Systematic Entomology
Systematic Entomology (2008), DOI: 10.1111/j.1365-3113.2008.00443.x
Phylogeny and biogeography of the dung beetle genus Phanaeus (Coleoptera: Scarabaeidae)
DANA L. PRICE Department of Ecology, Evolution and Natural Resources, Rutgers University, New Brunswick, New Jersey, U.S.A.
Abstract. The dung beetle genus Phanaeus as currently recognized by Edmonds (1994) consists of 51 species placed in 13 species groups and two subgenera. Here, I examine the phylogeny and biogeography of this genus by analysing the mitochondrial cytochrome oxidase subunit I (530 bp), nuclear large subunit ribosomal RNA (28S, D2 region), and 67 morphological characters for 28 species of Phanaeus. Both maximum parsimony and Bayesian analyses from the combined data yielded well-resolved trees, although low bootstrap and posterior probability support were found for basal nodes. The phylogenetic hypotheses presented here suggest that the subgenera Phanaeus s.str. and Notiophanaeus should each be elevated to the status of full genus. With the exception of the eucraniine outgroups, the paleano species group of the genus Phanaeus is recovered as sister to all other taxa, including the outgroups Oxysternon, Sulcophanaeus and Coprophanaeus. High bootstrap values and posterior probabilities supported the species groups endymion, tridens and vindex. Biogeographical analyses suggest an ancestral distribution for Phanaeus in the Andes in South America, although numerous dispersal events evidently have produced a complicated biogeographical history.
Introduction some difficulties (Edmonds, 1994; Price, 2007). Based on morphological and biogeographical characters, Edmonds The genus Phanaeus Macleay, 1819 comprises a group of (1994) split Phanaeus into two subgenera: (i) Notiophanaeus, tunnelling (as opposed to rolling) dung beetles distributed in comprising 15 mostly South American species in five species the Neotropical and Nearctic regions. Most of these beetles groups; and (ii) Phanaeus s.str., including 27 species (þ four are preferentially coprophagous, feeding on large herbivore subspecies) in eight species groups, mostly in Central and omnivore excrement. During the breeding season, the America and Mexico. Since 1994, nine new species have male and female may cooperate in provisioning a nesting been described (Delgado-Castillo, 1991 [not reported in gallery, and the female subsequently uses the stored food in Edmonds’s 1994 revision]; Arnaud, 1997, 2000, 2001; constructing brood balls (Edmonds, 1994). Phanaeus are of Kohlmann & Solis, 2001; Edmonds, 2004, 2006). In a phy- biological interest for their ecological importance and their logenetic analysis of the genus based on 67 morphological behaviours (male–male competition, bisexual cooperation and and one biogeographical character, and including 49 of the nidification, etc.) and regarding the evolution of their metallic 51 Phanaeus species, Price (2007) recovered a monophyletic colours and variably developed cephalic and pronotal horns. Phanaeus if the genus Oxysternon is included within it. Much of the previous taxonomy of Phanaeus has been Phanaeus dung beetles are restricted to the New World, based on secondary sexual features, especially the shape of from northern Argentina throughout much of South and the cephalic horn and pronotum of the males, although the Central America, Mexico and the United States, northwards often extreme intraspecific variation in shape has caused and eastwards to Massachusetts. Most tropical Phanaeus species are mostly stenotopic (Edmonds, 1994), with distri- butions determined by ground cover and prevailing climate, Correspondence: Dana L.Price, Department of Biological Sciences, especially the amount and timing of warm-season rains. Salisbury University, 1101 Camden Avenue, Salisbury, MD 21801, Geographic distributions can be extremely patchy in regions U.S.A. E-mail: [email protected] such as Mexico, where physiography and habitats are highly Unpublished for the purposes of zoological nomenclature (Art. 8.2, fragmented. Temperate zone species are far fewer and are ICZN) distributed across a wider range of habitat and area. The
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society 1 2 D. L. Price present distributions of the more stenotopic, tropical species Morphology undoubtedly have been strongly affected by human activi- ties (Bennett, 1969; Edmonds, 1994). For this study, 67 morphological characters from Price Edmonds (1994) hypothesized a South American origin for (2007) were used, including characters of the antennae, legs, Phanaeus as a whole; Notiophanaeus species were presumed to labrum, pygidium and genitalia, as well as re-evaluated be descendants of ancestral Phanaeus and to represent an characters from Edmonds (1994). Emphasis was placed on early radiation in South America, with the endymion group large male secondary sexual characters. For the purposes of having recently entered Central America, as have other this paper, morphological data are used only in combined Phanaeini genera, Sulcophanaeus and Coprophanaeus,and analyses with molecular data. other scarabaeines (Edmonds, 1972; Kohlmann & Halffter, 1988, 1990). Phanaeus s.str. was thought to have originated in DNA extraction Mesoamerica (the region from northwest South America west and north of the Andes to the extreme southwestern U.S.) Except for 30 dry pinned museum specimens, all speci- and to consist of three or perhaps four evolutionary lines mens were stored at 208C in 95% ethanol. DNA was (Edmonds, 1994): (i) a lineage including the hermes, triangu- extracted from a leg or the thoracic muscles using a DNeasy laris and tridens groups that expanded both northwards and tissue kit (Qiagen). Tissues were incubated at 558C for 24 to southwards, ultimately entering northwest South America 72 h in 180 mL of ATL buffer and 20–40 mL of Proteinase during the Pleistocene; (ii) a lineage comprising the amethys- K. After incubation, standard protocols following the tinus and quadridens groups that diversified in Mesoamerica DNeasy Tissue Handbook (Qiagen) for DNA extraction montane habitats; (iii) the beltianus and mexicanus groups, of animal tissue were used. which diversified extensively throughout Mesoamerica in warmer, open habitats (i.e. intermediate between montane and forest zones); and (iv) the vindex group, which may Polymerase chain reaction amplification and DNA sequencing represent a fourth lineage that invaded north temperate North America. The primers used for polymerase chain reaction (PCR) The purpose of this study is to analyse the phylogenetic amplification are shown in Table 2. These primers were used relationships within Phanaeus using the mitochondrial to amplify a 530-bp portion of mtDNA (COI) and a 625-bp cytochrome oxidase subunit I (COI), 28S rRNA (D2 portion of 28S rRNA (D2 region). PCR was performed using region) and morphological characters. The results of a GeneAmp PCR System 9700 (Applied Biosystems, Foster a previous morphological study (Price, 2007) indicated City, CA) in 25 or 50 mL reaction volumes using either Taq that the examination of hypothesized sister group relation- PCRCoreKits(Qiagen)orTaqPCRMasterMixKits ships is needed as well. This study presents the first (Qiagen). PCR cycle conditions were as follows: 94–968Cfor phylogenetic hypotheses for Phanaeus species using molec- 3 min; 40–45 cycles of 948C for 30 s, 46–588C for 30–45 s, ular data. Relationships with other Phanaeini genera 728C for 30–60 s; and 728Cfor10min.AmplifiedPCR are also discussed. The historical biogeography of Pha- product was visualized on a 2% high-melting agarose gel naeus will also be analysed and discussed using the phy- (Fisher Biosciences). PCR products were purified using the logenetic trees based on combined molecular and QIAquick PCR Purification Kit (Qiagen) and cycle- morphological data. sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on an ABI 3100 capillary sequencer. Each product was sequenced in both directions. The multiple Materials and methods sequence alignment software Sequence Navigator (Applied Biosystems) was used to compare and edit sequences. Taxon sampling
Twenty-eight species of Phanaeus were sampled (Table 1), Alignment including at least one species from each of the 13 species groups of Edmonds (1994). When possible, several speci- For a first approximation, sequences were aligned with mens of the same species were examined in order to account CLUSTALX(Thompsonet al., 1997). The CLUSTALXalignment for intraspecific variation. Outgroup representatives were was sufficient for the alignment of COI, because there was no chosen according to a recent phylogenetic analysis of the length variation among sequences. The computer alignments tribe Phanaeini (Philips et al., 2004a). Sequences for Anomi- of 28S rRNA sequences were manually adjusted according to opsoides heteroclyta (Blanchard, 1845) and Glyphoderus the criteria in Kjer (1995). The published secondary structure sterquilinus (Westwood, 1837), both from the Eucraniini, of the 28S rRNA was used as a reference, using the secondary thought to be the sister to Phanaeini (Philips et al., 2004; structural model of Gillespie et al. (2004) for the 28S rRNA Ocampo & Hawks, 2006), were generously supplied by expansion segment D2 from chrysomelid and related leaf Federico Ocampo (University of Nebraska State Museum). beetles. Insertions and deletions in regions for which the Included taxa, voucher location and collection data are alignment was unambiguous, but which possessed short provided in Table 1. indels (1–2 nucleotides long), were treated as a fifth character
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x Phanaeus phylogeny and biogeography 3
Table 1. Species, specimen code, voucher location, year collected, country localities and GenBank accession number for specimens and sequences used in the phylogenetic analysis. WDE, collection of W.D. Edmonds; CMN, collection of the Canadian Museum of Nature; DLP, collection of Dana L. Price.
Specimen Voucher Year COI Species code location Collector collected Country GenBank D2 GenBank
Phanaeus achilles 34 WDE B. Streit 2003 Ecuador EU477300 EU432227 P. achilles 35 WDE B. Streit 2003 Ecuador EU477301 EU432228 P. achilles 180 DLP B. Streit 2006 Ecuador EU477302 P. achilles 181 DLP B. Streit 2006 Ecuador EU477303 EU432229 P. alvarengai 120 DLP S. Spector 1999 Bolivia EU477307 EU432232 P. a. amethystinus 261 CMN F. Genier 1993 Guatemala EU477339 EU432258 P. a. guatemalensis 260 CMN F. Genier 1993 Guatemala EU477340 EU432257 P. amithaon 177 DLP B. Streit 2004 USA EU477333 EU432251 P. amithaon 272 DLP B. Streit 2005 USA EU477332 EU432252 P. amithaon 273 DLP B. Streit 2005 USA EU477335 EU432253 P. bispinus 101 DLP S. Spector 1999 Bolivia EU477308 EU432233 P. chalcomelas 202 DLP T. Larsen 2004 Peru EU477298 P. chalcomelas 303 DLP D.L. Price 2005 French Guiana EU477299 EU432226 P. dejeani 255 CMN F. Genier 2000 Brazil EU477292 EU432223 P. endymion 15 WDE W.D. Edmonds 1997 Bolivia EU477315 EU432237 P. endymion 250 CMN B. Gill 1990 Mexico EU477316 EU432238 P. endymion 313 DLP C. Gillett 2006 Belize EU477317 P. furiosus 21 WDE W.D. Edmonds 1999 Mexico EU477324 EU432243 P. furiosus 274 DLP B. Streit 2005 Mexico EU477325 EU432244 P. furiosus 275 DLP B. Streit 2005 Mexico EU477326 EU432245 P. haroldi 179 DLP B. Streit 2005 Ecuador EU477293 EU432219 P. haroldi 185 DLP B. Streit 2006 Ecuador EU477294 EU432220 P. haroldi 254 CMN F. Genier 1994 Ecuador EU477295 EU432221 P. howdeni 257 CMN Gillogly-Stockwell 1996 Panama EU477337 EU432257 P. igneus 301 DLP K. Beucke 2005 USA EU477345 EU432262 P. igneus 302 DLP C. Marshall 2005 USA EU477346 EU432263 P. kirbyi 10 WDE S. Spector 1999 Bolivia EU477309 EU432234 P. kirbyi 102 DLP S. Spector 2000 Bolivia EU477102 P. kirbyi 117 DLP S. Spector 1999 Bolivia EU477117 P. lecourti 204 DLP T. Larsen 2004 Peru EU477306 EU432231 P. lunaris 182 DLP B. Streit 2006 Ecuador EU477329 EU432248 P. lunaris 183 DLP B. Streit 2006 Ecuador EU477330 EU432249 P. lunaris 184 DLP B. Streit 2006 Ecuador EU477331 EU432250 P. meleagris 205 DLP T. Larsen 2004 Peru EU477304 P. meleagris 256 CMN F. Genier 1999 Bolivia EU477305 EU432230 P. melibaeus 5 WDE S. Spector 1999 Bolivia EU477296 EU432224 P. melibaeus 6 WDE S. Spector 1999 Bolivia EU477297 EU432225 P. nimrod 18 WDE W.D. Edmonds & Reyes 2003 Mexico EU477322 EU432241 P. nimrod 19 WDE W.D. Edmonds & Reyes 2003 Mexico EU477323 EU432242 P. paleano 8 WDE E. Cororo 2001 Paraguay EU477312 EU432235 P. paleano 104 DLP S. Spector 1999 Bolivia EU477313 P. paleano 258 CMN F. Genier & F. Vaz de Mello 2001 Brazil EU477314 EU432236 P. prasinus 16 WDE 2000 Venezuela EU477320 P. prasinus 252 CMN S. Peck 1993 Trinidad EU477321 EU432240 P. pyrois 13 WDE Olaya & Mosquero 2003 Colombia EU477318 P. pyrois 251 CMN J.S. Ashe & A.K. Ashe 1993 Costa Rica EU477319 EU432239 P. quadridens 22 WDE W.E. Edmonds & Reyes 1996 Mexico EU477341 P. quadridens 271 DLP B. Streit & Cunningham 2005 Mexico EU477342 EU432261 P. quadridens 175 DLP B. Streit 2004 Mexico EU477343 EU432259 P. quadridens 178 DLP B. Streit 2004 USA EU477344 EU432260 P. sallei 311 DLP C. Gillett 2006 Belize EU477311 EU432256 P. splendidulus 253 CMN F. Genier 2000 Brazil EU477291 EU432222 P. triangularis texensis 32 WDE W.D. Edmonds 2002 USA EU477327 EU432246 P. triangularis texensis 33 WDE W.D. Edmonds 2002 USA EU477328 EU432247 P. vindex 200 DLP D.L. Price 2003 USA EU477347
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x 4 D. L. Price
Table 1. Continued.
Specimen Voucher Year COI Species code location Collector collected Country GenBank D2 GenBank
P. vindex 270 DLP D.L. Price 2004 USA EU477348 EU432264 P. wagneri wagneri 176 DLP B. Streit 2004 Costa Rica EU477332 P. yecoraensis 276 DLP B. Streit 2005 Mexico EU477336 EU432254 Outgroups Coprophanaeus ignecinctus 207 DLP T. Larsen 2004 Peru EU477353 EU432267 C. pluto 44 WDE W.D. Edmonds 1999 Mexico EU477349 EU432265 C. pluto 45 WDE W.D. Edmonds 1999 Mexico EU477350 EU432266 C. telamon 208 DLP T. Larsen 2004 Peru EU477351 C. telamon 312 DLP C. Gillett 2006 Belize EU477352 Oxysternon conspicillatum 40 WDE Olaya & Mosquero 2003 Colombia EU477359 EU432270 O. conspicillatum 211 DLP T. Larsen 2004 Peru EU477360 O. durantoni 304 DLP D.L. Price 2005 French Guiana EU477358 EU432273 O. festivum 277 DLP D.L. Price 2005 French Guiana EU477357 EU432272 O. silenus 41 WDE Olaya & Mosquero 2003 Colombia EU477361 O. silenus 42 WDE Olaya & Mosquero 2003 Colombia EU477362 EU432271 O. spiniferum spiniferum 262 CMN F. Genier 1999 Bolivia EU477363 Sulcophanaeus auricollis 46 WDE Olaya & Mosquero 2003 Colombia EU477354 EU432268 S. faunus 113 DLP S. Spector 1999 Bolivia EU477355 S. faunus 278 DLP D.L. Price 2005 French Guiana EU477356 EU432269
state. For two larger insertions and deletions, different based analyses were performed with PAUP* 4.0b 10 (Swofford, approaches were used. In order to retain as much information 1999). Trees were estimated using heuristic searches with as possible, the first region of 14 nucleotides was aligned using 10 000 random addition replicates and tree bisection– a guide tree created from the remaining nucleotides in reconnection (TBR) branch swapping, and branches were CLUSTALX. A second ambiguous region of 34 nucleotides collapsed if the minimum length was zero. Branch support was coded as multistate characters, and the nucleotides were in the resulting cladograms was assessed using bootstrap excluded from the analysis. All molecular data have been analysis (Felsenstein, 1985). One thousand replicates were submitted to GenBank under the accession numbers implemented, with 10 random addition sequences per EU432219–EU432272 (D2) and EU477300–EU477363 replicate. For the COI data, homogeneity of third-codon (COI) (see Table 1). base frequencies across taxa was evaluated with a chi-square test using PAUP*. In order to examine Edmonds’ (1994) hypothesis regarding the evolutionary lines based on the Phylogenetic analysis ecogeographic regions of Phanaeus s.str. species groups, a constraint analysis using parsimony was conducted in Datasets were analysed individually and in combination PAUP* as follows {Outgroups (Notiophanaeus)[(triangularis (i.e. COI, D2, COI þ D2 and COI þ D2 þ morphology) gr., tridens gr., hermes gr.)(quadridens gr., amethystinus using parsimony and Bayesian analyses. All parsimony- gr.)(mexicanus gr., beltianus gr.)(vindex gr.)]}. Because of uncertainty in the placement of the vindex species group, three additional analyses were conducted with vindex gr. Table 2. Primers used for polymerase chain reaction amplification and sequencing of the cytochrome oxidase subunit I mtDNA gene constrained within each of the above lineages of the sub- fragment and the 28S rRNA (D2) fragment. genus Phanaeus s.str. Prior to Bayesian analyses, MODELTEST 3.06 Akaike Primer Sequence weights (Posada & Crandall, 1998; Posada & Buckley, 2004) and DT-MODSEL (Minin et al., 2003) were used to C1-J-1718* GGAGGATTTGGAAATTGATTAGTTCC select an appropriate model of evolution for each of the two C1-J-1751* GGATCACCTGATATAGCATTCCC C1-N-2191* CCCGGTAAAATTAAAATATAAACTTC independent gene fragments. Both programs suggested C1-N-2329* ACTGTAAATATATGATGAGCTCA GTR þ I þ G for both COI and D2 (Yang, 1994; Yang D2-J-4 AGTCGTGTTGCTTGATAGTGCAG et al., 1994; Gu et al., 1995). Bayesian analyses were D2-J-6TR GGTAAACTCCATCTAAGGCTAA performed on both molecular datasets as well as for D2-N-B TTGGTCCGTGTTTCAAGACGG a combined analysis (D2 þ COI þ morphology) using the D2-N-BJ CTTTGGTCCGTGTTTCAAGAC program MRBAYES 3.1.2 (Hulsenbeck & Ronquist, 2001). Bayesian analyses used a mixed model with three partitions, J is for sense and N is for antisense strands. Primers marked with an asterisk were compiled from Simon et al. (1994). namely COI, D2 and morphology. Bayesian analyses for D2 primers were designed in Kjers laboratory at Rutgers University. COI data were run twice for 5 million generations, with
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x Phanaeus phylogeny and biogeography 5 a sampling frequency of 500 generations. Analyses of tive dispersal and vicariance events. The data matrix was combined data were run twice for 7 million and 5 million constructed by scoring the taxa for presence or absence in generations, respectively. The first 200 trees in each file were 12 areas (12 characters). Because DIVA requires a completely discarded as ‘burn-in’. The remaining trees were pooled and bifurcated tree, the tree with the highest likelihood score used for estimating Bayesian posterior probabilities by recovered from the combined Bayesian analysis was used a majority-rule consensus procedure in PAUP. Bayesian trees for these analyses. DIVA optimizations were then conducted from the combined data were also loaded into PAUP*, and all either with an unrestricted number of areas assigned to trees supporting the monophyly of Phanaeus were filtered each node or with areas per node restricted to two, three or using the ‘filter’ command under the ‘trees’ menu and the four. following constraint [eucraniines, Coprophanaeus, Sulcopha- The literature used to help with the establishment of naeus, Oxysternon (Phanaeus)]. geographic regions (Fig. 1) included Hooghiemstra et al. (2006), Metcalfe (2006) and Perret et al. (2006). The geo- graphic areas defined for these analyses were: (A) portions Biogeography of the Guyana shield ranging from the Rio Orinoco westwards and from the Parque Nacional do Pico Neblina Distribution data were obtained from the literature eastwards; (B) Amazonia, including northern Colombia and (Edmonds, 1994, 2000; Arnaud, 2002; Edmonds & Zidek, Venezuela; (C) the caatingas of northeastern Brazil west- 2004; Ocampo, 2004, 2005) and from specimens used in the wards, the cerrado, and southwards including the campos molecular analyses. rupestre (North Bahia southwards to Serra do Ouro Bran- The distribution ranges of ancestral nodes were inferred co), distributed east of the Sa˜o Francisco river southwards using the program DIVA (Ronquist, 1996, 1997), which to the Parana river; (D) northern Argentina eastwards to the estimates ancestral distributions and differentiates puta- Parana River; (E) the Andes; (F) west of the Andes from
Fig. 1. Biogeographical areas used to delimit Phanaeus species distributions in South and Central America, Mexico and the United States.
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x 6 D. L. Price southern Ecuador, northwards through Colombia and into and endymion species groups. The splendidulus, paleano and Panama; (G) central Panama northwards to Costa Rica, bispinus groups and P. achilles, along with Oxysternon, northwards through Honduras, Nicaragua, Guatemala Coprophanaeus and S. auricollis, formed another polytomy, (except the northern Yucatan region), southern Belize sister to Phanaeus s.str. The eucraniines and S. faunus were including the Maya Mountains and into Mexico (including outside the latter assemblage. the Chiapas and the easternmost portion of Oaxaca includ- The results from the parsimony analysis of the combined ing Tehuantepec); (H) northern Belize, northern Guatemala, molecular and morphology data are shown in Fig. 2. One Mexico (including Yucatan, Quintana Roo, Campeche, most-parsimonious tree of 1865 steps (CI ¼ 0.38, RI ¼ Tabasco, Veracruz, Tamaulipas and Nuevo Leon) and 0.68) was recovered. Three hundred and thirty-six charac- southern Texas; (I) Mexico (southern Mexico, the Sierra ters were parsimony-informative. The resulting phylogeny Madre Oriental and the Sierra Madre Occidental); (J) recovered the paleano group as sister to all other phanaeine Mexico east of the Sierra Madre Occidental, including the taxa. The strict consensus yielded a well-resolved tree, Sonoran desert of Arizona; (K) the western United States although bootstrap values are low for most of the early (encompassing the southern tip of Texas to an arbitrary branches. Because the support values are so low, the location just east of Austin, northwards into eastern por- relationships among Phanaeus, Oxysternon, Sulcophanaeus tions of Oklahoma, Kansas and Nebraska); (L) the eastern and Coprophanaeus are considered unresolved. United States. Parsimony analyses constrained to recover the principal clades in Edmonds’ (1994) hypotheses of Phanaeus s.str. evolution recovered four most-parsimonious trees of 1887 Results steps (not shown). The final strict consensus, with species groups indicated, was as follows (mexicanus gr. þ beltianus Parsimony analyses gr.
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x # ora compilation Journal 08TeAuthor The 2008
Glyphoderus sterquilinus Glyphoderus sterquilinus Outgroups Anomiopsoides heteroclyta Anomiopsoides heteroclyta 100* Sulcophanaeus faunus Outgroups 100 Phanaeus kirbyi 70 S. faunus 99 P. kirbyi 100 Phanaeus kirbyi P. kirbyi # 70 P. kirbyi 100 P. paleano Paleano 80* P. kirbyi 73 P. paleano
08TeRylEtmlgclSociety, Entomological Royal The 2008 Paleano 99 P. paleano P. paleano 100 * 65 P. paleano 88 Coprophanaeus pluto P. paleano 100 100 C. pluto 59 P. splendidulus 66 C. ignecinctus P. dejeani 85 C. telamon 99* P. melibaeus C. telamon 88* P. melibaeus Splendidulus S. auricollis 100 72 92* P. haroldi Sulcophanaeus faunus Outgroups 55 P. haroldi S. faunus P. haroldi 87 Oxysternon s. spiniferum P. alvarengai 100 O. silenus P. bispinus Bispinus O. silenus Coprophanaeus pluto O. festivum 55* C. pluto 75 O. durantoni 82 C. ignecinctus 95 O. conspicillatum 87 C. telamon O. conspicillatum C. telamon 100 P. achilles S. auricollis 97 P. achilles Chalcomelas 67 Oxysternon s. spiniferum Outgroups 63 P. achilles 100 O. silenus P. achilles O. silenus P. bispinus Bispinus O. festivum 67 P. splendidulus O. durantoni P. dejeani Splendidulus 77 O. conspicillatum P. alvarengai Bispinus O. conspicillatum 100 P. haroldi 100 P. achilles 100 58 P. haroldi 95 P. achilles P. haroldi Splendidulus 58 P. achilles Chalcomelas 100 P. melibaeus P. achilles P. melibaeus 71 100 ytmtcEntomology Systematic P. endymion P. prasinus P. endymion P. prasinus Hermes P. endymion Endymion 97 P. chalcomelas P. pyrois 55 P. chalcomelas P. pyrois 58 P. lecourti Chalcomelas 100 P. prasinus 82 P. meleagris P. prasinus Hermes P. meleagris 95 P. chalcomelas 71 P. endymion P. chalcomelas 96 P. endymion P. lecourti Chalcomelas P. endymion Endymion 70 P. meleagris 49 P. pyrois P. meleagris P. pyrois 100 100 P. nimrod P. triangularis texensis Triangularis 99* P. nimrod 77 P. t. texensis 98 P. furiosus Tridens P. quadridens 58 100 P. furiosus 63 P. quadridens Quadridens P. furiosus P. quadridens
o:10.1111/j.1365-3113.2008.00443.x doi: , P. howdeni P. quadridens P. sallei Beltianus P. yecoraensis Mexicanus 94 P. lunaris 100 P. nimrod 58 P. lunaris Mexicanus 100 P. nimrod Tridens P. lunaris 98 P. furiosus 93 P. triangularis texensis 57 P. furiosus biogeography and phylogeny Phanaeus 85 P. t. texensis Triangularis P. furiosus P. quadridens 94 P. igneus 100* 100 63 P. quadridens Quadridens P. igneus Vindex P. quadridens 100 P. vindex P. quadridens P. vindex P. yecoraensis 97 P. w. wagneri 98 P. w. wagneri 91 P. amithaon 86 P. amithaon Mexicanus 83 P. amithaon 82 P. amithaon P. amithaon Mexicanus P. amithaon 63 P. lunaris 67 P. igneus 99 100 P. lunaris P. igneus Vindex 66 P. lunaris 100 P. vindex P. sallei P. vindex Beltianus 100 100 P. howdeni ABP. a. amethystinus Amethystinus P. a. amethystinus P. a. guatemalensis P. a. guatemalensis Amethystinus
Fig. 2. (A) Phylogenetic hypothesis for Phanaeus resulting from parsimony analysis of cytochrome oxidase subunit I data. Strict consensus of 38 most-parsimonious trees of 1319 steps. Numbers above branches represent bootstrap values >50%. Branches with an asterisk indicate congruence with D2 parsimony analysis. (B) Phylogenetic hypothesis for Phanaeus inferred from a parsimony analysis of the combined molecular and morphological data. Numbers above branches represent bootstrap values >50%. 7 8 .L Price L. D. ora compilation Journal
Glyphoderus sterqulinus Glyphoderus sterquilinus Outgroups Anomiopsoides heteroclyta Outgroups Anomiopsoides heteroclyta 100 Sulcophanaeus faunus 100 Phanaeus kirbyi S. faunus 86 P. kirbyi 80 100* Phanaeus melibaeus P. kirbyi Paleano 99* P. melibaeus 85 P. paleano 96* P. haroldi Splendidulus 50 P. paleano 100* P. haroldi P. paleano P. haroldi 100 Oxysternon festivum P. alvarengai 100 O. durantoni P. bispinus Bispinus 100 O .conspicillatum Outgroups 94* P. splendidulus 53 O. conspicillatum Splendidulus 100 100 P. dejeani P. bispinus Bispinus 100 P. kirbyi 90 99 P. splendidulus
# Splendidulus 83 P. kirbyi 80 P. dejeani 100* P. kirbyi P. alvarengai Bispinus
08TeRylEtmlgclSociety, Entomological Royal The 2008 Paleano 93 P. paleano 94 100 P. melibaeus P. paleano 100 P. melibaeus P. paleano 100 P. haroldi Splendidulus 66 Coprophanaeus pluto P. haroldi 77 81* C. pluto 67 P. haroldi 59 C. ignecinctus 52 Sulcophanaeus auricollis 99 C. telamon 99 S. faunus C. telamon 67 S. faunus S. auricollis 90 Outgroups 100 O. s. spiniferum 88 Oxysternon s. spiniferum 100 O. silenus Outgroups 100 O. silenus O. silenus O. silenus Coprophanaeus ignecinctus 98 O. festivum 100 100 C. pluto 84 O. durantoni 61 63 C. pluto 100 O. conspicillatum 96 C. telamon 81 O. conspicillatum C. telamon 100 P. achilles P. endymion 71 P. achilles 100 P. endymion 55 P. achilles 69 P. endymion Endymion P. achilles Chalcomelas P. pyrois 100 P. chalcomelas P. pyrois 50 P. chalcomelas 100 P. achilles 79 P. lecourti 63 P. achilles 85 99 P. meleagris P. achilles P. meleagris 98 P. achilles 100 P. prasinus 89 100 P. chalcomelas Chalcomelas P. prasinus Hermes P. chalcomelas 78 59 96 P. pyrois 93 P. lecourti P. pyrois 100 P. meleagris 59 P. endymion Endymion P. meleagris 80 P. endymion 100 P. prasinus ytmtcEntomology Systematic P. endymion P. prasinus Hermes P. triangularis texensis Triangularis P. triangularis texensis P. t. texensis 70 Triangularis 100 100 P. t. texensis 100* P. quadridens P. quadridens 50 P. quadridens Quadridens 100 P. quadridens P. quadridens 69 P. quadridens Quadridens P. quadridens P. quadridens 72 P. igneus 100 P. igneus 67 100 P. igneus 100 Vindex P. igneus Vindex 100 P. vindex 100 P. vindex P. vindex P. vindex P. nimrod 100 P. nimrod 100* P. nimrod 100 P. nimrod Tridens 95 P. furiosus Tridens 77 98 P. furiosus 54 P. furiosus 68 64 P. furiosus P. furiosus P. furiosus P. yecoraensis P. yecoraensis o:10.1111/j.1365-3113.2008.00443.x doi: , 99 P. w. wagneri 94 P. wagneri wagneri 97 P. amithaon 97 P. amithaon 84 P. amithaon Mexicanus 78 P. amithaon Mexicanus P. amithaon 57 P. amithaon 97 P. lunaris 99 P. lunaris 84 P. lunaris 72 P. lunaris P. lunaris 91 P. lunaris 57 P. sallei Beltianus 72 P. sallei P. howdeni Beltianus 100 P. howdeni P. a. amethystinus Amethystinus 100 P. amethystinus amethystinus A P. a. guatemalensis B P. a. guatemalensis Amethystinus
Fig. 3. (A) Majority rule consensus of the Bayesian maximum likelihood analysis from cytochrome oxidase subunit I data. Numbers represent posterior probabilities. Branches #
08TeAuthor The 2008 with an asterisk indicate congruence with D2 Bayesian analysis. (B) Majority rule consensus of the Bayesian maximum likelihood analysis from combined molecular and morphological data (mixed model). Numbers represent posterior probabilities. Phanaeus phylogeny and biogeography 9 the paleano group as sister to all other Phanaeini taxa rRNA (D2 region), and 67 morphological characters from (Phanaeus, and outgroups Oxysternon, Sulcophanaeus and Price (2007). COI data are confirmed as a good data source Coprophanaeus). Oxysternon festivum, O. durantoni and O. to resolve phylogenetic questions at this level. By contrast, conspicillatum were recovered as sister clade to the bispinus D2 has evolved much more slowly, and does not give much and splendidulus species groups. Phanaeus bispinus is sister information about Phanaeus relationships. Although some to the other species (90% posterior probability), and P. topological differences exist between the two genes, most of alvarengai is the sister taxon to P. melibaeus and P. haroldi the differences are not supported by high bootstrap values. (94% posterior probability). Although not supported in any The phylogenies produced from these molecular data, other analyses, P. achilles is recovered here with the although not in complete agreement with morphological chalcomelas group with 98% posterior probability. As in data (Price, 2007), are congruent in most respects. Conse- the combined parsimony tree, the mexicanus species group is quently, phylogenetic analyses were also performed on found to be polyphyletic with P. yecoraensis as sister taxon to a combined dataset. P. nimrod and P. furiosus,andP. lunaris recovered within the beltianus species group. Species groups (with two or more species) recovered as monophyletic include the paleano, Phanaeus endymion, chalcomelas, vindex, tridens and beltianus groups. Within Phanaeus s.str. there appear to be five evolutionary Based on combined analyses of COI, D2 and morpho- lineages as follows: the endymion group; the hermes and logical data, the paleano species group is sister to all other chalcomelas groups; the triangularis, quadridens and vindex phanaeine taxa. By contrast, its position in previous mor- groups; the tridens group; and the mexicanus, beltianus and phological analyses (Price, 2007) suggested that the paleano amethystinus groups. When Bayesian trees were filtered for species group was nested within the subgenus Notiopha- Phanaeus monophyly no trees were recovered. naeus. Phanaeus s.str. appears to represent a clade if the endymion and chalcomelas groups are included (89% poste- Biogeography rior probability). This, however, contradicts Edmonds’ (1994) placement of the chalcomelas and endymion groups
The DIVA analysis resulted in multiple combinations of within Notiophanaeus. optimal reconstructions. The ancestral distribution for the Edmonds (1994) placed the chalcomelas and endymion root of the tree is uncertain, but constraining the areas to groups in Notiophanaeus based on the texture of their two resulted in an ancestral distribution in the Andes (as pronotum. His primary distinction between Notiophanaeus opposed to the widespread ancestral distribution when no and Phanaeus s.str. was that in Notiophanaeus the pronota constraints were used). When no restrictions were used, and of both sexes are minutely punctate, although they appear when the maximum number of ancestral nodes was glassy smooth to the unaided eye, in contrast to the rugose restricted to three (Fig. 4), DIVA identified a total of 55 to punctatorugose sculpturing of Phanaeus s.str. However, dispersal events. Fifty-four dispersal events were identified Price (2007) questioned the position of the chalcomelas and when the maximum number of ancestral nodes was hermes groups. Here I suggest that the shape of the restricted to four. Ancestors of Notiophanaeus, as limited pronotum is perhaps more important for separating Notio- here (bispinus and splendidulus species groups), are sup- phanaeus and Phanaeus s.str. Based on the present study, all ported as having an origin in Amazonia. Biogeographical Notiophanaeus species possess spiniform projections on their scenarios are shown in Fig. 5. pronota. Pronota of Phanaeus s.str. species, on the other Oxysternon, Sulcophanaeus and Coprophanaeus, the pa- hand, are triangular to heart-shaped, without spiniform leano species group, Notiophanaeus as here restricted, and projections, and are comparatively flat, except in the tridens the chalcomelas species group are largely restricted to the group and in some species of the mexicanus group. In the Andes and regions east of the Andes. Only five species have present study, Notiophanaeus consists of the bispinus and penetrated northwest South America and Central America: splendidulus groups (67% parsimony bootstrap; 90% pos- P. pyrois, O. conspicillatum, O. silenus, C. pluto and C. terior probability), although relationships with outgroup telamon. The tridens, triangularis, quadridens and vindex genera can be proposed only tentatively owing to low species groups and P. yecoraensis make up a clade that support values. The data presented here support the mono- originated in Mexico and have since dispersed throughout phyly of Phanaeus s.str.; Notiophanaeus, in the restricted that country and much of the United States. The mexicanus, sense proposed here, probably deserves genus status, as all beltianus and amethystinus species groups form a clade that of the current analyses recover this clade and suggest that it has dispersed back into Central and South America. is not sister to Phanaeus s.str. (see Table 3 for a breakdown of the past and currently proposed taxonomy). With the exception of the bispinus, chalcomelas and mexicanus groups, Edmonds’ (1994) species groups are Discussion recovered as monophyletic. In several analyses, Price (2007) recovered the bispinus group either in a polytomy In this study, the systematics of the genus Phanaeus was with the splendidulus group, or inside the splendidulus group analysed using the subunit cytochrome oxidase I (COI), 28S (all with less than 50% bootstrap support). However, the
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x 10 D. L. Price
D Glyphoderus sterqulinus D Outgroups D Anomiopsoides heteroclyta BCE Phaneaus paleano BDE paleano BCD/DE/ CE P. kirbyi CDE ABCEF Oxysternon conspicillatum BCE B E/BE/CE B AB O. festivum Outgroups AB B O. durantoni E ABE P. bispinus bispinus B C C P. splendidulus splendidulus C P. dejeani 1b BC B P. alvarengai bispinus B B ABE P. haroldi 1a BE splendidulus BC P. melibaeus ABCE Sulcophanaeus faunus E E S. auricollis E ABEF O. silenus E Outgroups ABE O. s. spiniferum E GH Coprophanaeus pluto EGH BEFGH EG/EH E C. telamon B C. ignecinctus EFG GHI P. endymion E endymion G/EG/EH/EFH/EGH/EI/EFI/EGI/EHI EFG P. pyrois BE P. prasinus hermes E E P. achilles 2 E EGI ABE P. chalcomelas E/EG E chalcomelas BE E P. meleagris BE P. lecourti IKL P. triangularis texensis triangularis 3a EI I I I P. quadridens quadridens IL 3c IKL L P. igneus I vindex L/IL/I JL I JKL P. vindex I P. yecoraensis mexicanus I I P. nimrod 3b I I tridens I J P. furiosus I J P. amithaon FI FG P. w. wagneri mexicanus 4 FGI FI J F GI/GI J EF F P. lunaris FG F P. howdeni FH/FGH beltianus GH P. sallei G G P. a. amethystinus amethystinus G P. a guatemalensis
Fig. 4. Ancestral area reconstruction from the DIVA analysis mapped onto the most likely tree ( 9667.446) recovered from the Bayesian analysis of combined molecular and morphological data. Letters above the branches are optimized ancestral areas when the maximum number of areas is constrained to three. Letters below the branches represent alternative, equally parsimonious scenarios. Letters in square boxes correspond to the biogeographical scenarios shown in Fig. 5. bispinus group is clearly distinct morphologically from the mexicanus group, is recovered as closest to the beltianus splendidulus group in the shape of the male pronotum: males group. of both P. bispinus and P. alvarengai have convex pronota Edmonds (1994) did not present a phylogeny, but his with two short medial spiniform processes projecting evolutionary, ecogeographic hypotheses clearly imply the towards the head. The splendidulus group, by contrast, has following relationships: {Outgroups (Notiophanaeus)[(tri- concave pronota with lateral spiniform processes. angularis gr., tridens gr., hermes gr.)(quadridens gr., ame- The mexicanus group is morphologically and geograph- thystinus gr.)(mexicanus gr., beltianus gr.)(vindex gr.)]}. As ically similar to the tridens group (Edmonds, 1994). In both already mentioned, the data presented in this study suggest the parsimony and the Bayesian combined analyses, the following relationships (hermes gr., chalcomelas gr.)((en- P. yecoraensis (mexicanus group), a recently described dymion gr.)(((vindex gr.)((triangularis gr., quadridens gr.)(tri- species (Edmonds, 2004), is recovered with the tridens dens gr.)))((amethystinus gr.)((mexicanus gr., beltianus group. Furthermore, P. lunaris, a species Edmonds (1994) gr.)))). Within Phanaeus s.str., Edmonds’ hypotheses re- regarded as taxonomically isolated from other species in the garding the mexicanus and beltianus groups are in agreement
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x Phanaeus phylogeny and biogeography 11
Fig. 5. Biogeographical scenarios based on the DIVA analysis when the maximum number of areas is restricted to three. Top left figure is coordinated with nodes 1A and B in Fig. 4; top right – node 2; bottom left – nodes 3A, B and C; bottom right – node 4.
with the present study. In this study, the ancestral distribu- Bayesian analyses of COI and of the combined molecular tion for the hermes group is in the Andes, and this group is and morphological data both suggest that Oxysternon is recovered as sister to the chalcomelas group, also an Andean a polyphyletic genus with two clades: one consisting of O. species group. Phanaeus quadridens (quadridens group) is festivum, O. durantoni and O. conspicillatum; and the second recovered as the sister taxon to P. triangularis texensis consisting of O. spiniferum spiniferum and O. silenus nested (triangularis group), both of which have ancestral distribu- inside Sulcophanaeus. Parsimony analyses, however, recov- tions in Mexico. Phanaeus amethystinus (amethystinus ered a monophyletic (COI) or paraphyletic (combined data) group), by contrast, has an ancestral distribution in Central Oxysternon. According to Edmonds (1972) and Edmonds & America, and is sister to the mexicanus and beltianus groups Zidek (2004), Oxysternon is presumed to be monophyletic (Edmonds’ third lineage). The phylogenetic hypotheses based on three synapomorphic morphological characters from this study provide evidence against Edmonds’s ecogeo- (posterior median angle of pronotum acutely produced graphic hypotheses. between basal angles of elytra, long spiniform extension of the anterior angle of the metasternum, fifth abdominal sternum impressed). Price (2007) also found Oxysternon to Oxysternon, Sulcophanaeus and Coprophanaeus be monophyletic, although nested well within Phanaeus. Sulcophanaeus is recovered as polyphyletic in all COI Because no trees were recovered when the Bayesian trees analyses, although D2 analyses recovered a monophyletic were filtered for trees supporting the monophyly of Phanaeus, Sulcophanaeus. According to Edmonds (2000), no identified these analyses suggest that Phanaeus is not monophyletic synapomorphies define this genus, and Sulcophanaeus is best unless it is defined to include Oxysternon, Coprophanaeus and interpreted as a polyphyletic grouping of survivors placed in at least some Sulcophanaeus. In contrast to these findings, at least four clades. Philips et al. (2004a) further confirmed recent studies that have examined the phylogeny of Phanaeini that Sulcophanaeus is not monophyletic. Although Sulco- (Philips et al., 2004a) and the phylogeny of Scarabaeinae phanaeus is represented by only two species in the present (Philips et al., 2004b; Monaghan et al., 2007) suggest that study, this research indicates that COI and D2 may have Phanaeus is monophyletic and sister to Oxysternon. different evolutionary histories. Further molecular evidence
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x 12 D. L. Price
Table 3. Previous taxonomy of species groups versus current Biogeography hypotheses. The age of the common ancestor of Phanaeini is Edmonds’s (1994) speculative, but phanaeines probably evolved in South hypothesis Price (2007) Present study America after the late Mesozoic separation from Africa Outgroups Outgroups Outgroups (Philips et al., 2004). Fossilized brood balls attributed to Anomiopsoides Anomiopsoides Anomiopsoides scarabs, including phanaeines, have been found in various Glyphoderus Glyphoderus Glyphoderus Tertiary deposits in southern Argentina (cited in Frenguel- a Coprophanaeus Coprophanaeus paleano species gr. li, 1938, 1939; Edmonds, 1972). These balls indicate the b Sulcophanaeus Sulcophanaeus Oxysternon presence of phanaeines or their ancestors in southern Oxysternon South America at least 28.5 million years ago (Ma) Phanaeus (genus) Phanaeus (genus) Notiophanaeus (genus) (F. C. Ocampo, personal communication, 2006). Extant Notiophanaeus Notiophanaeus bispinus gr. (subgenus) (subgenus) splendidulus gr. species of Phanaeus are distributed in three main geo- splendidulus gr. Oxysternon Sulcophanaeusb graphic areas. Dispersal-vicariance reconstruction indi- chalcomelas gr. splendidulus gr. Coprophanaeus cates that the Andes are probably the ancestral area of bispinus gr. bispinus gr. Phanaeus (genus) the genus Phanaeus. Dispersal from the Andes into Ama- paleano gr. paleano gr. endymion gr. zonia was followed by a vicariance event. Within Notio- endymion gr. chalcomelas gr. hermes gr. phanaeus (as presented here), further dispersal occurred Phanaeus s.str. endymion gr. chalcomelas gr. from Amazonia into southern Brazil and northwards into (subgenus) hermes gr. triangularis gr. the Guianas region. Oxysternon and Sulcophanaeus have hermes gr. Phanaeus s.str. quadridens gr. undergone similar expansions. Coprophanaeus, by con- tridens gr. (subgenus) vindex gr. trast, moved northwestwards into Central America. triangularis gr. tridens gr. tridens gr. mexicanus gr. triangularis gr. mexicanus gr. The earliest representatives of Phanaeus s.str. probably beltianus gr. mexicanus gr. beltianus gr. arrived in Mesoamerica during the Miocene (23–5 Ma), when amethystinus gr. beltianus gr. amethystinus gr. the physiographic diversification of Central America and quadridens gr. amethystinus gr. Mexico was just beginning (Edmonds, 1994). Studies on other vindex gr. quadridens gr. dung beetle genera (i.e. Ateuchus, Canthon, Boreocanthon, vindex gr. Melanocanthon) suggest that there have been two main incur- sions of scarabaeines from South America into Mesoamerica: aRequires new generic name if position confirmed. bPossibly polyphyletic. one during the Miocene and the other following the final establishment of the Central America landbridge during the late Pliocene and early Pleistocene (Kohlmann & Halffter, using several genes of different evolutionary rates may be 1988, 1990). Portions of the landbridge between South useful in clarifying relationships within the genus (Philips America and Mexico were present during the middle of the et al., 2004a). Miocene (15–16 Ma), although the northwest portion of Coprophanaeus, a monophyletic group in these analyses, South America (biogeographical region F), as indicated in was recovered as sister taxon to Phanaeus s.str. in the Fig. 1, was still probably deep ocean. By the late Pliocene Bayesian analyses of combined data. In parsimony analyses, (c. 3 Ma), much of the landbridge was present, including however, Coprophanaeus was recovered as sister to Sulco- portions of northwestern South America and Panama (Cox & phanaeus. Interestingly, in a monograph on the phanaeine Moore, 2000). Fossil Phanaeus are limited to two species: species, Olsoufieff (1924) classified Sulcophanaeus and Cop- Phanaeus antiquus Horn, 1876, and Phanaeus labreae Pierce, rophanaeus as subgenera within Phanaeus, although, upon 1946 (Krell, 2007). These records are in agreement with the later examination, Edmonds (1972) raised these taxa to evolutionary hypotheses presented in this manuscript. genus level. Edmonds (1972) was the first to publish Edmonds (1994) hypothesized that the endymion group a topology of hypothesized generic relationships within represents a recent invasion of Notiophanaeus into Middle the phanaeines, although his hypothesis suggested a basal America. The scenario presented here suggests that ancestors polytomy as follows [(Oxysternon, Phanaeus)(Sulcopha- of the endymion group were the first of the Phanaeus s.str. to naeus)(Diabroctis)(Coprophanaeus, Dendropaemon, Tetra- invade Middle America. Ancestors of the tridens (including meria, Megatharsis)]. In their examination of the P. yecoraensis from Edmonds’ mexicanus group), triangularis, Phanaeini, Philips et al. (2004a) recovered an equally quadridens and vindex groups represent the second wave of weighted tree with Bolbites, Diabroctis, Oxysternon, Pha- Mesoamerican invaders, and most extant species are now naeus and Sulcophanaeus in a polytomy with another clade endemic to Mexico and the United States. Species groups that including Coprophanaeus. Additional weighted schemes have dispersed back into Central and South America include recovered Sulcophanaeus and Oxysternon þ Phanaeus as the mexicanus, beltianus and amethystinusgroups. monophyletic. The evolutionary relationships among the Tropical South America is home to a rich fauna of dung Phanaeini require further examination with more data and beetles, including a number of large species with ecological several species from each of the 12 genera, including species requirements similar to those of Notiophanaeus. Hence, the from each of the proposed species groups. extensive radiation of Phanaeus s.str. in Mesoamerica could
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x Phanaeus phylogeny and biogeography 13 have been favoured in great part by the scarcity of potential References competitors. The rich Miocene–Pliocene fauna of large mammals is presumed to have supported the original Arnaud, P. (1997) Description d’une nouvelle espe` ce de Phanaeus invasion of Phanaeus (Edmonds, 1994). (Col. Scarabaeidae). Besoiro, 3, 6–7. The mountains of Mexico and Central America are cur- Arnaud, P. (2000) Descriptions de nouvelles espe` ces de Phanaeini. rently recognized as regions of high levels of diversification Besoiro, 5, 6–8. Arnaud, P. (2001) Description de nouvelles espe` ce de Phanaeides. and endemism for flora and fauna, including insects, Besoiro, 6, 2–8. herpetofauna, birds and mammals (Leon-Paniagua et al., Arnaud, P. (2002) The Beetles of the World, Vol. 28: Phanaeini. 2007). Halffter (1987) attributes this rich diversity partly to Hillside Books, Canterbury. the great variety of environments and ecological refuges Bennett, C.F. (1969) Human Influences on the Zoogeography of available in the zone and partly to adequate routes for Panama. University of California Press, Berkeley, CA. dispersal of faunas of different origin, ranging from cold- Blanchard, C.E. (1845) Insectes, Voyage dans I’Amerique Me´ridionale temperate mountain to humid tropical corridors. (ed. by A. d’Orbigny), vol. 6, pt. 2, pp. 61–222. Paris & Strasbourg. Currently, the extant fauna of Phanaeus is richer in North Cox, C.B. & Moore, P.D. (2000) Biogeography an Ecological and and Central America (32 species) than it is in South America Evolutionary Approach, 6th edn. Blackwell Science, London. (19 species). The survival of Phanaeus during the Pleistocene Delgado-Castillo, L. (1991) A new Mexican species of Phanaeus. Opscula Zoologica Fluminensia, 68, 1–6. extinctions may be attributable to their generalist feeding Edmonds, W.D. (1972) Comparative skeletal morphology, system- habits and to their ability to reproduce in a variety of atics, and evolution of the Phanaeine dung beetles (Coleoptera: ecological habitats. Edmonds (1994) argued that the mod- Scarabaeidae). The University of Kansas Bulletin, 49, 731–874. ern distribution of Phanaeus has been strongly influenced by Edmonds, W.D. (1994) Revision of Phanaeus Macleay, a new world humans. In Mexico, the presence, and increasing popula- genus of scarabaeine dung beetles (Coleoptera: Scarabaeidae, tion, of humans (and livestock) as early as 650 AD was Scarabaeinae). Contributions in Science, Natural History Museum important not only as a source of food but also as the cause of Los Angeles County, 443, 1–105. of habitat changes that favoured the expansion of species Edmonds, W.D. (2000) Revision of the Neotropical dung beetle preferring open habitats. The phylogenies presented here genus Sulcophanaeus (Coleoptera: Scarabaeidae: Scarabaeinae). support Edmonds’ (1994) idea that species groups found in Folia Heyrovskyana, 6, 1–60. Edmonds, W.D. (2004) A new species of Phanaeus Macleay Mexico and Central America are actively evolving. Addi- (Coleoptera: Scarabaeidae, Scarabaeinae) from Sonora, Mexico. tional molecular studies focusing on the Pliocene–Pleisto- The Coleopterists Bulletin, 58, 119–224. cene radiation in Mexico may provide insight into, for Edmonds, W.D. (2006) A new species of Phanaeus Macleay example, how and why some species in the mexicanus group (Coleoptera: Scarabaeidae: Scarabaeinae: Phanaeini) from Oaxa- have migrated back into Central and South America, and ca, Mexico. Zootaxa, 1171, 31–37. into their morphological evolution (for example, some Edmonds, W.D. & Zidek, J. (2004) Revision of the Neotropical species within the mexicanus group have male pronotal dung beetle genus Oxysternon (Coleoptera: Scarabaeinae: Pha- features that are not typical of Phanaeus s.str.). naeini). Folia Heyrovskyana, 11, 1–58. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783–791. Frenguelli, J. (1938) Bolas de escarabaeoides y nidos de vespidos Acknowledgements fosiles. Physis, 12, 348–352. Frenguelli, J. (1939) Nidos fosiles de insectos en el Tercario de Neuquen I would like to thank Michael May, Karl Kjer, Lena Struwe yRioNegro.Notas Museo La Plata, Paleontologia, 18, 379–393. and Doug Tallamy for discussions and comments on this Gillespie, J., Cannone, J., Gutell, R. & Cognato, A. (2004) A paper. I also thank W.D. Edmonds for discussions and secondary structural model of the 28S rRNA expansion segments D2 and D3 from rootworms and related leaf beetles (Coleoptera: comments. I thank several people who have helped me along Chrysomeldae; Galerucinae). Insect Molecular Biology, 13, the way, including Jessica Ware (Rutgers University), John 495–518. LaPolla (Towson University) and Jeremy Huff (AMNH). I Gu, X., Fu, Y.-X. & Li, W.-H. (1995) Maximum likelihood estima- am grateful to the following people who provided me with tion of the heterogeneity of substitution rate among nucleotide specimens for sequencing: W.D. Edmonds (Marfa, TX), sites. Molecular Biology and Evolution, 12, 546–557. Francois Genier (CMN, Ottawa, Canada), Sacha Spector Halffter, G. (1987) Biogeography of the montane entomofauna of (AMNH, New York, NY), Trond Larsen (Princeton Univer- Mexico and Central America. Annual Review of Entomology, 32, sity, Princeton, NJ), Kevina Vulinec (Delaware State Univer- 95–114. sity, Dover, DE), Barney Streit (Tucson, AZ), Conrad Gillett Hooghiemstra, H., Wijninga, V.M. & Cleef, A.M. (2006) The paleo- (NHM, London, U.K.), Kyle Beucke (University of Flori- botanical record of Colombia: implications for biogeography and biodiversity. Annals of the Missouri Botanical Garden, 93, 297–324. da, FL) and Christopher Marshall (Oregon State Univrsity, Hulsenbeck, J.P. & Ronquist, F. (2001) MRBAYES 3: Bayesian OR). I also thank Federico Ocampo for providing me with inference of phylogeny. Bioinformatics, 17, 754–755. eucraniine sequences, Scott Haag (Rutgers University) for Kjer, K.J. (1995) Use of rRNA secondary structure in phylogenetic creating and providing a biogeography map, and Frederick studies to identify homologous positions: an example of align- Ronquist for providing help with DIVA. Lastly, I thank ment and data presentation from the frogs. Molecular Phyloge- Michael May for providing the funds for this project. netics and Evolution, 4, 314–330.
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x 14 D. L. Price
Kohlmann, B. & Halffter, G. (1988) Cladistic and biogeographical Philips, T.K., Edmonds, W.D. & Scholtz, C.H. (2004a) A phyloge- analysis of Ateuchus (Coleoptera: Scarabaeidae) of Mexico and netic analysis of the New World tribe Phanaeini (Coleoptera: the United States. Folia Entomologica Mexicana, 74, 109–130. Scarabaeidae: Scarabaeinae): hypotheses on relationships and Kohlmann, B. & Halffter, G. (1990) Reconstruction of a specific origins. Insect Systematics and Evolution, 35, 43–63. example of insect invasion waves: the cladistic analysis of Philips, T.K., Pretorius, E. & Scholtz, C.H. (2004b) A phylogenetic Canthon (Coleoptera: Scarabaeidae) and related genera in North analysis of dung beetles (Scarabaeinae: Scarabaeidae): unrolling America. Quaestiones Entomologicae, 26, 1–20. an evolutionary history. Invertebrate Systematics, 18, 53–88. Kohlmann, B. & Solis, A. (2001) A new species of Phanaeus Posada, D. & Buckley, T. (2004) Model selection and model Macleay from Costa Rica and Panama. Besoiro, 6, 9–11. averaging in phylogenetics: advantages of Akaike information Krell, F.T. (2007) Catalogue of Fossil Scarabaeoidea (Coleoptera: criterion and Bayesian approaches over likelihood ratio tests. Polyphaga) of the Mesozoic and Tertiary, Version 2007. Denver Systematic Biology, 53, 793–808. Museum of Nature and Science Technical Report No. 2007-8,1–79. Posada, D. & Crandall, K.A. (1998) Modeltest: testing the model of Leon-Paniagua, L., Navarro-Siguenza, A.G., Hernandez-Banos, B.E. & DNA substitution. Bioinformatics, 124, 817–818. Morales, J.C. (2007) Diversification of the arboreal mice of the genus Price, D.L. (2007) A phylogenetic analysis of the dung beetle genus Habromys (Rodentia: Cricetidae: Neotominae) in the Mesoamerican Phanaeus (Coleoptera: Scarabaeidae) based on morphological highlands. Molecular Phylogenetics and Evolution, 42, 653–664. data. Insect Systematics and Evolution, 38, 1–18. Metcalfe, S.E. (2006) Late quaternary environments of the northern Ronquist, F. (1996) Reconstructing the history of host-parasite deserts and central transvolcanic belt of Mexico. Annals of the associations using generalised parsimony. Cladistics, 11, 73–89. Missouri Botanical Garden, 93, 258–273. Ronquist, F. (1997) Dispersal-vicariance analysis: A new approach Minin, V., Abdo, Z., Joyce, P. & Sullivan, J. (2003) Perform- to the quantification of historical biogeography. Systematic ance-based selection of likelihood models for phylogeny estima- Biology, 46, 195–203. tion. Systematic Biology, 52, 674–683. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, Monaghan, M.T., Inward, D.J.G., Hunt, T. & Vogler, A.P. (2007) P. (1994) Evolution, weighting, and phylogenetic utility of A molecular phylogenetic analysis of the Scarabaeinae (dung mitochondrial gene sequences and a compilation of conserved beetles). Molecular Phylogenetics and Evolution, 45, 674–692. polymerase chain reaction primers. Annals of the Entomological Ocampo, F.C. (2004) Food relocation behavior and synopsis of the Society of America, 87, 651–701. southern South America genus Glyphoderus Westwood (Scara- Swofford, D.L. (1999) PAUP*: Phylogenetic Analysis using Parsi- baeidae: Scarabaeinae: Eucraniini). The Coleopterists Bulletin, 58, mony, Version 4. Sinauer, Sunderland, MA. 295–305. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Ocampo, F.C. (2005) Revision of the southern South American Higgins, D.G. (1997) The ClustalX windows interface: flexible endemic genus Anomiopsoides Blackwelder, 1944 (Coleoptera: strategies for multiple sequence alignment aided by quality Scarabaeidae: Scarabaeinae: Eucraniini) and description of its food analysis tools. Nucleic Acids Research, 24, 4876–4882. relocation behaviour. Journal of Natural History, 39, 2537–2557. Westwood, J. O. (1837) Illustrations of Exotic Entomology, Ocampo, F.C. & Hawks, D. (2006) Molecular phylogenetics and Containing Upwards of Six Hundred and Fifty Figures and evolution of the food relocation behavior of the dung beetle tribe Descriptions of Foreign Insects, Interspersed with Remarks and Eucraniini (Coleoptera: Scarabaeidae: Scarabaeinae). Inverte- Reflections on their Nature and Properties, Vol. 1. H.G. Bohn, brate Systematics, 20, 557–570. London. Olsoufieff, G. (1924) Les Phanaeides (Col. Lamel.), Famille Scar- Yang, Z. (1994) Estimating the pattern of nucleotide substitution. abaeidae – Tr Coprini. Insecta, 13, 4–172. Journal of Molecular Evolution, 39, 105–111. Perret,M.,Chautems,A.&Spichiger,R.(2006)Dispersal– Yang, Z., Goldman, N. & Friday, A.E. (1994) Comparison of vicariance analyses in the Tribe Sinningieae (Gesneriaceae): a clue models for nucleotide substitution used in maximum estimation. to understanding biogeographical history of the Brazilian Molecular Biology and Evolution, 11, 316–324. Atlantic Forest. Annals of the Missouri Botanical Garden, 93, 340–358. Accepted 15 May 2008
# 2008 The Author Journal compilation # 2008 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/j.1365-3113.2008.00443.x