI ITR BsrGI AflII SspI NotI AvrII ZraI EagI Eco53kI AatII BsaBI SacI MunI Acc65I HincII KpnI HpaI PsiI

Figure 2.6: The map of pD10-1.7kb red opsin promoter (1.7L)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

SpeI BglII AsuII NsiI XhoI EcoRI Bpu1102I EcoRV NsiI

ITR

LCR

6000 1000 DraIII pD10 2.1L eGFP 5000 6771 bps 2000 BamHI red opsin core promoter

4000 3000

eGFP NaeI NgoMIV NcoI ScaI SV40 polyA ITR SspI AatII BsrGI NotI BsaBI MunI HincII HpaI AflII AvrII

Figure 2.7: The map of pD10-2.1kb red opsin promoter (2.1L)-eGFP plasmid vector LCR: 1.6kb locus control region, ITR: Inverted Terminal Repeat

SpeI BstBI NsiI BbvCI

ITR

PciI truncated LCR DraIII

6000 AarI BspMI 1000 pD10 1.75M eGFP Tth111I 5000 0.5kb green opsin promoter 6460 bps 2000

4000 NaeI 3000 NgoMIV eGFP BtgI NcoI

SV40 polyA ScaI ITR BsrGI AflII SspI NotI AvrII ZraI EagI Eco53kI AatII BsaBI SacI MunI Acc65I HincII KpnI HpaI PsiI

Figure 2.8: The map of pD10-1.75kb green opsin promoter (1.75M)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

SpeI BglII BstBI NsiI BbvCI

ITR

BstXI PciI truncated LCR DraIII 6000 Van91I AarI BspMI 1000 pD105000 1.45M eGFP 0.2kb green opsin promoter 6174 bps NaeI 2000 NgoMIV 4000 BtgI eGFP NcoI 3000

SV40 polyA

ITR BsrGI ScaI NotI AflII EagI AvrII BsaBI Eco53kI SspI MunI SacI ZraI HincII Acc65I AatII HpaI KpnI PsiI

Figure 2.9: The map of pD10-1.45kb green opsin promoter (1.45M)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

Introduction of XbaI site (GGGCCG → TCTAGA) in the 5’UTR of green opsin gene (from +5 to +10, named “M8” mutation) was performed using QuikChange Lightning Site-Directed Mutagenesis Kit (210518, Agilent) and a primer pair below (table 2.4), and pD10-green opsin promoter with M8 mutation-eGFP plasmids were made for pD10-1.45M or 1.75M-eGFP plasmids (figure 2.10, 2.11).

Table 2.4: Primer pair for introducing a XbaI site in 5’UTR of green opsin gene Name Sequence (5' → 3') Bold GACCCTCAGGTGACGCACCATCTAGAGCTGCCGT SDMGOM8 Forw XbaI CGGGGACAGGGC GCCCTGTCCCCGACGGCAGCTCTAGATGGTGCGT SDMGOM8 Rev XbaI CACCTGAGGGTC

SpeI BstBI NsiI BbvCI

XbaI ITR

PciI truncated LCR DraIII XbaI 6000 AarI BspMI 1000 pD10 1.75M-M8 eGFP Tth111I 5000 0.5kb green opsin promoter 6460 bps 2000

4000 XbaI 3000 BtgI eGFP NcoI

SV40 poyA ScaI ITR BsrGI AflII SspI NotI AvrII ZraI EagI Eco53kI AatII XbaI SacI BsaBI Acc65I MunI KpnI HincII HpaI PsiI XbaI

Figure 2.10: The map of pD10-1.75kb green opsin promoter with M8 mutation (1.75M M8)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

SpeI BglII BstBI NsiI BbvCI

XbaI ITR

BstXI LCR PciI DraIII XbaI 6000 Van91I AarI BspMI 1000 pD105000 1.45M M8 eGFP 0.2kb green opsin promoter 6174 bps XbaI 2000 BtgI 4000 NcoI eGFP 3000

SV40 polyA

ITR BsrGI ScaI NotI AflII EagI AvrII XbaI Eco53kI SspI BsaBI SacI ZraI MunI Acc65I AatII HincII KpnI HpaI PsiI XbaI

Figure 2.11: The map of pD10-1.45kb green opsin promoter with M8 mutation (1.45M M8)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

Human CNGA3 sequence was optimized for efficient translation primarily for human and secondarily for murine by adjusting codon usage and GC content (figure 2.12), by removing restriction enzyme sequences, cis-acting elements (slice sites, premature polyA sites, etc.) and repeat sequences. This codon optimization was performed by GenScript (https://www.genscript.com).

Figure 2.12: Codon usage bias and GC content adjustment in human CNGA3 gene Left-hand side green graph shows post-codon optimization results and right-hand side shows pre-codon optimization results. The data was provided in the customer report from GenScript (https://www.genscript.com).

The AAV plasmid with red opsin promoter driving human CNGA3 (pAAV-1.7L-codon optimized human CNGA3 (figure2.13)) was constructed from pD10-1.7L-eGFP plasmid. The red opsin promoter region was taken out by digestion with MluI followed by blunting and digestion with NcoI-HF and ligated into pAAV-human CNGA3. The AAV plasmid with red opsin promoter driving human original non-codon optimized CNGA3 was constructed in a similar way (pAAV-1.7L-non-co human CNGA3 (figure 2.14)).

MluI PciI

ITR AleI

truncated LCR Van91I AseI FspI

PvuI 6000 ScaI AmpR red opsin1000 core promoter XmnI pAAV 1.7L codon optimized hCNGA3

5000 6864 bps 2000 NcoI SpeI ZraI 4000 AatII 3000

AccI SalI hCNGA3 BmgBI ITR SV40 polyA SexAI SfoI BclI NarI KasI HpaI BsrGI BglII BlpI

Figure 2.13: The map of pD10-1.7kb red opsin promoter (1.7L)-codon optimized human CNGA3 plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat, hCNGA3; human CNGA3

MluI PciI

ITR

truncated LCR XbaI

AseI BamHI

AmpR 6000 ScaI red opsin1000 core promoter XmnI pAAV 1.7L non-co hCNGA3

5000 6870 bps 2000 BglII Tth111I ZraI AatII 4000 3000 AflII

hCNGA3 ITR Eco53kI SacI SV40 polyA XhoI EcoRI RsrII HpaI BstAPI HincII MunI SexAI ClaI

Figure 2.14: The map of pD10-1.7kb red opsin promoter (1.7L)-non-codon

optimized human CNGA3 plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat, hCNGA3; human CNGA3

Whereas the AAV plasmids with green opsin promoter driving codon optimized human CNGA3 were constructed from pD10-green opsin promoter-eGFP plasmids. The green opsin promoter regions were taken out by digestion with NsiI followed by blunting and digestion with NcoI-HF and ligated into pAAV-human CNGA3. Then, the removal of additional 4 nucleotide, CCAT, from the 5’UTR of pAAV-green opsin promoter-human CNGA3 (from +5 to +10) was performed using QuikChange Lightning Site-Directed Mutagenesis Kit (210518, Agilent) and a primer pair below (table 2.5) (pAAV-green opsin promoter -ccat-human CNGA3 (figure 2.15, 2.16)).

Table 2.5: Primer pair for removal of additional 4 nucleotides in 5’UTR of green opsin gene Name Sequence (5' → 3') Bold ccat antisense tattgatttttgccatggctatggaaagccctgtcc Start codon ccat sense ggacagggctttccatagccatggcaaaaatcaata Start codon

MluI PciI

ITR StuI AleI

truncated LCR AarI AseI BspMI FspI

PvuI Tth111I 6000 ScaI 0.5kb green1000 opsin promoter AmpR XmnIpAAV 1.75M M8 -ccat codon optimized hCNGA3

5000 6904 bps 2000 BtgI NcoI SpeI ZraI AatII 4000 3000

AccI hCNGA3 SalI BmgBI ITR SV40 polyA SexAI BclI BamHI HpaI BsrGI BlpI

Figure 2.15: The map of pAAV-1.75kb green opsin promoter with M8 mutation without CCAT (1.75M M8 -ccat)-codon optimized human CNGA3 plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat, hCNGA3; human CNGA3

MluI PciI

ITR StuI AleI truncated LCR Van91I AarI AseI BspMI FspI ClaI 6000 PvuI 0.2kb green1000 opsin promoter BtgI ScaI AmpR NcoI pAAV 1.45M M8 -ccat codon optimized hCNGA3 XmnI SpeI 5000

6618 bps 2000

4000 ZraI 3000 AccI AatII SalI BmgBI hCNGA3

ITR SexAI BclI SV40 polyA SfoI NarI KasI BsrGI BamHI BlpI HpaI BglII

Figure 2.16: The map of pAAV-1.45kb green opsin promoter with M8 mutation without CCAT (1.45M M8 -ccat)-codon optimized human CNGA3 plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat, hCNGA3; human CNGA3

Finally, the pD10-green opsin promoter -ccat-eGFP was constructed from the pAAV- green opsin promoter -ccat-human CNGA3 (pD10-green opsin promoter -ccat-eGFP (figure 2.17, 2.18)). 5’UTR between promoter region and start codon was kept the same in corresponding eGFP constructs and human CNGA3 constructs.

MluI SpeI BbvCI

ITR

truncated LCR DraIII

PciI AarI BspMI 6000 BglII 1000 Tth111I pD10 1.75M M8 -ccat eGFP 5000 0.5kb green opsin promoter 6442 bps 2000 BtgI 4000 NcoI

3000 eGFP

Ampicillin

SV40 polyA ITR ScaI BsrGI AflII NotI AvrII EagI Eco53kI SspI BsaBI SacI ZraI MunI Acc65I AatII HincII KpnI HpaI PsiI

Figure 2.17: The map of pD10-1.75kb green opsin promoter with M8 mutation without CCAT (1.75M M8 -ccat)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

SpeI MluI BbvCI

ITR

truncated LCR PciI DraIII 6000 Van91I AarI BspMI 1000 ClaI pD105000 1.45M M8 -ccat eGFP 0.2kb green opsin promoter 6156 bps BtgI 2000 NcoI 4000 eGFP 3000

AmpR

SV40 polyA

ITR BsrGI AflII ScaI NotI EagI AvrII BsaBI Eco53kI SspI MunI SacI ZraI HincII Acc65I AatII HpaI KpnI PsiI

Figure 2.18: The map of pD10-1.75kb green opsin promoter with M8 mutation without CCAT (1.75M M8 -ccat)-eGFP plasmid vector Truncated LCR: 1.2kb locus control region, ITR: Inverted Terminal Repeat

Adeno-associated virus vector production Plasmids for adeno-associated virus (AAV) production were amplified in the LB broth with ampicillin (100mg/l) and then the endotoxin free plasmid preparations were acquired using Endofree® Plasmid Mega Kit (12381, QIAGEN) as described in the manufacturer’s protocol. 10-20 plates of 70% confluent 15cm plate of HEK 293T cells were transfected through a triple transient transfection method using a target plasmid with a transgene (pD10 or pAAV backbone), a packaging plasmid (to produce ShH10, ShH10 cap gene plus AAV2 rep gene (shH10 plasmid (figure 2.19)) or to produce AAV8, packaging plasmid and adenoviral helper plasmid was on a single plasmid (pDP8.ape (PF478, PlasmidFactory GmbH & Co. KG))) and a helper plasmid pHGTI (figure 2.20) (adenoviral helper genes), in an amount of 10:10:30 µg/plate (or 10:10:0 µg/plate for AAV8), mixed with polyethylenimine MAX 40K (24765, Polysciences Inc) at a concentration of 50 µg/ml, as previously described (Nishiguchi, Carvalho et al. 2015).

AAV rep

ShH10

AAV cap

Figure 2.19: The map of ShH10 plasmid vector Reproduced from laboratory Standard Operating Procedure

pHGTI

Figure 2.20: The map of pHGTI plasmid vector Reproduced from laboratory Standard Operating Procedure Adenovirus helper gene (E2A, E4, VA)

The cells were collected 72 hours later and four times of freezing and thawing were performed to break the cell membranes to release AAV. Then the cells were treated with 50units/ml nuclease (Benzonase® Nuclease, ultrapure (E8263, Sigma Aldrich)) to degrade the plasmid DNAs. The cell debris was removed by centrifugation and filtration with 0.45 µm filter. Collected cell lysate containing AAV was purified with an affinity based AVB sepharose column (28-4112-11, GE Healthcare) as previously described (Davidoff, Ng et al. 2004) but with some modification. Resultant fraction was washed in PBS-MK and further concentrated with Vivaspin 4 (10kDa) (VS0404, Sartorius Stedim). Viral genomic titre was determined by quantitative real-time PCR (qRT-PCR) detecting quantity of the plasmid with transgene.

Titration of adeno-associated virus vectors Viral genomic titre was determined by quantitative real-time PCR (qRT-PCR) detecting quantity of the transgene by a probe to bind a specific DNA sequence amplified by a pair of primers specific to the viral genome and referencing to titres of standard series (Aurnhammer, Haase et al. 2012). For the vector that has eGFP as a reporter, the primer pair that bind to SV40 polyA sequence was used to amplify a SV40 amplicon, whereas for the vector that has CNGA3 as a transgene, the primer pair that bind to ITR sequence was applied to amplify a ITR amplicon. The primer and probe sequences used in this study were listed below (table 2.6- 2.7).

Table 2.6: A primer pair, probe and amplicon sequences for SV40 Name Sequence (5' → 3') SV40 Forward primer AGCAATAGCATCACAAATTTCACAA SV40 Reverse primer AGATACATTGATGAGTTTGGACAAAC FAM-5'- SV40 Probe AGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTC- 3'-TAMRA AGCAATAGCATCACAAATTTCACAAATAAAGCATTTT SV40 Amplicon TTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCAT CAATGTATCT

Table 2.7: A primer pair, probe and amplicon sequences for ITR Name Sequence (5' → 3') ITR Forward primer GGAACCCCTAGTGATGGAGTT ITR Reverse primer CGGCCTCAGTGAGCGA ITR Probe FAM-5'- CACTCCCTCTCTGCGCGCTCG-3'-TAMRA CGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGG ITR Amplicon AGTGGCCAACTCCATCACTAGGGGTTCC

Human embryonic body-derived retinoid (hEB) and viral infection Human embryonic body-derived retinoid (hEB) tissues were differentiated from human embryonic cell lines (WA09 H9 or research bank RB-002 H9, WiCell Research Institute) or human induced pluripotent stem cell line (IMR90–4, WiCell Research Institute) as previously described (Gonzalez-Cordero, Kruczek et al. 2017). Recombinant adeno-associated vector(AAV), ShH10 (Klimczak, Koerber et al. 2009)

carrying GFP was used to induce GFP expression in cone photoreceptors. Total 1.2 1011 viral particles were infected per hEB and the hEB was collected 2 weeks post infection for analysis.

Animals Mice are obtained from the Jackson Laboratory except Nrl-EGFP that was gift from Anand Swaroop, National Eye Institute. As a wild type mouse, C57BL/6J mouse strain (JAX stock #000664) was used. As a naturally occurring achromatopsia model due to the cnga3 gene mutation, B6.RHJ-Cnga3cpfl5/BocJ mouse strain (cpfl5) which have C57BL/6J genetic background (JAX stock #005978) was used in this project. To label type 7 cone bipolar cells, a Tg(Gnat3-GFP)1Rfm/ChowJ mouse strain that expresses GFP under the 8.4kb mouse Gnat3, guanine nucleotide binding protein, alpha transducing 3 gene promoter mouse strain (JAX stock #026704) was used (Huang, Shanker et al. 1999). Nrl-EGFP mouse strain was used to mark rod photoreceptor cells (Akimoto, Cheng et al. 2006). Mice are maintained on a 12hours light and dark cycle in the Biological Services Unit at Institute of Ophthalmology, UCL. All animal procedures were performed under the Animals (Scientific Procedures) Act 1986 and Amendment Regulations 2012. For a procedure, mice were anaesthetized and reversed afterwards. Ketamine (3- 4.5mg/10g body weight, Fort Dodge Animal Health) and medetomidine hydrochloride (0.05-0.075mg/10g body weight, Domitor™, Pfizer animal health) were administered by intraperitoneal injection for anaesthesia and analgesia. Pupils were dilated with a drop of 1% tropicamide (Minims Tropicamide 1%, Bausch & Lomb Inc.). If needed, a drop of 0.5% amethocaine (Minims Amethocaine 1%, Bausch & Lomb Inc.) was applied on an ocular surface for local anaesthesia. After the procedure (more than 15 minutes later from the administration of anaesthesia), the mice were reversed with atipamezole hydrochloride (0.05-0.075mg/10g body weight, Antisedan™, Pfizer animal health) by intraperitoneal injection and observed on a heat mat until they got awake and started to move around.

Subretinal injections to the rodent retina Subretinal injections were performed under reversible anaesthesia and pupils were dilated with a drop of 1% tropicamide as described above. A coverslip was put on the cornea with 2% hydroxypropyl methylcellulose (Viscotears liquid gel, Novartis Pharmaceuticals UK Ltd.) to view the retina through the cornea and lens under a surgical microscope (Leica Microsystems or Carl Zeiss). If eyelids were not widely

open enough for the procedure, canthotomy was performed. To fit a larger volume of virus, mice of some cohorts were performed paracentesis. Double injections were done, one in the superior and one in the inferior hemisphere of the eye (1 µl/ injection for mice at 2 weeks of age and 2 µl/ injection for mice older than 4 weeks of age). The tip of 34-gauge needle (207434, Hamilton RN Needle (gauge 34/8mm/pst 10º/tapN), Essex scientific laboratory supplies ltd) with 5µl Hamilton syringe (7633-01, VWR) was transsclerally inserted into subretinal space and a bullous retinal detachment was made to deliver a viral suspension. The wound tunnel was self-sealed with some extent of reflux of the viral suspension. The retinal detachment was expected to be self- resolved within a few days.

Electroretinographic recordings and analysis Electroretinographic recordings were performed under reversible anaesthesia and pupils were moderately dilated with a drop of 1% tropicamide as described above. A mouse was placed in an aluminium chamber to separate from surrounding electromagnetic radiation during stimulation and recording. To keep the body temperature, the mouse was laid on a hand warmer. A ground electrode was inserted into subcutaneously at the base of the tail and a reference electrode was placed sublingually with some PBS. A platinum electrode was contacted on the cornea of each eye with thin layer of PBS. Impedance was measured and confirmed less than 10kOhm to check the background noise. Photopic ERG response of 6 light intensity series (scotopic 0.1, 1, 10, 31.6, 75.28 cd.s/m2 (scotopic 10 cd.s/m2 = photopic 3.601 cd.s/m2)) with a background light intensity of photopic 30 cd.s/m2 (except for the first step: scotopic 0.1 cd.s/m2 stimulus with scotopic 30 cd.s/m2 background) were recorded using commercially available Ganzfeld ERG system (Espion E2, Diagnosys LLC). More than 40 sweeps were averaged, and amplitudes of b-wave were analysed using an Espion V6 software (Diagnosys LLC). The light intensity of stimulation in this thesis was mentioned in scotopic unit, if it was not specified.

Immunohistochemistry

II.4.1. Frozen sections A rodent eye globe was marked at nasal limbus and enucleated immediately after euthanasia and directly fixed in the 4% paraformaldehyde (PFA) (P6148, Sigma Aldrich) buffered with phosphate buffered saline (PBS-) (BR0014, Oxoid Microbiology) for 1 hour at room temperature (RT) and rinsed in PBS- afterwards. For preparation of

retinal sections, the eye was immersed in increasing concentration of sucrose solutions (10, 20, 30%) sequentially until the eye sank at the bottom and embedded in the optimal cutting temperature compound (OCT) (R40020-E, Pyramid innovation). Then the eye was immediately frozen in liquid nitrogen and stored at -20°C until cryosectioning. Cryosectioning at 12µm thickness was performed in vertical plane in order to include both dorsal (superior) and ventral (inferior) retina in a section. Cryosections were preserved at -20°C until use. For preparation of a flat mount retina, a retina was dissected from the eye cup just before use. For preparation of hEB sections, a hEB was collected and fixed in the 4% PFA for 1 hour at RT. Then the hEB was rinsed in the PBS and immersed in 20% sucrose solutions until the hEB sank at the bottom. The hEB was embedded in the OCT, immediately frozen in liquid nitrogen and left at -20°C at least 1 overnight. 10-20µm thickness of cryosections were cut and stored at -20°C until use. The frozen sections were first rehydrated in PBS and blocked by a blocking solution (4% Goat serum/4% Donkey serum/0.2% Triton X-100 diluted in PBS) for 1hour at RT (the flat mount retina was skipped this step). Primary antibodies (table 2.1) were diluted in the blocking solution and applied 1 overnight (2 overnights for flat mount retina) at 4°C or 2 hours at RT. After rinsed with PBS three times for 5 minutes (20 minutes for the flat mount retina) at RT, secondary antibodies (table 2.2) diluted in PBS were applied for 1 hour at RT (1 overnight at 4°C for the flat mount retina). The host of secondary antibodies were chosen not to match the host of the primary antibodies used. Following rinsing with PBS three times for 5 minutes (20 minutes for the flat mount retina) at RT, if needed, nuclear counter staining was performed with 4’,6- Diamidino-2-phenylindole dihydrochloride (DAPI) (D9542, Sigma Aldrich) for 5minutes (at least 20minutes for the flat mount retina). Finally, the sample was covered with coverslip using Fluorescence Mounting Medium (S3023, DAKO) (a refractive index matching reagent modified from ScaleS protocol (Hama, Hioki et al. 2015) for the flat mount retina after incubating in it overnight at 37°C). Primary (table 2.8) and secondary (table 2.9) antibodies used in this project were listed below.

Table 2.8: List of primary antibodies Antigen Host Source Dilution Red/Green opsin Rabbit AB5405, Merck 1:200-1:500 Blue opsin Rabbit AB5407, Merck 1:200- 1:500 Blue opsin Goat sc-14363, Santa Cruz Biotechnology Inc 1:500 Biotinylated N/A B-1075, Vector Laboratories Ltd 1:500 Peanut Agglutinin

Arrestin 3 Rabbit NBP1-19629, Novus Biologicals 1:200 Rhodopsin Mouse O4886, Sigma Aldrich 1:1000

Table 2.9: List of Secondary antibodies (Alexa Fluor® dye conjugated) Antigen/Alexa Fluor® dye Host Source Dilution Rabbit IgG H&L/405 Donkey ab175649, abcam 1:200-1:500 Rabbit IgG H&L/546 Goat A11035, Invitrogen 1:200-1:500 Rabbit IgG H&L/546 Donkey A10040, Invitrogen 1:200-1:500 Rabbit IgG H&L/647 Donkey A31573, Invitrogen 1:200-1:500 Mouse IgG H&L/546 Goat A11018, Invitrogen 1:200-1:500 Goat IgG H&L/546 Donkey A11056, Invitrogen 1:200-1:500 Biotin/streptavidin 633 N/A S21375, Invitrogen 1:500 GFP/488 Rabbit A21311, Invitrogen 1:200

II.4.2. Immunohistochemistry and clearing protocol of flat mount retinas for chapter V

Dissection and Fixation For preparation of a flat mount retina, the retina was collected just before immunohistochemistry. A rodent eye globe was made a burn mark at temporal limbus and enucleated immediately after euthanasia. A eye cup was immediately dissected from the eye globe removing cornea and lens under carbogen bubbling and incubated in a 50% AMES’ Medium/ 5% Sucrose/ dH2O reagent under carbogen bubbling for 5min at room temperature (RT). Then, the eye cup was incubated in 2% PFA/ 7.5%

Sucrose/ ddH2O and leave for 1 hour at RT (Excess duration of fixation could reduce a signal of immunohistochemistry). A retina was dissected from the eye cup and rinse in PBS-.

Immunohistochemistry The retina was incubated in primary antibodies diluted in 0.05% Saponin/ PBS- (dilution was listed in table 2.10) overnight at RT (can be for a few days). Following rinse of the retina with PBS- for 20min X 3 times, the retina was incubated in secondary antibodies diluted in 0.05% Saponin/ PBS- (dilution was listed in table 2.11). Then the retina was rinsed with PBS- for 20min X 3 times, if needed, was incubated in Hoechst/ DAPI 1hour at RT.

Table 2.10: List of primary antibodies for flat mount retina Antigen Host Source Dilution Biotinylated N/A B-1075, Vector Laboratories Ltd 1:500 Peanut Agglutinin Cone arrestin Rabbit AB15282, Merck 1:200 Protein kinase C α Rabbit P4334, Sigma Aldrich 1:500 Gpr179 Mouse MAB427, Merck 1:500 GFP/FITC Goat ab6662, abcam 1:200

Table 2.11: List of Secondary antibodies (Alexa Fluor® dye conjugated) for flat mount retina Antigen/Alexa Fluor® dye Host Source Dilution Mouse IgG H&L/555 Goat A32727, Invitrogen 1:200 Rabbit IgG H&L/647 Goat A32733, Invitrogen 1:200 Biotin/streptavidin 405 N/A S32351, Invitrogen 1:200 Goat IgG H&L/488 Donkey A11055, Invitrogen 1:200 Mouse IgG H&L/647 Donkey A31571, Invitrogen 1:200

Clearing Before clearing of the retina, excessive liquid was removed with Kimwipes as much as possible from the retina, and the retina was incubated in a clearing reagent (59.2% w/w iohexol/ 20.5% w/w 2,2′-thiodiethanol/ 20.0% w/w urea / 0.4% w/w propyl gallate/

6.2mM Tris/ 0.16mM EDTA/ ddH2O (pH 7.0)) for few hours to overnight at RT in shade. Then, the retina was mounted on a slide with the clearing reagent and covered with a coverslip.

Reagents used in this section wlisted below. 1. Paraformaldehyde (P6148, Sigma Aldrich) 2. AMES’ Medium (A1420, Sigma Aldrich) 3. Sodium bicarbonate (S5761, Sigma Aldrich) 4. Sucrose (102744B, BDH) 5. PBS- (BR0014, Oxoid Microbiology) 6. Saponin (47036, Sigma Aldrich) 7. Tris base (T1503, Sigma Aldrich)

8. Disodium EDTA 2H2O (100935, BDH) 9. Histodenz (iohexol) (D2158, sigma Aldrich) 10. Urea (443876Y, BDH)

11. Propyl gallate (02370, Sigma Aldrich) 12. 2,2′-Thiodiethanol (166782, Sigma Aldrich)

Confocal microscopy imaging

II.5.1. Imaging for cryosections Images were acquired by confocal microscopy (Leica DM5500Q) using 40× oil immersion lens (ACS APO 40×/1.15 OIL) at a resolution of 512×512 or 1024×1024 pixels. With a 1µm step size, several confocal sections (a thickness of confocal stacks were depended on a thickness of sample) were imaged and z-projection was made using Leica Application Suite X software (Leica Microsystems) or ImageJ (Schindelin, Rueden et al. 2015).

II.5.2. Imaging for flat mount retinas Images were acquired by confocal microscopy (Leica DM5500Q) using 63× oil immersion lens (ACS APO 63×/1.30 OIL) with a zoom factor of 1.5 and a scan format of 2048×2048. Scan speed was 400 Hz, and each frame was averaged twice. The resultant scan field size was 116.40 µm x 116.40 µm and the lateral pixel size was 56.86 nm. With a Pinhole size of 137.2 µm (1 Airy unit for λ = 580 nm), optical section thickness was 1.04 µm. With an optimized 0.35 µm z-step size, confocal stacks of a thickness of outer plexiform layer were imaged. Z-projection image was made using Leica Application Suite X software (Leica Microsystems). Analysis of signal intensity was quantified by Line Profile tool in the software.

Flow cytometry analysis For flow cytometry analysis was performed as previously described (Gonzalez- Cordero, Kruczek et al. 2017). Briefly, a hEB was dissociated with papain-based Neurosphere Dissociation Kit (130-095-943, MiltenyiBiotec) and resuspended in 350µl PBS followed by 50ng/ml DRAQ7 (BloStatus) staining for 5 minutes at RT to stain the nuclei in dead cells. LSRFortessa™ cell analyser (BD Biosciences) was used for the assay and acquired data was analysed by FlowJo software (FlowJo, LLC). Based on DRAQ7 staining using 640 -780/60 detector and forward scatter, dead cells, debris and aggregates were gated out. Doublets were further excluded by side scatter and the final population of the singlets were obtained. For green fluorescent protein (GFP) assay, 488-530/30 detector was used, and gating was set based on a GFP-negative hEB of matched age. The percentage of GFP and median fluorescent intensity for each sample was analysed.

Multielectrode array (MEA) recording The eyes were marked at superior corneal edge to identify orientation before the enucleation. The retina was dissected in AMES’ medium under carbogen bubbling (5%

CO2 and 95% oxygen). Two pieces of retina were taken from superior half of peripheral retina. Vitreous was carefully removed as much as possible because it prevents direct contact of electrodes and ganglion cells. The piece of the retina was placed on the multielectrode array (60pMEA100/30iR-Ti, Multi Channel Systems) in a chamber with ganglion cell side down. The retina was perfused with carbogen saturated AMES’ medium by a Gilson Minipuls 3 peristaltic pump. Another pump was used to pull the retina to the multielectrode array. The temperature of the medium was kept at 36.5°C using a TC02 temperature control module (Multi Channel Systems). The multielectrode array has 60 of 30μm-diameter electrodes spaced 100μm apart. Each electrode records mainly nearby ganglion cell extracellular potentials but the recording can be contaminated by spikes of multiple cells.

Statistical analysis Data represented in the figures were shown as means ± standard error of the mean, unless otherwise stated. Both eyes from a mouse were counted as one eye when they were treated with the same vector. Statistical analyses were performed using GraphPad Prism 5 for Windows Version 5 (GraphPad Software Inc). Statistical significance was assessed using an one-way analysis of variance (ANOVA) with Dunnett's multiple comparison post hoc test (compared all groups against control group) or Bonferroni multiple comparisons post hoc test (compared all groups or selected groups) for comparisons of vectors at single time point and a two-way ANOVA with Bonferroni multiple comparisons post hoc test for comparisons of vectors at multiple time points or two different time points of treatments with multiple vectors. Number of eyes or hEBs tested was provided as n and p values were provided as p.

Chapter III. Development of Cone specific promoters

Overview In order to develop a promoter for gene therapy for cone disorders, the specificity, activity, and size of the promoter driving transgene expression are important factors (Dyka, Boye et al. 2014). In a clinical trial, it is ideal to limit transgene expression specifically to cone photoreceptors for safety reasons, as ectopic expression of the transgene might have a toxic effect or alter the cells’ function. The strength of promoter activity is also important. Low expression of the transgene might result in a poor treatment effect, and promoter strength is essential as there are limitations to the dose of viral particles delivered because there is a maximum dose of viral vector we could apply clinically without evoking strong immune responses against the viral capsids. Additionally, what needs to be considered when a promoter is to be used for gene therapy with Adeno associated viruses (AAV) is a limitation of length of the promoter that could fit into to the AAV vector. AAV vectors can bear only 4.7-5 kilobase (kb) of transgene expression cassette including the inverted terminal repeats at both ends (Wu, Yang et al. 2010, Kotterman and Schaffer 2014). This includes a promoter, a gene of interest, and a polyadenylation signal without considering additional elements, such as intronic sequences, to boost expression where needed. In the case of CNGA3 gene supplementation, the promoter length should be less than 2.2-2.5 kb. Due to this limited cargo space in AAV, predicted promoter regions have to be truncated, but a truncation of predicted promoter region could change promoter specificity and strength. Moreover, specificity and strength of a promoter is not always the same across different species. To date, several promoters derived from cone specific genes have been reported, including a cone arrestin promoter (Sakuma, Murakami et al. 1998, Li, Zhu et al. 2002, Zhu, Ma et al. 2002, Fujimaki, Huang et al. 2004, Pickrell, Zhu et al. 2004), red/green opsin promoter(Wang, Macke et al. 1992, Shaaban and Deeb 1998, Smallwood, Wang et al. 2002, Ueyama, Tanabe et al. 2009), GNAT2 promoter (Dyka, Boye et al. 2014), and blue opsin promoter (Glushakova, Timmers et al. 2006). GNAT2 promoter with an enhancer element from the interphotoreceptor retinoid- binding protein promoter (IRBP/GNAT2) transduced robust GFP expression mainly in cone photoreceptors but also in rod photoreceptors in the murine following the subretinal injection of AAV5-IRBP/GNAT2-eGFP (Dyka, Boye et al. 2014). And in canine retina, subretinal injection of the AAV5-IRBP/GNAT2-eGFP mediated robust

expression of GFP selectively in cone photoreceptor. However, in non-human primate retina, the IRBP/GNAT2 promoter wasn’t able to mediate expression of a reporter gene in cone photoreceptors at all (Ye, Budzynski et al. 2016). A fragment of 569 base pairs (bp) of the human blue opsin promoter was also used to drive high levels of gene expression in all subtypes of cone and rod photoreceptors in the murine retina (Glushakova, Timmers et al. 2006), but in the canine retina it only showed weak expression in red/green cone and rod photoreceptors and lost its specificity to photoreceptors driving ectopic expression in RPE without expression in blue cone photoreceptors (Komaromy, Alexander et al. 2008). Therefore, testing a promoter in a species which is phylogenetically as close to human as possible or in human tissue is thought to be ideal to predict the promoter specificity and activity in the human retina in vivo. To provide more solid evidence that a promoter works in the human retina, an in vitro promoter assay system using human embryonic body-derived retinal organoids (hEBs) was established (Gonzalez-Cordero, Kruczek et al. 2017, Gonzalez-Cordero, Goh et al. 2018). In the following section, I evaluated the cone arrestin promoter, Guanine nucleotide- binding protein subunit beta-3 (GNB3) promoter, and red/green opsin promoter with or without modifications in order to drive robust transgene expression to all subtype of cone photoreceptors.

Cone arrestin promoter Both mouse and human cone arrestin promoters have been characterised by various groups, and about 0.5kb upstream of the transcription initiation site is thought to be efficient to mediate gene expression in cone photoreceptors (Sakuma, Murakami et al. 1998, Zhu, Ma et al. 2002, Fujimaki, Huang et al. 2004, Pickrell, Zhu et al. 2004) . A 0.5kb human cone arrestin (hCAR) promoter was used successfully to rescue the retinal sensitivity of the Cngb3 knock out mouse model to almost wild type levels as measured by photopic electroretinography (ERG) (Carvalho, Xu et al. 2011). Even though the hCAR promoter has been shown to mediate relatively low levels of gene expression in the murine retina, the levels of expression sufficed to rescue this model. We further tested the hCAR promoter expression profile in a higher order animal (dog) to probe whether the expression pattern was similar to that that has been reported in mice. Similar to what was seen in the murine retina, reporter gene expression in cones was relatively weak, however the hCAR promoter drove robust expression within the retinal pigment epithelium (RPE) (unpublished data – not shown).

III.2.1. Rescue of cpfl5 mice with cone arrestin promoter

I tested whether the 0.5kb hCAR promoter could rescue cone vision in the cone photoreceptor function loss 5 (cpfl5) mouse, a naturally occurring mouse model of achromatopsia due to a cnga3 gene mutation. An AAV8 vector with the hCAR promoter driving expression of a codon optimized human CNGA3 was injected subretinally to cpfl5 mice and photopic ERG responses were measured at 6 weeks post injection. Unlike what we observed in Cngb3 knock out mice where CNGB3 supplementation driven by hCAR promoter led to significant functional improvements (Carvalho, Xu et al. 2011), ERG responses were minimal and at less than 10% of wild-type levels, something that is not deemed to be a treatment effect (figure 3.1 A). There were two possible explanations for why hCAR could not rescue the cpfl5 mouse model phenotype with similar efficacy as observed in the Cngb3-deficient mouse model. One is that since a CNG channel consists of 3 CNGA3 subunits and 1 CNGB3 subunit to form a heterotetramer, the Cnga3 gene needs to be more highly expressed than Cngb3 gene. Secondly, CNGA3 subunits can form low functional channels as homotetramer, leading to residual function in Cngb3−/− mice and adding on to the fact that ERG responses can be rescued with only low expression of the Cngb3 gene.

Figure 3.1: ERG recording from a cpfl5 mouse of 1 month of age injected AAV8- hCAR-co hCNGA3 (A) or AAV8-Pops-co hCNGA3 (B). A cpfl5 mouse of 1 month of age was subretinally injected with AAV8-hCAR-co hCNGA3 in the right eye (A) and AAV8-Pops-co hCNGA3 in the left eye (B). Photopic ERG responses following stimulus at 10 cd.s/m2 was recorded at 6 weeks post injection. A and B waves are annotated. X axis denotes millisecond (ms) and Y axis denotes microvolt (μV).

III.2.2. hCAR promoter transduction profile in hEBs To assess the expression profile of the 0.5kb hCAR promoter in human-derived photoreceptors, AAVShH10-hCARp-eGFP was used to infect hEBs at 22 weeks of age and the hEBs were collected 2 weeks later. Consistent with the expression pattern observed in the canine retina, the hCAR promoter mediated high levels of transduction in the RPE and weak levels of transduction in cones (figure 3.2 A, B). Besides ectopic expression in the RPE, hCAR promoter was specific to cone photoreceptors and had expression in all subtypes of cones, blue cones and red/green cones, which was confirmed by immunohistochemistry (figure 3.2 C, D and E).

In summary, the hCAR promoter showed specific expression in all subtypes of cone photoreceptors and excluding rod photoreceptors but also exhibited ectopic expression within the RPE in human retinal cultures. Moreover, its weak expression levels in the murine retina were thought to be inadequate to rescue the mouse achromatopsia model of Cnga3 deficiency.

Figure 3.2: hCAR promoter transduction profile in hEBs. AAVShH10-hCARp-eGFP was used to transduce hEBs at 22 weeks of age and the hEBs were collected 2 weeks later for immunohistochemistry. (A) Strong GFP expression in the RPE was observed. (B) Expression in photoreceptors was relatively weak. (C) Rhodopsin staining did not colocalise with GFP signals. (D) Some of the blue opsin expressing cones (arrows) were colabelled with GFP. (E) The red/green opsin expressing cones were also colabelled with GFP. Blue staining indicates DAPI nuclear staining. Scale bar; 25μm.

2.1kb red opsin promoter (PR2.1) One of the most well characterised human cone-specific promoters is the red opsin promoter. The red and green opsin genes are located tandemly on the X chromosome and a single red opsin gene is followed by one or more green opsin genes (Deeb, Bisset et al. 2010). Each opsin gene has its own opsin core promoter at the 5’ end upstream of the transcription start, and which opsin gene is to be expressed exclusively in each cone photoreceptor type is thought to be directed by an enhancer element located 3.0kb upstream of the red opsin gene, called Locus Control Region (LCR) (Smallwood, Wang et al. 2002, Deeb, Liu et al. 2006, Deeb, Bisset et al. 2010). A transgene which has 1.6kb LCR fragment together with the red opsin core promoter (PR2.1) driving a reporter gene directed specific gene expression in all subtypes of cone photoreceptors in murine retina (figure3.3) (Wang, Macke et al. 1992). Whereas in the canine retina, PR2.1 only drove gene expression in a subtype of cone photoreceptors, the red/green cone photoreceptors, as was expected from its original design (Komaromy, Alexander et al. 2008). Controversially, PR2.1 drove expression in all subtypes of cone photoreceptors in non-human primate retinas, although the expression in blue cone photoreceptors were less efficient compared with the expression in red/green cone photoreceptors (Ye, Budzynski et al. 2016).

III.3.1. PR2.1 promoter transduction profile in hEBs To assess the PR2.1 specificity in human photoreceptors, hEBs at 11 weeks of age were transduced with AAVShH10-PR2.1p-eGFP and collected 2 weeks later. Immunohistochemistry revealed that GFP did not colocalised with blue opsin labelled cone photoreceptors (figure 3.4 A, A’) nor rhodopsin labelled rod photoreceptors (figure 3.4 B, B’). But only very occasionally, GFP colocalised with blue oprin labelled cone photoreceptors (data not shown). This indicates that while PR2.1 is not driving expression in human rod photoreceptors, cone-driven expression is likely to be restricted only to human red-green cones, similarly to what has been observed in the canine retina.

Figure 3.3: Development of 2.1kb red opsin promoter (PR2.1). Graphical representation of the q28 of human X-chromosome. Blue box indicates locus control region (LCR) and the light red or green box indicates 0.5 kb red or green opsin core promoter, respectively. Each opsin core promoter is immediately followed by each opsin gene. PR2.1 promoter was constructed by joining a 1.6kb fragment of LCR and 0.5kb red opsin core promoter.

Figure 3.4: PR2.1 promoter transduction profile in hEBs. AAVShH10-PR2.1-eGFP was used to transduce hEBs at 13 weeks of age and the hEBs were collected 2 weeks later for immunohistochemistry. Immunohistochemistry revealed that GFP never colocalised with blue opsin labelled cone photoreceptors (A, A’) nor rhodopsin labelled rod photoreceptors (B, B’). Scale bar; 25μm.

PR2.1 promoter with retinoic acid receptor-related orphan receptor response element (RORE) We speculated that if the PR2.1 promoter combined with an enhancer element that controls gene expression in human blue cones, it would mediate gene expression not only in red/green cones but also in blue cones. Retinoic acid receptor-related orphan receptor β (RORβ) has been shown to transactivate mouse blue opsin expression by binding to the corresponding response element (RORE) (Srinivas, Ng et al. 2006, Jetten 2009, Qiu, Miyazaki et al. 2009). We constructed a PR2.1 promoter with RORE by inserting a 77bp RORE between the LCR and red opsin core promoter, and named it POPS promoter.

III.4.1. POPS promoter transduction profile in murine retina To see whether RORE improved expression in blue cone photoreceptors, AAV8- PR2.1-eGFP or AAV8-POPS-eGFP were injected to the subretinal space of adult murine retina, and retinas were collected 1 month post injection (n=3 for each vector). Strong GFP expression was seen in cone photoreceptors that colocalized with both blue opsin and red/green opsin staining retinas injected with either vectors. Mild GFP expression were seen in rod photoreceptors but not in RPE (figure 3.5, 3.6). Unlike the human or canine retina, where exclusively a single subtype of opsin is expressed in cone photoreceptors, in the murine retina, more than 95% of cone photoreceptors have dual expression of blue opsin and red/green opsin. Pure blue opsin expressing cone photoreceptors only comprise less than 5% of total cone photoreceptors. Especially, in the superior(dorsal) peripheral retina, blue opsin expression is confined to pure blue cones, whereas in the inferior(ventral) retina, blue opsin expression is also seen in red/green opsin expressing cones (Haverkamp, Wassle et al. 2005, Wang, Weick et al. 2011). Therefore, applying careful tissue preparation and orientation, I further tested expression of GFP in pure blue cones in the superior retina by costaining with both blue and red/green opsin probing for cells that have only blue opsin expression (figure 3.7). In pure blue cones, GFP was expressed in around 48-49% of cells, and there was no difference between the retinas injected with either AAV8-PR2.1-eGFP or AAV8-POPS-eGFP (p=0.9564, paired t-test) (figure 3.8). Considering that non-pure blue cones had almost 100% of transduction, these promoters were less efficient in pure blue cones than in red/green opsin expressing cones.

Figure 3.5: PR2.1 promoter transduction profile in murine retina. AAV8-PR2.1-eGFP (titre 5x1012vg/ml) was injected subretinally into adult murine eyes, and eyes were collected at 1 month post injection for immunohistochemistry. Strong GFP expression was seen in cone photoreceptors in all injected eyes. Occasional rod photoreceptor transduction was also observed. GFP expression in the RPE was not observed. GFP labelled cone photoreceptors colocalised with blue opsin (A, A’) or red/green opsin (B, B’) staining. Scale bar, 25μm.

Figure 3.6: POPS promoter transduction profile in murine retina. AAV8-POPS-eGFP (titre 5x1012vg/ml) (titre 5x1012vg/ml) was injected subretinally into adult murine eyes, and eyes were collected 1 month post injection for immunohistochemistry. Strong GFP expression was seen in cone photoreceptors in all injected eyes. Occasional rod photoreceptor transduction was also observed. GFP expression in the RPE was not observed. GFP labelled cone photoreceptors colocalised with blue opsin (A, A’) or red/green opsin (B, B’) staining. Scale bar, 25μm.

Figure 3.7: POPS promoter transduction profile in pure blue cones of murine retina. AAV8-POPS-eGFP (titre 5x1012vg/ml) was injected subretinally into wild-type murine eyes, and the eyes were collected 1 month post injection. Sections from the three retinas were stained with both blue opsin (B) and red/green opsin (C). Superior (dorsal) retina was analysed for GFP expression in pure blue cones. (D) 1 out of around 50 cones was stained exclusively with blue opsin and colocalised with GFP. The other cones were exclusively stained with red/green opsin in the imaged field. Scale bar, 25μm.

Figure 3.8: Transduction efficacy in pure blue cones of murine retina. Both eyes of three adult wild-type mice were injected subretinally with either AAV8- PR2.1-eGFP or AAV8-POPS-eGFP (titre 5x1012vg/ml), and the eyes were collected 1 month post injection. Sections from the retinas were stained with both blue opsin and red/green opsin antibodies. Superior (dorsal) retina was analysed for quantification of GFP expression in pure blue cones. In pure blue cones, GFP was expressed in around 48-49% of cells, and there was no difference between the retinas injected with either AAV8-PR2.1-eGFP or AAV8-POPS-eGFP (p=0.9564, paired t test). Error bar indicates SEM.

III.4.2. POPS promoter transduction profile in hEBs To confirm the POPS promoter expression profile in human tissue, hEBs of 19 weeks were transduced with AAV5.POPS-eGFP and collected 2 weeks later. Immunohistochemistry revealed that GFP did not colocalise with blue opsin labelled cones but colabelled with red/green opsin (figure 3.9).

In summary, neither PR2.1 nor POPS could mediate gene expression in human blue cones of hEBs, therefore they were not deemed suitable for gene therapy of cone degeneration disorders.

100

Figure 3.9: POPS promoter transduction profile in hEBs. AAV5-POPS-eGFP was used to transduce hEBs at 19 weeks of age and the hEBs were collected 2 weeks later for immunohistochemistry. Immunohistochemistry revealed that some of the cells expressing GFP colabelled with red/green opsin (A, arrow) but never colocalised with blue opsin labelled cone photoreceptors (B) nor rhodopsin labelled rod photoreceptors (C). Scale bar; 25μm.

101

Guanine nucleotide-binding protein subunit beta-3 (GNB3) promoters Since hCAR promoter provided weak expression levels, and PR2.1 or POPS were not able to transduce all subtypes of cones, we sought to develop novel promoters based on genes expressed exclusively in cone photoreceptors. The guanine nucleotide- binding protein subunit beta-3 (GNB3) gene has been shown to be highly expressed in cone photoreceptors in the primate retina (Corbo, Myers et al. 2007, Ritchey, Bongini et al. 2010) and was selected as a candidate to design a promoter fragment for transgene expression profile analysis.

III.5.1. Construction of GNB3 promoters Although a putative GNB3 promoter is thought to exist within 0.4kb upstream of the transcription initiation site (Rosskopf, Busch et al. 2000), 0.4kb(-372/+24), 1kb(- 1062/+24), and 2kb(-2009/+24) promoter fragments were cloned into an AAV backbone plasmid to drive eGFP expression for our assessments. The inclusion of the larger promoter fragments in this study was to assess whether they would mediate stronger or more specific expression in cone cells compared with the putative fragment.

III.5.2. GNB3 promoter’s transduction profile in murine retina In order to test the GNB3 promoter transduction profile in the murine retina, AAV8- GNB3 promoter-eGFP vectors were injected into the subretinal space of C57BL/6 mice and eyes were collected 1 month post injection. All GNB3 promoter versions very occasionally drove GFP expression in photoreceptors and when they did it was mainly in rod photoreceptors. Moderate levels of GFP transduction were also found in the RPE. Intravitreal delivery led to GFP expression in ganglion cells and some amacrine cells. Overall, GNB3 promoters were neither cone specific nor provided strong expression in the murine retina. Additionally, promoter fragment length did not make any difference towards either the strength of expression or transduction profile (figure 3.10).

102

Figure 3.10: GNB3 promoter transduction profile in murine retina. Different versions of AAV8-GNB3 promoter-eGFP vectors were injected into the subretinal space of C57BL/6 mice and eyes were collected 1 month post injection. Immunohistochemistry was performed on the retinal sections with blue opsin, red/green opsin, peanut agglutinin (PNA) or DAPI (A, B: 0.4kb GNB3 promoter, C, D: 1.0kb GNB3 promoter, E, F: 2.0kb GNB3 promoter). GNB3 promoters very occasionally drove GFP expression in photoreceptors and when they did it was mainly in rod photoreceptors (A, C and E). Moderate level of GFP

103

transduction was found in the RPE (B, C). Intravitreal delivery led to GFP expression in ganglion cells and some amacrine cells (D, F). Scale bar; 25μm.

104

III.5.3. GNB3 promoter’s transduction profile in hEBs Although GNB3 promoters deemed not to be cone specific in the murine retina, in order to test transduction profile in human tissues, AAVShH10.GNB3 promoter-eGFP was used to transduce hEBs of 25 weeks of age and the hEBs were collected 2 weeks later. Transduction in photoreceptors was very sparse with all GNB3 promoters. In particular, using the shortest 0.4kb GNB3 promoter fragment, other cell types were also transduced. Based on their morphology, these cells are most probably supporting neurons of what would consist the developing inner retina (figure 3.11).

In summary, GNB3 promoters did not show cone specificity nor strong expression in both murine and human tissues. It is possible that an enhancer element that could potentially reside further upstream in the promoter region was missing in all three tested constructs.

105

Figure 3.11: GNB3 promoter transduction profile in hEBs. Different versions of AAVShH10-GNB3 promoter-eGFP were used to transduce hEBs of 25 weeks of age, and the hEBs were collected 2 weeks later. Sections of hEBs were stained with DAPI. (A: 2.0kb GNB3 promoter, B: 1.0kb GNB3 promoter, C, D and E: 0.4kb GNB3 promoter). Transduction in photoreceptors was very occasionally (A, B and C), and with the shortest 0.4kb GNB3 promoter fragment other neuronal cell types were also transduced. (D, E). Scale bar; 25μm.

Truncation of 5’ region of LCR in PR2.1 (1.7L)

106

Recently, it has been shown that a truncation of the LCR in the PR2.1 promoter was capable of mediating reporter gene expression in all subtypes of cone photoreceptors in the non-human primate retina (Ye, Budzynski et al. 2016). In order to reproduce this result, the 5’ beginning of the original LCR was truncated 309 bp and named 1.7L (+447/-41).

III.6.1. 1.7L promoter transduction profile in hEBs To test whether the 1.7L promoter could drive gene expression in human blue cone photoreceptors, AAVShH10.1.7L-eGFP was produced and used to transduce hEBs of 22 weeks of age which were analysed 2 weeks later. GFP expression levels were comparable to that of original PR2.1 promoter (figure 3.12 A, B). Immunohistochemistry showed that GFP expression was restricted to cone photoreceptors and colocalised with blue cone opsin and red/green cone opsin staining while GFP expression was not seen in rhodopsin stained photoreceptors (figure 3.12 C, D and E). Therefore, truncation of the original PR2.1 led to transduction in all subtype of cones without losing specificity to cone photoreceptors and its strength of activity.

107

Figure 3.12: 1.7L promoter transduction profile in hEBs. AAVShH10-1.7L-eGFP was used to transduce hEBs at 22 weeks of age and the hEBs were collected 2 weeks later for immunohistochemistry. Indicative images showing GFP expression stained with DAPI only (A, B). Immunohistochemistry revealed that some of the cells expressing GFP colabelled with red/green opsin (C, arrow) and blue opsin labelled cone photoreceptors (D) but never colocalised with rhodopsin labelled rod photoreceptors (E). Scale bar, 25μm.

108

Green opsin promoters A pilot study treating cpfl5 mice with AAV8.POPS-codon optimized CNGA3 showed a rescue of 60% of wild-type levels in photopic ERG responses (figure 3.1 B). I predicted that a similar result would be obtained with the 1.7L promoter. I hypothesised that the activity of the opsin promoter could be improved by replacing the red opsin core promoter with the green opsin core promoter as well as modifying the sequence of the promoter. It has been described that red and green opsin core promoters have 190bp of homologous region immediate upstream of the transcription initiation site and 41bp of homologous 5’ untranslated region (5’UTR). Between base positions +190 to -41, they have 13 nucleotides difference (Shaaban and Deeb 1998). In the retinoblastoma cell line WERI, green opsin core promoter (-190/+41) had four times higher luciferase activity than red opsin core promoter (-190/+41). The same group showed that an additional modification where a Xba1 restriction enzyme site replaced the sequence from +5 to +10 in the 5’UTR (named M8 mutation), led to the red opsin core promoter (-190/+41) activity being potentiated two times compared with the unmutated construct (Shaaban and Deeb 1998). Another group reported in transgenic mice that proximity to the LCR increased the activity of opsin core promoter, and replacement of red opsin core promoter (-455/+41) to equivalent green opsin core promoter (-455/+41) resulted to almost exclusive expression of the gene downstream of the green opsin core promoter to all cone photoreceptors. Whereas in its original locus position (where red opsin is close to the LCR), both genes downstream of each promoter were expressed in cone photoreceptor cells. This indicated that the green opsin core promoter is intrinsically stronger than the red opsin core promoter (Smallwood, Wang et al. 2002).

III.7.1. Construction of novel green opsin promoters Based on these previous reports, a truncated 1.2kb LCR with 200 or 500 bp green opsin core promoter regions were constructed and named 1.45M (-202/+41), 1.75M (- 488/+41) promoters. In parallel, the constructs with the Xba1 site introduction at +5/+10 in the 5’UTR (M8 mutation) were made for each length of the promoters and were named 1.45M M8 and 1.75M M8, respectively (figure 3.13).

109

Figure 3.13: Development of Green opsin promoters. Graphical representation of the q28 region of human X-chromosome. Blue box indicates locus control region (LCR) and the light red or green box indicates 0.5 kb red or green opsin core promoter, respectively. Each opsin core promoter is immediately followed by each opsin gene. PR2.1 promoter was constructed by joining 1.6kb fragment of LCR and 0.5kb red opsin core promoter. 1.7L red opsin was constructed by truncating 0.4kb of 5’ region of the LCA of PR2.1. 1.75M or 1.45M green opsin promoter was constructed by replacing 0.5kb red opsin core promoter to 0.5kb or 0.2kb green opsin promoter, respectively. 1.75M M8 or 1.45M M8 green opsin promoter was constructed by introducing an Xba1 site at the M8 region of the 5’UTR region of promoter (indicated by yellow).

110

III.7.2. Green opsin promoters transduction profile in murine retina To test promoter efficacy of green opsin promoters in the murine retina, histological analysis was done in C57/BL6 mice subretinally injected with AAVShH10-eGFP with the four different green opsin promoters or the equivalent red opsin promoter 1.7L fragment. Although the ShH10 capsid has a relatively low efficiency in transducing the murine retina, all promoters exhibited transduction in cone photoreceptors (figure 3.14) and colocalized with blue and red/green opsin (data not shown). However, the assessments were qualitative as it was difficult to compare quantitatively among promoters due to the low expression level. Rod photoreceptors were also transduced in lower extent.

III.7.3. Green opsin promoters transduction profile in rat retina The rat retina is known to have pure blue cones, although it has blue and red/green opsin coexpressing cone photoreceptors in the developmental stage, the adult rat retina doesn’t have coexpressing cone photoreceptors (Szel and Rohlich 1992, Szel, Rohlich et al. 1993, Szel, van Veen et al. 1994). To assess the capability of green opsin promoters to drive expression in pure blue cone photoreceptors in the rat retina, AAV8-eGFP with four different green opsin promoters or the equivalent red opsin promoter (1.7L or PR2.1) were injected subretinally (5µl double injections (titre 5x1012vg/ml)) at the age of 11 weeks, and eyes were collected at 1 month post injection. GFP was expressed in cone and rod photoreceptors as in the murine retina by all promoters (figure 3.15). Since the GFP expression levels were likely to be affected by the distance from injection site and injection quality, difference between the green opsin promoters was difficult to compare by histological analysis. Green opsin promoters drove GFP expression in both blue and red/green cones (figure 3.16 A, A’ and figure 3.17). Inconsistent with previous report (Li, Timmers et al. 2008), PR2.1 rarely drove GFP expression in blue cones in rat retina (figure 3.16 B, B’), therefore it was difficult to test the effect of truncation of LCR in the green opsin promoters.

111

Figure 3.14: Green opsin promoters’ transduction profile in murine retina. AAVShH10-eGFP with four different green opsin promoters or the equivalent red opsin promoter 1.7L fragment were subretinally injected in C57BL/6 mice and eyes were collected at 1 month post injection for histological analysis. Peanut agglutinin (PNA) was used as a cone photoreceptor marker. Although the ShH10 capsid has a relatively low efficiency in transducing the murine retina, all promoters exhibited transduction in cone photoreceptors with variation. Rod photoreceptors were also transduced in lower extent.

112

Figure 3.15: Green opsin promoters’ transduction profile in rat retina AAV8-eGFP with four different green opsin promoters or the red opsin promoter (1.7L or PR2.1) were injected subretinally to the rat at the age of 11 weeks, and eyes were collected at 1 month post injection. Retinal sections were stained with DAPI. White bar indicates 25µm. GFP was expressed in both cone and rod photoreceptors by all promoters. GFP expression levels were likely to be affected by the distance from injection site and injection quality.

113

Figure 3.16: Green opsin promoters’ transduction profile in rat retina AAV8-1.45M M8-eGFP or AAV8-PR2.1-eGFP was injected subretinally to the rat at the age of 11 weeks, and eyes were collected at 1 month post injection. Retinal sections were stained with blue and red/green opsin. White bar indicates 25µm. GFP was expressed in both blue (A, A’ white arrows) and red/green (A, A’ yellow arrows) cone photoreceptors by 1.45M M8 promoter. Rarely PR2.1 promoter also drove GFP expression in blue cones (B, B” white arrow).

114

Figure 3.17: Green opsin promoters’ transduction profile in rat retina AAV8-1.45M/1.75M/1.75M M8-eGFP were injected subretinally into the rat at the age of 11 weeks, and eyes were collected at 1 month post injection. Retinal flat mounts were stained with blue and red/green opsin. White bar indicates 25µm. GFP was expressed in both blue (white arrow) and red/green (yellow arrow) cone photoreceptors by either green opsin promoter.

115

III.7.4. Green opsin promoter’s transduction profile in hEBs Since in the murine retina all the human-derived cone opsin promoters show similar transduction profiles that also include rod photoreceptors, in order to further assess the effect of LCR truncation in the green opsin promoters, promoter analysis in human retinal tissue was thought to be essential. AAVShH10-eGFP with four different green opsin promoters (1.45M, 1.45M M8, 1.75M, 1.75M M8) and the 1.7L red opsin promoter were used to transduce hEBs of 25 weeks of age, and histological analysis was performed 2 weeks later. GFP expression was high enough to be imaged without anti-GFP antibody staining. Expression levels of GFP in all four different green opsin promoters were comparable to the equivalent red opsin promoter 1.7L (figure 3.18) and were superior compared with vectors with the cone arrestin promoter (figure 3.2). Expression of GFP by the four different green opsin promoters was specific to cone photoreceptors, which was confirmed by colocalisation with cone arrestin staining (figure 3.19). GFP expression in blue cones or red/green cones was initially checked by colabelling with either blue or red/green opsin. Only a subset of GFP positive cells were colocalised with blue or green opsin, which indicated that most of the GFP positive cells were immature cones that hadn’t yet turned on expression of corresponding cone opsins (figure 3.20).

116

Figure 3.18: Green opsin promoters’ transduction profile in hEBs. AAVShH10-eGFP with four different green opsin promoters (A:1.45M, B:1.45M M8, C:1.75M, D:1.75M M8) or the 1.7L red opsin promorter (E) were used to transduce hEBs of 25 weeks of age, and histological analysis was performed 2 weeks later. Nuclei were counterstained by DAPI. Indicative images of GFP expression for each vector construct. Scale bar; 25μm.

117

Figure 3.19: Green opsin promoters’ transduction profile in cone photoreceptors of hEBs. AAVShH10-eGFP with four different green opsin promoters (A:1.45M, B:1.45M M8, C:1.75M, D:1.75M M8) were used to transduce hEBs of 25 weeks of age, and histological analysis was performed 2 weeks later. Cone arrestin staining is shown in red. GFP colocalisation with cone arrestin staining is indicated as yellow in A’, B’, C’, D’. Scale bar; 25μm.

118

Figure 3.20: Green opsin promoters’ transduction profile in hEBs. AAVShH10-eGFP with four different green opsin promoters (A:1.45M, B:1.45M M8, C:1.75M, D:1.75M M8) were used to transduce hEBs of 25 weeks of age, and histological analysis was performed 2 weeks later. Sections were stained with either blue opsin or red/green opsin. Nuclei were counterstained with DAPI. GFP colocallisation with blue or red/green opsin positive cone photoreceptors is indicated (arrows). Scale bar; 25μm.

119

III.7.5. Quantitative analysis of opsin promoters with Flow cytometry Opsin promoters were confirmed to have specific expression in all subtypes of human cone photoreceptors by immunohistochemistry in vitro, however it was difficult to quantitatively analyse the expression levels by histological analysis. Therefore, analysis by flow cytometry was performed to compare percentage of transduced cells and mean fluorescence intensity among GFP transduced by opsin promoters. Gating was determined based on a plot of GFP-negative hEB of matched age and kept the same in all analysis on the same day. (figure 3.21, 3.22)

Green opsin promoters and 1.7L red opsin promoter hEBs of 17-19 weeks of age were transduced by AAVShH10 expressing eGFP under four different green opsin promoters (1.45M, 1.45M M8, 1.75M and 1.75M M8) or 1.7L red opsin promoter (n=4-8 for each promoter) and were collected 2 weeks later. After the dissociation of the hEBs, cells were analysed for percentage of GFP positive cells (figure 3.23 A) and median fluorescence intensity (MFI) in GFP positive cells (figure 3.23 B) by flow cytometry. Although the fraction of GFP positive cells showed variation between experiments that was most likely to be affected by the variation in hEB differentiation, relative MFI provided more consistent data (relative MFI in green-opsin vector transduced hEBs analysed on the same day were calculated as ratio to MFI in the EBs transduced by AAV ShH10-1.7L-eGFP). There was no overall significant difference among the tested promoters (one-way ANOVA), but on average green opsin promoters had higher percentage of GFP positive cells and similar level of MFI compared with 1.7L promoter as a trend. Promoters with longer core green opsin promoter and with the M8 mutation had slightly higher percentage of GFP positive cells compared with promoters with shorter green opsin promoter and without M8 mutation, but it was not a significant difference.

120

Figure 3.21: Gating for GFP negative cells with Flow cytometry LSRFortessa™ cell analyser (BD Biosciences) was used for the assay and acquired data was analysed by FlowJo software (FlowJo, LLC). Based on DRAQ7 staining using 640 -780/60 detector and forward scatter, dead cells, debris and aggregates were

121

gated out. Doublets were further excluded by side scatter and the final population of the singlets were obtained. For green fluorescent protein (GFP) assay, 488-530/30 detector was used, and gating was set based on a GFP-negative hEB of matched age (A). The percentage of GFP and median fluorescent intensity for the negative control was analysed (B).

122

Figure 3.22: Identification of GFPpositive cells with Flow cytometry LSRFortessa™ cell analyser (BD Biosciences) was used for the assay and acquired data was analysed by FlowJo software (FlowJo, LLC). Based on DRAQ7 staining using 640 -780/60 detector and forward scatter, dead cells, debris and aggregates were

123

gated out. Doublets were further excluded by side scatter and the final population of the singlets were obtained. For green fluorescent protein (GFP) assay, 488-530/30 detector was used, and gating was set based on a GFP-negative hEB of matched age. GFP positive cells were identified and shown as in the histogram below (A). The percentage of GFP and median fluorescent intensity for the positive cells transduced with AAVShH10-1.75M M8 -ccat-eGFP were analysed (B).

124

Figure 3.23: Quantitative analysis of opsin promoters with Flow cytometry. hEBs of 17-19 weeks of age were transduced with AAVShH10 expressing eGFP under four different green opsin promoters or 1.7L red opsin promoter (n=4-8 for each promoter), and were collected 2 weeks later. Following dissociation, cells were analysed for percentage of GFP positive cells (A) and relative median fluorescence intensity (MFI) in GFP positive cells (relative MFI in hEBs transduced with AAVsShH10-eGFP analysed on the same day were calculated as ratio to MFI in the EBs transduced with AAV ShH10-1.7L-eGFP) (B) by flow cytometry. Error bar indicates SEM.

125

Green opsin promoter without 4 additional nucleotides A higher percentage of GFP positive cells by green opsin promoters against the red opsin promoter was expected but the lower MFI was not consistent with previous reports comparing green and red opsin promoters in transgenic animals. Further assessements of the sequence of the green opsin promoter constructs revealed that 4 additional nucleotides immediately before the translation initiation site were erroneously inserted during cloning in the genomic sequence and were thought to affect expression level post-transcriptionally. Correctional cloning was preformed to remove these 4 nucleotides of CCAT (-ccat) from 1.45M M8 or 1.75M M8 promoters to render the vector promoter sequences as per the genomic sequence. The corrected constructs were named 1.45M M8 -ccat and 1.75M M8 -ccat and the same quantitative analysis of opsin promoters with flow cytometry was performed (n=4-8 for each promoter) taking these new vector constructs along. The green opsin promoters without ccat (1.45M M8 -ccat or 1.75M M8 -ccat) did not show significant difference in the percentage of GFP positive cells against green opsin promoter with ccat (1.45M M8 or 1.75M M8) (one-way ANOVA, p=0.6891), due to the variability of the data related to variability of hEBs (figure 3.24 A). On the other hand, relative MFI (relative MFI in green-opsin vector transduced hEBs analysed on the same day were calculated as ratio to MFI in the EBs transduced by AAV ShH10- 1.45M M8 -ccat-eGFP) was significantly higher by the green opsin promoter AAV ShH10-1.75M M8 -ccat (one-way ANOVA, p=0.0014) (figure 3.24 B). As there seemed to be an increase in promoter strength provided by the removal of the erroneous ccat nucleotides, further experiments with the same quantitative analysis of opsin promoters with flow cytometry was performed between the green opsin promoters without ccat and 1.7L red opsin promoter (n=6-8 for each promoter). Although the percentage of GFP positive cells was 52-77% higher by green opsin promoters without ccat compared with the 1.7L red opsin promoter, no significant difference was observed between 1.75M M8 -ccat and 1.7L promoter (t-test, p=0.0677) (figure 3.25 A). Whereas relative MFI by the green opsin promoters without ccat got 14- 47% higher than that by 1.7L promoter and the difference was significant for 1.75M M8 -ccat (one-way ANOVA, p=0.0061) (relative MFI in green-opsin vector transduced hEBs analysed on the same day experiment were calculated as ratio to MFI in the EBs transduced by AAV ShH10-1.7L-eGFP) (figure 3.25 B). In summary, the corrected green opsin promoters without additional 4 nucleotides (- ccat) showed higher potency than the 1.7L red opsin promoter.

126

Figure 3.24: Quantitative analysis of opsin promoters with Flow cytometry. hEBs of 17-19 weeks of age were transduced with AAVShH10 expressing eGFP under four different green opsin promoters (1.45M M8, 1.45M M8 -ccat, 1.75M M8, 1.75M M8 -ccat) and were collected 2 weeks later (n=4-8 for each promoter). Following dissociation, cells were analysed for percentage of GFP positive cells (A) and relative median fluorescence intensity (MFI) in GFP positive cells (relative MFI in the hEBs transduced with AAVShH10-eGFP analysed on the same day were calculated as ratio to MFI in the EBs transduced with AAV ShH10-1.45M M8 -ccat-eGFP) (B) by flow cytometry. Asterisk indicates significant difference (p ≤ 0.05). Error bar indicates SEM.

127

Figure 3.25: Quantitative analysis of opsin promoters with Flow cytometry. hEBs of 17-19 weeks of age were transduced with AAVShH10 expressing eGFP under four different green opsin promoters (1.45M M8, 1.45M M8 -ccat, 1.75M M8, 1.75M M8 -ccat) and were collected 2 weeks later (n= 6-8 for each promoter). Following dissociation, cells were analysed for percentage of GFP positive cells (A) and relative median fluorescence intensity (MFI) in GFP positive cells (relative MFI in the hEBs transduced with AAVShH10-eGFP analysed on the same day experiment were calculated as ratio to MFI in the EBs transduced with AAV ShH10-1.7L-eGFP) (B) by flow cytometry. Asterisk indicates significant difference (p ≤ 0.01). Error bar indicates SEM.

128

Summary As the murine retina doesn’t have exclusive expression of each cone opsin in cone photoreceptors and transduction profile of a promoter in murine is not necessarily the same in other species, it was necessary to assess the promoters in human tissue to dissect the efficiency of the human green opsin promoter fragments as detailed as possible. hCAR promoter was only mediate low level of transgene expression in cone photoreceptors in murine retinas. In hEBs, low level of transduction in cone photoreceptor and high level of ectopic transduction in RPE was observed. Therefore, the hCAR promoter was deemed to be inadequate for gene therapy for CNGA3 deficiency. The novel GNB3 promoters were neither efficient nor specific to cone photoreceptors in murine retina and hEBs. PR2.1 promoter had robust expression in both cone and rod photoreceptors including “pure” blue cone photoreceptors in murine retina. However, in hEBs, the PR2.1 promoter was inefficient to transduce in blue cone photoreceptors and addition of retinoic acid receptor-related orphan receptor response element (RORE) did not change its expression profile. Truncation of PR2.1 promoter (1,7L) enabled efficient expression in all subtypes of cone photoreceptors including blue cone photoreceptors without off-target expression in other cell type in hEBs and paved the way to treat all subtype of cone photoreceptors in human retina. Substitution of the red opsin core promoter to green opsin core promoter with M8 mutation in 1.7L promoter showed improvement in activity while preserving specificity, and as such we aimed to further investigate their capacity to rescue the Cnga3- deficient mouse model of achromatopsia.

129

Chapter IV. Rescue of Cnga3-deficient (cpfl5) mice with vectors carrying green opsin promoters

Overview There are two mouse disease model lines of achromatopsia due to Cnga3 gene mutations. Similar to achromatopsia patients, these mice don’t have any photopic responses from birth but do have an almost normal level of scotopic responses of electroretinography (ERG) (Biel, Seeliger et al. 1999, Pang, Deng et al. 2012). A Cnga3-/- mouse line was generated on the background of the 129sv strain, whereas a naturally occurring cpfl5 mutant line has a C57BL/6J background. Despite the difference of background in these two lines, cone degeneration is thought to progress with a similar rate. It has been shown in Cnga3-/- mice, that the number of cone photoreceptors is reduced to 60% of those in a wild-type retina at postnatal week 4, and 30% of those in a wild-type retina at postnatal month 17. Particularly blue opsin expressing cones rapidly degenerate and start to decrease in numbers from postnatal week 3. The nasal and ventral retina, which are regions rich in blue opsin expressing cones, lose more than half of their cones by postnatal week 4 (Michalakis, Geiger et al. 2005). Consistent with this, another study reported that cone death peaked at postnatal day 35 (Arango- Gonzalez, Trifunovic et al. 2014). Altogether, Cnga3-/- mice lose cone photoreceptors at a relatively early stage, and thereafter the speed of degeneration gets more gradual, which is also similar with what is observed in CNGA3-deficient patients (Aboshiha, Dubis et al. 2014). In the following section, AAV vectors with the human CNGA3 gene driven by the newly developed opsin promoters were used to treat the naturally occurring cpfl5 mouse model. Then treatment effect was evaluated by single flash photopic ERG recordings. Firstly, to potentiate gene expression post-transcriptionally so as to maximize the efficacy, human CNGA3 cDNA was codon optimized (co hCNGA3) and was compared with non-codon optimized human CNGA3 (non-co hCNGA3). Secondly, delivery of AAV was conducted at 2 weeks or 1 month postnatally to compare the efficacy of gene therapy before and after the major cone degeneration has initiated and synaptic contacts in outer plexiform layer are made. Thirdly, efficacy of three AAV capsids, AAV5, Anc80L65 (Zinn, Pacouret et al. 2015) and AAV44.9 were compared with that of AAV8 to rescue cpfl5 mice.

130

Additionally, different length of green opsin promoters and the red opsin promoter were compared in terms of efficacy to treat cpfl5 mice. Finally, a dose ranging study was performed to check efficacy of rescue using proposed titres for a Phase I/IIa clinical trial.

Single flash photopic ERG response of wild-type and untreated cpfl5 mice Before analysing the efficacy of gene therapy for cpfl5 mice, wild-type (C57BL6/J) and untreated cpfl5 mice were evaluated by single flash photopic ERG at 8, 12, 16, 20, 24, 28, 32, 36 and 40 weeks of age. A light stimulus of 10 cd.s/m2 was used for analysis (figure 4.1, 4.2). As previously reported, cpfl5 mice showed flat ERG responses from 8 weeks of age and afterwards (Biel, Seeliger et al. 1999, Pang, Deng et al. 2012, Dai, He et al. 2017). Since the photopic ERG response from cpfl5 mice did not have any significant wave and only had background fluctuation, measurement of amplitudes of b wave was based on the latency of a or b wave in wild-type mice. Since the latency of a wave in wild- type was commonly around 10 to 15 msec, trough between 5 to 20 msec was considered as a wave. Whereas the latency of b wave in wild- type was commonly around 35 to 40 msec, peak between 30 to 50 msec was considered as b wave. ERG recordings from wild-type mice were almost stable but gradually declining due to ageing from 163 μV at 8 weeks of age to 125 μV at 36 weeks of age, which was also reported previously (Carvalho, Xu et al. 2011).

131

Figure 4.1: ERG recording from a wild-type (C57BL6/J) (A) or a cpfl5 (B) mouse of 8 weeks of age A wild-type (C57BL6/J) (A) or a cpfl5 (B) mouse at 8 weeks of age was recorded photopic ERG response following stimulus at 10 cd.s/m2. A and B waves are annotated. X axis denotes millisecond (ms) and Y axis denotes microvolt (μV).

132

Figure 4.2: Time course of single flash photopic ERG response of wild-type (C57BL6/J) and cpfl5 mice Wild-type (C57BL6/J) and untreated cpfl5 mice single flash photopic ERG responses were evaluated at 8, 12, 16, 20, 24, 28, 32, and 36 weeks of age (n=8 for wild-type and n=3 for cpfl5 mice). A light stimulus of 10 cd.s/m2 was used for analysis. Two-way ANOVA: time point x strain: p=0.0281, time point: p=0.0081, strain: p<0.0001. Post-hoc test for strain difference between in each time point: ****: p≤0.0001. Error bar indicates SEM.

133

Codon optimisation of hCNGA3 cDNA To test the effect of codon optimization on treatment efficacy, AAV8-1.7L promoter with co hCNGA3 or non-co hCNGA3 (titre 3.5 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 1 month. Single flash photopic ERGs were recorded at 4, 8, 12 weeks post injection. The light stimulus of 10 cd.s/m2 was used for analysis. Gene delivery of the codon optimized hCNGA3 gene improved ERG responses compared with non-codon optimized hCNGA3 significantly at all time points in the group injected at 1 month of age (two-way ANOVA, p=0.0006) (figure 4.3, 4.4). From this point on, only vectors carrying the codon optimized hCNGA3 were selected to be used in subsequent experiments.

134

Figure 4.3: ERG recording from a cpfl5 mouse of 1 month of age injected AAV8- 1.7L promoter vectors with co hCNGA3 (A) or non-co hCNGA3 (B) A cpfl5 mouse of 1 month of age was subretinally injected with AAV8-1.7L promoter vectors with co hCNGA3 in the right eye (A) and with non-co hCNGA3 in the left eye (B). Photopic ERG responses following stimulus at 10 cd.s/m2 was recorded at 4 weeks post injection. A and B waves are annotated. X axis denotes millisecond (ms) and Y axis denotes microvolt (μV).

135

Figure 4.4: Efficacy of codon optimised hCNGA3 AAV8-1.7L promoter vectors with co hCNGA3 or non-co hCNGA3 (titre 3.5 x 1012vg/ml) were delivered to the subretinal space of cpfl5 mice at the age of 1 month (n=14-16 for each vector). Single flash photopic ERGs were recorded at 4, 8 and 12 weeks post injection. A light stimulus of 10 cd.s/m2 was used for analysis. Two-way ANOVA: time point x vector: p=0.0267, time point: p=0.0004, vector: p=0.0006. Post-hoc test for vector difference between in each time point: ****: p≤0.0001, **: p≤0.01. Error bar indicates SEM.

136

Optimal time window of treatment It was speculated that early intervention into cpfl5 mice before cone degeneration initiates could improve the efficacy of the treatment. To determine the optimal time window of intervention in cpfl5 mice, mice were treated at 2 weeks or 1 month of age. Since the degeneration of cones is thought to initiate from 3 weeks of age and 40% of cones have been lost at 4 weeks of age, treatment at 2 weeks of age could be expected to prevent the degeneration, whereas treatment at 1 month of age was expected to rescue only dorsal or temporal area of retina where cones expressing blue opsin are less prominent. AAV8 vectors carrying the 1.45M M8-co hCNGA3 expression cassette (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 2 weeks or 1 month. Single flash photopic ERG was recorded at 4, 8, 12, 16, 20, 24 weeks post injection (n=10-12 for each group). The light stimulus of 10 cd.s/m2 was used for analysis. Although early intervention at 2 weeks of age was thought to improve efficacy, mice treated at 2 weeks and 1 month exhibited a consistently similar response up to 24 weeks post injection (figure 4.5). This result might indicate that cone photoreceptors were lost despite the treatment at early age when the mice still do not have degeneration. Alternatively, the developing retina at 2 weeks of age might be more vulnerable to procedure-related damage than the mature retina at the age of 1 month. Even younger cpfl5 mice at the age of 6 days were also treatedin an attempt to rescue the phenotype using the same vector, but ERG responses at 4 weeks post-injection were flat and worse than the treatment at 2 weeks of age (data not shown), which was also seen in a gene therapy for another achromatopsia mouse model, Cngb3 knock out mouse (Carvalho, Xu et al. 2011). Altogether, optimal time window for subretinal treatment was deemed to be between 2 weeks and 1 month of age. For this reason, subsequent experiments were done at either timepoints depending on the availability of mice at a given age.

137

Figure 4.5: Optimal time window of treatment of cpfl5 mice AAV8 vectors carrying the 1.45M M8-co hCNGA3 expression cassette (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 2 weeks or 1 month. Single flash photopic ERGs were recorded at 4, 8, 12, 16, 20, 24 weeks post injection (n=10-12 for each group). The light stimulus of 10 cd.s/m2 was used for analysis. Error bar indicates SEM.

138

AAV5 vs AAV8 Although AAV5 has been reported as less efficient transducing the retina than AAV8 (Allocca, Mussolino et al. 2007), their cone-specific expression levels and efficacy has not been evaluated and as such the efficacy of AAV5 and AAV8-mediated gene therapy was compared in cpfl5 mice. AAV vectors carrying the 1.45M M8-co hCNGA3 expression cassette (titre 3.5 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 2 weeks. Single flash photopic ERGs were recorded at 4, 12, 16, 20, 24 weeks post injection (n=4 for each vector). The light stimulus of 10 cd.s/m2 was used for analysis. Consistent with the previous reports, AAV8 showed significantly higher treatment efficacy than AAV5 up to at 20 weeks post injection (two-way ANOVA, p<0.05) (figure 4.6).

Anc80L65 vs AAV8 Recently, a newly developed Anc80L65 capsid was shown to have efficient tropism to photoreceptors and to be comparable or even superior to AAV8 (Zinn, Pacouret et al. 2015, Carvalho, Xiao et al. 2018). To assess whether cone-specific transduction is indeed superior between Anc80L65 and AAV8, AAV vectors carrying the 1.45M M8-co hCNGA3 expression cassette (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 2 weeks, and single flash photopic ERGs were recorded at 4, 8, 12, 16, 20, 24 and 28 weeks post injection (n=10-11 for each vector). The light stimulus of 10 cd.s/m2 was used for analysis. AAV8-mediated gene transfer led to significantly higher ERG responses than Anc80L65 up to at 20 weeks post injection (two-way ANOVA, p=0.0023) (figure 4.7). This suggested Anc80L65 transduction efficacy might be better in rod photoreceptors but not in cone photoreceptors than AAV8.

139

Figure 4.6: Comparison of AAV5 and AAV8 AAV5 or AAV8 carrying the 1.45M M8-co hCNGA3 expression cassette (titre 3.5 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 2 weeks (n=4 for each vector). Single flash photopic ERGs were recorded at 4, 12, 16, 20, 24 weeks post injection. The light stimulus of 10 cd.s/m2 was used for analysis. Two-way ANOVA: time point x vector: p=0.2272, time point: p=0.0112, vector: p=0.0129. Post- hoc test for vector difference between in each time point: **: p≤0.01, *: p≤0.05. Error bar indicates SEM.

140

Figure 4.7: Comparison of Anc80L65 and AAV8 Anc80L65 or AAV8 carrying the 1.45M M8 -ccat-co hCNGA3 expression cassette (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 2 weeks (n=10-11 for each vector). Single flash photopic ERGs were recorded at 4, 12, 16, 20, 24, 28 weeks post injection. The light stimulus of 10cd.s/m2 was used for analysis. Two-way ANOVA: time point x vector: p=0.0619, time point: p<0.0001, vector: p=0.0023. Post-hoc test for vector difference between in each time point: **: p ≤ 0.01, *: p ≤ 0.05. Error bar indicates SEM.

141

AAV44.9 vs AAV8 Another novel AAV capsid called AAV44.9 was developed at National Institute of Health. AAV44.9 showed high transduction efficacy to neuronal cells and was known to be less susceptible to major neutralizing antibodies to AAV (https://www.ott.nih.gov/technology/e-175-2015). To compare the efficacy of AAV44.9 and AAV8, AAV vectors carrying the 1.45M M8-co hCNGA3 expression cassette (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 4 weeks, and single flash photopic ERG was recorded at 4, 8, 12, 16, 20 and 24 weeks post injection (n=9 for each promoter). The light stimulus of 10 cd.s/m2 was used for analyses. AAV8-mediated gene therapy led to higher ERG responses than AAV44.9-mediated gene therapy at all time points as a trend but the difference was not significant (two- way ANOVA, p=0.0914) (figure 4.8). Although overall AAV44.9 did not show superiority to AAV8, some eyes treated with AAV44.9 vector had equivalent ERG responses to eyes treated with AAV8 vector. However, due to the fact that purification of AAV44.9 with AVB column, which is the standard method of purification for AAV in clinical use, was not able to get a high enough titre of viral particles, further investigation for AAV44.9 was not conducted as the main future perspective of this study is the development of a scalable gene therapy vector. At last, AAV8 capsid was selected as the capsid of choice for a gene therapy vector to treat achromatopsia due to CNGA3 mutations.

142

Figure 4.8: Comparison of AAV44.9 and AAV8 AAV44.9 or AAV8 carrying the 1.45M M8 -ccat-co hCNGA3 expression cassette (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 4 weeks (n = 9 for each vector). Single flash photopic ERGs were recorded at 4, 12, 16, 20, 24 weeks post injection. The light stimulus of 10cd.s/m2 was used for analysis. Two-way ANOVA: time point x vector: p=0.0118, time point: p=0.0008, vector: p=0.0914. Error bar indicates SEM.

143

Comparison of 1.45M M8 –ccat, 1.75M M8 –ccat and 1.7L promoters In the promoter assay using hEBs in the previous chapter, the longer green opsin promoter (1.75M M8 -ccat promoter) showed 28% higher level of median fluorescence intensity to the shorter green opsin promoter (1.45M M8 -ccat promoter) and 47% higher level of median fluorescence intensity to the equivalent red opsin promoter (1.7L promoter). To compare the ability of these two green opsin promoters and red opsin promoter to rescue cpfl5 mice, AAV8-co hCNGA3 with either the 1.45M M8 –ccat, the 1.75M M8 - ccat promoter or the 1.7L promoter (titre 1.0 x 1012 vg/ml) was injected into cpfl5 mice at 2 weeks of age (n=12-14 for each promoter). Single flash photopic ERG responses were recorded at 4, 8, 12, 16, 20 and 24 weeks post injection and b-wave amplitudes from the light stimulus of 10 cd.s/m2 were analysed. There was no difference in terms of efficacy among the 1.45M M8 -ccat promoter, the 1.75M M8 -ccat promoter and the 1.7L promoter up to 24 weeks post injection (two- way ANOVA) (figure 4.9). This could be due to the fact that murine and human retina have different cone opsin expression profiles. Therefore, it is possible that the longer 1.75M M8 -ccat promoter transduces more cone photoreceptors in human retina than the shorter 1.45M M8 -ccat promoter as was shown in hEBs, but at least in the murine retina the length of green opsin promoter did not show a difference of efficacy. Since the final aim of this study is to develop a viral gene therapy vector to treat human patients, based on the human EBs expression profile, the longer version of the green opsin promoter (1.75M M8 -ccat) was chosen as the proposed component of an AAV8- based clinical vector.

144

Figure 4.9: Comparison of green and red promoter efficacy AAV8-co hCNGA3 with either the 1.45M M8 –ccat, the 1.75M M8 -ccat promoter or the 1.7L promoter (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at 2 weeks of age (n=12-14 for each promoter). Single flash photopic ERG response was recorded at 4, 8, 12, 16, 20 and 24 weeks post injection. The light stimulus of 10 cd.s/m2 were used for analysis. Two-way ANOVA: time point x vector: p=0.9528, time point: p<0.0001, vector: p=0.8716. Error bar indicates SEM.

145

Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 in cpfl5 mice From all previous data, studying components of the proposed clinical vector, we chose AAV8 capsid, 1.75M M8 –ccat promoter and codon optimized hCNGA3 cDNA. Empirically, viral particle titre of 1.0 x 1012 vg/ml has known to be highest titre for subretinal clinical use to avoid intense immunological response and toxic effect (Bainbridge, Mehat et al. 2015). To test whether there is a dose response with this treatment, AAV8-1.75M M8 -ccat-co hCNGA3 was injected into cpfl5 mice at 2 weeks of age at three different titres 1.0 x 1012, 3.0 x 1011 and 1.0 x 1011 vg/ml (n=7 for each titre). Single flash photopic ERG responses were recorded at 4, 8 and 12 weeks post injection and b-wave amplitudes from the light stimulus of 10 cd.s/m2 were analysed. There were no significant differences in ERG responses among the three tested titres although there was a trend of a dose response (figure 4.10, 4.11). The middle titre seemed to take weeks to reach maximum effect, however, it exhibited almost similar efficacy as highest titre 12 weeks post injection. Compared with untreated data from figure 4.2, the treated mice at the middle titre of 3.0 x 1011 vg/ml had still significant differences in ERG responses compared with untreated mice (Two-way ANOVA: time point x dose: p=0.0882, time point: p=0.8065, vector: p=0.0080.).

146

Figure 4.10: Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 Three different dose (titre 1.0 x 1012 (A), 3.0 x 1011 (B) or 1.0 x 1011 (C) vg/ml) of AAV8 1.75M M8 –ccat co hCNGA3 were delivered to subretinal space of cpfl5 mice at 2 weeks of age (n = 7 for each vector). Single flash photopic ERG was recorded at 4 weeks post injection. The light stimulus of 10 cd.s/m2 was used for analysis. A and B

147

waves are annotated. X axis denotes millisecond (ms) and Y axis denotes microvolt (μV).

148

Figure 4.11: Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 in cpfl5 AAV8 1.75M M8 –ccat co hCNGA3 (titre 1.0 x 1011, 3.0 x 1011or 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at 2 weeks of age (n = 7 for each vector). Single flash photopic ERG was recorded at 4, 8 and 12 weeks post injection. The light stimulus of 10 cd.s/m2 was used for analysis. Two-way ANOVA: time point x dose: p=0.2726, time point: p=0.0154, dose: p=0.1240. Error bar indicates SEM.

149

Dose ranging of AAV8 1.75M M8 –ccat co hCNGA3 in wild-type mice Since the green opsin promoters mediated gene expression not specifically in cone photoreceptors but also in rod photoreceptors in murine retinas, there is a concern that the photopic ERG response from the cpfl5 mice treated with AAV8-1.75M M8 -ccat-co hCNGA3 might be from the rod photoreceptors with cone CNG channel alpha subunits. To validate the effect of overexpression of CNGA3 gene in rod photoreceptors in murine retina, AAV8-1.75M M8 -ccat-co hCNGA3 was injected into wild-type (C57BL/6) mice at the age of 8 weeks (n = 7 to 10 for each dose). Single flash photopic or scotopic ERG was recorded at 4, 12 and 24 weeks post injection. The light stimulus of 10cd.s/m2 (photopic) or 0.01cd.s/m2 (scotopic) was used for analysis. Neither photopic nor scotopic ERG response had significant difference among treated and untreated retinas at any time point (two-way ANOVA: photopic (time point x dose: p=0.8706, time point: p=0.9731, dose: p=0.4600.), scotopic (time point x dose: p=0.0901, time point: p=0.1862, dose: p=0.2536.). This result indicated that the vector did not have either toxic nor electrophysiological effect to cone and rod photoreceptors cell in wild-type retina. The ectopic CNGA3 protein may not be able to interact with other transduction cascade protein in murine rod photoreceptors or may be unstable in rod photoreceptors. Consequently, the photopic ERG response from treated cpfl5 was deemed to be from cone not from rod photoreceptors.

150

Figure 4.12: Dose de-escalation of AAV8 1.75M M8 –ccat co hCNGA3 in wild-type AAV8 carrying the 1.75M M8 -ccat-co hCNGA3 expression cassette (titer 1.0 x 1012, 3.0 x 1011, 0.0 (PBS) vg/ml) were delivered to subretinal space of wild-type (C57BL/6) mice at the age of 8 weeks (n = 7 to 10 for each dose). Single flash photopic or scotopic ERG was recorded at 4, 12 and 24 weeks post injection. The light stimulus of 10cd.s/m2 (photopic) or 0.01cd.s/m2 (scotopic) was used for analysis. Two-way ANOVA: photopic (time point x dose: p=0.8706, time point: p=0.9731, dose: p=0.4600.), scotopic (time point x dose: p=0.0901, time point: p=0.1862, dose: p=0.2536.). Error bar indicates SEM.

151

Summary AAV vectors carrying the human CNGA3 gene under control of the Green and Red opsin promoters can mediate a significant, but not complete, rescue of the photopic ERG of Cnga3 deficient mice (Photopic ERG response was recovered up to 30% of wild type level). Treatment at younger age of mice did not improve photopic ERG response significantly and optimal time window for treatment seemed to be between 2 weeks and 1 month of age. Codon optimized hCNGA3 provided better rescue than the non-codon optimized hCNGA3. Neither AAV5, Anc80L65 nor AAV44.9 were as efficient as AAV8 to transduce cone photoreceptors and thought to be superior to AAV8 for further development of a therapeutic vector. In the end, AAV8-1.75M M8 –ccat-co hCNGA3 was selected as the therapeutic vector that could potentially provide the maximum benefit to achromatopsia patients, based on the in vivo data of the cpfl5 mice rescue and the in vitro data of the hEBs promoter assays.

152

Chapter V. Synaptic plasticity of cpfl5 mice retina following gene therapy

Overview In retinal degenerations, alteration of retinal synaptic connections has been known to occur (Jones and Marc 2005, D'Orazi, Suzuki et al. 2014, Soto and Kerschensteiner 2015). Although gene supplementation therapies for retinal autosomal recessive diseases have been successfully reported, whether the retinal synaptic connections were corrected fully or not, has not been shown clearly. In a murine model of retinoschisis, following gene therapy, restoration of postsynaptic marker of retinal bipolar cells as assessed by immunohistochemistry of retinal vertical sections was reported (Ou, Vijayasarathy et al. 2015). However, studying retinal connectivity with retinal vertical sections is limited because the retinal synaptic layers spread tangentially. Therefore, retinal flat-mount is ideal for studying connectivity, but working on the retinal flat-mount is challenging for two reasons relating to tissue thickness. One reason is inefficient immunohistochemistry labelling due to inability of diffusion of antibodies. Another reason is that light scattering of tissue interferes with imaging by confocal microscopy but there is no tissue clearing protocol that is able to preserve fine synaptic structures and at the same time allow for robust endogenous fluorescent labelling. To overcome these hurdles, a novel fixation and immunohistochemistry protocol for retinal flat-mount was developed to establish efficient and reliable immunohistochemistry as well as a gentle tissue clearing protocol. In this chapter, to assess the plasticity of retinal synaptic connectivity in cpfl5 mice, mice up to 12 months of age were treated and pre- and post-synaptic markers of cone photoreceptor and subtypes of ON bipolar cells (type 7 cone bipolar cells and rod bipolar cells) were analysed immunohistochemically following gene therapy.

Survival of cone photoreceptor in young treated cpfl5 murine retinas To check whether production of human CNGA3 can rescue cone photoreceptor degeneration in cpfl5 murine retina, cpfl5 mice at 2 weeks of age were subretinally injected with AAV8-co hCNGA3 and eyes were collected at 2 months post injection together with uninjected controls. The whole-mount retinas were stained with cone arrestin (CAR) or PNA as cone photoreceptor markers, then the density and shape of

153

cone pedicles were analysed. Age-matched wild-type (C57BL/6J) retinas were also stained. In untreated cpfl5 retinas, cone pedicles which were labelled with CAR or PNA staining were observed. PNA staining was weak and less defined compared with wild–type cone pedicles (figure 5.1 (A, C), 5.2 (A, B)). CAR staining seen in these remaining cone pedicles was more rounded in shape rather than the usual polygonal shape and lacking filopodia which were prominent in wild–type cone pedicles (figure 5.1 (B, D), 5.3 (A, B)). Whereas PNA staining of cone pedicles in treated retinas was more defined and brighter than in untreated retina (figure 5.1 (C, E), 5.2 (B, C)). CAR staining of cone pedicles in treated retinas was more polygonal in shape and had extended multiple filopodia to neighboring cone pedicles and rod spherules. It also exhibited many dark rounded spots, which were presumably mitochondria, inside the outer part of the cone pedicles as were seen in wild-type (figure 5.1 (A, F), 5.3 (A, C)). The density of cone pedicles in treated eyes was relatively preserved as in wild-type eyes, however that in untreated retinas was lower than in wild-type or treated retinas (figure 5.1). The same analysis was performed at 14 months post injection, and cone pedicles are preserved well as was seen in CAR and PNA staining at 2-month post injection (figure 5.4).

In summary, production of human CNGA3 from early age in cpfl5 murine retinas preserved normal morphology of cone pedicles and the treatment effect lasted up to 14 months post injection.

154

Figure 5.1: Survival of cone photoreceptor in young treated cpfl5 murine retinas Z-projection confocal images of flat mount retina from a C57BL/6J mouse of 3-4 months of age (A, B), or a cpfl5 mouse of the same age uninjected (C, D) or injected

155

(E, F) AAV8-1.75M M8 -ccat-co hCNGA3 at 2 weeks of age. The retinas were stained with PNA (A, C, E) and cone arrestin (B, D, F) and cleared. Scale bar; 10μm

156

Figure 5.2: Survival of cone photoreceptor in young treated cpfl5 mouse retinas Single plane confocal images of flat mount retina from a C57BL/6J mouse of 3-4 months of age (A), or a cpfl5 mouse of the same age uninjected (B) or injected (C) with

157

AAV8-1.75M M8 -ccat-co hCNGA3 at 2 weeks of age. The retinas were stained with PNA and cleared. The imaged area was the same location shown in Figure 5.3. Scale bar; 5μm

158

Figure 5.3: Survival of cone photoreceptor in young treated cpfl5 murine retinas Single plane confocal images of flat mount retina from a C57BL/6J mouse of 3-4 months of age (A), or a cpfl5 mouse of the same age uninjected (B) or injected (C)

159

AAV8-1.75M M8 -ccat-co hCNGA3 at 2 weeks of age. The retinas were stained with cone arrestin and cleared. The imaged area was the same location shown in Figure 5.2. Scale bar; 5μm

160

Figure 5.4: Survival of cone photoreceptor in young treated cpfl5 murine retinas Z-projection confocal images (A, B) or single plane confocal images (C, D) of flat mount retina from a cpfl5 mouse of 14 months of age injected AAV8-1.75M M8 -ccat-co

161

hCNGA3 at 2 weeks of age. The retinal flat mounts were stained with PNA (A, C) and cone arrestin (B, D) and cleared. Scale bar; 10 μm (A, B), 5μm (C, D)

162

Restoration of post-synaptic marker in treated retina Human CNGA3 supplementation therapy in cpfl5 was able to maintain the surviving cone pedicles morphologically, but whether the connection between the rescued cone pedicles and bipolar cell dendritic tips were as well established remained to be answered. This is because withdrawal of normal connections and formation of aberrant connections has been reported in degenerated retinas (Sullivan, Woldemussie et al. 2007, Soto and Kerschensteiner 2015). In particular, ectopic connection between rod photoreceptors and cone bipolar cells was described in Cnga3-/- mice (Haverkamp, Michalakis et al. 2006).

V.3.1. Gpr179 staining in dendritic tips of ON cone bipolar cells Gpr179 has been known as a component of the mGluR6 signaling cascade (Ray, Heath et al. 2014). To test cone pedicle and bipolar cell connection, Gpr179 staining, which stains dendritic tips of ON bipolar cells, was used as a post synaptic marker (Tummala, Neinstein et al. 2014, Hasan, Ray et al. 2016). In case of rod bipolar cells (RBC), which are ON bipolar cells, they mainly receive inputs from rod photoreceptors following invagination of ON bipolar cell dendrites into rod spherules that coincides with eye opening at around post-natal day 14. Staining intensity of Gpr179 in the dendritic tips begins to accumulate at that time and reaches maximum levels at post-natal day 28. Gpr179 staining in ON cone bipolar cells (CBC) are thought to follow similar time course but the staining intensity has been previously reported as 54% of that in RBCs following quantification (Tummala, Neinstein et al. 2014). It has been shown from electron microscopy images of C57BL/6J murine retinas that in general each rod spherule has two outputs to nearby RBCs, but a minority has two outputs to the same RBC through dendritic tips splitting inside or outside the rod spherules. In the case of the dendritic tips splitting inside the rod spherules, the dendritic tips formed Y-shaped dendrite (Tsukamoto and Omi 2013). Another group showed from immunohistochemically Gpr179-stained flat-mounted retinal images of C57BL/6J mice, that rod spherules had one to three outputs to one to three RBCs (Johnson, Tien et al. 2017). On the other hand, Gpr179 staining of CBC dendritic tips in a murine retina has not been well characterized so far. From vertical sections of C57BL/6J murine retinas, Gpr179 staining colocalized with mGluR6 staining at the dendritic tips of CBCs similarly to RBCs, and it formed clusters at the innermost part of the outer plexiform layer (Tummala, Neinstein et al. 2014). Extrapolating from mGlur6 staining of flat-mount murine retinas, Gpr179 staining at the dendritic tips of CBCs was thought to form oval-

163

shaped clusters attached to cone pedicle bases (Dunn, Della Santina et al. 2013, Dunn 2015, Beier, Hovhannisyan et al. 2017).

Gpr179 staining in C57BL/6J or Nrl-GFP murine retina To image Gpr179 staining in flat-mount murine retinas, adult C57BL/6J murine retinas were immunostained with Gpr179, CAR and PNA. Whether Gpr179 staining indicates a connection with rod spherules or cone pedicles was judged by CAR or PNA staining. If the Gpr179 staining was inside the invagination clefts delineated by CAR staining or attached to the PNA staining at the invagination clefts of cone pedicles, the Gpr179 staining was considered to relate to cone pedicles (Figure 5.5). However, independent from CAR or PNA staining, rod spherule-related Gpr179 staining was easier to identify by its duplet or triplet staining pattern at the dendritic tips. Next, to characterize the Gpr179 staining at rod spherules, adult Nrl-GFP murine flat- mount retinas were immunostained with Gpr179 and Protein kinase C alpha (PKCα) which is the marker of rod bipolar cells. Almost all the Gpr179 staining colocalized with PKCα and invaginated into rod spherule delineated by Nrl-GFP (figure 5.6). As previously reported, rod spherules mostly had two parallel small dendritic tip outputs, but double dendritic tips could form V-shape (figure 5.6, white arrows). Some rod spherules had triple outputs (figure 5.6, yellow arrow heads) and in more rare cases they seemingly had only one output (figure 5.6, white arrow heads). Some of the triple output cases were combinations of one common output plus Y or U-shaped outputs (figure 5.6, cyan arrow head). Whereas the single output cases could be angled U-shaped output or incomplete circled output (figure 5.6, magenta arrow head). On the other hand, cone pedicles had an oval-shaped cluster of small U-shaped Gpr179 staining (figure 5.5). Each cone pedicle had roughly around 10 of the small U- shaped staining patterns and this was similar to what has been reported previously for numbers of synaptic ribbons per cone pedicle (Dunn, Della Santina et al. 2013). Gpr179 staining intensity relating to cone pedicles was slightly fainter than that relating to rod spherules (figure 5.7 (A, B)), and the ratio of staining intensity related to cone pedicles to rod spherules (CP/RS) was within the range of 0.58 ± 0.15 (mean ± standard deviation) at 3-4 months of age (figure 5.8).

164

Figure 5.5: Gpr179 staining at cone pedicle bases in C57BL/6J murine retina

165

Single plane confocal images of flat mount retina from a C57BL/6J mouse of 14 months of age. The retina was stained with Gpr179 (A, B, C; red), PNA (B; grey) and cone arrestin (C; green) and cleared. Scale bar; 5μm

166

Figure 5.6: Gpr179 staining at rod spherules in Nrl-GFP murine retina

167

Single plane confocal images of flat mount retina from a NRL-GFP mouse of 8 months of age. The retina was stained with Gpr179 (A, B, C; red) and Protein kinase C alpha (PKCα) (C; green) and cleared. GFP signal was shown in grey (B). V-shaped double dendritic tips (white arrows), triple outputs (yellow arrow head), single U-shaped output (white arrow head), single incomplete circled output (magenta arrow head), triple outputs with a combination of one common output plus Y or U-shaped output (cyan arrow head) are indicated. Scale bar; 10μm

168

Figure 5.7: Gpr179 staining in C57BL/6J and young treated or untreated cpfl5 murine retinas Z-projection of confocal images of flat mount retinas from a C57BL/6J mouse of 3-4 month of age (A, B), or a cpfl5 mouse of the same age uninjected (C, D) or injected (E, F) with AAV8-1.75M M8 -ccat-co hCNGA3 at 2 weeks of age. The retinas were stained with Gpr179 (A-F; grey) and PNA (B, D, F; red), and then cleared. Scale bar; 5μm

169

C Treated at 2 weeks of age

1.0 ** ns * 0.8

0.6

0.4

0.2 toCone Rod ratio

0.0

treated wild-type untreated

Figure 5.8: Signal intensity of Gpr179 staining at cone pedicle bases in C57BL/6J and young treated or untreated cpfl5 murine retinas Analysis of signal intensity of Gpr179 staining performed on single plane confocal images of flat mount retinas from a C57BL/6J mouse of 3-4 month of age, or a cpfl5 mouse of the same age uninjected or injected with AAV8-1.75M M8 -ccat-co hCNGA3 at 2 weeks of age. The retinas were stained with Gpr179 and PNA and then cleared.

170

Leica Las X software was used to process the image. Gpr179 stainings were traced by drawing a free hand line on several cone pedicle related Gpr179 staining (PNA staining was used to confirm the cone pedicles) and more than 10 rod spherule related Gpr179 staining (A). Signal intensity was output (B; white line: Gpr179, red line: PNA). Peaks of signal intensity from each origin were averaged, and cone pedicle to rod spherule related Gpr179 ratio (CP/RS) was calculated. CP/RS from four different locations were used for statistical analysis (Bonferroni's Multiple Comparison Test (ns: p>0.05, **: p≤0.01, *: p≤0.05)). Error bar indicates SEM. (C).

171

Gpr179 staining in cpfl5 murine retina To investigate how Gpr179 staining is altered in the cpfl5 degenerative retina, cpfl5 flat- mount retinas were immunostained with Gpr179 and PNA at 3-4 months of age. Gpr179 staining associated with synapses with rod spherules was unaltered compared with wild-type control. However, Gpr179 staining associated with synapses with cone pedicles was less defined and sometime not visible with reduced staining intensity compared with age matched wild-type (figure 5.7 (C, D)). CP/RS ratio was 0.28 ± 0.05 (mean ± standard deviation) at 3-4 month of age and significantly lower than age matched wild-type control (figure 5.8 (C), Bonferroni's Multiple Comparison Test, p ≤ 0.01).

Gpr179 staining in cpfl5 murine retina following human CNGA3 supplementation therapy Following human CNGA3 supplementation therapy at 2 weeks of age in cpfl5 mice, eyes were collected at 3-4 months of age and the flat-mounted retinas were immunostained with Gpr179 and PNA. Gpr179 staining associated with synapses with rod spherules was unaltered compared with wild-type control and untreated retinas. However, Gpr179 staining associated with synapses with cone pedicles was maintained to wild-type levels in terms of both staining intensity and morphology (figure 5.7 (C, D)). CP/RS ratio was 0.49 ± 0.03 (mean ± standard deviation) at 3-4 months of age and significantly higher than age matched untreated retina (one-way ANOVA, p ≤ 0.05) and not significantly different from wild-type control (one-way ANOVA, p > 0.05) (figure 5.8 (C)).

In summary, Gpr179 staining associated with synapses with rod spherules was unaltered in cpfl5 mice compared with wild-type control. Whereas Gpr179 staining associated with synapses with cone pedicles in cpfl5 mice was less defined and sometime invisible with reduced staining intensity, it was preserved to wild-type level in terms of both staining intensity and morphology in cpfl5 mice following human CNGA3 supplementation therapy at the early age.

V.3.2. Analyses of connections between cone or rod photoreceptors to ON bipolar cells Following the human CNGA3 supplementation therapy in cpfl5 mice, restoration of a post synaptic marker was observed. Focusing on the specific ON bipolar cell type,

172

further analysis of synaptic contact between cone or rod photoreceptors was carried out. The type 7 bipolar cell (CBC7) is one of the most characterized ON cone bipolar cells because a GUS-GFP transgenic murine strain, in which CBC7s are transduced with GFP under gustducin promoter, is available (Huang, Shanker et al. 1999, Wassle, Puller et al. 2009, Behrens, Schubert et al. 2016). Each CBC7 is reported to be contacted by 5 - 8 cone photoreceptors. On the other hand, each cone pedicle makes inputs to one or two CBC7s. To label the CBC7, GUS-GFP transgenic murine strain was crossed with the cpfl5 murine strain and a double mutant strain of GUS-GFP and cpfl5 (cpfl5-gus-gfp) was used. As wild-type controls for this double mutant strain, littermates of the double mutants that were homozygous of GUS-GFP and wild-type Cnga3 allele and their descendants were used (B6;129-gus-gfp). RBCs in the murine retina were originally thought to have contacts exclusively with rod spherules but recently it has been reported that cone pedicles also have direct contacts with RBCs (Pang, Gao et al. 2010, Behrens, Schubert et al. 2016, Rogerson, Behrens et al. 2017). Each RBC was reported to have contacts with around 35 rod spherules and 0 – 3 cone pedicles (25% of RBCs had no contact with cone pedicles). Cone pedicles made inputs to 0 RBC (20%), 1 RBC (45%) and 2-4 RBC (35%). Protein kinase C alpha (PKCα) was used as a RBC marker in this chapter.

Connections between cone photoreceptors and CBC7s The cpfl5-gus-gfp or B6;129-gus-gfp strain retinas were analysed by immunostaining with GFP, Gpr179 and PNA. Contacts between cone pedicles and CBC7s were deemed to be functional connections if a dendrite of a CBC7 was colocalized with Gpr179 staining at a base of cone pedicle. Although Gpr179 staining alone was enough to discriminate cone and rod terminals by the difference of staining (doublets or triplets at rod spherules and oval cluster of small U-shaped staining at cone pedicles), PNA staining was further used to confirm a cone pedicle base. In the B6;129-gus-gfp strain retina, GFP signal intensity of each CBC7 was not homogenous and RBCs were also occasionally labelled but with lower GFP signal intensity. To analyse the dendritic arbors of CBC7s, anti-GFP staining was used (figure 5.9). As previously reported, in central retina each cone pedicle made inputs to one or two CBC7s. A Cone pedicle that was proximal to a cell body of a certain CBC7 was likely to contact only the CBC7, whereas a cone pedicle located at the border of dendritic fields sometimes appeared to input into nearby two CBC7s. In superior mid-peripheral retina, where GFP-labelled CBC7 are sparser than in the central retina, each CBC7 contacts 5

173

to 8 cone pedicles as has been reported, on the other hand each of the cone pedicles were contacted by 0 to 2 CBC7s (figure 5.9).

Connections between cone photoreceptors and RBCs To assess the effect of human CNGA3 supplementation therapy on the connections between cone photoreceptors and RBCs, C57BL/6J as well as treated at 2 weeks of age and untreated cpfl5 murine retinas, were immunostained with Gpr179, PKCα and PNA, and mid-peripheral superior retinal regions were imaged with confocal microscopy. Contacts between cone pedicles and RBCs were deemed to be functional connections if a dendrite of RBC was colocalized with Gpr179 staining at a base of cone pedicle. Although Gpr179 staining was enough to discriminate cone and rod terminals, PNA staining was sometimes used to confirm a cone pedicle base. First, C57BL/6J retinas at the age of 3-4 months were analysed. The connections between cone pedicles and RBCs were commonly observed as previously reported. The connections were likely to locate at the edge of a cone pedicle base. Gpr179 staining at the RBC dendrite tends to be longer and stronger compared with Gpr179 staining at the corresponding cone pedicle base belongs to CBCs. The Gpr179 staining is similar to that associated to rod spherules (figure 5.10). Secondly, untreated cpfl5 retinas were analysed with the same protocol. Contacts between cone pedicles and RBCs were not observed (figure 5.11). Thirdly, treated cpfl5 retinas were analysed with the same protocol. The connections between cone pedicles and RBCs were present, but less frequently than in wild-type murine retinas (figure 5.12). Considering that the cone photoreceptors do not respond to a light stimulus in cpfl5 murine retinas, we can deduce that a maintenance of connectivity between cone pedicles and RBCs needs a functional cone photoreceptor.

174

Figure 5.9: Connectivity of cone pedicles and type 7 cone bipolar cells Z-projection of confocal images of flat mount retinas from a B6;129-gus-gfp strain retina of 5-6 month of age. The retina was stained with GFP (A, B; green), PNA (A, B; red) and Gpr179 (B; grey), and then cleared. Mid-peripheral of superior retina was imaged. Scale bar; 5μm

175

Figure 5.10: Connectivity of cone pedicles and rod bipolar cells in C57BL/6J

176

Single plane confocal images of flat mount retinas from a C57BL/6J retina of 3-4 months of age. The retina was stained with Gpr179 (A-C; red), PNA (B; grey) and PKCα (C; green), and then cleared. Mid-peripheral of superior retina was imaged. Arrow heads indicate colocalization of Gpr179 and PKCα. Scale bar; 10μm

177

Figure 5.11: Connectivity of cone pedicles and rod bipolar cells in untreated cpfl5

178

Single plane confocal images of flat mount retinas from an untreated cpfl5 retina of 3-4 months of age. The retina was stained with Gpr179 (A-C; red), PNA (B; grey) and PKCα (C; green), and then cleared. Mid-peripheral of superior retina was imaged. Scale bar; 10μm

179

Figure 5.12: Connectivity of cone pedicles and rod bipolar cells in young treated cpfl5

180

Single plane confocal images of flat mount retinas from a treated cpfl5 retina of 3-4 months of age. The retina was stained with Gpr179 (A-C; red), PNA (B; grey) and PKCα (C; green), and then cleared. Mid-peripheral of superior retina was imaged. Arrow heads indicate colocalization of Gpr179 and PKCα. Scale bar; 10μm

181

Late treatment in cpfl5 murine model Although an advanced disease stage treatment after photoreceptor death results in lower efficacy of a gene supplementation therapy, it was reported that at 3 months of age it was still possible to restore significant photopic ERG response in Cnga3-/- mice following gene therapy using AAV8(Y733F)-S opsin-Cnga3 vector (Muhlfriedel, Tanimoto et al. 2017). Another group showed in a Retinoschisin-deficient murine model, at the advanced stage (7 months old), that a gene supplementation therapy did not exhibit significant restoration of ERG responses but was able to rescue cone and rod photoreceptor viability, which was quantitatively analysed by immunohistochemistry of nucleus staining in outer nuclear layer and PNA staining (Janssen, Min et al. 2008). A question arisen from here was whether the rescued photoreceptors made functional connections with bipolar cells or not.

In this subchapter, cpfl5 mice were treated with AAV8-co hCNGA3 at the age of 6 or 12 months of age and the efficacy of gene therapy was assessed by full-field photopic ERG and immunohistochemistry of retinas.

V.4.1. Photopic ERG response in cpfl5 mice treated at advanced stage To test the treatment efficacy of gene supplementation therapy on advanced stage of cpfl5 mice, AAV8-1.75M M8 –ccat-co hCNGA3 (titre 1.0 x 1012 vg/ml) was delivered to the subretinal space of cpfl5 mice at the age of 6 or 12 months (n = 29 or 21, respectively). Only one eye was treated, and the contralateral eye was left untreated. Single flash photopic ERGs were recorded at 8 weeks post injection. The light stimulus of 10 cd.s/m2 was used for analysis. Compared with b-wave amplitudes of cpfl5 mice treated at 2 weeks or 1 month of age, b-wave amplitudes of cpfl5 mice treated at 6 or 12 months of age were small. However, the photopic negative responses in some mice treated at 6 months of age were relatively bigger in relation to b-wave in those mice (figure 5.13, 5.14). There was a significant difference in b-wave amplitudes between untreated eyes and eyes treated at 6 or 12 months of age (paired t test, p ≤0.0001). The difference between untreated and treated eyes was small, however full-field ERG was able to pick up the efficacy of gene therapy (figure 5.15).

182

Figure 5.13: ERG recording from a cpfl5 mouse of 6 months of age injected AAV8-1.75M M8 -ccat-co hCNGA3 (A) or uninjected (B). A cpfl5 mouse of 6 months of age was subretinally injected with AAV8-1.75M M8 -ccat- co hCNGA3 in the right eye (A) and uninjected in the left eye (B). Photopic ERG responses following stimulus at 10 cd.s/m2 was recorded at 8 weeks post injection. A and B waves are annotated. X-axis denotes millisecond (ms) and Y-axis denotes microvolt (μV).

183

Figure 5.14: ERG recording from a cpfl5 mouse of 12 months of age injected with AAV8-1.75M M8 -ccat-co hCNGA3 (A) or uninjected (B). A cpfl5 mouse of 12 months of age was subretinally injected with AAV8-1.75M M8 - ccat-co hCNGA3 in the right eye (A) and uninjected in the left eye (B). Photopic ERG responses following stimulus at 10 cd.s/m2 was recorded at 8 weeks post injection. A and B waves are annotated. X-axis denotes millisecond (ms) and Y-axis denotes microvolt (μV).

184

A Treated at 6 months of age

V 

25 ****

Photopic b-wave ERG response b-wave Photopic B treated Treateduntreated at 12 month of age

V 

25 **** 20

Photopic b-wave ERG response b-wave Photopic treated untreated

Figure 5.15: Photopic ERG response in cpfl5 mice treated at advanced stage AAV8-1.75M M8 –ccat- co CNGA3 (titre 1.0 x 1012) was delivered to the subretinal space of cpfl5 mice at 6 (A) or 12 (B) months of age (n=29 or 21 for each age). Single flash photopic ERG response was recorded at 8 weeks post injection. The light stimulus of 10 cd.s/m2 were used for analysis. ****: p ≤ 0.0001 (paired t test). Error bar indicates SEM.

185

V.4.2. Multielectrode array (MEA) Multielectrode array was used to test a focal area of treated retinas. Whereas the full- field ERG is a powerful tool to assess retinal function from the whole retina, MEA is superior to the full-field ERG when it comes to assess the retinal responses of focal areas. As the degeneration of cone photoreceptors progresses, majority of the cone photoreceptor cells disappear in the inferior retina, but some remain in the superior retina. In this situation, b-wave amplitude of the full-field photopic ERG was largely attenuated by the reduced number of remaining cone photoreceptors and it was not able to reflect the electrophysiological response of a small fraction of photoreceptors that were rescued. Therefore, MEA analysis specifically for the superior retina was conducted in this study to better characterise the electrophysiological response of the focal area of superior retina where cone photoreceptor density is relatively maintained. The preliminary data was described below, but more animals are still needed, especially in the 2-4 week injection group, and for optimal assessment of the responses the data need to be spike-sorted to characterize further.

Photopic Flicker response AAV8-1.75M M8 –ccat-co hCNGA3 (titre 1.0 x 1012 vg/ml) were delivered to subretinal space of cpfl5 mice at the age of 6 months. Only one eye was treated and the contralateral eye was left untreated. Dissected parts of retina from mid-peripheral superior retina were used. To probe for a photopic response, flicker stimuli of 0, 5, 10 and 15 Hz at ND1 light intensity under light adapted background were used. Only responding electrodes were recorded and the resultant data were averaged and analysed without spike sorting. As the flicker stimuli got faster, the response got lower and almost disappeared from 10 Hz stimuli in untreated eyes of cpfl5 mice. Therefore, MEA response at 0 or 5 Hz stimuli was thought to be mixed from cone photoreceptors and rod photoreceptors, whereas responses at 10 Hz stimuli were deemed to reflect cone photoreceptor responses exclusively. In eyes of untreated cpfl5 mice there were no measurable responses at 10 Hz and above. In contrast, amplitudes of response to 10 Hz stimuli in some – but not all – treated eyes remained moderately high and comparable with wild- type response (figure 5.16). This indicated late treatment of cone photoreceptor cells was still able to restore cone photoreceptor response comparable with wild-type response.

186

Figure 5.16: Multielectrode array data of C57BL/6J and cpfl5 mice treated or untreated with subretinal injection of AAV8-1.75M M8 –ccat-co hCNGA3 Dark blue lines indicate response of C57BL/6J, red is untreated cpfl5, green is treated cpfl5 at 6 months of age, and cyan is treated cpfl5 at 2 to 4 weeks of age. Each line is the mean from a single piece of superior retina.

187

Histological analysis of retinas treated at advanced stage of disease

V.5.1. Pre- and Post-synaptic marker of cone photoreceptors To test the anatomical change following the gene supplementation therapy on advanced stage of cpfl5 mice, AAV8-1.75M M8 –ccat-co hCNGA3 (titre 1.0 x 1012 vg/ml) was delivered to the subretinal space of cpfl5 mice at the age of 6 or 12 months. Only one eye was treated, and the contralateral eye was left untreated. Retinas were collected 2 to 3 months post injection and immunostained with Gpr179 and PNA as well as CAR or PKCα.

Presynaptic marker of cone photoreceptors CAR and PNA staining were used as presynaptic markers of cone photoreceptors. As was seen in the cpfl5 retina of 3-4 months of age, CAR staining in untreated cpfl5 retina of 8-9 or 14 months of age was likely to have a rounded shape rather than a polygonal one and lacking filopodia which were prominent in normal cone pedicles (figure 5.17 (C), 5.20 (C)). Especially, retinas of 14 months of age had some cone pedicles which showed unusually large round dark spaces internally (figure 5.20 (C), 5.21 (C)). Likewise, PNA staining was weak and less defined compared with normal cone pedicles (figure 5.17 (B), 5.20 (B)). CAR staining of cone pedicles in treated retinas was more polygonal shape and they had extended multiple filopodia to neighboring cone pedicles and rod spherules. They also exhibited multiple small dark rounded spots, which were presumably mitochondria, inside the outer part of the cone pedicles (figure 5.19 (C), 5.21 (C)). PNA staining was more defined and brighter than in untreated retinas (figure 5.19 (B), 5.21 (B)).

188

Figure 5.17: Cone pedicles in a C57BL/6J murine retina of 8-9 months of age

189

Single plane confocal images of flat mount retina from a C57BL/6J mouse of 9 months of age. The retina was stained with Gpr179 (A, B, C; red), PNA (B; grey) and cone arrestin (C; green) and cleared. Scale bar; 5μm

190

Figure 5.18: Cone pedicles in a cpfl5 murine retina of 8-9 months of age

191

Single plane confocal images of flat mount retina from a cpfl5 mouse of 8-9 months of age. The retina was stained with Gpr179 (A, B, C; red), PNA (B; grey) and cone arrestin (C; green) and cleared. Scale bar; 5μm

192

Figure 5.19: Cone pedicles in a cpfl5 murine retina of 8-9 months of age treated at 6 months of age

193

Single plane confocal images of flat mount retina from a cpfl5 mouse of 8-9 months of age injected AAV8-1.75M M8 –ccat- co CNGA3 (titre 1.0 x 1012) at 6 months of age. The retina was stained with Gpr179 (A, B, C; red), PNA (B; grey) and cone arrestin (C; green) and cleared. Scale bar; 5μm

194

Figure 5.20: Cone pedicles in a cpfl5 murine retina of 14 months of age

195

Single plane confocal images of flat mount retina from a cpfl5 mouse of 14 months of age. The retina was stained with Gpr179 (A, B, C; red), PNA (B; grey) and cone arrestin (C; green) and cleared. Scale bar; 5μm

196

Figure 5.21: Cone pedicles in a cpfl5 murine retina of 14 months of age treated at 12 months of age

197

Single plane confocal images of flat mount retina from a cpfl5 mouse of 14 months of age injected AAV8-1.75M M8 –ccat- co CNGA3 (titre 1.0 x 1012) at 12 months of age. The retina was stained with Gpr179 (A, B, C; red), PNA (B; grey) and cone arrestin (C; green) and cleared. Scale bar; 5μm

198

Postsynaptic marker of cone photoreceptors Gpr179 staining associated with synapses with rod spherules were unaltered compared with wild-type control and untreated retinas. Gpr179 staining associated with synapses with cone pedicles was less defined in untreated cpfl5 retina, however the Gpr179 staining was restored to levels similar to wild-type in terms of both staining intensity and morphology in treated cpfl5 retina at the age of 6 months (figure 5.17, 5.19). Whereas the Gpr179 staining was partially restored to wild-type levels in terms of both staining intensity and morphology in treated cpfl5 retina at the age of 12 months (figure 5.5, 5.21). Compared with the cpfl5 retina treated at 2 weeks of age, restoration of Gpr179 staining at cone pedicle bases in the cpfl5 mice treated at 6 months of age was of similar level, however the restoration was slightly less prominent but still observed at 12 months of age. It was also worth noting that the CP/RS ratios of untreated cpfl5 murine retina of 14 months of age tend to be slightly lower than that of untreated cpfl5 murine retina of 8-9 months of age (figure 5.22).

In summary, cpfl5 mice still maintain some Gpr179 localization at the dendritic tips of ON bipolar cells at the advanced disease stage, and gene therapy was able to restore healthy cone pedicles structure and restore Gpr179 expression level at the dendritic tips of ON bipolar cells.

199

A Treated at 6 months of age

1.0 ns ** 0.8

0.6

0.4

0.2 Cone to Cone ratio Rod

0.0

treated wild-type untreated B Treated at 12 months of age

1.0 * 0.8

0.6

0.4

0.2 Cone to Cone ratio Rod

0.0

treated wild-type untreated

Figure 5.22: Signal intensity of Gpr179 staining at cone pedicle bases in C57BL/6J and late treated or untreated cpfl5 murine retinas Analysis of signal intensity of Gpr179 staining performed on single plane confocal images of flat mount retinas from a C57BL/6J mouse of 8-9 or 14 months of age, or a cpfl5 mouse of the same age uninjected or injected AAV8-1.75M M8 -ccat-co hCNGA3 at 6 or 12 months of age. The retinas were stained with Gpr179 and PNA and then cleared. Leica Las X software was used to process the image. Gpr179 stainings were traced by drawing a free hand line on several cone pedicle related Gpr179 staining (PNA staining was used to confirm the cone pedicles) and more than 10 rod spherule related Gpr179 staining. Peaks of signal intensity from each origin were averaged, and

200

cone pedicle to rod spherule related Gpr179 signal intensity ratio (CP/RS) was calculated. CP/RS from three retinas were used for statistical analysis (Dunnett's Multiple Comparison Test for A, Paired t Test for B (ns: p>0.05, **: p≤0.01, *: p≤0.05)). Error bar indicates SEM. (C).

201

V.5.2. Connections between cone photoreceptors and RBCs Following the restoration of pre- and post-synaptic marker of cone photoreceptors, connectivity of cone pedicles to RBCs was tested following the gene supplementation therapy of advanced stage cpfl5 mice. AAV8-1.75M M8 –ccat-co hCNGA3 (titre 1.0 x 1012 vg/ml) was delivered to the subretinal space of cpfl5 mice at the age of 6 months. Only one eye was treated, and the contralateral eye was left untreated. Retinas were collected 2 to 3 months post injection and immunostained with Gpr179, PKCα and PNA. In contrast with age matched wild-type retina, both the untreated and the treated retina did not have any connection between cone pedicles and rod bipolar cells (figure 5.23- 25). This indicated that the formation or maintenance of connectivity between cone pedicles and RBCs needed a functional cone photoreceptor cell and once the connection was lost, the restoration of the connection may not happen anymore.

V.5.3. Connection between cone photoreceptors and CBCs Following the restoration of pre- and post-synaptic marker of cone photoreceptors, connectivity of cone pedicles to CBC7s was tested in cpfl5-gus-gfp mice. AAV8-1.75M M8 –ccat-co hCNGA3 (titre 1.0 x 1012 vg/ml) was delivered to the subretinal space of cpfl5-gus-gfp mice at the age of 3 months. Only one eye was treated, and the contralateral eye was left untreated. Retinas were collected 2 to 3 months post injection and immunostained with Gpr179 and PNA. Analysis of the untreated and treated cpfl5-gus-gfp strain retinas at 5-6 months of age revealed that each CBC7 contacted with lower number of cone pedicles than in the B6;129-gus-gfp strain retina if the local density of cone pedicles was lower. Although further statistical analysis is required, the number of each cone pedicle contacts with CBC7s was similar in untreated and treated cpfl5-gus-gfp strain retinas as well as in the B6;129-gus-gfp strain retina (figure 5.9, 5.26-27). At a local area where cone pedicles were lost, dendrites of CBC7 may rarely form aberrant connections to rod spherules in cpfl5-gus-gfp strain retinas. CBC7s may contact one of the doublets of Gpr179 staining at rod spherules (figure 5.28) or form an additional connection near the doublets at rod spherules (figure 5.29). Considering that the cone photoreceptors do not respond to light stimulus in cpfl5 murine retinas, a formation and maintenance of contacts between cone pedicles and CBC7s does not need a functional cone photoreceptor as long as there is a surviving cone photoreceptor cell.

202

Figure 5.23: Connectivity of cone pedicles and rod bipolar cells in a C57BL/6J of 8-9 months of age

203

Single plane confocal images of flat mount retinas from a C57BL/6J retina of 8-9 months of age. The retina was stained with Gpr179 (A-C; red), PNA (B; grey) and PKCα (C; green), and then cleared. Mid-periphery of superior retina was imaged. Arrow heads indicate colocalization of Gpr179 and PKCα. Scale bar; 5μm

204

Figure 5.24: Connectivity of cone pedicles and rod bipolar cells in an untreated cpfl5 of 8-9 months of age

205

Single plane confocal images of flat mount retinas from an untreated cpfl5 retina of 8-9 months of age. The retina was stained with Gpr179 (A-C; red), PNA (B; grey) and PKCα (C; green), and then cleared. Mid-periphery of superior retina was imaged. Scale bar; 5μm

206

Figure 5.25: Connectivity of cone pedicles and rod bipolar cells in a treated cpfl5 of 8-9 months of age

207

Single plane confocal images of flat mount retinas from a treated cpfl5 retina of 8-9 months of age injected AAV8-1.75M M8 –ccat- co CNGA3 (titre 1.0 x 1012) at 6 months of age. The retina was stained with Gpr179 (A-C; red), PNA (B; grey) and PKCα (C; green), and then cleared. Mid-periphery of superior retina was imaged. Scale bar; 5μm

208

Figure 5.26: Connectivity of cone pedicles and type 7 cone bipolar cells in cpfl5- gus-gfp mice Z-projection of confocal images of flat mount retinas from a cpfl5-gus-gfp retina of 5-6 month of age. The retina was stained with GFP (A, B; green), PNA (A, B; red) and

209

Gpr179 (B; grey), and then cleared. Mid-periphery of superior retina was imaged. Scale bar; 5μm

210

Figure 5.27: Connectivity of cone pedicles and type 7 cone bipolar cells in treated cpfl5-gus-gfp mice Z-projection of confocal images of flat mount retinas from a cpfl5-gus-gfp retina of 5-6 month of age injected AAV8-1.75M M8 –ccat- co CNGA3 (titre 1.0 x 1012) at 3 months

211

of age. The retina was stained with GFP (A, B; green), PNA (A, B; red) and Gpr179 (B; grey), and then cleared. Mid-periphery of superior retina was imaged. Scale bar; 5μm

212

Figure 5.28: Connectivity of rod spherules and type 7 cone bipolar cells in cpfl5- gus-gfp mice Z-projection of confocal images of flat mount retinas from a cpfl5-gus-gfp retina of 5-6 month of age. The retina was stained with GFP (A, C, D; green), PNA (A, B, D; red) and Gpr179 (A, B, D; grey), and then cleared. Mid-periphery of superior retina was imaged. B, C and D are high magnification images of white rectangle area in A. Arrow indicates co-localization of GFP and one of common doublets Gpr179 staining at a rod spherule Scale bar; 5μm

213

Figure 5.29: Connectivity of rod spherules and type 7 cone bipolar cells in cpfl5- gus-gfp mice Z-projection of confocal images of flat mount retinas from a cpfl5-gus-gfp retina of 5-6 month of age. The retina was stained with GFP (A, C, D; green), PNA (A, B, D; red) and Gpr179 (A, B, D; grey), and then cleared. Mid-periphery of superior retina was imaged. B, C and D are high magnification images of white rectangle area in A. Arrow indicates co-localization of GFP and an additional Gpr179 staining at a rod spherule Scale bar; 5μm

214

Summary The cpfl5 strain is one of cone dysfunction syndrome and do not have residual photopic electrophysiological from birth. Therefore, cpfl5 is an ideal disease model to validate an effect of deafferentation and following restoration of afferentation from cone photoreceptors to bipolar cells via gene supplementation therapy. Short-term (2 weeks from birth) deafferentation in young treated mouse showed similar profile of pre-synaptic markers such as cone arrestin or PNA. Post-synaptic marker in dendritic tips of cone bipolar cells, Gpr179 was also similar to wild-type level. However, cone photoreceptors lost majority of functional connection to rod photoreceptors. Long-term (6 or 12 months from birth) deafferentation still preserved plasticity of the functional connection between cone photoreceptors and bipolar cells as shown by photopic ERG response, photopic flicker response of MEA and the synaptic markers. A few-month deafferentation from birth did not eliminate the non-functional connection between cone photoreceptors and cone bipolar cells, whereas 6-month deafferentation from birth did retract non-functional connection between cone photoreceptors and rod bipolar cells. Ectopic connections between rod photoreceptors and cone bipolar cells may not be major consequence of the long-term deafferentation.

215

Chapter VI. Discussion

The first gene therapy for a mouse disease model of cone dysfunction was conducted in cpfl3 mice which have Gnat2 deficiency. Following the delivery of AAV5-PR2.1- GNAT2, the mice showed normal range of photopic ERG response (Alexander, Umino et al. 2007). This study was quite encouraging for a development of gene therapy for achromatopsia, although the promoter used in this study was able to target only human red/green cones but not blue cones.

Development of a cone specific promoter The aim of this study was firstly to develop gene therapy for achromatopsia due to CNGA3 gene mutations, but also to develop a robust cone specific promoter which can target all subtypes of cones in human retina. So far, the mouse blue opsin promoter or CBA promoter were used to treat mouse disease models of achromatopsia due to Cnga3 gene mutations. An AAV5 carrying the mouse cnga3 gene under the mouse blue opsin promoter showed 25-30% of wild type level of photopic ERG response with delivering 30% area of the retina in Cnga3-/- mice (Banin, Gootwine et al. 2015). Since human blue opsin promoter was not able to work specifically and as strongly as in the murine retina, in a higher order animal retina, such as the canine retina, mouse blue opsin promoter could also have the same issue (Dyka, Boye et al. 2014). Whereas the CBA promoter performed even better in rescuing cpfl5 mice. AAV5- CBA promoter-mouse Cnga3 achieved 80% of wild type level of photopic ERG (Pang, Deng et al. 2012), however the CBA promoter is ubiquitous promoter and was thought to not be appropriate for clinical use for safety reasons as expression of the CNGA3 gene might e.g. interfere with rod function. Based on the previous study that compared red and green opsin core promoter, I developed novel green opsin promoters. These green opsin promoters drove high expression of transgene specifically to all subtype of cone photoreceptors in hEBs. As a trend, although transgene expression in each cone photoreceptor mediated by the green opsin promoters with four additional nucleotides in 5’UTR immediately before the start codon were slightly lower than the1.7L red opsin promoter, the fraction of cone photoreceptors in which transgene expression was detected were slightly higher by the green opsin promoters mediate than the red opsin promoter. This indicated transcription level was upregulated by the green opsin promoters but potentially the translation levels were lower than the red opsin promoter. Following the removal of those 4 nucleotides from the 5’UTR, transgene expression level in each cone photoreceptor by the green opsin promoters increased and reached up to 47% higher

216

level compared with the red opsin promoter in hEBs. This suggested the importance of 5’UTR in regulating messenger RNA stability or translational levels. Thus, the novel green opsin promoters were proved to have higher efficacy than the red opsin promoter and have specific expression in all subtype of cone photoreceptors in human tissue.

Rescue of cpfl5 mice with vectors carrying green opsin promoters Secondly, the vectors carrying the green opsin promoters were used to treat Cnga3 deficient mice. As was predicted from the in vitro promoter profile data in hEBs, the mice treated at 1 month of age by AAV8 carrying the green opsin promoters with the 4 additional nucleotides did not exhibit superior photopic ERG response than that provided by the red opsin promoter. Whereas the mice treated at 1 month of age by AAV8 carrying the green opsin promoter without the 4 nucleotides showed consistently higher photopic ERG response up to 12 weeks post injection than the red opsin promoter, although the difference was not slightly significant (two-way ANOVA, p=0.065). Early treatment at 2 weeks of age before cone degeneration initiates was also performed. Photopic ERG response of the mice treated at 2 weeks of age had slightly higher response at 4 weeks post injection but not with significance, the difference had disappeared after 8 weeks post injection compared with treatment at 1 month of age, when 40% of cone photoreceptors have already degenerated. It was claimed that one microliter of virus given at a single injection was almost enough to detach the entire area of the murine retina at 2 weeks of age and a higher volume might induce damage to the retina (Pang, Deng et al. 2012). In our experiment, 1 or 1.5 microliter of double injection with/without paracentesis was performed. Procedure related retinal damage might be the reason that the treatment at an early age did not improve the efficacy of gene supplementation therapy. Volume of subretinal injection or with/without paracentesis should be carefully considered for further experiment. Compared with the previous report using AAV5-CBA-mouse Cnga3, AAV8-1.45M M8 – ccat-co human CNGA3 seemed to perform less efficiently, although there were difference in injected vector genome particles (1010 vs 0.7-1.05x1010) and volume (1x1 microliter vs 1-1.5x2 microliters). The CBA promoter is thought to drive transgene expression at detectable level from 7 days post injection, therefore it is fast enough to suppress degeneration after 3 weeks of age when the vector is injected at 2 weeks of age (Pang, Deng et al. 2012). Whereas the green opsin promoter might have more gradual expression profile or the expression level at the steady state could be lower than the CBA promoter. Additionally, in this study, the human transgene was used to

217

rescue, but its efficiency in combining with mouse CNGB3 subunit is unknown. Lastly and importantly, in the study using the CBA promoter, 40% of low quality of injections (12 eyes) were excluded from the analysis and resulted in at least 3 eyes per experiment, but in my study, all the injected eyes were included in the analysis irrespective of injection quality so as to be more objective. The level of rescue in this animal model varies substantially. Considering that some treated eyes in this study showed the level of photopic ERG response as same as wild-type level, it is difficult to conclude the green opsin promoter is less efficient than CBA promoter. AAV8 carrying the green opsin promoter treated Cnga3 deficient mice at 2 weeks or 1 month of age showed almost 30% of photopic ERG response of wild-type mice. Different capsids of AAV were tested to improve the efficacy of treatment. As was expected from previous reports, AAV5 was less efficient than the AAV8. Despite that novel capsid Anc80L65 was reported to have better tropism to photoreceptors than AAV8, it performed worse than AAV8 rescuing Cnga3 deficient mice. Another novel capsid AAV44.9 had a comparable potential to AAV8, however the production of sufficient titre of AAV44.9 by AAV column purification method, which is widely used for clinical grade vector production, was difficult in our hands.

In summary, the novel green opsin promoter is a robust cone specific promoter which can target all subtypes of cones in human retinal culture. Treatment of Cnga3 deficient mice at 2 weeks or 1 month of age with AAV8 carrying the green opsin promoter showed almost 30% of photopic ERG response of wild-type mice.

Synaptic plasticity in cpfl5 mouse retina AAV supplementation gene therapy for a murine model of achromatopsia due to Cnga3 gene mutation has proved its efficacy not only in early stage but also in advanced stage of degeneration both electrophysiologically and morphologically. Although the ectopic cone bipolar cell connection to rod photoreceptor cells has been reported (Haverkamp, Michalakis et al. 2006), this study showed that the ectopic connection deemed to be functional but rare. ON cone bipolar cells were able to maintain connection to non-functional cone photoreceptor cells with remnant localisation of one of the mGluR6 cascade protein, Gpr179, at their dendritic tips in the invagination clefts of the cone pedicle bases. And those connections were reactivated following the gene supplementation therapy even in advanced disease stage. The full-field ERG responses in adult treated cpfl5 mice were smaller than that in young treated as it reflects total number of rescued cone photoreceptor cells, however some MEA responses at superior retina, where cone photoreceptor cells are surviving relatively

218

well, were comparable with wild-type. Together with the fact that almost full recovery of Gpr179 localization at cone bipolar cell dendritic tips at 6 months of age treatment, this suggested the connectivity of cone photoreceptor cells to cone bipolar cells can be fully restored in each surviving cone photoreceptor cell. This is encouraging indication as future clinical trials will likely involve not new born babies but infants and adult patients. Two of the subtypes of ON bipolar cells, type 7 cone bipolar cells and rod bipolar cells were focused on further in this study to investigate the connectivity in the non- functional cone photoreceptor cell retina, cpfl5. The CBC7s still maintained connection with surviving non-functional cone photoreceptor cells, whereas RBCs lost connection with the cone photoreceptor cells but had unaltered connection with rod photoreceptor cells. In contrast to early age treatment of cpfl5 mice where the connectivity of cone photoreceptor cells and RBCs was partially maintained, the late treatment was not able to preserve the connectivity. This indicates that outputs of cone and rod photoreceptor cells into RBCs are competing with each other and this notion agrees with the fact that an increased frequency of cone photoreceptor cells and RBCs connecting with each other in a rod photoreceptor cell degeneration murine model (Michalakis, Kleppisch et al. 2011). Although the functional significance of connection between cone photoreceptor cells and RBCs is unknown, Gpr179 protein level in RBC dendritic tips at cone pedicle bases was higher and contact area was relatively larger than the other cone ON bipolar cell dendritic tips. The Gpr179 protein level of RBC dendritic tips was similar at both cone pedicles and rod spherules, but the contact area at each cone pedicle was larger than at each rod spherule. Those results suggest that the cone photoreceptor cell - RBC pathway may have unknown significant function in murine retina. In summary, surviving cone photoreceptor cells of Cnga3 deficient mice at advanced stage can be functional following gene supplementation therapy. And those cone photoreceptors still maintain contacts with cone bipolar cells. One of the CBCs, CBC7, showed ectopic connections with rod photoreceptor cells, but the ectopic connections were rare and may not be the significant issue. Rather, the preservation and synaptic plasticity of cone photoreceptor cells and cone bipolar cells connectivity in advanced Cnga3 deficiency sheds light on the future clinical trial.

219

Chapter VII. Future directions

Further study is ongoing to develop and accomplish the following projects.

Characterization of degeneration in cpfl5 murine retina The characterization of degeneration in murine models of Cnga3 gene mutations has been conducted mainly on the Cnga3-/- strain. As the cpfl5 strain has natural occurring Cnga3 gene mutations that results in missense mutation, the degeneration in the cpfl5 strain is expected to be similar to that in Cnga3-/- strain, however this has not been confirmed. It could be argued though, that the cpfl5 mutant strain is more likely to reflect the human disease accurately as the majority of human CNGA3 mutations are amino acid substitutions (Wissinger, Gamer et al. 2001). The progression rate of cone photoreceptor degeneration in cpfl5 mice will be analysed by Peanut agglutinin (PNA) staining of the cpfl5 and C57BL/6J murine whole mount retina at the age of 3 weeks, 4 weeks, 3 months, 6 months and 12 months. As degeneration in Cnga3-/- mice has been reported to be more progressive in inferior and nasal retina than in superior and temporal retina, four peripheral quadrants of superior, temporal, inferior and nasal retinal cone photoreceptors’ inner/outer segments density by PNA staining will be counted to test topographical difference as well.

Expression of human CNGA3 transgene in treated retina Although the sequence of human CNGA3 sequence matches 79% that of murine Cnga3 sequence, anti CNGA3 antibody to detect both murine and human origin is not commercially available. Especially, human CNGA3 protein was difficult to be stained due to lack of good performance antibody. To check human CNGA3 transgene expression and anatomical localization in mouse retina, cpfl5 murine eyes injected with AAV8-1.75M M8 –ccat-co hCNGA3 or uninjected controls were collected and will be analysed by immunohistochemistry of human CNGA3 using newly obtained anti human CNGA3 antibodies.

Behaviour test following gene therapy on cpfl5 mice

220

Behaviour test in treated cpfl5 mice is ongoing. Optomotor test based on optokinetic response has been used to evaluate the visual behaviour response, however the subjective nature of the test makes it not necessarily reliable and requires a well- trained examiner. Recently, a group has developed an automated optomotor system and it should provide more reliable and reproduceable results. Preliminary data showed the automated system was able to distinguish the difference of photopic vision mediated response in wild-type and cpfl5 mice, therapeutic improvement in cpfl5 mice treated at 2 weeks of age was seen in contrast sensitivity.

Further histological analysis of connectivity Analysis of other post-synaptic markers of subtypes of bipolar cells and horizontal cells as well as pre-synaptic marker of cone photoreceptor cells in the cpfl5 murine retina following gene supplementation therapy is ongoing. It has been shown that the strategy to form synaptic connection by distinct subtypes of cone bipolar cells (type 6, 7 and 8) during the developmental stage are different in the murine retina (Dunn and Wong 2012). In addition, response and remodelling in the absence of light stimuli by the distinct subtypes of cone bipolar cells were different (Dunn, Della Santina et al. 2013). Moreover, compared with ON cone bipolar cells, OFF bipolar cells have reported to be less vulnerable to bystander effect against cone photoreceptor cells in rod photoreceptor degeneration murine model (Gayet-Primo and Puthussery 2015). As the distinct subtypes of bipolar cells convey different information to the central nervous system, analysis of connectivity of other subtypes of bipolar cells is crucial to understand the therapeutic efficacy of gene therapy for CNGA3 deficiency. Immunohistological imaging of flat-mounted retina stained with secretagoginin (for type 2, 3, and 4 OFF bipolar cells and type 5, 6 and possibly 8 ON cone bipolar cells), synaptotagmin 2 (for type 2 OFF and 6 ON bipolar cells), NK3R (for type 1 and 2 OFF bipolar cells), GluR5 (for all OFF bipolar cells) is ongoing. In addition, horizontal cell connectivity and ribbon structure are under investigation.

221

Chapter VIII. References

Abken, H. (2017). "Driving CARs on the Highway to Solid Cancer: Some Considerations on the Adoptive Therapy with CAR T Cells." Hum Gene Ther 28(11): 1047-1060. Aboshiha, J., A. M. Dubis, J. Carroll, A. J. Hardcastle and M. Michaelides (2016). "The cone dysfunction syndromes." Br J Ophthalmol 100(1): 115-121. Aboshiha, J., A. M. Dubis, J. Cowing, R. T. Fahy, V. Sundaram, J. W. Bainbridge, R. R. Ali, A. Dubra, M. Nardini, A. R. Webster, A. T. Moore, G. Rubin, J. Carroll and M. Michaelides (2014). "A prospective longitudinal study of retinal structure and function in achromatopsia." Invest Ophthalmol Vis Sci 55(9): 5733-5743. Aboshiha, J., V. Luong, J. Cowing, A. M. Dubis, J. W. Bainbridge, R. R. Ali, A. R. Webster, A. T. Moore, F. W. Fitzke and M. Michaelides (2014). "Dark-adaptation functions in molecularly confirmed achromatopsia and the implications for assessment in retinal therapy trials." Invest Ophthalmol Vis Sci 55(10): 6340-6349. Abozaid, M. A., C. S. Langlo, A. M. Dubis, M. Michaelides, S. Tarima and J. Carroll (2016). "Reliability and Repeatability of Cone Density Measurements in Patients with Congenital Achromatopsia." Adv Exp Med Biol 854: 277-283. Aguirre, G. D. (2017). "Concepts and Strategies in Retinal Gene Therapy." Invest Ophthalmol Vis Sci 58(12): 5399-5411. Akimoto, M., H. Cheng, D. X. Zhu, J. A. Brzezinski, R. Khanna, E. Filippova, E. C. T. Oh, Y. Z. Jing, J. L. Linares, M. Brooks, S. Zareparsi, A. J. Mears, A. Hero, T. Glaser and A. Swaroop (2006). "Targeting of GFP to newborn rods by Nrl promoter and temporal expression profiling of flow-sorted photoreceptors." Proceedings of the National Academy of Sciences of the United States of America 103(10): 3890-3895. Alexander, J. J., Y. Umino, D. Everhart, B. Chang, S. H. Min, Q. Li, A. M. Timmers, N. L. Hawes, J. J. Pang, R. B. Barlow and W. W. Hauswirth (2007). "Restoration of cone vision in a mouse model of achromatopsia." Nat Med 13(6): 685-687. Aligianis, I. A., T. Forshew, S. Johnson, M. Michaelides, C. A. Johnson, R. C. Trembath, D. M. Hunt, A. T. Moore and E. R. Maher (2002). "Mapping of a novel locus for achromatopsia (ACHM4) to 1p and identification of a germline mutation in the alpha subunit of cone transducin (GNAT2)." J Med Genet 39(9): 656-660. Allocca, M., C. Mussolino, M. Garcia-Hoyos, D. Sanges, C. Iodice, M. Petrillo, L. H. Vandenberghe, J. M. Wilson, V. Marigo, E. M. Surace and A. Auricchio (2007). "Novel adeno-associated virus serotypes efficiently transduce murine photoreceptors." J Virol 81(20): 11372-11380. Andersen, M. K., N. L. Christoffersen, B. Sander, C. Edmund, M. Larsen, T. Grau, B. Wissinger, S. Kohl and T. Rosenberg (2010). "Oligocone trichromacy: clinical and molecular genetic investigations." Invest Ophthalmol Vis Sci 51(1): 89-95. Andreasson, S. O., M. A. Sandberg and E. L. Berson (1988). "Narrow-band filtering for monitoring low-amplitude cone electroretinograms in retinitis pigmentosa." Am J Ophthalmol 105(5): 500-503. Arango-Gonzalez, B., D. Trifunovic, A. Sahaboglu, K. Kranz, S. Michalakis, P. Farinelli, S. Koch, F. Koch, S. Cottet, U. Janssen-Bienhold, K. Dedek, M. Biel, E. Zrenner, T. Euler, P. Ekstrom, M. Ueffing and F. Paquet-Durand (2014). "Identification of a common non-apoptotic cell death mechanism in hereditary retinal degeneration." PLoS One 9(11): e112142. Araujo, P. R., K. Yoon, D. J. Ko, A. D. Smith, M. Qiao, U. Suresh, S. C. Burns and L. O. F. Penalva (2012). "Before It Gets Started: Regulating Translation at the 5 ' UTR." Comparative and Functional Genomics. Augustyniak, J., A. Bertero, T. Coccini, D. Baderna, L. Buzanska and F. Caloni (2019). "Organoids are promising tools for species-specific in vitro toxicological studies." J Appl Toxicol. Auricchio, A., I. Trapani and R. Allikmets (2015). "Gene Therapy of ABCA4-Associated Diseases." Cold Spring Harb Perspect Med 5(5): a017301.

222

Aurnhammer, C., M. Haase, N. Muether, M. Hausl, C. Rauschhuber, I. Huber, H. Nitschko, U. Busch, A. Sing, A. Ehrhardt and A. Baiker (2012). "Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences." Hum Gene Ther Methods 23(1): 18-28. Bainbridge, J. W., M. S. Mehat, V. Sundaram, S. J. Robbie, S. E. Barker, C. Ripamonti, A. Georgiadis, F. M. Mowat, S. G. Beattie, P. J. Gardner, K. L. Feathers, V. A. Luong, S. Yzer, K. Balaggan, A. Viswanathan, T. J. de Ravel, I. Casteels, G. E. Holder, N. Tyler, F. W. Fitzke, R. G. Weleber, M. Nardini, A. T. Moore, D. A. Thompson, S. M. Petersen-Jones, M. Michaelides, L. I. van den Born, A. Stockman, A. J. Smith, G. Rubin and R. R. Ali (2015). "Long-term effect of gene therapy on Leber's congenital amaurosis." N Engl J Med 372(20): 1887-1897. Bainbridge, J. W., A. J. Smith, S. S. Barker, S. Robbie, R. Henderson, K. Balaggan, A. Viswanathan, G. E. Holder, A. Stockman, N. Tyler, S. Petersen-Jones, S. S. Bhattacharya, A. J. Thrasher, F. W. Fitzke, B. J. Carter, G. S. Rubin, A. T. Moore and R. R. Ali (2008). "Effect of gene therapy on visual function in Leber's congenital amaurosis." N Engl J Med 358(21): 2231-2239. Balaggan, K. S., K. Binley, M. Esapa, S. Iqball, Z. Askham, O. Kan, M. Tschernutter, J. W. Bainbridge, S. Naylor and R. R. Ali (2006). "Stable and efficient intraocular gene transfer using pseudotyped EIAV lentiviral vectors." J Gene Med 8(3): 275-285. Banin, E., E. Gootwine, A. Obolensky, R. Ezra-Elia, A. Ejzenberg, L. Zelinger, H. Honig, A. Rosov, E. Yamin, D. Sharon, E. Averbukh, W. W. Hauswirth and R. Ofri (2015). "Gene Augmentation Therapy Restores Retinal Function and Visual Behavior in a Sheep Model of CNGA3 Achromatopsia." Mol Ther 23(9): 1423-1433. Baseler, H. A., A. A. Brewer, L. T. Sharpe, A. B. Morland, H. Jagle and B. A. Wandell (2002). "Reorganization of human cortical maps caused by inherited photoreceptor abnormalities." Nat Neurosci 5(4): 364-370. Behrens, C., T. Schubert, S. Haverkamp, T. Euler and P. Berens (2016). "Connectivity map of bipolar cells and photoreceptors in the mouse retina." Elife 5. Beier, C., A. Hovhannisyan, S. Weiser, J. Kung, S. Lee, D. Y. Lee, P. Huie, R. Dalal, D. Palanker and A. Sher (2017). "Deafferented Adult Rod Bipolar Cells Create New Synapses with Photoreceptors to Restore Vision." J Neurosci 37(17): 4635-4644. Berns, K. I. and N. Muzyczka (2017). "AAV: An Overview of Unanswered Questions." Human Gene Therapy 28(4): 308-313. Bessant, D. A., R. R. Ali and S. S. Bhattacharya (2001). "Molecular genetics and prospects for therapy of the inherited retinal dystrophies." Curr Opin Genet Dev 11(3): 307-316. Biel, M., M. Seeliger, A. Pfeifer, K. Kohler, A. Gerstner, A. Ludwig, G. Jaissle, S. Fauser, E. Zrenner and F. Hofmann (1999). "Selective loss of cone function in mice lacking the cyclic nucleotide-gated channel CNG3." Proc Natl Acad Sci U S A 96(13): 7553-7557. Blackwell, H. R. and O. M. Blackwell (1961). "Rod and Cone Receptor Mechanisms in Typical and Atypical Congenital Achromatopsia." Vision Research 1(1-2): 62-107. Boutin, S., V. Monteilhet, P. Veron, C. Leborgne, O. Benveniste, M. F. Montus and C. Masurier (2010). "Prevalence of Serum IgG and Neutralizing Factors Against Adeno- Associated Virus (AAV) Types 1, 2, 5, 6, 8, and 9 in the Healthy Population: Implications for Gene Therapy Using AAV Vectors." Human Gene Therapy 21(6): 704- 712. Bramall, A. N., A. F. Wright, S. G. Jacobson and R. R. McInnes (2010). "The Genomic, Biochemical, and Cellular Responses of the Retina in Inherited Photoreceptor Degenerations and Prospects for the Treatment of These Disorders." Annual Review of Neuroscience, Vol 33 33: 441-472. Brennenstuhl, C., N. Tanimoto, M. Burkard, R. Wagner, S. Bolz, D. Trifunovic, C. Kabagema-Bilan, F. Paquet-Durand, S. C. Beck, G. Huber, M. W. Seeliger, P. Ruth, B. Wissinger and R. Lukowski (2015). "Targeted ablation of the Pde6h gene in mice reveals cross-species differences in cone and rod phototransduction protein isoform inventory." J Biol Chem 290(16): 10242-10255.

223

Brody, J. A., I. Hussels, E. Brink and J. Torres (1970). "Hereditary blindness among Pingelapese people of Eastern Caroline Islands." Lancet 1(7659): 1253-1257. Cante-Barrett, K., R. D. Mendes, W. K. Smits, Y. M. van Helsdingen-van Wijk, R. Pieters and J. P. Meijerink (2016). "Lentiviral gene transfer into human and murine hematopoietic stem cells: size matters." BMC Res Notes 9: 312. Carroll, J., S. S. Choi and D. R. Williams (2008). "In vivo imaging of the photoreceptor mosaic of a rod monochromat." Vision Res 48(26): 2564-2568. Carvalho, L. S., H. T. Turunen, S. J. Wassmer, M. V. Luna-Velez, R. Xiao, J. Bennett and L. H. Vandenberghe (2017). "Evaluating Efficiencies of Dual AAV Approaches for Retinal Targeting." Front Neurosci 11: 503. Carvalho, L. S., R. Xiao, S. J. Wassmer, A. Langsdorf, E. Zinn, S. Pacouret, S. Shah, J. I. Comander, L. A. Kim, L. Lim and L. H. Vandenberghe (2018). "Synthetic Adeno- Associated Viral Vector Efficiently Targets Mouse and Nonhuman Primate Retina In Vivo." Hum Gene Ther 29(7): 771-784. Carvalho, L. S., J. Xu, R. A. Pearson, A. J. Smith, J. W. Bainbridge, L. M. Morris, S. J. Fliesler, X. Q. Ding and R. R. Ali (2011). "Long-term and age-dependent restoration of visual function in a mouse model of CNGB3-associated achromatopsia following gene therapy." Hum Mol Genet 20(16): 3161-3175. Cavalieri, V., E. Baiamonte and M. Lo Iacono (2018). "Non-Primate Lentiviral Vectors and Their Applications in Gene Therapy for Ocular Disorders." Viruses 10(6). Cavazza, A., A. Moiani and F. Mavilio (2013). "Mechanisms of retroviral integration and mutagenesis." Hum Gene Ther 24(2): 119-131. Cavazzana-Calvo, M., E. Payen, O. Negre, G. Wang, K. Hehir, F. Fusil, J. Down, M. Denaro, T. Brady, K. Westerman, R. Cavallesco, B. Gillet-Legrand, L. Caccavelli, R. Sgarra, L. Maouche-Chretien, F. Bernaudin, R. Girot, R. Dorazio, G. J. Mulder, A. Polack, A. Bank, J. Soulier, J. Larghero, N. Kabbara, B. Dalle, B. Gourmel, G. Socie, S. Chretien, N. Cartier, P. Aubourg, A. Fischer, K. Cornetta, F. Galacteros, Y. Beuzard, E. Gluckman, F. Bushman, S. Hacein-Bey-Abina and P. Leboulch (2010). "Transfusion independence and HMGA2 activation after gene therapy of human beta-thalassaemia." Nature 467(7313): 318-322. Chandler, R. J., M. S. Sands and C. P. Venditti (2017). "Recombinant Adeno- Associated Viral Integration and Genotoxicity: Insights from Animal Models." Human Gene Therapy 28(4): 314-322. Chang, B., M. S. Dacey, N. L. Hawes, P. F. Hitchcock, A. H. Milam, P. Atmaca- Sonmez, S. Nusinowitz and J. R. Heckenlively (2006). "Cone photoreceptor function loss-3, a novel mouse model of achromatopsia due to a mutation in Gnat2." Invest Ophthalmol Vis Sci 47(11): 5017-5021. Chang, B., T. Grau, S. Dangel, R. Hurd, B. Jurklies, E. C. Sener, S. Andreasson, H. Dollfus, B. Baumann, S. Bolz, N. Artemyev, S. Kohl, J. Heckenlively and B. Wissinger (2009). "A homologous genetic basis of the murine cpfl1 mutant and human achromatopsia linked to mutations in the PDE6C gene." Proc Natl Acad Sci U S A 106(46): 19581-19586. Chatterjee, S. and J. K. Pal (2009). "Role of 5 '- and 3 '-untranslated regions of mRNAs in human diseases." Biology of the Cell 101(5): 251-262. Chira, S., C. S. Jackson, I. Oprea, F. Ozturk, M. S. Pepper, I. Diaconu, C. Braicu, L. Z. Raduly, G. A. Calin and I. Berindan-Neagoe (2015). "Progresses towards safe and efficient gene therapy vectors." Oncotarget 6(31): 30675-30703. Cho, K. I., M. Haque, J. Wang, M. Yu, Y. Hao, S. Qiu, I. C. Pillai, N. S. Peachey and P. A. Ferreira (2013). "Distinct and atypical intrinsic and extrinsic cell death pathways between photoreceptor cell types upon specific ablation of Ranbp2 in cone photoreceptors." PLoS Genet 9(6): e1003555. Cideciyan, A. V., D. C. Hood, Y. J. Huang, E. Banin, Z. Y. Li, E. M. Stone, A. H. Milam and S. G. Jacobson (1998). "Disease sequence from mutant rhodopsin allele to rod and cone photoreceptor degeneration in man." Proceedings of the National Academy of Sciences of the United States of America 95(12): 7103-7108. Colella, P., G. Ronzitti and F. Mingozzi (2018). "Emerging Issues in AAV-Mediated In Vivo Gene Therapy." Mol Ther Methods Clin Dev 8: 87-104.

224

Corbo, J. C., C. A. Myers, K. A. Lawrence, A. P. Jadhav and C. L. Cepko (2007). "A typology of photoreceptor gene expression patterns in the mouse." Proc Natl Acad Sci U S A 104(29): 12069-12074. Counsell, J. R., Z. Asgarian, J. H. Meng, V. Ferrer, C. A. Vink, S. J. Howe, S. N. Waddington, A. J. Thrasher, F. Muntoni, J. E. Morgan and O. Danos (2017). "Lentiviral vectors can be used for full-length dystrophin gene therapy." Scientific Reports 7. Curcio, C. A., K. R. Sloan, R. E. Kalina and A. E. Hendrickson (1990). "Human photoreceptor topography." J Comp Neurol 292(4): 497-523. D'Orazi, F. D., S. C. Suzuki and R. O. Wong (2014). "Neuronal remodeling in retinal circuit assembly, disassembly, and reassembly." Trends Neurosci 37(10): 594-603. D.Oprian, D. (1993). "Expression of Opsin Genes in COS Cells." Methods in Neurosciences 15: 301-306. Dai, X., Y. He, H. Zhang, Y. Zhang, Y. Liu, M. Wang, H. Chen and J. J. Pang (2017). "Long-term retinal cone rescue using a capsid mutant AAV8 vector in a mouse model of CNGA3-achromatopsia." PLoS One 12(11): e0188032. Dalkara, D., L. C. Byrne, R. R. Klimczak, M. Visel, L. Yin, W. H. Merigan, J. G. Flannery and D. V. Schaffer (2013). "In vivo-directed evolution of a new adeno- associated virus for therapeutic outer retinal gene delivery from the vitreous." Sci Transl Med 5(189): 189ra176. Dalkara, D. and J. A. Sahel (2014). "Gene therapy for inherited retinal degenerations." Comptes Rendus Biologies 337(3): 185-192. Davidoff, A. M., C. Y. Ng, S. Sleep, J. Gray, S. Azam, Y. Zhao, J. H. McIntosh, M. Karimipoor and A. C. Nathwani (2004). "Purification of recombinant adeno-associated virus type 8 vectors by ion exchange chromatography generates clinical grade vector stock." J Virol Methods 121(2): 209-215. Debyser, Z. (2003). "Biosafety of lentiviral vectors." Curr Gene Ther 3(6): 517-525. Deeb, S. S., D. Bisset and L. Fu (2010). "Epigenetic control of expression of the human L- and M- pigment genes." Ophthalmic Physiol Opt 30(5): 446-453. Deeb, S. S., Y. Liu and T. Hayashi (2006). "Mutually exclusive expression of the L and M pigment genes in the human retinoblastoma cell line WERI: Resetting by cell division." Vis Neurosci 23(3-4): 371-378. Delori, F. C., D. G. Goger and C. K. Dorey (2001). "Age-related accumulation and spatial distribution of lipofuscin in RPE of normal subjects." Invest Ophthalmol Vis Sci 42(8): 1855-1866. DiCarlo, J. E., V. B. Mahajan and S. H. Tsang (2018). "Gene therapy and genome surgery in the retina." J Clin Invest 128(6): 2177-2188. Dimopoulos, I. S., S. C. Hoang, A. Radziwon, N. M. Binczyk, M. C. Seabra, R. E. MacLaren, R. Somani, M. T. S. Tennant and I. M. MacDonald (2018). "Two-Year Results After AAV2-Mediated Gene Therapy for Choroideremia: The Alberta Experience." Am J Ophthalmol 193: 130-142. Ding, X. Q., A. Thapa, H. Ma, J. Xu, M. H. Elliott, K. K. Rodgers, M. L. Smith, J. S. Wang, S. J. Pittler and V. J. Kefalov (2016). "The B3 Subunit of the Cone Cyclic Nucleotide-gated Channel Regulates the Light Responses of Cones and Contributes to the Channel Structural Flexibility." J Biol Chem 291(16): 8721-8734. Docchio, F., M. Boulton, R. Cubeddu, R. Ramponi and P. D. Barker (1991). "Age- Related-Changes in the Fluorescence of Melanin and Lipofuscin Granules of the Retinal-Pigment Epithelium - a Time-Resolved Fluorescence Spectroscopy Study." Photochemistry and Photobiology 54(2): 247-253. Dorgau, B., M. Felemban, G. Hilgen, M. Kiening, D. Zerti, N. C. Hunt, M. Doherty, P. Whitfield, D. Hallam, K. White, Y. Ding, N. Krasnogor, J. Al-Aama, H. Z. Asfour, E. Sernagor and M. Lako (2019). "Decellularised extracellular matrix-derived peptides from neural retina and retinal pigment epithelium enhance the expression of synaptic markers and light responsiveness of human pluripotent stem cell derived retinal organoids." Biomaterials 199: 63-75. Doshi, B. S. and V. R. Arruda (2018). "Gene therapy for hemophilia: what does the future hold?" Therapeutic Advances in Hematology 9(9): 273-293.

225

Drouin, L. M. and M. Agbandje-McKenna (2013). "Adeno-associated virus structural biology as a tool in vector development." Future Virology 8(12): 1183-1199. Duan, D., Y. Yue and J. F. Engelhardt (2003). "Consequences of DNA-dependent protein kinase catalytic subunit deficiency on recombinant adeno-associated virus genome circularization and heterodimerization in muscle tissue." J Virol 77(8): 4751- 4759. Duan, D. S., P. Sharma, J. S. Yang, Y. P. Yue, L. Dudus, Y. L. Zhang, K. J. Fisher and J. F. Engelhardt (1998). "Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue." Journal of Virology 72(11): 8568-8577. Dubis, A. M., R. F. Cooper, J. Aboshiha, C. S. Langlo, V. Sundaram, B. Liu, F. Collison, G. A. Fishman, A. T. Moore, A. R. Webster, A. Dubra, J. Carroll and M. Michaelides (2014). "Genotype-dependent variability in residual cone structure in achromatopsia: toward developing metrics for assessing cone health." Invest Ophthalmol Vis Sci 55(11): 7303-7311. Dudek, A. M., S. Pillay, A. S. Puschnik, C. M. Nagamine, F. Cheng, J. Qiu, J. E. Carette and L. H. Vandenberghe (2018). "An Alternate Route for Adeno-associated Virus (AAV) Entry Independent of AAV Receptor." J Virol 92(7). Duffy, M. R., K. D. Fisher and L. W. Seymour (2017). "Making Oncolytic Virotherapy a Clinical Reality: The European Contribution." Hum Gene Ther 28(11): 1033-1046. Dull, T., R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen, D. Trono and L. Naldini (1998). "A third-generation lentivirus vector with a conditional packaging system." J Virol 72(11): 8463-8471. Duncan, J. L., E. A. Pierce, A. M. Laster, S. P. Daiger, D. G. Birch, J. D. Ash, A. Iannaccone, J. G. Flannery, J. A. Sahel, D. J. Zack, M. A. Zarbin and B. and the Foundation Fighting Blindness Scientific Advisory (2018). "Inherited Retinal Degenerations: Current Landscape and Knowledge Gaps." Transl Vis Sci Technol 7(4): 6. Dunn, F. A. (2015). "Photoreceptor Ablation Initiates the Immediate Loss of Glutamate Receptors in Postsynaptic Bipolar Cells in Retinal." Journal of Neuroscience 35(6): 2423-2431. Dunn, F. A., L. Della Santina, E. D. Parker and R. O. L. Wong (2013). "Sensory Experience Shapes the Development of the Visual System's First Synapse." Neuron 80(5): 1159-1166. Dunn, F. A. and R. O. Wong (2012). "Diverse strategies engaged in establishing stereotypic wiring patterns among neurons sharing a common input at the visual system's first synapse." J Neurosci 32(30): 10306-10317. Dyka, F. M., S. L. Boye, R. C. Ryals, V. A. Chiodo, S. E. Boye and W. W. Hauswirth (2014). "Cone specific promoter for use in gene therapy of retinal degenerative diseases." Adv Exp Med Biol 801: 695-701. Eiraku, M., N. Takata, H. Ishibashi, M. Kawada, E. Sakakura, S. Okuda, K. Sekiguchi, T. Adachi and Y. Sasai (2011). "Self-organizing optic-cup morphogenesis in three- dimensional culture." Nature 472(7341): 51-56. Fahim, A. T., N. W. Khan, S. Zahid, I. H. Schachar, K. Branham, S. Kohl, B. Wissinger, V. M. Elner, J. R. Heckenlively and T. Jayasundera (2013). "Diagnostic fundus autofluorescence patterns in achromatopsia." Am J Ophthalmol 156(6): 1211-1219 e1212. Falls, H. F., J. R. Wolter and M. Alpern (1965). "Typical total monochromacy. A histological and psychophysical study." Arch Ophthalmol 74(5): 610-616. Farkas Á, W. K., Vámos R, Gyory J. (1999). "A congenitalis achromatopsia diagnosztikai és differenciáldiagnosztikai megközelítése két klinikai eset kapcsán." Szemeszet(136): 187. Faust, S. M., P. Bell, B. J. Cutler, S. N. Ashley, Y. Zhu, J. E. Rabinowitz and J. M. Wilson (2013). "CpG-depleted adeno-associated virus vectors evade immune detection." J Clin Invest 123(7): 2994-3001.

226

Felberer, F., J. S. Kroisamer, B. Baumann, S. Zotter, U. Schmidt-Erfurth, C. K. Hitzenberger and M. Pircher (2014). "Adaptive optics SLO/OCT for 3D imaging of human photoreceptors in vivo." Biomed Opt Express 5(2): 439-456. Feng, L. and D. K. Niu (2007). "Relationship between mRNA stability and length: An old question with a new twist." Biochemical Genetics 45(1-2): 131-137. Ferrua, F. and A. Aiuti (2017). "Twenty-five years of gene therapy for ADA-SCID: from "bubble babies" to an approved drug." Hum Gene Ther. Finn, J. D., D. Hui, H. D. Downey, D. Dunn, G. C. Pien, F. Mingozzi, S. Zhou and K. A. High (2010). "Proteasome inhibitors decrease AAV2 capsid derived peptide epitope presentation on MHC class I following transduction." Mol Ther 18(1): 135-142. Flotte, T. R., S. A. Afione, R. Solow, M. L. Drumm, D. Markakis, W. B. Guggino, P. L. Zeitlin and B. J. Carter (1993). "Expression of the cystic fibrosis transmembrane conductance regulator from a novel adeno-associated virus promoter." J Biol Chem 268(5): 3781-3790. Foote, K. G., P. Loumou, S. Griffin, J. Qin, K. Ratnam, T. C. Porco, A. Roorda and J. L. Duncan (2018). "Relationship Between Foveal Cone Structure and Visual Acuity Measured With Adaptive Optics Scanning Laser Ophthalmoscopy in Retinal Degeneration." Invest Ophthalmol Vis Sci 59(8): 3385-3393. Fujimaki, T., Z. Y. Huang, H. Kitagawa, H. Sakuma, A. Murakami, A. Kanai, M. J. McLaren and G. Inana (2004). "Truncation and mutagenesis analysis of the human X- arrestin gene promoter." Gene 339: 139-147. Gabriele, M. L., G. Wollstein, H. Ishikawa, L. Kagemann, J. A. Xu, L. S. Folio and J. S. Schuman (2011). "Optical Coherence Tomography: History, Current Status, and Laboratory Work." Investigative Ophthalmology & Visual Science 52(5): 2425-2436. Galy, A. (2017). "Major Advances in the Development of Vectors for Clinical Gene Therapy of Hematopoietic Stem Cells from European Groups over the Last 25 Years." Hum Gene Ther 28(11): 964-971. Gao, G., M. R. Alvira, S. Somanathan, Y. Lu, L. H. Vandenberghe, J. J. Rux, R. Calcedo, J. Sanmiguel, Z. Abbas and J. M. Wilson (2003). "Adeno-associated viruses undergo substantial evolution in primates during natural infections." Proc Natl Acad Sci U S A 100(10): 6081-6086. Gao, G., L. H. Vandenberghe, M. R. Alvira, Y. Lu, R. Calcedo, X. Zhou and J. M. Wilson (2004). "Clades of Adeno-associated viruses are widely disseminated in human tissues." J Virol 78(12): 6381-6388. Gawlik, K. I. (2018). "At the Crossroads of Clinical and Preclinical Research for Muscular DystrophyAre We Closer to Effective Treatment for Patients?" International Journal of Molecular Sciences 19(5). Gayet-Primo, J. and T. Puthussery (2015). "Alterations in Kainate Receptor and TRPM1 Localization in Bipolar Cells after Retinal Photoreceptor Degeneration." Front Cell Neurosci 9: 486. Genead, M. A., G. A. Fishman, J. Rha, A. M. Dubis, D. M. Bonci, A. Dubra, E. M. Stone, M. Neitz and J. Carroll (2011). "Photoreceptor structure and function in patients with congenital achromatopsia." Invest Ophthalmol Vis Sci 52(10): 7298-7308. George, L. A. (2017). "Hemophilia gene therapy comes of age." Blood Adv 1(26): 2591- 2599. Georgiou, M., A. Kalitzeos, E. J. Patterson, A. Dubra, J. Carroll and M. Michaelides (2018). "Adaptive optics imaging of inherited retinal diseases." Br J Ophthalmol 102(8): 1028-1035. Ghazi, N. G., E. B. Abboud, S. R. Nowilaty, H. Alkuraya, A. Alhommadi, H. Cai, R. Hou, W. T. Deng, S. L. Boye, A. Almaghamsi, F. Al Saikhan, H. Al-Dhibi, D. Birch, C. Chung, D. Colak, M. M. LaVail, D. Vollrath, K. Erger, W. Wang, T. Conlon, K. Zhang, W. Hauswirth and F. S. Alkuraya (2016). "Treatment of retinitis pigmentosa due to MERTK mutations by ocular subretinal injection of adeno-associated virus gene vector: results of a phase I trial." Hum Genet 135(3): 327-343. Glushakova, L. G., A. M. Timmers, J. Pang, J. T. Teusner and W. W. Hauswirth (2006). "Human blue-opsin promoter preferentially targets reporter gene expression to rat s- cone photoreceptors." Invest Ophthalmol Vis Sci 47(8): 3505-3513.

227

Gonzalez-Cordero, A., D. Goh, K. Kruczek, A. Naeem, M. Fernando, S. M. Kleine Holthaus, M. Takaaki, S. J. I. Blackford, M. Kloc, L. Agundez, R. D. Sampson, S. Borooah, P. Ovando-Roche, M. S. Mehat, E. L. West, A. J. Smith, R. A. Pearson and R. R. Ali (2018). "Assessment of AAV Vector Tropisms for Mouse and Human Pluripotent Stem Cell-Derived RPE and Photoreceptor Cells." Hum Gene Ther. Gonzalez-Cordero, A., D. Goh, K. Kruczek, A. Naeem, M. Fernando, S. M. Kleine Holthaus, M. Takaaki, S. J. I. Blackford, M. Kloc, L. Agundez, R. D. Sampson, S. Borooah, P. Ovando-Roche, M. S. Mehat, E. L. West, A. J. Smith, R. A. Pearson and R. R. Ali (2018). "Assessment of AAV Vector Tropisms for Mouse and Human Pluripotent Stem Cell-Derived RPE and Photoreceptor Cells." Hum Gene Ther 29(10): 1124-1139. Gonzalez-Cordero, A., K. Kruczek, A. Naeem, M. Fernando, M. Kloc, J. Ribeiro, D. Goh, Y. Duran, S. J. I. Blackford, L. Abelleira-Hervas, R. D. Sampson, I. O. Shum, M. J. Branch, P. J. Gardner, J. C. Sowden, J. W. B. Bainbridge, A. J. Smith, E. L. West, R. A. Pearson and R. R. Ali (2017). "Recapitulation of Human Retinal Development from Human Pluripotent Stem Cells Generates Transplantable Populations of Cone Photoreceptors." Stem Cell Reports. Gray, S. J., S. B. Foti, J. W. Schwartz, L. Bachaboina, B. Taylor-Blake, J. Coleman, M. D. Ehlers, M. J. Zylka, T. J. McCown and R. J. Samulski (2011). "Optimizing Promoters for Recombinant Adeno-Associated Virus-Mediated Gene Expression in the Peripheral and Central Nervous System Using Self-Complementary Vectors." Human Gene Therapy 22(9): 1143-1153. Greenberg, J. P., J. Sherman, S. A. Zweifel, R. W. Chen, T. Duncker, S. Kohl, B. Baumann, B. Wissinger, L. A. Yannuzzi and S. H. Tsang (2014). "Spectral-domain optical coherence tomography staging and autofluorescence imaging in achromatopsia." JAMA Ophthalmol 132(4): 437-445. Grimm, D. and H. Buning (2017). "Small But Increasingly Mighty: Latest Advances in AAV Vector Research, Design, and Evolution." Hum Gene Ther 28(11): 1075-1086. Grimm, D., A. Kern, K. Rittner and J. A. Kleinschmidt (1998). "Novel tools for production and purification of recombinant adenoassociated virus vectors." Hum Gene Ther 9(18): 2745-2760. Gu, W., Y. Xu, X. Xie, T. Wang, J. H. Ko and T. Zhou (2014). "The role of RNA structure at 5' untranslated region in microRNA-mediated gene regulation." RNA 20(9): 1369-1375. Gupta, N., K. E. Brown and A. H. Milam (2003). "Activated microglia in human retinitis pigmentosa, late-onset retinal degeneration, and age-related macular degeneration." Experimental Eye Research 76(4): 463-471. Hadjikhani, N. and R. B. H. Tootell (2000). "Projection of rods and cones within human visual cortex." Human Brain Mapping 9(1): 55-63. Hafler, B. P. (2017). "Clinical Progress in Inherited Retinal Degenerations: Gene Therapy Clinical Trials and Advances in Genetic Sequencing." Retina 37(3): 417-423. Hama, H., H. Hioki, K. Namiki, T. Hoshida, H. Kurokawa, F. Ishidate, T. Kaneko, T. Akagi, T. Saito, T. Saido and A. Miyawaki (2015). "ScaleS: an optical clearing palette for biological imaging." Nat Neurosci 18(10): 1518-1529. Harper, S. Q., M. A. Hauser, C. DelloRusso, D. Duan, R. W. Crawford, S. F. Phelps, H. A. Harper, A. S. Robinson, J. F. Engelhardt, S. V. Brooks and J. S. Chamberlain (2002). "Modular flexibility of dystrophin: implications for gene therapy of Duchenne muscular dystrophy." Nat Med 8(3): 253-261. Harrison, R., D. Hoefnagel and J. N. Hayward (1960). "Congenital Total Color Blindness - a Clinicopathological Report." Archives of Ophthalmology 64(5): 685-&. Hartong, D. T., E. L. Berson and T. P. Dryja (2006). "Retinitis pigmentosa." Lancet 368(9549): 1795-1809. Hasan, N., T. A. Ray and R. G. Gregg (2016). "CACNA1S expression in mouse retina: Novel isoforms and antibody cross-reactivity with GPR179." Vis Neurosci 33: E009. Haverkamp, S., S. Michalakis, E. Claes, M. W. Seeliger, P. Humphries, M. Biel and A. Feigenspan (2006). "Synaptic plasticity in CNGA3(-/-) mice: cone bipolar cells react on

228

the missing cone input and form ectopic synapses with rods." J Neurosci 26(19): 5248- 5255. Haverkamp, S., H. Wassle, J. Duebel, T. Kuner, G. J. Augustine, G. Feng and T. Euler (2005). "The primordial, blue-cone color system of the mouse retina." J Neurosci 25(22): 5438-5445. Hecht, S., S. Shlaer, E. L. Smith, C. Haig and J. C. Peskin (1948). "The Visual Functions of the Complete Colorblind." Journal of General Physiology 31(6): 459-472. Heesy, C. P. and M. I. Hall (2010). "The nocturnal bottleneck and the evolution of mammalian vision." Brain Behav Evol 75(3): 195-203. Hendrickson, A. E. and C. Yuodelis (1984). "The morphological development of the human fovea." Ophthalmology 91(6): 603-612. Hirsch, T., T. Rothoeft, N. Teig, J. W. Bauer, G. Pellegrini, L. De Rosa, D. Scaglione, J. Reichelt, A. Klausegger, D. Kneisz, O. Romano, A. Secone Seconetti, R. Contin, E. Enzo, I. Jurman, S. Carulli, F. Jacobsen, T. Luecke, M. Lehnhardt, M. Fischer, M. Kueckelhaus, D. Quaglino, M. Morgante, S. Bicciato, S. Bondanza and M. De Luca (2017). "Regeneration of the entire human epidermis using transgenic stem cells." Nature 551(7680): 327-332. Holz, F. G., C. Bellman, S. Staudt, F. Schutt and H. E. Volcker (2001). "Fundus autofluorescence and development of geographic atrophy in age-related macular degeneration." Invest Ophthalmol Vis Sci 42(5): 1051-1056. Horton, J. C. and W. F. Hoyt (1991). "The representation of the visual field in human striate cortex. A revision of the classic Holmes map." Arch Ophthalmol 109(6): 816-824. Hosel, M., A. Huber, S. Bohlen, J. Lucifora, G. Ronzitti, F. Puzzo, F. Boisgerault, U. T. Hacker, W. J. Kwanten, N. Kloting, M. Bluher, A. Gluschko, M. Schramm, O. Utermohlen, W. Bloch, F. Mingozzi, O. Krut and H. Buning (2017). "Autophagy determines efficiency of liver-directed gene therapy with adeno-associated viral vectors." Hepatology 66(1): 252-265. Hosel, M., J. Lucifora, T. Michler, G. Holz, M. Gruffaz, S. Stahnke, F. Zoulim, D. Durantel, M. Heikenwalder, D. Nierhoff, R. Millet, A. Salvetti, U. Protzer and H. Buning (2014). "Hepatitis B virus infection enhances susceptibility toward adeno-associated viral vector transduction in vitro and in vivo." Hepatology 59(6): 2110-2120. Huang, L., Y. G. Shanker, J. Dubauskaite, J. Z. Zheng, W. Yan, S. Rosenzweig, A. I. Spielman, M. Max and R. F. Margolskee (1999). "Ggamma13 colocalizes with gustducin in taste receptor cells and mediates IP3 responses to bitter denatonium." Nat Neurosci 2(12): 1055-1062. Huang, L. Y., S. Halder and M. Agbandje-McKenna (2014). "Parvovirus glycan interactions." Curr Opin Virol 7: 108-118. Ingram, N. T., A. P. Sampath and G. L. Fain (2016). "Why are rods more sensitive than cones?" J Physiol 594(19): 5415-5426. Janssen, A., S. H. Min, L. L. Molday, N. Tanimoto, M. W. Seeliger, W. W. Hauswirth, R. S. Molday and B. H. Weber (2008). "Effect of late-stage therapy on disease progression in AAV-mediated rescue of photoreceptor cells in the retinoschisin- deficient mouse." Mol Ther 16(6): 1010-1017. Jetten, A. M. (2009). "Retinoid-related orphan receptors (RORs): critical roles in development, immunity, circadian rhythm, and cellular metabolism." Nucl Recept Signal 7: e003. Jin, Z. B., M. L. Gao, W. L. Deng, K. C. Wu, S. Sugita, M. Mandai and M. Takahashi (2019). "Stemming retinal regeneration with pluripotent stem cells." Prog Retin Eye Res 69: 38-56. Johnson, R. E., N. W. Tien, N. Shen, J. T. Pearson, F. Soto and D. Kerschensteiner (2017). "Homeostatic plasticity shapes the visual system's first synapse." Nat Commun 8(1): 1220. Jones, B. W. and R. E. Marc (2005). "Retinal remodeling during retinal degeneration." Exp Eye Res 81(2): 123-137. Kaeppel, C., S. G. Beattie, R. Fronza, R. van Logtenstein, F. Salmon, S. Schmidt, S. Wolf, A. Nowrouzi, H. Glimm, C. von Kalle, H. Petry, D. Gaudet and M. Schmidt (2013).

229

"A largely random AAV integration profile after LPLD gene therapy." Nat Med 19(7): 889-891. Keilhauer, C. N. and F. C. Delori (2006). "Near-infrared autofluorescence imaging of the fundus: visualization of ocular melanin." Invest Ophthalmol Vis Sci 47(8): 3556- 3564. Khan, N. W., B. Wissinger, S. Kohl and P. A. Sieving (2007). "CNGB3 achromatopsia with progressive loss of residual cone function and impaired rod-mediated function." Invest Ophthalmol Vis Sci 48(8): 3864-3871. Kishi, S. (2016). "Impact of swept source optical coherence tomography on ophthalmology." Taiwan J Ophthalmol 6(2): 58-68. Klimczak, R. R., J. T. Koerber, D. Dalkara, J. G. Flannery and D. V. Schaffer (2009). "A novel adeno-associated viral variant for efficient and selective intravitreal transduction of rat Muller cells." PLoS One 4(10): e7467. Klimczak, R. R., J. T. Koerber, D. Dalkara, J. G. Flannery and D. V. Schaffer (2009). "A Novel Adeno-Associated Viral Variant for Efficient and Selective Intravitreal Transduction of Rat Muller Cells." Plos One 4(10). Kohl, S., B. Baumann, T. Rosenberg, U. Kellner, B. Lorenz, M. Vadala, S. G. Jacobson and B. Wissinger (2002). "Mutations in the cone photoreceptor G-protein alpha-subunit gene GNAT2 in patients with achromatopsia." Am J Hum Genet 71(2): 422-425. Kohl, S., F. Coppieters, F. Meire, S. Schaich, S. Roosing, C. Brennenstuhl, S. Bolz, M. M. van Genderen, F. C. Riemslag, C. European Retinal Disease, R. Lukowski, A. I. den Hollander, F. P. Cremers, E. De Baere, C. B. Hoyng and B. Wissinger (2012). "A nonsense mutation in PDE6H causes autosomal-recessive incomplete achromatopsia." Am J Hum Genet 91(3): 527-532. Kohl, S., H. Jagle and B. Wissinger (1993). Achromatopsia. GeneReviews((R)). M. P. Adam, H. H. Ardinger, R. A. Pagon et al. Seattle (WA). Kohl, S., D. Zobor, W. C. Chiang, N. Weisschuh, J. Staller, I. Gonzalez Menendez, S. Chang, S. C. Beck, M. Garcia Garrido, V. Sothilingam, M. W. Seeliger, F. Stanzial, F. Benedicenti, F. Inzana, E. Heon, A. Vincent, J. Beis, T. M. Strom, G. Rudolph, S. Roosing, A. I. Hollander, F. P. Cremers, I. Lopez, H. Ren, A. T. Moore, A. R. Webster, M. Michaelides, R. K. Koenekoop, E. Zrenner, R. J. Kaufman, S. H. Tsang, B. Wissinger and J. H. Lin (2015). "Mutations in the unfolded protein response regulator ATF6 cause the cone dysfunction disorder achromatopsia." Nat Genet 47(7): 757-765. Kolb, J. P., T. Pfeiffer, M. Eibl, H. Hakert and R. Huber (2018). "High-resolution retinal swept source optical coherence tomography with an ultra-wideband Fourier-domain mode-locked laser at MHz A-scan rates." Biomed Opt Express 9(1): 120-130. Komaromy, A. M., J. J. Alexander, A. E. Cooper, V. A. Chiodo, L. G. Glushakova, G. M. Acland, W. W. Hauswirth and G. D. Aguirre (2008). "Targeting gene expression to cones with human cone opsin promoters in recombinant AAV." Gene Ther 15(14): 1049-1055. Komeima, K., B. S. Rogers, L. L. Lu and P. A. Campochiaro (2006). "Antioxidants reduce cone cell death in a model of retinitis pigmentosa." Proceedings of the National Academy of Sciences of the United States of America 103(30): 11300-11305. Kong, J., S. R. Kim, K. Binley, I. Pata, K. Doi, J. Mannik, J. Zernant-Rajang, O. Kan, S. Iqball, S. Naylor, J. R. Sparrow, P. Gouras and R. Allikmets (2008). "Correction of the disease phenotype in the mouse model of Stargardt disease by lentiviral gene therapy." Gene Ther 15(19): 1311-1320. Kotin, R. M., J. C. Menninger, D. C. Ward and K. I. Berns (1991). "Mapping and direct visualization of a region-specific viral DNA integration site on chromosome 19q13-qter." Genomics 10(3): 831-834. Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi and K. I. Berns (1990). "Site-specific integration by adeno-associated virus." Proc Natl Acad Sci U S A 87(6): 2211-2215. Kotterman, M. A. and D. V. Schaffer (2014). "Engineering adeno-associated viruses for clinical gene therapy." Nat Rev Genet 15(7): 445-451. Kroeger, H., N. Grimsey, R. Paxman, W. C. Chiang, L. Plate, Y. Jones, P. X. Shaw, J. Trejo, S. H. Tsang, E. Powers, J. W. Kelly, R. L. Wiseman and J. H. Lin (2018). "The

230

unfolded protein response regulator ATF6 promotes mesodermal differentiation." Sci Signal 11(517). Kumar, M., B. Keller, N. Makalou and R. E. Sutton (2001). "Systematic determination of the packaging limit of lentiviral vectors." Hum Gene Ther 12(15): 1893-1905. Lai, Y., Y. Yue and D. Duan (2010). "Evidence for the failure of adeno-associated virus serotype 5 to package a viral genome > or = 8.2 kb." Mol Ther 18(1): 75-79. Lamb, T. D. (2016). "Why rods and cones?" Eye (Lond) 30(2): 179-185. Langlo, C. S., L. R. Erker, M. Parker, E. J. Patterson, B. P. Higgins, P. Summerfelt, M. M. Razeen, F. T. Collison, G. A. Fishman, C. N. Kay, J. Zhang, R. G. Weleber, P. Yang, M. E. Pennesi, B. L. Lam, J. D. Chulay, A. Dubra, W. W. Hauswirth, D. J. Wilson, J. Carroll and A.-s. group (2017). "Repeatability and Longitudinal Assessment of Foveal Cone Structure in Cngb3-Associated Achromatopsia." Retina 37(10): 1956- 1966. Langlo, C. S., E. J. Patterson, B. P. Higgins, P. Summerfelt, M. M. Razeen, L. R. Erker, M. Parker, F. T. Collison, G. A. Fishman, C. N. Kay, J. Zhang, R. G. Weleber, P. Yang, D. J. Wilson, M. E. Pennesi, B. L. Lam, J. Chiang, J. D. Chulay, A. Dubra, W. W. Hauswirth, J. Carroll and A.-S. Group (2016). "Residual Foveal Cone Structure in CNGB3-Associated Achromatopsia." Invest Ophthalmol Vis Sci 57(10): 3984-3995. Lee, C. S., E. S. Bishop, R. Zhang, X. Yu, E. M. Farina, S. Yan, C. Zhao, Z. Zheng, Y. Shu, X. Wu, J. Lei, Y. Li, W. Zhang, C. Yang, K. Wu, Y. Wu, S. Ho, A. Athiviraham, M. J. Lee, J. M. Wolf, R. R. Reid and T. C. He (2017). "Adenovirus-Mediated Gene Delivery: Potential Applications for Gene and Cell-Based Therapies in the New Era of Personalized Medicine." Genes Dis 4(2): 43-63. Lee, H., R. Purohit, V. Sheth, R. J. McLean, S. Kohl, B. P. Leroy, V. Sundaram, M. Michaelides, F. A. Proudlock and I. Gottlob (2015). "Retinal Development in Infants and Young Children with Achromatopsia." Ophthalmology 122(10): 2145-2147. Leveillard, T., S. Mohand-Said, O. Lorentz, D. Hicks, A. C. Fintz, E. Clerin, M. Simonutti, V. Forster, N. Cavusoglu, F. Chalmel, P. Dolle, O. Poch, G. Lambrou and J. A. Sahel (2004). "Identification and characterization of rod-derived cone viability factor." Nat Genet 36(7): 755-759. Li, A., X. Zhu and C. M. Craft (2002). "Retinoic acid upregulates cone arrestin expression in retinoblastoma cells through a Cis element in the distal promoter region." Invest Ophthalmol Vis Sci 43(5): 1375-1383. Li, J., W. C. Sun, B. Wang, X. Xiao and X. Q. Liu (2008). "Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy." Human Gene Therapy 19(9): 958-964. Li, Q., A. M. Timmers, J. Guy, J. Pang and W. W. Hauswirth (2008). "Cone-specific expression using a human red opsin promoter in recombinant AAV." Vision Res 48(3): 332-338. Liang, X., F. Dong, H. Li, H. Li, L. Yang and R. Sui (2015). "Novel CNGA3 mutations in Chinese patients with achromatopsia." Br J Ophthalmol 99(4): 571-576. Litts, K. M., R. F. Cooper, J. L. Duncan and J. Carroll (2017). "Photoreceptor-Based Biomarkers in AOSLO Retinal Imaging." Invest Ophthalmol Vis Sci 58(6): BIO255- BIO267. Llonch, S., M. Carido and M. Ader (2018). "Organoid technology for retinal repair." Dev Biol 433(2): 132-143. Mandai, M., M. Fujii, T. Hashiguchi, G. A. Sunagawa, S. I. Ito, J. Sun, J. Kaneko, J. Sho, C. Yamada and M. Takahashi (2017). "iPSC-Derived Retina Transplants Improve Vision in rd1 End-Stage Retinal-Degeneration Mice." Stem Cell Reports 8(4): 1112- 1113. Manno, C. S., G. F. Pierce, V. R. Arruda, B. Glader, M. Ragni, J. J. Rasko, M. C. Ozelo, K. Hoots, P. Blatt, B. Konkle, M. Dake, R. Kaye, M. Razavi, A. Zajko, J. Zehnder, P. K. Rustagi, H. Nakai, A. Chew, D. Leonard, J. F. Wright, R. R. Lessard, J. M. Sommer, M. Tigges, D. Sabatino, A. Luk, H. Jiang, F. Mingozzi, L. Couto, H. C. Ertl, K. A. High and M. A. Kay (2006). "Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response." Nat Med 12(3): 342-347.

231

Matet, A., S. Kohl, B. Baumann, A. Antonio, S. Mohand-Said, J. A. Sahel and I. Audo (2018). "Multimodal imaging including semiquantitative short-wavelength and near- infrared autofluorescence in achromatopsia." Sci Rep 8(1): 5665. Mayer, A. K., C. Van Cauwenbergh, C. Rother, B. Baumann, P. Reuter, E. De Baere, B. Wissinger, S. Kohl and A. S. Group (2017). "CNGB3 mutation spectrum including copy number variations in 552 achromatopsia patients." Hum Mutat 38(11): 1579-1591. McCarty, D. M. (2008). "Self-complementary AAV vectors; advances and applications." Mol Ther 16(10): 1648-1656. Meliani, A., F. Boisgerault, Z. Fitzpatrick, S. Marmier, C. Leborgne, F. Collaud, M. Simon Sola, S. Charles, G. Ronzitti, A. Vignaud, L. van Wittenberghe, B. Marolleau, F. Jouen, S. Tan, O. Boyer, O. Christophe, A. R. Brisson, C. A. Maguire and F. Mingozzi (2017). "Enhanced liver gene transfer and evasion of preexisting humoral immunity with exosome-enveloped AAV vectors." Blood Adv 1(23): 2019-2031. Mendell, J. R., S. Al-Zaidy, R. Shell, W. D. Arnold, L. R. Rodino-Klapac, T. W. Prior, L. Lowes, L. Alfano, K. Berry, K. Church, J. T. Kissel, S. Nagendran, J. L'Italien, D. M. Sproule, C. Wells, J. A. Cardenas, M. D. Heitzer, A. Kaspar, S. Corcoran, L. Braun, S. Likhite, C. Miranda, K. Meyer, K. D. Foust, A. H. M. Burghes and B. K. Kaspar (2017). "Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy." N Engl J Med 377(18): 1713-1722. Miao, C. H., K. Ohashi, G. A. Patijn, L. Meuse, X. Ye, A. R. Thompson and M. A. Kay (2000). "Inclusion of the hepatic locus control region, an intron, and untranslated region increases and stabilizes hepatic factor IX gene expression in vivo but not in vitro." Mol Ther 1(6): 522-532. Michaelides, M., I. A. Aligianis, J. R. Ainsworth, P. Good, J. D. Mollon, E. R. Maher, A. T. Moore and D. M. Hunt (2004). "Progressive cone dystrophy associated with mutation in CNGB3." Investigative Ophthalmology & Visual Science 45(6): 1975-1982. Michaelides, M., I. A. Aligianis, G. E. Holder, M. Simunovic, J. D. Mollon, E. R. Maher, D. M. Hunt and A. T. Moore (2003). "Cone dystrophy phenotype associated with a frameshift mutation (M280fsX291) in the alpha-subunit of cone specific transducin (GNAT2)." Br J Ophthalmol 87(11): 1317-1320. Michaelides, M., J. Rha, E. W. Dees, R. C. Baraas, M. L. Wagner-Schuman, J. D. Mollon, A. M. Dubis, M. K. Andersen, T. Rosenberg, M. Larsen, A. T. Moore and J. Carroll (2011). "Integrity of the cone photoreceptor mosaic in oligocone trichromacy." Invest Ophthalmol Vis Sci 52(7): 4757-4764. Michalakis, S., E. Becirovic and M. Biel (2018). "Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy." Int J Mol Sci 19(3). Michalakis, S., H. Geiger, S. Haverkamp, F. Hofmann, A. Gerstner and M. Biel (2005). "Impaired opsin targeting and cone photoreceptor migration in the retina of mice lacking the cyclic nucleotide-gated channel CNGA3." Invest Ophthalmol Vis Sci 46(4): 1516-1524. Michalakis, S., T. Kleppisch, S. A. Polta, C. T. Wotjak, S. Koch, G. Rammes, L. Matt, E. Becirovic and M. Biel (2011). "Altered synaptic plasticity and behavioral abnormalities in CNGA3-deficient mice." Genes Brain Behav 10(2): 137-148. Michalakis, S., C. Schon, E. Becirovic and M. Biel (2017). "Gene therapy for achromatopsia." J Gene Med 19(3). Milone, M. C. and U. O'Doherty (2018). "Clinical use of lentiviral vectors." Leukemia 32(7): 1529-1541. Mimuro, J., H. Mizukami, S. Hishikawa, T. Ikemoto, A. Ishiwata, A. Sakata, T. Ohmori, S. Madoiwa, F. Ono, K. Ozawa and Y. Sakata (2013). "Minimizing the inhibitory effect of neutralizing antibody for efficient gene expression in the liver with adeno-associated virus 8 vectors." Mol Ther 21(2): 318-323. Mingozzi, F. and K. A. High (2013). "Immune responses to AAV vectors: overcoming barriers to successful gene therapy." Blood 122(1): 23-36. Monteilhet, V., S. Saheb, S. Boutin, C. Leborgne, P. Veron, M. F. Montus, P. Moullier, O. Benveniste and C. Masurier (2011). "A 10 patient case report on the impact of plasmapheresis upon neutralizing factors against adeno-associated virus (AAV) types 1, 2, 6, and 8." Mol Ther 19(11): 2084-2091.

232

Moshiri, A., R. Chen, S. Kim, R. A. Harris, Y. Li, M. Raveendran, S. Davis, Q. Liang, O. Pomerantz, J. Wang, L. Garzel, A. Cameron, G. Yiu, J. T. Stout, Y. Huang, C. J. Murphy, J. Roberts, K. N. Gopalakrishna, K. Boyd, N. O. Artemyev, J. Rogers and S. M. Thomasy (2019). "A nonhuman primate model of inherited retinal disease." J Clin Invest 129(2): 863-874. Moskowitz, A., R. M. Hansen, J. D. Akula, S. E. Eklund and A. B. Fulton (2009). "Rod and rod-driven function in achromatopsia and blue cone monochromatism." Invest Ophthalmol Vis Sci 50(2): 950-958. Muhlfriedel, R., N. Tanimoto, C. Schon, V. Sothilingam, M. Garcia Garrido, S. C. Beck, G. Huber, M. Biel, M. W. Seeliger and S. Michalakis (2017). "AAV-Mediated Gene Supplementation Therapy in Achromatopsia Type 2: Preclinical Data on Therapeutic Time Window and Long-Term Effects." Front Neurosci 11: 292. Nakai, H., E. Montini, S. Fuess, T. A. Storm, M. Grompe and M. A. Kay (2003). "AAV serotype 2 vectors preferentially integrate into active genes in mice." Nature Genetics 34(3): 297-302. Nakano, T., S. Ando, N. Takata, M. Kawada, K. Muguruma, K. Sekiguchi, K. Saito, S. Yonemura, M. Eiraku and Y. Sasai (2012). "Self-formation of optic cups and storable stratified neural retina from human ESCs." Cell Stem Cell 10(6): 771-785. Naldini, L. (2015). "Gene therapy returns to centre stage." Nature 526(7573): 351-360. Naso, M. F., B. Tomkowicz, W. L. Perry, 3rd and W. R. Strohl (2017). "Adeno- Associated Virus (AAV) as a Vector for Gene Therapy." BioDrugs 31(4): 317-334. Nathwani, A. C., A. M. Davidoff and E. G. D. Tuddenham (2017). "Advances in Gene Therapy for Hemophilia." Hum Gene Ther 28(11): 1004-1012. Nathwani, A. C., E. G. Tuddenham, S. Rangarajan, C. Rosales, J. McIntosh, D. C. Linch, P. Chowdary, A. Riddell, A. J. Pie, C. Harrington, J. O'Beirne, K. Smith, J. Pasi, B. Glader, P. Rustagi, C. Y. Ng, M. A. Kay, J. Zhou, Y. Spence, C. L. Morton, J. Allay, J. Coleman, S. Sleep, J. M. Cunningham, D. Srivastava, E. Basner-Tschakarjan, F. Mingozzi, K. A. High, J. T. Gray, U. M. Reiss, A. W. Nienhuis and A. M. Davidoff (2011). "Adenovirus-associated virus vector-mediated gene transfer in hemophilia B." N Engl J Med 365(25): 2357-2365. Nathwani, A. C., E. G. D. Tuddenham, S. Rangarajan, C. Rosales, J. McIntosh, D. C. Linch, P. Chowdary, A. Riddell, A. J. Pie, C. Harrington, J. O'Beirne, K. Smith, J. Pasi, B. Glader, P. Rustagi, C. Y. C. Ng, M. A. Kay, J. F. Zhou, Y. Spence, C. L. Morton, J. Allay, J. Coleman, S. Sleep, J. M. Cunningham, D. Srivastava, E. Basner-Tschakarjan, F. Mingozzi, K. A. High, J. T. Gray, U. M. Reiss, A. W. Nienhuis and A. M. Davidoff (2011). "Adenovirus-Associated Virus Vector-Mediated Gene Transfer in Hemophilia B." New England Journal of Medicine 365(25): 2357-2365. Natkunarajah, M., P. Trittibach, J. McIntosh, Y. Duran, S. E. Barker, A. J. Smith, A. C. Nathwani and R. R. Ali (2008). "Assessment of ocular transduction using single- stranded and self-complementary recombinant adeno-associated virus serotype 2/8." Gene Therapy 15(6): 463-467. Nishiguchi, K. M., L. S. Carvalho, M. Rizzi, K. Powell, S. M. Holthaus, S. A. Azam, Y. Duran, J. Ribeiro, U. F. Luhmann, J. W. Bainbridge, A. J. Smith and R. R. Ali (2015). "Gene therapy restores vision in rd1 mice after removal of a confounding mutation in Gpr179." Nat Commun 6: 6006. Nishiguchi, K. M., M. A. Sandberg, N. Gorji, E. L. Berson and T. P. Dryja (2005). "Cone cGMP-gated channel mutations and clinical findings in patients with achromatopsia, macular degeneration, and other hereditary cone diseases." Hum Mutat 25(3): 248- 258. Nishiyama, J., T. Mikuni and R. Yasuda (2017). "Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain." Neuron 96(4): 755-768 e755. Oishi, M., A. Oishi, K. Ogino, Y. Makiyama, N. Gotoh, M. Kurimoto and N. Yoshimura (2014). "Wide-field fundus autofluorescence abnormalities and visual function in patients with cone and cone-rod dystrophies." Invest Ophthalmol Vis Sci 55(6): 3572- 3577.

233

Orlans, H. O., T. L. Edwards, S. R. De Silva, M. I. Patricio and R. E. MacLaren (2018). "Human Retinal Explant Culture for Ex Vivo Validation of AAV Gene Therapy." Methods Mol Biol 1715: 289-303. Otani, A., M. I. Dorrell, K. Kinder, S. K. Moreno, S. Nusinowitz, E. Banin, J. Heckenlively and M. Friedlander (2004). "Rescue of retinal degeneration by intravitreally injected adult bone marrow-derived lineage-negative hematopoietic stem cells." J Clin Invest 114(6): 765-774. Ou, J., C. Vijayasarathy, L. Ziccardi, S. Chen, Y. Zeng, D. Marangoni, J. G. Pope, R. A. Bush, Z. Wu, W. Li and P. A. Sieving (2015). "Synaptic pathology and therapeutic repair in adult retinoschisis mouse by AAV-RS1 transfer." J Clin Invest 125(7): 2891- 2903. Palfi, S., J. M. Gurruchaga, G. S. Ralph, H. Lepetit, S. Lavisse, P. C. Buttery, C. Watts, J. Miskin, M. Kelleher, S. Deeley, H. Iwamuro, J. P. Lefaucheur, C. Thiriez, G. Fenelon, C. Lucas, P. Brugieres, I. Gabriel, K. Abhay, X. Drouot, N. Tani, A. Kas, B. Ghaleh, P. Le Corvoisier, P. Dolphin, D. P. Breen, S. Mason, N. V. Guzman, N. D. Mazarakis, P. A. Radcliffe, R. Harrop, S. M. Kingsman, O. Rascol, S. Naylor, R. A. Barker, P. Hantraye, P. Remy, P. Cesaro and K. A. Mitrophanous (2014). "Long-term safety and tolerability of ProSavin, a lentiviral vector-based gene therapy for Parkinson's disease: a dose escalation, open-label, phase 1/2 trial." Lancet 383(9923): 1138-1146. Pang, J. J., W. T. Deng, X. Dai, B. Lei, D. Everhart, Y. Umino, J. Li, K. Zhang, S. Mao, S. L. Boye, L. Liu, V. A. Chiodo, X. Liu, W. Shi, Y. Tao, B. Chang and W. W. Hauswirth (2012). "AAV-mediated cone rescue in a naturally occurring mouse model of CNGA3- achromatopsia." PLoS One 7(4): e35250. Pang, J. J., F. Gao, J. Lem, D. E. Bramblett, D. L. Paul and S. M. Wu (2010). "Direct rod input to cone BCs and direct cone input to rod BCs challenge the traditional view of mammalian BC circuitry." Proc Natl Acad Sci U S A 107(1): 395-400. Perel, P., I. Roberts, E. Sena, P. Wheble, C. Briscoe, P. Sandercock, M. Macleod, L. E. Mignini, P. Jayaram and K. S. Khan (2007). "Comparison of treatment effects between animal experiments and clinical trials: systematic review." BMJ 334(7586): 197. Perlman, I. (1995). The Electroretinogram: ERG. Webvision: The Organization of the Retina and Visual System. H. Kolb, E. Fernandez and R. Nelson. Salt Lake City (UT). Petit, L., H. Khanna and C. Punzo (2016). "Advances in Gene Therapy for Diseases of the Eye." Hum Gene Ther 27(8): 563-579. Pickrell, S. W., X. Zhu, X. Wang and C. M. Craft (2004). "Deciphering the contribution of known cis-elements in the mouse cone arrestin gene to its cone-specific expression." Invest Ophthalmol Vis Sci 45(11): 3877-3884. Pillay, S. and J. E. Carette (2017). "Host determinants of adeno-associated viral vector entry." Curr Opin Virol 24: 124-131. Pillay, S., N. L. Meyer, A. S. Puschnik, O. Davulcu, J. Diep, Y. Ishikawa, L. T. Jae, J. E. Wosen, C. M. Nagamine, M. S. Chapman and J. E. Carette (2016). "An essential receptor for adeno-associated virus infection." Nature 530(7588): 108-112. Pillay, S., W. Zou, F. Cheng, A. S. Puschnik, N. L. Meyer, S. S. Ganaie, X. F. Deng, J. E. Wosen, O. Davulcu, Z. Y. Y. Yan, J. F. Engelhardt, K. E. Brown, M. S. Chapman, J. M. Qiu and J. E. Carette (2017). "Adeno-associated Virus (AAV) Serotypes Have Distinctive Interactions with Domains of the Cellular AAV Receptor." Journal of Virology 91(18). Pokorny, J., V. C. Smith, A. J. Pinckers and M. Cozijnsen (1982). "Classification of complete and incomplete autosomal recessive achromatopsia." Graefes Arch Clin Exp Ophthalmol 219(3): 121-130. Powell, S. K., R. Rivera-Soto and S. J. Gray (2015). "Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy." Discov Med 19(102): 49-57. Presnyak, V., N. Alhusaini, Y. H. Chen, S. Martin, N. Morris, N. Kline, S. Olson, D. Weinberg, K. E. Baker, B. R. Graveley and J. Coller (2015). "Codon Optimality Is a Major Determinant of mRNA Stability." Cell 160(6): 1111-1124.

234

Punzo, C., K. Kornacker and C. L. Cepko (2009). "Stimulation of the insulin/mTOR pathway delays cone death in a mouse model of retinitis pigmentosa." Nat Neurosci 12(1): 44-52. Qiu, C. H., W. Miyazaki, T. Iwasaki, M. Londono, K. Ibhazehiebo, N. Shimokawa and N. Koibuchi (2009). "Retinoic Acid receptor-related orphan receptor alpha-enhanced thyroid hormone receptor-mediated transcription requires its ligand binding domain which is not, by itself, sufficient: possible direct interaction of two receptors." Thyroid 19(8): 893-898. Quax, T. E. F., N. J. Claassens, D. Soll and J. van der Oost (2015). "Codon Bias as a Means to Fine-Tune Gene Expression." Molecular Cell 59(2): 149-161. Quigley, H. A., G. R. Dunkelberger and W. R. Green (1989). "Retinal ganglion cell atrophy correlated with automated perimetry in human eyes with glaucoma." Am J Ophthalmol 107(5): 453-464. Raper, S. E., N. Chirmule, F. S. Lee, N. A. Wivel, A. Bagg, G. P. Gao, J. M. Wilson and M. L. Batshaw (2003). "Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer." Mol Genet Metab 80(1-2): 148-158. Ratnam, K., J. Carroll, T. C. Porco, J. L. Duncan and A. Roorda (2013). "Relationship between foveal cone structure and clinical measures of visual function in patients with inherited retinal degenerations." Invest Ophthalmol Vis Sci 54(8): 5836-5847. Ray, T. A., K. M. Heath, N. Hasan, J. M. Noel, I. S. Samuels, K. A. Martemyanov, N. S. Peachey, M. A. McCall and R. G. Gregg (2014). "GPR179 is required for high sensitivity of the mGluR6 signaling cascade in depolarizing bipolar cells." J Neurosci 34(18): 6334-6343. Remmer, M. H., N. Rastogi, M. P. Ranka and E. J. Ceisler (2015). "Achromatopsia: a review." Curr Opin Ophthalmol 26(5): 333-340. Ripps, H. (2002). "Cell death in retinitis pigmentosa: gap junctions and the 'bystander' effect." Exp Eye Res 74(3): 327-336. Ritchey, E. R., R. E. Bongini, K. A. Code, C. Zelinka, S. Petersen-Jones and A. J. Fischer (2010). "The pattern of expression of guanine nucleotide-binding protein beta3 in the retina is conserved across vertebrate species." Neuroscience 169(3): 1376-1391. Robson, A. G., M. Michaelides, V. A. Luong, G. E. Holder, A. C. Bird, A. R. Webster, A. T. Moore and F. W. Fitzke (2008). "Functional correlates of fundus autofluorescence abnormalities in patients with RPGR or RIMS1 mutations causing cone or cone rod dystrophy." Br J Ophthalmol 92(1): 95-102. Robson, A. G., M. Michaelides, Z. Saihan, A. C. Bird, A. R. Webster, A. T. Moore, F. W. Fitzke and G. E. Holder (2008). "Functional characteristics of patients with retinal dystrophy that manifest abnormal parafoveal annuli of high density fundus autofluorescence; a review and update." Documenta Ophthalmologica 116(2): 79-89. Rogerson, L. E., C. Behrens, T. Euler, P. Berens and T. Schubert (2017). "Connectomics of synaptic microcircuits: lessons from the outer retina." J Physiol 595(16): 5517-5524. Ronning, K. E., G. P. Allina, E. B. Miller, R. J. Zawadzki, E. N. Pugh, R. Herrmann and M. E. Burns (2018). "Loss of cone function without degeneration in a novel Gnat2 knock-out mouse." Experimental Eye Research 171: 111-118. Ronzitti, G., G. Bortolussi, R. van Dijk, F. Collaud, S. Charles, C. Leborgne, P. Vidal, S. Martin, B. Gjata, M. S. Sola, L. van Wittenberghe, A. Vignaud, P. Veron, P. J. Bosma, A. F. Muro and F. Mingozzi (2016). "A translationally optimized AAV-UGT1A1 vector drives safe and long-lasting correction of Crigler-Najjar syndrome." Mol Ther Methods Clin Dev 3: 16049. Roorda, A. and J. L. Duncan (2015). "Adaptive optics ophthalmoscopy." Annu Rev Vis Sci 1: 19-50. Rossi, E. A. and A. Roorda (2010). "The relationship between visual resolution and cone spacing in the human fovea." Nat Neurosci 13(2): 156-157. Rosskopf, D., S. Busch, I. Manthey and W. Siffert (2000). "G protein beta 3 gene: structure, promoter, and additional polymorphisms." Hypertension 36(1): 33-41.

235

Rozanowski, B., J. M. Burke, M. E. Boulton, T. Sarna and M. Rozanowska (2008). "Human RPE melanosomes protect from photosensitized and iron-mediated oxidation but become pro-oxidant in the presence of iron upon photodegradation." Investigative Ophthalmology & Visual Science 49(7): 2838-2847. Sakuma, H., A. Murakami, T. Fujimaki and G. Inana (1998). "Isolation and characterization of the human X-arrestin gene." Gene 224(1-2): 87-95. Saleh, L. and F. B. Perler (2006). "Protein splicing in cis and in trans." Chemical Record 6(4): 183-193. Samulski, R. J., X. Zhu, X. Xiao, J. D. Brook, D. E. Housman, N. Epstein and L. A. Hunter (1991). "Targeted integration of adeno-associated virus (AAV) into human chromosome 19." EMBO J 10(12): 3941-3950. Sarna, T. (1992). "Properties and function of the ocular melanin--a photobiophysical view." J Photochem Photobiol B 12(3): 215-258. Schindelin, J., C. T. Rueden, M. C. Hiner and K. W. Eliceiri (2015). "The ImageJ ecosystem: An open platform for biomedical image analysis." Mol Reprod Dev 82(7-8): 518-529. Schmitz-Valckenberg, S., F. G. Holz, A. C. Bird and R. F. Spaide (2008). "Fundus autofluorescence imaging: review and perspectives." Retina 28(3): 385-409. Seagle, B. L., K. A. Rezai, Y. Kobori, E. M. Gasyna, K. A. Rezaei and J. R. Norris, Jr. (2005). "Melanin photoprotection in the human retinal pigment epithelium and its correlation with light-induced cell apoptosis." Proc Natl Acad Sci U S A 102(25): 8978- 8983. Sengillo, J. D., S. Justus, T. Cabral and S. H. Tsang (2017). "Correction of Monogenic and Common Retinal Disorders with Gene Therapy." Genes (Basel) 8(2). Shaaban, S. A. and S. S. Deeb (1998). "Functional analysis of the promoters of the human red and green visual pigment genes." Invest Ophthalmol Vis Sci 39(6): 885- 896. Shamir, E. R. and A. J. Ewald (2014). "Three-dimensional organotypic culture: experimental models of mammalian biology and disease." Nat Rev Mol Cell Biol 15(10): 647-664. Sharpe LT, S. A., Jagle H, Nathans J (1999). Opsin genes , cone photopigments , color vision , and color blindness. Color Vision: from Genes to Perception. Cambridge, UK, Cambridge University Press: 3-52. Shen, J. K., X. R. Yang, A. L. Dong, R. M. Petters, Y. W. Peng, F. Wong and P. A. Campochiaro (2005). "Oxidative damage is a potential cause of cone cell death in retinitis pigmentosa." Journal of Cellular Physiology 203(3): 457-464. Shuart, N. G., Y. Haitin, S. S. Camp, K. D. Black and W. N. Zagotta (2011). "Molecular mechanism for 3:1 subunit stoichiometry of rod cyclic nucleotide-gated ion channels." Nat Commun 2: 457. Sieving, P. A. and C. Nino (1988). "Scotopic Threshold Response (Str) of the Human Electroretinogram." Investigative Ophthalmology & Visual Science 29(11): 1608-1614. Skorczyk-Werner, A., W. C. Chiang, A. Wawrocka, K. Wicher, M. Jarmuz-Szymczak, M. Kostrzewska-Poczekaj, A. Jamsheer, R. Ploski, M. Rydzanicz, D. Pojda-Wilczek, N. Weisschuh, B. Wissinger, S. Kohl, J. H. Lin and M. R. Krawczynski (2017). "Autosomal recessive cone-rod dystrophy can be caused by mutations in the ATF6 gene." Eur J Hum Genet 25(11): 1210-1216. Skorczyk-Werner, A., W. C. Chiang, A. Wawrocka, K. Wicher, M. Jarmuz-Szymczak, M. Kostrzewska-Poczekaj, A. Jamsheer, R. Ploski, M. Rydzanicz, D. Pojda-Wilczek, N. Weisschuh, B. Wissinger, S. Kohl, J. H. Lin and M. R. Krawczynski (2017). "Autosomal recessive cone-rod dystrophy can be caused by mutations in the ATF6 gene." European Journal of Human Genetics 25(11): 1210-1216. Sloan, L. L. (1954). "Congenital achromatopsia; a report of 19 cases." J Opt Soc Am 44(2): 117-128. Sloan, L. L. and K. Feiock (1972). "Acuity-Luminance Function in Achromatopsia and in Progressive Cone Degeneration - Factors Related to Individual Differences in Tolerance to Bright Light." Investigative Ophthalmology 11(10): 862-&.

236

Smallwood, P. M., Y. Wang and J. Nathans (2002). "Role of a locus control region in the mutually exclusive expression of human red and green cone pigment genes." Proc Natl Acad Sci U S A 99(2): 1008-1011. Smith, V. C., J. Pokorny and F. W. Newell (1978). "Autosomal recessive incomplete achromatopsia with protan luminosity function." Ophthalmologica 177(4): 197-207. Sonntag, F., K. Schmidt and J. A. Kleinschmidt (2010). "A viral assembly factor promotes AAV2 capsid formation in the nucleolus." Proc Natl Acad Sci U S A 107(22): 10220-10225. Soto, F. and D. Kerschensteiner (2015). "Synaptic remodeling of neuronal circuits in early retinal degeneration." Front Cell Neurosci 9: 395. Spaide, R. F. and C. A. Curcio (2011). "ANATOMICAL CORRELATES TO THE BANDS SEEN IN THE OUTER RETINA BY OPTICAL COHERENCE TOMOGRAPHY Literature Review and Model." Retina-the Journal of Retinal and Vitreous Diseases 31(8): 1609-1619. Spaide, R. F. and J. M. Klancnik, Jr. (2005). "Fundus autofluorescence and central serous chorioretinopathy." Ophthalmology 112(5): 825-833. Sparrow, J. R., E. Gregory-Roberts, K. Yamamoto, A. Blonska, S. K. Ghosh, K. Ueda and J. Zhou (2012). "The bisretinoids of retinal pigment epithelium." Prog Retin Eye Res 31(2): 121-135. Srinivas, M., L. Ng, H. Liu, L. Jia and D. Forrest (2006). "Activation of the blue opsin gene in cone photoreceptor development by retinoid-related orphan receptor beta." Mol Endocrinol 20(8): 1728-1741. Staurenghi, G., S. Sadda, U. Chakravarthy, R. F. Spaide and P. International Nomenclature for Optical Coherence Tomography (2014). "Proposed lexicon for anatomic landmarks in normal posterior segment spectral-domain optical coherence tomography: the IN*OCT consensus." Ophthalmology 121(8): 1572-1578. Stearns, G., M. Evangelista, J. M. Fadool and S. E. Brockerhoff (2007). "A mutation in the cone-specific pde6 gene causes rapid cone photoreceptor degeneration in zebrafish." J Neurosci 27(50): 13866-13874. Stilwell, J. L. and R. J. Samulski (2004). "Role of viral vectors and virion shells in cellular gene expression." Mol Ther 9(3): 337-346. Sullivan, R. K., E. Woldemussie and D. V. Pow (2007). "Dendritic and synaptic plasticity of neurons in the human age-related macular degeneration retina." Invest Ophthalmol Vis Sci 48(6): 2782-2791. Sundaram, V., C. Wilde, J. Aboshiha, J. Cowing, C. Han, C. S. Langlo, R. Chana, A. E. Davidson, P. I. Sergouniotis, J. W. Bainbridge, R. R. Ali, A. Dubra, G. Rubin, A. R. Webster, A. T. Moore, M. Nardini, J. Carroll and M. Michaelides (2014). "Retinal structure and function in achromatopsia: implications for gene therapy." Ophthalmology 121(1): 234-245. Suzuki, K. and J. C. Izpisua Belmonte (2018). "In vivo genome editing via the HITI method as a tool for gene therapy." J Hum Genet 63(2): 157-164. Suzuki, K., Y. Tsunekawa, R. Hernandez-Benitez, J. Wu, J. Zhu, E. J. Kim, F. Hatanaka, M. Yamamoto, T. Araoka, Z. Li, M. Kurita, T. Hishida, M. Li, E. Aizawa, S. Guo, S. Chen, A. Goebl, R. D. Soligalla, J. Qu, T. Jiang, X. Fu, M. Jafari, C. R. Esteban, W. T. Berggren, J. Lajara, E. Nunez-Delicado, P. Guillen, J. M. Campistol, F. Matsuzaki, G. H. Liu, P. Magistretti, K. Zhang, E. M. Callaway, K. Zhang and J. C. Belmonte (2016). "In vivo genome editing via CRISPR/Cas9 mediated homology- independent targeted integration." Nature 540(7631): 144-149. Szel, A. and P. Rohlich (1992). "Two cone types of rat retina detected by anti-visual pigment antibodies." Exp Eye Res 55(1): 47-52. Szel, A., P. Rohlich, K. Mieziewska, G. Aguirre and T. van Veen (1993). "Spatial and temporal differences between the expression of short- and middle-wave sensitive cone pigments in the mouse retina: a developmental study." J Comp Neurol 331(4): 564-577. Szel, A., T. van Veen and P. Rohlich (1994). "Retinal cone differentiation." Nature 370(6488): 336. Talcott, K. E., K. Ratnam, S. M. Sundquist, A. S. Lucero, B. J. Lujan, W. Tao, T. C. Porco, A. Roorda and J. L. Duncan (2011). "Longitudinal study of cone photoreceptors

237

during retinal degeneration and in response to ciliary neurotrophic factor treatment." Invest Ophthalmol Vis Sci 52(5): 2219-2226. Tanimoto, N., R. L. Muehlfriedel, M. D. Fischer, E. Fahl, P. Humphries, M. Biel and M. W. Seeliger (2009). "Vision tests in the mouse: Functional phenotyping with electroretinography." Front Biosci (Landmark Ed) 14: 2730-2737. Tatsis, N. and H. C. J. Ertl (2004). "Adenoviruses as vaccine vectors." Molecular Therapy 10(4): 616-629. Thiadens, A. A., N. W. Slingerland, S. Roosing, M. J. van Schooneveld, J. J. van Lith- Verhoeven, N. van Moll-Ramirez, L. I. van den Born, C. B. Hoyng, F. P. Cremers and C. C. Klaver (2009). "Genetic etiology and clinical consequences of complete and incomplete achromatopsia." Ophthalmology 116(10): 1984-1989 e1981. Thiadens, A. A., V. Somervuo, L. I. van den Born, S. Roosing, M. J. van Schooneveld, R. W. Kuijpers, N. van Moll-Ramirez, F. P. Cremers, C. B. Hoyng and C. C. Klaver (2010). "Progressive loss of cones in achromatopsia: an imaging study using spectral- domain optical coherence tomography." Invest Ophthalmol Vis Sci 51(11): 5952-5957. Thiadens, A. A. H. J., A. I. den Hollander, S. Roosing, S. B. Nabuurs, R. C. Zekveld- Vroon, R. W. J. Collin, E. De Baere, R. K. Koenekoop, M. J. van Schooneveld, T. M. Strom, J. J. C. van Lith-Verhoeven, A. J. Lotery, N. van Moll-Ramirez, B. P. Leroy, L. I. van den Born, C. B. Hoyng, F. P. M. Cremers and C. C. W. Klaver (2009). "Homozygosity Mapping Reveals PDE6C Mutations in Patients with Early-Onset Cone Photoreceptor Disorders." American Journal of Human Genetics 85(2): 240-247. Thomas, M. G. and I. Gottlob (2014). "Re: Sundaram et al.: retinal structure and function in achromatopsia: implications for gene therapy (Ophthalmology 2014;121:234-45)." Ophthalmology 121(9): e46-47. Thomas, M. G., A. Kumar, S. Kohl, F. A. Proudlock and I. Gottlob (2011). "High- resolution in vivo imaging in achromatopsia." Ophthalmology 118(5): 882-887. Thomas, M. G., R. J. McLean, S. Kohl, V. Sheth and I. Gottlob (2012). "Early signs of longitudinal progressive cone photoreceptor degeneration in achromatopsia." Br J Ophthalmol 96(9): 1232-1236. Trapani, I. and A. Auricchio (2018). "Seeing the Light after 25 Years of Retinal Gene Therapy." Trends in Molecular Medicine 24(8): 669-681. Trapani, I., P. Colella, A. Sommella, C. Iodice, G. Cesi, S. de Simone, E. Marrocco, S. Rossi, M. Giunti, A. Palfi, G. J. Farrar, R. Polishchuk and A. Auricchio (2014). "Effective delivery of large genes to the retina by dual AAV vectors." EMBO Mol Med 6(2): 194- 211. Truong, D. J., K. Kuhner, R. Kuhn, S. Werfel, S. Engelhardt, W. Wurst and O. Ortiz (2015). "Development of an intein-mediated split-Cas9 system for gene therapy." Nucleic Acids Res 43(13): 6450-6458. Tsukamoto, Y. and N. Omi (2013). "Functional allocation of synaptic contacts in microcircuits from rods via rod bipolar to AII amacrine cells in the mouse retina." J Comp Neurol 521(15): 3541-3555. Tummala, S. R., A. Neinstein, M. E. Fina, A. Dhingra and N. Vardi (2014). "Localization of Cacna1s to ON bipolar dendritic tips requires mGluR6-related cascade elements." Invest Ophthalmol Vis Sci 55(3): 1483-1492. Ueno, S., A. Nakanishi, T. Kominami, Y. Ito, T. Hayashi, K. Yoshitake, Y. Kawamura, K. Tsunoda, T. Iwata and H. Terasaki (2017). "In vivo imaging of a cone mosaic in a patient with achromatopsia associated with a GNAT2 variant." Jpn J Ophthalmol 61(1): 92-98. Ueyama, H., S. Tanabe, S. Muraki-Oda, S. Yamade, M. Ohji and I. Ohkubo (2009). "Analysis of introns and promoters of L/M visual pigment genes in relation to deutan color-vision deficiency with an array of normal gene orders." J Hum Genet 54(9): 525- 530. Viswanathan, S., L. J. Frishman, J. G. Robson, R. S. Harwerth and E. L. Smith (1999). "The photopic negative response of the macaque electroretinogram: Reduction by experimental glaucoma." Investigative Ophthalmology & Visual Science 40(6): 1124- 1136.

238

Volkmann, G. and H. Iwai (2010). "Protein trans-splicing and its use in structural biology: opportunities and limitations." Molecular Biosystems 6(11): 2110-2121. Wachtmeister, L. (1998). "Oscillatory potentials in the retina: what do they reveal." Progress in Retinal and Eye Research 17(4): 485-521. Wang, I., N. W. Khan, K. Branham, B. Wissinger, S. Kohl and J. R. Heckenlively (2012). "Establishing baseline rod electroretinogram values in achromatopsia and cone dystrophy." Doc Ophthalmol 125(3): 229-233. Wang, Y., J. P. Macke, S. L. Merbs, D. J. Zack, B. Klaunberg, J. Bennett, J. Gearhart and J. Nathans (1992). "A locus control region adjacent to the human red and green visual pigment genes." Neuron 9(3): 429-440. Wang, Y., P. M. Smallwood, M. Cowan, D. Blesh, A. Lawler and J. Nathans (1999). "Mutually exclusive expression of human red and green visual pigment-reporter transgenes occurs at high frequency in murine cone photoreceptors." Proc Natl Acad Sci U S A 96(9): 5251-5256. Wang, Y. V., M. Weick and J. B. Demb (2011). "Spectral and temporal sensitivity of cone-mediated responses in mouse retinal ganglion cells." J Neurosci 31(21): 7670- 7681. Wang, Z., J. Dillon and E. R. Gaillard (2006). "Antioxidant properties of melanin in retinal pigment epithelial cells." Photochemistry and Photobiology 82(2): 474-479. Wassle, H., C. Puller, F. Muller and S. Haverkamp (2009). "Cone contacts, mosaics, and territories of bipolar cells in the mouse retina." J Neurosci 29(1): 106-117. Wiley, L. A., E. R. Burnight, E. E. Kaalberg, C. Jiao, M. J. Riker, J. A. Halder, M. A. Luse, I. C. Han, S. R. Russell, E. H. Sohn, E. M. Stone, B. A. Tucker and R. F. Mullins (2018). "Assessment of Adeno-Associated Virus Serotype Tropism in Human Retinal Explants." Hum Gene Ther 29(4): 424-436. Wissinger, B., D. Gamer, H. Jagle, R. Giorda, T. Marx, S. Mayer, S. Tippmann, M. Broghammer, B. Jurklies, T. Rosenberg, S. G. Jacobson, E. C. Sener, S. Tatlipinar, C. B. Hoyng, C. Castellan, P. Bitoun, S. Andreasson, G. Rudolph, U. Kellner, B. Lorenz, G. Wolff, C. Verellen-Dumoulin, M. Schwartz, F. P. M. Cremers, E. Apfelstedt-ylla, E. Zrenner, R. Salati, L. T. Sharpe and S. Kohl (2001). "CNGA3 mutations in hereditary cone photoreceptor disorders." American Journal of Human Genetics 69(4): 722-737. Wu, C. and C. E. Dunbar (2011). "Stem cell gene therapy: the risks of insertional mutagenesis and approaches to minimize genotoxicity." Front Med 5(4): 356-371. Wu, Z., H. Yang and P. Colosi (2010). "Effect of genome size on AAV vector packaging." Mol Ther 18(1): 80-86. Xie, J., Q. Mao, P. W. L. Tai, R. He, J. Ai, Q. Su, Y. Zhu, H. Ma, J. Li, S. Gong, D. Wang, Z. Gao, M. Li, L. Zhong, H. Zhou and G. Gao (2017). "Short DNA Hairpins Compromise Recombinant Adeno-Associated Virus Genome Homogeneity." Mol Ther 25(6): 1363-1374. Xu, J., L. M. Morris, S. Michalakis, M. Biel, S. J. Fliesler, D. M. Sherry and X. Q. Ding (2012). "CNGA3 deficiency affects cone synaptic terminal structure and function and leads to secondary rod dysfunction and degeneration." Invest Ophthalmol Vis Sci 53(3): 1117-1129. Xue, K., J. K. Jolly, A. R. Barnard, A. Rudenko, A. P. Salvetti, M. I. Patricio, T. L. Edwards, M. Groppe, H. O. Orlans, T. Tolmachova, G. C. Black, A. R. Webster, A. J. Lotery, G. E. Holder, S. M. Downes, M. C. Seabra and R. E. MacLaren (2018). "Beneficial effects on vision in patients undergoing retinal gene therapy for choroideremia." Nat Med 24(10): 1507-1512. Yang, P., K. V. Michaels, R. J. Courtney, Y. Wen, D. A. Greninger, L. Reznick, D. J. Karr, L. B. Wilson, R. G. Weleber and M. E. Pennesi (2014). "Retinal morphology of patients with achromatopsia during early childhood: implications for gene therapy." JAMA Ophthalmol 132(7): 823-831. Ye, G. J., E. Budzynski, P. Sonnentag, T. M. Nork, N. Sheibani, Z. Gurel, S. L. Boye, J. J. Peterson, S. E. Boye, W. W. Hauswirth and J. D. Chulay (2016). "Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases." Hum Gene Ther 27(1): 72-82.

239

Yung, M., M. A. Klufas and D. Sarraf (2016). "Clinical applications of fundus autofluorescence in retinal disease." Int J Retina Vitreous 2: 12. Zallocchi, M., K. Binley, Y. Lad, S. Ellis, P. Widdowson, S. Iqball, V. Scripps, M. Kelleher, J. Loader, J. Miskin, Y. W. Peng, W. M. Wang, L. Cheung, D. Delimont, K. A. Mitrophanous and D. Cosgrove (2014). "EIAV-based retinal gene therapy in the shaker1 mouse model for usher syndrome type 1B: development of UshStat." PLoS One 9(4): e94272. Zawadzki, R. J., S. M. Jones, S. S. Olivier, M. Zhao, B. A. Bower, J. A. Izatt, S. Choi, S. Laut and J. S. Werner (2005). "Adaptive-optics optical coherence tomography for high- resolution and high-speed 3D retinal in vivo imaging." Opt Express 13(21): 8532-8546. Zelinger, L., A. V. Cideciyan, S. Kohl, S. B. Schwartz, A. Rosenmann, D. Eli, A. Sumaroka, A. J. Roman, X. Luo, C. Brown, B. Rosin, A. Blumenfeld, B. Wissinger, S. G. Jacobson, E. Banin and D. Sharon (2015). "Genetics and Disease Expression in the CNGA3 Form of Achromatopsia: Steps on the Path to Gene Therapy." Ophthalmology 122(5): 997-1007. Zhang, W., L. J. Li, Q. Su, G. P. Gao and H. Khanna (2018). "Gene Therapy Using a miniCEP290 Fragment Delays Photoreceptor Degeneration in a Mouse Model of Leber Congenital Amaurosis." Human Gene Therapy 29(1): 42-50. Zhong, L., B. Li, C. S. Mah, L. Govindasamy, M. Agbandje-McKenna, M. Cooper, R. W. Herzog, I. Zolotukhin, K. H. Warrington, Jr., K. A. Weigel-Van Aken, J. A. Hobbs, S. Zolotukhin, N. Muzyczka and A. Srivastava (2008). "Next generation of adeno- associated virus 2 vectors: point mutations in tyrosines lead to high-efficiency transduction at lower doses." Proc Natl Acad Sci U S A 105(22): 7827-7832. Zhu, X. and C. M. Craft (2000). "Modulation of CRX transactivation activity by phosducin isoforms." Mol Cell Biol 20(14): 5216-5226. Zhu, X., B. Ma, S. Babu, J. Murage, B. E. Knox and C. M. Craft (2002). "Mouse cone arrestin gene characterization: promoter targets expression to cone photoreceptors." FEBS Lett 524(1-3): 116-122. Zincarelli, C., S. Soltys, G. Rengo and J. E. Rabinowitz (2008). "Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection." Mol Ther 16(6): 1073-1080. Zinn, E., S. Pacouret, V. Khaychuk, H. T. Turunen, L. S. Carvalho, E. Andres-Mateos, S. Shah, R. Shelke, A. C. Maurer, E. Plovie, R. Xiao and L. H. Vandenberghe (2015). "In Silico Reconstruction of the Viral Evolutionary Lineage Yields a Potent Gene Therapy Vector." Cell Rep 12(6): 1056-1068. Zinn, E. and L. H. Vandenberghe (2014). "Adeno-associated virus: fit to serve." Curr Opin Virol 8: 90-97. Zobor, D., A. Werner, F. Stanzial, F. Benedicenti, G. Rudolph, U. Kellner, C. Hamel, S. Andreasson, G. Zobor, T. Strasser, B. Wissinger, S. Kohl, E. Zrenner and R.-C. Consortium (2017). "The Clinical Phenotype of CNGA3-Related Achromatopsia: Pretreatment Characterization in Preparation of a Gene Replacement Therapy Trial." Invest Ophthalmol Vis Sci 58(2): 821-832. Zobor, D., G. Zobor and S. Kohl (2015). "Achromatopsia: on the doorstep of a possible therapy." Ophthalmic Res 54(2): 103-108.

240