CIRCADIAN TIMING OF CURCUMIN EFFICACY AND NUCLEAR TRANSPORT PROPERTIES OF CANCER CELLS
Ashapurna Sarma
A Dissertation
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
December 2015
Committee:
Michael E. Geusz, Advisor
Lewis P. Fulcher Graduate Faculty Representative
George S. Bullerjahn
Scott O. Rogers
Vipaporn Phuntumart
© 2015
Ashapurna Sarma
All Rights Reserved iii ABSTRACT
Michael Geusz, Advisor
Understanding how the circadian clock controls delivery and activity of chemotherapies
could optimize cancer treatments. Most anti-cancer drugs are targeted to the nucleus and their
movement through the nuclear envelope could be controlled by the circadian clock. Circadian
regulation of cell toxicity was tested by measuring the ability of the phytochemical curcumin to
kill C6 glioma cells at different phases of the circadian cycle. Mitotic and cell death events were
counted every 5 minutes for 5 days. An initial low curcumin treatment (5 µM) caused an
elevated cell death rate in C6 cells at rhythmic intervals with a period of 24.4 hours. The rhythm
was disrupted at 10 µM. These results revealed a sensitive phase of the circadian cycle that
could be exploited in therapies based on curcumin or its analogs. Curcumin’s persistence in cells
was imaged for at least 24 hours using autofluorescence. The observed higher stability of the
curcumin congeners demethoxycurcumin and bisdemethoxycurcumin suggested that they too
may produce sustained cancer cell toxicity.
Circadian regulation of anti-cancer agents may also occur in the nuclear transport
mechanism through nuclear pore complexes (NPCs). The transport mechanism could be
regulated by cell calcium ion stores. A single-molecule imaging technique provided the kinetic
parameters as well as spatial locations of transported molecules at altered calcium ion store
concentrations. This three-dimensional, high-speed, super-resolution imaging indicated that
transport was altered. It is possible that previously described circadian calcium oscillations
regulate NPC activity. iv Quantitative RT-PCR was used to test whether with the circadian clock controls expression of the Crm1 gene. CRM1 protein is a nuclear exporter that may generate circadian rhythms in cargo concentrations in the cytoplasm. The phase of the circadian rhythm detected suggested that Crm1 could be controlled by the circadian clock protein BMAL1. To test whether transport of an anti-cancer agent into the nucleus might be under circadian control, the nuclear accumulation rate of doxorubicin fluorescence was measured in C6 cells. Cyclic accumulation was observed with a period near 24 hrs, suggesting that nuclear entry may be clock regulated.
These results could help in determining optimal daily drug delivery times during cancer therapy.
. v
I dedicate this dissertation to the loving memory of my father whom I lost to pancreatic cancer
and my extended family for their constant love and support. vi ACKNOWLEDGMENTS
I would like to thank several individuals who have helped me throughout the past years of my doctoral study. Firstly, I would like to thank Dr. Michael Geusz, for his encouragement and his excellent guidance and mentorship in completion of my work. I am obligated to him for accepting me as his student midterm. Since I joined his lab, his resolute support and patience helped me to complete my projects. I admire his dedication to science and his passion for knowledge. Working under him, I hope I have imbibed some of his scientific qualities like insightful thinking and innovative strategies to approach a problem. He is extremely kind, caring, and thoughtful person. He worked beyond working hours to accommodate my personal commitments during my pregnancy/maternity period. I am eternally grateful to Dr. Geusz for helping me complete my doctoral dissertation, despite academic and personal setbacks during the last three years.
Secondly, I thank my committee members Dr. Scott Rogers, Dr. George Bullerjahn, and
Dr. Vipaporn Phuntumart for their comments and advice regarding my projects at different times. Their knowledge in their respective fields motivates me.
I would also take the opportunity to thank my previous advisor Dr. Weidong Yang, under whose guidance I completed one part of my dissertation. I am grateful for his valuable time and advice he offered for my project. His dedication and hard work is inspiring and I learned much during my stay in that lab.
Special thanks to the following labs in the Biology Department for providing me with resources to complete my projects: Dr. Xu Lab, Dr. Morris Lab, Dr. Heckman Lab, Dr. Jamasbi
Lab, Dr. Rogers Lab Dr. Bullerjahn Lab, Dr. McKay Lab, Dr. Bouzat Lab, Dr. Larsen Lab and
Dr. Phuntumart Lab. Many thanks to stockroom staff Linda, Chris, Susan, Steve, and former graduate secretary DeeDee for making things easier in ordering supplies, paperwork, etc. and vii making graduate life in the Department sane with their sweet greetings and occasional chit-chats.
Dr. Miner and Dr. Bullerjahn were very helpful and supportive during my transition to the new lab and I appreciate their help and support.
I would like to acknowledge my colleagues and friends in the Department, especially my lab members, Alex, Jane, Ram, Vishal, Astha, and Emily for all their help and for making a happy working environment. I particularly thank Dr. Jiong Ma, former member of Dr. Yang’s lab, who helped me with the instrumentation and biophysical methods to complete one project. I also thank Karunakar Samuel, an undergraduate member of our lab for helping me with data collection. I extended my gratitude to Cameron McLaughin for her help in editing the dissertation.
My close friend and my extended family helped me survive the pressures of graduate school. They were my constant sources of encouragement and my support system. My mother, brother, and my husband Vishal inspired me to proceed towards this endeavor and they constantly helped me during the entire process. I thank Vishal for taking care of me and helping me in all the ways he could. I am very thankful to my mother-in-law and my mother for taking care of my little daughter Ashvi while I was away working.
viii
TABLE OF CONTENTS
Page
CHAPTER I: GENERAL INTRODUCTION ……………………...... 1
Cancer and Chemotherapy...... …………………………………………. 1
Curcumin and its Role as Cancer Therapy ...... 3
Curcumin Treatment for Gliomas ...... 6
Circadian Rhythms...... 7
Molecular Mechanisms of Circadian Clocks ...... 9
Nuclear Transport ...... 12
Calcium Regulation of Nuclear Transport ...... 15
Nuclear Transport Components and Their Role in Cancer ...... 19
Nuclear Transport Components and Clock Proteins ...... 21
Chronotherapy...... 23
CHAPTER II: THE CIRCADIAN CLOCK MODULATES ANTI-CANCER PROPERTIES OF
CURCUMIN ...... 27
Preface ...... 27
Introduction ...... 27
Materials and Methods ...... 30
Cell Culture ...... 30
Bioluminescence Assay ...... 30
Curcumin Treatment ...... 31
Long Term Time-Lapse Cell Imaging ...... 31
Immunocytochemistry ...... 32 ix
Curcumin Localization in C6 Cells...... 33
Spectral Analysis of Curcumin ...... 33
Data Analysis ...... 34
Results ...... 35
Circadian Rhythms Persists at Low Curcumin Concentrations ...... 35
Long-Term Effects of Curcumin on Mitosis and Cell Death ...... 37
Circadian Modulation of Curcumin Effects on Mitosis and Cell Survival .... 39
Stability and Localization of Curcuminoids and their Metabolites ...... 44
Discussion ...... 47
CHAPTER III: HIGH-RESOLUTION MAPPING OF THE CALCIUM-REGULATED
NEUCLEOCYTOPLASMIC TRANSPORT ...... 51
Preface ...... 51
Introduction ...... 51
Overview of Transport Kinetics of Calcium Regulated Nuclear Transport .. 54
Methods and Materials ...... 55
Dextran, Protein Purification and Labeling ...... 55
Cell Line, Cell Culture and Transport Conditions ...... 56
Alterations of Calcium Store Concentrations ...... 57
Single-Molecule Tracking of Passive and Facilitated Transport through NPC
...... 57
Orientation of Single NPC ...... 58
Data Analysis ...... 58
Results ...... 59 x
Single Molecule Experiments Determine the Spatial Localizations and Mapping
3D pathways ...... 59
3D Routes of Passive Diffusion in the NPC Regulated by the Calcium Store
Concentrations ...... 62
3D Routes of Facilitated Transport in the NPC Regulated by the Calcium Store
Concentrations ...... 64
Discussion ...... 67
CHAPTER 1V: CIRCADIAN MODULATION OF NUCLEAR TRANSPORT ...... 71
Introduction ...... 71
Materials and Methods ...... 75
Cell Culture ...... 75
Confocal Time-Lapse Imaging of Doxorubicin Nuclear Transport ...... 76
Data Analysis ...... 77
Database Search for Gene Sequences ...... 77
Promoter Sequence Identification and Transcription Factor Binding Site
Identification ...... 78
RNA Extractions and cDNA Synthesis ...... 79
Quantitative Real Time Polymerase Chain Reaction (qPCR) ...... 79
Results ...... 80
Nuclear Import of Doxorubicin Varies According to Circadian Phase ...... 80
Identification of Nuclear Transport Components that are Potentially Circadian
Regulated ...... 83 xi
Circadian Regulation of Crm1 Expression in C6 Cells ...... 88
Discussion ...... 89
CHAPTER V: CONCLUDING REMARKS...... 93
REFERENCES ...... 97 xii
LIST OF FIGURES
Page
1 Structure of curcuminoids and molecular targets regulated by curcumin ...... 4
2 Potential anticancer effects of curcumin ...... 5
3 The mammalian circadian system ...... 9
4 Model of the circadian clock mechanism ...... 11
5 Structure of nuclear pore complex ...... 13
6 Nucleocytoplasmic transport ...... 15
7 Controversial data regarding calcium-mediated nucleocytoplasmic transport ...... 19
8 Main cellular determinants of cancer chronotheraupatics ...... 24
9 Overview of curcumin's anticancer effects of curcumin and interactions with circadian
clock components ...... 29
10 Circadian rhythms in mPer2 clock gene expression ...... 36
11 Circadian rhythms in mPer2 clock gene expression persist after treatment with 5 µM
curcumin ...... 37
12 Effect of curcumin dosages on mitosis and apoptosis of C6 glioma cells ...... 38
13 Circadian clock regulation of curcumin efficacy ...... 41
14 The phase of circadian rhythms in cells treated with curcumin ...... 42
15 Expression of activated caspase-3 according to circadian cycle ...... 43
16 Stability of curcumin in cell cultures ...... 45
17 Stability of curcuminoids in cell cultures ...... 46
18 Effect of curcumin conditioned medium on (A) mitosis and (B) apoptosis in C6 glioma
cells ...... 47 xiii
19 Single-molecule tracking and 3D view of nuclear transport by SPEED microscopy 61
20 The 2D super-resolution images and 3D pathways of passive diffusion under various
calcium conditions ...... 63
21 The 2D super-resolution images and 3D pathways of Imp 1 under various ca
conditions ...... 66
22 Calcium-regulated nuclear transport models ...... 68
23 Nucleocytoplasmic shuttling of clock proteins in the molecular circadian machinery 73
24 Nuclear import of doxorubicin at different circadian phases ...... 82
25 Comparison of mPER2 protein and doxorubicin nuclear import oscillations in C6 cells
...... 83
26 Real time analysis of Crm1 andBmal1 mRNA expression in C6 cells ...... 89
xiv
LIST OF TABLES
Page
1 Period analyses of C6 cell cultures ...... 40
2 Transport time, efficiency and entrance frequency of passive diffusion and facilitated
transport through the NPC ...... 55
3 List of primer pairs used in real time PCR analysis of clock regulation in cancer stem cell
genes ...... 80
4 Circadian properties of nuclear transport components ...... 84
5 Transcription factor binding sites of important nuclear transport components ...... 87
xv
PREFACE
This dissertation focuses on important concepts in cancer and chemotherapy. My work brings together three major projects on circadian modulation of curcumin and doxorubicin used in cancer treatments, circadian regulation of nuclear transport, and calcium regulation of nuclear transport. Chapter One provides an overview of cancer and chemotherapy, followed by the importance of two interrelated cellular processes—circadian rhythms and nuclear transport. I will also discuss the phytochemical curcumin and its role in cancer therapy. The chapter ends with a note on chronotherapy, an emerging area in chemotherapy. In Chapter Two, I describe how the circadian clock modulates the anti-cancer properties of curcumin. This is the first study to
examine the effects of curcumin on circadian rhythms in cancer cells and whether the circadian
clock is in turn altered by curcumin treatments. Cell division and cell death rates were observed
and the circadian period and phase were analyzed to find the most effective time of day for
curcumin-based chemotherapy. Chapter Three deviates from the circadian aspect of the cell; here
I study a different cellular process, nuclear transport, and how it is altered by the perinuclear
calcium ion concentrations. This is a biophysical study using a single-molecule imaging
technique to characterize the different pathways of passive and facilitated nuclear transport when
the calcium ion concentrations are altered in the cell’s calcium stores. Chapter Four connects two
concepts of circadian rhythm and nuclear transport. I tested whether the nuclear transport rate of
an anti-cancer drug varies according to circadian phase. As many anti-cancer drugs are targeted
to the nucleus, my experiments will help in designing more effective chemotherapeutic regimes.
Here, I also try to identify nuclear transport components that are circadian-regulated at the
transcriptional level through a detailed in silico analysis using a circadian database. Chapter Five
provides concluding remarks on the three major projects that I worked on, bringing together xvi
concepts of chrono-chemotherapy with regards to circadian rhythms and nuclear transport. I also
present some suggestions for future work on understanding clock control of the efficacy of other
anti-cancer drugs and, most importantly, circadian timing in nuclear-targeted drug delivery systems. These two future research directions will benefit the field of cancer chronopharmacology.
1
CHAPTER I: GENERAL INTRODUCTION
Cancer and Chemotherapy
A eukaryotic cell is complex biological machinery and is equipped with numerous cellular and molecular processes. These processes are carried out in the form of biochemical signaling pathways that enable the cell to communicate with its various compartments as well as with its immediate surroundings. Any dysfunction in these mechanisms can lead to a diseased state. These abnormal changes in the biochemical communication system can trigger uncontrollable growth of a cell and, in some cases, tumor formation. A cancerous cell is not only limited locally to the affected site but can also become metastatic and spread to various parts of the body. Cancer has been known as a disease since about 400 B.C. Some of the earliest evidence of bone cancer was discovered in human fossils and is explicitly discussed in ancient manuscripts dating back to 1600 B.C. In ancient times, cancer was thought to be an incurable disease and was surgically removed, as is done for most tumors even today. Although cancer has been recognized for a very long time, not much was known in terms of the biological mechanisms underlying the disease. For more than half of the last century, scientists worldwide have focused on understanding the biological mechanism of cancer, and this has become one of the many challenges of medicine. Hallmarks of a cancer cell are broadly defined by six major capabilities: 1) sustaining a proliferative signal; 2) evading growth suppressors; 3) activating invasion and metastasis; 4) evading replicative immortality; 5) inducing angiogenesis; and 6) resisting cell death.
Statistics show that 14.1 million new cancer cases were diagnosed in 2012, with 8.2 million cancer deaths in 2012 worldwide [1]. About 1,658,370 new cancer cases are expected to 2 be diagnosed in 2015, with about 589,430 people to die of cancer, approximately 1,620 people to die per day, in America [2].
During 1942 Goodman and Gilman showed through a series of experiments that nitrogen mustard, a chemical developed for warfare, could be effectively used to regress a lymphoid tumor grafted into mice [3].This success, though short-lived, established the principle of chemotherapy. Today chemotherapy is widely used as an independent treatment or in combination with surgery to treat metastatic cancers. Interestingly, the most important finding that came out of the early experiments by Goodman and Gilman was that alkylation agents like nitrogen mustard could be used to target neoplastic cell DNA, eventually damaging the cell enough that it dies [4]. With this concept in place, drugs like cyclophosphamide and chlorambucil and many others of the same class became a common choice of many physicians around the world as the first line of treatment for cancer patients.
Anti-folates were the second approach, and these provided brief remission of acute lymphoblastic leukemia [5]. During the 1950's, scientists tried to inhibit tumor growth by targeting RNA or DNA synthesis, and the several agents screened for this purpose marked the beginning of modern cancer chemotherapy. Novel compounds were tested on animal models of cancer and on cancer cell lines[6]. With an improved understanding of biology of cancer cells scientists have now developed drugs that target various biological processes which control the cell division cycle. However, DNA-damaging drugs are still most commonly used in combination with other classes of anti-tumor drugs. During the 1960's and subsequent years, natural products have been of much interest to cancer researchers.
3
Curcumin and its Role as Cancer Therapy
Over the past few decades, natural products have generated interest for therapeutic use in
many areas of modern medicine. One such polyphenol is curcumin, which has been used for
thousands of years in some countries but has been extensively studied only recently for its
potential anti-inflammatory and anti-cancer effects [7, 8]. Curcumin powder was first isolated in
1815, and the crystalline form was prepared in 1870 [9]. Curcumin is an active ingredient of the
perennial herb Curcuma longa (commonly known as turmeric). Turmeric is a popular Indian
spice that gives the distinctive yellow color to Indian curries [10]. The rhizome of turmeric
contains a mixture of curcuminoids, including demethoxycurcumin (DMC) and
bisdemethoxycurcumin (BDMC), along with the curcumin (CUR) (Fig. 1A). Commercially
available curcumin has approximately 77% CUR, 17% DMC, and 3% BDMC [11].
Curcumin is stable in organic solvents like DMSO, ethanol, methanol, and acetone. It is
also stable at acidic pH but degraded rapidly in basic or neutral pH [12]. Tetrahydrocurcumin is a
major degradation product, while vanillin, ferulic acid, feruloylmethane are minor degradation
products for CUR. Tetrahydrocurcumin has a better stability at physiological pH than curcumin.
Curcumin, however, shows better stability at pH above 11.7. BDMC is a more stable
curcuminoid than CUR or DMC, due to the absence of two methoxy groups [13]. Curcumin’s
anti-inflammatory, anti-microbial, and wound-healing properties result from its interaction with numerous biochemical and molecular pathways [14]. It targets transcription factors nuclear
factor-κB (NF-κB), activator protein-1 (AP-1), peroxisome proliferator-associated receptor
gamma (PPAR-γ), signal transducer and activator of transcription (STAT), Wnt/β-catenin, Nrf-
2], growth factors and their receptors [epidermal growth factor receptor (EGFR)], cytokines
[tumor necrosis factor-alpha (TNF-α) and interleukins], enzymes [inducible nitric oxide synthase 4
(iNOS), cyclooxygenase-2 (COX-2), lipooxygenase (LOX)], and genes regulating cell proliferation and apoptosis[14](Fig. 1B).
Adapted from Shanmugam, M.K., et al., Molecules, 2015 and Xu, D., et al., molecular medicine reports, 2012[7, 15].
Figure 1: Structure of curcuminoids and molecular targets regulated by curcumin. (A) The structures of three naturally occurring curcuminoids. (B) Curcumin acts on a number of molecular targets, ↓down-regulated targets; ↑up-regulated targets participating in different cellular pathways.
Curcumin acts on many transcription factors, oncogenes and signaling proteins involved in the development of cancer [16]. Curcumin inhibits the formation of tumors by acting on a variety of signal transduction pathways and molecular targets, interfering in cell cycle progression, and inducing apoptosis in cancer cells (Fig. 2). Curcumin acts on many transcription factors, oncogenes, and signaling proteins involved in the development of cancer [17]. In most cancer cells the transcription factors NF-κB and AP-1 are constitutively active. Curcumin effectively enhances apoptosis by blocking NF-κB and AP-1 signaling pathways [18]. Curcumin downregulates the activity of multiple kinases including phosphorylase kinase (PhK), protein 5 kinase C (PKC), and protamine kinase etc., thereby inhibiting inflammatory pathways either directly or indirectly [19].
Adapted from Shanmugam, M.K., et al., Molecules, 2015 [7].
Figure 2: Potential anticancer effects of curcumin. Curcumin acts on several molecular targets and signaling pathways and has anticancer effects on various cancerous cells.
Curcumin has been found to suppress initiation, progression, and metastasis of a variety of tumors (Fig. 2). It also interferes with cell cycle (Cyclin D1 and Cyclin E), cell survival
(PI3K/AKT pathway), and apoptotic pathways (activation of caspases and downregulation of anti-apoptotic gene products) as well as cell invasion(MMP-9 and adhesion molecules), cell proliferation (HER-2, EGFR, AP-1),angiogenesis (VEGF),and metastasis pathways(CXCR-4)[7,
20]. Thus, curcumin can kill or inhibit proliferation of cancerous cells through multiple 6 mechanisms[21]. Curcumin is reported to act against leukemia and lymphoma, gastrointestinal cancers, genitourinary cancers, breast cancer, brain cancer, ovarian cancer, head and neck squamous cell carcinoma, lung cancer, melanoma, neurological cancers, and sarcoma [20].
Curcumin Treatment for Gliomas
Curcumin and curcuminoid efficacy has been established in various human malignant glioblastomas or gliomas (the type of tumor formed from glial cells of brain). Curcumin inhibits
NF-κB and AP-1 signaling pathways in human and rat glioma cells [22] and has numerous other advantages against gliomas: Curcumin induces apoptosis of human glioma cells in a p53- dependent manner followed by induction of p21 WAF-1/CIP-1 and ING4 [23]. Apoptosis in glioma cells is also caused by activation of both receptor-mediated and mitochondria-mediated proteolytic pathways induced by curcumin [24].
Glioblastoma is the most lethal type of primary brain tumor [25]. One of the most aggressive forms, the glioblastoma multiforme (GBM) or astrocytoma, is shown to be suppressed by curcumin via caspase-3 dependent apoptotic pathways [26]. Another study with one type of
GBM cells concluded that curcumin either stimulates the p53 pathway by enhancing p53 and p21 and suppressing cdc2, or it significantly inhibits the retinoblastoma (RB) pathway by enhancing
CDKN2A/p16 and suppressing phosphorylated RB [27]. Studies done with five GBM cell lines showed curcumin decreased levels of STAT3, which downregulated the c-Myc gene, thereby inhibiting GBM proliferation, migration, and invasion [28].Sometimes, because of their structural differences, specific curcuminoids are more effective towards a particular type of cancer. For example, DMC was found to activate Bcl-2, which mediates G2/M arrest and leads to apoptosis [29]. DMC also inhibits cell proliferation and activation of apoptosis in the human 7
cell line of brain malignant glioma GBM 8401[30]. There are several studies on glioblastomas
and curcumin treatment; GLI1 is constitutively activated in the majority of malignant gliomas
and curcumin shows cytotoxic effects via the SHH/GLI1 pathway in vitro and in vivo [31].There
are reports of other in vivo studies that have also shown that curcumin inhibited tumor growth
significantly and induced autophagy [32]. In C6-implanted rats, intraperitoneal curcumin decreased brain tumors; it reduced tumor size and increased the number of apoptotic cells analyzed from the tumors[33]. Thus, curcumin acts as an anti-glioblastoma drug through
inhibition of the core signaling pathways of NF-κB,p53, and RB and by promotion of apoptotic
pathways. Researchers have also studied combinatorial chemotherapy for gliomas with curcumin
and classical anticancer drugs like cisplatin and doxorubicin [33]. Curcumin indirectly affects
gliomas by sensitizing them to several chemotherapeutic agents and to radiation therapy.
Circadian Rhythms
Circadian clocks are endogenous timing systems orchestrating the daily regulation of a
huge variety of physiological, metabolic, and behavioral processes [34, 35]. The master circadian
clock of mammals is located in the suprachiasmatic nuclei (SCN) of the anterior hypothalamus
of the brain [36]. Several peripheral tissues such as the pancreas, liver, adipose, and skeletal
muscles exhibit molecular rhythms leading to rhythmic control of key biological processes[37].
The SCN cells and the non-SCN cells exhibit cellular rhythms independent of each other. Even
though the master clock does not drive the circadian rhythms of the peripheral clocks, it appears
to be necessary for synchronization of rhythms within tissues to distinct phases (Fig. 3). This
synchrony can be obtained by neuronal or hormonal modes [38, 39]. The synchronization of
peripheral clocks is essential to ensure temporally coordinated physiology and is achieved 8 through still ill-defined pathways controlled by the master clock [40]. Like the neurons of the
SCN and peripheral tissues in an organism, several cultured cells contain a circadian clock[41].
These cellular clocks are driven by self-sustained molecular oscillators, generating rhythmic gene expression with a period of about 24 hours [42, 43]. Circadian rhythms are controlled by molecular clocks whose key features are (1) an input pathway that receives environmental cues and subsequently transmits them to the central oscillator; (2) a central oscillator that keeps circadian time and generates a rhythm; and (3) output pathways through which the rhythm is conveyed to control various metabolic, physiological, and behavioral processes. Circadian clocks are uniquely characterized as entrainable, self-sustained, and temperature-compensated oscillators. Circadian clocks in their entrained state match the period of the entraining signal by shifting the phase of their molecular timing mechanism. Whereas the Earth’s entraining external cycles of light and temperature are 24 hours, the endogenous period of circadian rhythms typically ranges from about 19 to 29 hours. 9
Adapted from Son, G.H., Frontiers in Neuroendocrinology, 2001[44].
Figure 3: The mammalian circadian system. The hierarchical organization of the mammalian circadian timing system showing the SCN, which resides in the ventral hypothalamus, functions as the central clock responsible for the coordination of multiple clock networks throughout the body. Signals from the SCN synchronize peripheral oscillators, such as direct neural signals through the autonomous nervous system, neuroendocrine signals such as glucocorticoids, and indirect signals such as circadian body temperature and food intake.
Molecular Mechanism of Circadian Clocks
The master clock and the peripheral clocks are similar at the molecular level [31, 32], and the circadian clock is present in virtually all cells of an organism. Molecular circadian rhythms are produced by interactions between clock genes and the proteins they encode. They are caused 10
by autoregulatory transcription-translation feedback loops (TTFL) in which two basic
transcription factors CLOCK and BMAL1 dimerize and bind to E-boxes (CACGTG) and similar elements in the promoters of three mammalian period (mPer) genes and two cryptochrome (Cry)
genes, inducing expression at a particular time of day [45]. The TTFL involves the core clock
genes Bmal1, Clock, Period (Per1, Per2 and Per3) referred to as Per1/2/3, and Cryptochrome
(Cry1 and Cry2) referred to as Cry1/2. Core clock components are defined as genes whose
protein products are necessary for the generation and regulation of circadian rhythms within
individual cells throughout the organism. Any alteration of the levels of the core clock proteins
changes the phase of the circadian clock (Fig. 4).
The basic-helix-loop-helix (bHLH) transcription factors CLOCK and BMAL1 dimerize
and form the primary loop as they activate transcription of the Per1/2/3 and Cry1/2 genes. The
mPER and CRY proteins then form a complex that is transported into the nucleus where it
inhibits the activation of their own genes and indirectly Clock-Bmal1, thereby closing the feedback loop. The outcome of this loop is the oscillation of Per and Cry transcripts and their protein products.
A second feedback loop stabilizes the first loop and is composed of REV-ERBα and
RORα, two retinoic acid-related orphan receptors who repress and activateBmal1, respectively,
leading to an anti-phase oscillation in Bmal1 expression relative toper and cry gene activation. In
addition, the CLOCK/BMAL1 dimers regulate expression of many clock-controlled genes [46-
50].
11
Adapted from the website http://www.hhmi.org/research/molecular-and-genetic-analysis- mammalian-circadian-clocks [51].
Figure 4: Model of the circadian clock mechanism. The circadian clock mechanism is composed of autoregulatory transcriptional feedback networks. CLOCK and BMAL1 proteins heterodimers and bind to DNA of clock target genes at E-boxes and initiate the transcription of their RNA. The resulting PER and CRY proteins dimerize in the cytoplasm and translocate to the nucleus where they inhibit CLOCK/BMAL1 proteins from initiating further transcription [47, 51, 52].
Termination of the repression phase of PER and CRY is an essential step that completes
the TTFL using the enzymes casein kinase (CK)1ε and CK1δ. CK1ε/δ-mediated phosphorylation
targets PER proteins for ubiquitination by βTrCP and degradation by the 26S proteasome, which
marks the termination of PER and CRY-induced repression and allows a start of new of Per and
Cry transcription. CRY proteins are phosphorylated by a different set of kinase enzymes;
AMPK1 and DYRK1A/GSK-3β phosphorylate CRY1 and CRY2, respectively. Following 12
phosphorylation, CRY is polyubiquitinated by FBXL3 protein and targeted for proteosomal
degradation (Fig. 4). The stability and degradation rates of PER and CRY are key to setting the
circadian period of the clock [53-55].
Nuclear Transport
The regulated gene expression control in eukaryotic cells is attributed to their compartmentalization into cytoplasm and nucleus. The nuclear envelope (NE) plays a vital role
in the process of transcription and translation by transporting proteins and RNA into and out of
the nucleus. Nuclear transport also plays an important role in shuttling of core clock proteins.
Large protein complexes known as nuclear pore complexes (NPCs) are embedded in the nuclear
envelope and serve as gateways for the bidirectional transport of macromolecules. NPCs strictly
control the nuclear-cytoplasmic traffic of molecules. Since the discovery of NPCs in the 1950s,
there has been much research on NPC structure, composition, and functions [56, 57]. The 3D
structures of NPCs, with a mass of approximately 125 MDa, show a basic framework of eight-
fold rotational symmetry in the plane of the membrane[58]. The central framework has a
diameter of 50 nm in the mid-plane and the axial length of vertebrate NPCs is almost 200 nm
[59]. Each NPC is composed of multiple copies of proteins, known as nucleoporins (Nups), from
approximately 30 different gene products that can be grouped into three functional classes: (i) the transmembrane Nups that anchor the pore complex to the NE, also known as POMs, pore membrane proteins; (ii) the structural Nups that are responsible for the shape of the pore and also help in assembly of the peripheral Nups; and (iii) the Nups with phenylalanine-glycine repeats
(FG Nups), which have a prominent presence in NPCs and provide binding sites for transport receptors, thus playing a significant role in nuclear-cytoplasmic transport [60-63] (Fig. 5). 13
Adapted from Adams, R.L.,et al., Cell, 2013 [60].
Figure 5: Structure of nuclear pore complex. Schematic of the nuclear pore complex (NPC) architecture. The measurements indicate dimensions for human NPC from cryo-electron transmission microscope.
Nucleocytoplasmic transport (NT) of smaller molecules is fairly straightforward as they can permeate through the pore, but for molecules larger than 40 kDa the transport is mediated by
NT receptors (NTR). They recognize the specific signal-bearing proteins for transport by interacting with Nups and delivering their cargo to their destination, either within or outside the nucleus. The transport receptor proteins, especially ones in the karyopherin β family, are responsible for import of cargo proteins into the nucleus by recognizing a nuclear localization sequence (NLS) in the cargo proteins. The karyopherin β family consists of the importin β-like proteins (Imp β), which associate with their macromolecular cargo in the cytoplasm either directly or via adaptor proteins such as the importin α isoforms [64]. 14
Other transport receptors responsible for export of proteins from the nucleus recognize a
nuclear export signal (NES) in cargo proteins. One such transport receptor, chromosome region
maintenance 1(CRM1), is a very important member of the export receptors, which recognizes the leucine-rich NES[65]. The composition and constituents of amino acids in these transport receptors make them flexible molecules, stretching and compressing their domains for smooth transport inside the pore[66]. For nuclear import, an import complex assembly is formed, with the cargo proteins carrying a classical basic NLS, the receptor molecule importin β, and the adaptor importin α that bridges between the cargo and receptor molecules. This complex then translocates through the NPC with the help of FG Nup interaction, and on reaching the nucleus the import complex disassembles, followed by recycling of importin α and Importin β back to the cytoplasm. Importin β is recycled by its association with RanGTP, whereas importin α is
exported to cytoplasm by a transport receptor-CAS (Fig. 6A).
In nuclear protein export, the transport receptor CRM1, the cargo protein carrying the
NES signal, and the RanGTP form a trimeric complex which is exported out of the nucleus. In
the cytoplasm, RanGAP stimulates Ran to hydrolyze its bound GTP to GDP (Fig. 6B). The resulting conformational change in Ran causes dissociation of the cargo complex, releasing
CRM1 and Ran GDP, which are recycled back to the nucleus [64, 66-71].
15
Adapted from Jamieson,C., et al., Seminars in Cancer Biology, 2014 [72].
Figure 6: Nucleocytoplasmic transport. (A) Nuclear import of molecules, where proteins carrying a NLS signal bind to an Imp-α/β complex. Imp-β facilitates passage through the NPC by contacting nucleoporins. The complex dissociates in the presence of RanGTP. Imps α/β are re- cycled back to the cytoplasm for the next round of import. (B) Nuclear export of molecules, where cargo proteins containing a nuclear export signal (NES) bind to CRM1 in the presence of RanGTP. CRM1 interacts with nucleoporins and transports protein substrates across the NPC. The complex dissociates in the cytoplasm where RanGTP is hydrolyzed to RanGDP.
Calcium Regulation of Nuclear Transport
Intracellular calcium ions (Ca2+) are responsible for several cellular processes including membrane potential, neurotransmitter release, and gene expression. Shifts in the intracellular ionic environment affects proper functioning of the cell. Ca2+ is important for regulation of cell functions and has an impact on nearly every aspect of cellular life. There is a circadian component to the calcium signaling in cells [73]. Clock proteins also have an effect in calcium 16
signaling; mitogen-activated protein kinase (MAPK) phosphorylates BMAL1[74], repressing
BMAL1/CLOCK activity. Putative mechanisms linking melatonin rhythms and the circadian
clock include repression of adenylate cyclase and protein kinase A, a pathway known to
influence cAMP-responsive element (CRE)-binding protein (CREB) activation. A second
mechanism is thought to activate the MAPK–CREB cascade [75] through Ca2+ influx, leading to
transcriptional activity through CRE elements in the per gene promoters [76].
Transport of macromolecules across the NE is essential for the cell, but change in gene
expression of NPC components or the transport machinery may change the NPC structure. The change in NPC structure such as altering the functional diameter may even impede NT. Calcium is believed to be one of the many players that change nuclear pore structure and function if its intracellular or intraluminal concentration is altered. Apart from the mitochondria, the major Ca2+
stores for the cell are the endoplasmic reticulum (ER) lumen and its continuation into the
perinuclear luminal space of the NE, which holds near millimolarCa2+concentrations [77]. The
nucleus is surrounded by this calcium storage compartment, which sequesters and releases
calcium in response to intracellular second messengers, which are regulated by calcium channel
receptors located on the cytoplasmic and nucleoplasmic sides of the NE [78, 79]. Inositol 1,4,5-
trisphosphate (IP3) binds to one such calcium channel receptor IP3 receptors and releases calcium from the stores into the cytoplasm or the nucleus. Conversely, high calcium concentrations in the stores are maintained by ATP-dependent calcium uptake pumps, which sequester calcium back into the stores. However, the store calcium concentration can be depleted by a specific calcium ion ionophore or by calcium ion chelators like bis-aminophenoxy ethane-tetraacetic acid
(BAPTA) or if the calcium pump mechanisms are disabled, for example, by thapsigargin (Tg), a 17
specific inhibitor of the calcium ATPase pump [77, 78, 80-84]. Thapsigargin is extracted from a
plant Thapsia garganica.
Studies by previous research groups show connections between the NPC structure and
store Ca2+ concentrations. There are contradictory results for conformational changes in NPC,
with respect to the depth of the central pore and the diameter of the pore following Ca2+ depletion
from the perinuclear space[85]. Atomic force microscopy studies reveal that higher calcium in the
stores created well-defined central pore which was not observed when store calcium levels were
depleted. Although some research groups have shown NPC structural changes with depletion of
Ca2+ from stores, there are contradictory results as to how the structure changes [86-92].
The structural changes in NPC are correlated with NT rate. Speculations on unavailability
of FG Nups due to pore structural changes are responsible for inhibition of NT were made [91,
93]. A research study with two specific Nups showed that with different levels of store calcium concentrations, with changes in location of Nup153 and Nup21 in the nuclear pore [94]. With little agreement that NPC structural change by cell Ca2+ levels may affect nuclear trafficking,
there remains a constant debate on this issue. Different lines of thoughts based on three
hypotheses were speculated. First, both passive diffusion and active transport are inhibited when
Ca2+ levels are depleted from the cell. Second, passive diffusion alone is slowed, but active transport is independent of luminal Ca2+ ion stores in the cell. Third, Ca2+ levels regulate NPC
permeability only during facilitated transport[85]. Passive diffusion of 10 kilodalton (kDa)
dextran molecules was reported to be affected by calcium store depletion and some extended the
study to facilitated transport of 27 kDa GFP and 21 kDa H1 histone proteins which were also
regulated by store calcium stores[86, 95-97]. Some studies attribute these changes to specific Nup
gp210, a transmembrane Nup, which senses changes in calcium levels in the NE, thereby 18
mediating structural and functional changes in NPC [98]. Increases in cytosolic calcium also have
an effect in NT by increasing the transport rate of molecules, as shown in one study [99].
Researchers propose that changes in internal diameter of the pore or a change in spatial
distribution in FG Nups due to alterations in calcium levels are main reasons for the changes in
nuclear transport rates [100, 101]. In contrast, there are several reports stating that the transport
modes are independent of luminal calcium stores, whether it is passive diffusion of 10 kDa
dextran molecules or facilitated transport of 27 kDa[102-104] (Fig. 7).
Innovative strategies and detailed studies are needed to clarify the conflicting role of store
Ca2+ in regulating NPC structure and function. All previous investigations on Ca2+ effects on nuclear pore permeability were carried out by ensemble measurements in which important information is lost by averaging signals. To determine molecular mechanisms of NT a monitoring of individual transiting events becomes essential. Specialized single-molecule imaging techniques are required to measure detailed kinetic parameters like transport time, transport efficiency, and spatial locations of transiting molecules within the sub-micrometer-sized NPC. 19
Adapted from Sarma, A., et al., Proteins and Cell, 2011 [85].
Figure 7: Controversial data regarding calcium-mediated nucleocytoplasmic transport. (A) Nucleocytoplasmic transport of cargo molecules affected by calcium depletion from the stores. Figures a and b show examples of how passive diffusion of molecules (10 kDa dextran molecules) is inhibited at calcium-depletion condition. Figures c and d are examples of active transport of molecules inhibited in the absence of calcium. (B) Some results demonstrated that nucleocytoplasmic transports of molecules were not regulated by the calcium depletion from the stores. Figure a shows that there was no change observed in passive transport of fluorescent 10 kDa dextran. Figures b and c show that active transport was not altered with absence of calcium.
Nuclear Transport Components and Their Role in Cancer
Dysregulation in nuclear transport can result in subcellular mislocalization of molecules,
which could result in tumor growth, inflammatory responses, and apoptosis [105, 106]. Defects
in the NT of NF-κB, and its localization in the nucleus is found in many cancer cells, which 20 occurs due to phosphorylation of IκB and unmasking of the NLS sequence of NF-κB, promoting nuclear import[107]. Mutations in the tumor suppressorp53 are reported in most of the human cancers. It is also reported that p53 sequestration in the cytoplasm may cause p53 inactivation
[108]. Evidence indicates that persistent export by CRM1 is needed to prevent nuclear accumulation of p53 with increased export[109]. Therefore, CRM1 activity levels likely determine whether p53 has access to the nucleus, a property that appears diminished in cancer cells.
CRM1 is the most studied and best understood nuclear transport receptor targeted in cancer therapeutics [110]. CRM1 binds to nuclear pore proteins, playing an important role in NT.
Additionally; it plays a role in centrosome and spindle assembly, especially in response to DNA damage.CRM1 levels are elevated in most of the cancer cells including gliomas [111]. There is a vast literature on how CRM1 facilitates export of tumor-suppressive proteins and oncoproteins like retinoblastoma, p53, BRAC1 (breast cancer1), Survivin (an apoptosis inhibitor), neucloplasmin, Activated Protein C and FOXO proteins, INI1/hSNF5 (chromatin remodeling complex), galectin-3, Bok (apoptosis inducer), RASSF2 ( Ras association domain-containing protein 2), Merlin (a tumor suppressor), P21, p27, estradiol receptor and Tob (anti-proliferative protein), drug targets topoisomerase I and IIα and BCR-ABL, and the molecular chaperone protein Hsp90. In cancer cells, there is a higher level of these proteins in the cytoplasm[112].
The export of oncoproteins is reversed by CRM1 inhibitors and this property is explored for cancer therapeutics. Leptomycin B is a known CRM1 Inhibitor[113], but clinical trials with
Leptomycin B proved toxic for patients, so small molecules that are classified as SINE (Selective
Inhibitors of Nuclear Export), interfering with cargo-NES binding, are being studied and used in clinical trials. CRM1 inhibitors in combination with chemotherapeutics such as pegylated 21 liposomal doxorubicin, platinum drugs (cisplatin and oxaliplatin), proteasome inhibitors
(bortezomib and carfilzomib), or tyrosine-kinase inhibitors (imatinib) are also being examined and may prove effective in the treatment of cancer[105, 110, 114-116].
Along with the nuclear transport receptors, poorly regulated expressions of nuclear pore proteins are related to different cancers. Overexpression of Nup88 [117]or absence of Nup88, which is associated with CRM1 export, leads to increased nuclear export of certain tumor suppressor molecules like NFκB. Some Nups are involved in chromosomal translocations where there is interchange of parts between two non-homologous chromosomes causing cancer in many cells. Nup98, Nup214, and trp nuclear pore proteins contribute to cancer, especially in leukemia, by chromosomal translocation. For example, it has been established that Nup98/NSD1, a fusion of Nup98 is responsible for upregulation of both HOXA9 and MEIS1 genes. Also, Nup214 interacts with Dek and Set, which are all chromatin binding proteins. These mechanisms appear to lead to leukemogenesis [118, 119].
Nuclear Transport Components and Clock Proteins
To establish the autoregulatory feedback loops, clock proteins are required to be transported in and out of the nucleus. NT of these clock proteins is a vital checkpoint for the correct pace of the circadian clock [120]. The timing of clock protein entry, residence time in the nucleus, and export of these proteins and mRNA are critical to maintain the timing of circadian feedback loops [121].
Most of the clock proteins contain one or more NLS proteins, and importin α and β mediate the nuclear import [122, 123]. Studies performed with Drosophila show that the time during which clock proteins reside in either of the two compartments determines the period 22 length of circadian rhythms, and mutations in per gene cause phase delays and changes in period
[124]. The clock proteins CRY and mPER are imported into the nucleus and repress their own expression. In Drosophila dPER and dTIMELESS (dTIM) are located in the cytoplasm during the day where they accumulate until they herterodimerize, which masks the cytoplasmic localization domains triggers nuclear entry, and results in both proteins being mostly in the nucleus during the night [125]. Mouse clock proteins mCRY1 and mCRY2 also form a complex with mPER2, which helps nuclear entry of mPERs [126]. Rat PER2 enters the nucleus in a similar manner [122]. PER2 proteins have a bipartite NLS in the carboxyl end so that transport receptors can identify the protein a cargo. Mutations in the NLS sequence as well as phosphorylation-dependent masking of the NLS prevent their nuclear entries. For example, casein kinase-Iε blocks the mPER1 NLS in a kinase-dependent manner and controls the rate of mPER2 nuclear entry [127]. Studies have also shown that the PER NLS and the CRY NLS are important for nuclear entry of the PER-CRY complex [123].
Along with NLS, clock proteins also have a NES for export of the proteins back to the cytoplasm so that nuclear accumulation is limited and the circadian oscillator is properly regulated. The transport receptor CRM1 is a major player in nuclear export as it binds to the leucine-rich NES in clock proteins and transports them to the cytoplasm [128, 129]. BMAL1 has a CRM1-dependent NES for its export to the cytoplasm. The nucleocytoplasmic shuttling and the phosphorylation states of some clock proteins like BMAL1 are temporally regulated and they help in maintenance of circadian oscillations [130, 131].
Importin β and Importin α also mediate the nuclear transport of CRY2 and PER2 proteins. Importin α belongs to a multigene family, and Imp α1, Imp α3 and Imp α7 are all capable of nuclear import of clock proteins [123]. Imp α2 (Kpna2) overexpression causes 23
cytoplasmic accumulation of PER1 and PER2 resulting in impairment of clock functions [132].
A recent finding shows that, KPNB1,or Imp β is responsible for regulated nuclear translocation
of the PER-CRY repressor complex without independently of Imp α. Deletion of the KPNB1 component from Imp β, using molecular methods, blocks the nuclear entry of PER proteins and traps the PER-CRY complex in the cytoplasm, terminating the circadian rhythms in the cell
[133].
One study reported that Nup153 is responsible for PER-TIM nuclear entry. Of the following Nups they examined; Nup214, 88, 153, 154 and Megator/trp, they found Nup153
causes arrhythmicity and lethality. They also report that RanGTPase is also an integral part of the
process where it helps in the dissociation of the nuclear PER-TIM complex [134]. These reports suggest an important but uncharacterized role of NT in proper clock functioning. Disruption of circadian rhythms can lead to deregulated cell proliferation followed by tumorigenesis [135,
136]. Because a regular circadian schedule and proper functioning of clock components appears to protect cells from various cancers, I chose to explore the circadian timing of NPC mechanisms and its potential role in medicine.
Chronotherapy
Chronotherapy is the administration of drugs at the appropriate phases of the circadian clock to obtain the best therapeutic response. Most biological functions are rhythmically modulated by the circadian system. The circadian timing system controls cell cycle progression,
DNA repair, and apoptosis. It also controls the physiological and molecular mechanism of anticancer drug efficacy that includes metabolism and transport, bioactivities, detoxification, and elimination, which provide the basis for chrono-chemotherapy[137]. There is, for example, a 24
strong circadian component to the nucleotide excision repair rate and cell cycle regulation in
cancerous cells, thus, possibilities for improving chemotherapy and, radiotherapy by appropriate circadian time delivery or by modulating the core circadian system are becoming apparent [138]
(Fig. 8).
Adapted from Levi, F., et al., Annual Review of Pharmacol. and Toxicol., 2010[139] Figure 8: Main cellular determinants of cancer chronotherapeutics. The circadian timing system (CTS) determines the optimal circadian timing of anticancer medications. The CTS controls drug transport, bioactivation, detoxification, metabolism, targets, and elimination, which account for the chronopharmacology of anticancer agents at cellular, tissue, and whole organism levels. The CTS also regulates several cell-cycle-related events, as well as DNA repair and apoptosis, which account for the chronopharmacodynamics of anticancer drugs.
Studies in rodents and human have revealed that drug delivery time is critical for
treatment tolerability and drug efficacy. Around 40 anticancer drugs, including cytostatics,
cytokines, and targeted biological agents, in mice or rats were tested and they show a 2 to 10-
fold increase in toxicity when a particular circadian timing is used for drug delivery. Within the
24-hour period, the membrane viscosity or permeability, receptor density or binding of 25
enzymatic activities, and transport of repair proteins and ion channels were observed after drug
administration and these showed a 24-hr rhythmicity [140]. Studies are now targeting systemic
mapping of critical pathways of anticancer drug chronopharmacology for optimizing treatment
effects and tailored drug delivery [141] .
In summary, this dissertation is focused on the core topics of cancer and chemotherapy.
Three major projects are described in the following chapters to examine the importance of
circadian rhythms and the regulation of nuclear transport in relation to possible cancer
treatments. To increase the efficacy of cancer treatments various drugs were often used in
combination, curcumin being one of them. The circadian clock modifies the effectiveness of
cancer treatments; the hypothesis tested was how the circadian clock will modulate the efficacy
of curcumin treatment. The results provided a time window during the day when this anti-cancer
agent is likely to be most effective at the cancer cell level.
One project focuses on nuclear transport and the calcium stores in perinuclear spaces.
Studies suggest a link between the perinuclear Ca2+ store concentration and NPC structure and function. But due to lack of advanced imaging techniques, there are some contradictory views on intracellular Ca2+ level effects and regulation of NT. My work with single-molecule imaging
gives a deeper insight into NT in response to different Ca2+ concentrations as well as a clearer
picture of NT mechanisms.
The NT process is very accurate and timely in a normal cell. Regulated nuclear entry of
the clock proteins is essential for the generation and maintenance of molecular circadian
oscillations and, ultimately, circadian behaviors of the organism. I tested the hypothesis that the
clock might regulate NPC function. With an anti-cancer drug doxorubicin I studied the nuclear
uptake of the drug to the nucleus at different circadian phases and found that it is modulated by 26 the clock. Furthermore, understanding this mechanism will help in designing more effective chemotherapeutic regimes because many chemotherapeutic drugs are targeted to the nucleus. I also found that expression of some of the Nups and nuclear transporters is under clock control.
In all the three projects, there is emphasis on understanding the cellular process of circadian rhythms and nuclear transport in relation to cancer and how chemotherapeutic drugs are affected by cellular processes.
27
CHAPTER II: THE CIRCADIAN CLOCK MODULATES ANTI-CANCER PROPERTIES OF CURCUMIN
Preface
This chapter is being prepared for submission to a cancer biology journal. Figure 17 in this chapter is from collaborative work with Drs. Arindam B. Sarkar and M. Chandra Sekar, of the University of Findlay who performed HPLC measurements.
Introduction
Curcumin is a promising phytochemical that is currently being evaluated for use in treating several cancers. This ingredient of the spice turmeric has been used as a remedy for thousands of years because of its anti-inflammatory, anti-microbial, and wound-healing properties [14]. Curcumin’s anti-cancer properties have much potential when used alone or in combination with standard chemotherapies or radiation treatments. It arrests tumor cell proliferation by inhibiting multiple signal transduction pathways, interfering with the cell cycle, and inducing apoptosis. Unlike numerous other agents currently used to target cancer cells, it is reported to have little or no negative effects on normal cells [142]. The molecular targets of curcumin and related curcuminoids include several transcription factors, oncogenes, and signaling proteins engaged in cancer initiation and progression [16, 17] (Fig. 9). For example,
NF-κB (nuclear factor-κB) and AP-1 (activator protein-1) are constitutively active in many cancer cells, and curcumin enhances apoptosis by blocking signaling pathways that rely on these transcription factors [18, 21]. Curcumin has multiple molecular targets in various types of cancers including gliomas [143]. Curcumin inhibits proliferation and induces cell death in C6 glioma cell lines. Additionally, curcumin used in combination with cisplatin and doxorubicin, 28 common chemotherapy drugs, induces apoptosis in glioblastoma cells lines [144]. Naturally- occurring curcuminoids in the turmeric root include the two congeners, demethoxycurcumin
(DMC) and bis-demethoxycurcumin (BMC) and degradation products such as tetrahydrocurcumin [145-147]. Although curcumin has poor bioavailability and is degraded rapidly in the body, anti-cancer activity has also been attributed to the congeners and curcumin degradation products, which may persist longer in tissues than curcumin [147].
Another factor influencing the efficacy of cancer therapies is the circadian rhythm that is prominent in many physiological processes [148]. The circadian timing system generates near
24-hr rhythms in the body through autonomous intracellular circadian clocks, including ones identified in many cancer cells [149-152]. It has been speculated that circadian timing within some cancer cell types increases their growth or survival [153]. As the molecular mechanism of clock genes and proteins are explored in-depth, chemotherapy regimens based on the circadian clock are being developed and tested [154].
It is possible that curcumin pharmacokinetics are modulated by the circadian clock, and the molecular circadian timing within clock cells may be altered by curcumin treatments. For example, the clock gene Bmal1 that is a critical part of the molecular oscillator producing circadian rhythms is a likely curcumin target. Bmal1 is activated by curcumin through stimulation of PPAR-γ [155, 156]. Studies also suggest that polyphenols such as curcumin activate sirtuin1 (SIRT1), which regulates circadian rhythms. SIRT1, a histone deacetylase, indirectly controls the circadian clock by (1) down-regulating NF-κB [157]; (2) inhibiting nuclear localization of the clock protein mPER2 through deacetylation of the tumor suppressor
PML [158]; and (3) binding to the CLOCK-BMAL1 dimer, promoting deacetylation and degradation of mPER2 [159]. Thus, curcumin can potentially influence circadian rhythms in 29
normal and cancer cells, although it has no reported effects on the circadian timing system (Fig.
9).
Adapted from Wilken, R., et al.. Molecular Cancer, 2011 [18].
Figure 9: Overview of curcumin’s anticancer effects and interactions with circadian clock components. Curcumin suppresses NF-κB activation, leading to suppression of many NF-κB- regulated genes involved in tumorigenesis. Curcumin is involved in cell cycle control and stimulates apoptosis. Curcumin activates PPAR-γ, an inducer of Bmal1 gene expression, and also activates SIRT1 to regulate circadian clocks.
Drug chronotherapy, using the circadian system to optimize pharmacokinetics or
pharmacodynamics, is becoming a more established medical approach [160]. Many proteins
involved in drug absorption, metabolism, and elimination display daily oscillations. Studies with
rodents show different effects and toxicities from chemotherapeutic drugs depending on time of
day of administration [161]. Reported circadian regulation of chemotherapeutic treatments
includes anticancer drugs 5-flurouracil (5-FU), platinum complex analogs of cisplatin,
carboplatin, and oxaliplatin, doxorubicin, riscovitineet [162-165]. Some but not all of these
effects likely depend on the ability of circadian clocks to regulate daily cell division timing. The
most effective time of day when chemotherapies based on curcumin should be administered to 30
patients is unknown. In this study, we identified a phase of the circadian cycle when a low dose
of curcuminoids is most effective at inducing death of rat glioma cancer cells in vitro, and we
found that circadian rhythms in gene expression persist at this dosage.
Methods and Materials
Cell Culture
Rat C6 glioma cells were cultured in what was designated as complete medium that
consisted of Dulbecco's Modified Eagle Medium (DMEM) containing penicillin (100 units/ml),
streptomycin (100 µg/ml), 10% fetal bovine serum (FBS) and with no pyruvate or phenol red.
Cells were grown in 100-mm tissue culture dishes and incubated at 37°C in 5% CO2. Cells were passaged when they reached near confluency. C6 cell lines were cotransfected with amPer2::mPer2::luc construct, which produced a fusion protein containing mPER2 and firefly luciferase, and CMV::neo[166] These cells were used for most of the experiments.
Bioluminescence Assay
C6 cells containing the mPer2::mPer2:luc reporter gene were seeded (105 cells/dish) in
35-mm tissue culture dishes and incubated in DMEM medium containing 10% FBS at 37°C in
5% CO2. When the plates were 90-100% confluent, the cells were washed twice with a 10mM
Hepes-buffered, low-bicarbonate, phenol red-free DMEM designed for use in room air, along
with 10% FBS, designated as final medium (FM), After an exchange with Hepes-buffered
medium, cells were treated with 20 µM forskolin for 2 hrs to synchronize the cellular circadian
clocks. Immediately before imaging, 0.2 mM of the luciferase substrate luciferin was added. For
the other set of experiments with low-dose curcumin, 12 hrs after forskolin treatment, 0.2 mM 31 luciferin and 5 µM CUR (Sigma-Aldrich) were added to the plate. To monitor rhythmic expression of the clock protein, bioluminescence was recorded using a Wallac Victor 1420
Multilabel plate reader (Perkin Elmer). The plates were maintained at 37 ºC while readings were taken repeatedly for 50 or 96 hrs. The background noise was subtracted from each reading and signals were summed across replicate cultures.
Curcumin Treatment
To determine the effect of different doses of curcumin and to study the circadian rhythms in cell division and cell death, C6 cells were seeded at a density of 6 x 105cells in 60-mm dishes containing complete medium and grown overnight to 50% confluency. They were then given one of three treatments: 20 µM forskolin in FM for two hrs, forskolin for two hrs followed by 5 µM
CUR or forskolin followed by 10 µM CUR. For forskolin treatment, the cells were washed twice with 5 ml FM, the medium was exchanged with 20 µM forskolin in FM, and cells were incubated for 2 hrs at 37°C. Curcumin (Sigma-Aldrich C-1386) as dissolved in dimethyl sulfoxide (DMSO) to make a stock solution of 25 mM Curcumin. For each experiment the stock solution was diluted to a final concentration of 5 µM or 10 µM in final medium. Following the treatments, the cells were imaged continuously and mitotic and apoptotic events were counted at
5-min intervals.
Long Term Time-Lapse Cell Imaging
To image individual mitotic and apoptotic events a single field of view was captured at 5- min intervals using time-lapse videography continuously over 4-6 days. The imaging system was custom built using an inverted microscope with a 20X objective lens, red LED light source, and a 32 digital color camera. The system was placed inside a 37°C incubator to maintain ideal culture conditions. Time-lapse recording software FLIX captured live cell events, and images were analyzed with ImageJ software (NIH).
Immunocytochemistry
Immunofluorescence staining was used to identify apoptotic cells and verify the peak and trough of the circadian rhythm in apoptotic events. C6 cells were seeded (105 cells/dish) in 35- mm tissue glass bottom dishes (MatTeck cooperation) and incubated in DMEM medium containing 10% FBS at 37°C in 5% CO2. Cells were then fixed in 100% methanol for 5 minutes and standard immunocytochemistry methods were used to identify cleaved caspase-3-positive cells. Primary antibody anti-cleaved caspase-3 antibody (Cell Signaling) was used in 1:1000 dilution. The samples were rinsed after overnight incubation at 4°C, and were incubated for 2 hrs with Alexa488-conjugated, complimentary secondary antibody. For nuclear staining, cells were stained with Hoechst 33342 (10-20 ng/ml, Invitrogen) for 2 minutes. Cells were imaged with a
DMI3000B inverted fluorescence microscope (Leica Microsystems) and a Rolera Thunder cooled-CCD camera with back-thinned, back-illuminated, electron-multiplying sensor
(Photometrics), with Metamorph software controlling image acquisition and data analysis
(Molecular Devises). An X-Light spinning-disk confocal unit (CrestOptics) and a Spectra X
LED light engine (Lumencore) was also used, Images were collected with a 40X objective lens and standard DAPI and fluorescein filters. Images were also analyzed with ImageJ software
(NIH).
33
Curcumin Localization in C6 Cells
For autofluorescence imaging of curcumin in C6 cells, C6 cells were grown in 35-mm glass-bottom dishes (MatTeck cooperation). The following day, cells were treated with 5 µM
CUR dissolved in dimethyl sulfoxide and incubated at 37°C. After 1 hr and 24 hrs, cells were washed with final media and curcumin fluorescence in the cells was imaged using standard fluorescein filters. Images were captured with the confocal fluorescence imaging system and a
63X oil immersion lens. After 24 hrs, cells were fixed and stained with Hoechst and imaged again using DAPI filters.
Spectral Analysis of Curcumin
The absorption spectrum of phenol red-free DMEM with 10% FBS was measured after adding 5 µM CUR dissolved in dimethyl sulfoxide (DMSO). In a second set of measurements, cells were grown in 60-mm dishes with 5 µM CUR. A GENESYS 10S UV-Vis
Spectrophotometer was used to measure spectra at 0, 4, 8, 12, 24, 48, 72 and 96 hrs after adding curcumin (scanning mode 200-600 nm). Curcumin absorbs maximally near 430 nm.
For the high performance liquid chromatography (HPLC) studies a Hewlett-Packard 1050
HPLC system consisting of a quaternary pump (79852A), an autosampler (79855A), a degasser
(G1303A), a diode-array-detector (HP1046A), and solvent tray were controlled with
Chemstation software. The stationary phase consisted of a Zorbax Eclipse Plus column along with a compatible Zorbax Eclipse Plus Phenyl Hexyl pre-column. The mobile phase consisted of
45% acetonitrile and 55% Buffer-pH 3.0 (1% acetic acid). The pH was adjusted with triethanolamine (approx. 400 µl/L). The run time was 15min. The column was maintained at 34
30oC. The flow rate was 1.0 ml/min, and injection volume was 10 µl, while detection wavelength
was 420 nm.
Data Analysis
For circadian mPer2 rhythm measurements, total 1-hr bioluminescence signal from each
dish was collected repeatedly for up to 4 days. After background subtraction, each time series
was detrended by subtracting a 24-hr running average. A five-point running average was then
applied, and the time when peaks occurred was measured. For continuous imaging of mitotic and
apoptotic rates, the cell counts taken from each image frame were summed into 1-hr bins. The
average hourly rates for each day were compared by two-tailed Student t-test and ANOVA.
Circadian periods were measured using different methods as follows. Period estimates were taken as the average time between peaks during the first three circadian cycles. Period stability was determined as the average difference between the periods of the 1st and 2nd circadian cycles. The dominant period within averaged time series was also found by Fast Fourier
Transform analysis (Origin Labs). Period estimates of rhythms were determined using a Lomb-
Scargle periodogram MATLAB program (LOMB), Fast-Fourier Transform (OriginLab software,
Microcal) and The Maximum Entropy Method (MEM, kSpectra Toolkit software,
SpectraWorks,). When multiple peaks were found using MEM the peak within the circadian range (19-29 hrs) was used as the most precise measure of the circadian rhythm. Modulo 24 h of the time of the first peak of a circadian cycle from the start of the time series was used to calculate the phase of the oscillation Circular statistics (Rayleigh test for randomness) were performed (Oriana, Kovach Computing Services) and the mean phase vector was calculated to describe the phase of circadian rhythms. Other statistical tests were performed using OriginLab 35 software. Data set means were compared using Tukey’s multiple comparison test, Chi-square analysis, Mann-Whitney U test, and one-way analysis of variance (ANOVA) followed by
Scheffe post hoc test (p< 0.05). Linear correlation was performed with OriginLab.
Results
Circadian Rhythms Persist at Low Curcumin Concentrations
To test for an influence of the circadian clock on curcumin’s ability to suppress mitosis and cell survival, we needed a cell line known to express circadian rhythms in gene expression and a low dose of curcumin (CUR) that would cause limited but significant cell death [167].
Because curcumin acts on many intracellular signaling pathways [168] it was important to avoid suppressing the molecular mechanism of the circadian oscillator. Although comparatively benign towards non-cancer cells, curcumin has cytotoxic effects on many glioma cells [144, 169-
175]. We choose the C6 rat glioma cell line that has been shown to produce circadian rhythms in expression of the core circadian clock gene mPer2 in attached cell cultures [167] and in tumorspheres cultures[176].
We used C6 cells stably transfected with a reporter gene that generates a fusion protein of mPER2 and firefly luciferase under control by the mPer2 gene promoter [176]. Circadian clock cells in cultures of these mPer2::mPer2:lucC6 cells were synchronized with a 2-hr forskolin treatment. Starting 12 hrs later, to allow acute forskolin effects to subside, medium was exchanged with medium containing curcumin dissolved in 0.1% DMSO. This pulse of curcumin was intended to mimic a single delivery of the drug either intravenously or intracerebrally to a cancer patient and was expected to be degraded in vitro over the next few hrs based on the known properties of curcumin [177, 178]. 36
We examined a C6 culture expressing the mPER2-LUC fusion protein and detected a significant rhythm of 25.16 hrs (p<0.001)(Fig. 10B), according to Lomb-Scargle periodogram
(LS) analysis and 25.51 hrs according to FFT (Fig. 10C).Whereas when the same cells were examined for rhythms without the forskolin pulse, there was no rhythm in the cell culture (Fig.
10A).The mPer2::mPer2:lucC6 cells expressed circadian rhythms in cultures given 5 µM CUR
(Fig. 11A). C6 cell cultures in medium with 10% FBS are reported to have a 23.5-hr circadian rhythm when measured with a destabilized luciferase reporter gene controlled by the mPer2 promoter [167]. For cultures treated with 5 µM CUR the average period was estimated at 24.48 hrs by LS (p<0.001) (Fig. 11B) and 24.47 hrs by FFT. Because circadian rhythms persisted after low curcumin dose treatments, we synchronized the circadian clock in C6and examined the pattern of individual mitotic and apoptotic events for any effects from curcumin or the circadian clock.
Figure 10: Circadian rhythms in mPer2clock gene expression. (A)Signal from the mPer2::mPer2:luc reporter gene without forskolin pulse. (B) Signal from the mPer2::mPer2:luc reporter gene after a forskolin pulse was used to synchronize cellular circadian oscillators. A significant period of 25.16 hrs was detected by Lomb-Scargle analysis (p<0.001), as shown in (C), which shows the detected peak frequency (0.03974) corresponding to the inverse of the period.
37
Figure 11: Circadian rhythms in mPer2clock gene expression persist after treatment with 5 µM CUR. (A) Signal from the mPer2::mPer2:luc reporter gene after a forskolin pulse used to synchronize cellular circadian oscillators shown as the hourly integrated light signal (average of 4 independent cultures shown as relative light units). A significant period of 24.48 hrs was detected by Lomb-Scargle periodogram analysis (p<0.001) as shown in (B).
Long-Term Effects of Curcumin on Mitosis and Cell Death
To determine whether the low curcumin treatment (5 µM) was sufficient to produce
anticancer effects on C6, and whether a higher dose would be more useful for this study, C6 cells
were monitored continuously by digital video imaging of cell cultures. To identify ongoing cell
division and cell death events in cultures time-lapse imaging (TLI) was performed using 5-min
frame intervals for up to 5 days, after synchronizing cells with forskolin and treating with the
desired amount of curcumin 12 hrs later on the first day. All events were counted from a single
field-of-view which represented the cell events occurring in the plate in a given location during 5
days of recording. During TLI, the field-of-view initially had an average of 23.57 +7.03 (SD)
cells (range 18 to 30, n=15 cultures).
Distinct mitotic and apoptotic events were visible and counted following exposure to 0, 5,
and 10 µM CUR (Fig. 12). When mitotic events during day 1 of imaging were compared
(ANOVA, F=4.537, p=0.03408), 10 µM was significantly more effective at suppressing cell 38
division than 5 µM (Fisher post hoc test, p=0.01482) and the control (p=0.02165) (Fig. 12A).
The 5 µM group was, however, not significantly different from the control (p=0.8061). When
the total mitotic events for the first four days were examined, 10 µM again resulted in a
significant suppression of mitosis (p=0.0485) relative to control (0 µM: 62.667 36.439, n=6; 5
µM: 60.000 30.469, n=6; 10 µM: 15.000 4.358 n=3). By day 4 (5th day in culture), cell confluence in the control dishes limited our ability to detect cell division events, so they were not counted.
When the apoptotic events occurring during day 1 in the 0, 5, and 10 µM groups were compared (F=18.751, p=0.0002028), 10 µM produced significant cell death (p=5.512 x10-5), but
not 5 µM (Fig. 12B). However, when total apoptotic events over days 1-4 were compared
(F=6.398, p=0.01284) the 5 µM treatment caused significant cell death (p=0.00384).Cell death
rates were lower in 10 µM treated cells, as most of the cell death occurred in the first day.
Figure 12: Effect of curcumin dosages on mitosis and apoptosis of C6 glioma cells. (A) Effects of curcumin on mitosis rates. Average hourly mitotic rates imaged in single fields-of- view for 5 days after a forskolin pulse. (B) Effects of curcumin on cell death rates. Average hourly apoptotic rates imaged in single fields-of-view for 5 days after a forskolin pulse.
39
Circadian Modulation of Curcumin Effects on Mitosis and Cell Survival
To determine whether ongoing events of cell division and cell death in cultures exposed to curcumin are modulated by circadian timing, we measured the period and phase of the circadian cycle (Fig. 13). Because individual events within the field-of-view were few, data was pooled from all cultures in each treatment group. According to LS analysis a significant circadian rhythm in mitosis was detected in the control culture (See Table 1). Most of these rhythms were also identified by FFT. To provide a more precise estimate of the circadian period than what LS or FFT can provide we used the Maximum Entropy Method, to find periods with a resolution ±1 hr, the sampling interval. According to MEM the untreated cultures displayed an average period of 21.3 hrs for mitotic events. This rhythm in the cell division cycle is very similar to the doubling time of 22 hrs reported for C6 cells[179]. The 10 µM CUR-treated cultures displayed a 20.5-hr period. Thus, circadian rhythms were observed in mitotic events of the control and 10 µM cultures (Fig. 13A, C), but not in the 5µM group (Fig. 13B). In the presence of 5 µM CUR the cell division cycles and circadian rhythms appeared to be uncoupled.
Mitosis displayed a rhythm of about 15 hrs, and these shorter rhythms termed as ultradian rhythms (rhythms with periods less than 18 hrs) may have been caused by curcumin acting on the cell cycle oscillator. To further test the periods of these cultures, we analyzed the mitotic events with FFT, which yielded periods of 21.3 hrs for the control group, 15.0 hrs for 5 µM, and
18.3 hrs for the 10 µM group.
Circadian rhythmicity was analyzed for the apoptotic events that occurred in the cell cultures. A rhythm with a period of 18.9 hrs was found for the untreated group (Fig. 13D), which is at the edge of the typically cited circadian range of 19-30 hrs (Table 1). The apoptotic events occurring in 5 µM CUR-treated cells followed a circadian rhythm with a period of 22.3 hrs (Fig. 40
13E). All the period estimates for this treatment group fall in the circadian range (Table 1).
Circadian rhythms were absent in 10 µM CUR-treated cells (Fig. 13F) that instead had a shorter period of 11-14 hrs (Table 1). Circadian rhythms in apoptosis persisted in the 5 but not 10 µM cultures, indicating that the clock can modulate cell death at the lower curcumin dosage.
Because mitotic and apoptotic rates appeared to reach a peak at different times, we examined the circadian phase of mitotic and apoptotic events for the untreated, 5, and 10 µM treatments. The apparent inverse relationship between apoptosis and mitosis was confirmed by a linear correlation test comparing time-series: Pearson’s r values were -0.350, -0.599, and 0.437 for the 0, 5, and 10 µM treatments respectively (Fig. 13G-I). The rate of mitosis was higher in the untreated group as apoptotic events were fewer in that group, while the 10 µM group had lower mitotic rates and higher rates of apoptosis during the initial days of treatment.
Table 1: Period analyses of C6 cell cultures. All period estimates are in hours. LS: Lomb- Scargle periodogram, FFT: Fast Fourier Transform, MEM: Maximum Entropy Method. All LS results were significant (p<0.001). “Non-circadian” indicates the two most powerful peaks of the spectra were not in the circadian range (19-30 hours).
Mitosis Apoptosis Curcumin Imaging Treatment Duration LS FFT MEM FFT MEM LS (hrs) (µM) (hrs) (hrs) (hrs) (hrs) (hrs) (hrs)
0 114 22.6 21.3 21.3 18.8 21.3 18.9 Non- 5 135 14.9 15.0 circadian 22.3 23.3 24.4 Non- 10 112 18.5 18.3 20.5 11.1 14.2 circadian
41
Figure 13: Circadian clock regulation of curcumin efficacy. (A-C) Mitotic events in C6 cultures show circadian rhythms in 0 and 10 µM CUR but not 5 µM. (D-F) Cell death rates (apoptotic events) show circadian rhythms in 0 and 5 but not 10µM. (G-I) Apoptotic and mitotic rates were inversely correlated as shown by linear regression.
Along with a period analysis, we also examined phase relationships (Fig. 14) between the mitotic and apoptotic rhythms and their timing relationships to the mPER2 rhythm shown in Fig.
11. When examining the timing of curcumin-treated rhythms relative to the mPER2 rhythm, we used circular statistics to identify clustering of apoptotic events over the first three 24-hr cycles of imaging. Significant clustering was observed at 18.3 and 18.6hrsduring the 2nd and 3rd days of imaging in the 5 µM group. (Fig. 14A, B). When comparing these phases with the mPER2 42 rhythm, they occurred on the rising phase, 6 and 10 hrs before the peaks in mPER2-Luc protein expression. There was no significant clustering of cell death events in the 10 µM group (Fig.
14C,D), in agreement with the loss of circadian periodicity of apoptosis. The phase of cell deaths in the control group (0 µM) was significantly clustered (p<0.05) on the second day, but the mean vector (16:24 hrs with a 99% confidence interval of 12:31 hrs and 20:17 hrs) was not different from that of the 5 µM group (18:18 hrs with a 99% confidence interval of 16:34 hrs and
20:03 hrs), indicating that curcumin did not produce a measurable phase shift. There was no significant clustering of apoptotic or mitotic events in the other groups.
Figure 14: The phase of circadian rhythms in cells treated with curcumin. (A, B) The phase of cell death shows significant clustering (p<0.001) in 5 µM CUR on days 2 and 3 respectively (Z=14.625 and 7.399 by Rayleigh Test). Large arrow indicates mean vector. Small green arrow indicates the peak of mPER2::LUC rhythm from Fig. 11A. (C, D) There is no significant clustering in the phase of cell death in 10 µM curcumin on days 2 and 3, respectively, indicating a disruption of rhythms within individual circadian oscillator cells or a loss of synchronization between oscillators. The curcumin treatment began at 12:00 AM (0:00) on Day 1. Each blue dot indicates 2 events. 43
As an additional test of whether cell death events vary according to the circadian cycle,
we quantified the percentage of cells expressing activated caspase-3, a late apoptotic marker
[180, 181] in C6 cells given 5 µM CUR. Three times were selected to coincide with the second peak, the following trough, and the third peak observed in the rhythm in apoptosis (Fig. 13E).
The three phases examined showed relative differences in cell death that matched the oscillations in apoptotic events in the time series (Fig. 15A). Percentage of apoptotic cells were 61.15 ±
0.03% at the 45th hr and 47.62 ± 0.04% at the 69th hr, which are both peak phases in the circadian
rhythm of death rate. During the trough phase, (57thhr) the percentage of apoptotic cells declined
to23.50 ±0.02%.There were more cells stained with anti-caspase3 antibody at the peak phases
(Fig. 15B I and II) when compared to the trough phase (Fig. 15B III and IV).
Figure 15: Expression of activated caspase-3 according to circadian cycle. (A) Percentage of apoptotic cell counts at 45, 57, and 69 hours after adding 5 µM CUR. The relative changes in the percent cell death agreed with the peaks and trough in the circadian rhythm of death rate for cells treated with 5 µM CUR. (B) Cleaved caspase-3 immunostaining of apoptotic cells (green) in 5 µM CUR at two circadian phases (I, at a peak phase and, III, at a trough phase), and also merged with Hoechst nuclear stain (red; II, IV). Scale bar = 10 µm.
44
Stability and Localization of Curcuminoids and their Metabolites
Curcumin is used as an anticancer drug and is being tested in a number of clinical trials
[17, 182]. Nevertheless, its use is limited because of degradation at alkaline pH and also its poor tissue absorption[183, 184]. Studies have shown that curcumin is stable in culture media containing 10% fetal bovine serum (FBS), compared to phosphate buffer or culture media without FBS[185]. Our TLI data showed that apoptosis continued for several days after initial treatment with 5 or 10 µM CUR. Spectroscopic studies showed presence of curcumin in culture media for all the 5 days the cells were imaged (Fig. 16). For spectroscopy, a standard curve was created for curcumin’s maximal absorbance near 430 nm (Fig. 16C), as mentioned in earlier studies [186]. Curcumin levels declined within the first day to background levels after addition to cell cultures (Fig. 16A). During the first 24 hrs, the curcumin concentration declined with a half- life of about 1.7 hrs by degrading or entering into cells (Fig. 16B). The levels of curcumin in media also showed a small increase after the second day.
Autofluorescence evaluation of curcumin’s cellular distribution in live cells showed that curcumin is present in the nucleus one hr after application (Fig. 16D).Though the levels of curcumin decreased considerably in the culture media; curcumin was present in the nucleus of
C6 cells, at least 24 hrs after application (Fig. 16E). The autofluorescence study was performed
in live C6 cells 1 hr and 24 hrs after curcumin treatment. To confirm the nuclear localization of
curcumin 24 hrs after curcumin treatment, cells were fixed and stained with Hoechst nuclear
stain (Fig. 16F). It was observed that curcumin was present in the nucleus concentrated in distinct intranuclear sites, as described previously [187].
45
Figure 16: Stability of curcumin in cell cultures. (A) Absorbance of curcumin in cell culture medium with C6 cells in culture for 5 days (measured at 430 nm). (B) Absorbance of curcumin in cell culture medium with C6 cells in culture for first 24 hrs. Curcumin degraded with a half- life of about 1.7 hrs in cell culture medium. (C) Absorbance of curcumin at 430 nm wavelength at different concentrations of curcumin, starting from 0.05 µM to 50 µM. (D) 5 µM CUR produces fluorescence in live C6 cells within 1 hr after it is added. Scale bar = 10 µm. (E) Curcumin persists in cells for at least 24 hrs. (F) Curcumin fluorescence in fixed C6 cells after 24 hrs of 5 µm CUR treatment and stained with Hoechst nuclear stain. Both cytoplasmic and intranuclear curcumin localization was observed.
The curcumin treatment used in the study includes curcuminoids DMC and BDMC (Fig.
17A), which may have also contributed towards the apoptosis. To better understand which
curcuminoids could have produced the cell death observed through TLI, the degradation rates of
curcumin, DBMC, and BMC levels were evaluated by HPLC. As predicted from previous
studies,[188] HPLC indicated that 75% of the curcumin was degraded within 12 hrs in culture
medium at room temperature, but the two congeners degraded more slowly (Fig. 17B), around
20% for BMC and only 8% for BDMC, suggesting that they could have been responsible for cell
death after the first day of treatment. The degradation rates of curcuminoids in DMSO were 46
relatively slower than in culture media (Fig. 17B). Degradation patterns of the congeners were observed in samples of culture media with C6 cells from each day after the curcumin treatment
(Fig. 17C). All the conditions of these samples were kept the previous experimental samples of
TLI. There was a rapid decline of curcumin in culture media after the first 24 hrs up to 15% after
the first day in culture media at 37°C, DMC too declined to about 16% in the first 24 hrs of
treatment, whereas the other congeners BDMC declined to about 28% after the first 24 hrs (Fig.
17C inset). Although the culture media had very little curcumin or congener present, the cells retained the curcumin, as shown in Figs 16D and E, which could have been responsible for apoptosis and other cellular effects. To determine whether the medium retains an anticancer property after curcumin levels decline, we examined C6 cells treated with a conditioned medium
(CM) that was withdrawn from a C6 culture one day after treatment with 5 µM curcumin (Fig.
18). Significant cell death or mitotic arrest was not observed in response to CM treatment.
Figure 17: Stability of curcuminoids in cell cultures. (A) HPLC measurements all 3 curcuminoids in cell culture. The relative levels of curcumin, DMC and BDMC present in the treatments. (B) HPLC measurements show curcuminoids DMC and BDMC persist longer than curcumin in cell culture medium and in DMSO. (C) HPLC measurements of curcuminoids in culture medium with C6 for 5 days. Inset: Normalized measurements of curcuminoids in culture medium with C6 for 5 days. About 0.5 µM was the limit of detection for HPLC
47
Figure 18: Effect of curcumin conditioned medium on (A) mitosis and (B) apoptosis in C6 glioma cells. Average hourly mitotic and apoptotic rates were imaged in single fields-of-view for 5 days after a synchronizing forskolin pulse.
Discussion
This is the first study to examine the effects of curcumin on circadian rhythms in cancer
cells and whether the circadian clock is altered by curcumin treatments. Curcumin affects
several signaling pathways regulating the intracellular timing cycles that generate the circadian
rhythm. These targets, which include STAT, PPARγ, and NFκB act on gene expression within
the timing loops. Nevertheless, the circadian rhythm in C6 cells persisted following the 5 µM
curcumin treatment that produced increased cell death days later. Although this dosage did not
arrest the clock, the 10 µm curcumin treatment caused a loss of any detectable circadian rhythm
in apoptosis. The absence of circadian periodicity at 10 µM could have been caused by
disruption of individual circadian oscillators of clock cells or the coupling between circadian
clocks. Nevertheless, fast circadian oscillations in mitotic events persisted.
Perhaps the best explanation for these results is that the clock regulates cell death by
increasing the probability it will occur at a particular phase of the circadian cycle, but treatment 48 dosages that produce greater stimulation of the apoptotic pathway mask the clock-controlled events. It is unclear why the circadian rhythm in mitotic events was lost after applying 5 µM but not 10 µM curcumin. Both of these concentrations were below the reported IC50 of 25 µM for curcumin and C6 [189], and cells continued to proliferate during the several days of imaging.
Curcumin produced a delayed and persistent cell death well after it was no longer detectable by HPLC and absorbance spectroscopy at the end of the first day of delivery. There are several possible mechanisms that can explain this sustained effect: The initial treatment altered some of the cells in a way that arrested their cell cycle and caused them to die much later.
Curcumin is known to induce cell death through mitotic arrest, at which point cell death might begin long after the time when normal cells would have divided. Alternatively, the cells may have continued to divide, but the treatment caused a change in the viability of the cells that was also present in the progeny of the treated cells. For example, curcumin has epigenetic effects that may promote cancer cell death [190].
Another intriguing possibility is that because curcumin is lipophilic it was entrapped in cell membranes where it was protected from degradation and then released into the cytosol, thereby killing cells later. A similar mechanism was proposed for effects from vanillin, a curcumin degradation product [191]. This possibility is supported by the curcumin autofluorescence we observed in live cells at least 24 hrs after exposure. Curcumin showed greater stability in DMSO than in cell culture medium suggesting that the nonpolar cell membrane environment could also protect curcumin longer than culture medium or other aqueous fluids. 49
We also considered the possibility that the two congeners of curcumin may have caused the delayed cell death along with curcumin or in its absence. Both DMC and BDMC persisted much longer in culture medium than curcumin, and both are reported to have anti-cancer effects, for example in lung cancer cell lines [192, 193]. Curcumin degrades rapidly in blood and perhaps also cerebrospinal fluid, but the more persistent congeners may be responsible for the systemic effects reported in some animal studies [194]. Interestingly, BDMC also inhibits metastasis
[195]. DMC was reported to oxidize more slowly than curcumin at physiological pH, persisting for at least a day, but BDMC was resistant to oxidation[196], suggesting that it may have a more prolonged effect on C6 cells than the other two. It is also possible that some or much of the autofluorescence we and others observed in cell membranes actually originated from the congeners, which have excitation and emission spectra similar to those of curcumin [197]. By passing through this cell reservoir the congeners might have had delayed cell toxicity.
Finally, we did not investigate curcumin’s degradation products in C6, but some of these have known anti-cancer properties. For example, tetrahydrocurcumin is an early product that would be formed in aqueous media, such as after an intravascular injection [194], and it may have contributed to cell death in the C6 cultures. Similarly, the more lipophilic products may have accumulated in cell membranes, producing a delayed response. Because the conditioned medium, collected after 24 hrs with C6 cells, did not increase cell death, any curcumin, congeners, or degradation products present in the culture medium after the first day are not likely to have had much effect on cell survival. Instead, curcuminoids bound to cell membranes are the most likely causal agents.
The C6 mitotic and apoptotic events displayed a significant inverse relationship in 0, 5, and 10 µM curcumin, indicating a coordinated timing relationship in the cultures. Circadian 50 clocks can control the cell division cycle at several checkpoints, most notably through p21 regulation by the core clock component BMAL1. This coupling is, however, facultative as shown previously when the two rhythms were manipulated in Lewis lung carcinoma cells to oscillate with different periods [198]. Unlike circadian clocks, metabolic and hormonal signals can readily arrest or initiate mitosis, and the liability of the cell cycle period impairs its ability to provide accurate timing. Furthermore, the circadian clock is compensated to maintain a more constant period as temperature changes. We detected about a 2-hr difference in period between mitotic and apoptotic oscillations in the control culture, suggesting that these processes are not tightly coupled. Nevertheless, these results indicate that the phase of the cell cycle can provide an estimate of circadian phase in some cancer cell types and may be useful for predicting when curcumin is most effective, In the C6 cultures, cell death occurred most often when mitotic rates were minimal.
The highest apoptotic rate was about 6-10 hrs before the peak of mPER2 expression for
C6 cells, suggesting that there is a time of day when curcumin treatment is most effective in treating patients. To use this result to optimize delivery of curcumin or encapsulated curcumin
(providing improved bioavailability) it will be necessary to determine the circadian phase of the cancer cells within the tumor. Curcumin analogs are more stable alternatives [199] and should be tested to determine whether they too are most effective at this phase. Furthermore, chemically distinct chemotherapeutic agents that act through pathways blocked by curcumin, such as NFκB
[189], may be most effective at this phase in gliomas and other cancer cell types. Curcumin’s reported ability to prevent cancer may also be optimal at the time of day corresponding with the phase of highest sensitivity, which could be determined from the PER2 circadian rhythm measured in non-cancer cells of healthy individuals. 51
CHAPTER III: HIGH-RESOLUTION MAPPING OF THE CALCIUM-REGULATED NUCLEOCYTOPLASMIC TRANSPORT
Preface
This chapter is from my work during the initial years of my doctoral program with Dr.
Weidong Yang in his lab while he was at Bowling Green State University. He moved to Temple
University during fall of 2012. This work was also a continuation of my Master's thesis titled "A
Single Molecule Study of Calcium Effect on Nuclear Transport"; I determined the transport kinetics of passive and facilitated transport of molecules across nuclear pore complexes at different calcium store concentrations. The study here is on mapping three-dimensional distributions of molecules inside the nuclear pore and their interactions with the pore components to provide better insights into calcium-regulated nuclear transport mechanisms. A manuscript is in preparation to be submitted to a cell biology journal.
Introduction
In eukaryotic cells, genetic materials in the nucleus and protein-synthesizing apparatus in the cytoplasm are separated by the double-membrane nuclear envelope (NE). Proteins destined for nuclear functions transit to the nucleus and the major cellular RNAs, and ribosomal subunits generated in the nucleus are exported to the cytoplasm. This bidirectional nucleocytoplasmic transport (NT) is mediated by NPCs, a large protein assembly embedded in the nuclear envelope
[200-202]. The NPC is built from multiple copies of approximate 30 different Nups, almost one- third of which lack ordered secondary structure and contain domains rich in phenylalanine- glycine (FG) repeats [203-208]. These FG repeats form a permeable and selective barrier in the 52
NPC that allows for facilitated translocation of large molecules (up to 50 MDa) chaperoned by
transport receptors and passive diffusion of small molecules (< 20 - 40 kDa) [200-202, 209].
Many studies have also indicated that both passive and facilitated nucleocytoplasmic
transport modes could be further regulated by disturbance in the cellular environment like
intracellular ionic shifts [63, 78, 210-212]. Particularly, the divalent calcium cation, a major
signaling molecule that influences almost every aspect of cellular life, plays a noticeable role in
regulating the nucleocytoplasmic transport. In eukaryotic cells+, the major calcium stores are
located in the lumen of endoplasmic reticulum (ER) and the cisternal space of NE [213].
Numerous studies based on electron microscope and atomic force microscopy in past two
decades have proposed that the NPC structure changes when free calcium ions (Ca2+) in the calcium stores are depleted, describing an appearance of a central plug [81, 84, 89, 101, 213-
217]. Others found that the variation in calcium store concentrations also changed the structures of some FG Nups[100]. However, whether the central plug might be the cargo caught in transport or the altered form of FG-Nup barriers remains in dispute [100, 218, 219]. The disputes
also exist for the effect of calcium-depletion in the calcium stores on NT. Initially, investigations
demonstrated that significant inhibitions occurred for both passive diffusion of small molecules
(< 20 kDa) and the facilitated transport of proteins with sizes bigger than 40 kDa through the
NPC with the calcium-depletion in the calcium stores[210, 212, 220-222]. Conversely, other subsequent studies have reported that calcium depletion had almost no influence on either passive diffusion or facilitated translocation through the NPC [102, 223-225]. Clearly, more strategies and studies are needed to clarify the observed conflicting roles that calcium plays in regulating the function and structure of NPC. 53
Almost all previous investigations on calcium effects on nuclear pore permeability were
carried out by the ensemble measurements of the concentration ratio of transiting molecules
between the cytoplasm and the nucleus. The use of ensemble measurements, which report
averaged outcomes, has been crucial in our understanding of NT. However, important
information could be lost by averaging signals of the bulk amount of transiting molecules. For
example, the detailed transport information through the NPC, such as transport time, transport
efficiency and spatial locations of transiting molecules, is inevitably missed due to a challenge of
capturing transient movements of individual molecules within the sub-micrometer-sized NPC.
Therefore, assessing the detailed dynamic information is beyond the capabilities of population methods and these parameters are extremely important for a fundamental understanding of the calcium-regulated transport mechanism through the NPC.
Single-molecule methods provide unique information on spatial properties and kinetic processes of substrate molecules that are otherwise lost by averaging over large populations of unsynchronized molecules. This technique has been proven to be particularly suited for NT studies[226-230]. Using optical microscopy and high-sensitivity CCD cameras, single molecules were imaged as diffraction-limited spots, which are then fitted by two-dimensional Gaussian functions. The centroid of each particle can be determined with high spatial precision up to a few nanometers by the fitting process if high signal/noise ratios of targeted molecules could be guaranteed. With more improvements in localization precision and temporal resolution of single- molecule imaging, the spatial locations of molecules can be captured and three-dimensional spatial density maps of interaction sites between FG Nups and transiting molecules can be obtained. In this study, we employed a newly developed high-speed super-resolution single- molecule imaging approach, single-point edge-excitation sub-diffraction (SPEED) microscopy 54
[231-233], to quantitatively determine three-dimensional (3D) spatial routes for both passive
diffusion and facilitated transport through the native NPCs at various calcium store
concentrations
Overview on Transport Kinetics of Calcium Regulated Nuclear Transport
In my earlier research, which was a systematic investigation of the calcium-induced changes in nuclear pore permeability, I clarified the ambiguity associated with previous conflicting results and also unraveled the detailed kinetics of calcium-regulated passive diffusion and facilitated transport. Single-molecule methods enabled us to measure the transport kinetics for passive diffusion and facilitated transport in different store calcium concentrations.
First various calcium concentrations in the calcium stores were created as high-, normal-
or depleted-calcium store concentration in permeabilized HeLa cells. We then determined
several parameters which are critical for the bulk nuclear transport rate at the single-molecule level, including import/export time, import/export efficiency, and import/export entrance frequency of transiting molecules through the NPC.
For passive diffusion of 10 kDa dextran molecules under the normal-calcium condition, we found that the transport time increased, transport efficiency decreased, and entrance frequency was reduced with a decrease in store calcium concentrations, as summarized in Table
2. When the calcium effect on the nuclear transport kinetics of Imp β1was analyzed, we found the high-calcium condition had almost no effect on the transport efficiency and the entrance frequency but reduced the transport time down to one third for Imp β1 when compared with the normal-calcium condition. Relatively, the low-calcium condition generated dramatic changes in all three parameters of the kinetics for Imp β1; only 10% of Imp β1 molecules successfully 55
transported through the NPC within less than 2-ms dwell time. Remarkably, the low-calcium
condition further produced an import entrance frequency more than two-fold higher, but the
export frequency approximately a half of, the corresponding parameter of Imp β1 at normal-
calcium condition (Table 2).
Table 2: Transport time, efficiency and entrance frequency of passive diffusion and facilitated transport through the NPC. The table shows the import/export time, the import/export efficiency, the import/export entrance frequency for both passive diffusion of 10- kDa dextran and facilitated transport of Imp β1.
Transport Entrance Transport Time Substrate Efficiency Frequency Calcium (in ms) condition (in percentage) (events/pore/sec) Import Export Import Export Import Export
High 1.1 ± 0.1 1.2 ± 0.1 59 ± 3 60 ± 4 77 ± 9 62 ± 8
10-kDa Normal 1.7 ± 0.1 1.7 ± 0.1 53 ± 3 53 ± 4 25 ± 6 22 ± 6 dextran Depleted 2.8 ± 0.2 2.8 ± 0.1 4 ± 1 6 ± 2 2 ± 1 1 ± 0
High 1.1 ± 0.1 1.2 ± 0.1 53 ± 4 53 ± 3 20 ± 1 30 ± 3
Imp β1 Normal 3.2 ± 0.3 3.8 ± 0.3 52 ± 5 47 ± 4 22 ± 1 22 ± 1
Depleted 2.0 ± 0.1 1.5 ± 0.1 9 ± 1 10 ± 2 45 ± 1 13 ± 5
Methods and Materials
Dextran, Protein Purification and Labeling
Alex Fluor 647-labeled 10 kDa dextran was purchased from Invitrogen. N-terminal His- tagged human Imp β1 proteins were expressed in Escherichia coli and purified by nickle- nitrilotriacetic Superflow(Qiagen), MonoQ, and Superdex 200 (Amersham) chromatography.
The solvent accessible cysteines on Imp β1 were labeled with 20-fold molar excess Alexa Flour 56
647 maleimide dye (Invitrogen) for 2 hrs at room temperature in 50 mM sodium phosphate, 150
mM NaCl, and pH 7.5. Reactions were quenched with β-mercaptoethanol, and the products were
dialyzed to remove the free dyes. The labeling ratio was about four dye molecules per Imp β1.
The control experiments showed that the labeled dyes on Imp β1 did not affect their interactions
with the NPC.
Cell Line, Cell Culture and Transport Conditions
A HeLa cell line stably expressing the GFP-conjugated POM121 was adopted and freshly split cells were grown overnight on coverslips in DMEM supplemented with 10% FCS. By conjugating GFPs with POM121, the middle plane of the nuclear envelope can be determined[228, 232-234]. However, multiple-GFPs-conjugate-POM121 NPCs have enhanced transport time and efficiency compared to that of wild type NPCs[229]. Following the same experimental procedure, the transport time and efficiency for single-GFP-POM121NPCs were measured, and it was found that nuclear transport was not enhanced by a single GFP-conjugate.
Therefore, experiments were conducted with a single-GFP-POM121 cell line, and GFP fluorescence was utilized to localize the centroid of individual NPC[232-234].
For microscopy imaging, flow cell chamber was constructed with a top coverslip and two lines of silicone grease as spacers. Cells in the chamber were washed with transport buffer (20 mM HEPES, 110 mM KOAc, 5 mM NaOAc, 2 mM MgOAc, 1 mM EGTA, pH 7.3), permeabilized for two minutes with 40 µg/mL digitonin in transport buffer, and washed twice with transport buffer supplemented with 1.5% polyvinylpyrrolidone (PVP; 360 kDa).
57
Alteration of Calcium Store Concentration
Permeabilized cells were first washed four times by normal transport buffer
supplemented with 1.5% PVP. Then, to increase the calcium concentration in the NE, cells were
incubated with 2 mM CaCl2 for 15 minutes. To deplete calcium in the NE, cells were incubated
in 10 mM BAPTA (Ca2+ chelator, Sigma-Aldrich)and 1mM thapsigargin (Ca2+-ATPase inhibitor,
Sigma-Aldrich) for 15 minutes. 1.5% PVP was included in all above buffer solutions to prevent
osmotic swelling of nuclei.
Single-Molecule Tracking of Passive and Facilitated Transport through the NPC
For single-molecule measurements of passive diffusion and facilitated transport by
SPEED microscopy, 1 nM Alexa Fluor 647-labeled 10-kDa dextran molecules (Invitrogen, CA) and 1 nM Alexa Fluor 647-labeled Imp β1 were incubated with permeabilized cells under various calcium concentrations. The condition of 2 mM CaCl2 incubated with cells is defined as
high Ca2+ condition, and the situation that 10 mM BAPTA and 1 mM thapsigargin was incubated
with cells refers Ca2+-depleted or reduced Ca2+ condition.
The SPEED microscope includes an Olympus IX81 equipped with a 1.4 N.A. 100× oil-
immersion apochromatic objective (UPLSAPO 100XO, Olympus), a 35 mW 633 nm He-Ne laser (Melles Griot), a 120mWArKr tunable ion laser (Melles Griot), an on-chip multiplication gain CCD camera (Cascade128þ, Roper Scientific) and the Slidebook software package
(Intelligent Imaging Innovations) for data acquisition and processing. An optical chopper
(Newport) was used to generate anon–off mode of laser excitation. GFP and Alexa Flour 647 fluorescence were excited by 488 and 633-nm lasers, respectively. Two lasers were combined by 58
an optical filter (FFF555/646 Di01,Semrock), collimated and focused into an overlapped
illumination volume in the focal plane. The green and red fluorescence emissions were collected
by the same objective, filtered by a dichroic filter (Di01-R405/488/561/635-25x36, Semrock)
and an emission filter (NF01-405/488/561/635-25X5.0, Semrock), and imaged by an identical
CCD camera. The system error of alignment between red and green fluorescence channels is 3.0
± 0.1 nm, determined by measuring 230 immobile Alexa Fluor 647-labeled GFP fluorescent molecules on the surface of the coverslip.
Orientation of Single NPC
Two rules were then used to select a single NPC oriented perpendicular to the NE on the equator of the nucleus and to the y direction of the Cartesian coordinates (x, y) in the CCD camera: (i) Choose a fluorescent NPC on the equator of the nucleus such that the tangent of the
NE at the location of this NPC should be parallel to the y direction of the Cartesian coordinates
(x, y) in the CCD camera; and (ii) examine the ratio of Gaussian widths in the long and short axes of the chosen GFP-NPC fluorescence spot. The ratio needs to fall between 1.74 and 1.82.
Within this range, an illuminated NPC only has a free angle of 1.4° to the perpendicular direction to the NE [232].
Data Analysis
The localization precision for fluorescent NPCs, immobile fluorescence molecules and moving fluorescence molecules was defined as how precisely the central point of each detected 59
fluorescent diffraction-limited spot was determined. For transport kinetics of Alexa Fluor 647-
labeled 10-kDa dextran molecules, we obtained ≤ 10 nm localization precision (σsm) at 400 µs
detection time. For immobile molecules or fluorescent NPCs, the fluorescent spot was fitted to
2D symmetrical or an elliptical Gaussian function, respectively, and the localization precision
was determined by the standard deviation of multiple measurements of the central point.
However, for moving molecules, the fluorescent spot was fitted to 2D elliptical Gaussian
functions, but the localization precision (σ) was determined by an algorithm of
s a22 8π bs 24 σ ++= , where N is the number of collected photons, a is the effective pixel N 12N Na 22 size of the detector, b is the standard deviation of the background in photons per pixel, and s is the standard deviation of the point spread function [232, 235]. The deconvolution process used to obtain the 3D spatial distribution of interaction sites between transiting molecules and the NPC is described in Ma and Yang, PNAS 2010 [232].
Results
Single Molecule Experiments Determine the Spatial Locations and Mapping 3D Pathways
Recently, SPEED microscopy (Fig. 19) has enabled us to achieve the following capabilities in mapping dynamic nucleocytoplasmic transport of proteins or mRNAs in HeLa cells [234]: first, determine dwell times of real-time fast movements of transiting molecules
(typically a few milliseconds) through the native NPCs in cells with high temporal resolution
(0.4 ms in SPEED microscopy, as shown in Fig. 19B ); Second, high spatial-resolution localization of the individual NPCs on the NE (1-3 nm localization precision for the centroid of 60
NPC) and simultaneously mapping of the transiting molecules through the NPCs (single-particle tracking precision < 10 nm for substrates moving through the NPC, as observed in Fig. 19C);
Third, obtain a 3D view of real-time spatial transport routes for the inherently 3D moving substrates in the NPC via a deconvolution algorithm (demonstrated in Fig. 19D). With the established methodology, our goal for this study was to is to provide a comprehensive understanding of the calcium-regulated nucleocytoplasmic transport by elucidating the details in the spatial routes for both passive and facilitated transport under altered calcium conditions.
We mapped 3D pathways, following published procedure, first by superimposing thousands of locations of transiting molecules, and we obtained 2D super-resolution images of these molecules in the NPC (2D data in Fig. 20 and 21). Then, with an established 2D to 3D conversion algorithm we recovered the 3D spatial portability density maps for both transport modes (3D data in Figs. 20 and 21).
61
Figure 19: Single-molecule tracking and 3D view of nuclear transport by SPEED microscopy. (A) Illumination of a single NPC in a cell by SPEED microscopy. Single transiting molecules (red dots) through a single GFP-NPC (green) are imaged using an inclined illumination point spread function (blue, iPSF forms an angle of 45° to the z direction) at the equatorial plane of a HeLa cell nucleus in the focal plane (between the double light brown lines). C, cytoplasm and N, nucleus. (B) Single-molecule trajectories and transport times through single NPCs. A typical import event of single transiting molecules (red spots) through a single GFP- NPC (green spot) is shown. Numbers denote the time in millisecond. C, the cytoplasmic side of NPC and N, the nucleoplasmic side of NPC (C) The single-molecule trajectories of the event shown in B (red dots for import and blue for the centroid of the NPC). (D) The 2D to 3D deconvolution process. Using an established deconvolution algorithms, the 3D spatial distribution of transiting molecules in the NPC in a cylindrical coordinate system (R, θ, x) are recovered from the obtained 2D spatial locations in the xy plane.
In our experiments, we adopted digitonin-permeabilized HeLa cells as the model cell system. In permeabilized cells, the intact nucleus, together with a controlled cytoplasmic environment, provides a greatly simplified transport system that allows us to elucidate the
complicated nuclear transport step by step. Numerous ensemble or single-molecule experiments
conducted in the permeabilized cell system have provided great insights into nuclear transport 62 mechanism and other various biological/biomedical questions. Normally, we maintain the permeabilized cells in the transport buffer with 1 mM EGTA (Normal Ca2+ condition) , which acts as a calcium buffer that maintains Ca2+ concentration near the physiological resting level of
100 nM. To reduce the calcium concentration in the calcium stores, 1 mM thapsigargin (Tg), followed by 10 mM BAPTA, was used (Depleted Ca2+ condition). On the contrary of the calcium depletion, we also increased the concentration of calcium in the calcium stores to test the effect of high stored calcium on nuclear transport. For which, the permeabilized cells were treated with a buffer where we removed the EGTA from the normal transport buffer and then added 2 mM
2+ CaCl2 to increase the concentration of free calcium in the buffer (High Ca condition).
3D Routes of Passive Diffusion in the NPC Regulated by the Calcium Store Concentration
For passive diffusion of 10-kDa dextran through the NPC, we found it possesses an hourglass-like effective diffusion route, with an effective diffusion length of ~168 nm and an effective diameter of the narrowest waist of ~19 nm, under the normal calcium condition (Figs.
20A-C). While both the length and the diameter was altered at either higher or lower calcium conditions. In detail, we observed that high Ca2+ concentration induced a shorter and wider diffusion path for 10-kDa dextran (~141 nm in length and ~26 nm in diameter) (Figs. 20D-F).
Reversely, the reduced Ca2+concentration generated a longer and narrower diffusion route (up to
200 nm in length and ~14 nm in diameter) for 10-kDa dextran molecules in the NPC (Figs. 20G-
I). Particularly, the pathway at the reduced Ca2+ condition consists of two distinct effective routes rather than one observed at normal or high Ca2+concentration (Fig. 20I). 63
Figure 20: The 2D super-resolution images and 3D pathways of passive diffusion under various calcium conditions. (A) Superposition of 1930 spatial locations of single 10-kD dextran molecules in the NPC at high calcium condition, generating the 2D super-resolution image of 10- kD dextran locations in the NPC. (B-C) With the 2D to 3D deconvolution algorithms, the 3D spatial probability density map of 10-kD dextran molecules (red) was obtained and superimposed on the architecture of NPC(blue), along with the quantitatively determination of the diameters in R dimension (B) and the length in X dimension (C) of passive diffusion route. The numbers denote nanometers. (D-F) The 2D super-resolution images and 3D pathways of 10-kD dextran molecules in the normal calcium condition. (G-I) The 2D super-resolution images and 3D pathways of 10-kD dextran molecules under the depleted calcium condition.
64
3D Routes of Facilitated Transport in the NPC Regulated by the Calcium Store
Concentration
For the 3D routes of facilitated transport under different Ca2+ conditions, we followed the
similar procedure as the passive diffusion of 10-kDa dextran. 3D pathways for facilitated
transport were mapped using Alexa Flour647 labeled Imp-β 1 molecules.
As shown in Fig. 21, Imp β1 has completely different transport routes from 10-kDa
dextran under all the three calcium conditions. Under the normal Ca2+condition, Imp β 1 rarely occupied an axial central channel in the NPC (Figs. 21D-F), which is almost the exact spatial location of the passive diffusion path of 10-kDa dextran. The measurement here repeated what we observed previously as reported in Ma et al., 2012 [233]. The big difference between Imp β1 and 10-kDa dextran as they move through the NPC is that the former has strong interactions and the latter has no interaction at all with all the FG Nups in the NPC [205, 207]. Thus their distinct spatial locations in the NPC should be closely related to the spatial distribution of FG Nups.
Consequently, the spatial distribution of Imp β1could suggest the distribution of FG filaments of all the FG Nups that are available to interact with Imp β1, while the spatial location of 10-kDa dextran may reveal the locations where contain no or very few FG filaments in the NPC. Exactly, our results revealed that Imp β1 and 10-kDa dextran have completely distinct and almost complementary spatial routes in the NPC (Fig. 20F and Fig. 21F). Different from those at the normal Ca2+ condition, Imp β1’s spatial locations were obviously altered under the high (Figs.
21A-C) and reduced Ca2+ concentrations (Figs. 21G-I). Instead of mainly staying in the
peripheral regions around the axial central channel in the NPC, Imp β1molecules began to appear
in the central channel on the cytoplasmic side at the high Ca2+condition (from 50 nm to 80 nm in
Fig. 21C) and on both the cytoplasmic and nucleoplasmic sides under the reduced 65
Ca2+concentration (from 10 nm to 90 nm and from -30 nm to -60 nm in Fig. 21I). The total interaction length at the high Ca2+concentration is approximately 20 nm shorter than that of normal or reduced Ca2+concentration. Therefore, the altered locations of Imp β1 strongly suggest that the distributions of FG filaments recognized by Imp β1 were significantly modified at the high and low Ca2+concentrations.
66
Figure 21: The 2D super-resolution images and 3D pathways of Imp β1 under various calcium conditions. (A) Superposition of 1550 spatial locations of single Imp β1molecules in the NPC at high calcium condition, generating the 2D super-resolution image of Imp β1locations in the NPC. (B-C) With the 2D to 3D deconvolution algorithms, the 3D spatial probability density map of Imp β1(green) was obtained and superimposed on the architecture of NPC (blue), along with the quantitatively determination of the distribution in R dimension at the cross-section of 3D transport route in the range I to V. Bin size: 5 nm.. The numbers denote nanometers. (D-F) The 2D super-resolution images and 3D pathways of Imp β1 molecules in the normal calcium condition. (G-I) The 2D super-resolution images and 3D pathways of Imp β1molecules under the depleted calcium condition.
67
Discussion
High-speed, super resolution single-molecule measurements used for mapping of the 3D
transport routes in passive diffusion and facilitated translocation provide great insight into the
calcium-regulated NPC’s permeability and nucleocytoplasmic transport mechanism in cells.
First, our measurements demonstrated that the classical signal-dependent and size-exclusive nucleocytoplasmic transport mechanism indeed can be further regulated by Ca2+stored in the
lumen of nuclear envelope and endoplasmic reticulum, by quantitatively determining the
transport kinetics and the 3D pathways of passive and facilitated transport under various
Ca2+concentrations.
Second, the Ca2+-modified NPC’s permeability and nuclear transport mechanism may
root deeply in the conformational changes of FG-filaments of FG Nups in the NPC induced by
different Ca2+concentrations. The permeable and selective barrier formed by these FG filaments
in the NPC is believed to play critical rules in mediating bidirectional trafficking of
macromolecules between the cytoplasm and nucleus of eukaryotic cells. Any changes in the
configuration of this barrier would unavoidably affect both the transport kinetics and spatial
pathways for passive and facilitated transport. In our experiments, the 3D spatial distributions of
FG filaments recognized by Imp β1 in the NPC were greatly modified by the altered Ca2+
concentrations and the dramatic changes of the FG filaments mainly happened in the axial
central channel. At normal Ca2+condition, the data suggest that few or very sparse FG filaments
exist in the central channel and the majority of FG filaments concentrated in the periphery
around the channel. Such a distribution impelled that the passive and facilitated transport possess
spatially separated transport routes, the former diffuse through the axial central channel due to no
interaction with FG filaments and the latter transport through the peripheral regions around the 68
channel because of strong interactions with FG filaments. However, the configuration of the FG-
filament barrier was greatly changed when the Ca2+concentration is deviated from the normal
condition. Particularly under the Ca2+-depleted condition, many FG filaments began to extend
into the axial central channel on both sides of NPC. Meanwhile, the high Ca2+ concentration may
cause most FG filaments to slightly collapse in the central and nucleoplasmic regions of NPC,
though a few FG filaments appeared in the central channel on the cytoplasmic side. As
summarized in Fig. 22, the altered Ca2+ concentration in the calcium store could induce the conformation of FG-Nup filaments to change in the way of extension and/or collapse, which is similar as the transport-receptor-dependent FG-Nup conformational changes reported
previously[233, 236, 237].
Figure 22: Calcium-regulated nuclear transport models. The possible conformational changes of FG-Nup barrier in the NPC under different Ca2+concentrations are summarized here, along with the experimentally determined transport routes of passive diffusion (red) and facilitated transport (green) superimposed on the architecture of NPC (blue grids).
These conformational changes can significantly modify the NPC’s permeability and the
transport kinetics for passive diffusion, studied previously. As soon as the FG filaments
extensively extended into the central channel as observed at the Ca2+-depleted condition, they 69
would immediately act as additional physical barriers for signal-independent small molecules to
passively diffuse through, which can increase the diffusing time and reduce the transport
efficiency and the entrance frequency, as we observed in our previous experiments (Table 2).
Interestingly, these FG filaments behaved differently at the high Ca2+ condition, generating a
shorter and wider effective diffusion path for passive diffusion and resulting in the shorter
transport times, the higher transport efficiencies and the higher entrance frequencies shown as
measured in my previous study (Table 2).
Moreover, the conformational changes of FG filaments have different effects on
facilitated transport from that on passive diffusion. As soon as the FG filaments are redistributed
in the NPC by the higher or lower Ca2+ concentrations, the spatial densities of FG filaments
could be re-arranged as well, which consequently could cause Imp β1 to have different spatial
locations and transport kinetics. At the high Ca2+ concentration, the FG-filament barrier forms a
shorter interaction length for Imp β1 but largely maintain its conformation along the NPC, which
is why we only observed in the previous study on transport kinetics, that the transport time
became shorter but the transport efficiency and the entrance frequency kept almost the same as
those at the normal Ca2+ condition. At the reduced Ca2+ concentration, the FG filaments
extensively extended into the axial central channel and occupied more space in the NPC, which
would eventually cause lower spatial densities of FG filaments in the periphery around the
central channel and may not provide enough effective interaction sites for Imp β1 to move
through these areas. The above subsequent changes may be the fundamental causes for the
kinetic parameters observed in my previous study where Imp β1 shorter interaction times, the
reduced transport efficiencies and the lower export entrance frequency of Imp β1 at the Ca2+
depleted condition (exceptionally the higher import entrance frequency might be caused by more 70
FG filaments distributed on the cytoplasmic side providing more reception sites for Imp β1
molecules as they were added in the cytoplasm of permeabilized cells).
Overall, the high-speed super-resolution mapping approach provided quantitatively understanding of calcium-regulated nucleocytoplasmic transport. The calcium-modified FG-Nup barrier in the NPC could be the fundamental causes for the observed altered transport kinetics and pathways for both passive and facilitated transport. Previously, EM data revealed that gp210, a scaffold Nups, had a significant conformational change under the Ca2+ depletion condition
[210]. Also, several other NPC scaffold proteins were recently reported to alter the NPC physical
structure as well [238, 239]. We believe that the further investigations of the calcium effect on
more individual Nups in the NPC are needed and the fruitful results could be obtained if cryo-
EM and super-resolution live cell imaging could be combined to conduct the future studies.
71
CHAPTER IV: CIRCADIAN MODULATION OF NUCLEAR TRANSPORT
Introduction
Nuclear transport is the movement of molecules, either passively diffused or actively transported, across the nuclear membrane. This movement is bidirectional in nature and is one of the key cellular processes for normal functioning of a cell. Basic molecular mechanisms such as transcription and translation would be in disarray without effective and efficient nucleocytoplasmic transport (NT). Import of transcription factors involved in tumor suppression and export of signaling molecules involved in cell division and apoptosis heavily depend on intact NT process. Most of the nuclear transport receptors and nuclear pore proteins, broadly defined in this chapter as nuclear transport components (NTCs) are known to be regulated abnormally in cancer [119]. The detailed mechanism of how the NTCs take part in NT is described in Chapter 1. The NTC CRM1, an export receptor, is broadly used for cancer prognosis and therapeutics [110].
CRM1 levels are elevated in most cancer cells including gliomas [111]. CRM1 is a ubiquitous nuclear export receptor that binds to a cargo protein that has the hydrophobic NES.
Almost 241 macromolecules are exported by CRM1 [240]. There is a vast literature on how tumor-suppressive proteins and oncoproteins are exported out by CRM1.In cancer cells, there is an overexpression of CRM1 which possibly results in export of nuclear functioning oncoproteins back into the cytoplasm, suggesting increased half-life of oncoproteins in the nucleus [112].
CRM1, along with other nuclear transport receptors, is involved in nuclear cytoplasmic shuttling of clock proteins, a major feature in the molecular mechanism of circadian clocks that is found in many cells. Circadian rhythms are the result of internal timing systems that control 72
daily events responsible for the physiological and behavioral changes in an organism. A regular
circadian schedule and proper functioning of clock components appears to provide protection
from different cancers. Disruption of circadian rhythms can lead to deregulated cell proliferation followed by tumorigenesis [135, 136]. Clock genes and proteins are involved in interacting autoregulatory transcription-translation feedback loops that comprise the molecular clockwork
[45] (Fig. 23). To maintain the autoregulatory feedback loops, clock proteins need to be
transported in and out of the nucleus [120]. The timing of clock protein entry, residence time in
the nucleus, and export of these proteins and their mRNA are important for circadian rhythms of
the cell [121], as shown in Figure 23. Most of the clock proteins contain NLS and NES
sequences for receptor-mediated NT [122, 123] and depend on CRM1 as a major player in
nuclear export of clock proteins [128, 129].
73
Adapted from Zanquetta et al., Molecular Cell Biology, 2010 [241]
Figure 23: Nucleocytoplasmic shuttling of clock proteins in the molecular circadian machinery. The autoregulatory transcription-translation feedback loops controlling the molecular circadian clock. Activation of genes is shown with straight lines and inhibition with dashed lines. There is a continuous nucleocytoplasmic shuttling of clock components with export of the clock gene transcripts to the cytoplasm and import to the nucleus. The figure is modified from Zanquetta et al., 2010, to show the nucleocytoplasmic shuttling of clock gene transcripts and clock proteins. The NT is shown with red arrows.
In addition to the core clock genes involved in the circadian oscillations, many more genes express circadian rhythm in various tissues, commonly referred to as clock-controlled genes (CCGs). Based on several studies in the last decade we now know that between 2% to 10% of mammalian transcripts in various tissues are under direct circadian control and many more genes are under indirect clock control by CCGs [242-245]. One of the nuclear transport receptors, Transportin1 (Tnpo1) or karyopherin-β2, shows circadian rhythms in mice under constant dark conditions [246]. The study concluded that Tnpo1 is a CCG and may also contribute to circadian rhythm generation. Though all NTCs are not studied individually, studies 74
using microarray-based high-throughput techniques reveal that some NTC genes are rhythmic in
some tissues and cell lines [243, 247]. One such database used in our research is the circadian
expression profiles database (CircaDB). CircaDB uses microarray analysis in combination with
curve-fitting and Fourier-transform- based statistical algorithms to search data provided by
multiple labs for transcripts which oscillate with a significant circadian rhythm.
Clearly the NT of core clock proteins is required for circadian regulation. Furthermore,
the clock might regulate NT, and because many chemotherapeutic drugs are nuclear targeted,
clock control of NT could explain in part why chemotherapeutic agents are more effective in
patients at particular phases of the circadian cycle. One such drug, doxorubicin (DOX), is among
the most effective anticancer drugs ever developed [248]. DOX, also known as adriamycin,
which was isolated from the fungus Streptomyces peucetius in1972, is a chemotherapeutic agent
with strong activity against a wide range of malignant tumors [249]. It damages the DNA of
malignant cells by several mechanisms as described by different research groups [250]. One
major antineoplastic mechanism of DOX is that it intercalates into the DNA helix and also binds
to proteins involved in DNA replication and transcription [251].
Cellular uptake of DOX and its nuclear entry is characterized as a three-step process. In the first step DOX enters cancer cells by simple diffusion and binds with high affinity to 20S proteosomal subunit of 26S proteasome complex in the cytoplasm. In step two, the DOX proteasome complex is transported into the nucleus via the nuclear pore complexes. In step three,
DOX dissociates from the proteasome complex in the nucleus and binds to DNA as DOX has higher affinity for DNA than the proteasome [250-252]. The nuclear transport of 26S proteasome
(made up of 20S core, capped at one or both ends by 19S regulatory complexes [253]) specifically follows the classical nuclear transport pathways or uses a HEAT-like repeat protein 75
structurally related to karyopherin β, Blm10, for import of its core particles. The regulatory particles associated with the 26S proteasome structure also use classical NLS-mediated nuclear
import. The export mechanism of the proteasome is not clear [254, 255].
This study investigated whether the molecular circadian clock modulates nuclear import
of DOX to determine whether the nuclear uptake of DOX in C6 glioma cells varies according to
circadian phase. It also identified whether nuclear transport components are circadian-regulated
at the transcriptional level in this cell line.
Methods and Materials
Cell Culture
Rat C6 glioma cells obtained from American Type Cell Culture (catalog number CCL-
107) were cultured in what was designated as complete medium that consisted of Dulbecco's
Modified Eagle Medium (DMEM) containing penicillin (100 units/ml), streptomycin (100
µg/ml), 10% fetal bovine serum (FBS), and no pyruvate or phenol red. Cells were grown in 100-
mm culture dishes and incubated at 37°C in 5% CO2. Cells were passaged when they reached
near-confluency. C6 cell lines were cotransfected with amPer2::mPer2::luc construct, which
produced a fusion protein containing mPER2 and firefly luciferase along with the product of
CMV::neo[166] These cells were used for all experiments.
76
Confocal Time-Lapse Imaging of Doxorubicin Nuclear Transport
C6 cells for imaging were seeded (105 cells/dish) in 35-mm tissue culture dishes and incubated overnight in DMEM medium containing 10% FBS at 37°C in 5% CO2. The cells were washed twice with a 10mMHepes-buffered, low-bicarbonate, phenol red-free DMEM designed for use in room air, along with 10% FBS, designated as final medium (FM), After the exchange with Hepes-buffered medium, cells were treated with 20 µM forskolin in 0.3 % DMSO for 2 hrs to synchronize the cellular circadian clocks. After two hours, cells were rinsed again and imaged on the confocal microscope system consisting of a DMI3000B inverted microscope (Leica
Microsystems, Buffalo Grove, IL, USA) equipped with a Spectra X LED light engine
(Lumencore, Beaverton, OR, USA), X-Light spinning-disk confocal unit (CrestOptics, Rome,
Italy), and a RoleraThunder cooled CCD camera with back-thinned, back-illuminated, electron- multiplying sensor (Photometrics) with Metamorph software controlling image acquisition and data analysis (Molecular Devices, Sunnyvale, CA, USA). Confocal images were collected with a
63X oil immersion objective using standard fluorescein filter wavelengths. Cells were first imaged for autofluorescence. Cell were then treated with 10 µM doxorubicin (DOX) and immediately imaged to quantify nuclear transport with a time-lapse feature of Metamorph. A single field of view was captured at 5-min intervals over a period of 120 min. This time point at
2 hrs after the forskolin treatment was the 0 hour circadian time point. Using the same method of synchronization, DOX treatment, and time-lapse confocal imaging, data from other circadian time points of 6 hr, 12 hr, 18hr, 24 hr, 36 hr, and 48 hr were collected from additional cultures.
77
Data Analysis
Confocal fluorescence images at each 5-min interval were collected into a stack for each circadian time point. The background intensity of the images was subtracted based on the average intensity measurements from controls in which cells were not treated with DOX. ImageJ software (NIH) was used to draw a region of interest (ROI) in the nucleus of all the cells in the frame from the middle of the image stack. The maximal fluorescence intensity of the ROIs was measured. The average of the maximal fluorescence intensity of DOX in the nucleus of all cells in the field of view was used for every time point in the 120-minute time lapse video images at all the circadian phases. The averages across the 120-min time series after DOX treatment for each circadian phase were also measured.
Database Search for Gene Sequences
The NCBI Entrez gene database was used to search for four Nup genes encoding Nup98
(NUP98 nucleoporin 98 kDa; Gene ID 4928), Nup153 (NUP153 nucleoporin 153 kDa; Gene ID
9972), Nup214 (NUP214 nucleoporin 214 kDa; Gene ID 8021) and p62 (NUP62 nucleoporin
62kDa; Gene ID 23636), Nup188 (NUP188 nucleoporin 188 kDa; Gene ID 23511), proteins, and three transportin genes (2 importin and 1 exportin) encoding Importin β1 [KPNB1 karyopherin
(importin) beta1 97 kDa; Gene ID 3837], Importin β2 [TNPO1 transportin 1 97 kDa; Gene ID
3842], and CRM1 [XPO1 exportin 1 110 kDa; Gene ID 7514] proteins. The genomic sequences were used for gene predictions and further analysis. After the genomic DNA sequences were obtained, gene prediction programs were used to locate genes and the regulatory sequences of the transcription factor binding sites (TFBS) [256]. 78
Promoter Sequence Identification and Transcription Factor Binding Site Identification
The internet-based software tool First EF(http://rulai.cshl.edu/tools/FirstEF/) was used for promoter site prediction. It is the first exon and promoter prediction program for human DNA.
The genomic sequences of the proteins of interest in FASTA format were imported into the program, which predicted possible promoter sites in that particular sequence. It also gave the predicted promoter start site and end site for each promoter. All the promoter sites predicted by the software for each gene sequence of interest were taken into consideration, and then those specific sequence positions were searched in the Gene Bank data base. The promoter regions of all eight genes were collected separately for analyzing and predicting the transcription binding factors for those sequences.
Internet-based databases and software were used for finding and predicting TFBS. The public version of Matrix Search for Transcription Factor Binding Sites – MATCH
(http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi) program finds binding sites of transcription factors in query sequences. The promoter sequences from the previous searches were imported into the MATCH program and explored for their potential transcription factor binding sites in promoter sequences from the eight genes. The predicted
TFBS from MATCH were alternately searched in JASPAR (http://jaspar.genereg.net/),a high- quality transcription factor binding profile database that provides more curated and non- redundant results than many other databases. Also, some sequences were examined with the program AliBaba2.1 for confirmation of results. As a control, gene predictions were also made for the circadian clock protein rPer2; the promoter sites for rat NTC candidates were detected and analyzed for putative regulatory elements that bind transcription factors, and these were 79
compared with the predicted transcription factors regulating genes encoding Nups and
transportins.
RNA Extraction and cDNA Synthesis
Total RNA was isolated from C6 cell lines using Arcturus Pico Pure RNA Isolation Kit
from Life Technologies at specific circadian time points after forskolin treatment. C6 cells for
imaging were seeded (105 cells/dish) in 35-mm tissue culture dishes and incubated overnight in
DMEM medium containing 10% FBS at 37°C in 5% CO2. The cells were washed twice with FM
and treated with 20 µM forskolin for 2 hrs. At the end of two hours, media was exchanged with
fresh FM. After the first 24-hr cycle, the total RNA was collected every 4 hrs for 24 hrs, starting with 0 hr.
The isolated RNA concentration was measured using a nanodrop spectrophotometer
(Thermo Scientific), and quality was assessed on a 2.5 % agarose gel. The RNA was stored at -
80°C until used for cDNA synthesis. A total of 2 µg of RNA for each time point was used for first strand synthesis using a high capacity cDNA synthesis kit from Applied Biosystems. The cDNA was synthesized at 37°C for 120 min followed by 5-min incubation at 85°C. The cDNA was stored at -20°C until the next analysis.
Quantitative Real Time Polymerase Chain Reaction (qPCR)
PCR primers used for this experiment are listed in Table 3. An initial DNA denaturation step at 95 °C for 2 min was followed by 40 cycles of denaturation at 95 °C for 30 s, primer 80
annealing at 58 °C for 15 s, and extension at 72 °C for 30 s. The primer specificity was
confirmed by sequence searches in human and rat DNA databases (NCBI Primer search) and
analyzed electrophoretically on agarose gels. The qPCR was performed using a Bio-Rad MJ
Mini Opticon thermocycler (Bio-Rad) and Bio-Rad CFxX Manager software (Bio-Rad). All PCR
procedures were performed in duplicate in a volume of 20 μL using 48-well optical-grade PCR
plates and an optical sealing tape (USA Scientific). The expression of all clock and CCG
transcripts was normalized with respect to GAPDH expression. The relative level of expression
was calculated with the formula 2−Δct and was normalized to hGAPDH.
Table 3: List of primer pairs used in real time PCR analysis of clock regulation in cancer stem cell genes.
Target Orientation 5' → 3' Sequence Product Size (bp) rβ-actin Forward CACCCGCGAGTACAACCTTCT 77 Reverse TATCGTCATCCATGGCGAACTGG
rBmal1 Forward ACTGTCTAGGTGGAGGATTTTGG 82 Reverse CTGGTCACCTCAAAGCGACT
rCrm1 Forward GAAGGAGCCCAGCAGAGAAT 100 Reverse TCTGCGAAAACTCCAAAATGGT
Results
Nuclear Import of Doxorubicin in C6 Glioma Cells varies according to Circadian Phase
To test whether the nuclear import of molecules is circadian regulated, we chose a
chemotherapeutic drug doxorubicin for two important reasons: 1) DOX is a very popular
research tool because of its inherent fluorescence associated with the central anthracycline
chromophore group [257]; and 2) DOX has been used clinically for treatment of glioblastomas
and has also been used to study antitumor effects with the C6 cell line [258-262]. 81
We used C6 cells to measure DOX nuclear import at different times of the day. When C6
circadian cell clocks were synchronized with forskolin and given DOX at seven time points, a
circadian rhythm in the nuclear uptake was observed (Fig. 24). The average number of cells in
each field of view for all the circadian phases ranged from 12 to 17 cells (Average of 14.85 ±
1.85). A linear increase in nuclear uptake of DOX during the 2 hours of imaging (Fig. 24A) with greater DOX nuclear import was observed at time points 0, 24, and 48 hrs after clock synchronization. A linear regression was measured for nuclear import of DOX over the 120-min interval for all circadian phases. A plot of linear regression of the slopes from each circadian time point shows a circadian rhythm in the nuclear transport rate of DOX (Fig. 24B). A point of saturation was observed for nuclear uptake of DOX at the 24 hr circadian phase, and retention in the nucleus was higher than at other phases. The nuclear localization of fluorescent DOX at the
24-hr phase two hours after DOX treatment is shown in Figure 24C.
When the nuclear entry was analyzed to take into account individual time points from the
120-min time series after DOX treatment, almost all the time points showed a similar circadian pattern, with higher nuclear transport at circadian phases 24 and 48 hours and lower nuclear transport at 12 and 36 hours (Fig. 24D and E). A peak in nuclear transport was observed after every 24 hours; at 0 hrs, 24 hrs and 48 hrs.
82
Figure 24: Nuclear import of doxorubicin at different circadian phases. (A) Three- dimensional plot of nuclear import of DOX at different circadian phases for a period of 120 min. The fluorescence intensity of DOX (y-axis) inside the nucleus was observed at 7 different circadian phases (x-axis) for a period of 120 min after treatment with DOX to the C6 cells (z- axis). (B) Linear regression slope for all the plots measured at different circadian phases. Error bars represent the error of the regression. (C) Fluorescence image of DOX nuclear localization after 120 minutes at circadian time 24 hr. Scale bar = 10µm. Average DOX intensity in the nucleus at 15 minutes after DOX treatment at different circadian phases (D)and at 120 minutes (E). Error bars are standard error of mean.
83
When the circadian rhythm in DOX nuclear uptake was compared with the mPer2gene expression rhythm described in Chapter 2, the peak uptake preceded the peak in gene expression by about 6 hours (Fig. 25). ThemPer2clock gene expression was derived from a C6 culture expressing a reporter gene that generates a fusion protein of mPER2 and firefly luciferase under control by the mPer2 gene promoter. The mPer2- expressing cultures had a significant period of
25.16 hrs (p<0.001) according to Lomb-Scargle periodogram (LS) analysis.
Figure 25: Comparison of mPER2 protein and doxorubicin nuclear import oscillations in C6 cells. The peak of the rhythm in doxorubicin nuclear transport (black) occurs about 6 hours before the mPER2 protein expression rhythm peak (red).
Identification of Nuclear Transport Components that are Potentially Circadian Regulated
We characterized the nuclear transport of DOX as circadian-regulated. We then extended our study to determine whether any of the nuclear pore components or related proteins are regulated by core clock genes. The rhythmic expression of the candidate genes was verified using the Circa Database (CircaDB), a collection of various cDNA microarray analyses of 84 rhythmic expression of genes in different tissues obtained from mice, humans, and various cell lines. Table 4 shows the results from the database search for statistically significant circadian rhythms in gene expression for all the important nuclear pore components. Members of the import receptor family Importin β1 and export receptor Crm1 were found to be rhythmic in some tissues. Several important Nups also showed circadian rhythms in their mRNA transcripts.
Table 4: Circadian properties of nuclear transport components. The circadian properties NTCs were analyzed using the CircaDB website. Tissues or cells with significant circadian rhythms, based on the period estimates of the Lomb-Scargle periodogram with p-value <0.05, are shown in bold. Where circadian rhythms were identified in cell lines is indicated by (*).
Nuclear Transport Proteins of interest Tissues or cell lines with observed circadian Components properties Importin α1 Mouse liver, kidney tissues and NIH3T3 cell lines*
Importin α2 Mouse liver, skeletal muscles, heart tissues and SCN
Importin α3 Mouse kidney tissues
Importin α4 Mouse liver, white and brown adipose tissues
Importin β1 Mouse liver and kidney tissues Import Transport Regulators or Importin β2 Not reported Importins Importin 5 Mouse liver tissues Importin 7 Mouse liver tissues
Importin 9 Mouse liver, kidney and brown adipose tissues
Importin 11 Mouse adrenal gland tissues
NTF2 Non-Rhythmic Transportin 1 Mouse liver tissues
Transportin 2 Human osteosarcoma U2OS cell lines*
Export Transport CRM1 Mouse kidney tissues and SCN 85
Regulators or CAS/Exportin2 Non-Rhythmic Exportins Nup98 Mouse liver and heart tissues
Nup214 Not reported Nup88 Mouse liver tissues
Nup384 Not reported Gle1 Mouse liver tissues and SCN
Nup54 Mouse brown adipose tissues and SCN
p62 Mouse liver, skeletal muscles, adrenal gland and heart tissues
Nup58 Not reported Nup45 Not reported Nup93 Mouse brown adipose tissues
Nup205 Mouse liver, kidney, adrenal gland, skeletal muscles and brown adipose tissues
Nup188 Mouse aorta tissues and human osteosarcoma Nuclear pore proteins U2OS cell lines* or Nups Nup155 Mouse pituitary and white adipose tissues
Nup35 Mouse heart, kidney, adrenal gland, aorta and brown adipose tissues
Sec13 Mouse liver and kidney tissues
Nup133 Mouse liver tissues
Nup37 Mouse liver, kidney and adrenal gland tissues
Nup43 Mouse SCN and NIH3T3 cell lines*
Nup160 Not reported Nup96 Not reported Nup107 Not reported Seh1 Not reported POM121 Mouse heart tissue and SCN
Nup 153 Non-Rhythmic Nup50 Mouse liver tissue and SCN 86
Although some of the NTCs shown in Table 4 have a circadian rhythm in their RNA
expression, they do not contain a canonical E-box (CACGTG) in their promoter region. They
will still be characterized here as CCGs because they may contain this regulatory element in their
intronic or exonic regions or 3’ downstream sequence, all of which could mediate circadian
rhythmicity. Also, we did not test for presence of related E-boxes, the D box (TTA[T/C]GTAA)
which binds DBP, or the RRE ([A/T]A[A/T]NT[A/G]GGTCA) that binds the retinoic acid-type
receptors Rev-Erb and ROR that serve in the core clock mechanism [263].
To find the E-box elements of some of the important NTCs, we performed bioinformatics
studies of the promoter region of a few of the important genes. Through our in silico promoter
analysis study we identified gene promoters of eight selected NTCs, which included structural
NUPs and import and export receptors essential for nuclear transport that contain the canonical
E-box sequence as our best candidates for further study. Eight genomic sequences encoding all
the eight proteins were examined for possible promoter sites and then the transcription factor
binding sites present on those promoter sites were analyzed. The promoter detection was carried
out by the internet-based software tool FirstEF. The promoter site sequences were then analyzed
for TFBS. Transcription factors for each protein were characterized for the presence of E-box
binding and bHLH binding sequences, specifically CACGTG. The results are shown in Table 5.
Nup 188 and CRM1 genes have the E-box sequence (shown as USF in red) and are predicted to
bind basic-helix-loop-helix transcription factors such as BMAL1. Upstream stimulating factor
(USF) contains a leucine repeat that is required for efficient DNA binding. USF binds the core sequence CACGTG (E-box). Interestingly, Nup 98 promoters have elements like glucocorticoid
receptors (GR) known to bind clock-controlled transcription factors that could produce circadian
rhythms in transcription [264]. Other Nups--Nup 214, Nup188, and Nup153--were shown to 87 have transcription factor binding sites (PAX-4, EVI-1, IRF, AP-1) which are studied as promising candidates for circadian transcriptional regulators. These transcription factors are significantly overrepresented in promoter regions of CCGs[265]. Because the Crm1 promoter contains a USF and the gene is rhythmically expressed in at least two animal tissues, we tested for circadian rhythms of Crm1expression in C6 cells.
Table 5: Transcription factor binding sites of important nuclear transport components. The transcription factor binding sites in the promoter region of the genes of the Nups and NTRs are predicted using MATCH, JASPAR, and AliBaba2.1. Transcription factors in red bind to E- boxes. Transcription factors in bold are possible candidates of circadian transcriptional regulators.
Transcription factor binding sites predicted Protein of Interest Circadian property in promoter region
Importin β1 Rhythmic Staf
Importin β2 Not reported RFX-1, Hand1, Hairy, Elk-1, StupAP, c-Re1
Crm1 Rhythmic USF, IRF-1, FOXJ2, Elf-1, HSF
Nup98 Rhythmic GR, Nkx2-5, PAX4, Pax6, BR-C Z4,
Myogenin, NF-1, AP-1, Kr, PAX4, CREB, Nup214 Non-rhythmic CRE-SP1, c-Jun, Elk-1 CDP CR3+HD, COMP1, v-Myb, HNF-3beta, p62 Rhythmic HNF-1, FOXD3, EVI-1 PAX4, FOXJ2, FOXD3, Myogenin, NF-1, Nup188 Rhythmic AP-1, CRP, NF-E2, Bcd, USF
Nup153 Non-rhythmic Oct-1,FOXD3, EVI-1
88
Circadian Regulation of Crm1 Expression in C6 Cells
The presence of USF in the promoter region of the Crm1 genes suggests that it is under
circadian regulation. To validate the clock regulation of Crm1 we performed qPCR analysis of
its transcripts at 4-hr intervals for 24 hours. We harvested total RNA from only C6 cells at each
time point. A 2-hr, 20 μM forskolin pulse was used to synchronize the mPer2 reporter gene
rhythms in C6 cell lines before total RNA extraction at the 4-hr time points. The cells were
harvested starting at 24 hrs after synchronization to avoid any acute effects of the forskolin pulse.
The quality of RNA at each time point was checked for RNA integrity using gel electrophoresis.
Only if the RNA was stable and no degradation was observed was it used for cDNA synthesis
followed by qPCR analysis. As positive controls we used primers for clock gene Bmal1. The
gene expression was normalized to β-actin for gene expression in C6 cells (ΔCt). After
normalization the transcript levels at each time point were calibrated to the 0 hr time point
(ΔΔCt). Using the formula 2−ΔΔCt the mRNA level at each time was calculated.
Based on the results obtained, we observed near 24-hr oscillations in the transcript levels of Bmal1(Figs. 26B), with a peak at around circadian time 12 as predicted. The Crm1 transcripts showed a 24-hour oscillation with peak transcription at circadian time 16(Fig. 26A), which was 4 hours after the Bmal1 transcription peak (Fig. 26C). This delay would be expected if Crm1 is activated by the CLOCK/BMAL1 complex, as are many CCGs. 89
Figure 26: Real time analysis of Crm1 andBmal1 mRNA expression in C6 cells. (A) The nuclear transport component gene Crm1 appears to be under circadian control. (B) C6 cells exhibit circadian Bmal1 expression after forskolin treatment to synchronize clock cells. (C) The Crm1 transcript oscillation (in red) exhibits 4 hours of delay when compared with Bmal1 transcript oscillations (in blue) after forskolin synchronization.
Discussion
Nuclear transport of core clock proteins is required for circadian regulation. This study
found evidence of how the clock might in turn regulate NPC function, although a circadian
modulation of the NT process has not yet been identified. Two rhythmic processes were
discovered in this study that could control rhythmic movement of circadian clock proteins across
the nuclear envelope—the import of DOX and expression of the export protein CRM1. 90
Autofluorescence imaging of DOX nuclear entry has been linked to simultaneous movement of the 20S proteasome subunit into the nucleus [250-252]. Therefore, the circadian rhythm in DOX nuclear accumulation represents two possible ways that the circadian clock could be modulated:
1) by circadian control of clock protein transport and 2) by possible clock control of a key component of the proteasome that degrades clock proteins. Furthermore, the core clock proteins may be exported in a circadian rhythm if the circadian rhythm in Crm1 expression results in a circadian rhythm in CRM1 protein activity, a likely possibility but not examined in this study.
Another interesting possibility is that--along with clock proteins--DOX export from the nucleus may depend on CRM1, in which case the circadian rhythm in nuclear DOX accumulation could be driven by CRM1 activity, because it could counteract accumulation more effectively at particular circadian phases. Additional studies are needed to address these questions.
If the transport rates are circadian-regulated, then understanding this mechanism will help in designing more effective chemotherapeutic regimes because many chemotherapeutic drugs are targeted to the nucleus. Because chemotherapeutic agents are more effective at particular phases of the circadian cycle, it is important to optimize drug delivery at these times. One clear outcome of this study is the faster nuclear accumulation of DOX at a particular phase that could be estimated by its timing relationship with the peaks in Crm1, Bmal1, or Per2-Luc expression in this project or mPer2 message in previous reports on C6. Essentially, markers of the phase of circadian timing in cancer cells within a particular tumor could be used to estimate the optimal time to deliver DOX or perhaps other chemotherapies.
Based on previous studies of DOX translocation into the nucleus, it is believed that it might be translocated into the nucleus via the 20S proteasome subunit. In 2013 another group 91 showed differential regulation of CRY stability in the nucleus and cytoplasm, and the subcellular distribution and relative E3 ligase activity of FBXL3 and FBXL21 regulating CRY stability in the cell [54].Taking into consideration the above studies and our data it can be speculated that the 20S proteasome subunit may be rhythmically translocated into the nucleus, because of which we detected rhythmic translocation of doxorubicin in C6 glioma cells, as nuclear transport of
DOX follows the nuclear transport routes of the 20S proteasome.
Maintenance of circadian rhythms requires an intact positive and negative feedback loop.
These loops are primarily established by the translocation of positive transcription factors such as CLOCK/BMAL1 and negative transcription factors CRY/PER to the nucleus at specific times of day. Along with timely translocation of these transcription factors to the nucleus, timely degradation of the positive and negative transcription factors by the proteasome play a key role in the normal functioning of the clock [266]. One possibility suggested by this project is that proteasome activity is also regulated by the circadian clock, based on its rhythm in nuclear entry indicated indirectly by DOX autofluorescence, which could further modulate clock proteins.
Numerous studies from clinical trials in the past have demonstrated that toxicity, tolerability, and pharmacokinetic endpoints of several chemotherapeutic drugs, including DOX, is strongly time-dependent [267]. However, none of these studies has demonstrated time- dependent efficacy of DOX in glioma cancer cells. It is now well established that the efficacy of individually applied DOX and their combined treatment varies largely as a function of circadian dosing time. Being an intercalating agent, DOX needs to be maximally translocated into the nucleus to effectively induce toxicity in the cancer cells. Additionally, its maximum concentration inside the cell should be coupled with the cell cycle. Several studies have clearly demonstrated that circadian clock and the cell cycle are coupled to each other [268]. The 92 circadian cock regulates several cell-cycle-related events that gate G1/S or G2/M transitions, as well as DNA repair and apoptosis, which account for the chronopharmacodynamics of anticancer drugs [269, 270].
Additionally, we also demonstrated that CRM1 transport from nucleus to cytoplasm exhibits a circadian rhythm approximately 8hrs out of phase compared to the circadian timing of maximal translocation of doxorubicin. Based on this observation it can be speculated that CRM1 may be involved in export of doxorubicin. In most cancer cells CRM1 is overexpressed, which will result in efflux of the drug from the nucleus, making the cells resistant. Doxorubicin resistance is observed in many cancer cells. Whether doxorubicin is exported out of the nucleus by itself or is assisted by a protein complex needs to be investigated.
An intriguing result from this study is the identification of Crm1 oscillations in a cell culture. Many of the circadian rhythms listed in Table 4 are in tissue harvested at different phases of the circadian cycle. These oscillations may be driven by circadian clocks located outside the collected tissue. Very few NTCs show circadian oscillations in cell cultures, which are rhythms produced by circadian clocks endogenous to those cells. Identifying a significant oscillation in Crm1 gene expression in C6 cells provides strong evidence that it is driven by the circadian clock known to exist in these cells, suggesting that Crm1 activity rhythms are present in gliomas. 93
CHAPTER V: CONCLUDING REMARKS
This research yielded an approximate time of day during which curcumin should be
delivered for maximum cancer cell death; which circadian phase is best for nuclear uptake of the
anti-cancer drug doxorubicin; and vital information on how some nuclear transport components
are circadian-controlled. This research also provided information on how the nuclear transport
pathways respond to different cell calcium levels. Precise single-molecule studies helped to
resolve the long-standing debate about calcium regulation of nuclear transport. This work identified unique properties of circadian and cancer biology that can be a valuable contribution
towards enhancing and improving chemotherapy.
This study tested two chemotherapeutic drugs, curcumin and doxorubicin, and found that
the efficacy of curcumin is circadian-modulated, while the nuclear entry of doxorubicin has a
circadian rhythm that may affect its efficacy. Curcumin efficacy is maximal during 6 to 10 hours
prior to PER expression, and the nuclear uptake of doxorubicin was maximal at about the same
time as PER expression. Doxorubicin is a widely accepted and popular chemo drug, while
curcumin is a fairly newer addition to the range of chemotherapies. Doxorubicin is a hydrophilic
drug and acts by intercalating with the DNA, resulting in many side effects [251], whereas the
polyphenol curcumin is hydrophobic and acts primarily by interacting with cell signaling
pathways, though there are some reports of curcumin binding to DNA [271]. Curcumin treatment
has fewer side effects than doxorubicin.
These very different drugs are subject to circadian control, and there is a good possibility that the effectiveness of other chemotherapy drugs is likewise under circadian control, whether in
nuclear targeting or in overall efficacy. At the organismal level, there are previous reports on 94
modulation of doxorubicin pharmacokinetics at different circadian phases [272]. This study on
the circadian modulation of chemo drugs at the cellular level is novel.
The chemotherapeutic drugs used here accumulate in the nucleus, with doxorubicin
indirectly following receptor-mediated nuclear transport with the 20S proteasome [252]. Thus
the nuclear transport mechanism of this 20S subunit should be more thoroughly studied.
Numerous studies have been conducted on nuclear pore structure and nuclear transport, but
evidence is emerging that the nuclear transport mechanism could be further regulated by free
calcium ions stored in the lumen of the nuclear envelope and endoplasmic reticulum [85].
However, the fundamental calcium-regulated nuclear transport mechanism remains obscure with
many conflicting reports. My earlier work on calcium-regulated nuclear transport using single-
molecule analysis methods concluded that the reduced luminal Ca2+ concentrations significantly
diminished the NPC’s permeability for both passive diffusion and facilitated translocation, while
increased Ca2+concentrations greatly boosted the flux of passive diffusion through the NPC. This study clarifies the kinetics better and provides more insight into the transport routes of different sized molecules inside the pore at altered store calcium states. Remarkably, the reconstruction of
3D spatial routes for both transport modes revealed that the conformation of the NPC selectivity barrier is altered at different calcium concentrations, which could be the fundamental mechanism for the calcium regulated nucleocytoplasmic transport.
This biophysical study used semi-permeabilized cells and chemically altered Ca2+ store concentrations. More testing techniques are needed to determine whether a more physiological signal can be used to alter perinuclear calcium in intact cells, and more efforts are needed to determine whether perinuclear Ca2+ levels change in response to physiological cytosolic calcium
signals in cells. If they do change during normal cell signaling, it should be determined whether 95 the perinuclear Ca2+ responses alter NPC function. If so, then we could conclude that NPC functions may be altered by the many cell signaling pathways that cause release of calcium from intracellular stores.
Furthermore, ER Ca2+ can be altered by cytosolic Ca2+ acting through mitochondria
[273]. Circadian rhythms in cytosolic Ca2+ have been reported in SCN neurons [274]. If C6 cells also have circadian rhythms in intracellular Ca2+, then Ca2+ in their intraluminal space may also show a circadian rhythm. Based on these single-molecule studies, this Ca2+ oscillation could modulate NPC activity throughout the circadian cycle. This potentially circadian nuclear transport could be responsible for the circadian uptake of doxorubicin observed in C6 cells and may also rhythmically alter nuclear transport of other chemo drugs.
Nuclear transport of core clock proteins is required for circadian regulation, and their nuclear export depends on CRM1. This study found that thecrm1 gene transcript is under clock control. Circadian rhythms in crm1 expression have been shown in non-cancer cells (Table 4), but this is the first time CRM1 has been shown to be rhythmic in a cancer cell line.
CRM1 levels are reported to be overexpressed in many cancer cells [114], which may have helped in identifying the Crm1expression rhythms in C6. Because CRM1 is a current target in clinical trials of cancer drugs, its circadian rhythm could be exploited to provide more effective treatments. As in the rhythms in doxorubicin and curcumin, CRM1 may be more effectively repressed at a particular phase of the cycle, but it is important to keep in mind that many tumor cells and cancer cell lines lack a detectable or robust circadian rhythm like that found in C6. For cancer cells that do have a strong circadian clock, regulation of Crm1 promoter 96 activity by its E-box, perhaps through CLOCK/BMAL1 activity, is a promising direction for future drug development.
One major finding of this study is the circadian control of curcumin efficacy. A sensitive phase of the circadian cycle was found that could be applied to patient therapies based on curcumin or curcumin analogues. One other important result of this study of circadian modulation on nuclear transport was discovery of a circadian phase for nuclear transport of the chemotherapeutic drug doxorubicin. Screening of more chemo agents and in vivo studies with these drugs are needed to more fully explore their chronotherapeutic potential. The work reported here provides a sound basis for further work in this area and expands the potential for the field of chronochemotherapy.
97
REFERENCES
1. Society, A.C., Global Cancer Facts & Figures in American Cancer Society. 2015 Atlanta. 2. Society, A.C., Cancer Facts & Figures in American Cancer Society. 2015: Atlanta. 3. GILMAN, A., et al., THE RELATIONSHIP BETWEEN CHEMICAL STRUCTURE AND PHARMACOLOGICAL ACTIVITY OF FORTY-THREE NEW SYNTHETIC LOCAL ANESTHETICS. Journal of Pharmacology and Experimental Therapeutics, 1942. 74(3): p. 290-308. 4. DeVita, V.T. and E. Chu, A History of Cancer Chemotherapy. Cancer Research, 2008. 68(21): p. 8643-8653. 5. Farber, S., et al., Temporary Remissions in Acute Leukemia in Children Produced by Folic Acid Antagonist, 4-Aminopteroyl-Glutamic Acid (Aminopterin). New England Journal of Medicine, 1948. 238(23): p. 787-793. 6. Chabner, B.A. and T.G. Roberts, Jr., Timeline: Chemotherapy and the war on cancer. Nat Rev Cancer, 2005. 5(1): p. 65-72. 7. Shanmugam, M.K., et al., The multifaceted role of curcumin in cancer prevention and treatment. Molecules, 2015. 20(2): p. 2728-69. 8. Goel, A., A.B. Kunnumakkara, and B.B. Aggarwal, Curcumin as "Curecumin": from kitchen to clinic. Biochem Pharmacol, 2008. 75(4): p. 787-809. 9. Ravindran, J., S. Prasad, and B.B. Aggarwal, Curcumin and Cancer Cells: How Many Ways Can Curry Kill Tumor Cells Selectively? The AAPS Journal, 2009. 11(3): p. 495- 510. 10. Mahmood, K., et al., Recent developments in curcumin and curcumin based polymeric materials for biomedical applications: A review. International Journal of Biological Macromolecules, 2015. 81: p. 877-890. 11. Rodrigues, J.L., et al., Heterologous Production of Curcuminoids. Microbiology and Molecular Biology Reviews, 2015. 79(1): p. 39-60. 12. Wang, Y.J., et al., Stability of curcumin in buffer solutions and characterization of its degradation products. J Pharm Biomed Anal, 1997. 15(12): p. 1867-76. 13. Esatbeyoglu, T., et al., Curcumin--from molecule to biological function. Angew Chem Int Ed Engl, 2012. 51(22): p. 5308-32. 14. Maheshwari, R.K., et al., Multiple biological activities of curcumin: A short review. Life Sciences, 2006. 78(18): p. 2081-2087. 15. Xu, D., Tian, W., & Shen, H, P-gp upregulation may be blocked by natural curcuminoids, a novel class of chemoresistance-preventing agent. Molecular Medicine Reports, 2012. 7: p. 115-121. 16. López-Lázaro, M., Anticancer and carcinogenic properties of curcumin: Considerations for its clinical development as a cancer chemopreventive and chemotherapeutic agent. Molecular Nutrition & Food Research, 2008. 52(S1): p. S103-S127. 17. Shehzad, A., F. Wahid, and Y.S. Lee, Curcumin in Cancer Chemoprevention: Molecular Targets, Pharmacokinetics, Bioavailability, and Clinical Trials. Archiv der Pharmazie, 2010. 343(9): p. 489-499. 18. Wilken, R., et al., Curcumin: A review of anti-cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Molecular Cancer, 2011. 10(1): p. 1-19. 98
19. Aggarwal BB, B.I., Ichikawa H, Ahn KS, Sethi G, Sandur SK, et. al, Curcumin– boiological and medicinal properties. Turmeric: the genus Curcuma. 2006: Taylor and Francis Group;. 20. Anand, P., et al., Curcumin and cancer: An “old-age” disease with an “age-old” solution. Cancer Letters, 2008. 267(1): p. 133-164. 21. Shishodia, S., M.M. Chaturvedi, and B.B. Aggarwal, Role of Curcumin in Cancer Therapy. Current Problems in Cancer, 2007. 31(4): p. 243-305. 22. Dhandapani, K.M., V.B. Mahesh, and D.W. Brann, Curcumin suppresses growth and chemoresistance of human glioblastoma cells via AP-1 and NFkappaB transcription factors. J Neurochem, 2007. 102(2): p. 522-38. 23. Liu, E., et al., Curcumin induces G2/M cell cycle arrest in a p53-dependent manner and upregulates ING4 expression in human glioma. Journal of Neuro-Oncology, 2007. 85(3): p. 263-270. 24. Karmakar, S., et al., Curcumin activated both receptor-mediated and mitochondria- mediated proteolytic pathways for apoptosis in human glioblastoma T98G cells. Neurosci Lett, 2006. 407(1): p. 53-8. 25. Parsons, D.W., et al., An Integrated Genomic Analysis of Human Glioblastoma Multiforme. Science (New York, N.Y.), 2008. 321(5897): p. 1807. 26. Huang, T.Y., et al., Curcuminoids suppress the growth and induce apoptosis through caspase-3-dependent pathways in glioblastoma multiforme (GBM) 8401 cells. J Agric Food Chem, 2010. 58(19): p. 10639-45. 27. Su, C.C., M.J. Wang, and T.L. Chiu, The anti-cancer efficacy of curcumin scrutinized through core signaling pathways in glioblastoma. Int J Mol Med, 2010. 26(2): p. 217-24. 28. Senft, C., et al., The nontoxic natural compound Curcumin exerts anti-proliferative, anti- migratory, and anti-invasive properties against malignant gliomas. BMC Cancer, 2010. 10: p. 491. 29. Luthra, P.M., R. Kumar, and A. Prakash, Demethoxycurcumin induces Bcl-2 mediated G2/M arrest and apoptosis in human glioma U87 cells. Biochem Biophys Res Commun, 2009. 384(4): p. 420-5. 30. Huang, T.Y., et al., Demethoxycurcumin Retards Cell Growth and Induces Apoptosis in Human Brain Malignant Glioma GBM 8401 Cells. Evid Based Complement Alternat Med, 2012. 2012: p. 396573. 31. Du, W.Z., et al., Curcumin suppresses malignant glioma cells growth and induces apoptosis by inhibition of SHH/GLI1 signaling pathway in vitro and vivo. CNS Neurosci Ther, 2013. 19(12): p. 926-36. 32. Aoki, H., et al., Evidence that curcumin suppresses the growth of malignant gliomas in vitro and in vivo through induction of autophagy: Role of akt and extracellular signal- regulated kinase signaling pathways. Molecular Pharmacology, 2007. 72(1): p. 29-39. 33. Zanotto-Filho, A., et al., The curry spice curcumin selectively inhibits cancer cells growth in vitro and in preclinical model of glioblastoma. J Nutr Biochem, 2012. 23(6): p. 591-601. 34. Reppert, S.M. and D.R. Weaver, Coordination of circadian timing in mammals. Nature, 2002. 418(6901): p. 935-41. 35. Lowrey, P.L. and J.S. Takahashi, Mammalian circadian biology: elucidating genome- wide levels of temporal organization. Annu Rev Genomics Hum Genet, 2004. 5: p. 407- 41. 99
36. Reppert, S.M. and D.R. Weaver, MOLECULAR ANALYSIS OF MAMMALIAN CIRCADIAN RHYTHMS. Annual Review of Physiology, 2001. 63(1): p. 647-676. 37. Asher, G. and P. Sassone-Corsi, Time for food: the intimate interplay between nutrition, metabolism, and the circadian clock. Cell, 2015. 161(1): p. 84-92. 38. Ralph, M.R., et al., Transplanted suprachiasmatic nucleus determines circadian period. Science, 1990. 247(4945): p. 975-8. 39. Yamazaki, S., et al., Resetting central and peripheral circadian oscillators in transgenic rats. Science, 2000. 288(5466): p. 682-5. 40. Saini, C., et al., The mammalian circadian timing system: synchronization of peripheral clocks. Cold Spring Harb Symp Quant Biol, 2011. 76: p. 39-47. 41. Ko, C.H. and J.S. Takahashi, Molecular components of the mammalian circadian clock. Human Molecular Genetics, 2006. 15(suppl 2): p. R271-R277. 42. Isojima, Y., N. Okumura, and K. Nagai, Molecular Mechanism of Mammalian Circadian Clock. Journal of Biochemistry, 2003. 134(6): p. 777-784. 43. Korf, H.W. and C. von Gall, Mice, melatonin and the circadian system. Molecular and Cellular Endocrinology, 2006. 252(1–2): p. 57-68. 44. Son, G.H., S. Chung, and K. Kim, The adrenal peripheral clock: Glucocorticoid and the circadian timing system. Frontiers in Neuroendocrinology, 2011. 32(4): p. 451-465. 45. Shearman, L.P., et al., Interacting Molecular Loops in the Mammalian Circadian Clock. Science, 2000. 288(5468): p. 1013-1019. 46. Mohawk, J.A., C.B. Green, and J.S. Takahashi, Central and Peripheral Circadian Clocks in Mammals. Annual Review of Neuroscience, 2012. 35(1): p. 445-462. 47. Mohawk, J.A., C.B. Green, and J.S. Takahashi, Central and peripheral circadian clocks in mammals. Annu Rev Neurosci, 2012. 35: p. 445-62. 48. Albrecht, U., Timing to perfection: the biology of central and peripheral circadian clocks. Neuron, 2012. 74(2): p. 246-60. 49. Dardente, H. and N. Cermakian, Molecular circadian rhythms in central and peripheral clocks in mammals. Chronobiol Int, 2007. 24(2): p. 195-213. 50. Isojima, Y., N. Okumura, and K. Nagai, Molecular mechanism of mammalian circadian clock. J Biochem, 2003. 134(6): p. 777-84. 51. Takahashi, J.S. Molecular and Genetic Analysis of Mammalian Circadian Clocks. 2012; Available from: http://www.hhmi.org/research/molecular-and-genetic-analysis- mammalian-circadian-clocks. 52. Yoo, S.-H., et al., Competing E3 Ubiquitin Ligases Govern Circadian Periodicity by Degradation of CRY in Nucleus and Cytoplasm. Cell, 2013. 152(5): p. 1091-1105. 53. Sidote, D. and I. Edery, Heat-induced degradation of PER and TIM in Drosophila bearing a conditional allele of the heat shock transcription factor gene. Chronobiol Int, 1999. 16(4): p. 519-25. 54. Yoo, S.H., et al., Competing E3 ubiquitin ligases govern circadian periodicity by degradation of CRY in nucleus and cytoplasm. Cell, 2013. 152(5): p. 1091-105. 55. Sathyanarayanan, S., et al., Identification of novel genes involved in light-dependent CRY degradation through a genome-wide RNAi screen. Genes Dev, 2008. 22(11): p. 1522-33. 56. Callan, H.G. and S.G. Tomlin, Experimental Studies on Amphibian Oocyte Nuclei. I. Investigation of the Structure of the Nuclear Membrane by Means of the Electron Microscope. Proceedings of the Royal Society of London B: Biological Sciences, 1950. 137(888): p. 367-378. 100
57. Watson, M.L., Further Observations on the Nuclear Envelope of the Animal Cell. The Journal of Biophysical and Biochemical Cytology, 1959. 6(2): p. 147-156. 58. Hurt, E. and M. Beck, Towards understanding nuclear pore complex architecture and dynamics in the age of integrative structural analysis. Current Opinion in Cell Biology, 2015. 34: p. 31-38. 59. Beck, M., et al., Nuclear Pore Complex Structure and Dynamics Revealed by Cryoelectron Tomography. Science, 2004. 306(5700): p. 1387-1390. 60. Adams, Rebecca L. and Susan R. Wente, Uncovering Nuclear Pore Complexity with Innovation. Cell, 2013. 152(6): p. 1218-1221. 61. Terry, L.J. and S.R. Wente, Flexible Gates: Dynamic Topologies and Functions for FG Nucleoporins in Nucleocytoplasmic Transport. Eukaryotic Cell, 2009. 8(12): p. 1814- 1827. 62. Brohawn, S.G., et al., The Nuclear Pore Complex Has Entered the Atomic Age. Structure, 2009. 17(9): p. 1156-1168. 63. Corbett, A.H. and P.A. Silver, Nucleocytoplasmic transport of macromolecules. Microbiology and Molecular Biology Reviews, 1997. 61(2): p. 193-211. 64. Terry, L.J., E.B. Shows, and S.R. Wente, Crossing the Nuclear Envelope: Hierarchical Regulation of Nucleocytoplasmic Transport. Science, 2007. 318(5855): p. 1412-1416. 65. Kapon, R., et al., Permeating the nuclear pore complex. Nucleus, 2010. 1(6): p. 475-480. 66. Fried, H. and U. Kutay, Nucleocytoplasmic transport: taking an inventory. Cellular and Molecular Life Sciences CMLS, 2003. 60(8): p. 1659-1688. 67. Tran, E.J., T.A. Bolger, and S.R. Wente, SnapShot: Nuclear Transport. Cell, 2007. 131(2): p. 420.e1. 68. Stewart, M., Molecular mechanism of the nuclear protein import cycle. Nat Rev Mol Cell Biol, 2007. 8(3): p. 195-208. 69. Tran, E.J., T.A. Bolger, and S.R. Wente, SnapShot: Nuclear Transport. Cell, 2007. 131(2): p. 420. 70. Cook, A., et al., Structural Biology of Nucleocytoplasmic Transport. Annual Review of Biochemistry, 2007. 76(1): p. 647-671. 71. Kuersten, S., M. Ohno, and I.W. Mattaj, Nucleocytoplasmic transport: Ran, beta and beyond. Trends in Cell Biology, 2001. 11(12): p. 497-503. 72. Jamieson, C., M. Sharma, and B.R. Henderson, Targeting the β-catenin nuclear transport pathway in cancer. Seminars in Cancer Biology, 2014. 27: p. 20-29. 73. Ikeda, M., et al., Circadian dynamics of cytosolic and nuclear Ca2+ in single suprachiasmatic nucleus neurons. Neuron, 2003. 38(2): p. 253-63. 74. Obrietan, K., S. Impey, and D.R. Storm, Light and circadian rhythmicity regulate MAP kinase activation in the suprachiasmatic nuclei. Nat Neurosci, 1998. 1(8): p. 693-700. 75. Dolmetsch, R.E., et al., Signaling to the nucleus by an L-type calcium channel- calmodulin complex through the MAP kinase pathway. Science, 2001. 294(5541): p. 333- 9. 76. Travnickova-Bendova, Z., et al., Bimodal regulation of mPeriod promoters by CREB- dependent signaling and CLOCK/BMAL1 activity. Proc Natl Acad Sci U S A, 2002. 99(11): p. 7728-33. 77. D L Gill, T.K.G., J Bian, A D Short, R T Waldron, S L Rybak, Function and organization of the inositol 1,4,5-trisphosphate-sensitive calcium pool. Adv Second Messenger Phosphoprotein Res., 1996. 26: p. 265-308. 101
78. Lee, M.A., et al., Calcium regulation of nuclear pore permeability. Cell Calcium, 1998. 23(2–3): p. 91-101. 79. Mauger, J.-P., Role of the nuclear envelope in calcium signalling. Biology of the Cell, 2012. 104(2): p. 70-83. 80. Malviya, A.N. and C. Klein, Mechanism regulating nuclear calcium signalingThis paper is one of a selection of papers published in this Special Issue, entitled The Nucleus: A Cell Within A Cell. Canadian Journal of Physiology and Pharmacology, 2006. 84(3-4): p. 403-422. 81. Perez-Terzic, C., M. Jaconi, and D.E. Clapham, Nuclear calcium and the regulation of the nuclear pore complex. BioEssays, 1997. 19(9): p. 787-792. 82. Humbert, J.-P., et al., Inositol 1,4,5-Trisphosphate Receptor Is Located to the Inner Nuclear Membrane Vindicating Regulation of Nuclear Calcium Signaling by Inositol 1,4,5-Trisphosphate. Journal of Biological Chemistry, 1996. 271(1): p. 478-485. 83. Gerasimenko, J., et al., Calcium signalling in and around the nuclear envelope. Biochemical Society Transactions, 2003. 31(1): p. 76-78. 84. Bootman, M.D., et al., An update on nuclear calcium signalling. Journal of Cell Science, 2009. 122(14): p. 2337-2350. 85. Sarma, A. and W. Yang, Calcium regulation of nucleocytoplasmic transport. Protein & Cell, 2011. 2(4): p. 291-302. 86. Perez-Terzic, C., et al., Structural plasticity of the cardiac nuclear pore complex in response to regulators of nuclear import. Circ Res, 1999. 84(11): p. 1292-301. 87. Perez-Terzic, C., et al., Conformational states of the nuclear pore complex induced by depletion of nuclear Ca2+ stores. Science, 1996. 273(5283): p. 1875-7. 88. Wang, H. and D.E. Clapham, Conformational changes of the in situ nuclear pore complex. Biophys J, 1999. 77(1): p. 241-7. 89. Moore-Nichols, D., A. Arnott, and R.C. Dunn, Regulation of Nuclear Pore Complex Conformation by IP3 Receptor Activation. Biophysical Journal, 2002. 83(3): p. 1421- 1428. 90. Mooren, O.L., et al., Nuclear side conformational changes in the nuclear pore complex following calcium release from the nuclear membrane. Phys Biol, 2004. 1(1-2): p. 125- 34. 91. Erickson, E.S., et al., The role of nuclear envelope calcium in modifying nuclear pore complex structure. Can J Physiol Pharmacol, 2006. 84(3-4): p. 309-18. 92. Malviya, A.N. and P.J. Rogue, “Tell Me Where Is Calcium Bred”: Clarifying the Roles of Nuclear Calcium. Cell, 1998. 92(1): p. 17-23. 93. Strubing, C. and D.E. Clapham, Active nuclear import and export is independent of lumenal Ca2+ stores in intact mammalian cells. J Gen Physiol, 1999. 113(2): p. 239-48. 94. Paulillo, S.M., et al., Changes in nucleoporin domain topology in response to chemical effectors. J Mol Biol, 2006. 363(1): p. 39-50. 95. Stehno-Bittel, L., C. Perez-Terzic, and D.E. Clapham, Diffusion across the nuclear envelope inhibited by depletion of the nuclear Ca2+ store. Science, 1995. 270(5243): p. 1835-8. 96. Greber, U.F. and L. Gerace, Depletion of calcium from the lumen of endoplasmic reticulum reversibly inhibits passive diffusion and signal-mediated transport into the nucleus. J Cell Biol, 1995. 128(1-2): p. 5-14. 102
97. Gensburger, C., et al., In vivo nuclear Ca2+-ATPase phosphorylation triggers intermediate size molecular transport to the nucleus. Biochem Biophys Res Commun, 2003. 303(4): p. 1225-8. 98. Greber, U.F. and L. Gerace, Nuclear protein import is inhibited by an antibody to a lumenal epitope of a nuclear pore complex glycoprotein. The Journal of Cell Biology, 1992. 116(1): p. 15-30. 99. O'Brien, E.M., et al., Hormonal regulation of nuclear permeability. J Biol Chem, 2007. 282(6): p. 4210-7. 100. Paulillo, S.M., et al., Changes in Nucleoporin Domain Topology in Response to Chemical Effectors. Journal of Molecular Biology, 2006. 363(1): p. 39-50. 101. Perez-Terzic, C., et al., Conformational States of the Nuclear Pore Complex Induced by Depletion of Nuclear Ca2+ Stores. Science, 1996. 273(5283): p. 1875-1877. 102. Strübing, C. and D.E. Clapham, Active Nuclear Import and Export Is Independent of Lumenal Ca2+ Stores in Intact Mammalian Cells. The Journal of General Physiology, 1999. 113(2): p. 239-248. 103. Wei, X., et al., Real-time imaging of nuclear permeation by EGFP in single intact cells. Biophys J, 2003. 84(2 Pt 1): p. 1317-27. 104. Enss, K., et al., Passive Transport of Macromolecules through Xenopus laevis Nuclear Envelope. The Journal of Membrane Biology, 2003. 196(3): p. 147-155. 105. Gravina, G.L., et al., Nucleo-cytoplasmic transport as a therapeutic target of cancer. J Hematol Oncol, 2014. 7: p. 85. 106. Kau, T.R., J.C. Way, and P.A. Silver, Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer, 2004. 4(2): p. 106-17. 107. Beg, A.A., et al., I kappa B interacts with the nuclear localization sequences of the subunits of NF-kappa B: a mechanism for cytoplasmic retention. Genes Dev, 1992. 6(10): p. 1899-913. 108. Moll, U.M., G. Riou, and A.J. Levine, Two distinct mechanisms alter p53 in breast cancer: mutation and nuclear exclusion. Proc Natl Acad Sci U S A, 1992. 89(15): p. 7262-6. 109. Lu, W., et al., Nuclear exclusion of p53 in a subset of tumors requires MDM2 function. Oncogene, 2000. 19(2): p. 232-40. 110. Turner, J.G., et al., Inhibition of CRM1-dependent nuclear export sensitizes malignant cells to cytotoxic and targeted agents. Semin Cancer Biol, 2014. 27: p. 62-73. 111. Shen, A., et al., Expression of CRM1 in human gliomas and its significance in p27 expression and clinical prognosis. Neurosurgery, 2009. 65(1): p. 153-9; discussion 159- 60. 112. Tan, D.S., et al., Promising SINEs for embargoing nuclear-cytoplasmic export as an anticancer strategy. Cancer Discov, 2014. 4(5): p. 527-37. 113. Kudo, N., et al., Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc Natl Acad Sci U S A, 1999. 96(16): p. 9112-7. 114. Nguyen, K.T., M.P. Holloway, and R.A. Altura, The CRM1 nuclear export protein in normal development and disease. Int J Biochem Mol Biol, 2012. 3(2): p. 137-51. 115. Turner, J.G., J. Dawson, and D.M. Sullivan, Nuclear export of proteins and drug resistance in cancer. Biochem Pharmacol, 2012. 83(8): p. 1021-32. 103
116. Dickmanns, A., T. Monecke, and R. Ficner, Structural Basis of Targeting the Exportin CRM1 in Cancer. Cells, 2015. 4(3): p. 538-68. 117. Martinez, N., et al., The nuclear pore complex protein Nup88 is overexpressed in tumor cells. Cancer Res, 1999. 59(21): p. 5408-11. 118. Wang, G.G., et al., NUP98-NSD1 links H3K36 methylation to Hox-A gene activation and leukaemogenesis. Nat Cell Biol, 2007. 9(7): p. 804-12. 119. Xu, S. and M.A. Powers, Nuclear pore proteins and cancer. Semin Cell Dev Biol, 2009. 20(5): p. 620-30. 120. Cermakian, N. and P. Sassone-Corsi, Multilevel regulation of the circadian clock. Nature Reviews. Molecular Cell Biology, 2000. 1(1): p. 59-67. 121. Tamanini, F., et al., Nucleocytoplasmic Shuttling of Clock Proteins, in Methods in Enzymology, W.Y. Michael, Editor. 2005, Academic Press. p. 418-435. 122. Miyazaki, K., M. Mesaki, and N. Ishida, Nuclear Entry Mechanism of Rat PER2 (rPER2): Role of rPER2 in Nuclear Localization of CRY Protein. Molecular and Cellular Biology, 2001. 21(19): p. 6651-6659. 123. Sakakida, Y., et al., Importin α/β Mediates Nuclear Transport of a Mammalian Circadian Clock Component, mCRY2, Together with mPER2, through a Bipartite Nuclear Localization Signal. Journal of Biological Chemistry, 2005. 280(14): p. 13272-13278. 124. Saez, L., et al., A Key Temporal Delay in the Circadian Cycle of Drosophila Is Mediated by a Nuclear Localization Signal in the Timeless Protein. Genetics, 2011. 188(3): p. 591- 600. 125. Saez, L. and M.W. Young, Regulation of nuclear entry of the Drosophila clock proteins period and timeless. Neuron, 1996. 17(5): p. 911-20. 126. Kume, K., et al., mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop. Cell, 1999. 98(2): p. 193-205. 127. Vielhaber, E., et al., Nuclear Entry of the Circadian Regulator mPER1 Is Controlled by Mammalian Casein Kinase I ɛ. Molecular and Cellular Biology, 2000. 20(13): p. 4888- 4899. 128. Yagita, K., et al., Nucleocytoplasmic shuttling and mCRY-dependent inhibition of ubiquitylation of the mPER2 clock protein. The EMBO Journal, 2002. 21(6): p. 1301- 1314. 129. Vielhaber, E.L., et al., Nuclear Export of Mammalian PERIOD Proteins. Journal of Biological Chemistry, 2001. 276(49): p. 45921-45927. 130. Tamaru, T., et al., Nucleocytoplasmic shuttling and phosphorylation of BMAL1 are regulated by circadian clock in cultured fibroblasts. Genes to Cells, 2003. 8(12): p. 973- 983. 131. Kwon, I., et al., BMAL1 Shuttling Controls Transactivation and Degradation of the CLOCK/BMAL1 Heterodimer. Molecular and Cellular Biology, 2006. 26(19): p. 7318- 7330. 132. Umemura, Y., et al., Transcriptional program of Kpna2/Importin-α2 regulates cellular differentiation-coupled circadian clock development in mammalian cells. Proceedings of the National Academy of Sciences, 2014. 111(47): p. E5039-E5048. 133. Lee, Y., et al., KPNB1 mediates PER/CRY nuclear translocation and circadian clock function. eLife, 2015. 4. 134. Jang, A.R., et al.,
135. Savvidis, C. and M. Koutsilieris, Circadian rhythm disruption in cancer biology. Molecular Medicine (Cambridge, Mass.), 2012. 18: p. 1249-1260. 136. Hrushesky, W.J.M., et al., Circadian Clock Manipulation for Cancer Prevention and Control and the Relief of Cancer Symptoms. Integrative Cancer Therapies, 2009. 8(4): p. 387-397. 137. Innominato, P.F., et al., The circadian timing system in clinical oncology. Ann Med, 2014. 46(4): p. 191-207. 138. Sancar, A., et al., Circadian clock, cancer, and chemotherapy. Biochemistry, 2015. 54(2): p. 110-23. 139. Lévi, F., et al., Circadian Timing in Cancer Treatments. Annual Review of Pharmacology and Toxicology, 2010. 50(1): p. 377-421. 140. Levi, F. and U. Schibler, Circadian rhythms: mechanisms and therapeutic implications. Annu Rev Pharmacol Toxicol, 2007. 47: p. 593-628. 141. Dulong, S., et al., Identification of Circadian Determinants of Cancer Chronotherapy through In Vitro Chronopharmacology and Mathematical Modeling. Molecular Cancer Therapeutics, 2015. 14(9): p. 2154-2164. 142. Syng-ai, C., A.L. Kumari, and A. Khar, Effect of curcumin on normal and tumor cells: Role of glutathione and bcl-2. Molecular Cancer Therapeutics, 2004. 3(9): p. 1101-1108. 143. Shehzad, A., J. Lee, and Y.S. Lee, Curcumin in various cancers. BioFactors, 2013. 39(1): p. 56-68. 144. Zanotto-Filho, A., et al., The curry spice curcumin selectively inhibits cancer cells growth in vitro and in preclinical model of glioblastoma. The Journal of Nutritional Biochemistry, 2012. 23(6): p. 591-601. 145. Ahsan, H., et al., Pro-oxidant, anti-oxidant and cleavage activities on DNA of curcumin and its derivatives demethoxycurcumin and bisdemethoxycurcumin. Chemico-Biological Interactions, 1999. 121(2): p. 161-175. 146. Hoehle, S.I., et al., Metabolism of Curcuminoids in Tissue Slices and Subcellular Fractions from Rat Liver. Journal of Agricultural and Food Chemistry, 2006. 54(3): p. 756-764. 147. Ruby, A.J., et al., Anti-tumour and antioxidant activity of natural curcuminoids. Cancer Letters, 1995. 94(1): p. 79-83. 148. Focan, C., Circadian rhythms and cancer chemotherapy. Pharmacology & Therapeutics, 1995. 67(1): p. 1-52. 149. Granda, T.G., et al., Circadian regulation of cell cycle and apoptosis proteins in mouse bone marrow and tumor. The FASEB Journal, 2004. 150. Nakagawa, K., T. Yamamoto, and A. Yasuda, Detection of the CLOCK/BMAL1 heterodimer using a nucleic acid probe with cycling probe technology. Analytical Biochemistry, 2010. 404(2): p. 165-170. 151. Kromkowski, J., et al., Response to lithium of a cell surface ECTO-NOX protein with time-keeping characteristics. Neuroscience Letters, 2008. 438(1): p. 121-125. 152. Gallego, M., H. Kang, and David M. Virshup, Protein phosphatase 1 regulates the stability of the circadian protein PER2. Biochemical Journal, 2006. 399(1): p. 169-175. 153. Geusz, M.E., Sharma,V.P., Sarma,A., Malik,A. , Evaluating Circadian Oscillators In Cancer Stem Cells. Journal of Evolving Stem Cell Research, 2015. 1(1). 154. Sancar, A., et al., Circadian Clock, Cancer, and Chemotherapy. Biochemistry, 2015. 54(2): p. 110-123. 105
155. Wang, H.-M., et al., PPARγ Agonist Curcumin Reduces the Amyloid-β-Stimulated Inflammatory Responses in Primary Astrocytes. Journal of Alzheimer's Disease, 2010. 20(4): p. 1189-1199. 156. Wang, N., et al., Vascular PPARγ Controls Circadian Variation in Blood Pressure and Heart Rate through Bmal1. Cell Metabolism, 2008. 8(6): p. 482-491. 157. Chung, S., et al., Regulation of SIRT1 in cellular functions: Role of polyphenols. Archives of Biochemistry and Biophysics, 2010. 501(1): p. 79-90. 158. Miki, T., et al., PML regulates PER2 nuclear localization and circadian function. Vol. 31. 2012. 1427-1439. 159. Asher, G., et al., SIRT1 Regulates Circadian Clock Gene Expression through PER2 Deacetylation. Cell, 2008. 134(2): p. 317-328. 160. Kaur, G., et al., Timing is important in medication administration: a timely review of chronotherapy research. International Journal of Clinical Pharmacy, 2013. 35(3): p. 344- 358. 161. Griffett, K. and T.P. Burris, The mammalian clock and chronopharmacology. Bioorganic & Medicinal Chemistry Letters, 2013. 23(7): p. 1929-1934. 162. Sallam, H., et al., The effect of circadian rhythm on pharmacokinetics and metabolism of the Cdk inhibitor, roscovitine, in tumor mice model. Chronobiology International, 2015. 32(5): p. 608-614. 163. Lévi, F., et al., Implications of circadian clocks for the rhythmic delivery of cancer therapeutics. Advanced Drug Delivery Reviews, 2007. 59(9–10): p. 1015-1035. 164. Altinok, A., F. Lévi, and A. Goldbeter, A cell cycle automaton model for probing circadian patterns of anticancer drug delivery. Advanced Drug Delivery Reviews, 2007. 59(9–10): p. 1036-1053. 165. Lévi, F., Chronotherapeutics: The Relevance of Timing in Cancer Therapy. Cancer Causes & Control, 2006. 17(4): p. 611-621. 166. Sharma, V.P., N.T. Anderson, and M.E. Geusz, Circadian properties of cancer stem cells in glioma cell cultures and tumorspheres. Cancer Letters. 345(1): p. 65-74. 167. Fujioka, A., N. Takashima, and Y. Shigeyoshi, Circadian rhythm generation in a glioma cell line. Biochemical and Biophysical Research Communications, 2006. 346(1): p. 169- 174. 168. Ghosh, S., S. Banerjee, and P.C. Sil, The beneficial role of curcumin on inflammation, diabetes and neurodegenerative disease: A recent update. Food and Chemical Toxicology, 2015. 83: p. 111-124. 169. Dhandapani, K.M., V.B. Mahesh, and D.W. Brann, Curcumin suppresses growth and chemoresistance of human glioblastoma cells via AP-1 and NFkappaB transcription factors. Journal Of Neurochemistry, 2007. 102(2): p. 522-538. 170. Gao, X., et al., Curcumin differentially sensitizes malignant glioma cells to TRAIL/Apo2L-mediated apoptosis through activation of procaspases and release of cytochrome c from mitochondria. Journal Of Experimental Therapeutics & Oncology, 2005. 5(1): p. 39-48. 171. Kim, S.-Y., S.-H. Jung, and H.-S. Kim, Curcumin is a potent broad spectrum inhibitor of matrix metalloproteinase gene expression in human astroglioma cells. Biochemical and Biophysical Research Communications, 2005. 337(2): p. 510-516. 106
172. Nagai, S., et al., Inhibition of Cellular Proliferation and Induction of Apoptosis by Curcumin in Human Malignant Astrocytoma Cell Lines. Journal of Neuro-Oncology, 2005. 74(2): p. 105-111. 173. Panchal, H., et al., Early Anti-Oxidative and Anti-Proliferative Curcumin Effects on Neuroglioma Cells Suggest Therapeutic Targets. Neurochemical Research, 2008. 33(9): p. 1701-1710. 174. Senft, C., et al., The nontoxic natural compound Curcumin exerts anti-proliferative, anti- migratory, and anti-invasive properties against malignant gliomas. BMC Cancer, 2010. 10(1): p. 491. 175. Su, C.-C., M.-J. Wang, and T.-L. Chiu, The anti-cancer efficacy of curcumin scrutinized through core signaling pathways in glioblastoma. International Journal of Molecular Medicine, 2010. 26(2): p. 217-224. 176. Sharma, V.P., N.T. Anderson, and M.E. Geusz, Circadian properties of cancer stem cells in glioma cell cultures and tumorspheres. Cancer Letters, 2014. 345(1): p. 65-74. 177. Teiten, M.-H., M. Dicato, and M. Diederich, Hybrid Curcumin Compounds: A New Strategy for Cancer Treatment. Molecules, 2014. 19(12): p. 20839. 178. Salem, M., S. Rohani, and E.R. Gillies, Curcumin, a promising anti-cancer therapeutic: a review of its chemical properties, bioactivity and approaches to cancer cell delivery. RSC Advances, 2014. 4(21): p. 10815-10829. 179. Fan, K. and B.G. Uzman, Rat glioma cells (C6) cultured in serum-free defined medium. Experimental Cell Research, 1977. 106(2): p. 397-401. 180. Jänicke, R.U., et al., Caspase-3 Is Required for DNA Fragmentation and Morphological Changes Associated with Apoptosis. Journal of Biological Chemistry, 1998. 273(16): p. 9357-9360. 181. Zheng, T.S., et al., Caspase-3 controls both cytoplasmic and nuclear events associated with Fas-mediated apoptosis in vivo. Proceedings of the National Academy of Sciences, 1998. 95(23): p. 13618-13623. 182. Hosseini, A. and A. Ghorbani, Cancer therapy with phytochemicals: evidence from clinical studies. Avicenna Journal of Phytomedicine, 2015. 5(2): p. 84-97. 183. Mohanty, C. and S.K. Sahoo, The in vitro stability and in vivo pharmacokinetics of curcumin prepared as an aqueous nanoparticulate formulation. Biomaterials, 2010. 31(25): p. 6597-6611. 184. Anand, P., Kunnumakkara, A.B., Newman, R.A., Aggarwal, B.B., Bioavailability of curcumin: Problems and promises. Molecular Pharmaceutics, 2007. 4(6): p. 807-818. 185. Wang, Y.-J., et al., Stability of curcumin in buffer solutions and characterization of its degradation products. Journal of Pharmaceutical and Biomedical Analysis, 1997. 15(12): p. 1867-1876. 186. Chignell, C.F., et al., SPECTRAL AND PHOTOCHEMICAL PROPERTIES OF CURCUMIN. Photochemistry and Photobiology, 1994. 59(3): p. 295-302. 187. Ghosh, M. and R.O. Ryan, Curcumin homing to the nucleolus: mechanism for initiation of an apoptotic program. Journal of Nutritional Biochemistry, 2014. 25(11): p. 1117- 1123. 188. Jayaprakasha, G.K., L. Jagan Mohan Rao, and K.K. Sakariah, Improved HPLC Method for the Determination of Curcumin, Demethoxycurcumin, and Bisdemethoxycurcumin. Journal of Agricultural and Food Chemistry, 2002. 50(13): p. 3668-3672. 107
189. Mut M, A.S., Hussaini IM., PKC alpha phosphorylates cytosolic NF-kappaB/p65 and PKC delta delays nuclear translocation of NF-kappaB/p65 in U1242 glioblastoma cells. Turk Neurosurg., 2010. 20(3): p. 277-85. 190. Vahid, F., et al., The role dietary of bioactive compounds on the regulation of histone acetylases and deacetylases: A review. Gene, 2015. 562(1): p. 8-15. 191. LIRDPRAPAMONGKOL, K., et al., Vanillin Enhances TRAIL-Induced Apoptosis in Cancer Cells through Inhibition of NF-κB Activation. In Vivo, 2010. 24(4): p. 501-506. 192. Yang, S.-T., et al., Bisdemethoxycurcumin-induced S phase arrest through the inhibition of cyclin A and E and induction of apoptosis via endoplasmic reticulum stress and mitochondria-dependent pathways in human lung cancer NCI H460 cells. Environmental Toxicology, 2015: p. n/a-n/a. 193. XU Jin Hong, Y.H.P., ZHOU Xiang Dong, WANG Hai Jing, GONG Liang, TANG Chun Lan, Autophagy Accompanied with Bisdemethoxycurcumin-induced Apoptosis in Non- small Cell Lung Cancer Cells. Biomed Environ Sci, 2015. 28(2): p. 105-115. 194. Shen, L. and H.-F. Ji, The pharmacology of curcumin: is it the degradation products? Trends in Molecular Medicine, 2012. 18(3): p. 138-144. 195. Xu JH, Y.H., Zhou XD, Wang HJ, Gong L, Tang CL., Role of Wnt Inhibitory Factor-1 in Inhibition of Bisdemethoxycurcumin Mediated Epithelial-to-Mesenchymal Transition in Highly Metastatic Lung Cancer 95D Cells. Chin Med J (Engl). 2015. 128(10): p. 1376- 83. 196. Gordon, O.N., et al., Oxidative Transformation of Demethoxy- and Bisdemethoxycurcumin: Products, Mechanism of Formation, and Poisoning of Human Topoisomerase IIα. Chemical Research in Toxicology, 2015. 28(5): p. 989-996. 197. Lestari, M.L.A.D. and G. Indrayanto, Chapter Three - Curcumin, in Profiles of Drug Substances, Excipients and Related Methodology, G.B. Harry, Editor. 2014, Academic Press. p. 113-204. 198. Yeom, M., et al., Circadian-independent cell mitosis in immortalized fibroblasts. Proceedings of the National Academy of Sciences, 2010. 107(21): p. 9665-9670. 199. Vyas A, D.P., Padhye S, Ahmad A, Sarkar F., Perspectives on New Synthetic Curcumin Analogs and their Potential Anticancer Properties Curr Pharm Des. , 2013. 19(11): p. 2047-69. 200. Fried, H. and U. Kutay, Nucleocytoplasmic transport: taking an inventory. Cellular and Molecular Life Sciences, 2003. 60(8): p. 1659-1688. 201. Tran, E.J. and S.R. Wente, Dynamic Nuclear Pore Complexes: Life on the Edge. Cell, 2006. 125(6): p. 1041-1053. 202. Weis, K., Regulating Access to the Genome: Nucleocytoplasmic Transport throughout the Cell Cycle. Cell, 2003. 112(4): p. 441-451. 203. Cronshaw, J.M., et al., Proteomic analysis of the mammalian nuclear pore complex. The Journal of Cell Biology, 2002. 158(5): p. 915-927. 204. Denning, D.P., et al., Disorder in the nuclear pore complex: The FG repeat regions of nucleoporins are natively unfolded. Proceedings of the National Academy of Sciences, 2003. 100(5): p. 2450-2455. 205. Patel, S.S., et al., Natively Unfolded Nucleoporins Gate Protein Diffusion across the Nuclear Pore Complex. Cell, 2007. 129(1): p. 83-96. 206. Rout, M.P. and S.R. Wente, Pores for thought: nuclear pore complex proteins. Trends in Cell Biology, 1994. 4(10): p. 357-365. 108
207. Strawn, L.A., et al., Minimal nuclear pore complexes define FG repeat domains essential for transport. Nat Cell Biol, 2004. 6(3): p. 197-206. 208. Suntharalingam, M. and S.R. Wente, Peering through the Pore: Nuclear Pore Complex Structure, Assembly, and Function. Developmental cell, 2003. 4(6): p. 775-789. 209. Miao, L. and K. Schulten, Transport-Related Structures and Processes of the Nuclear Pore Complex Studied through Molecular Dynamics. Structure (London, England : 1993), 2009. 17(3): p. 449-459. 210. Greber, U.F. and L. Gerace, Depletion of calcium from the lumen of endoplasmic reticulum reversibly inhibits passive diffusion and signal-mediated transport into the nucleus. The Journal of Cell Biology, 1995. 128(1): p. 5-14. 211. Kau, T.R., J.C. Way, and P.A. Silver, Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer, 2004. 4(2): p. 106-117. 212. Stehno-Bittel, L., C. Perez-Terzic, and D.E. Clapham, Diffusion Across the Nuclear Envelope Inhibited by Depletion of the Nuclear Ca2+ Store. Science, 1995. 270(5243): p. 1835-1838. 213. Erickson, E.S., et al., The role of nuclear envelope calcium in modifying nuclear pore complex structureThis paper is one of a selection of papers published in this Special Issue, entitled The Nucleus: A Cell Within A Cell. Canadian Journal of Physiology and Pharmacology, 2006. 84(3-4): p. 309-318. 214. Erickson, E.S., et al., Activation of ryanodine receptors in the nuclear envelope alters the conformation of the nuclear pore complex. Biophysical Chemistry, 2004. 112(1): p. 1-7. 215. Olivia L Mooren, E.S.E., David Moore-Nichols and Robert C Dunn, Nuclear side conformational changes in the nuclear pore complex following calcium release from the nuclear membrane. Phys. Biol., 2004. 1(2): p. 125. 216. Stoffler, D., et al., Calcium-mediated structural changes of native nuclear pore complexes monitored by time-lapse atomic force microscopy. Journal of Molecular Biology, 1999. 287(4): p. 741-752. 217. Wang, H. and D.E. Clapham, Conformational Changes of the in Situ Nuclear Pore Complex. Biophysical Journal, 1999. 77(1): p. 241-247. 218. Stoffler, D., et al., Cryo-electron Tomography Provides Novel Insights into Nuclear Pore Architecture: Implications for Nucleocytoplasmic Transport. Journal of Molecular Biology, 2003. 328(1): p. 119-130. 219. Stoffler, D., et al., Getting across the nuclear pore complex: new insights into nucleocytoplasmic transportThis paper is one of a selection of papers published in this Special Issue, entitled The Nucleus: A Cell Within A Cell. Canadian Journal of Physiology and Pharmacology, 2006. 84(3-4): p. 499-507. 220. Gensburger, C., et al., In vivo nuclear Ca2+-ATPase phosphorylation triggers intermediate size molecular transport to the nucleus. Biochemical and Biophysical Research Communications, 2003. 303(4): p. 1225-1228. 221. O'Brien, E.M., et al., Hormonal Regulation of Nuclear Permeability. Journal of Biological Chemistry, 2007. 282(6): p. 4210-4217. 222. Perez-Terzic, C., et al., Structural Plasticity of the Cardiac Nuclear Pore Complex in Response to Regulators of Nuclear Import. Circulation Research, 1999. 84(11): p. 1292- 1301. 109
223. Enss, K., et al., Passive Transport of Macromolecules through <i>Xenopus laevis</i> Nuclear Envelope. Journal of Membrane Biology, 2003. 196(3): p. 147- 155. 224. Shahin, V.D., Timm. Enss, Karoline. Ossig, Rainer. Oberleithner, Hans., Evidence for Ca2+- and ATP-sensitive peripheral channels in nuclear pore complexes. The FASEB Journal, 2001. 15(11): p. 1895-1901. 225. Wei, X., et al., Real-Time Imaging of Nuclear Permeation by EGFP in Single Intact Cells. Biophysical Journal, 2003. 84(2): p. 1317-1327. 226. Dange, T., et al., Autonomy and robustness of translocation through the nuclear pore complex: a single-molecule study. The Journal of Cell Biology, 2008. 183(1): p. 77-86. 227. Kubitscheck, U., et al., Nuclear transport of single molecules. The Journal of Cell Biology, 2005. 168(2): p. 233-243. 228. Yang, W., J. Gelles, and S.M. Musser, Imaging of single-molecule translocation through nuclear pore complexes. Proceedings of the National Academy of Sciences of the United States of America, 2004. 101(35): p. 12887-12892. 229. Yang, W. and S.M. Musser, Visualizing single molecules interacting with nuclear pore complexes by narrow-field epifluorescence microscopy. Methods, 2006. 39(4): p. 316- 328. 230. Yang, W. and S.M. Musser, Nuclear import time and transport efficiency depend on importin β concentration. The Journal of Cell Biology, 2006. 174(7): p. 951-961. 231. Goryaynov, A., J. Ma, and W. Yang, Single-molecule studies of nucleocytoplasmic transport: from one dimension to three dimensions. Integrative Biology, 2012. 4(1): p. 10-21. 232. Ma, J. and W. Yang, Three-dimensional distribution of transient interactions in the nuclear pore complex obtained from single-molecule snapshots. Proceedings of the National Academy of Sciences, 2010. 107(16): p. 7305-7310. 233. Ma, J., et al., Self-regulated viscous channel in the nuclear pore complex. Proceedings of the National Academy of Sciences, 2012. 109(19): p. 7326-7331. 234. Ma, J., et al., High-resolution three-dimensional mapping of mRNA export through the nuclear pore. Nat Commun, 2013. 4. 235. Thompson, R.E., D.R. Larson, and W.W. Webb, Precise Nanometer Localization Analysis for Individual Fluorescent Probes. Biophysical Journal, 2002. 82(5): p. 2775- 2783. 236. Lim, R.Y.H., et al., Nanomechanical interactions of phenylalanine–glycine nucleoporins studied by single molecule force–volume spectroscopy. Journal of Structural Biology, 2007. 159(2): p. 277-289. 237. Wagner, Raphael S., et al., Promiscuous Binding of Karyopherinβ1 Modulates FG Nucleoporin Barrier Function and Expedites NTF2 Transport Kinetics. Biophysical Journal, 2015. 108(4): p. 918-927. 238. Sharma, A., et al., Ordered Regions of Channel Nucleoporins Nup62, Nup54, and Nup58 Form Dynamic Complexes in Solution. Journal of Biological Chemistry, 2015. 290(30): p. 18370-18378. 239. Koh, J. and G. Blobel, Allosteric Regulation in Gating the Central Channel of the Nuclear Pore Complex. Cell, 2015. 161(6): p. 1361-1373. 240. Xu, D., et al., Sequence and structural analyses of nuclear export signals in the NESdb database. Mol Biol Cell, 2012. 23(18): p. 3677-93. 110
241. Zanquetta, M., et al., Body weight, metabolism and clock genes. Diabetology & Metabolic Syndrome, 2010. 2(1): p. 53. 242. Kornmann, B., et al., Analysis of circadian liver gene expression by ADDER, a highly sensitive method for the display of differentially expressed mRNAs. Nucleic Acids Res, 2001. 29(11): p. E51-1. 243. Panda, S., et al., Coordinated transcription of key pathways in the mouse by the circadian clock. Cell, 2002. 109(3): p. 307-20. 244. Storch, K.F., et al., Extensive and divergent circadian gene expression in liver and heart. Nature, 2002. 417(6884): p. 78-83. 245. Storch, K.F., et al., Physiological importance of a circadian clock outside the suprachiasmatic nucleus. Cold Spring Harb Symp Quant Biol, 2007. 72: p. 307-18. 246. Sato, M., et al., Transportin 1 in the mouse brain: appearance in regions of neurogenesis, cerebrospinal fluid production/sensing, and circadian clock. J Comp Neurol, 2011. 519(9): p. 1770-80. 247. Hughes, M.E., et al., Harmonics of circadian gene transcription in mammals. PLoS Genet, 2009. 5(4): p. e1000442. 248. Weiss, R.B., The anthracyclines: will we ever find a better doxorubicin? Semin Oncol, 1992. 19(6): p. 670-86. 249. Keizer, H.G., et al., Doxorubicin (adriamycin): A critical review of free radical- dependent mechanisms of cytotoxicity. Pharmacology & Therapeutics, 1990. 47(2): p. 219-231. 250. Minotti, G., et al., Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacol Rev, 2004. 56(2): p. 185-229. 251. Carvalho, C., et al., Doxorubicin: the good, the bad and the ugly effect. Curr Med Chem, 2009. 16(25): p. 3267-85. 252. Kiyomiya, K., S. Matsuo, and M. Kurebe, Mechanism of specific nuclear transport of adriamycin: the mode of nuclear translocation of adriamycin-proteasome complex. Cancer Res, 2001. 61(6): p. 2467-71. 253. Voges, D., P. Zwickl, and W. Baumeister, The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu Rev Biochem, 1999. 68: p. 1015-68. 254. Burcoglu, J., L. Zhao, and C. Enenkel, Nuclear Import of Yeast Proteasomes. Cells, 2015. 4(3): p. 387-405. 255. Enenkel, C., Nuclear transport of yeast proteasomes. Biomolecules, 2014. 4(4): p. 940- 55. 256. Mount, D., Bioinformatics Sequrnce and genome analysis. 2nd ed, ed. J. Cuddihy. 2004, New York: Cold Spring Harbour Lab Press. 257. Mohan, P. and N. Rapoport, Doxorubicin as a molecular nanotheranostic agent: effect of doxorubicin encapsulation in micelles or nanoemulsions on the ultrasound-mediated intracellular delivery and nuclear trafficking. Mol Pharm, 2010. 7(6): p. 1959-73. 258. Liu, S., et al., Gene and doxorubicin co-delivery system for targeting therapy of glioma. Biomaterials, 2012. 33(19): p. 4907-16. 259. Baltes, S., et al., Doxorubicin and irinotecan drug-eluting beads for treatment of glioma: a pilot study in a rat model. J Mater Sci Mater Med, 2010. 21(4): p. 1393-402. 260. Glas, M., et al., Pegylated liposomal doxorubicin in recurrent malignant glioma: analysis of a case series. Oncology, 2007. 72(5-6): p. 302-7. 111
261. Hau, P., et al., Pegylated liposomal doxorubicin-efficacy in patients with recurrent high- grade glioma. Cancer, 2004. 100(6): p. 1199-207. 262. Darling, J.L. and D.G. Thomas, Response of short-term cultures derived from human malignant glioma to aziridinylbenzoquinone, etoposide and doxorubicin: an in vitro phase II trial. Anticancer Drugs, 2001. 12(9): p. 753-60. 263. Ukai-Tadenuma, M., et al., Delay in feedback repression by cryptochrome 1 is required for circadian clock function. Cell, 2011. 144(2): p. 268-81. 264. Nader, N., G.P. Chrousos, and T. Kino, Circadian rhythm transcription factor CLOCK regulates the transcriptional activity of the glucocorticoid receptor by acetylating its hinge region lysine cluster: potential physiological implications. FASEB J, 2009. 23(5): p. 1572-83. 265. Bozek, K., et al., Regulation of Clock-Controlled Genes in Mammals. PLoS ONE, 2009. 4(3): p. e4882. 266. Rath, M.F., L. Rovsing, and M. Moller, Circadian oscillators in the mouse brain: molecular clock components in the neocortex and cerebellar cortex. Cell Tissue Res, 2014. 357(3): p. 743-55. 267. Granda, T.G., et al., Experimental chronotherapy of mouse mammary adenocarcinoma MA13/C with docetaxel and doxorubicin as single agents and in combination. Cancer Res, 2001. 61(5): p. 1996-2001. 268. Johnson, C.H., Circadian clocks and cell division: what's the pacemaker? Cell Cycle, 2010. 9(19): p. 3864-73. 269. Halberg, F., et al., Chronotherapy of mammary cancer in rats. Int J Chronobiol, 1980. 7(2): p. 85-99. 270. Levi, F., et al., Circadian timing in cancer treatments. Annu Rev Pharmacol Toxicol, 2010. 50: p. 377-421. 271. Pandey, A., et al., Berberine and Curcumin Target Survivin and STAT3 in Gastric Cancer Cells and Synergize Actions of Standard Chemotherapeutic 5-Fluorouracil. Nutr Cancer, 2015: p. 1-12. 272. Levi, F., Chronotherapeutics: the relevance of timing in cancer therapy. Cancer Causes Control, 2006. 17(4): p. 611-21. 273. Ishii, K., K. Hirose, and M. Iino, Ca2+ shuttling between endoplasmic reticulum and mitochondria underlying Ca2+ oscillations. EMBO Rep, 2006. 7(4): p. 390-6. 274. Ikeda, M., et al., Circadian Dynamics of Cytosolic and Nuclear Ca2+ in Single Suprachiasmatic Nucleus Neurons. Neuron, 2003. 38(2): p. 253-263.