Proc. Nati. Acad. Sci. USA Vol. 91, pp. 5471-5474, June 1994 Chemistry Spectrophotometric assay for enzyme-mediated unwinding of double-stranded DNA (/fluorescence/drug screning) PETER HOUSTON AND THOMAS KODADEK* Department of Chemistry, University of Texas, Austin, TX 78712 Communicated by John I. Brauman, March 21, 1994 (received for review January 10, 1994)

ABSTRACT A method is described for monitoring the this simple protocol to screen compounds as potential heli- enzyme-mediated unwinding of duplex DNA spectrophotomet- case inhibitors. rically. The assay employs a partially duplex oligonucleotide substrate modified at the complementary end with coumarin MATERIALS AND METHODS and fluorescein moieties. When in close proximity the fluores- cein quenches the fluorescence of coumarin. However, when Proteins. The Dda helicase was purified from an overpro- the strands are separated by the action of a DNA helicase, the ducing Escherichia coli strain according to the literature coumarin fluorescence increases greatly. Therefore, the prog- procedure (3). Bovine serum albumin was purchased from ress of enzyme-mediated DNA unwinding can be measured in New England Biolabs, and creatine kinase was purchased real time by fluorescence spectroscopy. This assay provides a from Sigma. All protein preparations were free of detectable simple method to screen for helicase inhibitors, which are of nuclease activities. growing interest as potential anticancer agents. The application . The oligodeoxyribonucleotides 5'-fluorescein-GG- of this technique to kinetic analyses of the mechanism of action CCTAACTCGATATGCAGGCCTCG(T)12-3' (iF) and 5'- of DNA is also discussed. (T)12CGAGGCCTCGATATCGTTAGGCC-NH2-3' (2) were purchased from Operon Technologies (Alameda, CA). A cou- The protein-mediated unwinding of double-stranded DNA is marin fluorophore was coupled to the 3' amino group of a central event in replication, recombination, and repair. This oligonucleotide 2 by the following procedure. Four nano- reaction is catalyzed by a family of enzymes called DNA moles of 2 was dissolved in 100 1.d of sodium borate-buffered helicases (1, 2), which couple the hydrolysis of nucleoside water (20 mM, pH 8.0). Then 40 nmol of the N-hydroxysul- triphosphates to translocation through, and melting of, the fosuccinimidyl (sulfo-NHS) ester of 7-amino-4-methyl- double helix. Because of their central role in DNA metabo- coumarin-3-acetic acid (purchased from Pierce) dissolved in lism, there has been a great deal of interest in understanding 25 1y of the same buffer was added slowly to the oligonucle- their mechanism of action. Unfortunately, the rather cum- otide solution over a 5-min period at 0C in the dark. The bersome nature of presently available assays for helicase- solution was then allowed to warm to room temperature over catalyzed DNA unwinding has hindered these efforts. Typ- a period of 6 hr. The coumarin-oligonucleotide conjugate 2C ically, a radiolabeled, partially duplex substrate is incubated was separated from excess sulfo-NHS ester by gel filtration with the DNA helicase and the degree of unwinding is chromatography (Bio-Rad P-6DG desalting column) and con- monitored by native gel electrophoresis and autoradiography centrated by ethanol precipitation. The conjugation reaction (1). This assay requires many hours to conduct and is limited proceeded in 90 ± 5% yield as determined by comparing the in the number of data points that can be collected by the absorbance of the product at 260 nm (due to the DNA bases) number ofgel lanes available. Therefore, it is not well suited and 340 nm (due to coumarin). When necessary, the product to support the extensive kinetic studies that will be required was 5'-32P-labeled with T4 polynucleotide kinase and to elucidate the detailed mechanism of action of DNA heli- [Y-32P]ATP. cases. For the same reasons, this assay is poorly suited to To form the tailed duplex (Fig. 1) 2C was annealed to iF by support large-scale screening ofDNA-binding compounds as mixing equimolar amounts ofeach oligonucleotide in a buffer potential helicase inhibitors, in which there is growing inter- composed of10 mM Tris/HCl (pH 7.4), 1 mM EDTA, and 100 est as potential anticancer agents. mM NaCl. The solution was heated briefly at 900C and then In this report, we describe a method that overcomes all of allowed to cool slowly to room temperature. the limitations of the current assay. A partially single- A covalent adduct of the drug CC-1065 and the coumarin- stranded DNA substrate is constructed with two fluorescent modified 1F-2C duplex was made by the literature procedure moieties, fluorescein and coumarin, attached to the comple- (4). The 5'-32P-labeled drug-adducted duplex was cleaved at mentary strands at the duplex end. In this form, the coumarin the modified base by heating in the presence ofpiperidine and exhibits a very low fluorescence intensity due to efficient electrophoresing the resulting products through an 8% poly- quenching by the nearby fluorescein. When the strands are acrylamide sequencing gel (data not shown). This demon- separated by the action of a DNA helicase, the fluorescence strated that the site of drug binding was A25 of 2C, as of the coumarin moiety increases greatly. Thus, the unwind- expected. ing reaction can be followed in real time with fluorescence Unwinding Assays. Helicase-catalyzed unwinding reac- spectroscopy. This procedure, which is quite sensitive and tions were conducted by incubating the purified Dda protein requires only minutes to carry out, should greatly facilitate (10 nM) with 1F*2C (100 nM) in a buffer composed of 10 mM extensive kinetic studies ofhelicase-mediated DNA unwind- Tris/acetate (pH 7.5), 10 mM magnesium acetate, 90 mM ing. In addition, we demonstrate here the feasibility of using potassium acetate, bovine serum albumin (50 ,g/ml), and an ATP-regenerating system composed of creatine kinase (1 The publication costs ofthis article were defrayed in part by page charge unit/ml) and 10 mM phosphocreatine. After a 5-min incuba- payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 5471 5472 Chemistry: Houston and Kodadek Proc. Natl. Acad Sci. USA 91 (1994) should be unaffected by unwinding, will not obscure the expected increase in the coumarin fluorescence intensity. To construct the appropriate substrate, we linked a IL coumarin moiety to the 3' end of an amine-terminated oligo- nucleotide (2) by use of the commercially available sulfo- OF CED NHS-activated 7-amino-4-methylcoumarin-3-acetic acid. Af- I ATP ter purification, this product (2C) was annealed to an equi- / molar amount of a partially complementary oligonucleotide (1F) with a 5'-linked fluorescein group. An oligo(dT) tail was included on each strand to facilitate loading of a DNA helicase. As expected, the duplex exhibited a lower level of coumarin-dependent fluorescence than the coumarin- + derivatized single strand (=20%; data not shown). To determine whether the action of a DNA helicase would result in the expected increase in coumarin-based fluores- cence using this substrate, 1F-2C was incubated in the presence of ATP and a catalytic amount of the purified FIG. 1. Schematic representation of the fluorescence-based un- bacteriophage T4 Dda protein, a DNA helicase involved in winding assay. Coumarin (C, stippled box) and fluorescein (F, oval) phage replication and recombination (6-9). As shown in Fig. probes are attached to the complementary ends of a partially duplex 2, the expected increase in coumarin intensity was indeed DNA substrate. When in close proximity, the fluorescein quenches observed. To ensure that the coumarin fluorescence accu- the normally intense coumarin fluorescence. When the DNA strands rately reflected the degree ofDNA unwinding, we conducted are unwound by a DNA helicase (shaded triangle) the fluorescent an molecules are separated and the coumarin-dependent fluorescence identical experiment, except that the coumarinated strand increases greatly (open box). The unwinding reaction can be followed was 5'-32P-labeled and the degree of unwinding was deter- by observing the coumarin emission over time. mined by native gel electrophoresis, autoradiography, and scintillation counting (Fig. 2). Virtually identical results were tion at 25°C, the reaction was initiated by the addition ofATP obtained, demonstrating the validity of the fluorescence- to 2 mM. based assay. A large excess of single-stranded oligonucleo- When the results were monitored by gel electrophoresis, a tide identical to the coumarinated strand but lacking the 32P-labeled substrate was employed and the volume of the fluorescent label was included in both of the experiments reaction mixture was 10 td. A 15-fold excess of unmodified shown in Fig. 2. Previous experience had shown that when 2 was also included in these runs to prevent reannealing ofthe the gel assay is employed, reannealing of helicase-separated separated strands. At the appropriate time, the reactions strands subsequent to quenching and prior to, or during, were quenched by the addition of EDTA (pH 8.0) to 50 mM. electrophoresis resulted in an artifactually low estimate ofthe Five microliters of 70%o (vol/vol) glycerol was added and the rate of the unwinding (I. Maine and T.K., unpublished samples were electrophoresed through a native 10% poly- results). In the presence of an unlabeled "trapping" strand, acrylamide gel for 3 hr at 150 V. The DNA-containing bands reannealing of the original duplex strands is unlikely and one were visualized and the of the melted strands remains single-stranded. However, in by autoradiography percentage of many applications such as detailed kinetic studies it is substrate unwound was determined by cutting out the bands undesirable to have large quantities of DNAs present other representing the duplex starting material and the single- than the substrate. Therefore, we asked whether the fluo- stranded product and quantitating the amount ofradioactivity rescence assay, which does not require that the helicase be contained in each by scintillation counting. quenched, would provide reliable results in the absence of a When unwinding was monitored spectroscopically, the trapping strand. volume was 2 ml and the reaction was carried out in the cavity of a Hoefer TKO 100 benchtop fluorometer (see Fig. 2) or a 100. Spex fluorometer, using an excitation wavelength of 360 nm and an emission wavelength at 450 nm (see Fig. 3). The slit width was 5 mm.

RESULTS -or._ Development of a Fluorescence-Based Assay for Helicase- 10 Mediated DNA Unwinding. The ideal alternative to gel elec- c trophoresis and autoradiography for the detection of DNA unwinding would be rapid, require only small amounts of substrate, and allow the reaction to be followed in real time. This obviously suggests a spectroscopic assay-in particular one based on fluorescence detection, which is quite sensitive. It has been shown previously that the normally intense 0 60 120 180 240 300 fluorescence of coumarin is quenched efficiently by fluores- Time, sec cein (5). Therefore, we surmised that ifthe two fluorophores were held in close proximity by tethering them to the com- FIG. 2. The fluorescence-based assay correlates well with a plementary ends of a double-helical DNA substrate, only a traditional electrophoretic measurement of helicase-mediated un- low level of coumarin-dependent fluorescence should be winding. The Dda protein-catalyzed unwinding of duplex IF-2C is measured by the increase in coumarin fluorescence intensity (m) or observed. However, after helicase-mediated strand separa- by native gel electrophoresis and autoradiography (e). The two tion, the fluorescent molecules would become separated and methods provide comparable results, demonstrating that the fluo- a large increase in coumarin fluorescence should result (Fig. rescence-based assay accurately reflects the rate ofDNA unwinding. 1). Since the emission maxima of fluorescein and coumarin In the fluorescence experiment, 10lo unwinding corresponds to a are well separated, the fluorescence of the former, which 20%o increase in the coumarin fluorescence. Chemistry: Houston and Kodadek Proc. Natl. Acad. Sci. USA 91 (1994) 5473

.^

-)'

!. lo i.1(1 7.~~~~~~~~NC 7411li~ f 1

illlc. LL

FIG. 3. Effect of a "trapping" strand and the DNA-binding drug CC-1065 on the Dda protein-catalyzed unwinding ofthe fluorescent duplex. The rate of unwinding of the 1FZC duplex was measured in the absence of added DNA (top curve) and in the presence of a 15-fold excess of "trapping" strand equivalent to the coumarinated strand but lacking the fluorophore (middle curve). The two reactions ultimately provided similar yields of unwinding, indicating that the fluorescence-based assay can be employed to measure rates of reaction in the absence of competitor DNAs. Almost no increase in coumarin fluorescence intensity was observed when a CC-1065-modified substrate was employed (bottom curve), showing that this assay should be useful for screening large numbers of compounds as potential helicase inhibitors. In a reaction mixture containing the 1F-2C duplex, but employs a tailed duplex substrate with fluorescein and lacking a trapping strand (Fig. 3, top curve), the rate of coumarin linked to the 3' and 5' complementary ends, unwinding was linear initially and the reaction was complete respectively. In the duplex form, the fluorescence intensity of within 1 min. When the trapping strand was included (Fig. 3, coumarin is low due to quenching by fluorescein. Unwinding middle curve), several minutes were required to achieve the of the duplex separates the fluorophores from one another same steady-state yield. It is important to note that both and results in a large increase in the coumarin fluorescence reactions were conducted at a 10:1 substrate/helicase ratio. intensity. This assay is superior in many ways to the widely Therefore, the rate offluorescence increase probably reflects employed electrophoretic measurement of helicase-cata- recycling of the helicase from one substrate molecule to lyzed DNA unwinding. Most important, the fluorescence- another rather than the time required to unwind a single is substrate molecule (this is fast). The presence of excess based protocol rapid and can be completed within minutes. trapping strand would be expected to sequester much of the Furthermore, it is much more precise since the number of active helicase, leading to a slower buildup ofthe product, as data points that can be collected is not limited by the number is seen in Fig. 3. Since the final yield of the unwinding of gel lanes available. reaction is independent of the trapping strand, the initial We envision that these advantages will facilitate two im- linear buildup of product observed in its absence is a true portant advances in the study of DNA helicases. First, a measure of the reaction rate. In other runs employing differ- version of this assay will provide a simple and rapid screen ent helicase concentrations, the initial rate was found to be for compounds with helicase-inhibiting activities. Since hel- proportional to the helicase concentration (data not shown). icases are required for DNA replication and repair (12, 13), This result demonstrates that this assay can be employed helicase inhibitors are of interest as potential anticancer profitably in detailed kinetic studies. compounds. As shown in Fig. 3, the fluorescence-based Inhibition of the Dda Helicase by the DNA-Binding Drug assay clearly reflects the previously demonstrated ability of (+)-CC-1065 Can Be Observed with the Fluorescence-Based the DNA-binding drug CC-1065 to inhibit helicase-mediated Assay. To demonstrate the utility of the present assay to unwinding. In large drug-screening programs, the fluorescent screen compounds for antihelicase activity, we modified the substrate could be mixed with the helicase and distributed to IF-2C substrate with the antitumor agent CC-1065. CC-1065 the wells of a 96-well microtiter plate. Ninety-six potential is a sequence-specific DNA binding molecule that lies in the helicase inhibitors would then be added, one in each well, and minor groove of DNA and binds covalently to adenine via the unwinding reaction would be initiated by the addition of nucleophilic attack of N3 on a highly reactive cyclopropane ATP. After a suitable incubation, the results would be moiety (10). In the electrophoretic assay, CC-1065 is a potent inhibitor of the Dda protein-mediated unwinding reaction determined with a commercially available fluorescence scan- (11). The drug blocks translocation of the helicase and traps ner that reads the fluorescence intensity in each of the wells the enzyme at the site of modification for several minutes. simultaneously. The wells that exhibited low coumarin flu- This inhibition is also observed with other DNA helicases and orescence contained a potential helicase inhibitor. With this may contribute to the biological activity of CC-1065. protocol, hundreds of compounds per hour could be The fluorometric assay faithfully reported the inability of screened. the Dda helicase to unwind the CC1065-adducted substrate The second important application of this method will be in (Fig. 3, bottom curve). Virtually no time-dependent increase detailed, pre-steady-state kinetic studies of helicase- in the coumarin fluorescence intensity is evident. The very mediated unwinding (for a recent example, see ref. 14). Such small amount of unwinding observed is due to the low level analyses have rarely been undertaken, largely due to the of unmodified duplex that is always present in CC-1065- cumbersome nature ofthe electrophoretic assay. To examine adducted DNA preparations. fast, single-turnover reactions, they must be initiated by rapid mixing and then quenched in a stopped-flow apparatus. A separate reaction must be run for each time point and only a DISCUSSION small number of reactions can be analyzed on a single gel. A method has been devised to monitor the enzyme-mediated The present assay lends itself to exactly this type of exper- unwinding of duplex DNA by fluorescence spectroscopy. It iment. A fluorescence spectrometer interfaced to a rapid 5474 Chemistry: Houston and Kodadek Proc. Natl. Acad Sci. USA 91 (1994) mixing apparatus and a computer could be employed to cations in both applied and basic studies of helicase enzy- measure the rate of single-turnover reactions without the mology. need for quenching multiple reactions at different times. Thus the large matrix of kinetic data that will be necessary to We thank Prof. Stephen Webber and his coworkers for use oftheir action can be collected Spex fluorescence spectrometer and advice in carrying out our understand the details of helicase measurements. We thank Dr. Daekyu Sun for coupling CC-1065 to rapidly and efficiently. the fluorescent duplex, Prof. Boyd Hardesty for helpful discussions, While we have examined the use of fluorescently labeled and Prof. Stephen Kowalczykowski for communicating data prior to DNAs as helicase substrates, another group has employed publication. This work was supported by a grant from the National fluorescence spectroscopy as a method to detect unwinding Institutes of Health (GM39393). of unmodified substrates. Roman and Kowalczykowski (15) have taken advantage of the fact that the intrinsic fluores- 1. Matson, S. W. & Kaiser-Rogers, K. (1990) Annu. Rev. Bio- cence of the E. coli single-stranded-DNA-binding protein chem. 59, 289-329. DNA. Since 2. Lohman, T. M. (1993) J. Biol. Chem. 268, 2269-2272. (SSB) is enhanced upon binding single-stranded 3. Hacker, K. J. & Alberts, B. M. (1992) J. Biol. Chem. 267, SSB binds very poorly to duplex DNA, the increase in 20674-20681. fluorescence intensity is observed only when single-stranded 4. Warpehoski, M. A. & Hurley, L. H. (1988) Chem. Res. Toxi- DNA is released by the action of a DNA helicase on an col. 1, 315-333. initially double-stranded substrate (15). This elegant assay 5. Czworkowski, J., Odom, 0. W. & Hardesty, B. (1991) Bio- has been used to study the E. coli RecBCD helicase, which chemistry 30, 4821-4830. has a peculiar preference for binding to blunt double-stranded 6. Jongeneel, C. V., Formosa, T. & Alberts, B. M. (1984) J. Biol. there is no DNA in the Chem. 259, 12925-12932. ends (16). Therefore, single-stranded 7. Jongeneel, C. V., Bedinger, P. & Alberts, B. M. (1984) J. Biol. starting material to which SSB can bind. However, most Chem. 259, 12933-12938. helicases require a single-stranded region to bind efficiently 8. Kodadek, T. & Alberts, B. M. (1987) Nature (London) 326, to a DNA substrate in vitro. High concentrations of SSB will 312-314. inhibit binding of the Dda helicase (data not shown), thus 9. Bonne-Andrea, C., Wong, M. L. & Alberts, B. M. (1990) introducing a complicating factor in the kinetics. For this Nature (London) 343, 719-726. reason, the SSB-based assay may be less generally useful 10. Reynold, V. L., Molineux, I. J., Kaplan, D. J., Swenson, than the one reported here. More recently, Kowalczykowski D. H. & Hurley, L. H. (1985) 24, 6628-6237. 11. Maine, I. P., Sun, D., Hurley, L. H. & Kodadek, T. (1992) and coworkers have developed a different procedure that Biochemistry 31, 3968-3975. employs the helicase-mediated displacement of fluorescent 12. Naegeli, H., Modrich, P. & Friedberg, E. C. (1993) J. Biol. DNA interchelators to measure duplex unwinding (S. C. Chem. 268, 10386-10392. Kowalczykowski, personal communication). This method 13. Sung, P., Bailley, V., Weber, C., Thompson, L. H., Prakash, may be complementary to our protocol. It should also be L. & Prakash, S. (1993) Nature (London) 365, 852-855. noted that fluorescence energy transfer has been used pre- 14. Aramatunga, M. & Lohman, T. M. (1993) Biochemistry 32, viously to monitor the annealing of complementary DNA 6815-6820. 15. Roman, L. J. & Kowalczykowski, S. (1989) Biochemistry 28, strands (17) and to explore the conformation of interesting 2863-2872. DNA structures such as four-way junctions (18). 16. Taylor, A. F. & Smith, G. R. (1980) Cell 22, 447-457. In summary, we have developed a simple and rapid real- 17. Cardullo, R. A., Agrawal, S., Flores, C., Zamecnik, P. C. & time method to monitor the helicase-mediated unwinding of Wolf, D. E. (1988) Proc. Nati. Acad. Sci. USA 85, 8790-8794. duplex DNA. We expect that this technique will have appli- 18. Eis, P. S. & Millar, D. P. (1993) Biochemistry 32, 13852-13860.