Analysis of Ige Reactivity to Pru Du 6, an 11S Globulin from Almond Nut, and Identification of Both Sequential and Conformational Epitopes Leanna N

Florida State University Libraries

Electronic Theses, Treatises and Dissertations The Graduate School

2013 Analysis of IgE Reactivity to Pru Du 6, an 11S Globulin from Almond Nut, and Identification of Both Sequential and Conformational Epitopes Leanna N. Willison

Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] THE FLORIDA STATE UNIVERSITY

COLLEGE OF ARTS AND SCIENCES

ANALYSIS OF IGE REACTIVITY TO PRU DU 6, AN 11S GLOBULIN FROM ALMOND

NUT, AND IDENTIFICATION OF BOTH SEQUENTIAL AND CONFORMATIONAL

EPITOPES

LEANNA N. WILLISON

A Dissertation submitted to the Department of Biological Science in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Degree Awarded: Spring Semester, 2013 LeAnna N. Willison defended this dissertation on March 7, 2013. The members of the supervisory committee were:

Kenneth H. Roux Professor Directing Dissertation

Shridhar K. Sathe University Representative

Thomas C.S. Keller III Committee Member

Laura R. Keller Committee Member

Yun-Hwa Peggy Hsieh Committee Member

The Graduate School has verified and approved the above-named committee members, and certifies that the dissertation has been approved in accordance with university requirements.

For my family

iii

ACKNOWLEDGEMENTS

I believe that it takes a village to raise a scientist as a number of individuals have provided both support and scientific guidance throughout the course of my dissertation project. First and foremost, I would like to thank my advisor, Dr. Kenneth Roux. He accepted me into his lab, introduced me to scientific research, and provided key directions during my dissertation work. My committee members, Dr. Shridhar Sathe, Dr. Thomas Keller, Dr. Laura Keller, and Dr. Peggy Heish have provided valuable assistance in experimental design throughout the years. Finally, Dr. Suzanne Teuber at UC, Davis, recruited allergic patients and supplied the lab with tree nut allergic sera. A large portion of this work could not have been completed without her assistance. The core facilities and support personnel at Florida State University were instrumental in many stages of this project. I would like to thank Steve Miller in the DNA sequencing laboratory for sequencing all of my phage, as there were many, many reactions to run and analyze. Cheryl Pye in the molecular cloning facility trained me on molecular genetic techniques which allowed me to generate all of the recombinant alanine mutants. Margaret Seavy in the analytical lab educated me on protein purification and chromatography techniques. I am eternally grateful to Margaret for both her friendship and the technical assistance she has provided over the years. I would not have made it through graduate school without wonderful lab members and friends, who have provided encouragement and assistance throughout the course of my research. Jason Robotham and Pallavi Tawde, were instrumental in encouraging me to apply to graduate school and stimulating my interest in research. Henry Grise provided scientific advice, ideas, and technical assistance with the molecular modeling programs. Jennifer Middlebrooks, Carl Whittington, Sarah Leuking, and Kyle Noble, were thoughtful friends both in and outside the laboratory. I am forever grateful to all of these individuals for their support as both scientists and friends. Finally, my largest debt goes to my family- for always encouraging and supporting me in my academic endeavors. I am forever grateful to my parents, Elaine Morse Willison and Robert Willison, for their unconditional love. I would like to thank my husband, Wester Harris, for always taking the time to listen to me and providing a shoulder to lean on. His continual optimism and unwavering confidence was truly a blessing. I am grateful that my mother in law, Mason Harris, was able to take care of my daughter Evelyn while I worked in the lab. This allowed me to finish up my experiments without worrying about her. I am looking forward to watching Evelyn grow and I hope to instill in her a passion for science.

TABLE OF CONTENTS

List of Tables ...... vii List of Figures ...... viii List of Abbreviations ...... xi Abstract ...... xiii

1. FOOD HYPERSENTIVITY AND TREE NUT ALLERGY ...... 1 Tree nut allergy ...... 2 Plant food allergens ...... 3 The 11S globulins (legumins) ...... 3 Prunin, an 11S globulin from almond ...... 4 IgE binding epitopes ...... 5 Phage display technology ...... 6 Treatment for allergy ...... 7 Peptide based immunotherapy (PIT) ...... 8 Aims of the dissertation ...... 10

2. CLONING, EXPRESSION AND PATIENT IGE REACTIVITY OF RECOMBINANT PRU DU 6, AN 11S GLOBULIN FROM ALMOND ...... 11 Introduction ...... 11 Methods ...... 12 Results ...... 18 Discussion ...... 29

3. IDENTIFICATION OF CONFORMATIONAL IGE-BINDING EPITOPES ON PRU DU 6 BY PHAGE DISPLAY ...... 34 Introduction ...... 34 Methods ...... 35 Results ...... 42 Discussion ...... 50

4. MURINE MONOCLONAL ANTIBODY REACTIVITY TO PRU DU 6 AND IDENTIFICATION OF SEQUENTIAL IGG BINDING EPITOPES ...... 55 Introduction ...... 55 Methods ...... 56 Results ...... 63 Discussion ...... 72

5. CONFORMATIONAL EPITOPE MAPPING OF PRU DU 6 USING A MURINE MONOCLONAL ANTIBODY BY HYDROGEN/DEUTERIUM EXCHANGE ...... 76 Introduction ...... 76 Methods ...... 77 Results ...... 87 v

Discussion ...... 97 Acknowledment ...... 99

6. CONCLUSION ...... 100

APPENDICES ...... 103

A. HUMAN SUBJECT COMMITTEE APPROVAL MEMORANDUM ...... 103

B. INFORMED CONSENT FORM ...... 105

REFERENCES ...... 106

BIOGRAPHICAL SKETCH ...... 119

LIST OF TABLES

2.1 Clinical characteristics of almond-allergic subjects ...... 12

2.2 Sequence of reactive peptides and epitope-containing peptide segments identified on Pru du 6.01 and Pru du 6.02 ...... 24

3.1 Clinical characteristics of almond-allergic subjects ...... 36

5.1 Primers used for the amplification and subcloning of almond Pru du 6.01 and soybean Gly m 6 11S globulin genes, constituent subunits, and chimeras...... 83

5.2 Primers used for site directed mutagenesis of selected residues to alanine in almond Pru du 6.01...... 84

vii

LIST OF FIGURES

2.1 Amino acid sequences of Pru du 6 polypeptides (A) Pru du 6.01 (prunin 1) sequence (B) Pru du 6.02 (prunin 2) sequence ...... 19

2.2 Immunodot blot and inhibition immunoblots ...... 21

2.3 Immunodot blot of rPru du 6.01 and rPru du 6.02 proteins treated with denaturing reagents and probed with individual rPru du 6.01- or rPru du 6.02-reactive sera ...... 22

2.4 SPOTs assay identifying sequential IgE-binding peptides in Pru du 6.01 and Pru du 6.02 using a pool of rPru du 6.01-reactive patients (#9, 14, 33, 44, 51, 55) and rPru du 6.02- reactive patients (#9, 51, 53, 55)...... 23

2.5 Sequence alignment of Pru du 6.01 and Pru du 6.02 ...... 25

2.6 Molecular models of Pru du 6 trimers using the crystal structure of prunin 1 ...... 26

2.7 Inhibition ELISA analysis of specific IgE reactivity of patient #8 against solid phase (A) rPru du 6.01, (B) rPru du 6.02 and (C) native prunin ...... 27

2.8 SPOTs inhibition assay using pooled Pru du 6-reactive sera either unabsorbed or pre- incubated with denatured and soluble native prunin (+prunin) ...... 28

2.9 Amino acid sequence and sequential epitope comparison of cashew (Ana o 2), almond (Pru du 6.01 and Pru du 6.02), walnut (Jug r 4), hazelnut (Cor a 9), soybean (Gly m 6.1 = Gly m 6.0101 and Gly m 6.2 = Gly m 6.0201), and peanut (Ara h 3) 11S globulins ...... 29

3.1 Immunodot blot of native prunin treated with denaturing reagents and probed with individual prunin-reactive sera ...... 43

3.2 SDS-PAGE and ELISA assays ...... 44

3.3 Coomassie Blue stained native-PAGE gel of prunin fractions obtained by size exclusion chromatography ...... 44

3.4 The selective enrichment of phage (pfu/mL) during successive panning rounds ...... 45

3.5 ELISA demonstrating the ability of native prunin to competitively elute phage bound to total IgE ...... 45

3.6 Analysis of IgE reactive phage sequences by Pepitope and the identification of putative conformational IgE binding epitopes on prunin (Pru du 6) ...... 46

3.7 Molecular models of prunin (Pru du 6) trimers using the crystal structure of prunin (PDB# 3FZ3) ...... 46

viii

3.8 SPOTs assay using solid phase peptides probed with patient #55 ...... 47

3.9 Panning assay to detect the presence of sequential and conformational IgE-binding epitopes on recombinant Pru du 6...... 48

3.10 Schematic representation of the negative selection assay used to separate and quantify the presence of conformational and sequential epitope binding IgE ...... 49

3.11 Negative selection assay to determine the relative percentage of conformational and sequential epitope-binding IgE in Pru du 6-sensitized individuals...... 50

4.1 Immunodot blot and inhibition immunoblot using almond mAbs ...... 65

4.2 Immunodot blot of rPru du 6.01 treated with various denaturants followed by probing with anti-almond mAbs...... 65

4.3 SPOTs assay identifying sequential IgG-binding peptides on Pru du 6.01 using selected mAbs...... 66

4.4 Molecular models of Pru du 6 trimers using the crystal structure of prunin 1 ...... 67

4.5 Immunodot blot demonstrating anti-almond mAb reactivity to rPru du 6 acidic and basic subunit...... 68

4.6 Alignment of overlapping mAb IgG binding epitope with human IgE binding epitope ...68

4.7 2-D gel electrophoresis and inhibition immunoblots ...... 69

4.8 ELISA, Coomassie Blue stained native-PAGE, and Ponceau S stained nitrocellulose .....71

4.9 Immunoblot assaying the Pru du 6.01-containing hexamer fraction (eluate) for Pru du 6.01 specific IgG and Pru du 6.02 specific IgE reactivity...... 72

5.1 Immunoblot and immunodot blots ...... 88

5.2 Inhibition ELISA demonstrating the ability of Pru du 6.01-reactive patient antibodies to inhibit 4C10 binding to native prunin expressed as a percent of uninhibited control ...... 88

5.3 Sequence coverage for the analyzed native prunin-4C10 complex ...... 90

5.4 Structural models of prunin (PDB# 3FZ3) ...... 91

5.5 Immunodot blot and structural models of prunin (PDB# 3FZ3) ...... 92

5.6 Circular dichroism analysis of A) native prunin B) maltose binding protein (MBP) and C) recombinant Pru du 6.01 wild type (wt) and cysteine mutants ...... 94

5.7 Structural models, chimeric molecules and dot blot assays ...... 95

5.8 Pru du 6 sequence alignment and structural model...... 97

LIST OF ABBREVIATIONS

APC = antigen presenting cells

CD = circular dichroism

CDR = complementarity determining regions

ELISA = enzyme linked immunosorbant assay

GI = gastrointestinal tract

HDX-MS = hydrogen/deuterium exchange mass spectrometry

hr = hour

LC-MS = liquid chromoatography mass spectrometry

LG = acidic subunit

M = molecular weight marker

mAb= monoclonal antibody

MBP = maltose binding protein

MHC = major histocompatibility complex

min = minute

NC = atopic serum negative control

NC = nitrocellulose membrane

NMR = nuclear magnetic resonance

o/n = overnight

OD = optical density

OIT = oral immunotherapy

pAb = polyclonal antibody

PBS = phosphate buffered saline

PIT = peptide immunotherapy

RAST = radioallergosorbent test

rPru du 6 = recombinant Pru du 6

RT = room temperature

SIT = specific immunotherapy

SLIT = sublingual immunotherapy

SM = basic subunit

SPOTs = solid phase overlapping peptide assay

TBS = Tris buffered saline

TCR = T cell receptor

TH1 = T helper 1 cells

TH2 = T helper 2 cells

Treg = T regulatory cell

WA = whole almond extract

xii

ABSTRACT

Tree nuts are a widely consumed food and include walnut, cashew, almond, hazelnut, pistachio, pecan, chestnut, macadamia, and Brazil nut. Although enjoyed safely by most individuals, allergic reactions are common and ~0.6% of the US population is allergic to one or more tree nuts. An important IgE-reactive protein in almonds is prunin (Pru du 6), a legumin, which represents a major component of the seed and has been identified as an important allergen. Two prunin isoforms have been identified: prunin 1 (Pru du 6.01) and prunin 2 (Pru du 6.02). IgE reactivity to recombinant Pru du 6.01 and Pru du 6.02 was found in the sera of 9 of 18 (50%) and 5 of 18 (28%) patients, respectively. To test for epitope stability, the recombinant proteins (rPru du 6) were treated with various denaturants. Immunodot blotting assays revealed the presence of both stable (sequential) and unstable (conformational) rPru du 6 epitopes. The sequential IgE binding epitopes on Pru du 6 were identified by solid-phase overlapping peptide analysis (SPOTs assay). Six IgE-binding sequential epitope-bearing peptides were found on Pru du 6.01 and eight on Pru du 6.02 using almond-allergic sera. Murine anti-almond IgG mAbs also showed greater reactivity to rPru du 6.01 than to rPru du 6.02. The sequential epitopes targeted for several mAbs (4G2, aa 353LQQERQQ359 ; 2B4 and 5D1, aa 120QQGRQQ125) were identified by SPOTs assay. The 5D1 and 2B4 epitopes were found to directly overlap with an IgE binding epitope on Pru du 6.01. Immunoblots, immunodot blots, and inhibition immunoblots indicate that Pru du 6.01 is the predominate isoform in the nut. To investigate conformational epitopes on prunin (Pru du 6), phage display technology was used to identify IgE-binding epitopes. Total IgE was purified from an almond-allergic patient by affinity chromatography and used to capture phage displaying 12 aa-long peptides that mimic prunin epitopes. The phage sequences were analyzed using the Pepitope program and three conformational epitopes were identified (epitope 1, E49,N78, L80, L82, P83, L244, A245, N290,

R312, L314, G316, N322, I325, Q326; epitope 2, V104, F105, H190, Q191, T193, P205, A206, G207, V208, V327,

R328, G329, N330, L331, D332, F333; epitope 3, H227,S229, S230, D231, H232, F411, W431, V433, N434, H436,

V451, Q473, N474, H475, G476, T493, N496, A497, F498, L502). One of these epitopes partially overlaps a sequential epitope previously identified by the SPOTs assay. Conformational epitope mapping studies were also performed using a murine monoclonal antibody (mAb) 4C10. This mAb reacts exclusively with non-reduced native prunin in

xiii immunoblotting assays, indicating that 4C10 binds to a conformational epitope expressed on prunin that is dependent on the large and small subunit association. Inhibition ELISA assays found that human IgE and IgG binding epitopes (sequential and/or conformational) overlap or sterically hinder 4C10 binding to prunin. To identify the epitope, hydrogen/deuterium exchange (HDX) monitored by 14.5 T Fourier transform ion cyclotron resonance mass spectrometry was performed on prunin and the 4C10-prunin complex. Comparison of deuterium uptake between the free vs. mAb-bound prunin identified several epitope candidate peptides that differ in deuterium uptake, suggesting that these peptides are part of the 4C10 epitope. Analyses of chimeric molecules using the homologous soybean allergen, Gly m 6, and alanine mutants further localized the epitope to three discontinuous strands (aa 21-45, 320-328, and 460-465). These data demonstrates that HDX-MS is a useful technique to aid in the identification of unknown conformational epitopes on native tree nut allergens.

xiv

CHAPTER ONE

FOOD HYPERSENSITIVITY AND TREE NUT ALLERGY

Food allergy is an adverse immunological (hypersensitivity) reaction to a normally harmless agent in food [1;2]. Allergies have become a growing problem in industrialized countries and it is estimated that food allergies affect 6% of young children and 4% of adults in the United States [3;4]. Food allergy is a type 1 hypersensitivity reaction that is IgE mediated and is one of the most extensively studied hypersensitivity reactions. Sensitization to allergenic proteins in food is a complex multistep process that is believed to occur through the gastrointestinal tract (GI). Allergenic proteins bypass the mucosal surfaces, and are picked up and processed by antigen presenting cells (APC) such as dendritic cells (DC) or B cells [5;6]. These APC recognize allergens via cell surface receptors, such as the membrane bound antibody receptor on B cells [3;5]. The APC will present the processed allergen on their surface as short peptides via the major histocompatibility complex (MHC) class II molecules to T cells with allergen-specific receptors. Upon interaction with an antigen:MHC complex, the T cell will become activated and differentiate into a specific effector T cell [3]. In allergic individuals, these reactive T cells differentiate into T helper 2 (TH2) cells and begin secreting specific cytokines such as IL-4, IL-13, IL-9, and IL-5 [3;6;7]. This cytokine profile stimulates B cells to undergo class switching and produce allergen-specific immunoglobulin E (IgE), thus becoming an antibody secreting plasma cell [3;6;]. The secreted allergen-specific IgE is recognized by the high affinity FcεRI receptor exposed on the cell surface of mast cells and basophils, thus sensitizing the effector cells for future involvement in the allergic response. Subsequent exposure to the offending food allergen results in recognition by the food-specific IgE antibodies loaded onto these effector cells and allergen cross-linking of IgE molecules leads to effector cell degranulation [3;6;8]. Degranulation releases preformed mediators such as histamines, which increases blood flow, and the enzymes tryptase and chymase, which activate metalloproteinases to break down tissue matrix proteins causing tissue destruction [9]. Also upon stimulation the mast cell synthesizes and releases cytokines, chemokines, and leukotrienes, which are important mediators of inflammation and perpetuate the allergic response [3;9]. The release of these chemical mediators is responsible for causing the allergic symptoms experienced

1 by the individual, which can include allergic rhinitis, allergic conjunctivitis, allergic asthma, urticaria, angioedema, and systemic anaphylaxis depending on the route of allergen entry [8;10]. The underlying cause leading to the development of IgE mediated hypersensitivity reactions (atopy) remains unclear. Several studies have identified factors that appear to promote the development of atopy mediated by TH2 cells, including both environmental and genetic factors [11-13]. Preliminary studies have been performed on several candidate genes including; IL-10, IL-13, and the forkhead box P3 gene (FOXP3), [14-16] however, these studies have only been performed using a small number of patients in localized areas. To date, the specific genes responsible for the development of food allergy remains unknown and as new data is being collected it now believed that susceptibility arises from a combination of multiple gene interactions [14;17;18]. One feature of atopy remains clear, affected individuals have a skewing

towards a TH2 response with elevated IL-4, IL-5, and IL-13 levels that drive B cell class switching to the production of IgE antibodies, as opposed to non-allergic individuals who

predominantly display a protective TH1/IgG phenotype. Future studies are needed to truly understand the etiology and biological mechanisms driving the development of food allergy.

Tree nut allergy The average human diet contains a large variety of different foods; however, only a few foods are responsible for the majority of food allergies [4]. The most common foods responsible for causing allergic reactions include wheat, milk, soy, fish, egg, peanuts, tree nuts, and shellfish. Allergies to milk, egg, and soy are often outgrown but allergies to peanuts, shellfish, and tree nuts can cause severe allergic reactions that persist throughout life [2]. Allergic reactions to tree nuts are fairly common and it is estimated that 0.5% of the US population is allergic to one or more tree nuts. Tree nuts are typically eaten as a snack or incorporated into foods, and include walnuts, almond, cashew, pistachio, pecan, hazelnut, macadamia, pine nut, Brazil nut and chestnut. In 2008, a random digit dialed phone survey conducted in the US revealed that, of 58 tree nut-allergic individuals, 70% reported allergy to walnut, 50% to cashew, 43% to almond, 45% to pecan, 33% to Brazil nut, 33% to pistachio, and 29% to hazelnut [19;20].

Plant food allergens Specific food proteins have been shown to be directly responsible for inducing food allergic reactions, some of which have been extensively studied at the molecular level. Plant food allergens can be grouped based on their sequence, function, and structural similarities [21;22]. One group of proteins identified in plant foods includes seed storage proteins, which are abundant proteins in the plant seed. They make up the majority of tree nut and peanut allergens and include 7S vicilins, 11S legumins, and 2S albumins [21;23]. These proteins have been identified as allergens in a variety of nuts and seeds such as cashew (Ana o 1, Ana o 2, Ana o 3), peanut (Ara h 1), soybean (Gly m 5, Gly m 6), sesame (Ses i 1, Ses i 2, Ses i 3), walnut (Jug r 1, Jug r 2), lentils (Len c 1), mustard (Sin a 1, Sin a 2), and hazelnut (Cor a 9, Cor a 11) [21;24]. Another group of plant food allergens include profilins. These are small proteins that bind actin in eukaryotic cells and regulate the polymerization of actin filaments. Profilins are highly conserved among plants with 70-85% sequence identity, and several studies have demonstrated a high degree of cross-reactivity between profilins from different sources [21;22]. Finally, pathogenesis-related proteins (PR-proteins) are proteins that are produced in the plant upon attack by bacteria/fungi, or when abiotically stressed [25]. They range from 5–70 kDa, are stable at acidic pH, and tend to be highly resistant to proteolytic degradation [25]. Members of the PR- proteins include chitinases, thaumatin-like proteins, peroxidases, endoproteinases, Bet v 1 homologues, and lipid transfer proteins.

The 11S globulins (legumins) The 11S globulins or legumin-like proteins are members of the cupin superfamily which are characterized by a 6 stranded –barrel conformation [22]. They are typically hexameric ~360 kDa proteins in which each monomeric subunit is comprised of an acidic 42–40 kDa polypeptide that is disulfide-linked to a 20 kDa basic polypeptide. In the plant, seed storage proteins serve as amino acid reserves for the developing seedling and act as a carbon and nitrogen source during germination [26;27]. Seed storage proteins are abundant in the seed and it is estimated that they can account for ~40% of the total protein [24]. The 11S globulins have been identified as important allergens in both peanuts and tree nuts including; hazelnut Cor a 9 [28], cashew Ana o 2 [29], walnut Jug r 4 [30], peanut Ara h 3 [31], and pistachio Pis v 2 [32]. It is not uncommon for multiple 11S globulin isoforms to be expressed in the seed and despite their

3 sequence similarity, not all isoforms in a given variety of plant seed are necessarily allergenic [27;33;34]. For example, four isoforms of the sesame seed 11S legumin [33] and five isoforms of glycinin, the 11S legumin from soybean [34], have been described. Interestingly, only two of the five soybean glycinin isoforms are allergenic [35-37]. Similarly, the sesame isoforms have been shown to differ in their allergenicity [38]. In almond two 11S isoforms have been identified to date, prunin 1 and prunin 2 [39].

Prunin, an 11S globulin from almond Almond prunin (amandin) is an 11S globulin legumin-like protein that is hexameric in form and composed of individual polypeptides [21;39-41]. Each monomeric subunit, like those of other 11S globulins, is comprised of a large 40-42 kDa acidic chain and a small 20 kDa basic chain that are linked by a disulfide bond [39;40;42]. To date, two isoforms have been identified in almond, prunin 1 and prunin 2, which comprise native prunin [39]. Analyses of almond protein extract has been extensively carried out by Sathe et al. who have shown that prunin is a major component of the nut, accounting for up to 65% of the protein in the soluble aqueous extract [42-44, 45-47]. Recently, the biochemical and structural features of prunin have been analyzed in detail. A circular dichroism (CD) spectroscopy study has shown that the native hexameric protein is quite resistant to thermal denaturation, retaining its secondary structure at temperatures of up to 90°C [48]. In contrast, the purified (isolated) acidic subunit demonstrated a continuous unfolding pattern from 20 to 90°C and basic subunit denatured completely at 62°C suggesting that the multimeric form of the native protein helps stabilize the secondary structure [48]. The susceptibility of prunin to chemical denaturation was assayed using both urea and - mercaptoethanol (-ME) [48]. Structural changes of prunin were measured by CD spectroscopy and demonstrate that 50% unfolding occurs in 2.5 M urea and reduction of the disulfide bonds by -ME resulted in a reduction of thermal stability with denaturation occurring at 72°C [48]. The lower thermal stability of prunin observed under denaturing conditions (72°C) compared to nondenaturing conditions (90°C), indicates that the disulfide bonds play an important role in increasing the thermostability of the hexameric protein [48]. In another study, the crystal structure of native hexameric prunin was resolved to 2.4 Å [49]. Analysis revealed that the overall structure of prunin is typical of the 11S globulin class of seed storage proteins, as it is

4 composed of two prunin trimers that associate to form the native hexameric structure [49]. Two regions of the prunin amino acid (aa) sequences were unresolved in the recently reported crystal structure of prunin 1, aa S118 to F184 and Q255 to G286 [49]. The likely reason for a failure of these segments to contribute to the crystal lattice is a high degree of flexibility and solvent exposure [49].

IgE binding epitopes Allergen-specific IgE antibodies are important effector molecules that play a critical role in initiating an immune response. Therefore, the identification of IgE binding epitopes is crucial for understanding the etiology of food allergy and the allergenic nature of foods. Two broad classes of IgE binding epitopes have been identified on allergens; sequential (linear, continuous) and conformational (discontinuous). Sequential epitopes are typically defined as short contiguous stretches of amino acids that are recognized by antibody, and are relatively easy to identify by probing short synthetic peptides for IgE binding. These epitopes are often prevalent on food allergens as these proteins are subjected to extensive processing and digestion before interacting with the cells of the immune system [50]. In contrast, conformational (discontinuous) epitopes are more difficult to detect as they are dependent upon one or more peptide segments held in a specific orientation due to the tertiary (or quaternary) structure of the antigen [4;51-53]. Conformational IgE epitopes are often prevalent on aeroallergens, such as pollens or pet dander, which typically sensitize through the respiratory tract [50]. Whereas epitopes tend to be categorized as either sequential or conformational, it should be noted that individual epitopes may have a mixture of both conformational and sequential characteristics, as short stretches of continuous residues may be part of more complex conformational epitopes. Over the last several years there has been debate over the clinical importance of the two epitope forms. Studies done on milk allergy have demonstrated that patients with more severe, lifelong allergy typically have IgE antibodies directed against sequential epitopes, as opposed to individuals who outgrow milk allergy, which have IgE directed against conformational epitopes [54;55]. In contrast, children recognized a greater number of sequential epitopes on several shrimp allergens whereas adults appear to recognize primarily conformational epitopes [56]. Studies analyzing reactivity to the Brazil nut 2S albumin, Ber e 1, showed IgE is predominantly directed against longer conformational epitopes and that short sequential epitopes did not appear to be of importance, at

5 least for the individuals used in that particular study. It is now becoming apparent that generalities concerning the relative importance of sequential vs conformational epitopes cannot be easily drawn and that the spectrum of epitope types may vary depending upon the allergen and perhaps even upon differential patient reactivity.

Phage display technology In recent years, phage display technology has emerged as a useful technique to identify protein-protein interactions for vaccine design, drug development, oncology, and allergology studies [57]. In regards to allergology, the identification of conformational epitopes on allergens is a difficult and laborious task that requires the generation of multiple allergen fragments or crystallization of antigen-antibody complexes. Phage display has proven to be a useful tool for identifying conformational epitopes through the generation of short random peptide fragments displayed on the filamentous M13 phage surface via fusion with the coat protein genes pVIII or pIII [10]. This approach allows the display of around 109 different peptides in the library that are able to interact with the antigen-specific antibodies of interest [58]. The goal is to identify short peptide fragments that mimic the physicochemical properties of a natural epitope, and thus are termed a mimotope [59]. Once the mimotope is successfully identified and the sequence determined, a variety of programs and algorithims such as; Biochemical Algorithms Library (BALL), BioInfo3D, Pepitope, or MIMOX, must be used to identify the position on the allergen corresponding to the mimotope [57;58;60;61]. These programs compare mimotope sequence, antigen sequence, and deduced structure to identify possible epitope locations on the antigen surface [58;62-64]. For each of the possible epitope locations, two criteria must be analyzed; the amino acids of the epitope identified by the mimotope must be surface accessible and epitope/mimotope peptides must assume similar spatial configurations [57]. This information allows the researcher to identify the most likely epitope location on the allergen structure after reviewing all the possible options. Studies done on both aeroallergens and food allergens have demonstrated the usefulness of phage display technology for identifying conformational epitopes on allergenic proteins. This technique was successfully used to identify two conformational epitopes on the peach LTP allergen, Pru p 3. These were mapped to a helix 2-loop-helix 3 region and part of the non- structured C-terminal coil [65]. Similarly, studies done on parvalbumin, a major fish allergen,

6 identified three conformational epitope regions, which were located in EF domain and the axis joining the CD and EF-hand [66]. Additionally, studies done on the birch pollen allergen, Bet v 1, were able to localize both conformational human IgE and sequential murine IgG epitopes [67]. The results obtained from these studies expand our knowledge of allergen-antibody interactions [65;68;69] but also provide a new avenue for the treatment of individuals suffering from allergies by using the epitopes identified by phage display in peptide immunotherapy.

Treatment for allergy Currently there is no definitive treatment for food allergy and affected individuals are encouraged to avoid the offending food. This strategy is often more difficult than it seems as many food allergens can be present in foods as unlabeled hidden ingredients. A widely used clinical approach for the treatment of pollinosis, animal, insect venom and, recently, food allergy is specific immunotherapy (SIT) [10;58;70-74]. In SIT, allergic individuals are administered increasing doses of allergens subcutaneously over an extended period of time to generate a immunological non-responsiveness to the offending allergen [10;17;58]. The immunological non-responsiveness generated in SIT is believed to be due to the down-regulation of TH2- dominated allergen response with decreased IL-5 and IL-4 cytokine production and up regulation

of IL-10 and TGF- cytokines leading towards a protective TH1 response in treated individuals [75;76]. Additionally during SIT, high levels of IgG antibodies are produced that are directed against the same or overlapping epitopes, thus sequestering the antigen and preventing IgE- mediated allergen activation of effector cells [75]. These factors are responsible for generating the immunological non-responsiveness found in SIT treated individuals and contribute to the overall success of immunotherapy. Although SIT has proven to be a useful treatment for allergies, there are inherent risks and side effects associated with treatment. One major disadvantage is the documentation of adverse reactions that have occurred as a result of treating allergic individuals [17]. To alleviate this issue sublingual immunotherapy (SLIT) and oral immunotheraphy (OIT) have been introduced as alternative treatments to SIT, where allergens are administered orally. The different route of administration is believed to prevent systemic absorption of the allergen thus reducing the possibility of severe anaphylactic reactions from occurring. Typically individuals experience only mild side effects ranging from mouth itching and slight swelling during

7 treatment [75;77]. Recent studies on OIT with peanut-allergic patients have proven to be quite successful as treated individuals were able to tolerate 2-3.9 grams of peanut proteins without adverse allergic reactions [72;78;79]. However, some patients still experienced allergic episodes during the treatment process, which ranged from mild to severe reactions [72]. Another disadvantage associated with immunotherapy is that it is often difficult to standardize allergen extracts. Several studies have demonstrated protein composition and amounts vary in extracts produced from native allergen sources [17;58]. Moreover, it is also possible to induce sensitization to new proteins in the native extract as these extracts contain both allergenic and previously non-allergenic proteins [58;76]. To alleviate some of these issues associated with SIT several different techniques have been used including; treatment with specific recombinant allergens, which allow for better standardization and dosage control, the use of hypoallergenic allergens, which contain mutations in the IgE binding epitopes to prevent IgE cross linking and effector cell activation, or the use of B and T cell peptide based immunotherapy (PIT, described below) [10;17;75]. These features focus on component resolved diagnosis and therapy which allows SIT to be tailored to a patient’s sensitization profile.

Peptide based immunotherapy (PIT) As detailed information on both antigen structure and antigen-antibody interactions continues to increase, alternative strategies to improve the safety and efficiency of SIT are being designed. Peptide based immunotherapy (PIT) is one therapeutic approach that utilizes information gathered on T cell and B cell epitopes for treatment of individuals affected by allergies. This approached focuses on the administration of peptide fragments corresponding to epitopes identified on the offending allergen. The small size of these peptides prevents the sensitization to new epitopes on the allergen and eliminates IgE –mediated cross-linking and stimulation of effector cell degranulation during the treatment process [75;80]. T cells play a critical role in both the development of immunological tolerance and in IgE-mediated immune responses [81]. T cells typically recognize epitopes composed of short contiguous stretches of 9 to 25 amino acids in length [82]. These epitopes are presented via the MHC complex to T cell receptors (TCR) on CD4+ T lymphocytes. Subsequent differentiation into either TH1, TH2 or Treg phenotypes is believed to be determined by the environment in which the epitope is presented [81;82]. Therapy using T cell epitopes focuses on regulating the

8 immune response by stimulating a TH1 and Treg driven response with increased IL-10 and TGF- cytokine production and the generation of an IgG antibody responses that result in reduced allergenic activity [17;80]. In contrast, B cell epitopes have been found to play a critical role in initiating the allergic response by cross-linking allergen molecules and triggering effector cell degranulation. Unlike T cell epitopes, B cell epitopes can be either sequential or conformational depending on the offending allergen and route of sensitization. The use of B cell epitopes during immunotherapy focuses on inducing the production of blocking IgG antibodies against the administered IgE epitopes, thereby preventing the binding of IgE antibodies to the allergen upon subsequent exposure [67;76;83;84]. Experimental studies done in murine models have demonstrated the ability of epitope based PIT to induce immunological tolerance to allergens. Timothy grass pollen is a common environmental allergen, and five major B cell epitopes have been identified on the major allergen, Phl p 1 [85]. To study the effect of Phl p 1 PIT mice were administered individual B cell epitopes. Analysis revealed increased levels of allergen-specific IgG after treatment [83]. Subsequent inhibition ELISA assays demonstrated the ability of these peptide-induced IgG antibodies to inhibit human IgE binding to the recombinant Phl p 1 allergen in 46 of 52 tested pollen allergic patients [83]. Similar studies were performed on the major birch pollen allergen, Bet v 1, in which sensitized mice were administered a mixture of six peptides containing B cell epitopes [84]. After treatment, increased levels of allergen specific IgG and decreased levels of IgE was observed by ELISA assay in mice [84]. PIT has also been performed using phage displaying a peptide mimotope that correspond to a conformational B cell epitope identified on Bet v 1 [67]. Immunized mice produced epitope specific IgG antibodies that were able to successfully block IgE binding to the allergen in immunoblotting assays [67]. Based on these successful results obtained in murine models, studies are being performed to evaluate the effectiveness of PIT in humans. To date, PIT has been evaluated for the treatment of cat, bee venom, and pollen hypersensitivity [86-90]. In bee venom PIT, individuals were administered a mixture of four T cell epitopes identified on the major honeybee allergen, phospholipase A2 [88]. Treatment resulted in decreased cytokine levels of IL-13/INF- and

increased levels of IL-10 levels, signifying the induction Treg cells and down-regulation of the

allergic TH2 response [88]. Subsequent exposure to bee venom resulted in decreased cutaneous reactions in peptide treated individuals indicating successful immune regulation following PIT

[88]. PIT with 26 peptide fragments containing sequential B cell epitopes from timothy grass pollen, Phl p 1, resulted in the generation of new epitope specific IgG antibodies in patients [85]. Immunodot blot analysis determined that these IgG antibodies bound to most of the IgE reactive epitopes; however, there were a few differences in the epitopes recognized between IgE and IgG antibodies [85]. To analyze the in vivo blocking effect of the generated IgG antibodies, basophil histamine release assays were performed using serum from treated individuals [85]. Preincubated of the recombinant Phl p 1 allergen with serum from treated individuals prior to interaction with basophils resulted in lower histamine release than those with serum from untreated patients [85]. These results indicate the successful in vivo inhibition of allergen- induced effector cell degranulation by IgG antibodies induced during PIT [85]. Collectively the studies described above have demonstrated the usefulness of PIT in modulating the immune system towards a more tolerogenic state through the induction of Treg mediated response and the generation of protective IgG antibodies that sequester the allergen from IgE. Thus, PIT with well-defined epitopes opens up a new approach for treating allergies without the adverse side effects commonly associated with traditional SIT.

Aims of the dissertation Tree nut allergy is a growing global concern as the number of affected individuals continues to rise. Research efforts largely focus on identifying and characterizing the allergenic proteins in tree nuts. This information is vital for understanding the etiology of food allergy and the allergenic nature of tree nuts. Almond is a commonly consumed nut in the US and is known to cause food induced allergic reactions. In this study we clone and express two genes, prunin 1 (Pru du 6.01) and prunin 2 (Pru du 6.02), which code for two isoforms of prunin, the major almond allergen, and assay each for IgE reactivity. Additionally, we localize both sequential and conformational epitopes on the prunin proteins by solid phase peptide probing assays, phage display library screening, and hydrogen/deuterium exchange (HDX) monitored by 14.5 T Fourier transform ion cyclotron resonance mass spectrometry (MS), respectively. Analyses of IgE/IgG reactivity to solid phase peptides, alanine point mutants, and chimeric molecules allow us to identify specific peptides in the epitopes and key residues for Ig binding. This information extends our knowledge of allergen:IgE/IgG interaction and may lead to advances in diagnosis, treatment, and possibly the prevention of tree nut allergy.

CHAPTER TWO

CLONING, EXPRESSION AND PATIENT IGE REACTIVITY OF RECOMBINANT PRU DU 6, AN 11S GLOBULIN FROM ALMOND

Introduction

Food allergy is a growing health concern and tree nut allergy, in particular, affects 0.6% of the population [19;20;91]. The five most commonly consumed tree nuts in the US, in rank order, are almond, pecan, walnut, pistachio, and cashew. Of these nuts, allergy to almond ranks third following walnut and cashew nut [19;20]. Almonds (Prunus dulcis) are an important commercial crop with the US producing 65% of almonds worldwide [92]. Four almond nut allergens have been identified: Pru du 4, a profilin; prunin a seed storage protein; Pru du 5, a 60s ribosomal protein; and Pru du 3, a ns-LTP [42;93;94] (www.IUIS.org). Almond prunin (amandin) is an 11S globulin (a legumin-like protein) that is hexameric in form and composed of prunin polypeptides [21;40; 39]. Each monomeric subunit, like those of other 11S globulins, is comprised of a large 40-4β kDa acidic α-chain and a small 20 kDa basic ß-chain that are linked by a disulfide bond [42;40;39]. Almond protein extract has been extensively studied by Sathe et al. who show that prunin is a major component of the nut, accounting for up to 65% of the protein in the soluble aqueous extract [42;44]. Immunoblotting assays using rabbit polyclonal and murine monoclonal anti-prunin antibodies reveal that a wide variety of commonly consumed almond cultivars have similarly high levels of prunin [45]. Immunoblot assays have also been performed using a pool of sera from almond-allergic patients to demonstrate high levels of IgE binding to presumptive prunin bands in aqueous almond extract [45;46;47]. Two isoforms, prunin 1 and prunin 2, have been identified in almond nut by screening an almond cDNA library [39] and the N-terminal sequences of both have been reported [42], but the relative amounts and immunogenicity of the two prunins have not been compared. The biochemical and structural features of prunin have recently been analyzed in detail. A circular dichroism (CD) spectroscopy study has shown that the native hexameric protein is quite resistant to thermal denaturation, retaining its secondary structure up to 90°C [48]. In another study, the crystal structure of native hexameric prunin was resolved to 2.4 Å to reveal an 11 overall structure typical of the 11S globulin class of seed storage proteins [49]. Interestingly, an extra helix at the C-terminal end of the acidic domain was observed in half of the monomers comprising the hexameric prunin [49]. Structural alignment of prunin 1 with the 11S allergens from peanut (Ara h 3 [95]) and soybean (Gly m 6 [96]) revealed that the extra helix present in prunin corresponds to a presumptive flexible loop region in these legumes [49]. The studies described above have focused primarily on the structural and general immunological properties of prunin. We have now produced recombinant prunin 1 and 2 polypeptides, (allergen designations Pru du 6.0101 and Pru du 6.0201, herein abbreviated as Pru du 6.01 and 6.02, respectively), analyzed the degree of patient IgE reactivity, and defined the sequential epitopes targeted. These studies have been published in International Archives of Allergy and Immunology, Willison et al. 2011 [97].

Methods

Human Sera Blood samples were obtained from patients with convincing histories of almond allergy, after informed consent, or were purchased from PlasmaLab International (Everett, WA, USA). The study was approved by the human subjects review committee of University of California, Davis (Davis, CA) and Florida State University. Sera were frozen at -80°C until use. The presence of almond-reactive IgE was confirmed by Pharmacia ImmunoCAP assay (Pharmacia Diagnostics, Uppsala, Sweden) or RAST. Clinical characteristics of the subjects are shown in Table 2.1. Atopic control serum was obtained from a patient with a history of asthma and dust mite allergy but who was not food-allergic.

Table 2.1. Clinical characteristics of almond-allergic subjects Serum Sex/Age Age 1Other Other food allergy 2ImmunoCap Positive No. of Atopy or RAST to immunodot onset almond blot to Pru extract du 6.01/6.02 4 M/27 5 As Walnut, Brazil, coconut, hazelnut, 1.35 No/No cashew 7 F/25 child AD, AR Peanuts, walnut, other tree nuts Class 2 No/No 8 F/43 1 AD, AR, As Peanut, tree nuts Class 5 YES/YES 9 F/34 1 AD,AR, As Walnut, cashew, pecan Class 3 YES/YES

Table 2.1. Continued Serum Sex/Age Age 1Other Other food allergy 2ImmunoCap Positive No. of Atopy or RAST to immunodot onset almond blot to Pru extract du 6.01/6.02 11 M/50 1 AD, AR, As Tree nuts 0.64 No/No 13 F/39 1 AD as child, Peas, walnut, pistachio, peanut, <0.35 No/No AR, As Brazil nut 14* F/38 5 As as a child Cashew, pistachio, brazil nut, 1.9 YES/No walnut 18 F/62 1 AR Peanut, walnut, cashew 1.15 YES/No 29 F/49 3 AD, AR, As Peanut, sesame, tree nut <0.35 YES/No 33 F/63 53 AD, AR, Peanut, cashew, pistachio, fish, eggs 1.84 YES/No Asthma 44* M/30 child AD as child, Never eaten other nuts 2.88 YES/No AR, As 50 M/12 2 As Walnut Class 2 No/No 51 F/? ? ? Peanut, pistachio, walnut 10.8 YES/YES 52 M/25 child U Chestnut, Pecan, peanut, soybean, 16.4 No/No Brazil nut, 53* F/44 child AD, U, AR, As Egg, soybean, crab, shrimp, tomato, 15.8 No/YES beef, pork, carrot, potato, coconut, apple, milk, peach 54 F/33 22 U Peanut, hazelnut, Brazil nut, pecan, 7.15 No/No cashew, pistachio, walnut, 55* M/39 10 U, AE Meat, egg, peanut, soybean, 9.05 YES/YES hazelnut, brazil nut, fish, shellfish, carrot, orange, apple, corn, potato, coconut, rice 56 F/20 5 AR, As Tree nuts, peanut, soybean, apple, 0.46 No/No carrots, sprouts, celery 1AD = Atopic dermatitis; AR = allergic rhinitis; As = Asthma; AE = angioedema; U = urticaria 2ImmunoCAP results are shown as kU/1, RAST as class. *Patients used for inhibition immunoblot assays.

Construction of almond cDNA library The almond cDNA library was generated by Dr. Fang Wang. Almond cDNA library construction was performed using mRNA derived from immature almond kernels using methods previously described in detail for cashew library generation [29;98]. Briefly, developing nuts were chopped, frozen in liquid nitrogen, and ground with a mortar and pestle. mRNA was isolated with a PolyATtract kit (Promega, Madison, WI). The construction of the cDNA library was performed with the Uni-Zap XR Gigapack Cloning Kit (Stratagene Inc, Cedar Creek, TX). The double-stranded cDNAs with EcoRI (using a 5′ end adapter) and XhoI (using a γ′ end PCR primer) cohesive ends were cloned into the lambda Uni-ZAP XR expression vector. The cDNA was amplified in E. coli strain XL1-Blue and used in subsequent PCR amplification.

PCR amplification and DNA sequencing Gene specific primers were designed for prunin 1 and prunin 2 based on the available NCBI sequences (accession numbers X78119 and X78120). The prunin 1 gene specific primers (forward: 5’-AAATCTAGAGCACGCCAGTCCCAGT -γ’ and reverse: 5’- CGCAAGCTTTTATACAACTGCCCTC -γ’) and prunin β primers (forward: 5’- GGCAAGCTTCTAATAACCAAGGATG-γ’ and reverse 5’- AGTCTAGATGCTTGCTTCTTCTTTTC-γ’) were designed. Platinum® PCR Supermix High Fidelity (Invitrogen, Carlsbad, CA) was used to amplify full length prunin cDNAs which were then TA cloned (TOPO TA Cloning Kit, Invitrogen). Three isolates for each prunin gene were sequenced on an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). The presumptive signal sequence on the prunin proteins was identified using the SignalP program (www.expasy.org, Swiss Institute of Bioinformatics, Basel, Switzerland). The segments of the cDNA sequences corresponding to the gene specific primers were confirmed by PCR using primers (prunin 1- forward 5’-CATCTATCTCCTTCTCATTCCTTGTG-γ’,and reverse 5’- TTGGTAGCTAGACTCTCTCC -3', prunin 2- lambda Uni-ZAP XR expression vector M13 primer 5’-GGAAACAGCTATGACCATG-γ’ and reverse 5’- TCGTTACATGCAGAAGCCTCC-γ’) designed within the 5’ and γ’ UTRs of the prunin sequences available in the NCBI database entries. The prunin cDNAs were amplified, TA cloned, and sequenced as described above.

Cloning, expression and purification of cDNA-encoded proteins The prunin cDNA sequences, designated Pru du 6.01 and Pru du 6.02, were ligated into the fusion expression vector pMAL-c4X containing a factor Xa cleavage site (New England BioLabs Inc, Beverly, MA). The cloning, expression, and purification of maltose-binding protein (MBP)-rPru du 6.01 and MBP-rPru du 6.02 fusion proteins were carried out as previously described (for cashew) [98]. Attempts to cleave the MBP tag from the fusion proteins using factor Xa resulted in nonspecific degradation of Pru du 6.01 and Pru du 6.02. Attempts were made to express the Pru du 6 proteins in expression vectors without the MBP tag, however, the unfused proteins were insoluble and could not be purified from cell lysates. Consequently, subsequent experiments were performed using the recombinant fusion proteins, MBP-rPru du

6.01 and MBP-rPru du 6.02. Recombinant proteins were stored at 4°C until use or, for long term storage, frozen at -80°C.

Almond protein extract Almond protein extracts were obtained from defatted almond flour by extraction with buffered saline borate (BSB) pH 8.2 (0.1 M H3BO3, 0.025 M Na2B4O7, 0.075 M NaCl) at room temperature (RT) for 1 hour (hr) and stored at -20°C for later analysis as previously described [99].

Purification of native prunin Native prunin was purified by Girdhari M. Sharma and Mengna Su in Dr. Shridhar Sathes lab from aqueous almond extract by column chromatography as previously described [42]. Fractions containing prunin were collected, dialyzed against distilled water, lyophilized, and stored at −β0°C until further use.

Immunodot blot analysis Recombinant Pru du 6.01 and Pru du 6.02 fusion proteins, native prunin, MBP, and almond protein extract were applied to nitrocellulose (NC) membranes using a 96-well Bio-Dot Microfiltration Apparatus (BioRad Laboratories) as previously described [93]. Briefly, recombinant proteins (0.6 μg per β mm dot), native prunin and almond extract (0.γ μg per βmm dot), and MBP (0.6 μg per βmm dot) were applied to NC and blocked overnight (o/n) at 4°C using phosphate buffered saline-Tween 20 (PBS-T)/5% (v/w) nonfat dry milk. Dots were incubated with sera diluted 1:3 (v/v) o/n at 4°C, washed 3X for 30 min at RT in PBS-T, and incubated o/n at 4°C with 125I-labeled anti-human IgE (Specific IgE Tracer, Hycor Biomedical Inc, Garden Grove, CA) diluted 1:10 in PBS-T/5% (w/v) nonfat dry milk. Membranes were washed again as above and signal intensity was determined after a 10 day exposure to Kodak Biomax X-ray film (Kodak X-OMAT, Kodak Molecular Imaging, New Haven, CT) at –80°C.

Immunodot blot testing for IgE epitope conformational sensitivity Recombinant proteins (1μg) were either boiled for 5 min in reducing sample buffer (70 mM Tris-HCl, pH 6.8, 10% glycerol, β% SDS, 0.05% bromophenol blue, and 5% -

15 mercaptoethanol) or were incubated at RT for 10 min in Tris buffered saline (TBS) (20 mM Tris, 137 mM NaCl, pH 7.6) containing either 10% SDS or 6 M urea. Samples were then spotted onto NC as described above. After spotting, dots were washed γX with 100 μl TBS, cut into strips, and used in IgE immunoblotting assays as described above.

Polyacrylamide gel electrophoresis and protein transfer Almond extract (12-14 μg per 4mm well width) was subjected to SDS-PAGE (12%). Samples were boiled for 5 min in reducing sample buffer containing -mercaptoethanol, subjected to electrophoresis and either stained with Coomassie Brilliant Blue R (Sigma-Aldrich, St. Louis, MO) or transferred to NC membranes as previously described [100].

IgE immunoblotting and inhibition NC strips (4 mm wide) from gel transfers containing 1β to 14 μg of almond nut protein extract were probed as described above. Briefly, strips were blocked o/n then incubated with a pool of almond-allergic sera, diluted 1:8 (v/v), o/n at 4°C. The probed strips were washed and then incubated o/n with 125I-labeled anti-human IgE diluted 1:10. Membranes were washed again and exposed to X-ray film. For inhibition immunoblots, human sera at 1:8 dilution (50 μl in 400 μl total volume) were pre-incubated with 170 μg/mL of rPru du 6.01, rPru du 6.0β or 60 μg/mL of native prunin inhibitor at 37°C for 1 hr and used as described above. Controls included strips exposed to IgE without inhibitor and strips exposed to serum from an atopic individual without a history of tree nut allergies.

Solid-phase peptide (SPOTs) synthesis and detection of IgE binding Two sets of overlapping 15 amino acid (aa) cellulose-derivatized peptides, each offset by 8 aa, corresponding to the entire deduced aa sequences of Pru du 6.01 and Pru du 6.02, were purchased from Sigma-Genosys (The Woodlands, Texas, US). A spacer of two ß–alanines was added between each of the peptides and cellulose membrane. The peptide purity was >70% by HPLC and mass spectroscopy according to the manufacturer. The peptide-containing cellulose membranes were probed as previously described [101].

Solid-phase peptide (SPOTs) inhibition assay The IgE-reactive peptides from Pru du 6.01 (#15,16,19-21, 29, 36, 64, 65) and Pru du 6.02 (#3, 14-16, 24, 27, 29, 36, 59) were purchased from Sigma-Genosys. The peptide- containing cellulose membranes were probed using pooled Pru du 6.01 (# 9, 14, 33, 44, 51, 55)- and Pru du 6.02 (#9, 51, 53, 55)-reactive sera as previously described [101]. For IgE inhibition, solid phase peptides were assayed with pooled Pru du 6-reactive sera that was first incubated with solid phase native prunin spotted onto NC (10 µg/spot) each spot treated separately with 6 M urea, 10% SDS, or reducing sample buffer o/n at 4ºC, followed by incubation with added soluble native prunin (60 µg/mL final concentration) at 37°C for 1.5 hr and then used as described above.

Enzyme linked immunosorbent assay (ELISA) and inhibition Native prunin (β0 μg/mL), rPru du 6.01 (γ4 μg/mL), and rPru du 6.0β (γγ μg/mL) diluted in coating buffer (0.1 mol/L carbonate-bicarbonate buffer, pH 9.6) were coated (60 μL/well) onto the wells of 96-microwell flat bottom polystyrene microtiter ELISA plates (Costar, Cambridge, Mass) at 37°C for 1 hr. Plates were washed 3 times between steps with PBS-T. Blocking was performed using PBS-T/5% (w/v) nonfat dry milk at 37°C for 1 hr. Sera from patient #8 was diluted 1:12 (v/v) in PBS-T/5% (w/v) nonfat dry milk then added to the coated wells (60 μL/well) and incubated at γ7°C for γ hrs. After washing, bound IgE was reacted with horseradish peroxidase–conjugated mouse anti-human IgE (Zymed Laboratories Inc) at a dilution of 1:1,000 and incubated for 1 hr at 37°C. IgE reactivity was detected by colorimetric reaction using o-phenylenediamine (Zymed Laboratories Inc) and H2O2 as substrate. OD was measured in a KC4 v2.5 ELISA reader (Bio-Tek Instruments Inc, Winooski, VT) at 495 nm. All assays were performed in triplicate and values below the cut-off value, OD495 = 0.15, (three times the non-specific baseline binding) were considered negative. For IgE inhibition ELISA, solid phase native prunin, rPru du 6.01 or rPru du 6.02 was assayed with serum from patient #8 pre-incubated with soluble inhibitors; native prunin (120 μg/mL and 1β μg/mL), rPru du 6.01 (β06 μg/mL and β0.6 μg/mL), and rPru du 6.0β (β00 μg/mL and β0 μg/mL) for 1 hr at γ7ºC and used as described above. Controls included wells exposed to serum IgE without inhibitor and wells exposed to serum from an atopic individual without a history of tree nut allergies.

Sequence analysis Deduced aa sequences for the almond prunins were aligned with each other and with sequences of other 11S globulins using BLAST 2.0 (http://blast.ncbi.nlm.nih.gov/Blast.cgi, National Center for Biotechnology, Bethesda, MD). Sequential IgE binding epitopes on each sequence were highlighted as previously described [102]. Solvent-exposed residues (1.4 Å probe) on the monomer, trimer and hexamer of tree nut 11S globulins were determined based on the crystal structure of prunin 1 (PDB: 3EHK and 3FZ3) [49] and its analysis using the GETAREA program (http://curie.utmb.edu/getarea.html).

Molecular modeling Molecular modeling was performed using chimera 1.6.1 (http://www.cgl.ucsf.edu/chimera/) and the prunin crystal structure (PDB# 3FZ3) [49].

Results

Gene characterization The prunin genes were amplified from the almond cDNA library by means of PCR with gene-specific primers. The resulting 1656-bp PCR product (GenBank ID: GU059260) for Pru du 6.01 encodes a 551-aa protein and the 1515-bp PCR product (GenBank ID GU059261) for Pru du 6.02 encodes a 512-aa protein. The SignalP program was used to identify a 20 aa presumptive signal sequence for Pru du 6.01 and a 19 aa presumptive signal sequence for Pru du 6.02 (in red, Fig. 2.1).

Protein sequence homology and recombinant protein expression Comparison of the rPru du 6.01 and rPru du 6.02 aa sequences with the prunin 1 and prunin 2 sequences previously identified by Garcia-Mas et al. [39] revealed that both recombinants share 99% sequence identity with their published prunin counterparts. Comparison of rPru du 6.01 to rPru du 6.02 revealed that they share 64% aa sequence identity and 77% similarity (Fig. 2.1). Interestingly, the presumptive flexible loop region from aa 118 to aa 184, identified on the Pru du 6.01 atomic structure by Jin et al. [49], does not appear to be present on Pru du 6.02. The two prunins share the greatest degree of sequence homology in the basic

18 chains, with alignment displaying 66% aa identity and 83% similarity (Fig. 2.1). Comparison of the two aa sequences with the NCBI database using BLAST analysis identified homology with other members of the 11S globulin family of seed storage proteins, several of which are known food allergens, including: 50% and 41%, respectively between r Pru du 6.01 and hazelnut Cor a 9 [28] and Brazil nut Ber e 2 [103] and 55% and 46% sequence identity, respectively, between rPru du 6.02 and English walnut Jug r 4 [104] and cashew Ana o 2 [29]. The entire Pru du 6.01 cDNA sequence, beginning at aa codon A21 following the presumptive signal peptide, and the entire Pru du 6.02 cDNA beginning at aa codon C10, were cloned and expressed as ~103 kDa and ~100 kDa MBP fusion proteins, respectively. Efforts to enzymatically liberate the prunins from their fusion partners resulted in fragmentation of the prunins and efforts to use other vectors yielded insoluble proteins. Consequently the MBP fusion proteins were used in all assays.

(A) 1 MAKAFVFSLC LLLVFNGCLA ARQSQLSPQN QCQLNQLQAR EPDNRIQAEA GQIETWNFNQ 61 EDFQCAGVAA SRITIQRNGL HLPSYSNAPQ LIYIVQGRGV LGAVFSGCPE TFEESQQSSQ 121 QGRQQEQEQE RQQQQQGEQG RQQGQQEQQQ ERQGRQQGRQ QQEEGRQQEQ QQGQQGRPQQ 181 QQQFRQFDRH QKTRRIREGD VVAIPAGVAY WSYNDGDQEL VAVNLFHVSS DHNQLDQNPR 241 KFYLAGNPEN EFNQQGQSQP RQQGEQGRPG QHQQPFGRPR QQEQQGSGNN VFSGFNTQLL 301 AQALNVNEET ARNLQGQNDN RNQIIRVRGN LDFVQPPRGR QEREHEERQQ EQLQQERQQQ 361 GGQLMANGLE ETFCSLRLKE NIGNPERADI FSPRAGRIST LNSHNLPILR FLRLSAERGF 421 FYRNGIYSPH WNVNAHSVVY VIRGNARVQV VNENGDAILD QEVQQGQLFI VPQNHGVIQQ 481 AGNQGFEYFA FKTEENAFIN TLAGRTSFLR ALPDEVLANA YQISREQARQ LKYNRQETIA 541 LSSSQQRRAV V

(B) 1 MPLALASLCL LLLFNGCLAS RQHIFGQNKE WQLNQLEARE PDNHIQSEAG VTESWNPSDP 61 QFQLAGVAVV RRTIEPNGLH LPSYVNAPQL IYIVRGRGVL GAVFPGCAET FEDSQPQQFQ 121 QQQQQQQFRP SRQEGGQGQQ QFQGEDQQDR HQKIRHIREG DIIALPAGVA YWSYNNGEQP 181 LVAVSLLDLN NDQNQLDQVP RRFYLAGNPQ DEFNPQQQGR QQQQQQQGQQ GNGNNIFSGF 241 DTQLLAQALN VNPETARNLQ GQDDNRNEIV RVQGQLDFVS PFSRSAGGRG DQERQQEEQQ 301 SQREREEKQR EQEQQGGGGQ DNGVEETFCS ARLSQNIGDP SRADFYNPQG GRISVVNRNH 361 LPILRYLRLS AEKGVLYNNA IYTPHWHTNA NALVYAIRGN ARVQVVNENG DPILDDEVRE 421 GQLFLIPQNH AVITQASNEG FEYISFRTDE NGFTNTLAGR TSVLRALPDE VLQNAFRISR 481 QEARNLKYNR QESRLLSATS PPRGRLMSIL GY

Fig. 2.1. Amino acid sequences of Pru du 6 polypeptides (A) Pru du 6.01 (prunin 1) sequence (B) Pru du 6.02 (prunin 2) sequence. The predicted signal peptide is underlined in black, the acidic chain is represented in red, and the basic chain in blue.

Reactivity of prunins with patient IgE Reactivity to rPru du 6.01 and rPru du 6.02 was screened using 18 patients with a history of almond allergy (patient numbers correspond to those used in our previous publications). IgE from nine of the 18 patients tested (50%; #8, 9, 14, 18, 29, 33, 44, 51, 55) reacted with rPru du 6.01 and five (28%, #8, 9, 51, 53, 55) reacted with rPru du 6.02 in immunodot blot assays (Fig. 2.2A). Of the 10 reactive patients, 5 (50%, #33, 14, 44, 18, 29) reacted only with rPru du 6.01 and one (#53) only with rPru du 6.02. To identify the Pru du 6.01 and Pru du 6.02 protein bands in Western blots of almond nut extract, inhibition immunoblotting was performed (Fig. 2.2B). Native prunin and either rPru du 6.01 or rPru du 6.02 were assayed for their ability to inhibit the reaction between a pool of rPru du 6.01-reactive patient sera (#14, 44, 55) or the single rPru du 6.02 (-only)-strongly reactive patient serum sample (#53), and almond protein extract. Pre- incubation of the anti-Pru du 6.01 serum pool with either rPru du 6.01 or native prunin shows inhibition of IgE binding to 60 and 34 kDa bands in the nut extract indicating that these bands represents the native Pru du 6.01 proprotein (60 kDa) and the acidic (34 kDa) chain (Fig. 2.2B). Inhibition of the anti-Pru du 6.02 serum with native prunin shows inhibition of IgE binding to 58, 30, 19 and 16 kDa bands. These bands likely represent the full length native prunin (58 kDa), the dissociated acidic (30 kDa), and basic chains (19 kDa) and an additional Pru du 6.02 fragment (16 kDa). Inhibition with rPru du 6.02 resulted in a loss of IgE binding to a 30 and 16 kDa band which likely represent the Pru du 6.02 acidic and basic chains, respectively (Fig. 2.2B).

Fig. 2.2. Immunodot blot and inhibition immunoblots [97]. (A) Immunodot blot of almond-allergic patients’ sera showing IgE reactivity to rPru du 6.01 and rPru du 6.02 (compiled from two separate blots) and native prunin (from a third blot). Data from sera showing no signal is not shown. (B) Inhibition immunoblot of almond extract probed with rPru du 6.01-reactive patients’ serum pool (#14, 44, 55) or rPru du 6.0β-reactive patient (#53), either unadsorbed (U) or pre-incubated (adsorbed) with rPru du 6.01 (+Pru1), rPru du 6.02 (+Pru2), or native prunin (+nat). Arrows indicate inhibited bands. Almond Extr = aqueous almond extract, MBP = maltose binding protein, NC = atopic serum negative control, ND = not determined due to serum availability limitation.

Conformational sensitivity of Pru du 6.01 and Pru du 6.02 IgE epitopes Prunin displays considerable conformational stability as assessed by CD spectroscopy with complete thermal denaturation observed at 90˚C and chemical denaturation at 5 M urea [48]. To assess the stability of epitopes on Pru du 6.01 and 6.02, we subjected the recombinant proteins to various denaturing conditions prior to immunodot blotting and probing with serum from representative recombinant prunin-reactive patients. The results show that, for patients #55 and 14, denaturation does not diminish reactivity to rPru du 6.01, indicating the recognition of stable epitopes (Fig. 2.3). Patient #55 showed a similar pattern of reactivity with undenatured and denatured rPru du 6.02. However, patient #53, our single patient recognizing only rPru du 6.02, showed a strong signal with the 6M urea-treated sample but almost complete loss of reactivity upon treatment with reducing buffer or SDS, indicating that this particular patient recognizes predominantly labile epitopes on the protein (Fig. 2.3). The surprisingly strong reactivity of patient #53 with the sample following the brief (10 min) 6M urea-treated may be the result of incomplete denaturation and partial refolding of the recombinant protein during the subsequent washing steps used in the immunodot blot assay. The observed similar IgE binding intensity to rPru du 6 under all treatment conditions for patients #14 and 55 indicates that IgE from these patients is primarily targeting sequential epitopes on both Pru du 6.01 and Pru du 6.02.

Fig. 2.3. Immunodot blot of rPru du 6.01 and rPru du 6.02 proteins treated with denaturing reagents and probed with individual rPru du 6.01- or rPru du 6.02-reactive sera [97]. Recombinant proteins were either boiled for 5 min in reducing sample buffer or were incubated at RT for 10 mins in Tris-buffered saline (TBS) containing either 10% SDS or 6 M urea, and then applied to nitrocellulose. NC = atopic serum negative control.

Identification of IgE-reactive sequential epitopes on rPru du 6.01 and rPru du 6.02 To identify sequential IgE binding epitopes, a series of 68 overlapping solid-phase synthetic peptides representing the entire aa length of Pru du 6.01, was probed with a pool of available sera from six Pru du 6.01-reactive patients (#9, 14, 33, 44, 51, 55). The pool reacted weakly with four peptides (#19, 20, 21 and 36), moderately with three peptides (#15, 29, and 65) and strongly with two peptides (#16 and 64) (Fig. 2.4 and Table 2.2). Because of an seven aa overlap between adjacent peptides, it is likely that IgE recognition of neighboring SPOTs represents recognition of the shared aa sequence and thus a single epitope. Two such peptide pairs are found in Pru du 6.01 (peptides #15-16 and #64-65). Assuming that the aa segment covered by peptides 19-21 represent at least two distinct epitopes based on similar reasoning (i.e., peptides 19 and 21 do not overlap), there are at least six epitope-containing peptide segments on Pru du 6.01 (Table 2.2). These epitope-containing peptide segments are distributed throughout the length of the protein, with five residing on the acidic chain, and one on the basic chain (Table 2.2). Half of epitopes (three of six) identified on Pru du 6.01 are located between aa 113 and aa 175, a region rich in glutamine residues (Fig. 2.5). Sixty two overlapping solid-phase synthetic peptides corresponding to the Pru du 6.02 sequence were similarly analyzed using a pool of four reactive patients’ sera (#9, 51, 53, 55). The pool reacted weakly with two peptides (#3, 24), moderately with three peptides (#14, 29, 36), and strongly with four peptides (#15, 16, 27, 59) (Fig. 2.4 and Table 2.2). Assuming peptides #14-16 represents two epitopes, a total of eight IgE-reactive epitope-containing peptide segments are present on Pru du 6.02, seven of which reside on the acidic chain, and one resides on the basic chain (Table 2.2).

Fig. 2.4. SPOTs assay identifying sequential IgE-binding peptides in Pru du 6.01 and Pru du 6.02 using a pool of rPru du 6.01-reactive patients (#9, 14, 33, 44, 51, 55) and rPru du 6.02-reactive patients (#9, 51, 53, 55) [97].

Table 2.2. Sequence of reactive peptides and epitope-containing peptide segments identified on Pru du 6.01 and Pru du 6.02 [97]. Pru du 6.01 Amino acid Prunin 1 Pool Peptide no. sequence position reactivity 15 EESQQSSQQGRQQEQ 113-127 ++ 16 QGRQQEQEQERQQQQ 121-135 +++ 19 QQEQQQERQGRQQGR 145-159 + 20 QGRQQGRQQQEEGRQ 153-167 + 21 QQEEGRQQEQQQGQQ 161-175 + 29 LFHVSSDHNQLDQNP 225-239 ++ 36 QQEQQGSGNNVFSGF 281-295 + 64 RTSFLRALPDEVLAN 505-519 +++ 65 PDEVLANAYQISREQ 513-527 ++ +++, strong binding; ++, moderate binding; +, weak binding

Pru du 6.01 Amino Acid sequence Epitope 1 118 SSQQGRQQEQEQERQ 132 2 145 QQEQQQERQGRQQGR 159 3 161 QQEEGRQQEQQQGQQ 175 4 225 LFHVSSDHNQLDQNP 239 5 281 QQEQQGSGNNVFSGF 295 6 510 RALPDEVLANAYQIS 524

Pru du 6.02 Amino acid sequence Prunin 2 Pool Peptide no. position reactivity 3 FGQNKEWQLNQLEAR 25-39 + 14 DSQPQQFQQQQQQQQ 113-127 ++ 15 QQQQQQQFRPSRQEG 121-135 +++ 16 RPSRQEGGQGQQQFQ 129-143 +++ 24 QNQLDQVPRRFYLAG 193-207 + 27 QQGRQQQQQQQGQQG 217-231 +++ 29 GNNIFSGFDTQLLAQ 233-247 ++ 36 RGDQERQQEEQQSQR 289-303 ++ 59 QNAFRISRQEARNLK 473-487 +++ +++, strong binding; ++, moderate binding; +, weak binding

Pru du 6.02 Amino acid sequence Epitope 1 25 FGQNKEWQLNQLEAR 39 2 113 DSQPQQFQQQQQQQQ 127 3 129 RPSRQEGGQGQQQFQ 143 4 193 QNQLDQVPRRFYLAG 207 5 217 QQGRQQQQQQQGQQG 231 6 233 GNNIFSGFDTQLLAQ 247 7 289 RGDQERQQEEQQSQR 303 8 473 QNAFRISRQEARNLK 487

As with Pru du 6.01, several of the Pru du 6.02-reactive peptides are glutamine rich. To compare the IgE-binding peptides, the sequences of Pru du 6.01 and Pru du 6.02 sequences were aligned and the identified epitopes highlighted (Fig. 2.5). Analysis revealed that the majority of epitopes identified (5 of 8) are located in homologous regions on the Pru du 6 proteins (i.e., they overlap in position by > 40% of their residues) (Fig. 2.5).

Fig. 2.5. Sequence alignment of Pru du 6.01 and Pru du 6.02 [97]. “*” = identical amino acid, “:” = similar amino acid. Identified epitope-containing peptides are highlighted in green for Pru du 6.01 and yellow for Pru du 6.02. The predicted signal peptide is indicated in red. Arrow indicates the proteolytic cleavage site between the acidic (on left) and basic (on right) subunits.

Molecular modeling of SPOTs identified epitopes The molecular positions of the sequential IgE-binding epitopes on Pru du 6 were identified by using the recently reported X-ray diffraction data of prunin 1 (PDB# 3FZ3) [49]

(Fig. 2.6). Interestingly, the sequential IgE epitopes on Pru du 6 were all located on the exterior of the molecule and thus likely accessible for antibody interaction.

Pru du 6.01 Pru du 6.02

IA Face IA Face

Fig. 2.6. Molecular models of Pru du 6 trimers using the crystal structure of prunin 1 [49]. Surface rendering on one monomer/subunit is shown in grey with the identified sequential epitopes highlighted in colors (blue, green, yellow, teal, magenta, red, and purple).

Epitope analysis by inhibition ELISA The observation that some patients react with both prunin isoforms coupled with the overlapping positions of some cognate peptides in the two isoforms suggested there might be cross-reactivity between the isoforms. To test for this, inhibition ELISA assays were performed using serum from patient #8. This serum sample was selected based on availability and the fact that it recognized both Pru du 6 isoforms by immunodot blot assay (Fig. 2.2A). Native prunin, rPru du 6.01, and rPru du 6.02 were assayed for their ability to inhibit the binding of IgE to the corresponding solid phase antigen (Fig. 2.7). Incubation with rPru du 6.01, 6.02, or native prunin resulted in a loss of IgE reactivity to both rPru du 6.01 and rPru du 6.02 (Fig. 2.7A and B) suggesting the recognition of similar (cross-reactive) epitopes on the rPru du 6 isoforms by this patient. Because both isoforms completely inhibited one another, neither could be identified as the initial sensitizing agent. It is likely that co-sensitization to both prunin proteins occurred. In contrast to these results, incubation of the serum with either of the rPru du 6 isoforms had little effect on IgE reactivity to native prunin (Fig. 2.7C). This somewhat surprising result suggests that a significant portion of the recognition of the native protein is dependent on the overall structure of the native protein. A likely source for the difference is the fact that most of the native prunin is in the form of mature cleaved hexamers whereas the recombinant proteins are

26 uncleaved proproteins presumably in the trimeric form. In contrast to the immunoblotting, which assays denatured proteins and thus sequential epitopes, the ELISA assays are performed under nondenaturing conditions.

Fig. 2.7. Inhibition ELISA analysis of specific IgE reactivity of patient #8 against solid phase (A) rPru du 6.01, (B) rPru du 6.02 and (C) native prunin. Serum was either unabsorbed or pre-incubated with the allergen inhibitors (+Pru du 6.01, +Pru du 6.02, or +Nat Prunin) [97]. NC = atopic serum negative control.

Solid-phase peptide inhibition assay To confirm the presence of sequential IgE binding epitopes on Pru du 6, peptide inhibition assays were performed. Native prunin was assayed for its ability to inhibit the binding of pooled Pru du 6.01 (# 9, 14, 33, 44, 51, 55)- and Pru du 6.02 (#9, 51, 53, 55)-reactive sera to the solid phase peptides identified by the SPOTs assay (Fig. 2.4 and Table 2.2). Sera was first incubated with solid phase denatured native prunin to allow IgE binding to epitopes that may not be accessible on the protein surface, followed by incubation with soluble native prunin. Upon inhibition, IgE binding to the 18 identified Pru du 6 peptides was significantly reduced or completely eliminated as compared to the uninhibited controls for all peptides except Pru du 6.02 peptide # 59, thus demonstrating the specificity of IgE binding to the Pru du 6 epitopes (Fig. 2.8).

Fig. 2.8. SPOTs inhibition assay using pooled Pru du 6-reactive sera either unabsorbed or pre-incubated with denatured and soluble native prunin (+prunin) [97]. NC = atopic serum negative control.

Comparison of prunin sequential epitopes to those on other 11S globulin allergens Sequential IgE-binding epitopes have been identified on a number of 11S globulins, including walnut Jug r 1, peanut Ara h 3, soybean Gly m 6, cashew Ana o 2, and hazelnut Cor a 9 [29;31;35;101;102;105]. To compare these epitopes with those of almond Pru du 6.01 and 6.02, we modified a recently published figure (Fig. 1 in [102] to include the Pru du 6 epitopes (Fig. 2.9). Four allergen ‘hot spots’ (HS #1-4), which represent regions in which a majority of the compared sequences display sequential epitopes, have been identified previously [102]. Surprisingly, only two of the hot spots (# 2 and #4) displayed Pru du 6 epitopes (Fig. 2.9). On the other hand, all of the newly identified Pru du 6.01 and 6.02 epitope-containing peptides demonstrate significant positional overlap with sequential epitope-bearing peptides in one or more of the other compared allergen sequences (Fig. 2.9). Further analysis of the sequential epitope locations identified a new hot spot (#5) in the allergen sequences. In contrast, the region previously identified as hot spot #1 [102] no longer appears to be epitope-rich. Clearly, the sequence segments designated as epitope “hotspots” will have to be modified as new data are considered.

Discussion

Allergies to tree nuts are common and can be severe [4;19;20;91;106;107]. Numerous studies have been directed toward the identification and immunological characterization of tree nut allergens [28;32; 93;104;108-113]. An important approach in the analysis of allergens is the use of recombinant proteins, which have repeatedly shown their value in basic studies, diagnosis, and the development of potential immuno-therapeutic agents (see reviews [114-118]).

Fig. 2.9. Amino acid sequence and sequential epitope comparison of cashew (Ana o 2), almond (Pru du 6.01 and Pru du 6.02), walnut (Jug r 4), hazelnut (Cor a 9), soybean (Gly m 6.1 = Gly m 6.0101 and Gly m 6.2 = Gly m 6.0201), and peanut (Ara h 3) 11S globulins [97]. Segments corresponding to peptides testing positive in IgE SPOTs assays are highlighted. Biochemically similar residues are indicated with “|”, identical amino acids with; “.”, positions where a space was added to enhance alignment with “-”, and sequences deleted to maximize alignment with “/”, * indicates additional loop region present in Pru du 6.01. Numbered dotted black boxes represent previously described (#1-4) [10β] and newly identified (#5) allergen “hot spots” (HS). Those residues solvent- exposed in the monomer, trimer and hexamer ( ), the monomer and trimer but occlude in the hexamer ( ) and those only exposed in the monomer (-) of the modeled core structure of the prunin 1 hexamer (PDB 3FZ3) [49] are indicated in the “Solv Exposed” line. Residues not exposed in the monomer (i.e., are buried) have no symbol. Those residues for which there are no atomic coordinates are also indicated (^).

ａｲＮｾ＠ 0 2 : 1 5 iki¥•jjlO;O¥f••ft.) ,. !;.LE?DURVEYE.AG1VE.A'f;D?lntE.QFRCAGVALVRHiiQ? 7 0 ?1:u du 6.01: 21 f ·· JLs? · i --f··li 1 ·Q ·R ····· IIA ·· ·o l · · I ·· .. ·AS ·I ···R 77 ?1:u du 6.02: a ·· ·/ ·· ··• lis · L····I ··R·· I · 68 Juq l: ｾＺ＠ 24 osGG• · · ·oro I · · II · · · · · · ·T · · I ·A· · I · ·R · · I · 81 ｃｯｬＺｾ＠ 9 : 28 R· · loln ·c -- · ·u l · ·· I ··· ·• · · I ·A· · ·· · II ·R· · I · 83 Gly ::-; 6.2: 19 L· II-A··I-- ··· ·o l · l ··l ····l ······s ·c · hm 73 Gll-· ::-; 6.1: 21 ·s l ·o• ··l-- ··· ·o l · l ··l ····l ······s ·c · l>m 76 ａＱＺｾ＠ h 3 .1: 2 ·r llo•III--A· ·FQ · ·I·OR · ···I · ·· · ·s ·Lv ii R 57 ?? ·• llo';) lll--=- ··ro ··I·QQ ····I ..ｾＺＮｱｺｩｩａ＠ '7'7 Solv Expo:;ed

ａｲＮｾ＠ 0 2' 71 136 ?

ａｲＮｾ＠ 0 2' 199 256 ?

ａｲＮｾ＠ o 2 : 308 LNL?IIi@i•ifl'' '"32•f§j@tifi15'fMijj§{[email protected]•,@#@u.VQVVDnFGtRVFDGEVREGQM 3 7 2 ?m i ····IEl< · I•I LID· ·····I Hs

G1y Q 6.1, 3<7 · I• ·A·s ·· I · ·A·F ·s ·R· · · I• I · · I ·· -II ··· ·Aw · IALI · · -lcu ·E ······II ·- II 406 ａ｣ｾ＠ h :1 . :. . :IG:. L I o A V lf I E' lA I ii I R L I IAlt In I E II u I ｾＲｇ＠ A. 3•, 391 · · ·L · · I · ·G · ·A ·Y·u · · I · · ·• I · · I ·• · I · · · · ·ALl ·IAH · · · · · In · I · · I ·E · II · ·• I <54 Solv Expo:;ed == = 5 s ::= - s s s ---::: ::= =::::

ＢＢｾ＠ 0 2' 373 Ｇｾ＠ｾｾＲ＠ ?l:U du 6.01: ｾＶＹ＠ r l · · · ·HG · 538 ?l:U du 6.02: H6 • II .. ·H · · li l ·sn ·c · ·······RA ｾＸＵ＠ Juq < ｾＺ＠ H 7 a i@ ·······AIRA ｾＸＶ＠ Co< • 9' ｾＲＲ＠ :fl . ·····A ·· ·E.S ·G · · · ·n ·QI ········AIRA I ｾＹＱ＠ Gly ::'; 6.2: ｾＰＲ＠ · I · ······AA I II s lu · · · · · · · ·?SI Gli · · -;u• · I ·tvd · ｾＷＰ＠ Gly ::'; 6.1: ｾＰＷ＠ · I · ····V·AA · I Is lu · · · · · · ·i ? ·IGi · · -;u• · I ·tvd · ｾＷＸ＠ａ＼ｴＺｾ＠ h 3 . 1 : ｾＲＷ＠ ··· ······AG I II s ·u · · · · Is ·?SI In · ··EU ·· IDn l · ｾＹＳ＠ａ＼ｴＺｾ＠ h 3•: ｾＵＵ＠ ··· ······AG I II s ·u · · · · Is ·?SI In · ··Eli ·FIDn l · ｾＹＳ＠ Solv Expo:;ed = """" = - = == == --=----=- 521 30

The 11S globulins are important nut and seed allergens. They constitute a large portion of the total seed protein content and it is not uncommon for multiple 11S globulin isoforms to be expressed. Isoform sequences can be divergent and not all isoforms in a given variety of plant seed are allergenic [27;33;34;38]. To date, two 11S isoforms have been identified in almond, prunin 1 and prunin 2 [39]. Here we have cloned and expressed both in an effort to determine the degree to which patient IgE recognizes and distinguishes between the two. In this study we found that of the 18 almond-allergic patients, 10 (56%) were prunin (Pru du 6)-reactive (Fig. 2.2A). Interestingly, five of the patients tested (28%) reacted exclusively to prunin 1 (Pru du 6.01), and one patient, #53, recognized prunin 2 (Pru du 6.02) exclusively, indicating that some patients’ IgE could distinguish between the isoforms to the exclusion of reactivity to one or the other, despite their degree of homology (78% aa similarity and 64% identity). This observation may reflect the fact that the protein core (internal) structures are most conserved whereas the solvent-accessible surface is more variable and is the portion most likely to express epitopes. Based on our IgE inhibition immunoblots, native and recombinant Pru du 6.01 appear antigenically equivalent with respect to the tested patients’ IgE. With regard to Pru du 6.02, the native counterpart found in the nut extract demonstrated a somewhat higher degree of inhibition than rPru du 6.02 in our tested patient (Fig. 2.2B). This observation may be due, in part, to structural differences between the enzymatically cleaved (into acidic and basic chains), hexameric structure of the mature native form and the uncleaved, likely trimeric structure, of our recombinant proprotein [26;27;119]. The native hexameric form, which predominates in the nut, is the likely sensitizing agent in our prunin-allergic patients. A conformational epitope sensitivity assay (Fig. 2.3) indicated a predominance of reactivity to sequential (linear) IgE- binding epitopes. In support of this observation, a probing of overlapping peptides by SPOTs analysis identified six IgE-binding peptides in Pru du 6.01 and eight peptides in Pru du 6.02, which were distributed throughout the sequence. Serum IgE reactivity to all but one of these peptides was inhibited by a mix of native and denatured prunin demonstrating relevance for the identified sequential epitope-bearing peptides. An analysis of the aa sequences of the Pru du 6 epitopes revealed two distinctive features. First, more than half are located in regions rich in glutamine residues (Pru du 6.01 peptides 15-16 E113-Q135, 19-21 Q145-Q175, and 36 Q291-F305; Pru du 6.02 peptides 14-16 D105-Q135, 27 Q209-G223, 36 R281-R295). Additionally, these epitopes display a preponderance of

31 hydrophilic/charged residues (Pru du 6.01 epitopes 1-5 and Pru du 6.02 epitopes 2, 3, 5 and 7) (Table 2.2). Interestingly, most of these epitopes are located in one of the two regions unresolved in the recently reported crystal structure of prunin 1 (aa 118 to 184) [49]. The likely reasons for these characteristics are high degrees of peptide flexibility and solvent exposure. Consistent with this interpretation is the observation that glutamine-rich regions are inherently flexible and can adopt multiple conformations including random coil, α helix, and extended loop structures [120]. The presence of exposed highly flexible regions on prunins, as well as other legumins, may provide convenient plant protease cleavage sites which are necessary to facilitate their rapid digestion and nutrient release in the germinating seed [26;27]. In contrast, during digestion within the human gut, proteins encounter a different series of proteases which facilitate the breakdown and absorption of food proteins. To analyze the susceptibility of Pru du 6.01 to proteases commonly found in the digestive tract, the protein sequence was analyzed for pepsin, trypsin, and chymotrypsin cleavage sites using the automated program PeptideCutter (http://www.expasy.org). Interestingly, both pepsin and chymotrypsin cleavage sites were absent from the glutamine rich loop on Pru du 6.01 and only a few trypsin cleavage sites were identified in this region. Based on these results it appears that the glutamine rich sequence located in this flexible loop region may help prevent excessive proteolytic degradation during the digestion process. Taken together, it is likely that our identification of sequential Pru du 6.01 epitopes in these presumptive flexible loop regions is due to their enhanced solvent (and thus IgE antibody) accessibility and perhaps an enhanced facility for induced fitting to antibody complementarity determining regions (CDRs) [121-123]. Moreover, a lack of rigidity in these regions might favor the generation of IgE against sequential epitopes over conformational epitopes. Additional studies should be undertaken to address these issues. B-cell epitopes are typically categorized as being either sequential (linear, continuous) or conformational (discontinuous) [4;51-53;124]. Recently, there has been considerable debate over the clinical importance and relevance of the two epitope forms and several studies have shown conflicting results. In a study by Sordet et al. four IgE binding regions were identified on the walnut allergen, Jug r 1 [111]. In an inhibition ELISA in which soluble peptides corresponding to two of the identified epitopes served as inhibitors, a significant inhibition of IgE binding to both the native and recombinant walnut allergen was demonstrated, suggesting a preponderance of sequential epitope recognition. In another study, Schulmeister et al. used

32 soluble peptides to identify several sequential epitopes spanning the sequence of αS1-casein, an important allergen in milk [125]. They found that pre-incubation of patients’ IgE with the soluble peptide mixture significantly inhibited IgE binding to rαS1-casein [125]. In contrast, Albrecht et al. identified several sequential epitopes on the shrimp tropomyosin Pen a 1 and the peanut allergen Ara h 2, but failed to find significant inhibition of IgE binding to the allergens using peptide inhibitors. Disruption of secondary structure did, however, prevent IgE binding, thereby demonstrating the importance of conformational epitopes on these allergens [126]. Similarly, an analysis of Brazil nut 2S albumin, Ber e 1, showed that IgE is predominantly directed against longer conformational epitopes [127]. From the above described studies, it is now clear that generalities concerning the relative importance of sequential vs conformational epitopes cannot be drawn and that the spectrum of epitope types varies depending upon the allergen and perhaps even upon differential patient reactivity. Additionally, our longstanding definition of sequential and conformational epitopes may be too rigid, as short stretches of continuous residues may be part of more complex conformational epitopes [121;124;128;129]. Though our studies do not resolve these issues with respect to almond Pru du 6, by identifying sequential IgE binding epitopes, we lay the foundation for additional studies to analyze the IgE binding profile of almond-allergic individuals to assess their relative reactivity to sequential vs. conformational epitopes. It is apparent from our results that conformational epitopes may play a role in IgE recognition, as one of the tested patients appears to recognize labile epitopes of Pru du 6. We are currently developing assays to assess the relative contributions of conformational and sequential epitopes on almond Pru du 6 to recognition by patient IgE.

CHAPTER THREE

IDENTIFICATION OF CONFORMATIONAL IGE-BINDING EPITOPES ON PRU DU 6 BY PHAGE DISPLAY

Introduction

Tree nuts are a widely consumed food and include walnut, cashew, almond, hazelnut, pistachio, pecan, chestnut, macadamia, and Brazil nut. Although enjoyed safely by most individuals, severe allergic reactions can occur in sensitized individuals. Several IgE reactive proteins have been identified in almond [20;42;93;94;97]. The 11S globulin, prunin (Pru du 6), represents a major component of the seed and was found to be an important allergen in almonds [42;44;97]. Sequential epitope mapping studies identified six IgE binding epitopes on Pru du 6.01 and eight on Pru du 6.02 [97]. These epitopes were distributed throughout the length of the protein and demonstrated significant positional overlap with sequential epitopes identified on other allergenic 11S globulins [97]. Few conformational IgE binding epitopes have been identified on food allergens [65;66;127;130-133]. This is largely due to their dependence upon one or more peptide segments held in a specific orientation due to the tertiary structure of the allergen [4;52;53;124]. The retention of the allergen structure during analysis is critical for epitope identification and often requires sophisticated techniques such as large scale mutagenesis, X-ray crystallography of immune complexes, nuclear magnetic resonance (NMR), phage display, or the generation of chimeric molecules [52;124]. Studies done on tree nut allergens have largely focused on the generation of chimeric molecules as they are relatively easy to create, cost effective, and typically maintain the overall structure of the allergen [127;130;131]. This approach has been successfully used for the Brazil nut allergen, Ber e 1, where probing of the chimeric molecules by microarray identified a conformational IgE binding epitope located in a helix-loop-helix region [127]. Similarly, a conformational murine IgG binding epitope also targeted by a subset of patient IgE antibodies was identified near the N-terminus of the cashew allergen, Ana o 2, by probing a large set of chimeric and point-mutated molecules in dot-blot and ELISA assays [130;131]. Recently, phage display has been applied to conformational epitope mapping studies. This approach utilizes a library of bacteriophage, genetically engineered to express random

34 peptides of 7-15 aa displayed on the filamentous M13 phage surface [10]. The library is screened with an antibody of interest in order to identify phage expressing peptides that mimic the physiochemical properties of amino acid patches (i.e., epitopes) on the allergen. Studies done on both aeroallergens and food allergens have demonstrated the usefulness of phage display technology for identifying conformational epitopes on allergenic proteins [57;65;66;132;133;134]. To date, limited information is available on conformational epitopes on almond prunin (Pru du 6). To investigate these epitopes, phage display was performed using an almond-allergic patient that is highly reactive to native prunin and appeared to recognize labile epitopes. Total IgE was used to capture phage displaying 12 aa-long peptides that mimic prunin epitopes. Analysis of the IgE reactive phage sequences identified three putative conformational epitopes

(epitope #1, E49,N78, L80, L82, P83, L244, A245, N290, R312, L314, G316, N322, I325, Q326; epitope #2,

V104, F105, H190, Q191, T193, P205, A206, G207, V208, V327, R328, G329, N330, L331, D332, F333; epitope

#3, H227,S229, S230, D231, H232, F411, W431, V433, N434, H436, V451, Q473, N474, H475, G476, T493, N496,

A497, F498, L502. One of these epitopes (#3) partially overlaps a sequential epitope previously identified by the solid-phase peptide SPOTs assay. The identification of multiple conformational epitopes and the observation that treatment with reducing agents affected the binding of IgE from some almond-sensitized patients suggests an important role for conformational epitopes on prunin.

Methods

Human Sera Blood samples were obtained from patients with convincing histories of almond allergy, after informed consent, or were purchased from PlasmaLab International (Everett, WA, USA). The study was approved by the human subjects review committee of University of California, Davis (Davis, CA) and Florida State University. Sera were frozen at -80°C until use. The presence of almond-reactive IgE was confirmed by Pharmacia ImmunoCAP assay (Pharmacia Diagnostics, Uppsala, Sweden) or RAST. Atopic control serum was obtained from a patient with a history of asthma and dust mite allergy but who was not food-allergic. Clinical

35 characteristics of the subjects are shown in Table 3.1. The patients chosen for study were those that reacted with native prunin and rPru du 6.01/6.02 in immunodot blot assays [97].

Table 3.1 Clinical characteristics of almond-allergic subjects

Serum Sex/Age Age of onset 1Other Atopy Other food allergy 2ImmunoCap or No. RAST to almond extract 8 F/43 1 AD, AR, As Peanut, tree nuts Class 5 9 F/34 1 AD,AR, As Walnut, cashew, pecan Class 3 14 F/38 5 As as a child Cashew, pistachio, brazil nut, 1.9 walnut 29 F/49 3 AD, AR, As Peanut, sesame, tree nut <0.35 44 M/30 child AD as child, AR, As Never eaten other nuts 2.88 53 F/44 child AD, U, AR, As Egg, soybean, crab, shrimp, 15.8 tomato, beef, pork, carrot, potato, coconut, apple, milk, peach 55 M/39 10 U, AE Meat, egg, peanut, soybean, 9.05 hazelnut, brazil nut, fish, shellfish, carrot, orange, apple, corn, potato, coconut, rice 1AD = Atopic dermatitis; AR = allergic rhinitis; As = Asthma; AE = angioedema; U = urticaria 2ImmunoCAP results are shown as kU/1, RAST as class.

Almond protein extract Almond protein extracts were obtained from defatted almond flour by extraction with

buffered saline borate (BSB) pH 8.2 (0.1 M H3BO3, 0.025 M Na2B4O7, 0.075 M NaCl) at room temperature (RT) for 1 hour (hr) and stored at -20°C for later analysis as previously described [99].

Purification of total IgE Total IgE was purified from Plasma Lab patient #55. Briefly, BrCN-activated Sepharose 4B beads (Sigma Aldrich) were rehydrated and washed 3X with 1 mM HCL, then incubated with 100 μg of mouse anti-human IgE (ABR Affinity Bioreagents, Rockford, IL) in PBS for 2 hr at RT with rotation. Unbound reactive sites were blocked using 0.2 M glycine for 20 min at RT with rotation. Then, the matrix was packed into a column and equilibrated with PBS buffer. Ten milliliters (diluted 1:1 with PBS and pre-centrifuged a 10,000 g for 10 min) of serum from patient #55 was applied to the affinity column. The effluent was collected and passed over the beads a second time, then stored in a 15 mL conical tube. The column was washed 10X with PBS to remove any residual unbound proteins. After washing, bound IgE was eluted using 0.2 mM glycine sulfate at pH 2.3. The eluate was equilibrated with 1 M Tris to raise the pH to 8.

The IgE eluate was collected/concentrated using a tube and Amicon Ultra 30,000 MWCO (Millipore Co.) passivated with 1% BSA in PBS overnight at 4°C to prevent any nonspecific adsorption of purified IgE.

Enzyme linked immunosorbent assay (ELISA) The purity of the total IgE fraction was tested by ELISA to verify separation of this antibody population. Total IgE (β μg/mL) diluted in coating buffer (0.1 μg/mL in 0.1 M

NaHCO3, pH 8.6) was coated on the solid phase. Wells were blocked with phosphate buffered saline-Tween 20 (PBS-T)/5% (v/w) nonfat dry milk for 1 hr at 37ºC, washed 6X with PBS-T, and probed with HRP-conjugated mouse anti-human IgE (Zymed Laboratories, Inc.) at a dilution of 1:1000. Wells were washed again as described above. Reactivity was detected by

colorimetric reaction using o-phenylenediamine (Zymed Laboratories Inc) and H2O2 as substrate. OD was measured in a KC4 v2.5 ELISA reader (Bio-Tek Instruments Inc, Winooski, Vt) at 495 nm.

Polyacrylamide gel electrophoresis (PAGE) Total IgE from patient # 55 (5 μg per 4mm well width) or unpurified serum (1:β0 (v/v) per 4mm well width) was subjected to SDS-PAGE (12%). Samples were boiled for 5 min in reducing sample buffer containing -mercaptoethanol, subjected to electrophoresis and stained with Coomassie Brilliant Blue R (Sigma-Aldrich, St. Louis, MO).

Purification of native prunin Native prunin was purified Girdhari M. Sharma and Mengna Su from aqueous almond extract by column chromatography as previously described [42]. Fractions containing prunin were collected, concentrated, and stored at −β0°C until further use. To obtain hexameric native prunin oligomers, size exclusion chromatography was performed using a Sephacryl S200 HR column equilibrated with BSB pH 8.2. The column flow rate was maintained at 0.4 mL/min, and fractions were collected every 1 min. Protein elution was monitored by UV absorbance at 280 nm. Fractions containing high molecular weight proteins were concentrated using Amicon Ultra 30,000 MWCO.

Native PAGE The purity of the prunin fractions obtained by size exclusion chromatography was assayed by native PAGE using an 8% gel. The gel was pre-run with 25 mM Tris and 192 mM glycine, pH 8.4 with and without 1% deoxycholate (DOC) in the cathode and anode chamber, respectively, for 30 min at 40 mA. Samples in the native sample buffer (15 µg protein, 62.5 mM Tris-Cl, pH 6.8, 15% glycerol and 1% bromophenol blue) were applied to the gel and electrophoresed for 3 hrs at 25 mA, then stained with Coomassie Brilliant Blue R (Sigma- Aldrich).

Immunodot blot testing for IgE epitope conformational sensitivity Native prunin, rPru du 6.01, or rPru du 6.0β (1 μg) were either boiled for 5 min in reducing sample buffer (70 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.05% bromophenol blue, and 5% -mercaptoethanol) or were diluted in 100 μl Tris buffered saline (TBS) (β0 mM Tris, 137 mM NaCl, pH 7.6) containing either 10% SDS or 6 M urea, and maintained at RT for 10 min. Samples were then dotted onto nitrocellulose membrane (NC) for use in IgE immunodot blot assays as described below.

Immunodot blot analysis Native prunin, rPru du 6, MBP, and almond protein extract were applied to NC using a 96-well Bio-Dot Microfiltration Apparatus (BioRad Laboratories) as previously described [93]. Briefly, native prunin and almond extract (0.γ μg per βmm dot), and rPru du 6 and MBP (0.6 μg per 2mm dot) were applied to NC and strips blocked overnight (o/n) at 4°C using phosphate buffered saline-Tween 20 (PBS-T)/5% (v/w) nonfat dry milk. Dots were incubated with individual sera or pooled patient sera (Pru du 6.01-reactive patients #9, 14, 33, 44, 51, 55, Pru du 6.02-reactive patients #9, 51, 53, 55) diluted 1:3 (v/v) o/n at 4°C, washed 3X for 30 min at RT in PBS-T, and incubated o/n at 4°C with 125I-labeled anti-human IgE (Specific IgE Tracer, Hycor Biomedical Inc, Garden Grove, CA) diluted 1:10 in PBS-T/5% (w/v) nonfat dry milk. Membranes were washed again as above and signal intensity was determined after a 10 day exposure to Kodak Biomax X-ray film (Kodak X-OMAT, Kodak Molecular Imaging, New Haven, CT) at –80°C.

Selection of phage-displayed IgE epitope mimicking peptides The Ph.D-12 Phage Display Peptide Library kit (1 x 1013 clones; New England Biolabs, Ipswich, MA) was used to select phage that bind purified total IgE from patient #55 according to the manufactures instructions. Three successive rounds of panning were performed. Briefly, microtiter wells were coated with 50 μg/mL (round one), β5 μg/mL (round two), and 15 μg/mL (round three) of purified IgE antibodies in 0.1 M NaHCO3 pH 8.6 o/n at 4ºC, then blocked with

0.1 M NaHCO3, 5 mg/mL BSA pH 8.6 for 2 hr at 4ºC. Wells were washed 6X with TBS-T (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% (v/v) Tween 20) then incubated with 100 µl of diluted phages (2 x 1011) in TBS-T for 60 min at RT. Wells were washed 10X with TBS-T. Bound phage were eluated with 100 μg/mL native prunin in TBS. The eluted phage were titered 1 4 using the E. coli host strain ER2738 at OD600=0.5. Eluted phage were diluted 10 -10 for all panning rounds and 10 µl of phage were incubated with 200 µl of host cells for 5 min at RT. Infected cells were mixed with top agar (10g Bacto tryptone, 5 g yeast extract, 5 g NaCl, 7 g Bacto-Agar) and poured onto LB/IPTG/XGAL plates and incubated o/n at 37ºC. Blue plaques were counted and the number of plaques was multiplied by the dilution factor to determine the plaque forming units (pfu) per 10 µl. The remaining phage eluate from all panning rounds were amplified using ER2738 at OD600 = 0.01-0.05 and incubated for 4.5 hrs at 37ºC. Infected cells were spun down for 10 min at 12,000 g and precipitated with 20% polyethylene glycol (PEG)/2.5 M NaCl o/n at 4ºC. In the morning the PEG precipitated was spun down at 12,000 g for 15 min and phage were resuspended in 1 mL TBS. Phage were re-precipitated by adding 1/6 the volume of 20% PEG/2.5 M NaCl and incubated on ice for 1 hr, spun at 14,000 g for 10 min and suspended in 200 µl TBS. Amplified phage were either used for the next round of panning or stored at -20ºC. After three rounds of panning, 40 phage clones were sequenced and the enrichment of prunin specific phage was verified by capture ELISA as described below.

Phage capture ELISA and competitive elution assays After three rounds of panning the specificity of IgE reactive phage were confirmed by capture ELISA assay. Total IgE (15 µg/mL) was coated in microtiter wells in 0.1 M NaHCO3 pH 8.6 o/n at 4ºC and blocked with TBS/1% dry nonfat milk for 2 hr at RT. Wells were incubated with 100 µl of IgE-reactive phage obtained in round three panning for 1 hr at RT, and then washed 10X with TBS-T. Bound phage were detected with anti-M13-peroxidase-

39 congugated monoclonal antibody (GE Healthcare Bioscience, Piscataway, NJ) at 1:5000 dilution for 1 hr at RT. Wells were washed as described above with TBS-T and reactivity detected by colorimetric reaction using o-phenylenediamine (OPD, Zymed Laboratories Inc.) and H2O2 as substrate. Optical density (OD) was measured in a KC4 v2.5 ELISA reader at 495 nm. All assays were performed in duplicate. For competitive elution assays, bound phage were competitively eluted using native prunin at 110 μg/mL, ββ0 μg/mL, and 440 μg/mL for 1.5 hr at RT. Bound phages were detected as described above.

Phage DNA precipitation and sequencing Individual IgE-reactive phage were plaque picked, amplified (described above), and 500 µl of phage containing supernatant were incubated with 20% PEG/2.5 M NaCl for 20 min at RT, and then spun down at 14,000 rpm for 10 min at 4ºC. Phage pellets were resuspended in 100 µl iodide buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI). Two hundred and fifty µl of ethanol was added, and the solution incubated for 20 min at RT. The solution was spun down and the pellet was resuspended in 30 µl TE buffer. DNA sequencing was performed on an ABI γ100 Genetic Analyzer (Applied Biosystems) using the specific 96 gIII sequencing primer: 5’- HOCCCTCATAGTTAGCGTAACG-γ’ provided by the manufacturer (New England Biolabs).

Mimotope sequence location on the structure of prunin (Pru du 6) The obtained phage sequences were analyzed using the online program Pepitope (http://pepitope.tau.ac.il/) as previously described [62]. Phage sequences were aligned onto the crystal structure of prunin, PDB 3FZ3 [49] by identifying areas with similar physiochemical properties and similar spatial organization. For analysis, the NNK library type, BLOSUM62 substitution matrix, -0.5 gap matrix, and the combined algorithm were used. The combined algorithm utilizes both the Pepsurf and Mapitope algorithms, to analyze phage sequences. Pepsurf mapped the affinity selected peptides onto the 3D surface of prunin. Mapitope identified amino acids pairs overrepresented in the phage sequences and then identified regions containing these residues on the surface of prunin. Regions identified by both the Pepsurf and Mapitope algorithms were considered to be an epitope on prunin.

Molecular modeling Molecular modeling was performed using chimera 1.6.1 (http://www.cgl.ucsf.edu/chimera/) and the prunin crystal structure (PDB# 3FZ3) [49].

Solid-phase peptide (SPOTs) synthesis and detection of IgE binding Peptides corresponding to the putative conformational epitopes (ENLLPLANRLGNIQ, VFHQTPAGVVRGNLDF, HSSDHGWVNHVQNHGTNAFL) were purchased from Sigma- Genosys (The Woodlands, Texas, US). Additionally, randomized amino acid peptide sequences (GNQEPLNELLANLR, GPAVTFVDGLQHFRVN, QTVFGNHDLNHSHNSHWAVF) derived from the amino acid composition of the three identified epitope sequences were also generated to serve as negative controls. A spacer of two ß–alanines was added between each of the peptides and cellulose membrane. The peptide purity was >70% by HPLC and mass spectroscopy according to the manufacturer. The peptide-containing cellulose membranes were probed as previously described [101].

Denaturation assay to remove sequential epitope binding IgE Sequential epitope-binding IgE was removed from Pru du 6-reactive sera through a negative selection process. Native prunin (30 μg) was either boiled for 5 min in reducing sample buffer or diluted in 100 μl TBS containing 6 M urea, and maintained at RT for 10 min. Samples were then dotted onto NC and strips were blocked o/n at 4°C using PBS-T/5% (v/w) nonfat dry milk. Strips were sequentially incubated with sera from patient #55 diluted 1:2 (v/v) or #8 diluted 1:10 o/n at 4°C, washed 3X for 30 min at RT in PBS-T, and incubated o/n at 4°C with 125I-labeled anti-human IgE (Specific IgE Tracer, Hycor Biomedical Inc, Garden Grove, CA) diluted 1:10 in PBS-T/5% (w/v) nonfat dry milk. Membranes were washed again as above and signal intensity was determined after a 10 day exposure to Kodak Biomax X-ray film (Kodak X- OMAT, Kodak Molecular Imaging) at –80°C. IgE directed against sequential epitopes was retained on the NC membranes and conformation epitope binding IgE in the serum supernatant. The supernatant was collected and used in ELISA assays for detection of conformational IgE (described below).

ELISA assay for the detection of conformational epitope binding IgE

Native prunin (40 µg/mL) was coated in microtiter wells in 0.1 M NaHCO3 pH 8.6 for 1 hr at 37ºC and blocked with PBS-T/5% dry nonfat milk o/n at 4ºC. Wells were incubated with 100 µl of unseparated patient serum or serum collected from the denaturation assay (described above) for 3 hr at 37 ºC, and then washed 10X with PBS-T. Bound IgE was detected with HRP- conjugated mouse anti-human IgE (Zymed Laboratories, Inc.) at a dilution of 1:1000 for 1 hr at 37 ºC. Wells were washed again as described above. Reactivity was detected by colorimetric reaction using o-phenylenediamine (Zymed Laboratories Inc) and H2O2 as substrate. OD was measured in a KC4 v2.5 ELISA reader (Bio-Tek Instruments Inc) at 495 nm. OD values obtained for the unseparated patient serum were normalized to 100% binding. The percentage of anti-sequential IgE was determined by comparison of the signal obtained from the unseparated serum and the serum collected from the denaturation assay. The reactivity was calculated as follows: (P+, patient serum collected from denaturation assay; P-, unseparated patient serum; OD, optical density). The percentage of anti-conformational epitope binding IgE was deduced by subtraction of the percentage of sequential epitope binding IgE from the unseparated patient serum normalized to 100% binding. All assays were performed in triplicate.

Inhibition (%) = OD(P-) - OD(P+) x 100 OD(P-)

Results

Conformational sensitivity of prunin IgE epitopes The stability of IgE epitopes on native prunin was tested by subjecting the protein to various denaturing conditions prior to immunodot blotting and probing with serum from reactive patients. The results show that, for several patients (#14, 44, 9, 53, and 55), denaturation with 10% SDS and reducing buffer plus boiling diminishes reactivity to native prunin, indicating the recognition of potentially labile (conformational) epitopes on the native protein (Fig. 3.1). The loss of reactivity upon reduction and heat denaturation is likely due, in part, to the dissociation of the acidic and basic chains in the native protein, indicating the recognition of conformational epitopes dependent on chain association. In contrast, patient #8 showed a similar pattern of

42 reactivity when probed against both undenatured and denatured prunin, suggesting the recognition of potentially stable (sequential) epitopes on the native protein (Fig. 3.1). Patient #29 reacted weakly with untreated native prunin only, suggesting the recognition of labile epitopes on the native protein. Overall the results indicate that both conformationally stable and labile epitopes are present on the native protein and that these epitopes are differentially targeted by IgE from individual patients.

Fig. 3.1. Immunodot blot of native prunin treated with denaturing reagents and probed with individual prunin- reactive sera. None = no treatment, Red. + boil = reducing buffer + boiling, Alm Ext. = almond extract, NC = atopic serum negative control.

Affinity purification of total IgE IgE from patient #55 was used as the target antibody for the phage biopanning assays. This patient was chosen based on two features, first the availability of large amounts of serum and second, conformational sensitivity assays have indicated the presence of IgE in the serum directed against conformational epitopes on native prunin (Fig. 3.1). Ninety µg of IgE was purified from a 10 ml serum sample by affinity chromatography. The purity was checked by Coomassie Blue-stained SDS-PAGE gel (Fig. 3.2A) and specificity was confirmed in ELISA assays using anti-human IgE antibodies (Fig. 3.2B).

Identification of conformational IgE binding epitopes by phage display Native prunin, like other 11S globulins, is biosynthesized as a large proprotein that is posttranslationally cleaved into the larger acidic (367 aa) and smaller basic (184 aa) subunits that remain associated via disulfide bonds [39;40;49;135]. The uncleaved proprotein normally forms trimers which, upon cleavage by asparaginyl endopeptidase, dimerizes via association of the

43 hydrophobic faces (IE face) to form the mature hexameric protein. The hexameric fraction of prunin (F26-30) was purified by size exclusion chromatography and observed by a Coomassie Blue stained native-PAGE gel (Fig. 3.3). The use of the hexameric fraction in phage display ensured that prunin was in the antigenically optimum form to express the complete set of IgE epitopes. This is the likely form that individuals encounter during sensitization.

A B

Reactivity of fractionated serum

2.5

1.5

nm 495 OD 0.5 0 Total IgE Eluate Effluent Unpurified serum

Fig. 3.2. SDS-PAGE and ELISA assays. A) Coomassie Blue stain of affinity chromatography purified IgE from patient #55. B) ELISA assay testing for the presence of total IgE in the purified eluate and effluent collected from patient #55 by affinity chromatography. M= molecular weight marker.

Fig. 3.3. Coomassie Blue stained native-PAGE gel of prunin fractions obtained by size exclusion chromatography. F#=fractions collected during size exclusion chromatography. nPru= native prunin, WA= whole almond extract, HMW= high molecular weight marker, LMW=low molecular weight marker.

Conformational epitopes were identified by screening a phage display peptide library containing random dodecapeptides, displayed on the M13 phage surface via the pIII coat protein, with total IgE from patient #55. The IgE-reactive phage were competitively eluted using the hexameric fraction of prunin. After three rounds of panning an enrichment of IgE reactive phage was observed (Fig. 3.4).

Patient #55 phage display panning

Round 1 Round 2 Round 3 2.1 x 105 2.2 x 105 2 x 106

Fig. 3.4. The selective enrichment of phage (pfu/mL) during successive panning rounds.

An ELISA assay was performed to determine if the selected phage are mimicking an epitope expressed on native prunin. Total IgE was coated on the solid phase and reactive phage were competitively eluted using increasing concentrations of prunin (Fig. 3.5). An 89% reduction in phage binding was observed after incubation with the native antigen (ββ0 μg/mL). This result suggests that the phage obtained in the panning assays truly mimic epitopes expressed on prunin.

% phage binding to solid phase IgE

0% Phage only Ag 110 ug/mL Ag 220 ug/mL Ag 440 ug/mL

Fig. 3.5. ELISA demonstrating the ability of native prunin to competitively elute phage bound to total IgE. Ag = native prunin.

A total of the 40 IgE-reactive phage were sequenced and 12 unique phage sequences were obtained (Fig. 3.6). To deduce the potential mimotope sequence/s, the free online program Pepitope was utilized to group the corresponding phage sequences according to their observed frequency and physiochemical features. Three mimotope clusters were found and the corresponding putative prunin epitopes identified (Fig. 3.6). Although these epitopes appear to be in close proximity on the prunin surface, they are quite distant from each other on the primary sequence (yellow epitope, E49,N78, L80, L82, P83, L244, A245, N290, R312, L314, G316, N322, I325, Q326;

purple epitope, V104, F105, H190, Q191, T193, P205, A206, G207, V208, V327, R328, G329, N330, L331, D332,

F333; blue epitope, H227,S229, S230, D231, H232, F411, W431, V433, N434, H436, V451, Q473, N474, H475,

G476, T493, N496, A497, F498, L502) (Fig. 3.7).

Fig. 3.6. Analysis of IgE reactive phage sequences by Pepitope and the identification of putative conformational IgE binding epitopes on prunin (Pru du 6).

Fig. 3.7. Molecular models of prunin (Pru du 6) trimers using the crystal structure of prunin (PDB# 3FZ3) [49]. Surface rendering on one monomer/subunit is shown in grey with the putative conformational epitopes highlighted in colors (yellow, purple, and blue).

Solid-phase peptide (SPOT) IgE binding assay IgE reactivity to the putative conformational epitopes was further assessed in a solid- phase peptide binding (SPOT) assay. Peptides corresponding to the identified epitopes (strip 1) and corresponding randomized amino acid peptide sequences (strip 2) were generated and screened with serum from patient #55 (Fig. 3.8). A positive control (PC) comprised of native prunin tested positive for IgE binding. No IgE binding was observed against the conformational epitope ENLLPLANRLGNIQ or the corresponding randomized peptide sequence GNQEPLNELLANLR (strips 1 and 2, Fig. 3.8). The lack of IgE reactivity is likely due to the improper folding/conformation of the epitope which would negatively affect antibody recognition and binding. Moderate reactivity was detected against the conformational epitope VFHQTPAGVVRGNLDF, as compared to its corresponding randomized control peptide GPAVTFVDGLQHFRVN, thus confirming that this peptide mimics an IgE Pru du 6 epitope (Fig. 3.8). Strong reactivity was detected against the conformational epitope HSSDHGWVNHVQNHGTNAFL. However even stronger reactivity was observed against the randomized control peptide QTVFGNHDLNHSHNSHWAVF, indicating that the IgE recognition observed is likely nonspecific in nature (Fig. 3.8).

Fig. 3.8. SPOTs assay using solid phase peptides probed with patient #55. Strip 1, peptides corresponding to the putative conformational epitopes identified by the phage display; strip 2, randomized peptide sequences serving as a negative control; PC, native prunin.

Denaturation assay to test for the presence of conformational and sequential epitope-binding IgE As IgE is a polyclonal in nature, it is likely that a mixed population of IgE antibodies is present in sensitized individuals directed against both sequential and conformational epitopes. To evaluate the IgE population in our Pru du 6 sensitized patients, a series of panning assays was preformed. The panning assay utilized a negative selection approach in which the anti-sequential IgE is removed from the pooled serum by reaction with denatured recombinant Pru du 6 spotted

47 onto nitrocellulose (strips 1-2, Fig. 3.9). This was followed by incubation with strips containing undenatured Pru du 6 in an immunodot blot assay to detect the presence of IgE directed against conformational epitopes (strip 3, Fig. 3.9). As a control, denatured Pru du 6 was also spotted onto strip 3 to ensure all anti-sequential IgE was removed during the initial panning steps (strips 1-2). Treatment of rPru du 6.01 with 6 M urea and reducing buffer plus boiling had little effect on IgE reactivity indicating the recognition of stable sequential epitopes on the protein as denaturation did not adversely affect binding (strips 1 and 2, Fig. 3.9). Similarly, IgE reactivity to rPru du 6.02 was observed when treated with 6 M urea and 10% SDS (strips 1 and 2, Fig. 3.9). These results correlate with those collected in the sequential epitope mapping studies as multiple IgE binding epitopes were identified on the Pru du 6 proteins (Chapter 2, Fig. 2.4 and Table 2.2). Subsequent probing of pooled sera against untreated rPru du 6 found IgE reactivity directed against the conformationally intact protein, indicating the presence of IgE directed against potentially labile epitopes on the protein (strip 3, Fig. 3.9). Overall, this preliminary panning assay indicates the presence of IgE directed against both sequential and conformational IgE binding epitopes on the Pru du 6 proteins.

Fig. 3.9. Panning assay to detect the presence of sequential and conformational IgE-binding epitopes on recombinant Pru du 6. Pooled sera (Pru du 6.01-reactive patients #9, 14, 33, 44, 51, 55; Pru du 6.02-reactive patients #9, 51, 53, 55) were incubated stepwise with strips containing denatured Pru du 6 proteins (strips 1-2), and then with undenatured Pru du 6 (strip 3). MBP = maltose binding protein, Red. +boil = reducing buffer plus boiling.

Negative selection assay to separate and quantify conformational and sequential epitope binding IgE A negative selection assay was designed to determine the percentage of conformational and sequential epitope binding IgE (Fig. 3.10). The assay utilized a selection approach in which

48 the anti-sequential IgE was removed from individual serum by solid-phase adsorption using denatured prunin dotted onto NC. This was followed by an ELISA assay using undenatured prunin to detect the presence of IgE directed against conformational epitopes (Fig. 3.10). Comparison of signals obtained from the unpurified patient serum with those from serum used in the denaturation immunodot adsorptions (containing only conformational antibodies) allowed the relative percentage of conformational and sequential epitope binding IgE to be determined.

Denatured prunin

Native prunin Conformational IgE

Sequential IgE ELISA DATA

Unbound Abs Add Ab sample are collected

ELISA assays Comparison of Denatured prunin Abs recognizing using prunin signal from bound to sequential probed with unpurified serum nitrocellulose epitopes bind unbound Abs with unbound conformational Ab sample

Fig. 3.10. Schematic representation of the negative selection assay used to separate and quantify the presence of conformational and sequential epitope binding IgE.

Patients’ sera were selected for analysis based on their previous use in denaturation immunodot blots and availability of sufficient serum to complete the assays (Fig. 3.1). Based on these results, patient #55 appeared to recognize predominantly conformational epitopes on prunin whereas #8 recognized predominantly sequential epitopes. Sequential epitope-binding IgE was depleted by solid-phase adsorption using denatured prunin dotted onto NC (Fig. 3.11A). All sequential epitope-binding IgE was depleted by strip 6 for patient #55 and by strip 8 for patient #8 (Fig. 3.11). Subsequent probing of patient #55 and #8 against undenatured prunin in an ELISA detected the presence of IgE directed against conformational epitopes (Fig. 3.11). Comparison of reactivity with the unpurified serum sample allowed the relative percentage of conformational and sequential epitope binding IgE to be determined. Patient #55 was found to have 77% of IgE directed against conformational epitopes and 23% directed against sequential epitopes on prunin (Fig. 3.11). In contrast, patient # 8 was found to have 53% of IgE directed against conformational epitopes and 47% directed against sequential epitopes (Fig. 3. 11).

Overall, these results are similar to the reactivity observed in the denaturation immunodot blot assay indicating that the negative selection assay can effectively separate and quantify conformational/sequential epitope binding IgE in prunin-sensitized patients.

% conformational vs. sequential epitope-binding IgE patient #55 % conformational vs. sequential epitope-binding IgE patient #8

100% 100% 90% 90% 80% 80% 70% 70% 60% 60% 50% 50% 40% 40%

%reactivity 30% 30% 20% %reactivity 20% 10% 10% 0% Conformational IgE binding Sequential IgE binding epitopes Total IgE binding epitopes 0% epitopes Conformational IgE binding epitopes Sequential IgE binding epitopes Total IgE binding epitopes

Fig 3.11. Negative selection assay to determine the relative percentage of conformational and sequential epitope- binding IgE in Pru du 6-sensitized individuals. A) Removal of sequential epitope-binding IgE from patient # 55 and #8 by solid-phase adsorption using denatured prunin spotted onto nitrocellulose. B) ELISA assay demonstrating the percentage of conformational vs. sequential epitope-binding IgE. NC = atopic serum negative control.

Discussion

Allergies have become a growing problem in industrialized countries and it is estimated that 0.6 % of the population is allergic to one or more nuts [19;20;91]. The identification of IgE binding epitopes, both conformational and sequential, is critical for understanding the etiology of food allergy and for the future development of immunotherapies for the treatment of food allergies. To date, a limited number of conformational epitopes have been identified on food allergens. This is largely due to their dependence upon the structure of the allergen and the assumption that sequential epitopes predominate on these molecules as they undergo extensive digestion before interacting with the immune cells [4;50;52;53]. However, a vast majority of B cell epitopes are thought to be conformational in nature as antibodies raised against the intact protein are often unreactive to short peptide fragments [53;126;129]. Therefore, it is critical to

50 identify and characterize these epitopes and determine their relative contribution to the total epitope profile. Recent studies using the peanut allergen, Ara h 1, found that the allergen was fragmented into peptides < 2kDa during simulated in vitro gastrointestinal digestion [136]. These peptide fragments condensed into aggregates of up to 20 kDa that were capable of inducing specific IgG and IgE antibodies in rats [136]. These results suggest that gastrointestinal digestion does not necessarily eliminate the sensitizing potential of the allergen [136]. Additional studies identified five conformational epitopes on Ara h 1 which were localized in three distinct areas on the 3D molecule [133]. This epitope pattern was similar for both intact and in vitro-digested Ara h 1, suggesting that these regions remain in a conformation resembling the native structure during the digestion process [133]. The findings from these studies support the presence of conformational epitopes and indicate their importance on food allergens. A variety of methods are available to identify conformational epitopes such as large scale mutagenesis, X-ray crystallography of immune complexes, nuclear magnetic resonance (NMR), phage display, or the generation of chimeric molecules [52;124]. However, many of these techniques require homogeneous preparations of allergen-specific IgE, suitable crystal formation, or extensive sample preparation and analysis, which often limits their use. Phage display technology has become a popular technique for epitope mapping studies as it utilizes small amounts of allergen-specific IgE, is cost effective and a relatively straightforward procedure [57;65;66;132;133;134]. Analysis of IgE antibodies directed against the melon allergen, Cuc m 2 (profilin), identified a conformational epitope composed of the two helical regions and a loop region which partially overlapped with the actin binding domain [132]. Similarly, studies done on parvalbumin, a major fish allergen, identified three conformational epitope regions which were located in EF domain and the axis joining the CD and EF-hand [66]. Comparison of the epitope recognized by a monoclonal antibody directed against the cockroach allergen, Bla g 2 (aspartic protease), using phage display found that it correlated with the residues identified by X-ray crystallography of the allergen-Fab complex [134]. These studies demonstrate the utility of phage display for epitope mapping and validate the application of this technique for mapping the more difficult-to-identify conformational epitopes. Tree nut allergens are classified as type 1 food allergens as sensitization typically occurs through the gastrointestinal tract. Tree nuts can cause severe life threatening reactions [137;138;139]. Sequential epitopes are believed to be prevalent on type I food allergens as they

51 can remain intact, unlike many conformational epitopes, after extensive food processing and gastric digestion [50]. To date, most studies done on tree nut allergens has been focused on the identification of sequential IgE binding epitopes as they are relatively easy to identify by probing short synthetic peptides with serum from sensitized individuals [50]. Sequential IgE binding epitopes have been described on pecan (Car i 1and 4) [140;141], cashew (Ana o 1, 2, 3) [29;98;142], walnut (Jug r 1 and 4) [101;102;111], hazelnut (Cor a 9) [102], and almond (Pru du 6) [97]. Several studies have focused on comparing the sequential epitopes identified on tree nut allergens with the hopes of establishing patterns of recognition and common features which may predispose such proteins to be targeted by IgE [97;102;140;141;143;144]. In contrast, few studies have focused on conformational epitopes (due to the reasons listed above). To date, only one IgE binding epitope has been identified on the Brazil nut allergen, Ber e 1, and a murine monoclonal IgG-binding epitope has been identified on the cashew allergen, Ana o 2 [127;130;131]. To further expand our knowledge of conformational epitopes on tree nut allergens we sought to investigate these epitopes on the almond allergen, prunin (Pru du 6). This allergen was selected for study as it is a major allergen and is a seed storage protein which is abundant in the nut. Phage display using total IgE purified from an prunin-sensitized individual (patient #55) identified three putative conformational epitopes on prunin (epitope #1, E49,N78, L80, L82, P83,

L244, A245, N290, R312, L314, G316, N322, I325, Q326; epitope #2, V104, F105, H190, Q191, T193, P205, A206,

G207, V208, V327, R328, G329, N330, L331, D332, F333; epitope #3, H227,S229, S230, D231, H232, F411,

W431, V433, N434, H436, V451, Q473, N474, H475, G476, T493, N496, A497, F498, L502) (Fig. 3.2 and 3.6). Comparison of these epitopes with those identified by SPOTs found that epitope # 3 overlapped

with the sequential epitope 225LFHVSSDHNQLDQNP239 [97]. This overlap could be due to the fact that individual epitopes may have a mixture of both conformational and sequential characteristics as short stretches of continuous residues may be part of more complex conformational epitopes [121;129]. Solid phase peptides corresponding to the identified epitopes were assayed for IgE reactivity (Fig. 3.8). Reactivity was specific in nature for epitope # 2 further indicating that this peptide is a likely epitope on prunin. Reactivity to both epitope # 3 and the random control peptide was observed suggesting that recognition is less sequence-specific and based more on charge and amino acid properties. In contrast, no reactivity was observed to epitope #1, which is

52 likely due to the improper folding and presentation of the epitope peptide which affected IgE recognition and binding. The generation of chimeric molecules would allow further assessment of these epitopes by analyzing IgE binding when presented on the backbone of a non-allergic 11S molecule. However, because of extensive cross-reactivity, a suitable chimera partner could not be identified as patient #55 was sensitized to a variety of legumes and seeds (amaranth, pumpkin, soybean, coconut, peanut, chestnut, and sunflower). The polyclonality of an IgE response likely leads to the generation of a mixed population of antibodies, which can be directed against sequential or conformational epitopes on the offending allergen. The relative contribution of each epitope type to food protein allergenicity has been debated in recent years. With respect to allergens, there is a commonly held belief that sequential epitopes predominate on type 1 food allergens, since these proteins are commonly subjected to both food processing and gastric digestion before interacting with the immune system [50]. In contrast, conformational epitopes are thought to be more prevalent on type 2 allergens such as aeroallergens (pollens or pet dander) which sensitize directly through the respiratory mucosa [50]. However, it is possible that digestion and food processing of allergens may yield conformationally stable fragments that retain sufficient structure to display conformational epitopes during passage through the gut mucosa and interaction with immune cells [51;133;145;146]. To investigate the presence of IgE directed against the two epitope types on prunin, a denaturation assay was performed (Fig. 3.9). Reactivity was observed to both the denatured and undenatured Pru du 6 proteins, indicating the presence of IgE directed against both sequential and conformational epitopes (Fig. 3.9). The relative amounts of the IgE directed against conformational vs. sequential epitopes in individual patients was analyzed using a negative selection assay followed by ELISA (Fig. 3.10). For the two patients used (patient #8 and #55) the results were similar to the reactivity observed in the denaturation immunodot blot assay, indicating that this assay can effectively separate and quantify conformational/sequential epitope binding IgE in our prunin-sensitized individuals. Additional patients should be analyzed using this assay in order to obtain an average % conformational and % sequential epitope- binding IgE for a population of prunin (Pru du 6) sensitized patients. In summary, this is the first study to use phage display to identify conformational epitopes on a tree nut allergen. A total of three putative conformational epitopes were identified on prunin (Pru du 6) and localized on the crystal structure. We also demonstrated the presence

53 of IgE antibodies directed against both conformational and sequential epitopes in prunin (Pru du 6)-sensitized individuals. An assay was designed to determine the relative percentage of IgE directed against each epitope type and used with selected patients. The epitope information gathered in this study may reveal characteristics associated with the severity of tree nut allergy for individual patients and indicate if the destruction of conformational epitopes is a possible option for reducing allergenicity to this tree nut allergen.

CHAPTER FOUR

MURINE MONOCLONAL ANTIBODY REACTIVITY TO PRU DU 6 AND IDENTIFICATION OF SEQUENTIAL IGG BINDING EPITOPES

Introduction

Monoclonal antibodies (mAbs) are monospecific antibodies that are produced by the fusion of a myeloma cells with the spleen cells from a mouse that has been immunized with the desired antigen [3]. Due to their monovalent affinity for a single epitope on the antigen they have become a standard reagent in both the laboratory and the clinic. They are commonly used to detect and quantify specific proteins in a complex mixture. The clinical applications of such antibodies is continuing to grow as they have been utilized in vaccine development [52], detection of food contamination [147;148], standardization of allergen extracts [149], and the therapeutic treatment of inflammation, asthma, cancer, and autoimmune diseases [150-152]. In regards to allergy, several studies have demonstrated a high degree of positional overlap between murine/rabbit IgG and human IgE binding epitopes thus indicating that mAb IgG can mimic the reactivity of human IgE [130;153;154]. A mAb directed against the cashew allergen, Ana o β, partially inhibits the binding of human IgE and patient’s IgE fully inhibits binding of the mAb to Ana o 2 indicating the overlap between one or more epitopes recognized by IgE with the mAb IgG epitope [130]. Studies analyzing rabbit IgG and human IgE directed against lipid transfer proteins (LTP) from fruits (apple Mal d 3, peach Pru p 3, apricot, and plum) found varying degrees of overlap and antibody reactivity to several of the sequential epitopes identified by probing solid-phase overlapping peptides [153]. In addition, mAbs are commonly used to test for food allergen contamination and the standardization of allergen extracts. ELISA assays using mAbs have been able to successfully detect trace amounts of peanut and hazelnut in foods as low as 0.2-1.2 mg/kg (ppm) [147;148]. The detection of the Platanus acerifolia (plane tree) pollen allergen, Pla a 1, using a mAb capture ELISA allowed the allergen to be quantified and subsequently standardized in allergen extracts used for clinical diagnosis [149]. These studies demonstrate the utility of murine/rabbit IgG as they can be a suitable surrogate for the

55 more limited patient IgE, detect trace amounts of contaminating allergens in foods, and aid in the standardization of allergen extracts for clinical diagnosis. These uses demonstrate the need to characterize and map the IgG binding epitopes recognized by mAbs on their target antigen. To date, extensive information is known about the IgE binding epitopes on Pru du 6 as both sequential and conformational epitope mapping studies have been performed. A total of six sequential epitopes have been identified on prunin isoform Pru du 6.01 and eight on Pru du 6.02 [97]. In addition, three putative conformational epitopes have been identified on Pru du 6.01 by phage display. To assess the mAb IgG binding epitopes on Pru du 6 and to determine if they overlap with the previously identified IgE binding epitopes, sequential epitope mapping studies have been performed. Analysis of IgG reactivity to solid-phase synthetic overlapping peptides corresponding to the entire Pru du 6.01 sequence identified the sequential epitopes targeted for several mAbs (4G2, aa 353LQQERQQ359; 2B4 and 5D1, aa 120QQGRQQ125). In particular, the epitope recognized by mAb 5D1 and 2B4 was found to directly overlap with a sequential IgE binding epitope on Pru du 6. The hexameric composition and the relative amounts of the Pru du 6 isoforms in the nut were assessed using mAbs and human IgE. Immunoblots and inhibition immunoblots indicate that Pru du 6.01 is the predominate isoform in the nut. This correlates with the observation that Pru du 6.01 is more widely recognized than Pru du 6.02 in the tested mAbs and patient population IgE, indicating that it is the more immunogenic of the two isoforms.

Methods

Almond protein extract Almond protein extracts were obtained from defatted almond flour by extraction with

buffered saline borate (BSB) pH 8.2 (0.1 M H3BO3, 0.025 M Na2B4O7, 0.075 M NaCl) at room temperature (RT) for 1 hour (hr) and stored at -20°C for later analysis as previously described [99].

Purification of native prunin Native prunin was purified by Girdhari M. Sharma and Mengna Su from aqueous almond extract using column chromatography as previously described [42]. Fractions containing prunin

56 were collected, dialyzed against distilled water, lyophilized, and stored at −β0°C until further use. To obtain a hexameric fraction of native prunin, gel filtration was performed with a Sephacryl S200 HR column equilibrated with BSB. The column flow rate was maintained at 0.4 mL/min, and fractions were collected at 1 min intervals. Protein elution was monitored by UV absorbance at 280 nm. Fractions containing high molecular weight proteins corresponding to the hexameric fraction (~360 kDa) were concentrated with Amicon Ultra 30,000 MWCO (Millipore Corp., Bedford, MA).

PCR amplification, DNA sequencing, cloning, expression and purification of cDNA-encoded proteins The full length prunin cDNA sequences, designated Pru du 6.01 and Pru du 6.02, and the free acidic and basic subunits were amplified, sequenced, ligated into the fusion expression vector pMAL-c4X (New England BioLabs Inc, Beverly, MA), cloned, expressed, and purified as previously described [97]. Recombinant proteins were stored at 4°C until use or, for long term storage, frozen at -80°C.

Monoclonal anti-almond antibodies (mAbs) mAbs against almond extract were raised in the Hybridoma Facility at Florida State University (FSU) using standard techniques [155]. The guidelines for animal care and welfare described in the ‘Guide for the Care and Use of Laboratory Animals’ prepared by the Institute of Laboratory Animals Resources (National Research Council, National Academy Press, revised 1996) were followed. Briefly, pairs of mice were each immunized with β5 μg of almond extract in RIBI adjuvant (RIBI ImmunoChem Research, Inc., Hamilton, MT) split between intraperitoneal and subcutaneous routes, boosted with 15 μg of almond extract in RIBI adjuvant, similarly partitioned, at three week intervals, and given a final injection of 15 μg of extract in saline equally split between the intravenous and subcutaneous routes. Following fusion, the resultant hybridomas were screened and assayed for relative strength of reactivity to almond extract by direct-binding ELISA [156]. Clones recognizing almond extract were selected and further screened for prunin protein specificity by immunoblot and immunodot blot assays.

Rabbit polyclonal antibody (pAb) production Production and characterization of rabbit polyclonal antibodies to purified prunin were generated as previously described [157]. Briefly, rabbits were immunized with native prunin using Freund's complete adjuvant. After boosting with prunin in Freund's incomplete adjuvant, the rabbits were bled, and the resultant serum was stored at −β0 °C until used.

Polyacrylamide gel electrophoresis and protein transfer Almond extract (12-14 g per 4 mm well width) was subjected to SDS-PAGE. Proteins were mixed with suitable volumes of reducing sample buffer (70 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.05% bromophenol blue and 5% -mercaptoethanol) or non-reducing sample buffer (70 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.05% bromophenol blue), heated for 5 min in a boiling water bath, then cooled to RT. Samples were electrophoresed on a 12% acrylamide separating gel with a 4% acrylamide stacking gel for 1.5 hr at 130 V. Gels were either stained with Coomassie Brilliant Blue R (Sigma-Aldrich, St. Louis, MO) or transferred to nitrocellulose (NC) membranes as previously described [100].

MAb immunoblotting and inhibition Nitrocellulose (NC) strips (4 mm wide) from gel transfers containing 12 to 14 g of almond nut protein extract were probed with the almond-specific mAbs. Strips were blocked overnight (o/n) at 4°C using phosphate buffered saline-Tween 20 (PBS-T)/5% (v/w) nonfat dry milk, then incubated with selected mAbs diluted (1:20, 1:200, 1:400, 1:500 or 1:1000) in PBS-T for 1 hr at RT. Strips were washed with PBS-T for 1 hr at RT and were then incubated with horse radish peroxidase (HRP)-labeled goat anti-mouse reagent (Jackson Immunoresearch Laboratories Inc., West Grove, PA) at a 1:80,000 v/v dilution in PBS-T for 1 hr at RT, and washed as above. Amersham ECL (GE Healthcare, Piscataway, NJ) was used to detect reactivity upon exposure of strips to Kodak XAR film (Kodak Molecular Imaging, New Haven, CT). For inhibition immunoblots, almond-specific mAbs were pre-incubated with 150 g/mL of rPru du 6.01, rPru du 6.02 or 60 g/mL of native prunin inhibitor at RT for 1 hr and used as described above. Controls included strips exposed to murine mAbs without inhibitor.

MAb immunodot blotting Recombinant Pru du 6.01 and Pru du 6.02 fusion proteins, native prunin, MBP, and almond protein extract were applied to NC membranes using a 96-well Bio-Dot Microfiltration Apparatus (BioRad Laboratories) as previously described [93]. Briefly, recombinant proteins (0.6 g per 2 mm dot), native prunin and almond extract (0.3 g per 2mm dot), and MBP (0.6 g per 2mm dot) were applied to NC and strips blocked o/n at 4°C using PBS-T/5% (v/w) nonfat dry milk. Dots were incubated with the almond-specific mAbs, diluted 1:400 or 1:500 in TBS-T, at RT for 1 hr, washed for 1 hr at RT in PBS-T, and incubated with horse radish peroxidase (HRP)-labeled goat anti-mouse reagent (Jackson Immunoresearch Laboratories Inc.) at a 1:80,000 v/v dilution in PBS-T for 1 hr at RT, and washed as above. Amersham ECL (GE Healthcare) was used to detect reactivity upon exposure of dot strips to Kodak XAR film (Kodak Molecular Imaging).

Immunodot blot testing for monoclonal antibody IgG epitope conformational sensitivity Native prunin (1 g) was either boiled for 5 min in reducing sample buffer (70 mM Tris- HCl, pH 6.8, 10% glycerol, 2% SDS, 0.05% bromophenol blue, and 5% -mercaptoethanol) or were diluted in 100 l Tris buffered saline (TBS) (20 mM Tris, 137 mM NaCl, pH 7.6) containing either 10%, 1%, 0.1% SDS or 6 M, 1 M, 0.1 M urea and maintained at RT for 10 min. Samples were then dotted onto NC and probed in immunodot blotting assays as described above.

Two dimensional (2-D) gel electrophoresis, pAb immunoblotting and inhibition Two-dimensional gel electrophoresis was performed using PROTEAN® i1β™ IEF Cell and the Mini-PROTEAN® Tetra Cell (Bio Rad, Hercules, CA). The almond extract samples (200 µg in 20 µl) were diluted in 130 µl of sample rehydration buffer (8 M urea, 2% CHAPS, 50 mM DTT, 0.2% Bio-Lyte® 3-10 ampholyte, 0.001% Bromophenol Blue) and then applied to an immobilized pH gradient gel strip (ReadyStrip™ IPG strips 7 cm, pH γ-10 NL, Bio Rad) by active rehydration o/n at RT. Isoelectric focusing (IEF) was performed using the PROTEAN® i1β™ IEF Cell (Bio Rad) as described by the manufacturer. The second dimension electrophoresis was performed using 12% polyacrylamide gels in a Mini-PROTEAN® Tetra Cell (Bio Rad) as described by the manufacturer. The 2-DE gel was either stained with Coomassie Brilliant Blue R (Sigma-Aldrich) or transferred to 0.45 µM NC as previously described [100].

NC membranes were probed in immunoblotting assays using rabbit anti-prunin serum diluted 1:50,000 and binding was detected using HRP-labeled goat anti-rabbit reagent (Promega, Madison, WI) diluted 1:50,000 in PBS-T as described above. For inhibition immunoblots, rabbit anti-prunin at a 1:50,000 dilution was pre-incubated with 200 g/mL of rPru du 6.01/rPru du 6.02 or 60 g/mL of native prunin inhibitor at RT for 2 hr and used as described above. Controls included membranes exposed to pAb without inhibitor.

Solid-phase peptide (SPOTs) synthesis and detection of IgG binding A set of overlapping 15 amino acid (aa) cellulose-derivatized peptides, each offset by eight aa, corresponding to the entire deduced aa sequences of Pru du 6.01 was purchased from Sigma-Genosys (The Woodlands, Texas, US). A spacer of two ß–alanines was added between each of the peptides and cellulose membrane. The peptide purity was >70% by HPLC and mass spectroscopy according to the manufacturer. The peptide-containing cellulose membranes were probed according to the manufactures instructions (Sigma-Genosys). Briefly, cellulose membranes were rehydrated in methanol for 5 min, washed 3X with TBS (50 mM TRIS, 137 mM NaCl, 2.7 mM KCl, pH 8.0) for 10 min, then blocked o/n at 4ºC in blocking buffer (100 mM maleic acid, 150 mM NaCl, 2.4 mM sodium azide, 10% casien). Membranes were incubated with the almond-specific mAbs (4G2 diluted 1:100, 2B4 diluted 1:2,500, or 5D1 diluted 1:100 in blocking buffer) at RT for 3 hr, washed for 1 hr at RT in TBS, and incubated with HRP-labeled goat anti-mouse reagent (Jackson Immunoresearch Laboratories Inc.) at a 1:5,000 v/v dilution in blocking buffer for 2 hr at RT, and washed as above. Amersham ECL (GE Healthcare, Piscataway, NJ) was used to detect reactivity upon exposure of membranes to Kodak XAR film (Kodak Molecular Imaging). Membranes were stripped between each mAb by washing membranes 2X for 10 min with

dH2O, followed by incubation with regeneration buffer IIA (8 M urea, 1% SDS, 0.1% 2- mercaptoethanol) 3X for 10 min and regeneration buffer IIB ( 400 mL H20, 500 mL ethanol, 100 mL acetic acid) 3X for 10 min. Membranes were washed 3X for 10 min with TBS-T (50 mM TRIS, 137 mM NaCl, 2.7 mM KCl, 0.05% Tween 20, pH 8.0). Membranes were blocked as described above and probed with HRP-labeled goat anti-mouse reagent to ensure all mAb IgG was removed during stripping.

Molecular modeling Molecular modeling was performed with chimera 1.6.1 (http://www.cgl.ucsf.edu/chimera/) using the prunin (PDB# 3FZ3) [49] crystal structures.

Affinity purification of rabbit Pru du 6 specific IgG Anti-Pru du 6.01 specific, Pru du 6.02 specific, and Pru du 6.01/2 cross-reactive IgG was purified from a rabbit immunized with native prunin. BrCN-activated Sepharose 4B beads (Sigma-Aldrich) were rehydrated and washed 3X with 1 mM HCL then incubated with 13 mg of rPru du 6.02 in PBS for 2 hours at RT with rotation. Unbound reactive sites were blocked using 0.2 M glycine for 20 min at RT with rotation. The matrix was packed into a column and equilibrated with PBS buffer. One milliliter of rabbit anti-prunin serum was applied to the rPru du 6.02 the affinity column. The effluent was collected and passed over the beads a second time, then stored in a 5 mL conical tube. The column was washed 10X with PBS to remove any residual unbound proteins. After washing, bound IgG was eluted using 0.2 mM glycine sulfate at pH 2.3. The eluate was equilibrated with 1 M Tris to raise the pH to 8. rPru du 6.01-specific IgG remained in the effluent. rPru du 6.02 specific and Pru du 6.01/2 cross reactive IgG in the eluate. To further purify the Pru du 6.01/2 cross-reactive IgG the eluate was then applied to BrCN-activated Sepharose 4B beads (Sigma-Aldrich) containing 12 mg of rPru du 6.01 (coupled and purified as described above). This second eluate contained Pru du 6.01/2 cross reactivity IgG, while the effluent contained Pru du 6.02 specific IgG. Pru du 6.01 specific IgG in the effluent was further purified from serum proteins in the effluent with a protein G affinity column. The effluent was passed over the column and bound IgG was eluted with 0.2 M glycine sulfate, pH 2.3. The eluate (containing Pru du 6.01 specific IgG) was immediately neutralized with 1.0 M Tris. Serum proteins remained in the effluent and were discarded.

Enzyme linked immunosorbent assay (ELISA) The purity of the Pru du 6 specific IgG fractions and the Pru du 6.01/2 cross-reactive IgG fraction were tested by ELISA to verify separation of the antibody population. rPru du 6.01 and

6.0β (40 µg/mL) diluted in coating buffer (0.1 μg/mL in 0.1 M NaHCO3, pH 8.6) were coated on the solid phase. Wells were blocked with PBS-T/5% (v/w) nonfat dry milk for 1 hr at 37ºC,

61 washed 6X with PBS-T, and probed with eluates containing rPru du 6.01, Pru du 6.02 specific IgG diluted 1:1,000 or unpurified rabbit anti-prunin diluted 1:30,000 in PBS-T for 1 hr at 37ºC. Wells were washed with PBS-T and incubated with HRP-conjugated goat anti-rabbit IgG (Promega) at a dilution of 1:50,000 for 1 hr at 37ºC. Wells were washed again as described above. Reactivity was detected by colorimetric reaction using o-phenylenediamine (Zymed

Laboratories Inc) and H2O2 as substrate. Reactions were quenched with H2SO4 and the OD was measured in a KC4 v2.5 ELISA reader (Bio-Tek Instruments Inc, Winooski, Vt) at 495 nm.

Affinity purification of prunin hexamers BrCN-activated Sepharose 4B beads (Sigma-Aldrich) were rehydrated, washed 3X with 1 mM HCL then incubated with 750 μg of Pru du 6.01 specific IgG in PBS for β hours at RT with rotation. Unbound reactive sites were blocked and packed into a column as described above. The hexameric fraction of prunin obtained by gel filtration (500 µg) was applied to the column. The effluent was collected and passed over the beads a second time, then stored in a 2 mL Eppendorf tube. The column was washed with PBS, bound hexamers were eluted, and neutralized as described above.

Native PAGE The purity of the prunin fractions obtained by gel filtration and by affinity chromatography using Pru du 6.01 specific IgG were assayed by native PAGE using an 8% gel. The gel was pre-run with 25 mM Tris and 192 mM glycine, pH 8.4 with and without 1% deoxycholate (DOC) in the cathode and anode chamber, respectively, for 30 min at 40 mA. Samples in the native sample buffer (γ μg or 15 µg protein, 6β.5 mM Tris-Cl, pH 6.8, 15% glycerol and 1% bromophenol blue) were applied to the gel and electrophoresed for 3 hr at 25 mA, then stained with Coomassie Brilliant Blue R (Sigma-Aldrich) or transferred to NC stained with Ponceau S (Sigma-Aldrich) and probed as described below.

Human Sera A blood sample was obtained from a patient with convincing histories of almond allergy from PlasmaLab International (Everett, WA). The study was approved by the Institutional Review Boards of the University of California at Davis, and Florida State University. Sera were

62 frozen at -80°C. The presence of almond-reactive IgE was confirmed by means of Pharmacia ImmunoCAP assay (Pharmacia Diagnostics, Uppsala, Sweden). Control serum was obtained from a patient with histories of asthma and dust mite allergy but who was not food-allergic. The patient chosen for this study was one who exclusively reacted with Pru du 6.02 in immunodot blot assays [97]. Patient #53 is a 44-year-old female with allergic responsiveness to almonds since childhood and an almond-specific ImmunoCAP® score of 15.8 kU/L. She is also clinically allergic to milk, soybean, coconut, apples, peaches, and eggs.

IgE immunoblotting of prunin hexamers NC strips (4 mm wide) from gel transfers containing 3 μg of affinity purified hexameric prunin and 15 µg of the hexameric fraction (F26-30) of native prunin were blocked o/n with PBS-T/5% (v/w) nonfat dry milk then incubated with patient #53, diluted 1:5 (v/v), o/n at 4°C. The probed strips were washed for 3X for 30 min with PBS-T and then incubated o/n at 4°C with 125I-labeled anti-human IgE (Specific IgE Tracer, Hycor Biomedical Inc, Garden Grove, CA) diluted 1:10 in PBS-T/5% (w/v) nonfat dry milk. Membranes were washed again as above and signal intensity was determined after a 10 day exposure to Kodak Biomax X-ray film (Kodak Molecular Imaging) at –80°C.

4G2 mAb immunoblotting of prunin hexamers NC strips (4 mm wide) from gel transfers containing 3 g of affinity purified hexameric prunin and 15 µg of the hexameric fraction (F26-30) of native prunin were probed with the almond-specific mAb 4G2 as described above.

Results

Reactivity of almond mAbs with recombinant proteins A panel of murine mAbs raised against almond extract was used to analyze IgG reactivity to rPru du 6.01 and rPru du 6.02. Of the 10 mAbs tested, six recognized rPru du 6.01 only, one recognized both Pru du 6.01 and 6.02, and none were specific for Pru du 6.02 (Fig. 4.1A). Comparison of murine IgG data (Fig. 4.1A) to that obtained using human IgE (Chapter 2, Fig.

2.2A), reveals a similar pattern of reactivity, as both IgG and IgE reactivity to rPru du 6.01 was greater than to rPru du 6.02 by immunodot blot assay. An inhibition immunoblot was performed to confirm the identity of native Pru du 6.01 in the nut extract (Fig. 4.1B). Pre-incubation of the four randomly selected mAbs that displayed rPru du 6.01 reactivity (4G2, 2A3, 2B4, 5D1) yielded partial to complete inhibition of binding to 65 and 60 kDa bands in the nut extract, indicating that these bands represents the native mature Pru du 6.01 polypeptides. The binding of mAbs to Pru du 6.01 polypeptides of slightly differently electrophoretic mobilities could be explained by the recent observation that half of the prunin 1 monomers in each hexamer have an additional 16 aa helix-containing segment at the C- terminal of the acidic subunit [49]. These isoforms may also explain some of the unexpected mAb inhibition data. For example, mAb 2A3 recognizes an epitope located on the larger of the two size isoforms of Pru du 6.01 (designated “Pru du 6.01 full; length” in Fig.4.1B) and thus may target the additional helix present on Pru du 6.01 monomers. Additionally, inhibition of binding to 35, 30, and 25 kDa bands in the nut extract was observed indicating that these lower molecular weight bands represent the acidic chain and basic chain components that are produced by in planta proteolysis [39;40;42]. As a negative control, mAbs were pre-incubated with rPru du 6.02 alone, which showed little effect on IgG binding to proteins in the nut extract (Fig. 4.1B). Pre-incubation of 2A3 and 2B4 mAbs with native prunin demonstrated inhibition of similar molecular weight bands (65, 60, 35, 30, and 25 kDa) as that observed with rPru du 6.01 inhibitor, further indicating that Pru du 6.01 is the predominant polypeptide comprising native prunin.

Conformational sensitivity of Pru du 6.01 IgG epitopes The stability of the IgG binding epitopes to denaturation was tested by subjecting rPru du 6.01 to various denaturing conditions prior to dot blotting and probing with mAbs. The results show that, for mAbs 2A3, 2B4, and 5D1 denaturation does not diminish reactivity to rPru du 6.01, indicating the recognition of stable epitopes (Fig. 4.2). mAbs 4G2 and 4F1 showed a similar pattern of reactivity when reacted with undenatured and the urea treated samples but almost complete loss of reactivity upon treatment with reducing buffer and 10% SDS indicating that these mAbs may recognize a slightly labile epitope on the protein (Fig. 4.2). The similar

IgG binding intensity to rPru du 6.01 under all treatment conditions for mAbs 2A3, 2B4, and 5D1 implies the recognition of sequential IgG binding epitopes on Pru du 6.01.

Fig. 4.1. Immunodot blot and inhibition immunoblot using almond mAbs. A) Immunodot blot demonstrating mAb reactivity to rPru du 6.01 and rPru du 6.02. B) Inhibition immunoblot of almond extract probed with mAbs either unabsorbed (2A3, 2B4, 4G2, 5D1) or pre-incubated with rPru du 6.01 (+Pru1), rPru du 6.02 (+Pru 2), both rPru du 6.01 and rPru du 6.02 (+P1/2), or native prunin (+nat). NC = negative control.

Fig. 4.2. Immunodot blot of rPru du 6.01 treated with various denaturants followed by probing with anti-almond mAbs. Red. buffer = reducing buffer, NC = negative control.

Identification of IgG-reactive sequential epitopes on Pru du 6.01 To identify sequential IgG binding epitopes, a series of 68 overlapping solid-phase synthetic peptides representing the entire aa length of Pru du 6.01, was probed with selected

65 mAbs (4G2, 2B4, 5D1) that appeared to be directed against predominantly sequential epitopes (Fig. 4.1 and Fig. 4.2). mAb 4G2 reacted strongly with two peptides (#44 and 45) (Fig. 4.3A). Since there is a seven aa overlap between adjacent peptides, it is likely that IgG recognition of neighboring SPOTs represents recognition of the shared aa sequence and thus a single epitope. Analysis of the overlapping region in the peptides recognized by 4G2 identified aa L353- Q359, as the likely epitope sequence (Fig. 4.3A). mAb 2B4 reacted strongly with five peptides (#15, 16, 17, 18, 20) (Fig. 4.3B). Similarly, analysis of these peptide sequences identified aa Q120- Q125 as the likely epitope region as it is present in all reactive peptides (Fig. 4.3B). mAb 5D1 reacted strongly with four peptides (#15, 17, 18, 20) and analysis identified aa Q120-Q125 as the likely epitope region (Fig. 4.3C). Both 2B4 and 5D1 appear to recognize the same sequential epitope on Pru du 6.01, aa Q120-Q125. This finding is supported by the inhibition immunoblot data (Fig. 4.1B) in which these mAbs show a similar pattern of reactivity and inhibition to almond extract suggesting the recognition of a similar epitope on the prunin protein. These IgG binding epitopes are localized at the N-terminal (2B4/5D1) and C-terminal (4G2) of the acidic subunit of Pru du 6.01.

Fig. 4.3. SPOTs assay identifying sequential IgG-binding peptides on Pru du 6.01 using selected mAbs. A) 4G2, B) 2B4, C) 5D1.

Molecular modeling of SPOTs-identified IgG epitopes Native prunin, like other 11S globulins, is biosynthesized as a large proprotein that temporarily associate into trimers. Subsequent cleavage of the proprotein by asparaginyl endopeptidase allows the trimers to dimerizes via association of the hydrophobic faces (IE face) to form the mature hexameric protein [39;40;49;135]. The molecular positions of the sequential IgG binding epitopes on Pru du 6 were identified by using the recently reported X-ray diffraction data of prunin (PDB# 3FZ3) [49] (Fig. 4.4). Interestingly, the sequential IgG epitopes recognized by 4G2 (green) was found to be located on the occluded IE face of Pru du 6. In contrast, the sequential epitope targeted by 2B4 and 5D1 (red) was found to be localized to a protruding loop region and easily accessible for mAb binding.

Fig. 4.4. Molecular models of Pru du 6 trimers using the crystal structure of prunin 1 [49]. One of the prunin monomers is color coded (acidic subunit, yellow; basic subunit, blue) and the additional monomers are represented in light grey and dark grey. The identified mAb sequential epitopes are colored green (4G2) and red (2B4/5D1) .

Immunodot blot against Pru du 6 subunits The location of the mAb sequential epitopes was verified by assaying the individual acidic and basic Pru du 6 subunits for reactivity. All mAbs reacted exclusively with the larger acidic subunit further supporting the epitope locations identified in the SPOTs assay.

Fig. 4.5. Immunodot blot demonstrating anti-almond mAb reactivity to rPru du 6 acidic and basic subunit. MBP = maltose binding protein, NC = negative control.

Comparison of mAb sequential epitopes with human IgE binding epitopes Several studies have demonstrated a high degree of positional overlap between murine/rabbit IgG and human IgE binding epitopes [130;153;154]. Therefore, the mAb sequential IgG binding epitopes were compared to the previously mapped IgE binding epitopes (Ch 2 Fig. 2.4 and Table 2.2, Ch 3 Fig. 3.6) [97]. Of the six sequential epitopes identified on Pru du 6.01, epitope aa 118-132 directly overlapped with the 5D1/2B4 epitope (Fig. 4.6). This epitope overlap indicates that mAb 5D1/2B4 IgG reactivity is likely to mimic the reactivity of human IgE, at least with respect to the overlapping epitope. No overlap was found between the mAb IgG sequential epitopes and the three putative conformational IgE binding epitopes by phage display.

Fig. 4.6. Alignment of overlapping mAb IgG binding epitope with human IgE binding epitope.

Detection of Pru du 6 isoforms by 2-D gel electrophoresis and immunoblotting The observation that most almond-allergic patients and mAbs reacted exclusively with Pru du 6.01 indicates that this may be the predominant isoforms present in the nut (Ch 2 Fig. 2.2, Fig. 4.1). To test this, almond extract was separated by 2-D gel electrophoresis (Fig. 4.7A) and inhibition immunoblotting assays were performed using serum from a rabbit immunized with native prunin. Native prunin, rPru du 6.01, and rPru du 6.02 were assayed for their ability to inhibit the binding of IgG to the corresponding proteins in the almond extract (Fig. 4.7). 68

Incubation with native prunin resulted in a complete loss of IgG reactivity to both isoforms in the nut (Fig. 4.7C),whereas, incubation with rPru du 6.01 inhibited a majority of the IgG reactive spots as compared to the uninhibited control (Fig. 4.7D). Several spots at ~55 kDa remained reactive indicating that these likely represent the Pru du 6.02 isoform (Fig. 4.7D). In contrast, incubation with rPru du 6.02 had little effect on IgG binding as compared to the uninhibited control (Fig. 4.7E). This is likely due to the predominant IgG reactivity directed against the Pru du 6.01 isoform which overshadows any minor inhibition to the Pru du 6.02 isoform. Overall these results support the observed IgE and IgG reactivity indicating that Pru du 6.01 is the predominant prunin isoform found in the nut.

Fig. 4.7. 2-D gel electrophoresis and inhibition immunoblots. A) Coomassie Blue stain of almond extract separated by 2-D gel electrophoresis. B) Immunoblot assay using rabbit anti-prunin. C) Inhibition immunoblot of almond

69 extract probed with rabbit anti-prunin incubated with native prunin inhibitor (+native prunin) ,or D) rPru du 6.01 inhibitor (+rPru du 6.01), or E) rPru du 6.02 inhibitor (+rPru du 6.02).

Isolation of Pru du 6.01 specific IgG and hexameric prunin Almond prunin is hexameric in form and composed of individual Pru du 6 polypeptides [21;39-41;97]. To date, two isoforms have been identified, Pru du 6.01 and Pru du 6.02, which comprise native prunin [39;97]. This finding is not uncommon as studies have identified multiple 11S isoforms in soybean, sesame and peanut [33;34;38]. Extensive research has analyzed IgE and IgG reactivity to these isoforms [36;38;97] but little is known about the isoform interactions that form the mature hexameric protein. To determine whether prunin subunits associate as homohexamers or heterohexamers, native prunin was purified and analyzed using isoform specific IgG. A stepwise fractionation approach was utilized in which Pru du 6.01-specific, 6.02-specific, and Pru du 6.01/02 cross-reactive rabbit IgG was purified by affinity chromatography. For fractionation, anti-prunin rabbit serum was first passed over a Pru du 6.02 affinity column. The Pru du 6.01-specific fraction was retained in the effluent, whereas Pru du 6.02-specific and Pru 6.01/2 cross-reactive IgG were located in the eluate. The eluate was further purified using a Pru du 6.01 affinity column to obtain a Pru du 6.02-specific fraction and a Pru du 6.01/2 cross-reactive fraction of IgG. The specificity of the separated IgG fractions was assessed in an ELISA assay (Fig. 4.8A). The slight reactivity to Pru du 6.01 observed in the Pru du 6.02-specific population is likely due to incomplete adsorption of cross-reactive IgG during purification (Fig. 4.8A). The hexameric fraction of prunin (F26-30) was purified by size exclusion chromatography and observed by a Coomassie Blue stained native-PAGE gel (Fig. 4.8B). Hexamers containing Pru du 6.01 were isolated by affinity chromatography using the purified rPru du 6.01-specific IgG (Fig. 4.8C).

Fig. 4.8. ELISA, Coomassie Blue stained native-PAGE, and Ponceau S stained nitrocellulose. A) ELISA assay testing for the presence of Pru du 6 specific IgG in the purified eluate and effluent collected by affinity chromatography using rabbit anti–native prunin serum. B) Coomassie Blue stained native-PAGE gel of prunin fractions obtained by size exclusion chromatography. F# = fractions collected during size exclusion chromatography. nPru = native prunin, WA = whole almond extract, HMW = high molecular weight marker, LMW = low molecular weight marker, E = empty lane. C) Ponceau S stained nitrocellulose of the Pru du 6.01 containing hexamer fraction (eluate) collected by affinity chromatography using Pru du 6.01 specific IgG. Hex Pru= hexameric fraction of prunin (F26-30).

Analysis of prunin hexamer composition An immunoblot was performed using the Pru du 6.01-containing hexamer fraction (eluate) obtained by affinity chromatography to determine the composition of the prunin hexamers. For analysis, the mAb 4G2, which is exclusively reactive with Pru du 6.01, and almond-allergic patient #53, which is exclusively reactive with Pru du 6.02, were selected. Strong reactivity of mAb 4G2 with the eluate was detected whereas no reactivity was observed with patient #53 (Fig. 4.9). This pattern of reactivity indicates that the native prunin hexamers are homohexameric in composition and composed of either Pru du 6.01 or Pru du 6.02. A positive control comprised of the hexameric fraction of prunin (Hex Pru) tested positive for IgG and IgE binding (Fig. 4.9).

Fig. 4.9. Immunoblot assaying the Pru du 6.01-containing hexamer fraction (eluate) for Pru du 6.01 specific IgG and Pru du 6.02 specific IgE reactivity. Hex Pru = hexameric fraction of prunin (F26-30), WA = whole almond extract, NC = negative control.

Discussion

The laboratory and clinical uses of mAbs are continuing to grow which emphasizes the need to identify and immunologically characterize the epitopes recognized by these antibodies.

Currently mAbs are an important tool for the detection of trace amounts of contaminating allergens in foods. Studies using mAbs directed against the major peanut allergen, Ara 1 (7S globulin), found that the concentration of the allergen increased in peanuts roasted for 10-15 min [158]. This is likely due to a higher yield of Ara h 1 extracted from roasted peanut or an increase in the accessibility of the mAb binding epitopes that occurs during the roasting process [158]. mAbs have also been used to detect milk, egg, and peanut allergen contamination in commercially bottled wine as these allergenic food proteins may be used as fining agents or processing aids in the manufacturing of wine [159]. Analysis revealed the presence of allergenic proteins however; the levels of these allergens were unlikely to cause adverse reactions in egg, milk, or peanut/tree nut allergic subjects [159]. Similarly, capture ELISA assays using mAbs specific for either peanut or hazelnut were able to successfully detect the contaminating nut in a variety of commercial foods including cereal, chocolate, ice cream, granola, and cookies [147]. Several of the foods that claimed to be nut free were found to contain trace amounts (in the low parts per million range) of the contaminating nut with hazelnut contamination found more often than peanut [147]. These studies indicate the importance of mAbs in screening foods and signify the need to map the epitopes recognized on their target allergen. As Pru du 6 is a major almond allergen and abundant in the nut, investigating mAb binding to this protein is of particular importance. A panel of randomly selected mAbs raised against almond extract was assayed for Pru du 6 binding. Reactivity was found to be largely directed against Pru du 6.01 as 70% of the tested mAbs reacted to this isoform (Fig. 4.1A). Comparison of murine IgG and human IgE data revealed a similar pattern of reactivity, as both IgG and IgE reactivity to rPru du 6.01 was greater than to rPru du 6.02. The stability of the IgG binding epitopes to denaturation was tested by subjecting rPru du 6.01 to various denaturing conditions prior to dot blotting and probing with mAbs (Fig. 4.2). The similar IgG binding intensity to rPru du 6.01 under all treatment conditions for several mAbs (2A3, 2B4, 5D1) implies the recognition of stable sequential epitopes. These mAbs are of particular importance as they would be suitable for use in assays aimed at the detection of almond contamination in foods. Many foods undergo extensive processing (baking, blanching, roasting, and frying) before consumption; therefore, mAbs directed against sequential epitopes should be ideal as they are able to detect the almond Pru du 6 protein processed under a variety of different conditions.

The use of mAbs in such an assay would improve food labeling and prevent accidental adverse reactions thus increasing food safety. The specific sequential epitopes targeted by mAb 4G2, aa L353-Q359, 2B4 and 5D1 aa Q120-Q125, were identified by SPOTs assay (Fig. 4.3). These IgG binding epitopes were found to be localized on the acidic subunit of Pru du 6.01 (Fig. 4.5). This finding is similar to those observed with human IgE as five of the six sequential epitopes for Pru du 6.01, 15 of the 22 sequential epitopes for the cashew allergen, Ana o 2, and 15 of the 19 sequential epitopes for the pecan allergen, Car i 4, were located on the acidic subunit [29;97;141]. Additionally, the epitopes located on the acidic subunit were found to be the most strongly reactive with patient IgE as compared to those identified on the basic subunit [29;97]. Collectively, these findings indicate that the acidic subunit is more immunogenic than the basic subunit, at least in respect to the 11S globulin proteins from tree nuts. Comparison of the mAb epitopes with the sequential IgE binding epitopes found that the 5D1 and 2B4 epitope directly overlapped with an IgE binding epitope on Pru du 6.01 (Fig. 4.6). This suggests that this epitope defines a region of high immunogenicity on the prunin protein and that mAb IgG reactivity is likely to mimic the reactivity of human IgE, at least in regards to the overlapping epitope. The observation that both IgG and IgE reactivity is largely directed against Pru du 6.01 indicates that it may be the predominant isoform present in the nut (Ch 2 Fig. 2.2, Fig. 4.1). Inhibition immunoblots found that incubation with rPru du 6.01 could inhibit binding to a majority of the IgG reactive spots, whereas rPru du 6.02 had no visible effect on IgG binding (Fig. 4.7). This is likely due to the predominant IgG reactivity directed against the Pru du 6.01 isoform which overshadows any minor inhibition by the Pru du 6.02. The comparison of the Pru du 6 aa sequences with the NCBI database using BLAST analysis identified homology with other allergens from the 11S globulin family of seed storage proteins, including: hazelnut Cor a 9 [28], Brazil nut Ber e 2 [103], English walnut Jug r 4 [104], cashew Ana o 2 [29], and pistachio Pis v 2 [32]. Analysis of both the Ig reactivity and sequence homology with other known allergens indicates that the difference between the Pru du 6 isoform reactivity is likely due to a combination of sequence specific features and the greater prevalence of the Pru du 6.01 in the nut. In particular, an extra loop region (aa 118-187) was found to be exclusively present in Pru du 6.01. Several of the sequential IgE binding epitopes (three of the six) and the mAb 2B4 and

5D1 IgG binding epitope are located in this region which indicates that it contributes to the enhanced immunogenicity of the Pru du 6.01 isoform. In summary, mAb IgG reactivity to Pru du 6 was analyzed and the sequential epitopes targeted by three mAbs identified and localized on the crystal structure. As many foods undergo extensive processing (baking, blanching, roasting, and frying) before consumption, these mAbs would be suitable for assays aimed at the detection of contaminating Pru du 6 in food products. We also demonstrated that Pru du 6.01 is the predominate isoform in almond nut which correlates with the greater IgG and IgE reactivity observed against Pru du 6.01 than to Pru du 6.02 is our tested population. The information gathered in this study may lead to the development of assays designed to detect almond contamination in foods and improve food safety for almond allergic individuals.

CHAPTER FIVE

CONFORMATIONAL EPITOPE MAPPING OF PRU DU 6 USING A MURINE MONOCLONAL ANTIBODY BY HYDROGEN/DEUTERIUM EXCHANGE

Introduction

Allergic reactions to tree nuts have become a global health concern as the number of affected individuals continues to rise [20;160]. Tree nuts are typically eaten as snacks or are incorporated into food dishes. The most commonly consumed tree nuts in the US, in rank order, are cashew, almond, pistachio, pecan, and walnut [161]. Among the tree nuts, almond ranks third, behind walnut and cashew nut, in the ability to elicit IgE mediated allergic reactions [20]. A major IgE-reactive allergenic protein in almonds is prunin (Pru du 6), a legumin [42;44;97]. Two isoforms of almond prunin have been identified, Pru du 6.01 and Pru du 6.02, which share 64% amino acid sequence identity and 77% similarity [39;97]. IgE reactivity to these two isoforms was found to vary significantly, with Pru du 6.01 being recognized by 50% and Pru du 6.02 by 28% of patients in the tested population [97]. B cell epitopes are typically categorized as either sequential (linear, continuous) or conformational (discontinuous) [4;52;53;124]. Sequential epitopes consist of short contiguous stretches of amino acids and can be readily identified by probing synthetic overlapping peptides with serum from sensitized individuals [50]. Extensive epitope mapping studies have been performed to identify and compare sequential epitopes on several tree nut allergens [29;97;98;101;102;111;140-144;162]. Whereas many sequential nut protein epitopes have been characterized, few studies have focused on conformational epitopes on tree nut allergens. The dependence of conformational epitopes upon the tertiary structure [4;50;52;53], requires sophisticated techniques such as large scale mutagenesis, X-ray crystallography of immune complexes, nuclear magnetic resonance (NMR), phage display, or the generation of chimeric molecules for identification [52;124]. Studies done on tree nut allergens (Brazil nut, Ber e 1; cashew, Ana o 2) have largely focused on the generation of chimeric molecules as they are easy to create, cost effective, and maintain the overall structure of the allergen [127;130;131].

To improve our knowledge of conformational epitopes on tree nut allergens the application of new techniques for epitope identification is critical. Recently, hydrogen/deuterium exchange footprint analysis, monitored by 14.5 T Fourier transform ion cyclotron resonance mass spectrometry (HDX-MS), has been applied to conformational epitope mapping studies [163;164]. HDX-MS can map the surfaces of proteins in their native state based on the solvent accessibility of exposed hydrogens on the amide backbone [165;167]. The binding of ligands, such as antibodies, followed by comparative mass determination by MS identifies peptides that are likely shielded by the ligand (e.g., epitopes) [163-167]. To date, limited information is available on conformational epitopes on almond Pru du 6. To investigate these epitopes, we utilized a previously characterized murine monoclonal antibody (mAb), 4C10 that is highly reactive to native prunin and appears to recognize a labile epitope [168]. Here we apply HDX-MS to the analysis of native prunin in complex with mAb 4C10 to identify the likely epitope. Analysis of chimeric molecules containing the homologous soybean allergen, Gly m 6, and alanine mutants in conjunction with atomic models further localized the conformational epitope to three discontinuous strands (aa 21-45, 320-328, and 460- 465). We also show that 4C10 binding can compete with patient IgE and IgG binding to Pru du 6, suggesting overlap between human and murine epitopes. The results further demonstrate the utility of HDX-MS for the identification of human allergy relevant conformational epitopes on targeted allergens.

Methods

Human Sera Blood samples were obtained with informed consent from patients with convincing histories of repeated clinical reactions to almond in the absence of other tree nut exposures or were purchased from PlasmaLab International (Everett, WA). The study was approved by the Institutional Review Boards of the University of California at Davis, and Florida State University. Sera were frozen at -80°C. The presence of almond-reactive IgE was confirmed by means of Pharmacia ImmunoCAP assay (Pharmacia Diagnostics, Uppsala, Sweden) or by Western immunoblotting as described below. Control serum was obtained from a patient with a history of asthma and dust mite allergy but who was not food-allergic. The almond-allergic

77 patients chosen for study were those that reacted with native prunin and recombinant (r)Pru du 6.01 in immunodot blot assays [97]. Patient #14 is a 38-year-old female with allergic responsiveness to almonds from age 5 with an ImmunoCAP® score of 1.9 kU/L. She is also clinically allergic to other tree nuts (cashew, Brazil nut, pistachio and walnut). Patient #55 is a 39-year-old male with allergic responsiveness to almond from age 10 with an almond-specific ImmunoCAP® score of 9.0 kU/L. He is also clinically allergic to hazelnuts, Brazil nuts, and peanuts. Patient #57 is a 50-year-old male with allergic responsiveness to almonds from age 10 with an ImmunoCAP® score of 9.99 kU/L.

Purification of native prunin Native prunin was purified by Girdhari M. Sharma and Mengna Su from aqueous almond extract by column chromatography as previously described [42]. To obtain a hexameric fraction of native prunin, gel filtration was performed with a Sephacryl S200 HR column equilibrated with BSB. The column flow rate was maintained at 0.4 mL/min, and fractions were collected at 1 min intervals. Protein elution was monitored by UV absorbance at 280 nm. Fractions containing high molecular weight proteins corresponding to the hexameric fraction (~360 kDa) were concentrated with Amicon Ultra 30,000 MWCO (Millipore Corp., Bedford, MA).

Polyacrylamide gel electrophoresis and protein transfer Almond extract (12-14 g per 4 mm well width) or native prunin (0.5 mg per 4 mm well width) was subjected to SDS-PAGE. Proteins were mixed with suitable volumes of reducing sample buffer (70 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.05% bromophenol blue and 5% -mercaptoethanol) or non-reducing sample buffer (70 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.05% bromophenol blue), heated for 5 min in a boiling water bath, then cooled to RT. Samples were electrophoresed on a 12% acrylamide separating gel with a 4% acrylamide

78 stacking gel for 1.5 hr at 130 V. Gels were either stained with Coomassie Brilliant Blue R (Sigma-Aldrich, St. Louis, MO) or transferred to nitrocellulose (NC) membranes as previously described [100].

Monoclonal anti-almond antibodies (mAbs) MAbs against almond extract were raised in the Hybridoma Facility at Florida State University by standard techniques [155] and screened in direct-binding ELISA assays as previously described [97]. The 4C10 mAb was chosen for epitope characterization as this mAb was highly reactive to native prunin and appeared to recognize a labile epitope [168]. Additional mAbs (4F10, 2A3, 2B4, 5D1, 2G4) that appeared to recognize sequential epitopes on prunin were selected to serve as controls.

Immunodot blotting Recombinant Pru du 6.01, Pru du 6.02 fusion proteins, native prunin, MBP, almond protein extract, alanine mutants, and chimeric (Pru du 6.01/Gly m 6) molecules were applied to NC membranes with a 96-well Bio-Dot Microfiltration Apparatus (BioRad Laboratories) as previously described [93]. Briefly, recombinant proteins (1 g per 2 mm dot), native prunin, and almond extract (0.5 g per 2 mm dot), and MBP (1 g per 2 mm dot) were applied to NC strips and blocked overnight (o/n) at 4°C with phosphate buffered saline-Tween 20 (PBS-T)(140 NaCl, 10 mM phosphate, 2.7 mM KCl, pH 7.4, 0.05% Tween-20)/5% (v/w) nonfat dry milk. Dots were incubated with the almond-specific mAbs, diluted 1:200, 1:400, 1:500, or 1:2,000 in PBS- T, at RT for 1 hr. Strips were washed 3X with PBS-T for 20 min each wash and then incubated with horse radish peroxidase (HRP)-labeled goat anti-mouse reagent (Jackson Immunoresearch Laboratories Inc., West Grove, PA) at a 1:5000 v/v dilution in PBS-T for 1 hr at RT, and washed as above. Amersham ECL (GE Healthcare, Piscataway, NJ) was used to detect reactivity upon exposure of dot strips to Kodak XAR film (Kodak Molecular Imaging, New Haven, CT).

79 containing either 10% SDS, 6 M urea, or 1.0 M -mercaptoethanol, and maintained at RT for 10 min. Samples were then dotted onto NC and probed in immunodot blotting assays as described below.

Immunoblotting NC strips from gel transfers containing 15 g of almond nut protein extract and native prunin were probed as described above. Briefly, strips were blocked o/n then incubated with 4C10 diluted 1:500 (v/v) in PBS-T at RT for 1 hr. Strips were washed 3X with PBS-T for 20 min per wash and then incubated with HRP-labeled goat anti-mouse reagent (Jackson Immunoresearch Laboratories, Inc.) at a 1:5000 v/v dilution in PBS-T for 1 hr at RT, and washed as above. Amersham ECL was used to detect reactivity upon exposure of dot strips to Kodak XAR film.

Hydrogen/deuterium exchange (HDX) The HDX assays were performed by Qian Zhang. The entire HDX experiment is automated with the HTC Pal autosampler (Eksigent Technologies, Dublin, CA) and performed as previously described [164]. HDX was performed with purified native hexameric prunin. Briefly, a 5 µL stock solution of native prunin (~10 µM concentration) or prunin-4C10 complex

(~10 µM for native prunin) was mixed with 45 µL of PBS in D2O, pH 7.4, to initiate each H/D

exchange period. For the blank control, the initial dilution was made in H2O PBS. The HDX reaction periods were 0.5, 1, 2, 4, 8, 15, 30, 60, 120, 240, and 480 min, each followed by simultaneous quench and proteolysis. Each 50 µL total volume was quenched by rapid mixing with 25 µL of 200 mM tris(2-carboxyethyl)phosphine (TCEP), 8 M urea solution in 1.0% formic acid and 25 µL five-fold dilution of saturated protease type XIII in 1.0% formic acid (final pH ~2.3). The protease digestion was performed for 2 min followed by injection for liquid chromatography-mass spectrometry (LC-MS) analysis. Each HDX reaction and assay was performed in triplicate.

On-line liquid chromatography electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry Liquid chromatography electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (LC ESI FTICR MS) was performed by Qian Zhang as previously described [164]. Briefly, after proteolysis, prunin (with or without mAb) peptides were separated and desalted with a Jasco high-performance liquid chromatography/supercritical fluid chromatography (HPLC/SFC) instrument (Jasco, Easton, MD). For LC, 45 µL of the protein digest was injected from a 50 µL loop to a Pro-Zap Expedite MS C18 column (Grace Davidson, Deerfield, IL), 1.5 µm particle size, 500 Å pore size, 2.1 × 10 mm2. A rapid gradient from 2% B to 95% B in 2 min (A: acetonitrile/H2O/formic acid, 5/94.5/0.5; B: acetonitrile/H2O/formic acid, 95/4.5/0.5) was performed for eluting peptides at a flow rate of 0.3 mL/min. The LC eluent flow rate was reduced by ~1/1000 by a postcolumn splitter for efficient electro spray ionization (ESI). The ionized LC eluent was directed to a custom-built hybrid linear trap quadrupole 14.5 tesla fourier transform-ion cyclotron resonance (LTQ 14.5 T FT-ICR) mass spectrometer (ThermoFisher, San Jose, CA). Mass spectra were collected from 380 < m/z < 1300 at high mass resolving power (m/Δm50% = 100,000 at m/z 400, in which Δm50% is mass spectral peak full width at half-maximum peak height). The total experimental event sequence for each sample was 6.5 min. External ion accumulation was performed in the linear ion trap with a target ion population of three million charges collected for each FT-ICR measurement. LTQ- accumulated ions were transferred (~1 ms transfer period) through three octopole ion guides (2.2 MHz, 250 Vp–p) to a capacitive coupled closed cylindrical ICR cell (55 mm i.d.) for analysis. The ion accumulation period was typically less than 100 ms during peptide elution and the ICR time-domain signal acquisition period was 767 ms (i.e., an overall duty cycle of ~1 Hz per acquisition).

HDX data analysis Data were collected with Xcalibur software (Thermo-Fisher) and analyzed by an in-house analysis package as previously described [164;169].

PCR amplification and DNA sequencing of recombinant genes Gene specific primers were designed for prunin 1 and prunin 2 based on the available NCBI sequences (accession numbers X78119 and X78120). The full length prunin cDNAs and the free large (acidic)/small (basic) subunits were amplified, TA cloned (TOPO TA Cloning Kit, Invitrogen, Carlsbad, CA), and sequenced on an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) as previously described [97].

Cloning, expression and purification of cDNA-encoded proteins The prunin cDNA coding sequences, representing the Pru du 6.01 and Pru du 6.02 isoforms, were ligated into the fusion expression vector pMAL-c4X (New England BioLabs Inc, Beverly, MA) and transformed into E. coli BL21(DE3) or Rosetta gamiB(De3)pLysS cells (EMD Millipore Corporation, Billerica, MA). The cloning, expression, and purification of mannose-binding protein (MBP)-rPru du 6.01 and MBP-rPru du 6.02 fusion proteins were carried out as previously described [97].

Production of individual subunits and chimeric molecules The recombinant pMAL-c4X vector containing the full-length Pru du 6.01 gene was used to produce rPru du 6 and served as a template for PCR-based cloning and expression of the large (acidic) and small (basic) subunit genes. The target coding sequences were modified by the addition of restriction sites at the 5′ and γ′ ends during the PCR reactions with PfuTurbo DNA polymerase (Stratagene, Cedar Creek, TX) and the appropriate chimeric/subunit primers (Table 5.1). This same amplification strategy was employed for the soybean Gly m 6 11S globulin gene (GenBank accession #X15121), to generate full-length rGly m 6 protein as well as its independent large and small subunits. Stop codons were introduced into both the Pru du 6.01 and Gly m 6 large subunit reverse primers (Table 5.1). The various Pru du 6/Gly m 6 chimeric constructs were generated by blunt-end ligation of Platinum Pfx DNA polymerase (Invitrogen)- amplified PCR products. These products then served as full-length templates for Pfu Turbo DNA polymerase amplification in subsequent PCR reactions. All PCR products were digested by XbaI and HindIII according to the manufacturer's instructions (Invitrogen). Digested products were purified with a QIAquick Gel Extraction Kit (Qiagen Inc., Valencia, CA) and ligated with T4 DNA Ligase H.C. (Invitrogen) to their respective sites in the pMAL-c4X

expression vector. Sequences were checked for identity to their respective templates by the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The expression and purification of these recombinant molecules was performed as described above.

Table 5.1. Primers used for the amplification and subcloning of almond Pru du 6.01 and soybean Gly m 6 11S globulin genes, constituent subunits, and chimeras. Large = acidic subunit, small = basic subunit Gene Primer Name: Primer Sequence(5′-3′) Amplicon PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Full length Pru du 6.01 (PLG Pru du 6.01 – PSM-R: CGCAAGCTTTTATACAACTGCCCTC PSM) PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Pru du 6.01 Pru du 6.01 large subunit (PLG) PLG-R: CGCAAGCTTTTAGTTGGCCATCAGTTGTTCTCC GLG-F: AGATCTAGATCCAGAGAGCAGCCTCAGC Gly m 6 Full length Gly m 6 (GLG-GSM) GSM-R: CCCCAAGCTTCTAAGCCACAGCTCTCTTCTG PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Pru du 6 P*-PLG P*-PLG-R: GTTGGCCATCAGTTGTTCTCC P*-GSM-F: GGCATTGACGAGACCATATGC Gly m 6 P*-GSM GSM-R: CCCCAAGCTTCTAAGCCACAGCTCTCTTCTG GLG-F: AGATCTAGATCCAGAGAGCAGCCTCAGC Gly m 6 P*-GLG P*-GLG-R: CTAATTTCTTCTGCTTTTGCTTTGGC P*-PSM-F: GGTCTTGAGGAGACCTTCTGC Pru du 6 P*-PSM PSM-R: CGCAAGCTTTTATACAACTGCCCTC PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Pru du 6 P*-Pru du 6-21-74 aa P*-P 74 aa-R: GGTGATTCGAGAGGCGGC P*-G 73aa-F: CGCAACGCCCTTCGTAGACCTTCC Gly m 6 P*-Gly m 6-73-310 aa P*-G 310aa-R: ATTTCTTCTGCTTTTGCTTTGGCTTCCTCG GLG-F: AGATCTAGATCCAGAGAGCAGCCTCAGC Gly m 6 P*-Gly m 6-22-72 aa P*-G72aa-R: GTTGAGGGTGCAGCGAGAGAGGGC P*-P 75aa-F: ATTCAGCGCAACGGCCTA Pru du 6 P*-Pru du 6-75-551 aa PSM-R: CGCAAGCTTTTATACAACTGCCCTC PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Pru du 6 P*-Pru du 6-21-465 aa P*-P465 aa-R: CTGCTGCACCTCCTGGTCAAGAATTGC P*-G 409aa-F: GGACGGGTGCTGATCGTGCCA Gly m 6 P*-Gly m 6-409-495 aa GSM-R: CCCCAAGCTTCTAAGCCACAGCTCTCTTCTG PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Pru du 6 P*-Pru du 6- 21-195 aa P*-P 195 aa-R: GCGGGTCTTCTGGTGGCGGTCG P*-G 135 aa-F: AACTTCAGAGAGGGTGATTTGATCGC Gly m 6 P*-Gly m 6-135-310 aa P*-G 310 aa-R: ATTTCTTCTGCTTTTGCTTTGGCTTCCTCG PLG-F: AAATCTAGAGCACGCCAGTCCCAGT Pru du 6 P*-Pru du 6.01-21-166 aa P*-P 166aa-R:TCTTCCTTCTTCTTGTTGCTGTCTCCC P*-G 115aa-F: CAACAACCTCAACAAAGAGGACAAAGCAGC Gly m 6 P*-Gly m 6-115-213 aa P*-G 213aa-R:TTCTTGCTGATGCTTTCCTTTCTGGC P*-P284aa F:CAACAAGGAAGCGGCAACAACGTCTTCTCC Pru du 6 P*-Pru du 6.01-284-551 aa PSM-R: CGCAAGCTTTTATACAACTGCCCTC PSM-F: AAATCTAGAAACGGTCTTGAGGAGACCTTCTGC Pru du 6.01 Pru du 6.01 small subunit (PSM) PSM-R: CGCAAGCTTTTATACAACTGCCCTC

Production of Pru du 6.01 alanine mutants Residues in the HDX-MS identified peptides were selected for mutation to alanine based on their solvent accessibility in the prunin crystal structure (281Q, 282Q, 317Q, 318N, 320N, 326R, 328R, 461Q, 462E, 464Q, 465Q) with the primers listed in Table 5.2. Plasmids containing Pru du 6.01 cDNA served as the template and mutants were made with the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA) following the manufactures instructions. Plasmids were sequenced, transformed into E. coli Rosetta gamiB(De3)pLysS cells and purified as described above. These recombinant proteins were concentrated and either stored (briefly) at 4°C or frozen at -80°C until use in immunodot blotting assays.

Table 5.2. Primers for site directed mutagenesis of selected residues to alanine in Pru du 6.01. Residue Primer Name: Primer Sequence(5′-3′) 281F: caaccattcggacgtcccagagcacaagaacaacaagga Q281A 281R: tccttgttgttcttgtgctctgggacgtccgaatggttg 282F: cattcggacgtcccagacaagcagaacaacaaggaagcg Q282A 282R: cgcttccttgttgttctgcttgtctgggacgtccgaatg 317F: caggaacctccagggagcgaacgacaacaggaac Q317A 317R: gttcctgttgtcgttcgctccctggaggttcctg 318F: ggaacctccagggacaggccgacaacaggaaccaaa N318A 318R: tttggttcctgttgtcggcctgtccctggaggttcc 320F: ctccagggacagaacgacgccaggaaccaaatcatccg N320A 320R: cggatgatttggttcctggcgtcgttctgtccctggag 326F: caggaaccaaatcatcgcggtaaggggcaacctc R326A 326R: gaggttgccccttaccgcgatgatttggttcctg 328F: aggaaccaaatcatccgggtagcgggcaacctcgac R328A 328R: gtcgaggttgcccgctacccggatgatttggttcct 461F: gagatgcaattcttgacgcggaggtgcagcagggac Q461A 461R: gtccctgctgcacctccgcgtcaagaattgcatctc 462F: caattcttgaccaggcggtgcagcagggaca E462A 462R: tgtccctgctgcaccgcctggtcaagaattg 464F: cttgaccaggaggtggcgcagggacagctgtt Q464A 464R: aacagctgtccctgcgccacctcctggtcaag 465F: gaccaggaggtgcaggcgggacagctgttcat Q465A 465R: atgaacagctgtcccgcctgcacctcctggtc 32F: gtccgcagaaccaggcccagctcaaccagc C32A 32R: gctggttgagctgggcctggttctgcggac C65A 65F: ggaggacttccaggctgccggggtcgcc 65R: ggcgaccccggcagcctggaagtcctcc

Table 5.2. Continued Residue Primer Name: Primer Sequence(5′-3′)

108F: ggcagtgttctctggggcccctgagactttcgaa C108A 108R: ttcgaaagtctcaggggccccagagaacactgc 374F: gtcttgaggagaccttcgccagcttgaggttgaagg C374A 374R: ccttcaacctcaagctggcgaaggtctcctcaagac

Molecular modeling Molecular modeling was performed with chimera 1.6.1 (http://www.cgl.ucsf.edu/chimera/) using the prunin (PDB# 3FZ3) [49] and soybean glycinin homohexamer (PDB# 1OD5) A3B4 [96] crystal structures. The solvent accessible surface area (areaSAS) and solvent excluded surface area (areaSES) was calculated for each residue with the structure analysis tool in chimera.

Circular Dichroism (CD) spectroscopy All CD spectra were collected with the help of Dr. Claudius Mundoma. Optically clear protein solutions of prunin, MBP, recombinant Pru du 6.01, and alanine mutants at 5 µM in 10 mM potassium phosphate buffer (pH 7.6) were used for CD spectroscopy. The CD spectra were recorded with an AVIV spectropolarimeter (Model 202, Aviv Instruments, Inc.) at a wavelength range of β60−190 nm. Buffer alone was used as a standard for calibration of the CD instrument. Molar ellipticity per amino acid residue (θ) was calculated from the collected data (number of amino acids was calculated from the c-DNA derived amino acid sequences of the proteins, available at NCBI website, http://www.ncbi.nlm.nih.gov/protein/). The spectrum obtained for MBP was subtracted from all recombinant Pru du 6.01 spectra. The computer program, CDPro (http://lamar.colostate.edu/~sreeram/CDPro/index.html), was used to determine secondary structure (-helices, -sheets, -turns, and random coil) of the selected samples.

Separation of total IgE and IgG from pooled patients’ sera Total IgG was purified from pooled Pru du 6.01 reactive patients’ sera (#14, 55, 57) with a protein G affinity column. Pooled serum was passed over the column and bound IgG was eluted with 0.2 M glycine sulfate, pH 2.3. The eluate was immediately neutralized with 1.0 M Tris. Total IgE from pooled patients remained in the effluent. The purified IgG and IgE

85 fractions were then tested in enzyme linked immunosorbent assay (ELISA) to verify separation of these antibody populations (described below). For detection of bound antibodies, HRP– conjugated mouse anti-human IgE (Zymed Laboratories, Inc.) at a dilution of 1:1,000 or HRP– conjugated goat anti-human IgG (Sigma Aldrich) diluted to 1:80,000 in PBS-T was used. All samples were incubated with both secondary antibodies to verify the depletion of IgG from the effluent, its presence in the eluate, and the depletion of IgE in the eluate and its presence in the effluent.

ELISA and inhibition The ELISA assay was performed as previously described [97]. Briefly, native prunin (40 μg/mL) diluted in coating buffer (0.1 mol/L carbonate-bicarbonate buffer, pH 9.6) was coated (100 μL/well) onto the wells of 96-microwell flat bottom polystyrene microtiter ELISA plates (Costar, Cambridge, MA) at 37°C for 1 hr. Plates were washed 3 times between steps with PBS- T. Blocking was performed with PBS-T/5% (w/v) nonfat dry milk at 4°C o/n. Total IgE or IgG from pooled patients (#14, 55, 57) was diluted 1:2 (v/v) in PBS-T/5% (w/v) nonfat dry milk, then added to the coated wells (100 μL/well), and incubated at 37°C for 3 hr. After washing, 4C10 was diluted to 1:4000 in PBS-T and then added to wells (100 μL/well) for γ0 min at γ7°C. Bound 4C10 IgG was reacted with HRP–conjugated goat anti-mouse IgG (Jackson Immunoresearch Laboratories, Inc.) at a dilution of 1:1,000 and incubated for 1 hr at 37°C. IgG reactivity was detected by a colorimetric reaction with o-phenylenediamine (Zymed Laboratories

Inc.) and H2O2 as substrate. Reactions were quenched with H2SO4 and OD was measured in a KC4 v2.5 ELISA reader (Bio-Tek Instruments, Inc., Winooski, VT) at 495 nm. All assays were performed in triplicate. Controls included wells exposed to 4C10 without any inhibitor and wells exposed to IgE and IgG from an atopic individual without a history of tree nut allergies. OD values obtained for 4C10 binding with no inhibitor were normalized to 100% binding. The percentage of human IgE and IgG inhibition on 4C10 binding was calculated as follows: (M+, mAb 4C10 with inhibitor; M-, mAb 4C10 without inhibitor; NSB, non-specific baseline binding; OD, optical density).

Inhibition (%) = OD(M-) - OD(M+) x 100 OD(M-)

Results

Conformational sensitivity of the 4C10 epitope The mAb 4C10 was chosen for epitope characterization as this mAb was found to be highly reactive to native prunin and appeared to recognize a conformational epitope [168]. Immunoblot assays of whole almond extract and native prunin indicated that 4C10 strongly reacted with non-reduced but not reduced samples indicating the recognition of a labile epitope (Fig. 5.1A). To further assess the stability of this epitope, native prunin was subjected to various denaturing conditions prior to immunodot blotting and probing with 4C10 (Fig. 5.1B). The results confirmed that treatment with -ME and reducing buffer plus boiling eliminated 4C10 reactivity, indicating the recognition of a conformational epitope dependant on the intramolecular disulfide bond within the large subunit and/or the intermolecular bond association of the large and small subunits. Additional mAbs (4F10, 2A3, 2B4, 5D1) directed against sequential epitopes on prunin were used as controls (Fig. 5.1B). To further assess the role of disulfide bonding in 4C10 epitope expression, rPru du 6 was expressed in two bacterial strains: the traditional E. coli BL21(DE3) cells, which do not favor disulfide bond formation, and Rosetta gamiB(De3)pLysS cells which facilitate disulfide bond formation. Immunodot blot assays demonstrated that only expression of recombinant Pru du 6.01 in the cell strain that allows formation of disulfide bonds were reactive with 4C10 (Fig. 5.1C). Consequently, all further epitope mapping studies were performed with recombinant proteins synthesized by Rosetta gamiB(De3)pLysS cells.

4C10 recognizes an epitope targeted by prunin-reactive patients’ sera To determine if the epitope region targeted by 4C10 is also recognized by Pru du 6- reactive patients, an inhibition ELISA was performed. Pooled Pru du 6-reactive patients’ sera (#14, 55, 57) was separated into total IgG and IgE fractions and tested for the ability to inhibit 4C10 binding to prunin. Both fractions were found to block 4C10 binding by varying degrees when pre-incubated with prunin-coated ELISA plates prior to probing with 4C10 (Fig. 5.2). Incubation with total IgE resulted in a 51% inhibition of 4C10 binding and total IgG inhibited binding by 58% as compared to the uninhibited control (Fig. 5.2). No significant inhibition was observed when total IgG and IgE fractions from an atopic control patient served as inhibitors.

Overall, it appears that both human IgG and IgE binding epitopes (sequential and/or conformational) may overlap or sterically hinder mAb 4C10 binding to prunin.

Fig. 5.1. Immunoblot and immunodot blots. A) Immunoblot of 4C10 showing reactivity with non-reduced, but not reduced, almond extract and native prunin. B) Immunodot blot of native prunin treated with various denaturants followed by probing with five anti-almond mAbs. C) Immunodot blot demonstrating anti-almond mAb reactivity with recombinant Pru du 6 expressed in different bacteria cell strains. NR = non-reducing buffer conditions, R = reducing buffer conditions, M = size marker, MBP = maltose binding protein, NC = negative control.

Fig. 5.2. Inhibition ELISA demonstrating the ability of Pru du 6.01-reactive patient antibodies to inhibit 4C10 binding to native prunin expressed as a percent of uninhibited control. NC = atopic serum negative control.

HDX identification of peptides masked by 4C10 binding MAb 4C10 was found to be reactive with native prunin purified from almond extract and rPru du 6.01 (Fig. 5.1). Reactivity with 4C10 was eliminated when prunin was denatured and reduced indicating the recognition of a conformational epitope. To identify peptides involved in the 4C10 conformational epitope, H/D exchange was performed with free prunin and prunin-

4C10 complex. 4C10 was incubated with prunin in the presence of D2O to generate a soluble Ag-mAb complex, digested, and the resultant peptides analyzed for deuterium uptake by MS. Both Pru du 6 isoforms are present in native prunin and peptides from each were recovered (Fig. 5.3). The segments covered 72% of Pru du 6.01 and 60% of Pru du 6.02. All segments were identified in at least two of the three replicates for every H/D exchange period. Only peptides corresponding to the sequence of Pru du 6.01 showed a deuterium uptake difference. These results were consistent with those of the immunodot blot assays in which 4C10 bound exclusively to Pru du 6.01 (Fig. 5.1C and Fig. 5.3). The binding of mAb 4C10 to prunin affords significant protection from HDX for Pru du 6.01 aa segments 184-190, 200-203, 281-288, 314- 328, 395-400, 401-405, 450-474, and 496-507 (Fig. 5.3). These peptides are likely to be involved in 4C10 conformational epitope or are otherwise blocked upon mAb binding to prunin.

Molecular modeling of HDX-identified peptides A molecular model of native prunin was obtained from the protein data base (PDB# 3FZ3) [49]. Native prunin is biosynthesized as a large proprotein that is posttranslationally cleaved into larger acidic (367 aa) and smaller basic (184 aa) subunits that remain associated via disulfide bonds [39;40;49;135]. The uncleaved proprotein normally forms trimers which, upon cleavage to the mature native form, dimerize via association of the hydrophobic faces (IE face) to form hexamers [40;49;96]. Peptides demonstrating a difference in deuterium uptake are highlighted on the prunin model (Fig. 5.4). As the hexameric form of prunin was used in the HDX assay, those differentially labeled peptides localized to the solvent-exposed IA face are most likely to be interacting with 4C10 directly, whereas those labeled peptides located on the occluded IE face are likely the result of conformational shifts due to mAb binding (Fig. 5.4A). Judging from the atomic model, significant portions of peptides aa 281-288, 314-326, and 450-474 are solvent-exposed on the IA face and peptides aa 184-190, 200-203, 395-400, 401-405, and 496-507 are either buried within the monomer or are predominantly located on the occluded IE face (Fig. 5.4B). Peptides on the IA face were found to be clustered in two distinct regions on the prunin monomer (Fig. 5.4B). Due to the spatial separation of the identified regions in a given monomeric subunit, it is unlikely that a single 4C10 binding site is directly interacting with both. However, in the context of the hexamer, the labeled peptides on adjacent large and small subunits do lie in close proximity (Fig.

5.4C). These data suggest that 4C10 may be directly interacting with peptides on one subunit and covering or blocking solvent access to a region on the adjacent prunin monomer. The specific amino acids corresponding to the HDX-defined peptide segments on the IA face are highlighted on the prunin model in figure 5.4.

Fig. 5.3. Sequence coverage for the analyzed native prunin-4C10 complex. Peptides indicated in red were found to have deuterium uptake difference between the free prunin and prunin-4C10 complex of greater than 30%.

Underlined amino acids correspond to the signal sequence which is not found on the mature protein. Asterisks indicate the large (acidic)-small (basic) subunit cleavage site (aa 367/368) in the mature protein.

Fig. 5.4. Structural models of prunin (PDB# 3FZ3). A) Side view of the prunin hexamer showing the lateral IA faces and the IE face-to-face association of two trimers. One of the prunin monomers is color coded (large (acidic) subunit, yellow; small (basic) subunit, blue) and the additional monomers are represented in light grey and dark grey. Peptides identified by HDX are shown in green on one monomer. B) Top view of the prunin trimer. The asterisk indicates the black line separating the large and small subunit in the color coded monomer. The peptides identified by HDX are shown in green. Surface exposed residues on the HDX-identified peptides are indicated by arrows. C) HDX-identified peptides are shown on each of three monomer in green, purple, and magenta, respectively.

Immunodot blot screening of Pru du 6.01 alanine mutants To further fine map the 4C10 epitope, solvent accessible residues in the HDX-identified peptides were substituted with alanine and tested for mAb reactivity. The results show that of the 11 residues screened, alanine substitutions completely abolished 4C10-reactivity for two (R328A and E462A), greatly reduced binding for four (N320A, R326A, Q461A, and Q464A), and had little to no effect for five (Q281, Q281A, Q317, N318A and Q465) (Fig. 5.5). The specific residues identified by mutagenesis likely represent the core of the 4C10 epitope, but it is possible that additional contact or otherwise structurally important residues may lie in adjacent regions or on peptide segments not recovered in HDX. To investigate this possibility, chimeric molecules in which orthologous segments of Pru du 6 and the soybean 11S globulin homolog, Gly m 6, were exchanged and probed with 4C10 (described below).

Fig. 5.5. Immunodot blot and structural models of prunin (PDB# 3FZ3). A) Immunodot blot of Pru du 6.01 alanine mutants probed with 4C10. MBP = maltose binding protein, nPru = native prunin. B) Top view of the prunin trimer with the cysteine residues involved in disulfide bonds indicated by arrows.

Assessment of the role of disulfide bonds in 4C10 epitope expression The loss of reactivity of Pru du 6 with mAb 4C10 following reduction suggested the importance of the disulfide bonds in stabilizing the structure of the epitope (Fig. 5.1C). To further substantiate this, alanine substitutions were made in cysteine residues involved in the disulfide bond located within the large subunit (residues 32 and 65) and, independently, the disulfide bond linking the large and small subunits (residues 108 and 374). Mutation of intrasubunit residues 32 and 65 to alanine completely eliminated 4C10 reactivity indicating that this bond plays a critical role in fostering the 4C10 conformational epitope (Fig. 5.5). In contrast, mutation of intersubunit residues 108 and 374 had little effect on 4C10 reactivity, suggesting that this bond does not contribute structurally to the epitope. The specific cysteine

92 residues involved in the disulfide bonds are indicated by arrows on the IA face of the prunin model in figure 5.5B. To analyze the effect of these mutations on the secondary structure of Pru du 6.01 circular dischorism spectroscopy was performed (Fig. 5.6). In the native state prunin was estimated to have secondary structures composed of α-helices (10 % respectively), -sheets and turns (66%), and random coil (20%). These values are similar to those previously reported for prunin [168;170], but are somewhat different from the recent reports by Albilos et al. [171], who found higher helix (34.3%) and lower -structure (37.8%) in isolated prunin. This difference could be attributed to enzymatic degradation during in vivo (in planta) synthesis, fractionation or purification, strain/cultivar differences, or variations in the developmental stages of the nut source. Recombinant Pru du 6.01 was found to be composed of α-helices (5% respectively), - sheets and turns (72%), and random coil (19 %) (Fig. 5.6). The cysteine mutants had comparable amounts of α-helices (γβ & 65A, γ%; 108 & γ74A, γ%; and all Cys mutants, 4%) and -sheets and turns (32 & 65A, 63%; 108 & 374A, 67%, all Cys mutants, 66%) as the wild type recombinant Pru du 6.01 (Fig. 5.6). In contrast, cysteine mutants displayed a higher degree of disordered random coil structure (32 & 65A, 33%: 108 & 374A, 26%; and all Cys mutants, 30%) as compared to recombinant Pru du 6.01. The increase in disordered structure likely explains the loss of the conformational epitope targeted by 4C10.

Immunodot blot screening of Pru du 6/Gly m 6 chimeric constructs and isolated subunits To further localize the 4C10 conformational epitope, chimeric molecules were generated by substituting Pru du 6.01 segments with orthologous segments from the 11S globulin soybean allergen, Gly m 6. Alignment of Pru du 6 (PBD# 3FZ3) and Gly m 6 (PDB# 1od5) crystal structures demonstrated a high degree of structural similarity, indicating that Gly m 6 is a suitable stand-in for segments of Pru du 6 (Fig. 5.7A). A variety of chimeric molecules were constructed in an attempt to define the 4C10-reactive segment(s) identified by HDX and to determine if regions that were not recovered in HDX are also involved in the epitope (Fig. 5.7B). These chimeric molecules were screened by immunodot blot for maintenance or loss of 4C10 reactivity (Fig. 5.7C). The results demonstrated that the chimeras could remain reactive upon Gly m 6 substitutions for Pru du 6 segments within the middle of the large subunit but not for substitutions at the N- or C-termini of the large or small subunit (#7, 8, 9, 10) (Fig. 5.7). A

93 construct containing Pru du 6 at the N-terminal (aa 21-74), Gly m 6 in the large subunit (aa 75- 310) and the Pru du 6 small subunit (#6) was also not reactive. Additionally, expression of free large and small Pru du 6 subunits and substitution of entire Pru du 6 subunits with Gly m 6 resulted in a loss of 4C10 reactivity (#4, 5, 13, and 14) (Fig. 5.1C and Fig. 5.7). These results indicate that expression of the 4C10 epitope is dependent upon the large and small subunit association.

Fig. 5.6. Circular dichroism analysis of A) native prunin B) maltose binding protein (MBP) and C) recombinant Pru du 6.01 wild type (wt) and cysteine mutants.

Fig. 5.7. Structural models, chimeric molecules and dot blot assays. A) Alignment of Pru du 6 (3FZ3) and Gly m (1od5) ribbon diagrams as viewed from the IA face. Green, Pru du 6; Yellow, Gly m 6. B) Schematic representation of Pru du 6.01, Gly m 6 and chimeric molecules. Yellow = Pru du 6.01; orange = Pru du 6.02; grey = Gly m 6; green = native prunin; blue = MBP. Note all molecules have N-terminal associated MBP, which is not shown. B) Immunodot blot of chimeric molecules probed with 4C10 and control mAbs (4F10, 2A3, and 2B4) directed against sequential epitopes on Pru du 6.

Residues involved in the 4C10 conformational epitope HDX assays identified several segments of Pru du 6.01 (aa 184-190, 200-203, 281-288, 314-328, 395-400, 401-405, 450-474, and 496-507) that may be involved in the 4C10 epitope. Analyses of 4C10 reactivity to alanine point mutants and chimeric molecules were performed to verify specific peptides involved in the conformational epitope and to identify key residues. Chimeric molecules containing N-terminal Gly m 6 substitution (aa 21-74, #7) abrogated 4C10 reactivity (Fig. 5.7). Peptides corresponding to aa 46-74 were recovered in HDX but did not show a deuterium uptake difference between free prunin and 4C10 bound prunin. Peptides corresponding to aa 21-45 were not recovered in the HDX assay. The overall loss of 4C10 reactivity to the chimeric molecule and analysis of the HDX data indicates that residues aa 21-45 are likely involved in the 4C10 epitope. Molecules in which the middle of the Pru du 6 large

95 subunit was substituted (aa 115-213, #9) with Gly m 6 maintained 4C10 reactivity, whereas substitution at the C-termini of the large subunit (aa 135-310, #8) eliminated 4C10 reactivity (Fig. 5.7). Analysis of 4C10 reactivity to these molecules indicates that regions at the N and C- termini (aa 21-166 and aa 284-367) of the large subunit are likely to be involved in the epitope. HDX peptides showing a deuterium uptake difference in these regions identified several peptides that were localized to the IA face (aa 281-288, 314-328, and 450-474). Solvent-exposed residues in these peptides were mutated to alanine. Screening of these mutants showed that substitutions N320A, R326A, R328A, E461A, Q462A, and Q464A resulted in a significant reduction or eliminated of 4C10 binding as compared to the unmutated control. In contrast, alanine mutations in peptide aa 281-288 had no effect on 4C10 reactivity (Fig. 5.5). Comparison of the aa sequence of the two Pru du 6 isoform sequences shows several differences (aa 328, 461 and 464) in the suspect regions which could explain the ability of 4C10 to bind Pru du 6.01 but not 6.02 (Fig. 5.8A). Collectively, these results indicate that the 4C10 conformational epitope is comprised of three discontinuous strands, aa 21-45, 320-328, and 460-465.

Comparison of 4C10 conformational epitope with human IgE binding epitopes The relative location of the 4C10 conformational epitope was compared to the previously mapped sequential Pru du 6 patient IgE-reactive epitopes [97]. Of the six sequential epitopes identified on Pru du 6.01, epitopes aa 118-132, 145-159, and 281-295 were in close proximity to the peptides likely involved in the 4C10 epitope (Fig. 5.8B). Residues involved in the sequential epitope aa 281-295 were found to be sterically occluded on the adjacent prunin monomer upon 4C10 binding in the HDX assay. Comparison with the conformational IgE binding epitopes identified by phage display found that several residues in epitope #1 E49, N78, L80, L82, P83, L244, A245, N290, R312, L314, G316, N322, I325, Q326 overlapped with those identified in the 4C10 epitope. This suggests that these epitopes define a region of high immunogenicity on prunin. The clustering and epitope overlap likely accounts for the observation that patient IgE can inhibit the binding of mAb 4C10 to this allergen (Fig. 5.2).

Fig. 5.8. Pru du 6 sequence alignment and structural model. A) Sequence alignment of Pru du 6 peptides involved in the 4C10 epitope. Asterisk (*) denotes aa identity, colon (:) indicates aa similarity. B) Structural model of prunin (PDB# 3FZ3) with peptides involved in the 4C10 epitope highlighted in green. Sequential IgE binding epitopes previously identified on Pru du 6 are highlighted in red [97].

Discussion

The identification of epitopes is critical for understanding the allergenic nature of foods, the etiology of food allergy, and the development of immunotherapies for the treatment of food allergies. Extensive research has been performed to identify sequential epitopes on food allergens. Tree nut sequential epitopes have been described for pecan (Car i 1and 2) [140;141], cashew (Ana o 1, 2, 3) [29;98;142], walnut (Jug r 1 and 4) [101;111], hazelnut (Cor a 9) [102], and almond (Pru du 6) [97]. In contrast to the abundant information on sequential allergen epitopes, few conformational epitopes have been identified on tree nut allergens, a situation resulting from the technical challenges associated with their characterization. Methods to identify and characterize conformational epitopes include large scale mutagenesis, X-ray crystallography of immune complexes, negative stain immunoelectron microscopic analysis of individual allergen-mAb immune complexes, NMR, phage display to identify allergen mimotopes, and the generation of chimeric molecules [10;52;58;124;131].

Recently, hydrogen/deuterium exchange footprint analysis, monitored by 14.5 T Fourier transform ion cyclotron resonance mass spectrometry (HDX-MS), has been applied to conformational epitope mapping studies [163;164]. Analysis of a mAb directed against human thrombin successfully identified a conformational IgG-binding epitope composed of two adjacent discontinuous surface strands by HDX-MS [166]. Comparison of the epitope recognized by a mAb directed against horse cytochrome c by HDX-MS found that it correlated with the residues identified in both X-ray crystallography and NMR studies [163]. HDX-MS has also been applied in epitope mapping studies of the recombinant cashew allergen, Ana o 2 [164]. The IgG epitopes identified by an anti- conformational and an anti-sequential mAbs overlapped with the epitopes previously identified on Ana o 2 in mutagenesis studies and by probing short synthetic overlapping peptides [164]. Collectively, these studies demonstrate the utility of HDX- MS for epitope mapping and validate the application of this technique for mapping the more difficult to identify conformational epitopes. In the present study, a murine mAb antibody, 4C10, was used to assess the ability of HDX-MS to identify an unknown epitope on the almond allergen, Pru du 6. This mAb is of particular interest because it appears to recognize a conformational epitope that is dependent on the association of the large and small subunits and is susceptible to denaturation (Fig. 5.1). Inhibition ELISA assays showed that both IgG and IgE from Pru du 6-reactive patients could inhibit 4C10 binding to prunin to varying degrees (Fig. 5.2). These results suggests that the 4C10 epitope, recognized by this murine IgG mAb, overlaps epitopes (sequential and/or conformational) recognized by human patient IgG and, more importantly with respect to almond allergy, IgE epitopes. As such, information gained through its study should shed light on the nature of the epitopes on this allergenic protein that are targeted by the immune system. HDX-MS assays were performed on immune complexes composed of native prunin and 4C10. Because recombinant Pru du 6 is in the uncleaved precursor form of the protein, naturally cleaved native prunin was utilized in the HDX-MS assay to ensure that the allergen expressed a complete set of epitopes. HDX-MS was able to identify several peptides that demonstrated a deuterium uptake difference between free prunin and the prunin-4C10 complex (Fig. 5.3). To help distinguish between peptides likely involved in the 4C10 epitope and those differentially labeled as a result of conformational perturbation upon 4C10 binding, labeled peptides were mapped onto the prunin crystal structure (PDB# 3FZ3) (Fig. 5.4). Several peptides (aa 184-190,

200-203, 395-400, 401-405, and 496-507) were buried on the IE interface of the prunin hexamer and are thus unlikely to directly contribute to mAb binding. The identification of candidate peptides on the solvent-exposed IA face of the hexamer (aa 281-288, 314-328, and 450-474) allowed the construction of targeted alanine mutants and chimeric molecules, which greatly reduced the time and number of constructs needed to fine map the epitope (Fig. 5.5 and 5.7). Analysis of 4C10 reactivity to these various recombinant molecules indicated that the conformational epitope is comprised of three discontinuous strands, aa 21-45, 320-328, and 460- 465, that are held in close proximity due to the secondary and tertiary structure of prunin (Fig. 5.4, 5.5, 5.7 and 5.8). Comparison of the location of the peptides involved in the 4C10 epitope with the previously mapped sequential IgE epitopes on Pru du 6 [97] did not reveal any direct epitope overlap (Fig. 5.8B). However, several epitopes (aa 118-132, 145-159, and 281-295) were in close proximity to the 4C10 epitope on the crystal structure of Pru du 6, which could explain the IgE inhibition of 4C10 binding (through steric clashes) observed in ELISA assays (Fig. 5.2). Though epitopes tend to be categorized as either sequential or conformational, it should be noted that individual epitopes may have a mixture of both conformational and sequential characteristics as short stretches of continuous residues may be part of more complex conformational epitopes [121;129]. Therefore, sequential epitopes identified on Pru du 6 may be part of larger epitopes or could represent only the epitope core with additional contact residues that were undetected in the mapping assays. Further assessment with patient IgE is needed to fully define the presence and nature of conformational epitopes on Pru du 6 and to determine if these more complex epitopes directly overlap with that of 4C10. In summary, these results indicate that HDX-MS is a technique that can aid in the identification and characterization of conformational epitopes, especially when coupled with atomic modeling, by allowing one to narrow the search to specific regions on the molecule. This approach reduces or eliminates the need for extensive chimeric and mutated molecules, which can speed up the overall epitope identification process.

Acknowledgement We would like to thank Dr. Alan G. Marshall, Chemistry & Biochemistry and National High Magnetic Field Laboratory, Florida State University, Tallahassee, FL, for his expertise and help in the HDX assay design and performance.

CHAPTER SIX

CONCLUSION

Food allergy is a growing global concern as the number of affected individuals continues to rise. Allergic reactions to tree nuts are common and it is now estimated that 0.6% of the US population and up to 1.4 % of the European population are allergic to one or more nuts [19;20;160]. Unlike some food allergies, tree nuts can cause severe, life threatening reactions that persist throughout life. Almonds (Prunus dulcis) are one of the most commonly consumed tree nuts in the US [161]. The per capita consumption of tree nuts from 2010 is reported as almond (1.6 lb), walnut (0.7 lb), pistachios (0.54 lb), pecan (0.54 lb), hazelnut (0.05 lb), and mixed nuts (cashew/macademia/Brazil nut-1.6 lbs) [172]. This study set out to investigate both IgE and IgG reactivity to prunin (Pru du 6), an 11S globulin from almond nut. The 11S globulins represent a family of abundant seed storage proteins and have been identified as major allergens in cashew, pecan, pistachio, walnut, and peanut [29;31;32;104;141]. We have clinically characterized and mapped the Ig-binding epitopes of this protein in almond nut. These efforts were aimed at contributing to our understanding of allergen-antibody interaction, the detection of almond allergens in commercial foods, and more broadly, the future development of epitope mapping techniques, and immunotherapies for the treatment of food allergies. The stability of both IgE and IgG binding epitopes on Pru du 6 was assessed by treating the native and recombinant proteins with various denaturants. Immunodot blotting assays using almond-allergic patients and mAbs revealed the presence of both stable (sequential) and unstable (conformational) epitopes. These epitopes were localized on Pru du 6 by utilizing solid-phase overlapping peptide analysis (SPOTs assay), phage display, and hydrogen/deuterium exchange monitored by 14.5 T Fourier transform ion cyclotron resonance mass spectrometry (HDX-MS). The localization of IgE/G epitopes on the surface of Pru du 6 provides vital information to further our understanding of allergen-antibody interactions. The results obtained in our studies revealed that epitopes, both sequential and conformational, were clustered in several distinct areas on the Pru du 6 protein. This information suggests that these areas are more immunogenic in nature as both human IgE, derived from naturally sensitized patients, and murine IgG, elicited during an immunization, were directed against similar regions. Additionally, the comparison of

100 the location of these epitopes with those identified on other allergenic 11S globulins showed significant positional overlap [97;102]. This epitope overlap among allergenic 11S globulin proteins indicates that there may be an underlying molecular basis for the generation of antibodies directed against these regions. The comparison of human IgE and murine IgG-binding epitopes found direct overlap between several epitopes identified on Pru du 6. The overlap observed in our studies indicates that mAb IgG reactivity is likely to mimic the reactivity of human IgE, at least with respect to the overlapping epitopes. This finding is of particular importance as the amount of IgE in serum is very low, typically 0.5-50 μg/ml, with allergen specific IgE representing only a small fraction of that amount [173-75]. These low levels of specific IgE are often a limiting factor in the development of novel techniques for epitope identification and analysis on allergens. Therefore, the overlap observed between human and murine epitopes would be particularly useful in the future design of epitope mapping techniques as mAbs can be suitable surrogates for the more limited patient IgE. Such an approach was utilized in Ch 5 where a mAb, 4C10, which competes with patient IgE and IgG binding to Pru du 6, was used in the novel epitope mapping technique HDX-MS. The results gathered in this study demonstrated the utility of HDX-MS for the identification of human allergy relevant conformational epitopes on targeted tree nut allergens. Epitopes tend to be categorized as either sequential or conformational and it is believed that an epitope type predominates on certain allergenic molecules. With respect to food allergens, sequential epitopes are thought to predominate, as they are commonly subjected to both food processing and gastric digestion before interacting with the immune system [50]. However, the relative contribution of the two epitope types to food protein allergenicity (as compared to aeroallergens) has become a topic of debate in recent years. The expression of both epitope types on prunin was investigated by using a negative selection assay designed to determine the percentage of conformational and sequential epitope binding IgE. The assay utilized a selection approach in which the anti-sequential IgE was removed from individual serum by solid-phase adsorption and the resultant depleted serum fraction assayed by ELISA. The two patients used (patient #8 and #55) showed different levels of IgE directed against each epitope type indicating that IgE is generated against both types during sensitization. Furthermore, we found that the levels of sequential and conformational epitope binding IgE varied between prunin-sensitized individuals. These observations shed light on the presence of

101 conformational epitopes on tree nut allergens and indicate that generalizations regarding the expression of rigid epitopes cannot be made for type 1 food allergens. Taken together, our experiments represent the most comprehensive epitope mapping study of the almond allergen, Pru du 6. The identification of shared and unique IgE/G epitopes, either sequential or conformational, may have both fundamental and clinical value. This information provides a better understanding of the structural regions of Pru du 6 which elicit IgE/G responses and may lead to the development of new immunological reagents for allergy diagnosis, epitope mapping, and specific immunotherapy for the treatment of almond allergy. Our finding provide the foundation for future studies on this allergen which should focus on the analysis of the effect of various food processing techniques on allergen structure, the identification of T cell epitopes, and the generation of modified proteins for potential use in immunotherapeutic applications.

102

APPENDIX A

HUMAN SUBJECT COMMITTEE APPROVAL MEMORANDUM

103

LstrteUNIVERSITY

Office of the! VIce PI'CIIIdcnt ror Rc,..... rcb lliiiMilll SubjootH Committee 'I'IIU.IUI.'W)(-, Fi41rida 323116-2741 (350) 644-8673 • IIAX (850) 644-4391

RE-APPROVAL MEMORANDUM

Date: 5/14!2009

To: Shridhnr Sathe Jssathc(fl/5ll.cdu)

Address: 1493 Dept.: NUTRn"ION FOOD AND MOVEMENT SCIENCES

From: Thomas L. Jacobson, Chair

Re: Rc-approval ofUsc of I hunan subjects in Research ld•mtificationlllld chnrtlctcrizntion of tree nut allergens

Your request to continue the research project listed above involvine human subjects has been approved by the Human Subjects Committee. If your project ha$ not been completed by 5112120 I 0, you an: must request renewed approval by the Committee.

If you submitted a proposed C

By copy of this memorandum, the Chair of your department and/or your major professor are reminded of their responsibility Cor being informed concerning research projeers involving human subjects in their department. They are advised to review the protocols as often as neceSSllry 'to insure tl1at the project is being conducted in compliance with our institution and with DH!IS reguJations.

Cc: Rahrwn Arjmaudi. Chair ｦ｢｡ｲｪｭｲｵｾ､ｩ｀ｦＮｷＮ･､ｵ｝＠ HSC No. 2009.2685

104

APPENDIX B

INFORMED CONSENT FORM

105

REFERENCES

1. Bruijnzeel-Kooman C, Ortolani C, Aas K. Adverse reactions to food: position paper. Allergy. 1995; 50:623-35.

2. Sicherer S.H., Sampson HA. Food allergy. J. Allergy Clin. Immunol. 2006; 117:S470-5.

3. Janeway CA, Trahvers P, Walport M, Shlomchik MJ. ImmunoBiology the immune system in health and disease 6th edition. Garland Publishing Inc. 2005;517-50.

4. Sampson HA. Update on food allergy. J. Allergy Clin. Immunol. 2004; 113:805-19.

5. Rolland JM, O'Hehir RE. Latex allergy: a model for therapy. Clin. Exp. Allergy. 2008; 38:898-912.

6. Bhalla PL, Singh MB. Biotechnology-based allergy diagnosis and vaccination. Trends Biotechnol. 2008; 26:153-61.

7. Valenta R, Kraft D. Recombinant allergens: from production and characterization to diagnosis, treatment, and prevention of allergy. Methods. 2004; 32:207-8.

8. Untersmayr E, Jensen-Jarolim E. Mechanisms of type I food allergy. Pharmacol. Ther. 2006; 112:787-98.

9. Kay A.B. Allergy and allergic diseases. First of two parts. N. Engl. J. Med. 2001; 344:30-7.

10. Riemer A, Scheiner O, Jensen-Jarolim E. Allergen mimotopes. Methods. 2004; 32:321-7.

11. Bjorksten B. Genetic and environmental risk factors for the development of food allergy. Curr. Opin. Allergy Clin. Immunol. 2005; 5:249-53.

12. Lack G. Epidemiologic risks for food allergy. J. Allergy Clin. Immunol. 2008; 121:1331-6.

13. Kay A.B. Allergy and allergic diseases. Second of two parts. N. Engl. J. Med. 2001; 344:109-13.

14. Hong X, Tsai HJ, Wang X. Genetics of food allergy. Curr. Opin. Pediatr. 2009; 21:770-6.

15. Yilmaz V, Yentur SP, Saruhan-Direskeneli G. IL-12 and IL-10 polymorphisms and their effects on cytokine production. Cytokine. 2005; 30:188-94.

16. Ochs HD, Gambineri E, Torgerson TR. IPEX, FOXP3 and regulatory T-cells: a model for autoimmunity. Immunol. Res. 2007; 38:112-21.

17. Larché M. Peptide immunotherapy for allergic diseases. Allergy. 2007; 62:325-31.

106

18. Cookson W. Genetics and genomics of asthma and allergic diseases. Immunol. Rev. 2002; 190:195-206.

19. Sicherer SH, Munoz-Furlong A, Sampson HA. Prevalence of peanut and tree nut allergy in the United States determined by means of random digit dial telephone survey: a 5-year follow-up study. J. Allergy Clin. Immunol. 2003; 112:1203-7.

20. Sicherer SH, Muñoz-Furlong A, Godbold JH, Sampson HA. US prevalence of self-reported peanut, tree nut, and sesame allergy: 11-year follow-up. J Allergy Clin Immunol. 2010; 125:1322-6

21. Breiteneder H, Radauer C. A classification of plant food allergens. J. Allergy Clin. Immunol. 2004; 113:821-30.

22. Radauer C, Breiteneder H. Evolutionary biology of plant food allergens. J. Allergy Clin. Immunol. 2007; 120:518-25.

23. Crespo JF, Jamea JM, Fernandez-Rodriguez C, Rodriguez J. Food Allergy: nuts and tree nuts. Brit. J. of Nutrition. 2006; 96:95-102.

24. Breiteneder H, Mills ENC. Plant food allergens---structural and functional aspects of allergenicity. Biotechnol. Adv. 2005; 23:395-9.

25. Hoffmann-Sommergruber K. Pathogenesis-related (PR)-proteins identified as allergens. Biochem. Soc. Transactions. 2002; 30:930-40.

26. Shutov AD, Baumlein H, Blattner FR, Muntz K. Storage and mobilization as antagonistic functional constraints on seed storage globulin evolution. J. Exp. Bot. 2003; 54:1645-54.

27. Shewry PR, Napier JA, Tatham AS. Seed storage proteins: structures and biosynthesis. Plant Cell. 1995; 7:945-56.

28. Beyer K, Grishina G, Bardina L, Grishin A, Sampson HA. Identification of an 11S globulin as a major hazelnut food allergen in hazelnut-induced systemic reactions. J. Allergy Clin. Immunol. 2002; 110:517-23.

29. Wang F, Robotham JM, Teuber SS, Sathe SK, Roux KH. Ana o 2, a major cashew (Anacardium occidentale L.) nut allergen of the legumin family. Int Arch Allergy Immunol 2003; 132:27-39.

30. Wallowitz M, Peterson WR, Uratsu S, Comstock SS, Dandekar AM, Teuber SS. Jug r 4, a legumin group food allergen from walnut (Juglans regia Cv. Chandler). J. Agric. Food Chem. 2006; 54:8369-75.

31. Rabjohn P, Helm EM, Stanley JS, West CM, Sampson HA, Burks AW, Bannon GA. Molecular cloning and epitope analysis of the peanut allergen Ara h 3. J. Clin. Invest. 1999; 103:535-42.

107

32. Ahn K., Bardina L., Grishina G., Beyer K., Sampson H.A. Identification of two pistachio allergens, Pis v 1 and Pis v 2, belonging to the 2S albumin and 11S globulin family. Clin. Exp. Allergy. 2009; 39:926-34.

33. Hsiao ES, Lin LJ, Li FY, Wang MM, Liao MY, Tzen JT. Gene families encoding isoforms of two major sesame seed storage proteins, 11S globulin and 2S albumin. J. Agric. Food Chem. 2006; 54:9544-50.

34. Nielsen NC, Dickinson CD, Cho TJ, Thanh VH, Scallon BJ, Fischer RL, Sims TL, Drews GN, Goldberg RB. Characterization of the glycinin gene family in soybean. Plant Cell. 1989; 1:313-28.

35. Helm RM, Cockrell G, Connaughton C, Sampson HA, Bannon GA, Beilinson V, Nielsen N, Burks. AW. A Soybean G2 Glycinin Allergen. Int. Arch. Allergy Immunol. 2000; 123:213-9.

36. Beardslee TA, Zeece MG, Sarath G, Markwell JP. Soybean glycinin G1 acidic chain shares IgE epitopes with peanut allergen Ara h 3. Int. Arc. Allergy Immunol. 2000; 123:299-307.

37. Natarajan SS, Xu C, Bae H, Caperna TJ, Garrett WM. Characterization of storage proteins in wild (Glycine soja) and cultivated (Glycine max) soybean seeds using proteomic analysis. J. Agric. Food Chem. 2006; 54:3114-20.

38. Beyer K, Grishina G, Bardina L, Sampson HA. Identification of 2 new sesame seed allergens: Ses i 6 and Ses i 7. J. Allergy Clin. Immunol. 2007; 119:1554-6.

39. Garcia-Mas J, Messeguer R, Arus P, Puigdomenech P. Molecular characterization of cDNAs corresponding to genes expressed during almond (Prunus amygdalus Batsch) seed development. Plant Mol. Biol. 1995; 27:205-10.

40. Shewry PR, Jenkins JA, Beaudoin F, Mills EN. The classification, functions and evolutionary relationships of plant proteins in relation to food allergies. In: Mills EN, Shewry PR, eds. Malden, MA: Blackwell Publishing Ltd., 2003: 24-41.

41. Breiteneder H, Radauer C. A classification of plant food allergens. J. Allergy Clin. Immunol. 2004; 113:821-30.

42. Sathe S, Wolf W, Roux K, Teuber S, Venkatachalam M, Sze-Tao K. Biochemical characterization of amandin, the major storage protein in almond (Prunus dulcis L). J. Agric. Food Chem. 2002; 50:4333-41.

43. Sathe S.K. Isolation and partial characterization of the major protein in almonds (Prunus amygdalus). Inst. Food Technol. Ann. Mtg. Book of Abstracts 1992;76.

44. Wolf W, Sathe S. Ultracentrifugal and polyacrylamide gel electrophoretic studies of extractability and stability of almond meal proteins. J. Sci. Food Agric. 1998; 78:511-21.

45. Sathe SK, Teuber SS, Gradziel TM, Roux KH. Electrophoretic and immunological analyses of almond (Prunus dulcis L.) genotypes and hybrids. J. Agric. Food Chem. 2001; 49:2043-52.

108

46. Roux KH, Teuber SS, Robotham JM, Sathe SK. Detection and stability of the major almond allergen in foods. J. Agric. Food Chem. 2001; 49:2131-6.

47. Roux K, Teuber S, Robotham J, Sathe S. Detection and stability of the major almond allergen in foods. J. Agric. Food Chem. 2001; 49:2131-6.

48. Albillos SM, Menhart N, Fu TJ. Structural stability of Amandin, a major allergen from almond (Prunus dulcis), and its acidic and basic polypeptides. J. Agric. Food Chem. 2009; 57:4698-705.

49. Jin T, Aibllos SM, Guo F, Howard A, Fu TJ, Kothary MH, Zhang YZ. Crystal structure of Prunin-1, a major component of the almond (Prunus dulcia) allergen Amandin. J. Agric. Food Chem. 2009; 57:8643-51.

50. Lin J, Sampson HA. The role of immunoglobulin E-binding epitopes in the characterization of food allergy. Curr. Opin. Allergy Clin. Immunol. 2009; 9:357-63.

51. Bannon GA. What makes a food protein an allergen? Curr. Allergy Asthma Rep. 2004; 4:43- 6.

52. Gershoni JM, Roitburd-Berman A, Siman-Tov DD, Tarnovitski Freund N, Weiss Y. Epitope mapping: the first step in developing epitope-based vaccines. BioDrugs. 2007; 21:145-56.

53. Barlow DJ, Edwards MS, Thornton JM. Continuous and discontinuous protein antigenic determinants. Nature. 1986; 322:747-8.

54. Vila L, Beyer K, Jarvinen KM, Chatchatee P, Bardina L, Sampson HA. Role of conformational and linear epitopes in the achievement of tolerance in cow's milk allergy. Clin. and Exper. Allergy. 2001; 31:1599-606.

55. Jarvinen KM, Beyer K, Vila L, Chatchatee P, Busse PJ, Sampson HA. B-cell epitopes as a screening instrument for persistent cow's milk allergy. J. Allergy Clin. Immunol. 2002; 110:293- 7.

56. Ayuso R, Sánchez-Garcia S, Lin J, Fu Z, Ibáñez MD, Carrillo T, Blanco C, Goldis M, Bardina L, Sastre J, Sampson HA. Greater epitope recognition of shrimp allergens by children than adults suggests that shrimp sensitization decreases with age. J. Allergy Clin. Immunol. 2010; 125:1286-1293.

57. Huang J, Gutteridge A, Honda W, Kanehisa M. MIMOX: a web tool for phage display based epitope mapping. BMC Bioinformatics. 2006; 7:451.

58. Knittelfelder R, Riemer AB, Jensen-Jarolim E. Mimotope vaccination--from allergy to cancer. Expert. Opin. Biol. Ther. 2009; 9:493-506.

59. Pali-Schöll I, Jensen-Jarolim E. Biopanning for the characterization of allergen mimotopes. Methods Mol. Med. 2008; 138:271-83.

109

60. Kohlbacher O, Lenhof H.P. BALL--rapid software prototyping in computational molecular biology. Biochemicals Algorithms Library. Bioinformatics. 2000; 16:815-24.

61. Shatsky M, Dror O, Schneidman-Duhovny D, Nussinov R, Wolfson HJ. BioInfo3D: a suite of tools for structural bioinformatics. Nucleic Acids Res. 2004; 32:503-7.

62. Mayrose I, Penn O, Erez E, Rubinstein ND, Shlomi T, Freund NT, Bublil EM, Ruppin E, Sharan R, Gershoni JM, Martz E, Pupko T. Pepitope: epitope mapping from affinity-selected peptides. Bioinformatics. 2007; 23:3244-6.

63. Halperin I, Wolfson H, Nussinov R. SiteLight: binding-site prediction using phage display libraries. Protein Sci. 2003; 12:1344-59.

64. Mumey BM, Bailey BW, Kirkpatrick B, Jesaitis AJ, Angel T, Dratz EA. A new method for mapping discontinuous antibody epitopes to reveal structural features of proteins. J. Comput. Biol. 2003; 10:555-67.

65. Pacios LF, Tordesillas L, Cuesta-Herranz J, Compes E, Sánchez-Monge R, Palacín A, Salcedo G, Díaz-Perales A. Mimotope mapping as a complementary strategy to define allergen IgE-epitopes: peach Pru p 3 allergen as a model. Mol. Immunol. 2008; 45:2269-76.

66. Untersmayr E , Szalai K, Riemer AB, Hemmer W, Swoboda I, Hantusch B, Schöll I, Spitzauer S, Scheiner O, Jarisch R, Boltz-Nitulescu G, Jensen-Jarolim E. Mimotopes identify conformational epitopes on parvalbumin, the major fish allergen. Mol. Immunol 2006; 43:1454- 61.

67. Ganglberger E, Grunberger K, Wiedermann U, Vermes M, Sponer B, Breiteneder H, Scheiner O, Boltz G, Jensen-Jarolim E. IgE mimotopes of birch pollen allergen Bet v 1 induce blocking IgG in mice. Int. Arch. Allergy Immunol. 2001; 124:395-7.

68. Hantusch B, Krieger S, Untersmayr E, Schöll I, Knittelfelder R, Flicker S, Spitzauer S, Valenta R, Boltz-Nitulescu G, Scheiner O, Jensen-Jarolim E. Mapping of conformational IgE epitopes on Phl p 5a by using mimotopes from a phage display library. J. Allergy Clin. Immunol. 2004; 114:1294-300.

69. Tordesillas L, Pacios LF, Palacin A, Quirce S, Armentia A, Barber D, Salcedo G, Diaz- Perales A. Molecular basis of allergen cross-reactivity: non-specific lipid transfer proteins from wheat flour and peach fruit as models. Mol. Immunol. 2009; 47:534-40.

70. Oppenheimer J, Areson JG, Nelson HS. Safety and efficacy of oral immunotherapy with standardized cat extract. J. Allergy Clin. Immunol. 1994; 93:61-7.

71. Nelson HS, Lahr J, Rule R, Bock A, Leung D. Treatment of anaphylactic sensitivity to peanuts by immunotherapy with injections of aqueous peanut extract. J. Allergy Clin. Immunol. 1997; 99:744-51.

72. Jones SM, Pons L, Roberts JL, Scurlock AM, Perry TT, Kulis M, Shreffler WG, Steele P, Henry KA, Adair M, Francis JM, Durham S, Vickery BP, Zhong X, Burks AW. Clinical efficacy

110 and immune regulation with peanut oral immunotherapy. J. Allergy Clin. Immunol. 2009; 124:292-300.

73. Oppenheimer JJ, Nelson HS, Bock SA, Christensen F, Leung DY. Treatment of peanut allergy with rush immunotherapy. J. Allergy Clin. Immunol. 1992; 90:256-62.

74. Focke M, Swoboda I, Marth K, Valenta R. Developments in allergen-specific immunotherapy: from allergen extracts to allergy vaccines bypassing allergen-specific immunoglobulin E and T cell reactivity. Clin. Exp. Allergy. 2010; 40:385-97.

75. Rolland J.M., Gardner L.M., O'Hehir R.E. Allergen-related approaches to immunotherapy. Pharmacology & Therapeutics. 2009; 121:273-84.

76. Niederberger V. Allergen-specific immunotherapy. Immunol. Lett. 2009; 21:131-3.

77. Skripak JM, Wood RA. Peanut and tree nut allergy in childhood. Pediatr. Allergy Immunol. 2008; 19:368-73.

78. Varshney P, Steele PH, Vickery BP, Bird JA, Thyagarajan A, Scurlock AM, Perry TT, Jones SM, Burks AW. Adverse reactions during peanut oral immunotherapy home dosing. J. Allergy Clin. Immunol. 2009; 124:1351-2.

79. Clark AT, Islam S, King Y, Deighton J, Anagnostou K, Ewan PW. Successful oral tolerance induction in severe peanut allergy. Allergy. 2009; 64:1218-20.

80. Larché M. Update on the current status of peptide immunotherapy. J. Allergy Clin. Immunol. 2007; 119:906-9.

81. Weber CA, Mehta PJ, Ardito M, Moise L, Martin B, De Groot AS. T cell epitope: friend or foe? Immunogenicity of biologics in context. Adv. Drug Deliv. Rev. 2009; 61:965-76.

82. Bohle B. T-cell epitopes of food allergens. Clin. Rev. Allergy Immunol. 2006; 30:97-108.

83. Focke M, Mahler V, Ball T, Sperr WR, Majlesi Y, Valent P, Kraft D, Valenta R. Nonanaphylactic synthetic peptides derived from B cell epitopes of the major grass pollen allergen,m Phl p 1, for allergy vaccination. FASEB Journal. 2001; 15:2042-4.

84. Focke M, Linhart B, Hartl A, Wiedermann U, Sperr WR, Valent P, Thalhamer J, Kraft D, Valenta R. Non-anaphylactic surface-exposed peptides of the major birch pollen allergen, Bet v 1, for preventive vaccination. Clin. Exp. Allergy. 2004; 34:1525-33.

85. Ball T, Sperr WF, Valent P, Lidholm J, Spitzauer S, Ebner CKD, Valenta R. Induction of antibody responses to new B cell epitopes indicates vaccination character of allergen immunotherapy. Eur. J. Immunol. 1999; 29:2026-36.

86. Grönlund H, Saarne T, Gafvelin G, van Hage M. The major cat allergen, Fel d 1, in diagnosis and therapy. Int. Arch. Allergy Immunol. 2010; 151:265-74.

111

87. Hirahara K, Tatsuta T, Takatori T, Ohtsuki M, Kirinaka H, Kawaguchi J, Serizawa N, Taniguchi Y, Saito S, Sakaguchi M, Inouye S, Shiraishi A. Preclinical evaluation of an immunotherapeutic peptide comprising 7 T-cell determinants of Cry j 1 and Cry j 2, the major Japanese cedar pollen allergens. J. Allergy Clin. Immunol. 2001; 108:94-100.

88. Tarzi M, Klunker S, Texier C, Verhoef A, Stapel SO, Akdis CA, Maillere B, Kay AB, Larché M. Induction of interleukin-10 and suppressor of cytokine signalling-3 gene expression following peptide immunotherapy. Clin. Exp. Allergy. 2006; 36:465-74.

89. Müller U, Akdis CA, Fricker M, Akdis M, Blesken T, Bettens F, Blaser K. Successful immunotherapy with T-cell epitope peptides of bee venom phospholipase A2 induces specific T- cell anergy in patients allergic to bee venom. J. Allergy Clin. Immunol. 1998; 101:747-54.

90. Oldfield WL, Kay AB, Larché M. Allergen-derived T cell peptide-induced late asthmatic reactions precede the induction of antigen-specific hyporesponsiveness in atopic allergic asthmatic subjects. J. Immunol. 2001; 167;1734-9.

91. Bock SA, Munoz-Furlong A, Sampson HA. Fatalities due to anaphylactic reactions to foods. J Allergy Clin Immunol 2001; 107:191-3.

92. Pollack S, Perez A. Fruit and tree nuts situation and outlook yearbook/FTS. United States Department of Agriculture 2008.

93. Tawde P, Venkatesh YP, Wang F, Teuber SS, Sathe SK, Roux KH. Cloning and characterization of profilin (Pru du 4), a cross-reactive almond (Prunus dulcis) allergen. J Allergy Clin Immunol 2006; 118:915-22.

94. Abolhassani M, Roux KH. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (Prunus dulcis). Iran J Allergy Asthma Immunol 2009; 8:77-84.

95. Jin T, Guo F, Chen YW, Howard A, Zhang YZ. Crystal structure of Ara h 3, a major allergen in peanut. Mol Immunol 2009; 46:1796-804.

96. Adachi M, Kanamori J, Masuda T, Yagasaki K, Kitamura K, Mikami B, Utsumi S. Crystal structure of soybean 11S globulin: glycinin A3B4 homohexamer. Proc Natl Acad Sci. 2003; 100:7395-400.

97. Willison LN, Tripathi P, Sharma G, Teuber SS, Sathe SK, Roux KH. Cloning, expression and patient IgE reactivity of recombinant Pru du 6, an 11S globulin from almond. Int Arch Allergy Immunol. 2011; 156(3):267-81.

98. Wang F, Robotham JM, Teuber SS, Tawde P, Sathe SK, Roux KH. Ana o 1, a cashew (Anacardium occidental) allergen of the vicilin seed storage protein family. J Allergy Clin Immunol 2002; 110:160-6.

99. Sathe SK, Sze-Tao KWC, Wolf WJ, Hamaker BR. Biochemical characterization and in vitro digestibility of the major globulin in cashew nut (Anacardium occidentale). J Agric Food Chem 1997; 45:2854-60.

112

100. Sze-Tao KWC, Schrimpf JE, Teuber SS, Roux KH, Sathe SK. Effects of processing and storage on walnut (Juglans regia L) tannins. J Sci Food Agric 2001; 81:1215-22.

101. Robotham J.M., Teuber S.S., Sathe S.K., Roux K.H. Linear IgE epitope mapping of the English walnut (Juglans regia) major food allergen, Jug r 1. J Allergy Clin Immunol 2002; 109:143-9.

102. Robotham JM, Hoffman GG, Teuber SS, Beyer K, Sampson HA, Sathe SK, Roux KH. Linear IgE-epitope mapping and comparative structural homology modeling of hazelnut and English walnut 11S globulins. Mol Immunol 2009; 46:2975-84.

103. Beyer K, Bardina L, Grishina G, Ashraf A, Teuber SS, Niggemann B, Sampson HA. Identification of an 11S globulin as a Brazil nut food allergen. Unpublished . 2002.

104. Wallowitz M, Peterson WR, Uratsu S, Comstock SS, Dandekar AM, Teuber SS. Jug r 4 a Legumin group food allergen from walnut (Juglans regia Cv. Chandler). J Agric Food Chem 2006; 54:8369-75.

105. Zeece MG, Beardslee TA, Markwell JJP, Sarath G. Identification of an IgE-binding region in soybean acidic glycinin G1. Food Agric Immunol 1999; 11:83-90.

106. Clark AT, Anagnostou K, Ewan PW. Cashew nut causes more severe reactions than peanut: case-matched comparison in 141 children. Allergy 2007; 62:913-6.

107. Sicherer SH, Munoz-Furlong A, Burks AW, Sampson HA. Prevalence of peanut and tree nut allergy in the US determined by a random digit dial telephone survey. J Allergy Clin Immunol 1999; 103:559-62.

108. Marsh J, Rigby N, Wellner K, Reese G, Knulst A, Akkerdaas J, van Ree R, Radauer C, Lovegrove A, Sancho A, Mills C, Vieths S, Hoffmann-Sommergruber K, Shewry PR. Purification and characterization of a panel of peanut allergens suitable for use in allergy diagnosis. Mol Nutr Food Res 2008; 52:S272-85.

109. Rigby NM, Marsh J, Sancho AI, Wellner K, Akkerdaas J, van Ree R, Knulst A, Fernández- Rivas M, Brettlova V, Schilte PP, Summer C, Pumphrey R, Shewry PR, Mills EN. The purification and characterization of allergenic hazelnut seed proteins. Mol Nutr Food Res 2008; 52:S251-61.

110. Teuber SS, Dandekar AM, Peterson WR, Sellers CL. Cloning and sequencing of a gene encoding a 2S albumin seed storage protein precursor from English walnut (Juglans regia), a major food allergen. J Allergy Clin Immunol 1998; 101:807-14.

111. Sordet C, Culerrier R, Granier C, Rancé F, Didier A, Barre A, Rougé P. Expression of Jug r 1, the 2S albumin allergen from walnut (Juglans regia), as a correctly folded and functional recombinant protein. Peptides 2009; 30:1213-21.

113

112. Teuber SS, Jarvis KC, Dandekar AM, Peterson WR, Ansari AA. Cloning and sequencing of a gene encoding a vicilin-like proprotein, Jug r2, from English walnut kernel (Juglans regia): a major food allergen. J Allergy Clin Immunol 1999; 104:1311-20.

113. Willison LN, Tawde P, Robotham JM, Penney RM4, Teuber SS, Sathe SK, Roux KH. Pistachio vicillin, Pis v 3, is immunoglobulin E-reactive and cross-reacts with the homologous cashew allergen, Ana o 1. Clin Exp Allergy 2008; 38:1220-38.

114. Valenta R, Kraft D. From allergen structure to new forms of allergen-specific immunotherapy. Curr Opin Immunol 2002; 14:718-27.

115. Egger M, Hauser M, Himly M, Wopfner N, Wallner M, Ferreira F. Development of recombinant allergens for diagnosis and therapy. Front Biosci (Elite Ed). 2009; 77-90.

116. Valenta R, Niederberger V. Recombinant allergens for immunotherapy. J Allergy Clin Immunol 2007; 119:826-30.

117. Vrtala S. From allergen genes to new forms of allergy diagnosis and treatment. Allergy. 2008; 63:299-309.

118. Hoffmann-Sommergruber K, Mills EN, Vieths S. Coordinated and standardized production, purification and characterization of natural and recombinant food allergens to establish a food allergen library. Mol Nutr Food Res 2008; 52:S159-65.

119. Adachi M, Takenaka Y, Gidamis AB, Mikami B, Utsumi S. Crystal structure of soybean proglycinin A1aB1b homotrimer. J Mol Biol. 2001; 305:291-305.

120. Kim MW, Chelliah Y, Kim SW, Otwinowski Z, Bezprozvanny I. Secondary structure of Huntingtin amino-terminal region. Structure 2009; 17:1205–1212.

121. Van Regenmortel MHV. Mapping Epitope structure and activity: from one-dimensional prediction to four-dimensional description of antigenic specificity. Methods 1996; 9:465-72.

122. Davies J, Riechmann L. Single antibody domains as small recognition units: design and in vitro antigen selection of camelized, human VH domains with improved protein stability. Protein Eng 1996; 9:531-7.

123. Sinha N, Smith-Gill SJ. Molecular dynamics simulation of a high-affinity antibody-protein complex: the binding site is a mosaic of locally flexible and preorganized rigid regions. Cell Biochem Biophys. 2005; 43:253-73.

124. Pomés A. Relevant B cell epitopes in allergic disease. Int Arch Allergy Immunol 2010; 152:1-11.

125. Schulmeister U, Hochwallner H, Swoboda I, Focke-Tejkl M , Geller B, Nystrand M, Härlin A, Thalhamer J, Scheiblhofer S, Keller W, Niggemann B, Quirce S, Ebner C, Mari A, Pauli G, Herz U, Valenta R, Spitzauer S. Cloning, expression, and mapping of allergenic determinants of alphaS1-casein, a major cow's milk allergen. J Immunol 2009; 182:7019-29.

114

126. Albrecht M, Kuehne Y, Ballmer-Weber BK, Becker W-M, Holzhauser T, Lauer I, Reuter A, Randow S, Falk S, Wangorsch A, Lidholm J, Reese G, Vieths S. Relevance of IgE binding to short peptides for the allergenic activity of food allergens. J Allergy Clin Immunol 2009; 329:328-36.

127. Alcocer MJC, Murtagh GJ, Wilson PB, Progias P, Lin J, Archer DB. The major human structural IgE epitope of the Brazil nut allergen Ber e 1: a chimaeric and protein microarray approach. J Mol Biol 2004; 343:759-69.

128. Schramm G, Bufe A, Petersen A, Haas H, Merget R, Schlaak M, Becker WM. Discontinuous IgE-binding epitopes contain multiple continuous epitope regions; results of an epitope mapping on recombinant Hol 5, a major allergen from velvet grass pollen. Clin Exp Allergy 2001; 31:331-41.

129. Aalberse R. Structural biology of allergens. J Allergy Clin Immunol 2000; 106:228-38.

130. Robotham JM, Xia L, Willison LN, Teuber SS, Sathe SK, Roux KH. Characterization of a cashew allergen, 11S globulin (Ana o 2), conformational epitope. Mol. Immunol. 2010; 47:1830- 8.

131. Xia L, Willison LN, Porter L, Robotham JM, Teuber SS, Sathe SK, Roux KH.Mapping of a conformational epitope on the cashew allergen Ana o 2: a discontinuous large subunit epitope dependent upon homologous or heterologous small subunit association.Mol Immunol. 2010; 47(9):1808-16.

132. Tordesillas L, L.F. Pacios, A. Palacin, J. Cuesta-Herranz, M. Madero, A. Diaz-Perales. Characterization of IgE epitopes of Cuc m 2, the major melon allergen, and their role in cross- reactivity with pollen profilins. Clin. Exp. Allergy, 2010; 40:174–181

133. Bøgh KL, Nielsen H, Madsen CB, Mills EN, Rigby N, Eiwegger T, Szépfalusi Z, Roggen EL. IgE epitopes of intact and digested Ara h 1: a comparative study in humans and rats. Mol Immunol. 2012; 51(3-4):337-46.

134. Tiwari R, Negi SS, Braun B, Braun W, Pomés A, Chapman MD, Goldblum RM, Midoro- Horiuti T. Validation of a phage display and computational algorithm by mapping a conformational epitope of Bla g 2. Int Arch Allergy Immunol. 2012; 157(4):323-30.

135. Staswick P.E., Hermodson M.A. and Nielsen N.C. Identification of the crystines which link the acidic and basic components of the glycinin subunits. J. Biol. Chem. 1984; 259: 13431- 13435.

136. Bogh KL, Kroghsbo S, Dahl L, Rigby NM, Barkholt V, Mills EN, Madsen CB. Digested ARA h 1 has sensitizing capacity in brown Norway rats. Clin. Exp. Allergy. 2009; 39(10):1611- 21.

137. Astwood JD, Leach JN, Fuchs RL. Stability of food allergens to digestion in vitro. Nature Biotech. 1996; 14:1269-73.

115

138. Bartra J, Sastre J, del Cuvillo A, Montoro J, Jáuregui I, Dávila I, Ferrer M, Mullol J, Valero A. From pollinosis to digestive allergy. J Investig Allergol Clin Immunol. 2009; 19:3-10.

139. Breiteneder H, Ebner C. Molecular and biochemical classification of plant-derived food allergens. J allergy Clin Immunol. 2000; 106:26-36.

140. Sharma GM, Irsigler A, Dhanarajan P, Ayuso R, Bardina L, Sampson HA, Roux KH, Sathe SK.Cloning and characterization of 2S albumin, Car i 1, a major allergen in pecan. J Agric Food Chem. 2011; 59(8):4130-9.

141. Sharma GM, Irsigler A, Dhanarajan P, Ayuso R, Bardina L, Sampson HA, Roux KH, Sathe SK.Cloning and characterization of an 11S legumin, Car i 4, a major allergen in pecan. J Agric Food Chem. 2011; 59(17):9542-52.

142. Robotham JM, Wang F, Seamon V, Teuber SS, Sathe SK, Sampson HA, Beyer K, Seavy M, Roux KH.Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. J Allergy Clin Immunol. 2005; 115(6):1284-90.

143. Barre, A., Sordet, C., Culerrier, R., Rancé, F., Didier, A., and Rougé, P. Vicilin allergens of peanut and tree nuts (walnut, hazelnut and cashew nut) share structurally related IgE-binding epitopes. Mol. Immunol. 2008; 45, 1231-1240.

144. Barre A, Jacquet G, Sordet C, Culerrier R, Rougé P.Homology modeling and conformational analysis of IgE-binding epitopes of Ara h 3 and other legumin allergens with a cupin fold from tree nuts. Mol Immunol. 2007; 44(12):3243-55.

145. Moreno FJ, Clemente A. 2S Albumin Storage Proteins: What Makes them Food Allergens? Open Biochem J. 2008; 2:16-28.

146. Moreno FJ. Gastrointestinal digestion of food allergens: effect on their allergenicity. Biomed. Pharmacother. 2007; 61:50-60.

147. Kiening M, Niessner R, Drs E, Baumgartner S, Krska R, Bremer M, Tomkies V, Reece P, Danks C, Immer U, Weller MG. Sandwich immunoassays for the determination of peanut and hazelnut traces in foods. J Agric Food Chem. 2005;5 3(9):3321-7.

148. Pomés A, Vinton R, Chapman MD. Peanut allergen (Ara h 1) detection in foods containing chocolate. J Food Prot. 2004; 67(4):793-8

149. Arilla MC, Ibarrola I, Mir A, Monteseirín J, Conde J, Martínez A, Asturias JA. Development of a sandwich-type ELISA for measuring Pla a 1, the major allergen of Platanus acerifolia pollen. Int Arch Allergy Immunol. 2005; 138(2):127-33.

150. Chan AC, Carter PJ. Therapeutic antibodies for autoimmunity and inflammation. Nat. Rev. Immunol. 2010; 10:301–316.

151. Clienti S, Morjaria JB, Basile E, Polosa R. Curr. Monoclonal antibodies for the treatment of severe asthma. Allergy Asthma. Rep. 2011; 11:253–260.

116

152. Weiner LM, Surana R, Wang S. Monoclonal antibodies: versatile platforms for cancer immunotherapy.Nat. Rev. Immunol. 2010;10:317–327.

153. Borges JP, Barre A, Culerrier R, Granier C, Didier A, Rougé P. Lipid transfer proteins from Rosaceae fruits share consensus epitopes responsible for their IgE-binding cross-reactivity. Biochem. Biophys. Res. Commun. 2008; 365:685-90.

154. Mine Y, Wei Zhang J. Identification and fine mapping of IgG and IgE epitopes in ovomucoid. Biochem. Biophys. Res. Commun. 2002; 292:1070-4.

155. McCullough KC, Spier RE. Monoclonal antibodies in Biotchnology: Theoretical and Practical Aspects.

156. Kemeny DM. A practical Guide to ELISA. Pergamon Press 1991;115.

157. Acosta, M. R.; Roux, K. H.; Teuber, S. S.; Sathe, S. K. Production and characterization of rabbit polyclonal antibodies to almond (Prunus dulcis L.) major storage protein. J. Agric. Food Chem. 1999, 47:405γ−4059.

158. Pomés A, Butts CL, Chapman MD. Quantification of Ara h 1 in peanuts: why roasting makes a difference. Clin Exp Allergy. 2006; 36(6):824-30.

159. Rolland JM, Apostolou E, de Leon MP, Stockley CS, O'Hehir RE. Specific and sensitiveenzyme-linked immunosorbent assays for analysis of residual allergenic food proteins in commercial bottled wine fined with egg white, milk, and nongrape-derived tannins. J Agric Food Chem. 2008; 56(2):349-54.

160. Zuidmeer L, Goldhahn K, Rona RJ, Gislason D, Madsen C, Summers C, Sodergren E, Dahlstrom J, Lindner T, Sigurdardottir ST, McBride D, Keil T. The prevalence of plant food allergies: a systematic review. J. Allergy Clin. Immunol. 2008; 121:1210-1218.

161. King JC, Blumberg J, Ingwersen L, Jenab M, Tucker KL. Tree nuts and peanuts as components of a healthy diet. J. Nutr. 2008; 138:1736S-1740S.

162. Venkatachalam M, Monaghan EK, Kshirsagar HH, Robotham JM, O'Donnell SE, Gerber MS, Roux KH, Sathe SK. Effects of processing on antigenic stability of cashew nut (Anacardium occidentale L.) proteins. J. Agric. Food Chem. 2008; 56:8998-9005.

163. Coales SJ, Tuske SJ, Tomasso JC, Hamuro Y. Epitope mapping by amide hydrogen/deuterium exchange coupled with immobilization of antibody, on-line proteolysis, liquid chromatography and mass spectrometry. Rapid Commun. Mass Spectrom. 2009; 23:639- 47.

164. Zhang Q, Willison LN, Tripathi P, Sathe SK, Roux KH, Emmett MR, Blakney GT, Zhang HM, Marshall AG. Epitope Mapping of a 95 kDa Antigen in Complex with Antibody by Solution-Phase Amide Backbone Hydrogen/Deuterium Exchange Monitored by Fourier Transform Ion Cyclotron Resonance Mass Spectrometry. Anal. Chem. 2011; 83(18):7129-36.

117

165. Chalmers MJ, Busby SA, Pascal BD, He Y, Hendrickson CL, Marshall AG, Griffin PR. Probing protein ligand interactions by automated hydrogen/deuterium exchange mass spectrometry. Anal. Chem. 2006; 78:1005-14.

166. Baerga-Ortiz A, Hughes CA, Mandell JG, Komives EA. Epitope mapping of a monoclonal antibody against human thrombin by H/D-exchange mass spectrometry reveals selection of a diverse sequence in a highly conserved protein. Protein Sci. 2002; 11:1300-8.

167. Lanman J, Prevelige PE Jr. High-sensitivity mass spectrometry for imaging subunit interactions: hydrogen/deuterium exchange. Curr. Opin. Struct. Biol. 2004; 14:181-8.

168. Kshirsagar HH, Fajer P, Sharma GM, Roux KH, Sathe SK. Biochemical and spectroscopic characterization of almond and cashew nut seed 11S legumins, amandin and anacardein. J. Agric. Food Chem. 2011; 59:386-93.

169. Kazazic S, Zhang HM, Schaub TM, Emmett MR, Hendrickson CL, Blakney GT, Marshall AG. Automated data reduction for hydrogen/deuterium exchange experiments, enabled by high- resolution Fourier transform ion cyclotron resonance mass spectrometry. J. Am. Soc. Mass Spectrom. 2010: 21:550-8.

170. Gaur V, Sethi DK, Salunke DM. Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis. Acta. Crystallogr. Sect. F. Struct. Biol. Cryst. Commun. 2008; 64:32-5.

171. Albillos SM, Jin T, Howard A, Zhang Y, Kothary MH, Fu TJ. Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin. J. Agric. Food Chem. 2008; 56: 5352-8.

172. Plattner K, Perez A. Fruit and tree nut outlook and Fruit and tree nuts yearbook: dataset, United States Department of Agriculture (USDA), http://usda01.library.cornell.edu/usda/current/FTS/FTS-12-18-2012.pdf and http://usda01.library.cornell.edu/usda/ers/89022/2011/FTS2011.pdf.

173. Grimbacher B, Belohradsky BH, Holland SM. Immunoglobulin E in primary immunodeficiency diseases. Allergy 2002; 57:995-1007.

174. Horst A, Hunzelmann N, Arce S, Herber M, Manz RA, Radbruch A, Nischt R, Schmitz J, Assenmacher M. Detection and characterization of plasma cells in peripheral blood: correlation of IgE+ plasma cell frequency with IgE serum titre. Clin. Exp. Immunol. 2002; 130:370-8.

175. Aalberse RC. Specific IgE and IgG responses in atopic versus nonatopic subjects. Am. J. Respir. Crit. Care Med. 2000; 162:S124-7.

118

BIOGRAPHICAL SKETCH

I. PERSONAL

LeAnna Nichole Willison Born in Adak, Alaska

II. EDUCATION AND DEGREES

May, 2013 Ph.D. in Biological Science Florida State University, Tallahassee, FL

December, 2009 M.S. in Biological Science Florida State University, Tallahassee, FL

August, 2005 B.S. in Biological Science Florida State University, Tallahassee, FL

June, 2000 Clay High School, Green Cove Springs, FL

III. PROFESSIONAL EXPERIENCE

2006-2013 Graduate Research Assistant Department of Biological Science, Florida State University

2006-2013 Graduate Teaching Assistant Department of Biological Science, Florida State University

2005-2006 Directed Individual Study Student Department of Biological Science, Florida State University

IV. TEACHING INTERESTS AND EXPERIENCE

Teaching assistant for laboratory classes at Florida State University including; BSC2011L- Animal Diversity Lab, PCB4233L- Immunology Lab, and PCB4024L- Molecular Biology Lab

Member of the 2009 and 2011 graduate student discussion panel for PSB5077- Responsible Conduct of Research at Florida State University

President of the Florida State University equestrian club for the 2004-2005 academic year

V. AWARDS

Faculty Graduate Student Publication Award for the 2011-2012 academic year

119

VI. PUBLICATIONS

Willison LN, Zhang Q, Su M, Teuber SS, Sathe SK, Roux KH. Conformational epitope mapping of Pru du 6, a major allergen from almond nut. Mol. Immunol. 2013. (In press).

Willison LN, Sathe SK, Roux KH. Production and analysis of recombinant tree nut allergens. Methods. 2013. (Accepted).

Zhang Q, Willison LN, Tripathi P, Sathe SK, Roux KH, Emmett MR, Blakney GT, Zhang HM, Marshall AG. Epitope Mapping of a 95 kDa Antigen in Complex with Antibody by Solution- Phase Amide Backbone Hydrogen/Deuterium Exchange Monitored by Fourier Transform Ion Cyclotron Resonance Mass Spectrometry. Anal. Chem. 2011;83(18):7129-36.

Willison LN, Tripathi P, Sharma GM, Teuber SS, Sathe SK, Roux KH. Cloning, expression, and patient IgE reactivity of recombinant Pru du 6, an 11S globulin from almond. Int. Arch. Allergy Immunol. 2011;156(3):267-281.

Robotham JM, Xia L, Willison LN, Teuber SS, Sathe SK, Roux KH. Characterization of a cashew allergen, 11S globulin (Ana o 2), conformational epitope. Mol. Immunol. 2010;47:1830- 8.

Xia L, Willison LN, Porter L, Robotham JM, Teuber SS, Sathe SK, Roux KH. Mapping of a conformational epitope on the cashew allergen Ana o 2: a discontinuous large subunit epitope dependent upon homologous or heterologous small subunit association. Mol. Immunol. 2010;47:1808-16.

Willison LN, Tawde P, Robotham JM, Penny R, Teuber SS, Sathe SK, Roux KH. Pistachio vicilin, Pis v 1, is allergenic and cross-reactive with the homologous cashew allergen, Ana o 1. Clin. Exp. Allergy. 2008;38(7):1229-38.

VII. ABSTRACTS AND PRESENTATIONS (* Indicates presenting author)

Willison LN, Zhang Q, Su M, Teuber SS, Marshall AG, Sathe SK*, Roux KH. Identification of a conformational epitope on the almond 11S globulin allergen using phage display and hydrogen-deuterium exchange. Annual meeting for the Institute of Food Technologists, Las Vegas, NV, June 2012.

Willison LN, Pallavi T, Sharma G, Teuber SS, Sathe SK*, and Roux KH. Biochemical and immunochemical properties of amandin from almond nut. Annual meeting of the Institute of Food Technologists, New Orleans, LA. June 2011.

Zhang Q*, Emmett MR, Tripathi P, Willison LN, Sathe SK, Roux KH and Marshall AG. Epitope Mapping for a ~300 kDa Antigen by Solution-Phase H/D Exchange FT-ICR Mass Spectrometry. 59th ASMS Conference on Mass Spectrometry and Allied Topics Colorado Convention Center, Denver, CO, June 2011.

120

Roux KH*, Pallavi T, Willison LN, and Sathe SK. Methods for epitope mapping using monoclonal antibodies. BIT’s γrd Annual International Congress of Antibodies-2011, Beijing China, March 2011.

Willison LN*, Tripathi P, Sharma GM, Teuber SS, Sathe SK, and Roux KH. Cloning, expression, and patient IgE reactivity of recombinant allergen Pru du 6, an 11S globulin from almond. Fowler Symposium, Department of Biological Science, Florida State University, December 2010.

Willison LN*, Sharma GM, Teuber SS, Sathe SK, Roux KH. Identification and Immunoreactivity of almond lipid transfer protein, Pru du 3. 28th Symposium Collegium Internationale Allergologicum, Ischia, Italy, May 2010.

Roux KH, Xia L, Robotham JM, Willison LN*, Teuber SS, and Sathe SK. Identification and characterization of a conformational epitope on the cashew nut 11S globulin allergen, Ana o 2. 28th Symposium Collegium Internationale Allergologicum, Ischia, Italy, May 2010.

Sathe SK*, Willison LN, Tripathi P, Roux KH. Biochemical and immunological properties of amandin. "Frontiers in Food Allergen Risk Assessment" organized by EuroPrevall and the International LifeSciences Institute, Nice, France, October 2010.

Sathe SK*, Willison LN, Kshirsagar HH, Su M, Sharma GM, Teuber SS, Roux KH. Biochemical and immunological properties of amandin, a major allergenic storage protein in almond (Prunus dulcis L.) seeds. Second International Conference on Natural Polymers, Bio- Polymers, Bio-Materials, their Composites, Blends, IPNs, Polyelectrolytes and Gels: Macro to Nano Scales, Kottayam, Kerala, India, September 2010. (Invited oral presentation)

Su M*, Peacock J, Willison LN, Roux KH, and Sathe SK. Mouse Monoclonal Antibody (mAb) based Enzyme Linked Immunosorbent Assay (ELISA) for Sensitive, Specific, and Robust Detection of Almond (Prunus dulcis L.). β010 NRI/AFRI Project Directors’ (PD) Meeting for the Improving Food Quality and Value Program, Chicago, IL, July 2010.

Willison LN*, Sharma GM, Venkatachalam M, Teuber SS, Sathe SK, Roux KH. Cloning and expression of almond prunin 1 and prunin 2 and analysis of patient IgE reactivity. American College of Allergy, Asthma & Immunology XIII International Food Allergy Symposium, Miami Beach, FL, November 2009.

Su M*, Sharma GM, Willison LN, Xia L, Robotham JM, Roux KH, and Sathe SK. Monoclonal antibody (mAb)-based enzyme linked immunoassay (ELISA) for sensitive, specific, and robust detection of trace quantities of almond (Prunus dulcis L.) Annual Meeting of the Institute of Food Technologists, Anaheim CA, June 2009.

Sathe SK*, Su M, Sharma GM, Willison LN, Robotham JM, Roux KH. Monoclonal antibody (mAb-based) enzyme linked immunoassay (ELISA) for sensitive, specific, and robust detection of trace quantities of almond (Prunus dulcis L.). United States Department of Agriculture (USDA) National Research Initiative (NRI) Cooperative state Research Education and Extension

121

Service (CSREES). 71.1 Improving Food Quality and Value & Bioactive Food Components for Optimal Health . Project directors Meeting, Anaheim, CA. June 2009.

Willison LN*, Tawde PT, Robotham JM, Penny R, Kshirsagar HH, Teuber SS, Sathe SK, and Roux KH. Pistachio vicilin, Pis v 3, is allergenic and cross-reactive with the homologous cashew allergen, Ana o 1. Federation of Clinical Immunology Societies Conference in San Diego, CA, June 2007.

122