1305.Full.Pdf

Vol. 4, 1305-1314, May 1998 Clinical Cancer Research 1305

Bryostatin 1 Down-Regulates mdrl and Potentiates Vincristine Cytotoxicity in Diffuse Large Cell Lymphoma Xenografts1

Ayad M. Al-Katib,2 Mitchell R. Smith, competitive reverse transcription-PCR assay revealed de- William S. Kamanda, George R. Pettit, creased mdrl RNA expression 24 h after Bryol treatment. These findings taken together indicate that Bryol-induced Mohammed Uamdan, Anwar N. Mohamed, down-regulation of mdrl might be one mechanism by which Bhadrani Chelladurai, and Ramzi M. Mohammad Bryol potentiates VCR activity. The sequential use of both Division of Hematology and Oncology, Department of Internal agents resulted in clinically significant antitumor activity in Medicine, Wayne State University School of Medicine, Detroit, this lymphoma model. Michigan482ol [A.M.A-K., M.H., A.N.M., B.C., R.M.M.]; Department of Medical Oncology, Fox Chase Cancer, Philadelphia. Pennsylvania 19027 [M. R. S.]: Department of Medicine, Michigan INTRODUCTION State University, Eist Lansing, Michigan 48824-1317 [W. S. K.l; and Expression of the mdr gene (,ndrl ) has been shown in a Cancer Research Institute and Department of Chemistry, Arizona State University, Tmpe. Arizona 85287-2404 [G. R. P.] wide variety of human tumors and normal tissues ( 1 ). This gene is differentially expressed in normal tissues, particularly along the secretory epithelium of the bowel, bile canaiicuii, tubular ABSTRACT epithelium of the kidney, and pancreatic small ductule epithe- The down-regulation of multidrug resistance (mdrl) hum (2). Moreover, it is highly expressed in adrenal gland, gene expression as detected by competitive reverse tran- placenta, capillary endothelium of the brain and testis, as well as scription-PCR and the antitumor activity of bryostatin 1 hematopoietie precursors and lymphocytes (3-5). The gene en- (Bryol) are investigated in a newly established cell line from codes a Mr 170,000 transmembrane glycoprotein (Pgp: Ref. 6). a patient with relapsed diffuse large cell lymphoma (DLCL). The expression pattern of indrl has suggested that Pgp might be The cell line (WSU-DLCL2) grows in liquid culture and involved in the secretion of metabolites and toxic substances forms s.c. tumors in mice with severe combined immune into the excretory pathways of bile, urine, and gastrointestinal deficiency. WSU-DLCL2 is a mature B-cell line (IgGX) that tract (3, 7). Within human tumors, mdrl expression is high in is negative for EBV nuclear antigen, expresses the multidrug solid tumors arising from tissues that are known to have a high resistance phenotype, and has t(14;18)(q32;q21) plus other level of expression, such as carcinoma of the colon, kidney, chromosomal aberrations. Exposure of the WSU-DLCL2 adrenal gland, and pancreas (I, 8). In lymphoma, indrl is cells to Bryol in culture reversed the multidrug resistance generally expressed in 20% or fewer eases at presentation and in phenotype within 24 h. A functional assay revealed a 4-fold 50-65% of relapsed or refractory cases (9, 10). The expression increase in [3H]vincristine accumulation in Bryol-treated of this mdr phenotype is shown to be associated with poor cells compared with control. Vincristine (VCR), doxorubi- prognosis and resistance to chemotherapy ( II ). Such resistance cm, Bryol, and 1-1-D-arabinofuranosylcytosine showed no is due to decreased intracellular accumulation of cytotoxic clinically significant activity when given alone to WSU- agents, resulting from the Pgp-mediated efflux mechanism (12). DLCL2-bearing severe combined immune deficiency mice. Because of the clinical relevance of the ndrl function, However, when given 24 h before each cytotoxic agent, attempts at interfering with the Pgp mechanism are being made. Bryol substantially increased the antitumor activity of VCR Several compounds are capable of reversing the drug efflux but not 1-1-D-arabinofuranosylcytosine. There was a statis- mechanism by binding with Pgp (13). The doses of such com- tically significant (P < 0.001) decrease in the expression of pounds required to achieve clinical effect have been prohibitive P-glycoprotein in WSU-DLCL2 tumors taken from Bryol- due to toxicity (14). No agents have yet been reported to treated animals compared with untreated controls. In vivo, a interfere with the indrl mechanism through down-regulation of gene expression. Bryol, a macrocyclie lactone and a natural marine product, is isolated from the marine byrozoan Bugula neritina. It has antitumor, immune modulating, and differenti- Received 9/26/96: revised 1/29/98: accepted 2/18/98. ating effects on a number of B-cell lymphomas ( 15- 17). Previ- The costs of publication of this article were defrayed in part by the ously, we have shown that Bryol augments the inhibitory effect payment of page charges. This article must therefore be hereby marked of VCR in WSU-DLCL2 in vitro ( I 8). The use of RT-PCR advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. allows for the amplification of individual RNA molecules. The

I Supported by Grant CA50715 from the National Cancer Institute, the Stephen Brandt Fund for Cancer Research, the Ayad Al-Katib Cancer Research Fund, and the Janice Charach Epstein Research Fund of Harper Hospital. Flow cytometry was performed at the core facility of the Karmanos Cancer Institute and was supported by Grant CA 22453. 3 The abbreviations used are: mdr, multidrug resistance: Pgp, P-glyco- 2 To whom requests for reprints should be addressed, at Division of protein; Bryol, bryostatin I ; RT-PCR. reverse transcription-PCR: Hematology and Oncology, Wayne State University School of Medi- DLCL, diffuse large cell lymphoma; FCM, flow cytometric analysis; cine, P. 0. Box 02143, Detroit, MI 48201. Phone: (313) 745-9082; Fax: CIg. cytoplasmic Ig; SCID, severe combined immune deficiency: VCR, (313) 993-0307. vincristine: Ara-C, I -3-D-arabinofuranosylcytosine.

method has been shown to be 1,000-10,000-fold more sensitive cm. Cells were then cultured in a 25-crn2 flask and incubated in compared with the RNA blot techniques. The ultrasensitivity of a humidified 5% CO2 atmosphere at 37#{176}C.The medium was RT-PCR makes it unique in detecting mRNA in small number partially replaced as needed until steady cell growth was noted. of cells or in small amounts of tissue and mRNA level in mixed After establishment, cells were adapted to grow in RPMI 1640 cells. In competitive PCR, a DNA fragment containing the same with 10% fetal bovine serum and designated as WSU-DLCL2. primer template sequences as the target competes for primer No growth factors, rnitogens, or EBV were added to the cell binding and amplification. The PCR products are distinguished culture medium. by size, hybridization. or change in a restriction site. Competi- Immunophenotyping of WSU-DLCL2. The fresh pleu- tive RT-PCR can be used to obtain quantitative information of ral fluid cells, the established cell line, and the s.c. xenograft mRNA levels comparable with traditional RNA blot techniques, cells underwent immunophenotyping by FCM on a FACScan with the added advantages of PCR. (Beeton Dickinson Immunodiagnosties, San Jose, CA) as de- In this study, we present evidence that Bryol decreases the scribed previously (17). Monoclonal antibodies used in this Pgp and ,ndrl RNA expression of a human lymphoma, and that study were as follows: anti-CD1O, CDI9, CD2O, CD22, HLA- this down-regulation is associated with increased tumor re- DR, and LeulO for B lineage; and CD2, CD5, and CD8 for T sponse to the Vinca alkaloid VCR. lineage. All monoelonal antibodies were obtained from Becton Dickinson. For CIgs, cells were treated with saponin (0.25%) and paraforrnaidehyde (I %), prior to staining as described pre- PATIENT, MATERIALS, AND METHODS viously (21). Assay for the EBV nuclear antigen was kindly Case Report. A white male, S. B., was diagnosed in performed by the EBV laboratory at the Joseph Stroke Research 1989, at age 40, with non-Hodgkin’s lymphoma. He presented Institute (Philadelphia, PA). with abdominal discomfort and was found to have left lower Xenografts. Four-week-old female Fox Chase C.B. 17 quadrant mass on physical examination and computerized to- SCID mice were obtained from Taconic Laboratory (German- mography. Exploratory laparotomy revealed lymphadenopathy town, NY). The animals became adapted, and WSU-DLCL2 throughout the small bowel mesentery, retroperitonium, and xenografts were developed as described previously (22). Each thickening of portions of the small bowel wall. Histopatholog- mouse received l0 WSU-DLCL2 cells (in serum-free RPMI ical examination showed malignant lymphoma, the diffuse large 1640) s.c. in each flank area. When s.c. tumors developed, mice cell non-cleaved type of intermediate grade. This lymphoma were sacrificed, and tumors were dissected and rneehanically was felt to represent transformation of follicular small cleaved dissociated into single-cell suspension. Mononuclear cells were cell (low grade), which was still identifiable in the intestinal separated by Ficoll-Hypaque density centrifugation and washed wall. Immunoperoxidase staining on frozen tissue revealed the twice with RPMI 1640. These cells were subjected to pheno- majority of the cells to be monoclonal B-cells (K- X+). The typic and karyotypic analyses for comparison with the estab- patient received six cycles of cyclophosphamide (750 mg/rn2 lished tumor line to insure the human origin and its stability. For iv), doxorubicin (50 mg/rn2 iv), VCR (1.4 rng/m2 iv), and the subsequent drug-efficacy trials, small fragments of the prednisone (40 mg/rn2 po, days 1-5; Ref. 19) and achieved WSU-DLCL2 xenograft (-30 mg) were transplanted s.c. into complete remission. However, 3 months later, the abdominal sirnilarly conditioned animals, using a 12-gauge trocar. Mice rnass recurred. At that time, the patient received radiation ther- were checked three times every week for tumor development. apy in preparation for bone marrow transplantation. While on Once palpable tumors developed, groups of five animals were radiation, new evidence of disease was seen in the abdomen and removed randomly for different treatments and a control. Each lung with a pleural effusion. S. B. received further chernother- experimental group received iv. injection of cytotoxic agents apy with cyclophosphamide (650 mg/rn2 iv), doxorubicin (25 via a tail vein every fourth day for a total of three doses. For rng/m2 iv), and etoposide (120 mg/rn2 iv) on day 1; prednisone Bryol, the injections were given i.p. The combination groups (60 rng/rn2 po) on days 1-14; and l--D-arabinofuranosyley- were treated sequentially with Bryol i.p. followed 24 h later by tosine (300 mg/rn2 iv), bleomycin (5 U/rn2 iv), VCR (1.4 mg/rn the cytotoxic agent as described previously (22) and as shown in

2 iv), and methotrexate ( 120 mg/rn2 iv, followed by leucovorin Table 2. Animals were observed for measurement of s.c. tumors, rescue) on day 8 (Promace-CytaBOM; Ref. 20). After one cycle, changes in weight, and side effects of the drugs and were the patient received high-dose cyclophosphamide and total body euthanized when their total tumor burden reached 2400 mg to irradiation, followed by autologous stem cell rescue in April of avoid discomfort. All studies involving mice were performed 1990. Unfortunately, the disease progressed 5 weeks later with under Institutional Review Board-approved protocol. Tumor GI involvement and pleural effusions, from which the cell line weights in SCID mice were plotted against time on a semilog WSU-DLCL2 was established. The patient expired shortly af- sheet. The growth pattern was close to an S-shape. Tumor terward of progressive disease -14 months from the time of doubling (Td) is the time (in days) required for tumor to double diagnosis. its weight during the exponential growth phase. Establishment of the Cell Line. Mononuclear cells were Assessment of Tumor Response. The end points for isolated by Ficoll-Hypaque (Pharmacia Fine Chemicals, Pisca- assessing antitumor activity were according to standard proce- taway, NJ) density centrifugation of the malignant pleural effu- dures used in our laboratories (22) and as follows: tumor weight

sion. Cells were washed twice with HBSS and resuspended at a (mg) = (A X B2)/2, where A and B are the tumor length and concentration of approximately 5 X 106 cells/rnl in RPMI 1640 width (in mrn), respectively; Tumor growth inhibition (T/C) is containing 20% heat-inactivated fetal bovine serum, 1 % L- the median tumor weight in the treated group (I) when the glutamine. 100 units/mb penicillin 0, and 100 i.g/rni streptomy- median tumor weight in the control group (C) reached - I 500

Table 1 Phenotypic characterization of the DLCL tumor#{176} injections of Bryol, followed 24 h later by removal of tumors

Pleural Established WSU- WSU-DLCL2 for rndrl assays. This design provided the opportunity to ana- Marker fluid DLCL2 line SCID xenograft lyze multiple tumor samples and determine the consistency of the findings. Reverse transcription was earned out per the man- CD1O ND” 86.8 ± 3.3 88.5 ± 7.9 CDI9 78.3 71.9 ± 8.3 90.2 ± 8.2 ufacturer’ 5 recommendations using 2 I 8 primers and CD2O 99.9 98.9 ± 0.3 79.3 ± 0.5 avian leukosis virus reverse transcriptase (RNA PCR kit; PE- CD22 ND 97.7 ± 0.5 93.4 ± 4.5 Cetus, Norwalk, CT). Competitive internal standards (MIMICs) CDI Ic ND 8.1 ± 0.8 13.7 ± 2.9 were constructed by two rounds of PCR amplified from the HLA-DR 92.1 99.3 ± 0.3 95.4 ± 0.6 v-erbB CD2 1.0 5.8 ± 0.1 8.9 ± 1.4 gene using a PCR Mimic construction kit (PCR MIMIC; CD5 1.4 5.3 ± 0.5 ND Clontech Labs, Palo Alto, CA). By using first a primer set with CD8 1.8 5.4±0.8 ND an internal 17 nucleotides to amplify a 267-bp fragment of LEU1O ND 98.3 ± 0.8 95.4 ± 1.4 v-erbB and an external 17 nueleotides that correspond to the SIgG 96.8 90.8 ± 5.9 88.8 ± 9.9 mdr primers, amplification of this mimic template in presence of SIgX 92 97.1 ± 1.5 91.3 ± 5.6 SIgK 2.3 11.7±0.4 11.6± 1.5 mdr primers results in a 307-bp product of v-erbB gene. Our SIgD ND 5.5 ± 0.7 9.2 ± 1.3 mdr primers amplify 500 bp of mdr-extraeted eDNA. An anal- 51gM ND 4.9 ± 0.3 ND ogous series of primers and constructs was made for 3-actin a Numbers represent percentage of positive cells for the given (499-bp fragment) and a 3-actin competitor (363-bp product). marker, ±SD. The sequences of the primers are as follows: mdr-Mimic- b ND, not done. sense,5’-GCTTGCTGTAATTACCCGAGCTGATlTGCAGAG- TT-3’ ; mdr-Mimie-antisense, 5’-TTGGCATAGTCAGGAGCG- TCAATGCAGTTTGTAG-3’ ; Actin-Mimic-sense, 5 ‘-GGGC- mg. Tumor growth delay (T - C) is the difference between the GCCCCAGGCACCATACAGGGAGATGAAAGG3 ‘ ; Actin- median time (in days) required for the treatment group tumor (7) Mimic-antisense, 5-ATGTCACGCACGATTFCT1TGATI’CT- to reach 1500 mg and the median time (in days) for the control GGACCATGG-3; mdr-sense, 5 ‘-CAGGCTITGCTGTAATFA- group tumors (C) to reach same weight: tumor cell kill net CCC-3’ ; mdr-antisense, 5’-GCTI’TGGCATAGTCAGGAGC-

(log10) = (T - C) - (duration of treatment in days)/(3.32)(Td). 3 ‘; Actin-sense, 5’-GTGGGGCGCCCCAGGCACCA-3’ ; and In this study, an agent is considered highly active (+ + + +) Actin-antisense, 5’-CTCCTTAATGTCACGCACGATTTC-3’. when log10 kill (net) is >2.0 and gross is >2.8. An activity The concentration of a spin column-purified mdr and 3- rating score of (+ + + +) is needed to effect complete tumor actin competitive MIMIC (templates) were determined by flu- regression. A score of + + + is assigned for log10 kill (net) of orometry with H33258 dye. Each 20-i.l PCR reaction contained 0.8-2.0 and (gross) of 2.0-2.8. This score is equivalent to 2 i.b of the synthesized eDNA, at the same concentrations before partial remission in clinical terms. A score of either + or + + is and after Bryol treatment, two i.l of serial dilutions of a known not considered active by usual clinical criteria (23). amount of the competitive MIMIC, and 1 .5 mvt MgCb2. PCR Cytogenetic Studies. Chromosomal analysis of the was carried out for 40 cycles at 94#{176}Cfor 1 mm, 60#{176}Cfor 1 mm, WSU-DLCL2 cells in culture and in SCID mice was done and 72#{176}Cfor 90 s. Eight p.1 of the PCR reaction were separated according to standard methods as described previously (24). The by electrophoresis on 2% agarose gels in 40 mtvt Tris-acetate- I cells were exposed to Colcemid (0.05 ji.g/ml) for 1 h. Cells were mM EDTA buffer (1 X TAE) in the presence of ethidium bro- then harvested and treated with 0.075 moIIL potassium chloride mide. Initially, 10-fold serial dilutions of the competitor were for 15 mm, before they were fixed with 3: 1 methanol:acetic used to determine approximate levels of expression, followed by acid. Slides were prepared by dropping cell suspension onto a 2-fold serial dilutions in that approximate range. Negative ethanol-cleaned glass microscope slides. G-banding methods photographs of the gels under UV transillumination were were applied for chromosome identification. From each culture, scanned on a Zenith densitometer (Advanced Arnerican Biotech, 20 metaphase cells were analyzed microscopically, and karyo- Fullerton, CA). The density ratio of the target eDNA PCR types were prepared. product to the competitive MIMIC, adjusted for the difference in in Vitro and in Vivo Detection of the Pgp by Flow product length, plotted against the concentration of the compet- Cytometry. Single-cell suspensions of WSU-DLCL2 in eul- itor and used to determine mass quality in attomoles. For each ture or dissociated from xenografts were washed and stained sample, the ratio ofmdrl eDNA to actin eDNA is determined to with anti-Pgp monocbonal antibody. The antibody C219 (Cen- normalize for differing amounts and integrity of extracted RNA. tocor, Inc., Malvern, PA), which detects an internal epitope of Northern Blot Analysis. WSU-DLCL2 and CCRF- the Pgp transmembrame molecule, was used. Cells were first CEM/R cells were exposed to Bryol at 200 nM for up to 72 h. fixed in cold ethanol for 5 mm and stained with indirect immu- The CCRF-CEMIR line is T-cell acute lymphoblastie leukemia nofluorescence procedure as described previously (25). with induced mdrl amplification (150-fold) and Adriamycin Competitive RT-PCR. Competitive RT-PCR was used resistance. The cells are used in this study as positive control. to obtain quantitative information of mRNA levels. Tumors Total cellular RNA was isolated at 24-h intervals from treated were excised from SCID mice, and portions were immediately and untreated (control) cells using RNA STAT-60 reagent (Tel- frozen at -70#{176}C.RNA was isolated by the one-step acid gua- Test “B” Inc., Friendswood, TX) according to the manufactur- nidinium phenol method (RNA STAT-60; Tel-Test, Friend- er’s instructions. Twenty ig of each RNA sample were dena- swood, TX; Ref. 26). Two animals, each with bilateral s.c. tured and separated on a formaldehyde-agarose (1%) gel using tumors were used per time point and received one, two, or three a Northern-Max kit (Ambion, Inc., Austin, TX) and was trans-

)L %

2 3 Fig. 1 G-banded karyotype of WSU-DLCL2 showing t(4:14) 11- ((-1 ‘!‘ -“ and t(14:18)(arrott’s). The corn- posite karyotype is: 48,XY,t( I; 2)(p36. 1 :q37),der(3)t(3;7)(ql 3: pl5),t(4; 14)(q27;1 32),+i(7p).der (7)t(3;7)(q2l;pl 1.2),+8.t(14:l8) (q32:q2 I ),der( 15)(q26. I ),del( 16) (q22),del( 17)(q25).

fl 4L ! 9 --

*-* !-!---- -*-- 19 20 21 J.- iY

Table 2 Activity of selected c ytotoxic agents and Bryol in WSU-DLCL2 SC ID xenografts

Agent Dose” Route No. of animals T/C (%) T - C(d) Log10 kill (net)

Diluent (control) 0.0 iv. 5 100 0.0 0.0 VCR 0.5 mg/kg iv. 5 29.6 16 0.7 Doxorubicin 3.3 mg/kg iv. 5 26.3 19 1.0 Ara-C 450 mg/kg iv. 5 38.2 16 0.7 Bryol 50 p.g/kg i.p. 5 100 0.0 0.0 d Bryol 75 Lg/kg i.p. 5 39 7 0.5 Bryol/ 50i.g/kg i.p./ 5 11.3 35 2.0 VCR 0.5 mg/kg iv. Bryol/ 75 J.gfkg i.p./ 5 6 38 2.5 VCR 0.5 mg/kg iv. Bryol/ 50 p.gfkg i.p./ 5 45.6 16 0.6 Ara-C 450 mg/kg iv. Bryol/ 50 i.g/kg i.p./ 5 Died of toxicity” doxorubicin 3.3 mg/kg iv.

(, Doses are determined based on previous experiments with these drugs.

I, This experiment was repeated using a lower dose of doxorubicin (2.3 mg/kg), where four of five mice also died of toxicity.

ferred to BrightStar-Pius nylon membrane (Ambion, Inc.). RNA At various time points, cells were washed three times with transcripts were prepared as probes using PTRI-MDR 1 -human chilled PBS, and the pellets were suspended in 1 rnl of scintil- and PTRI GAPDH-hurnan antisense probe templates and lation liquid cocktail and analyzed on a Beekrnan scintillation MAXlscript T7Kit (Ambion, Inc.). These RNA transcripts were counter (model LS-3801). Results were then converted to pmol/ labeled using BrightStar psoralen-biotin nonisotopic labeling kit 10” cells and plotted against time. (Ambion, Inc.). Northern blot analysis was carried out by hy- Anthracycline Efflux Analysis by Flow Cytometry. bridization at 69#{176}Cfor mdrl probe and at 65#{176}Cfor glyceralde- WSU-DLCL2 cells (5 X l0) from either control culture or hyde-3-phosphate dehydrogenase probe. The BrightStar Biode- following exposure to Bryol (200 nM) for 24 h were ali- teet kit (Ambion, Inc.) was used in the detection process. quoted in 12 x 75-mm tubes. After washing, cells were [3H]VCR Accumulation. WSU-DLCL2 cells at 5 X incubated with daunorubicin (at a final concentration of 2 105/mi were cultured with or without Bryol (200 nM) for 24 h p.g/ml), Adriamycin (20 ig/ml), or no treatment for 30 mm and washed with RPMI 1640. Cells (2.5 X l0) in 1 ml of at 37#{176}C.Cells were then washed, placed on ice, and imme- glucose-free RPMI 1640 were then exposed to 10 nM of diately analyzed on Coulter-XL flow cytometer, where l0 [3HIVCR (specific activity, 4.5 Ci/mmoi; Amersham Life Sci- cells were acquired per test and results were expressed on ence, Arlington Heights, IL) for 10 mm and incubated at 37#{176}C. semilog scale.

100 In Vitro

A B 80 C U)

a) C) 60 a) > r . 40 LBostatin1

a) 20 0 E 0 0 1 2 3

. . ,.,.., ib3 11$ “i ,..,,., #{252}o l’t$ Time (days)

100 InVivo

D E U) F

: 60 a

.r.A1#{239}ij )$ .,..l.. 0 1 2 3 immunofluorescence intensity Bryostatini Injections

Fig. 2 Pgp expression in WSU-DLCL2 cells detected by flow cytometry. In the upperpanel (A-C), 25 X I0 cells/ml were cultured with medium or 200 nM Bryol in vitro for up to 72 h. Cells were assayed for Pgp expression using C2l9 monoclonal antibody. A, FCM on control culture; B, Bryol-treated culture after 24 h; C. percentage of positive cells for Pgp in control and Bryol-treated cultures over a 72-h period. In the lower panel (in vivo; D-F), Pgp was assayed in tumors removed from WSU-DLCL2-bearing SCID mice with (E) or without (D) Bryol injections. F, summary of the percentage of positive cells in control (#{149})and Bryol-treated (0) animals. Tumors were removed and assayed 24 h after each injection. Pgp expression was completely abolished after the second injection of Bryol.

RESULTS 13.9%; CD37, 98.4%; CIgG, 54.3%; CIgX, 94.0%; CIgK, 4.9%; Characterization of WSU-DLCL2. After 4 weeks of CIgM, 6.9%; and CIgD, 4.5%. culture, some of the fresh pleural fluid mononuclear cells began in Vitro and in Vivo Cytogenetic Analysis. Cytogenetic to proliferate. Those cells achieved a steady state of growth by analysis of the cell line revealed an abnormal male karyotype 10 weeks. The cell line, designated WSU-DLCL2, has a dou- with several clonal aberrations (Fig. 1). The composite karyo- bling time of 1 8 h. Examination of the smears under a light type was: 48,XY,t( I ;2)(p36. 1 ;q37),der(3)t(3;7)(q I 3;p15),t(4; 14) microscope revealed large cells with primitive lymphobbastoid (q27;p32), +i(7)(plO),der(7)t(3;7)(q2 1 ;pl 1 .2),+ 8,t( 14; 1 8)(q32; features, including a barge irregular nucleus composed of fine q2 1), del( 15)(q26. l),del( 16)(q22),del( 17)(q25). The t( I 4; 1 8) is chromatin with one or more nucleoli and varying degrees of usually associated with follicular B-cell lymphoma. The same indentation. WSU-DLCL2 tested negative for EBV nuclear an- chromosomal abnormalities were observed in the s.c. tumor taken tigen. from SCID mice. Comparison of the phenotypes of the primary pleural fluid In Vivo Drug Efficacy. When 25 SCID mice were in- cells, established WSU-DLCL2 line in vitro, and in the SCID jected s.c. with equal numbers of WSU-DLCL2 cells ( l0) in mice as a xemograft is presented in Table 1 . The cell line and the each flank, 20 developed tumors (80% take rate). The tumors xemograft showed the same characteristics as the original lym- were palpable by the end of the third week. Tumor volume phoma. Cells expressed B-cell markers with a monoclonal doubling time (Td) in SCID mice was 3.8 days. When WSU- IgGX. There was no expression of T-iymphoid markers. Other DLCL2 was passaged in SCID mice, the take rate was 100%. monoclonal antibodies tested on the cell lime, not shown in Drug efficacy trials were conducted on animals with palpable Table 1, were as follows: BL1, 52.0%; CD45, 99.7%; CD21, tumors. 6.3%; Cdwl4, 7.2%; BL7, 12.1%; CDw13, 6.9%; CD33, Table 2 shows the activity of Bryol and selected cytotoxic

A 1 23 456 789M 12 34 5 6 7 89 M p . - . _ . - - - Fig. 3 Quantitative PCR assay of indrl RNA expression in control (no injection) and after 499 - one, two, or three bryostatin in- 363 - o . o . . . S jections in WSU-DLCL2-hear- 500 - ing SCID mice. Bryol was in- 307 - jected at a dose of 50 gfkg p. every third day. Tumors were removed 24 h after each injection. A, photographs of 2’- aga- 12 34 5 6 7 89 M rose gels after electrophoretic 1 23456 789 separation of PCR reactions containing amounts of eDNA I and indicated amounts of corn- I petitor. Left /)Wl(’l. ,ndrl : rig/It panel, aeOn. Concentrations of mdr competitor from wells 1-9 499 - . . - . ‘ were as follows (ng/ml): I X 363 - 10 5.2X1() 5,4Xl0 5.6X 500- #{149}#{149}#{149}#{149}#{149}*- 10 5.8X 10 ,l x 10 4,2X 307- 10 . 4 X 10 , and 6 X 10 . respectively. in both control (top) and after first Bryol injection (bottom). M. kilobase lad- control. 500. 05 - der DLCL2 rndrl B eDNA: 307, PCR rndrl mimic. Concentrations of actin competitor (right) in wells 1-9 were as 0.4 follows (ng/ml): I X 10 . 2 X 10 4,4X 10 -4.6x 10 1.8X

10 . I x 10 ‘ 2 x 10 . 4 x

10 ‘. and 6 x 1(1 . respec- 0.3 tively. in control (top) and after first Bryol injection (bottom). 499. DLCL2 actin cDNA: 363. actin mimic. In B, densitornetry 0.2 of negatives from above gels as C well as after second and third Bryol injections allowed deter- \ rnination of actual equivalence 0.1 points. These values were used \ to calculate the Fill/rI aeOn RNA ratios for each sample.

00 - 0 2 3 4

Time

agents given alone or sequentially to WSU-DLCL2-bearing not superior to Ara-C alone. Bryol/doxorubicin was too toxic SCID mice. When tumor responses are determined by the T/C because all of the animals lost weight. became listless, and died. value, VCR, doxorubicin, Bryol (in the higher dose). and Ara-C Reducing the dose of doxorubicin to 2.3 mg/kg was also lethal are considered active against this type of human tumor (T/C to the animals. The Bryol/VCR, however, was well tolerated at values, <42%). However, if log10 kill values are added as a both dose levels of Bryol and was associated with significant criterion, none of the agents had a clinically significant activity antiturnor activity. as measured by tumor growth inhibition, except doxorubicin. It should be noted that activity rating of tumor growth delay. and turnor log11) kill (Table 2). 1+ + +, log1() kill (net) 0.8-2.01 or I+ + + +. log11) kill (net) Bryol Effect on Pgp Expression. Incubation of WSU-

>2.0] is needed to effect partial or complete tumor regressions. DLCL2 cells in the presence of Bryol (200 nM) in vitro resulted respectively. Thus, a score ofl+, log10 kill (net) <0.4] or [++, in decreased expression of Pgp as detected by flow cytornetry. log11) kill (net) 0.4-0.79] is not considered active by usual In control cultures, 6070ek of WSU-DLCL2 cells expressed clinical criteria (23). detectable Pgp. whereas no significant expression was detected In the sequential treatrnent experirnents, Bryol/Ara-C was after 24 h ofexposure to Bryol (Fig. 2. A and B). This effect was

CEMIR W(J-DLCL2 U) .50 0 0 0 C.) .b .b 0 C . . . 0 0 ‘. 0 .. C.) C’4 C.) N ‘ t E z 0 > U) 0

4.6 kb- ‘ -MDRI 102 10 10

DNR -*

I .4 kb- ‘ -GAPDH

Untreated

Fig. 4 Northern blot analysis of multidrug resistance (mdrl ) mRNA. WSU-DLCL2 cells had no detectable ,ndrl mRNA by this method in control cultures. 24/: Brvo, 48/1 Brvo, and 72/i Brvo, time of exposure to . +Byyostatin Biyol (200 nM) before mRNA extraction. CEMIR, CCRF-CEM T-cell acute lymphoblastic leukemia cell line with induced resistance to Ad- riamycin used as a positive control.

101 I0 10’

030 ADR -#{248}’ . Control Fig. 6 Flow cytometric assay of daunorubicin (DNR) and Adriamycin C 0 Bryostatin 1 (ADR) fluorescence in control (untreated) and Bryol-treated cultures 0 025 (Bryol at 2(X) nM for 24 h) of WSU-DLCL2 cells. Auto, autofluores- It cence of cells without drug addition. 020 0 11) C) It It

5) CC 015 .i- Pgp expression was then assayed in WSU-DLCL2 xe- :0 nografts in SCID mice before and after Bryol treatment. WSU- 0.10 . 0. DLCL2 tumors in control animals showed a comparable level of > Pgp expression to that seen in vitro (Fig. 2, D and F). Twenty- 0.05 four h after first injection of Bryol (50 jigfkg). Pgp expression

decreased from 62 to 9% (P < 0.001 ; Fig. 2E). This expression decreased further (to 2.5%) when the animal received two Bryol 0.00 30 60 90 120 150 180 injections 72 h apart (Fig. 2F). Down-Regulation of mdrl RNA by Bryol. Photo- Time (Minutes) graphs of agarose gel electrophoresis of PCR reactions contain- Fig. 5 Representative experiment of I3HIVCR accumulation in WSU- ing 2-fold serial dilutions of mdr competitor with a constant DLCL2 cells. In this experiment. cells were exposed to Bryol (200 nsl) amount of eDNA from WSU-DLCL2 xenografts excised from for 24 h before exposure to I3H1VCR. Similar results were obtained when WSU-DLCL2 cells were exposed to Bryol for 48 h. Additional SCID mice, either untreated or after Bryo 1 injections, are shown mndrl I3HIVCR measurements were obtained in a separate experiment and in Fig. 3A. These data demonstrate a decrease in eDNA showed a decrease in drug level by 360 mm (data not shown). after Bryol treatment. The mdr/3-actin-normaiized expression for the various samples is shown in Fig. 3B. The data show that mdrl RNA was down-regulated in WSU-DLCL2 tumors after maintained for the duration of the experiment (72 h; Fig. 2C) treatment of SCID mice with Bryol . Thus, the down-regulation following the one-time addition of Bryol to culture at time zero. of mdr protein assessed by flow cytometry occurs, at least in The effectiveness of Bryol-induced down-regulation of Pgp part, at the RNA level. The mdrl mRNA, however, was not seems to depend on cell density in culture. with the optimum detectable in WSU-DLCL2 cells using conventional Northern results obtained at a cell concentration of 25 X 104/ml. blot technique. In these experiments, Bryol showed a 33%

reduction in mndrb mRNA in the CCRF-CEMIR cell line used as method to quantitate the tndrl RNA. These experiments showed a positive control (Fig. 4). a decrease in the tndrl RNA of WSU-DLCL-2 tumors removed Functional Drug Efflux Assays. Functional assays were from SCID mice treated with Bryob compared with untreated used to demonstrate the impact of Bryol-induced mdrl down- controls (Fig. 3). The competitive PCR method has been shown regulation on drug retention. Two classes of mdrl-depemdent to be quantitative in a number of systems (33, 34). Our modi- compounds were evaluated: Vinca alkaloids and anthracyclines. fication of normalizing the input eDNA by using competitive Prior exposure of WSU-DLCL2 cells to Bryol for 24 h led to PCR for 3-actin allows for more accurate quantitation and is increased intracellular accumulation of [3H]VCR (Fig. 5). There applicable to biopsy samples. After confirming that Bryob did was a 4-fold increase in [3H]VCR in bryol-treated cells corn- indeed lead to a decrease in the amount of Pgp and mdrl RNA, pared with untreated controls. Such a difference was apparent we tested whether there was a measurable decrease in Pgp after 30 rnin of exposure to [3H]VCR. Bryol-treated cells also function that would actually account for the Bryol enhancement showed brighter daunorubicin and, to a lesser extent, Adriamy- of VCR efficacy. We demonstrated that Bryol treatment of cm fluorescence compared with control cells (Fig. 6). WSU-DLCL2 cells leads to increased [3H]VCR and daunorubicin accumulation intraceblularly (Figs. 4 and 6). Cyciosporin A, a known inhibitor of Pgp, led to increased rhodamine-123 DISCUSSION fluorescence, mimicking Bryol effect (data not shown). In this report, we show that administering VCR 24 h after It is possible that Bryol has additional functions that can Bryol to SCID mice bearing DLCL tumors improves antitumor influence drug uptake besides down-regulation of mdrl RNA. activity. Bryol by itself showed some activity when given at the One such function is the phosphorylation of Pgp. Although we maximum tolerated dose by the SCID mice (75 .tg/kg). In did not assay for Pgp phosphorybation by Bryol, PKC activa- previous work, we have demonstrated that a Bryol dose of 100 tors, in general, are known to phosphorylate Pgp (35). Some fig/kg was toxic to SCID mice (22). However, even at a lower studies have shown that phosphorybation of Pgp beads to mod- dose of 50 rig/kg, which had no significant antitumor activity, ulation of its function (36). However, more definitive studies Bryol decreased Pgp and down-regulated mdrl RNA expres- using nonphosphorybatabbe Pgp mutants demonstrated that sion, as measured by flow cytometry and quantitative PCR phosphorybation/dephosphorylatiom mechanisms do not play a assay. This effect on tndri expression may be a mechanism by significant role in the establishment of tndr phenotype mediated which Bryol potentiates VCR action. This conclusion is sup- by human Pgp (37-39). Another function of Bryol that has ported by the increased uptake of [3HIVCR and daunorubicin relevance to drug sensitization is the modulatory effect on bcl2 fluorescence by WSU-DLCL2 cells after prior exposure to and p53 gene expression. We have demonstrated previously that Bryol compared with control cells. exposure of WSU-DLCL2 cells to Bryol in vitro led to de- Advanced-stage DLCL was found to be curable by mul- creased bcl2 expression and up-regulation of p53 (18). This tiagent chemotherapy more than two decades ago (19, 27). The original regimens resulted in cure of 30-40% of cases. Al- change in phenotype is associated with drug sensitivity, as though numerous attempts were made to improve on these exemplified by potemtiation of VCR cytotoxicity. It is likely, results, no further progress has thus far been made (20, 28). therefore, that reversal of resistance to chemotherapy by Bryol mdrl expression in DLCL is usually low at presentation (29) but is quite complex and may involve more than one known resist- increases at relapse or in resistant cases (10). These observations ance mechanism. suggest that ,ndrl expression may be clinically important in this The clinical course of the lymphoma from which the WSU- tumor. The WSU-DLCL2 line was established from a relapsed DLCL2 line is established was extremely aggressive and resist- DLCL that was clinically resistant to therapy. The disease ant to the most intensive therapy available. The WSU-DLCL2 relapsed after high doses of chemotherapy and radiation, fol- xenograft model was also resistant to single-agent therapy with lowed by bone marrow transplantation. The ability of these cells the exception of modest activity of doxorubicin (Table 2). Only to grow as xenografts in SCID mice makes it a useful preclinical the sequential use of Bryol and VCR bed to what is considered animal model for resistant lymphoma. a significant activity in the mouse that is clinically meaningful. The bryostatins represent one of the most promising ther- This finding is consistent with an earlier observation made in apeutie agents isolated from marine animals (30). Bryol, the our laboratory that sequential use of Bryol and VCR was quite most extensively studied, has antineoplastic properties against a effective against a human Waldenstrom’s macroglobulimemia number of murine tumors including B 16 melanoma (3 1), M5076 xemograft model (22). reticulum cell sarcoma, and L1OA B-cell lymphoma (32). Re- Modulation of mdrl is a previously unrecognized effect of cently, we have shown that Bryob can augment the inhibitory Bryol, and the down-regulation of the mdrb RNA is a novel effect of VCR in WSU-DLCL-2 cells in vitro ( 1 8). We hypoth- mechanism for overcoming mdr function. Because Bryob has esized that such effect is through the mdr mechanism, because entered clinical trials in cancer patients, recognition of this the cell line expresses mdr phenotype. To prove this, we first function may be clinically useful. demonstrated a decrease in Pgp expression by WSU-DLCL-2 cells in the presence of Bryol in vitro (Fig. 2). Moreover, in in l11’() studies, similar results were observed when WSU-DLCL-2 ACKNOWLEDGMENTS tumors were removed from SCID mice after Bryol treatment. We thank Kerry Vistisen for excellent technical assistance. Steven To determine whether the down-regulation of tndrl expres- Buck for assistance in flow cytometry, and Jean Parets and Claudia sion is at the RNA level, we developed a competitive PCR Mapes for typing the manuscript.

REFERENCES 19. Elias, L., Portlock, C. S., and Rosenberg, S. A. Combination chemotherapy of diffuse histiocytic lymphoma with cyclophosphamide, Ad- I. Cordon Cardo. C.. O’Brien, J. P., Boccia. J., Casals. D.. Bertino, riamycin. vincristine. and prednisone (CHOP). Cancer (Phila.), 42: J. R., and Melamed, M. R. Expression of the multidrug resistance gene 1705-1710, 1978. product (P-glycoprotein) in human normal and tumor issues. J. Histo- chem. Cytochem., 38: 1277-1287, 1990. 20. Fisher, R. I.. Gaynor, E. R., Dahlberg, S., Oken. M. M.. Grogan. T. M., Mize, E. M., Glick, J. H., Coltman. C. A.. Jr.. and Miller, T. P. 2. Cornwell, M. M. Molecular biology of P-glycoprotein. In: Robert F. Comparison of a standard regimen (CHOP) with three intensive chem- Ozols (ed), Molecular and Clinical Advances in Anticancer Drug Re- otherapy regimens for advanced non-Hodgkin’s lymphoma. N. Engl. sistance. pp. 37-56. Boston: Kiuwer Academic Publishers, 1991. J. Med., 328: 1002-1006, 1993. 3. Cordon, C. C., O’Brien. J. P., Casals, D., Rittman, G. L., Biedler, 21. Bardales. R. H.. Al-Katib, A. M.. Carrato. A., and Koziner. B. J. L., Melamed, M. R., and Bertino, J. R. Multidrug resistance gene Detection of intracytoplasmic immunoglobulin by flow cytometry in B (P-glyeoprotein) is expressed by endothelial cells at blood-brain barrier cell malignancies. J. Histochem. Cytochem.. 37: 83-89, 1989. sites. Proc. Natl. Acad. Sci. USA, 86: 695-698, 1989. 22. Mohammad, R. M.. Al-Katib, A., Pettit, G. R., and Sensebrenner. 4. Chaudhary, P. M., and Roninson, I. B. Expression and activity of L. L. Successful treatment of human Waldenstrom’s macroglobulinemia P-glycoprotein, a multidrug efflux pump. in human hematopoietic stem with combination biological chemotherapy agents. Cancer Res.. 54: cells. Cell, 66: 85-92, 1991. 165-168. 1994. p 5. Drach, D., Zhao, S., Drach, J., Mahadevia, R., Gattringer. C.. Huber. 23. Corbett, T. H.. Valeriote, F. A., Polin, L.. Panchapor. C.. Pugh. S.. H., and Andreeff, M. Subpopulations of normal peripheral blood and White, K., Lowinchik, N., Knight, J., Bissery, M. C.. Wozniak, A.. bone marrow cells express a functional multidrug resistant phenotype. LoRusso, P.. Biernat, L.. Polin, D.. Knight. L.. Biggar, S., Looney. D.. Blood, 80: 2729-2734, 1992. Demehik, L.. Jones, J.. Jones, L., Blair, S., Palmer. K.. Essenmacher, S., 6. Veda, K., Cornwell, M. M., Gottesman. M. M., Pastan, I., Roninson, Lisow, L., Mattes, K. C., Cavanaught. P. F.. Rake. J. B.. and Baker. L. I. B., Ling, V., and Riordan, J. R. The mndri gene, responsible for Discovery of solid tumor active agents using a soft-agar-colony-forma- multidrug resistance, codes for P-glycoprotein. Biochem. Biophys. Res. tion disk-diffusion assay. In: F. A. Valeriote, T. H. Corbett. and L. H. p Commun., 141: 956-962. 1986. Baker (eds.). Cytotoxic Anticancer Drugs: Models and Concepts for 7. Thiebaut, F., Tsuruo. T.. Hamada, H., Gottesman, M. M., Pastan, I.. Drug Discovery and Development. pp. 35-87. Boston: Kluwer Aca- and Willingham. M. C. Immunohistochemical localization in normal demic Publishers. 1992. tissues of different epitopes in the multidrug transport protein p.170: 24. Mohamed. A. N., and Wolman. S. R. Chromosome analysis in evidence for localization in brain capillaries and cross reactivity of one cell culture. In: G. Studzinski (ed). Cell Growth and Apoptosis; A antibody with a muscle protein. J. Histochem. Cytochem., 37: 159-164, Practical Approach, Ed. 2, Vol. 2., pp. 79-96. New York: Oxford 1989. University Press, 1995. 8. Fojo, A. T., Veda, K., Salmon, D. J.. Poplack, D. G., Gottesman, 25. Mohammad, R. M., Mohamed. A. N., KuKuruga, M., Smith, R. M., M. M.. and Pastan, I. Expression of a multidrug resistance gene in and Al-Katib, A. A human B-cell lymphoma line with a de nova human tumors and tissues. Proc. NatI. Acad. Sci. USA. 84: 265-269. multidrug phenotype. Cancer (Phila.), 69: 1468-1474, 1992. 1987. 26. Chomczynski, P., and Sacchi, N. Single-step method of RNA iso- 9. Miller, T. P.. Grogan, T. M., Dalton, W. S.. Spier. C. M., Scheper. lation by acid guanidinium thiocyanate-phenol-chloroform extraction. R. J., and Salmon, S. E. P-glycoprotein expression in malignant lymphoma and reversal of clinical drug resistance with chemotherapy plus Anal. Biochem., 162: 156-159, 1987. high dose verapamil. J. Clin. Oncol.. 9: 17-24, 1991. 27. DeVita. V., Jr.. Canellos. G., Chabner, B., Shein, P., Hubbard, S., 10. Cheng, A. L., Su, I. J., Chen, Y. C., Lee, T. C., and Wang, C. H. and Young. R. Advanced diffuse histiocytic lymphoma. a potentially Expression of P-glycoprotein and glutathione S-transferase in recur- curable disease: results with combination chemotherapy. Lancet. I: rent lymphomas: the possible role of Epstein-Barr virus, immuno- 248-250, 1975. phenotypes, and other predisposing factors. J. Clin. Oncol., 11: 28. Gordon, L. I.. Harrington, D., Andersen, J.. Colgan, J.. Glick, J.. 109-115, 1993. Neiman, R.. Mann, R., Resnick, G., Barcos, M., Gottlieb, A., and 11. Salmon, S. E., Grogan, T. M., Miller, T., Scheper. R.. and Dalton, O’Connell, M. Comparison of a second-generation combination chemo- W. S. Prediction of doxorubicin resistance in vitro in myeloma. lym- therapeutic regimen (m-BACOD) with standard regimen (CHOP) for phoma, and breast cancer by P-glycoprotein staining. J. Nail Cancer advanced diffuse non-Hodgkin’s lymphoma. N. EngI. J. Med.. 327: Inst., 81: 696-701, 1989. 1342-1349. 1992. 12. Pastan, I., and Gottesman, M. Multiple-drug resistance in human 29. Niehans, G. A., Jaszcz. W., Brunetto, V., Perri, R. T., Gajl-Peczal- cancer. N. Engl. J. Med., 316: 1388-1393. 1987. ska, K., Wick, M. R., Tsuruo, T., and Bloomfield, C. D. Immunohisto- 13. Ford, J. M., and Hait, W. N. Pharmacology of drugs that alter chemical identification of P-glycoprotein in previously untreated. dif- multidrug resistance in cancer. Pharmacol Rev., 42: 155-199. 1990. fuse large cell and immunoblastic lymphomas. Cancer Res.. 52: 3768- 3775, 1992. 14. Ozols, R.. Cunnion, R.. Klecker, R., Hamilton, T.. Ostchega, Y., Parrillo. J., and Young, R. Verapamil and Adriamycin in the treatment 30. Pettit, G. R., Herald, C. L., Doubek, D. L., Herald, D. L.. Arnold. E., of drug resistant ovarian cancer patients. J. Clin. Oncol., 5: 64 1-647, and Clardy, J. Isolation and structure of Bryostatin 1. J. Am. Chem. 1987. Soc.. /04: 6846-6848, 1982. 15. Stone, R. M., Sariban, E., Pettit, G. R., and Kufe, D. W. Bryostatin 31. Schuchter, L. M., Esa, A. H., May, S.. Laulis. M. K.. Pettit. G. R.. I activates protein kinase C and induces monocytic differentiation of and Hess, A. D. Successful treatment of murine melanoma with bryo- HL-60 cells. Blood. 72: 208-213. 1988. statin I. Cancer Res., 51: 682-687, 1991. 16. Jones, R. J., Sharkis, S. J., Miller, C. B., Rowinsky, E. K., Burke. 32. Hornung, R. L.. Pearson, J. W.. Beckwith, M., and Longo. D. L. P. J., and May, W. S. Bryostatin 1, a unique biologic response modifier: Preclinical evaluation of bryostatin as an anticancer agent against sev- anti-leukemic activity in vitro. Blood, 75: 1319-1323. 1990. eral murine tumor cell lines: in vitro versus in vivo activity. Cancer Res.. 17. Mohammad, R. M., Al-Katib, A., Pettit, G. R., and Sensebrenner, 52: 101-107, 1992. L. L. Differential effects of bryostatin 1 on human non-Hodgkin’s 33. Li. B., Sehajpal, P. K., Khanna, A., Vlassara, H., Cerami, A., B-Lymphoma cell lines. Leuk. Res., 17: 1-8, 1993. Stenzel, K. H., and Suthanthiran, M. Differential regulation of trans- 18. Mohammad, R. M., Diwakaran, H., Maki, A., Emara, M. A.. Pettit, forming growth factor 3 and interleukin 2 genes in human T cells: G. R., Redman, B., and Al-Katib, A. Bryostatin 1 induces apoptosis and demonstration by usage of novel competitor DNA constructs in the augments inhibitory effects of vincristine in human diffuse large cell quantitative polymerase chain reaction. J. Exp. Med., 174: 1259-1262, lymphoma. Leuk. Res., 19: 667-673, 1995. 1991.

34. Siebert. P. D.. and Larrick, J. W. PCR mimics: competitive DNA phosphorylation does not regulate drug transport by the human multi- fragments for use as internal standards in quantitative PCR. Biotech- drug resistance P-glycoprotein. J. Biol. Chem.. 271: 13668-13674, niques. 14: 244-249. 1993. 1996. 35. Yang. J. M., Chin. K. V., and Hait. W. N. Interaction of P- 38. Germann. V. A.. Chambers, T. C., Ambudkar, S. V., Licht, T., glycoprotein with protein kinase C in human multidrug resistant earci- Cardarelli, C. 0., Pastan, I., and Gottesman, M. M. Characterization of noma cells. Cancer Res., 56: 3490-3494. 1996. phosphorylation-defective mutants of human P-glycoprotein expressed 36. Lee, W. P. P-glycoprotein is hyperphosphorylated in multidrug in mammalian cells. J. Biol. Chem., 271: 1708-1716, 1996. resistant HOB 1 lymphoma cells treated with overdose of vincristine. 39. Smith, C. D., and Ziffier, J. T. Circumvention of P-glycoprotein- Biochim. Biophys. Acta. /245: 57-61. 1995. mediated multiple drug resistance by phosphorylation mediators is 37. Goodfellow, H. R.. Sardini, A., Ruetz, S., Callaghan. R.. Gros, P.. independent of protein kinases. J. Biol. Chem., 270: 28145-28 152, McNaughton. P. A., and Higgins, C. F. Protein kinase C-mediated 1995.

Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 1998 American Association for Cancer Research. Bryostatin 1 down-regulates mdr1 and potentiates vincristine cytotoxicity in diffuse large cell lymphoma xenografts.

A M Al-Katib, M R Smith, W S Kamanda, et al.

Clin Cancer Res 1998;4:1305-1314.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/4/5/1305

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/4/5/1305. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.