The Role of Histone Acetylation in the Extinction and Reinstatement Of

The role of histone acetylation in the extinction and reinstatement of

nicotine self-administration in the rat

Matthew Robert Castino

A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy

January 2017

School of Psychology

Faculty of Science

PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES

Thesis/Dissertation Sheet

Surname or Family name: CASTINO

First name: MATTHEW Other name/s: ROBERT

Abbreviation for degree as given in the University calendar: PhD

School: PSYCHOLOGY Faculty: SCIENCE

Title: The role of histone acetylation in the extinction and reinstatement of nicotine self-administration in the rat

Abstract 350 words maximum: (PLEASE TYPE)

Recurrent relapse to cigarette smoking is a principle characteristic of tobacco addiction. This may be due to the persistence of strong drug- associated memories that prompt drug use across abstinence. Like other forms of memory, drug-associated memories are dependent on transcriptional processes that are coordinated by dynamic chromatin modifications. Histone acetylation appears to be particularly important for the long-term memory processes in addictive behavior, as administration of the HDAC inhibitor, sodium butyrate (NaB), facilitates both the acquisition and extinction of cocaine-associated contextual memories.

The present thesis aimed to extend these findings to nicotine using an instrumental self-administration paradigm. When administered immediately after the session, NaB facilitated the extinction of nicotine-seeking in a persistent manner that provided resistance to reinstatement. Crucially, this was not observed when treatment was administered six hours after extinction sessions, or when rats responded for natural rewards, suggesting that NaB enhanced the consolidation of extinction memories, and that its effects are specific to a drug context.

Using a combination of chromatin immunoprecipitation (ChIP) and qPCR, I then investigated the consequences of NaB and nicotine exposure on mRNA expression and histone acetylation in the medial prefrontal cortex. Administration of NaB induced an increase in Cdk5 and BDNF mRNA expression, providing a potential molecular mechanism for the effects of treatment on extinction. Further, a prior history of nicotine induced a decrease in acetylation at the BDNF Exon IV promoter that persisted six days after drug exposure. These findings are consistent with the well- established roles for Cdk5 and BDNF in the synaptic changes involved in addictive behavior and extinction learning.

In summary, these findings demonstrate that NaB facilitates the extinction of nicotine-seeking in a persistent manner that provides resistance to reinstatement. In addition, this study identifies possible molecular targets for the effect of NaB on extinction, and demonstrates that a history of nicotine induces enduring changes in histone acetylation that are evident long after drug exposure. These results further implicate histone acetylation as a prime candidate mechanism for the stable changes in neuronal function that follow nicotine exposure, but also a key target for the pharmacological enhancement of extinction learning.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorize University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

…………………………………………………………… …………………………………….… ……….……………………... Signature Witness Date

The University recognizes that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award:

THIS SHEET IS TO BE GLUED TO THE INSIDE FRONT COVER OF THE THESIS iii

Originality statement

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at

UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………......

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorize University

Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

Authenticity statement

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………...... vi

Publications

Incorporated into the thesis

Castino, M. R., Cornish, J. L., & Clemens, K. J. (2015). Inhibition of histone deacetylases facilitates extinction and attenuates reinstatement of nicotine self-administration in rats. PLoS One, 10(4). doi: 10.1371/journal.pone.0124796 (as part of Chapter II of thesis).

Other published works

Castino, M. R., & Khoo, S. Y. (2015). Multiple properties of drug-paired cues may precipitate reinstatement. Journal of Neuroscience, 35(38), 12971-12973. doi:10.1523/jneurosci.2551-15.2015.

Clemens, K. J., Castino, M. R., Cornish, J. L., Goodchild, A. K., & Holmes, N. M.

(2014). Behavioral and neural substrates of habit formation in rats intravenously self- administering nicotine. Neuropsychopharmacology, 39(11), 2584-2593. doi:

10.1038/npp.2014.111.

vii

Conference presentations

Castino, M.R., Cornish, J.L. & Clemens, K.J. (2012, January). The inhibition of histone deacetylases during extinction of nicotine self-administration attenuates both cue- and nicotine-induced reinstatement. Poster session presented at the Australasian Neuroscience

Society (ANS) Annual Meeting, Gold Coast, Australia.

Castino, M. R., Cornish, J. L., & Clemens, K. J. (2013). The role of histone acetylation in the acquisition, extinction and reinstatement of nicotine self-administration in rats.

Behavioural Pharmacology, 24, 50-50. doi:10.1097/01.fbp.0000434849.25290.97

Castino, M.R., Cornish, J.L. & Clemens, K.J. (2014, December). Inhibition of histone deacetylases facilitates extinction and attenuates reinstatement of nicotine seeking in rats. Oral presentation at the Australian Learning Group (ALG) Winter Workshop, Katoomba, Australia.

Castino, M.R., Youngson, N.A., Baker-Andresen, D., Ratnu, V.S., Bredy, T.W.,

Clemens, K.J. (2015, August). Transcriptional and epigenetic factors underlying the extinction of nicotine-seeking behavior in the rat. Poster session presented at the joint meeting of the

International Drug Abuse Research Society (IDARS) and the Asia-Pacific Society for Alcohol and Addiction Research (ASPAAR), Sydney, Australia.

Castino, M.R., Youngson, N.A., Baker-Andresen, D., Ratnu, V.S., Bredy, T.W.,

Clemens, K.J. (2015, August). Transcriptional and epigenetic factors underlying the extinction of nicotine-seeking behavior in the rat. Journal of Neurochemistry, 134, 349-349. doi:

10.1111/jnc.13189.

viii

Care and use of animals

All procedures described here were approved by the Animal Care and Ethics Committee of the

University of New South and were conducted in accordance with the Australian Code for the

Care and Use of Animals for Scientific Purposes (8th ed, 2013). All efforts were made to minimize the number of animals used and their suffering.

Table of contents

Originality statement ...... iii

Authenticity statement...... v

Publications ...... vi

Conference presentations ...... vii

Care and use of animals ...... viii

Acknowledgement ...... xiii

Figures ...... xiv

Tables ...... xvi

Abbreviations ...... xvii

Abstract ...... xxi

Chapter I: Introduction ...... 1

Smoking...... 1 Animal models of drug-seeking ...... 2 Extinction of drug-seeking ...... 4 Neural circuits underlying the extinction of drug-seeking ...... 6 Overlapping cellular and molecular basis of memory and addiction ...... 8 Epigenetic mechanisms in drug addiction ...... 10 Histone acetylation ...... 11 Histone acetylation and long-term memory...... 13 Regulation of histone acetylation by drugs of abuse ...... 15 The role of histone acetylation in drug reward and motivation ...... 17 The role of histone acetylation in drug-associated contextual memory ...... 19 Histone acetylation and the extinction of drug-seeking...... 21 Extending Pavlovian conditioning studies to an instrumental paradigm ...... 22 Research Aims ...... 24 x

Chapter II: Inhibition of histone deacetylases facilitates extinction and attenuates reinstatement of nicotine self-administration ...... 26

Methods ...... 28 Subjects ...... 28 Drugs ...... 29 Surgery for the implantation of intravenous catheters (Experiments 1-3) ...... 29 Apparatus ...... 30 Experiment 1: The effect of HDAC inhibition on the extinction and reinstatement of nicotine-seeking behavior ...... 31 Nicotine self-administration ...... 31 Extinction ...... 33 Reinstatement ...... 34 Experiment 2: The effect of HDAC inhibition on the extinction and reinstatement of nicotine-seeking following acquisition under a variable-ratio schedule ...... 35 Nicotine self-administration ...... 35 Extinction and reinstatement ...... 35 Experiment 3: The effect of HDAC inhibition on cue-extinction of nicotine self- administration ...... 36 Nicotine self-administration ...... 36 Extinction and reinstatement ...... 36 Experiment 4: The effect of HDAC inhibition on the extinction and reinstatement of sucrose-seeking ...... 37 Sucrose self-administration ...... 37 Extinction and reinstatement ...... 37 Statistical analysis ...... 37 Results ...... 39 Experiment 1: NaB administered immediately, but not six hours, after extinction attenuates reinstatement of nicotine-seeking ...... 39 Nicotine self-administration ...... 39 Extinction ...... 39 Reinstatement ...... 41 Experiment 2: HDAC inhibition has no effect on extinction or reinstatement when rats acquire nicotine self-administration under a variable-ratio schedule ...... 43 xi

Nicotine self-administration ...... 43 Extinction ...... 45 Reinstatement ...... 45 Experiment 3: HDAC inhibition facilitates cue-extinction of nicotine self- administration ...... 47 Nicotine self-administration ...... 47 Extinction and reinstatement ...... 47 Experiment 4: NaB has no effect on the extinction and reinstatement of sucrose- seeking ...... 50 Sucrose self-administration ...... 50 Extinction ...... 50 Reinstatement ...... 50 Discussion ...... 53

Chapter III: Molecular mechanisms underlying NaB-potentiated extinction of nicotine- seeking ...... 59

Method...... 60 Subjects ...... 60 Drugs ...... 61 Behavioral procedures ...... 61 Intravenous self-administration ...... 61 Extinction ...... 63 Molecular assays ...... 63 mRNA expression ...... 65 RNA extraction and reverse transcriptions ...... 65 Quantitative polymerase chain reaction (qPCR) ...... 66 Chromatin immunoprecipitation (ChIP) ...... 66 Histone acetylation ...... 68 Histone methylation ...... 69 qPCR ...... 70 BDNF antisense (BDNFas) ...... 70 Strand-specific quantitative reverse transcription PCR (qRT-PCR) ...... 70 Statistical analysis ...... 73 Results ...... 74 xii

Behavior ...... 74 Intravenous self-administration ...... 74 Extinction ...... 76 Molecular assays ...... 76 mRNA expression ...... 76 Ventromedial prefrontal cortex...... 76 Nucleus accumbens ...... 80 Chromatin immunoprecipitation (ChIP) ...... 80 Histone acetylation (H3K14ac) ...... 80 Histone methylation (H3K27me3, H3K9me2 and H3K4me3) ...... 82 BDNF antisense (BDNFas) ...... 85 Discussion ...... 89

Chapter IV: General discussion ...... 99

Summary of key findings ...... 99 Epigenetic mechanisms in drug addiction ...... 101 Extending prior CPP studies to an instrumental conditioning paradigm ...... 101 Nicotine induces enduring epigenetic changes within the BDNF promoter ...... 103 Future directions ...... 107 The role of individual HDACs in the extinction of drug-seeking ...... 107 The role of histone acetylation in the ventromedial prefrontal cortex ...... 109 Antisense BDNF ...... 110 Implications for smokers ...... 111 Conclusion ...... 112

References ...... 114

Appendix ...... 144

Locomotor activity ...... 144

xiii

Acknowledgement

This thesis is a testament to several individuals who, over the past four years, have enabled my obsession by lending me their support, guidance and wisdom. This acknowledgement is for you.

To my supervisor, Dr. Kelly Clemens. At every stage of this process, you pushed me to make this thesis the very best it could be. You encouraged me to question my data, to learn new skills, to find balance and to never settle for ‘good enough’. Your commitment to your research and your family has been an endless source of inspiration to me. Whatever I accomplish in this thesis, and moving forward, is a reflection of your hard work and guidance.

To Mum, Dad and Emma. I could not have asked for a more loving, generous and supportive family. You stuck by me through good times and bad, never doubting that I was capable of producing a body of work such as this, even when I didn’t believe it myself. Without you, this certainly would not have been possible.

To members of the Clemens-Westbrook-McNally-Begg labs: Chris Antoniadis, Justine

Fam, Dominic Tran, Belinda Lay, Shaun Khoo, Angela Stuart and Nura Lingawi. Your friendship made each day bearable. A special thank you must also go to the Bredy Lab at the

University of Queensland for teaching me the molecular assays and to Professor Fred

Westbrook and Dr. Nathan Holmes for their invaluable comments on this thesis.

Finally, to Lauren. Whatever words I find to thank you will always come short of conveying what your love and support has meant to me. Each time I thought about giving up, you gave me strength to find my way back. I cannot wait to marry you. xiv

Figures

Chapter I

Figure 1.1. Extinction of drug-seeking………………………………………………………. 5

Figure 1.2. Neural circuitry of the expression and extinction of drug-seeking……………… 7

Figure 1.3. Chromatin modifications in the brain ...... 12

Figure 1.4. Transcriptional and epigenetic regulation by drugs of abuse ...... 16

Chapter II

Figure 2.1. Schematic representation of Experiments 1-4 ...... 32

Figure 2.2. Experiment 1: Acquisition and extinction of nicotine self-administration ...... 40

Figure 2.3. Experiment 1: Reinstatement of nicotine-seeking ...... 42

Figure 2.4. Experiment 2: Acquisition and extinction of nicotine self-administration ...... 44

Figure 2.5. Experiment 2: Reinstatement of nicotine-seeking ...... 46

Figure 2.6. Experiment 3: Acquisition and extinction of nicotine self-administration ...... 48

Figure 2.7. Experiment 3: Reinstatement of nicotine-seeking ...... 49

Figure 2.8. Experiment 4: Acquisition and extinction of sucrose self-administration ...... 51

Figure 2.9. Experiment 4: Reinstatement of sucrose-seeking...... 52

Chapter III

Figure 3.1. Schematic representation of the experimental procedure of Chapter III ...... 62

Figure 3.2. Brain dissections ...... 64

Figure 3.3. Acquisition and extinction of self-administration ...... 75

Figure 3.4. Cdk5 and BDNF mRNA in the ventromedial prefrontal cortex ...... 77

Figure 3.5. H3K14 acetylation at BDNF and Cdk5 promoter regions ...... 81

Figure 3.6. Histone methylation at the Cdk5 promoter region ...... 83

Figure 3.7. Histone methylation at the BDNF Exon IV promoter region...... 84

Figure 3.8. Validation of BDNF antisense on an agarose gel ...... 86

Figure 3.9. Sanger sequencing data aligned to genome assembly ...... 87

Figure 3.10. BDNF antisense expression in the ventromedial prefrontal cortex ...... 88

Chapter IV

Figure 4.1. Epigenetic priming and desensitisation……………………………………….. 105

Appendix

Figure A1.1. Sodium butyrate has no effect on locomotor activity……………………….. 144

xvi

Tables

Chapter III

Table 3.1. Primer sequences for mRNA expression ...... 67

Table 3.2. Primer sequences for ChIP-qPCR...... 71

Table 3.3. Primer sequences for BDNFas ...... 72

Table 3.4. mRNA expression in the ventromedial prefrontal cortex ...... 79

xvii

Abbreviations

BDNF Brain-derived neurotrophic factor

BDNFas Antisense brain-derived neurotrophic factor

BLA Basolateral amygdala

BLAT Basic local alignment tool bp Base pairs

CBP CREB-binding protein

CDB Chromatin immunoprecipitation dilution buffer

CDC Centers for Disease Control and Prevention

Cdk5 Cyclin-dependent kinase 5

ChIP Chromatin immunoprecipitation

CPP Conditioned place preference

CREB Cyclic adenosine monophosphate-response element-binding protein

CRF Corticotropin-releasing hormone

CS Conditioned stimulus

DNA Deoxyribonucleic acid

EDTA Ethylenediaminetetraacetic acid

EGR1 Early growth response 1

ELISA Enzyme-linked immunosorbent assay

ERK Extracellular signal-regulated kinases

FACS Fluorescence activated cell sorting

FR Fixed-ratio

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GluR Ionotropic glutamate receptor xviii

GRIN N-methyl-D-aspartate receptor

H3K14ac Histone H3 lysine 14 acetylation

H3K27me3 Histone H3 lysine 27 trimethylation

H3K4me3 Histone H3 lysine 4 trimethylation

H3K9ac Histone H3 lysine 9 acetylation

H3K9me2 Histone H3 lysine 9 dimethylation

HAT Histone acetyltransferase

HDAC Histone deacetylase i.p. Intraperitoneal

ID Internal diameter

IGG Immunoglobulin G

IL Infralimbic cortex

IVSA Intravenous self-administration lncRNA Long non-coding ribonucleic acid

LTD Long-term depression

LTP Long-term potentiation

MDH Medial dorsal hypothalamus mGlu Metabotropic glutamate receptor miRNA Micro-ribonucleic acid mPFC Medial prefrontal cortex mRNA Messenger ribonucleic acid

NaB Sodium butyrate

NaB + 6 h Sodium butyrate injected six hours after extinction sessions

NAc Nucleus accumbens

NAcc Nucleus accumbens core xix

NaCl Sodium chloride

NAcSh Nucleus accumbens shell

NaHCO3 Sodium bicarbonate ncRNA Non-coding ribonucleic acid

Nic Nicotine

NMDA N-methyl-D-aspartate

Nr4a Nuclear receptor subfamily 4 group A

NRC No-reverse transcriptase control

NRTs Nicotine replacement therapies

NTC No-template control

OD Outer diameter

ODN Oligodeoxynucleotide

PBS Phosphate buffered saline

PhB Sodium 4-phenylbutyrate

PI Protease inhibitor

PL Prelimbic cortex

PR Progressive-ratio qPCR Quantitative polymerase chain reaction

RNA Ribonucleic acid rtPCR Reverse transcription polymerase chain reaction s.c. Subcutaneous

Sal Saline

SDS Sodium dodecyl sulfate

Tris-Hcl Tris hydrochloride

TsA Trichostatin A xx

US Unconditioned stimulus

Veh Vehicle vmPFC Ventromedial prefrontal cortex

VPA Valproic acid

VR Variable-ratio

VTA Ventral tegmental area

xxi

Abstract

Recurrent relapse to cigarette smoking is a principle characteristic of tobacco addiction. This is due, in part, to the ability of nicotine to facilitate the formation of strong and enduring drug- associated memories, which continue to prompt relapse during abstinence. The mechanisms that support the persistence of these memories across an extended period of time are not well understood.

Drugs of abuse induce an array of epigenetic modifications in regions of the genome known to be critical for long-term memory consolidation. Accordingly, it has been hypothesized that epigenetic changes at specific gene promoters contribute to the aberrant learning and memory processes in addictive behavior. Histone acetylation appears to play a particularly important role in this process, as administration of the histone deacetylase (HDAC) inhibitor, sodium butyrate (NaB), facilitates both the acquisition and extinction of cocaine- associated contextual memories.

Studies examining the consequences of HDAC inhibition on the extinction of drug- seeking have been restricted to the conditioned place preference (CPP) procedure. Extending these results to an instrumental model of extinction learning may be important to the study of drug addiction as this procedure more closely approximates drug-taking behavior in humans.

Therefore, the principle aim of this thesis was to examine the role of histone acetylation in the extinction and reinstatement of operant nicotine self-administration.

In Chapter II, I aimed to investigate the effect of NaB treatment across extinction on subsequent reinstatement. Pursuant to this aim, I found that NaB administered immediately after extinction sessions facilitated the extinction of nicotine-seeking. This enhancement was persistent, conferring resistance to reinstatement in response to subsequent re-exposure to nicotine. Crucially, this was not observed when NaB was administered six hours after each xxii extinction session, suggesting that these results can be attributed to the effect of NaB on the consolidation of extinction learning and not to mere exposure to NaB itself.

Chapter III aimed to investigate the molecular mechanisms underlying these behavioral data. To this end, I used a combination of chromatin immunoprecipitation (ChIP) and qPCR to examine the transcriptional and epigenetic processes underlying NaB-potentiated extinction of nicotine-seeking. Treatment with NaB across extinction increased the expression of Cdk5 and

BDNF Exon I mRNA in the ventromedial prefrontal cortex. This is consistent with the well- established role of these genes in synaptic plasticity related to long-term memory consolidation.

In addition, nicotine self-administration induced decreases in H3K14ac, H3K27me3 and

H3K9me2 within the BDNF Exon IV promoter that persisted despite six days of extinction training. These data suggest that enduring epigenetic changes at the BDNF locus may contribute to the ability of nicotine to facilitate the formation of aberrantly powerful memories that promote relapse across abstinence.

In summary, these studies show for the first time that treatment with an HDAC inhibitor facilitates the extinction of nicotine-seeking in a persistent manner that provides resistance to reinstatement. In doing so, this thesis achieved its aim of extending the results of prior CPP studies to an instrumental paradigm, a model that more closely approximates drug-taking behavior in humans. Further, this is the first demonstration that nicotine self-administration induces enduring epigenetic changes that persist long after the final drug exposure. These data highlight histone acetylation as a potential mechanism underlying the persistence of nicotine- associated memories and as a pharmacological target for aiding smoking cessation in humans. 1

Chapter I: Introduction

Giving up smoking is the easiest thing in the world.

I know because I've done it thousands of times.

--Mark Twain--

Smoking

As many as two out of every three smokers will die of a smoking-related illness (Banks et al.,

2015). Indeed, cigarette smoking has been causally linked to cancer, as well as cardiovascular and respiratory disease (Centers for Disease Control and Prevention [CDC], 2014).

Unfortunately, nicotine is perhaps the most difficult drug to quit. Users dependent on nicotine take substantially longer to achieve abstinence than those dependent on alcohol, cannabis or cocaine (Lopez-Quintero et al., 2011). Strikingly, it takes an average of 30 years for a dependent smoker to quit.

The difficulties associated with quitting have led to the development of several anti- smoking treatments, such as nicotine replacement therapies (NRTs) and medications

(varenicline [Champix®], bupropion [Zyban®]). Though these approaches are effective in alleviating the cravings and withdrawal symptoms that arise during the initial stages of a quit attempt (Schnoll & Lerman, 2006), ex-smokers remain vulnerable to relapse long after these symptoms have subsided (Hawkins, Hollingworth, & Campbell, 2010).

Even after extended periods of abstinence former smokers report intense cravings when encountering cues (e.g. the smell of cigarette smoke, smoking paraphernalia), people and environments once associated with the rewarding effects of smoking (Caggiula et al., 2001;

Janes et al., 2009; Niaura, Abrams, Demuth, Pinto, & Monti, 1989; Santa Ana et al., 2009). 2

The enduring nature of these nicotine-associated memories may account for the continuing and, in many cases, life-long vulnerability to relapse that exists amongst abstinent smokers. The mechanisms that support the persistence of these memories across a prolonged period of time are not well understood.

Therefore, the broad aim of this thesis is to investigate the neurobiological processes underlying the persistence of nicotine-associated memories. Given the emerging role of epigenetic mechanisms in addiction and long-term memory processes, I used a combination of behavioral and molecular assays to examine the role of histone acetylation in the extinction and reinstatement of nicotine self-administration in rats.

Animal models of drug-seeking

Much of what is known about nicotine dependence, and drug addiction more generally, has arisen through the use of animal models of substance abuse. These models can be broadly characterized as those involving experimenter-administered drug injections or the active self- administration of the drug by the animal.

One of the most commonly used passive administration procedures is the conditioned place preference (CPP) paradigm, designed specifically to assay the rewarding properties of an addictive substance and the potential for contextual cues to promote drug-seeking behavior.

Using a Pavlovian conditioning procedure (Pavlov, 1927), animals are trained to associate the injection of a drug (unconditioned stimulus; US) with one of two distinct contexts (conditioned stimulus; CS), typically differentiated by patterns on the wall or floor of the apparatus (Bardo

& Bevins, 2000; O'Brien & Gardner, 2005). With repeated training, animals demonstrate approach behavior towards the context paired with drug administration. This preference is 3 taken as evidence that the drug is rewarding and that the animal has learned to associate the reward with the appropriate context.

Paradigms involving experimenter-administered injections speak to the behavioral and neurobiological consequences of drug exposure, but are not intended to model how humans seek and take drugs (Sanchis-Segura & Spanagel, 2006). For this reason, the intravenous self- administration (IVSA) method is widely used in preclinical research as it provides the highest degree of correspondence with addiction as it occurs in humans (Kalivas, Peters, & Knackstedt,

2006; Panlilio & Goldberg, 2007). The vast majority of drugs that are abused by humans are also self-administered by laboratory rodents (Kalivas et al., 2006), who will readily perform a behavioral response, such as a lever press or nose-poke, to obtain an intravenous infusion of the drug (O'Brien & Gardner, 2005). Unlike passive administration protocols, this technique can be used to model the defining features of substance abuse, including escalation of intake, extreme motivation to obtain the drug and the persistence of use despite the associated negative consequences (Deroche-Gamonet, Belin, & Piazza, 2004).

The IVSA procedure encapsulates the core components of instrumental and Pavlovian conditioning that are critical for maintaining addictive behavior. The model assumes that because drugs of abuse act as reinforcers, they will increase the likelihood of behaviors that result in their delivery (i.e. positive reinforcement; Skinner, 1938). Over the course of training animals also learn the relationship between the rewarding effects of the drug and the presence of various discrete and contextual stimuli, which become capable of promoting drug-seeking behavior in their own right. In support of this claim, the conditioned reinforcing properties of previously nicotine-paired cues sustain operant behavior in the absence of nicotine itself

(Caggiula et al., 2001; Macnamara, Holmes, Westbrook, & Clemens, 2016). 4

Accordingly, the IVSA paradigm represents the best approach for modelling nicotine addiction in laboratory rodents, as it allows for the examination of multiple interacting processes, including motivation, decision-making and the ability of Pavlovian-conditioned cues to drive behaviors aimed towards seeking and taking drugs. For these reasons I selected the IVSA paradigm as a model for testing the effects of epigenetic manipulation on nicotine- seeking.

Extinction of drug-seeking

Just as animals can learn to self-administer drugs, so too can they learn to inhibit their drug-seeking. During extinction, drug administration is withheld following the actions or stimuli that once predicted its delivery, resulting in a gradual reduction in the magnitude and frequency of drug-seeking behavior.

At face value extinction training appears to induce forgetting or unlearning of the behaviors and cues predictive of drug use. However, the decline in drug-seeking behavior across extinction is not permanent. Rather, the same factors that promote relapse in human smokers also induce reinstatement in laboratory animals, including stress (Buczek, Le, Wang,

Stewart, & Shaham, 1999), brief re-exposure to nicotine (reinstatement; Chiamulera, Borgo,

Falchetto, Valerio, & Tessari, 1996), presentation of nicotine-paired cues (cue-reinstatement;

Caggiula et al., 2001), or a return to contexts where nicotine was previously available (renewal;

Diergaarde, de Vries, Raaso, Schoffelmeer, & De Vries, 2008). These findings are taken as evidence that extinction reduces drug-seeking without erasing the associations formed during conditioning. As a result, extinction is typically thought to involve the learning of a new, competing inhibitory association (response/cue ≠ nicotine) that suppresses the expression of drug-seeking rather than completely removing it (Fig. 1.1; Chandler & Gass, 2013). 5

Figure 1.1. Extinction of drug-seeking. During extinction drug administration is withheld following the behaviors or cues that once predicted its delivery, resulting in a gradual decline in drug-seeking behavior (solid red/green line). Though extinction reduces drug-seeking, memories associated with drug use (e.g. cue/response = drug; dotted green line) are persistent, creating an enduring vulnerability to relapse. As a result, extinction is thought to involve the learning of a new, competing inhibitory association (cue/response ≠ drug; dotted red line) that suppresses the expression of drug-seeking behavior rather than completely removing it. Adapted from Chandler and Gass (2013).

The notion that extinction involves an active learning process has had a tremendous influence on addiction research. If extinction training imbues animals with a new inhibitory memory, then there is the possibility that this memory can be enhanced by manipulating the cellular and molecular processes necessary for its consolidation (Taylor, Olausson, Quinn, &

Torregrossa, 2009). This would allow the extinction memory to better compete for the control of behavior and ultimately attenuate reinstatement. Therefore, a vast body of research is now devoted to understanding the neuronal circuitry and intracellular processes that support the extinction of drug-seeking.

It should be noted that while human smokers occasionally receive extinction of

Pavlovian cue-drug associations (i.e. cue-exposure therapy), they rarely undergo explicit extinction of the instrumental actions involved in seeking and consuming drugs (McNally,

2014). However, preclinical models of extinction are not designed to replicate current smoking treatments, but rather to increase our understanding of the neurobiological mechanisms involved in the inhibition of drug-seeking behavior.

Neural circuits underlying the extinction of drug-seeking

The expression and extinction of drug-seeking recruits a distributed network of regions across the brain (Chandler & Gass, 2013), including the medial prefrontal cortex (mPFC), nucleus accumbens (NAc), hippocampus, basolateral amygdala (BLA), ventral tegmental area

(VTA) and medial dorsal hypothalamus (MDH; Fig. 1.2). Together these structures contribute to the mesolimbic dopamine pathway, the primary neural circuit of reward prediction (Kauer

& Malenka, 2007).

BLA

NAc PL core

VTA

NAc IL shell

Hippocampus

MDH

Expression of drug-seeking

Extinction of drug-seeking

Figure 1.2. Neural circuitry of the expression and extinction of drug-seeking. Pathways involved in the expression (green) and extinction (red) of drug-seeking. IL = infralimbic cortex; PL = prelimbic cortex; BLA = basolateral amygdala; NAc = nucleus accumbens; MDH = medial dorsal hypothalamus; VTA = ventral tegmental area. Adapted from Chandler and Gass (2013).

The mPFC plays a particularly important role in this circuit, as it is involved in processes such as inhibitory control (Meyer & Bucci, 2014) and decision making (Euston,

Gruber, & McNaughton, 2012). Indeed, glutamatergic projections from the ventral mPFC

(vmPFC; comprising the infralimbic cortex [IL] and the ventral portion of the prelimbic cortex

[PL]) to the NAc are critical for the consolidation and expression of the extinction of drug- seeking (LaLumiere, Niehoff, & Kalivas, 2010; Peters, Kalivas, & Quirk, 2009; Peters,

LaLumiere, & Kalivas, 2008; Sutton et al., 2003).

Following cocaine self-administration, post-extinction session inactivation of the IL impairs the long-term retention of extinction (LaLumiere et al., 2010). Further, bilateral inactivation of the IL or the NAc shell (NAcSh) using baclofen/muscimol is sufficient to reinstate cocaine-seeking behavior in extinguished rats (Peters et al., 2008), suggesting that tonic inhibition of the NAc by the IL is critical for inhibiting relapse. Therefore, strengthening the connections between these two structures may be a potential mechanism for enhancing extinction of drug-seeking.

Overlapping cellular and molecular basis of memory and addiction

A wealth of preclinical data has suggested that addiction is a disorder arising from the ability of drugs to create aberrant changes to mechanisms underlying normal learning and memory (Kelley, 2004; Torregrossa, Corlett, & Taylor, 2011). Like humans (Caggiula et al.,

2001; Janes et al., 2009) laboratory animals remain responsive to cues and contexts previously associated with drug use (Lu, Grimm, Hope, & Shaham, 2004), which are sufficient to induce strong motivation to obtain the drug. This cue hyper-reactivity far outlasts that for cues associated with natural rewards (Grimm, Hope, Wise, & Shaham, 2001; Lu et al., 2004), 9 suggesting that normal learning and memory processes are enhanced by exposure to addictive substances.

Long-term memories are encoded and stored in the brain via synapse-specific changes in the strength of connections between neurons (Martin, Grimwood, & Morris, 2000). The most pervasive model of this process is that of long-term potentiation (LTP) and long-term depression (LTD), whereby sustained neuronal activation results in an enduring facilitation or reduction in the efficiency of communication between neurons (Lomo, 1966). This is made possible by changes in the structure of dendritic spines and expression of receptors at the cell surface (Bekkers & Stevens, 1990; Engert & Bonhoeffer, 1999; Grosshans, Clayton, Coultrap,

& Browning, 2002; Lu et al., 2001).

Nicotine and cocaine induce LTP and LTD, as well as associated changes in neuronal morphology (e.g. dendritic spine length/density, receptor availability), in regions of the brain implicated in long-term memory, including the hippocampus, NAc and mPFC (Brown & Kolb,

2001; Huang, Lin, & Hsu, 2007; Robinson & Kolb, 1999). Importantly, by producing abnormally prolonged and pronounced increases in learning-related neurotransmitters (such as glutamate and dopamine; Di Chiara, 1999; Lambe, Picciotto, & Aghajanian, 2003), addictive drugs induce a form of LTP that is longer-lasting than that induced by natural rewards (Chen et al., 2008). Further, following cocaine self-administration, an enduring LTP is induced by stimuli that, under normal conditions, evoke only transient increases in neural activity (del

Olmo et al., 2006; Fole et al., 2014). Taken together, these data suggest that drugs create aberrantly persistent memories and that otherwise innocuous stimuli become well-learned under the influence of substances of abuse.

Drugs also act directly on the molecular processes that underlie these synaptic modifications. The binding of nicotine to its receptors on glutamatergic and dopaminergic 10 neurons activates intracellular signaling cascades that regulate the acute phase of gene transcription necessary for LTP and long-term memory consolidation (Alberini, 2009;

Albuquerque, Pereira, Alkondon, & Rogers, 2009; Inoue et al., 2007). For example, exposure to nicotine and its associated cues activates Ca2+-dependent pathways (such as the extracellular signal-regulated kinases [ERK] pathway) that induce the phosphorylation of cyclic adenosine monophosphate response element-binding protein (CREB; Walters, Cleck, Kuo, & Blendy,

2005). The target genes of this transcription factor, such as c-fos and brain-derived neurotrophic factor (BDNF), regulate the synthesis of new proteins that support the activity- dependent remodeling of synapses (Hu, Liu, Chang, & Berg, 2002; Kandel, 2012; Kivinummi,

Kaste, Rantamaki, Castren, & Ahtee, 2011; Nakayama, Numakawa, Ikeuchi, & Hatanaka,

2001).

In summary, the action of nicotine on neuronal function in specific brain regions results in the formation of strong yet maladaptive memories that may contribute to the high rate of relapse among smokers. However, the mechanisms supporting the formation and persistence of these memories currently remains unknown.

Epigenetic mechanisms in drug addiction

Epigenetic factors have become increasingly implicated in the transcriptional changes necessary for the establishment and maintenance of memories associated with drug use.

Epigenetic modifications result in a change in the structure of chromatin, permitting the regulation of gene expression without alterations to the structure of deoxyribonucleic acid

(DNA) itself (Borrelli, Nestler, Allis, & Sassone-Corsi, 2008). Though several epigenetic modifications have been identified, including DNA methylation, nucleosome remodeling and non-coding ribonucleic acids (ncRNA), the post translational modification of histone proteins has been among the most studied with respect to learning, memory and addiction. 11

Histone acetylation

Histones are basic proteins whose primary function is to organize and compact DNA within the nucleus. Due to the extraordinary length of DNA histone proteins are utilized as spools around which the DNA strand is coiled, forming a complex known as chromatin

(Kornberg, 1977). Each nucleosome, the repeating unit of chromatin, is comprised of ~147 base pairs (bp) of DNA wrapped around an octamer of the four core histone proteins (H2A,

H2B, H3, H4; Fig. 1.3A). In its native state, this DNA:protein complex is tightly packed and hence highly resistant to transcription. However, amino acid residues on N-terminal tails of histone proteins protrude beyond the DNA and are subject to several post-translational modifications (Luger, Mader, Richmond, Sargent, & Richmond, 1997), including acetylation, phosphorylation, ubiquitination, sumoylation and methylation. These modifications alter the affinity between positively charged histone proteins and negatively charged DNA, thereby regulating the accessibility of transcription machinery to the DNA strand (Fig. 1.3B). A single histone protein is subject to multiple modifications at several different sites, allowing for an extraordinarily diverse array of transcriptional responses to environmental stimuli (Kouzarides,

2007).

Acetylation of histones is bi-directionally regulated by histone acetyltransferases

(HATs) and histone deacetylases (HDACs), which alter chromatin structure to promote or inhibit transcription, respectively (Allfrey, Faulkner, & Mirsky, 1964; Grunstein, 1997).

Though several key HATs (such as CREB-binding protein [CBP]) have been identified, much of what is known about the role of histone acetylation in cognition has come from the manipulation of HDACs (Graff & Tsai, 2013b). Owing to their high level of expression throughout the brain, in particular the amygdala, hippocampus and cortex (Broide et al., 2007), class I HDACs (HDAC1, 2, 3, 8) have been the most interrogated with respect to learning and 12

Figure 1.3. Chromatin modifications in the brain. (A) The DNA strand is tightly coiled around octamers of the four core histone proteins: H2A, H2B, H3 and H4. (B) Amino acid residues on N-terminal tails of histone proteins protrude beyond the DNA and are available for post-translational modifications, including methylation (Me), phosphorylation (P) and acetylation (Ac). Several chromatin modifying enzymes result in a relaxed chromatin structure (such as histone acetyltransferases [HATs]) that permits the binding of transcriptional machinery to DNA, while others (e.g. histone deacetylases [HDACs]) induce a condensed chromatin structure and a state of transcriptional silence. Chromatin modifying enzymes also recruit co-activators or co-repressors to further facilitate or inhibit transcription, respectively. HMT = histone methyltransferases; HDM = histone demethylases; PP = protein phosphatases; PK = protein kinases. Adapted from Graff and Tsai (2013a).

13 memory. Indeed, inhibitors of class I HDACs, such as sodium butyrate (NaB) and valproic acid

(VPA), have well-described memory enhancing effects (Graff & Tsai, 2013b).

Histone acetylation and long-term memory

In a seminal paper, Levenson et al. (2004) used western blotting to demonstrate that global levels of histone H3 lysine 14 acetylation (H3K14ac) are increased in the hippocampus during consolidation of contextual fear conditioning. This increase in histone acetylation was dependent on the activation of receptors and intracellular signaling cascades implicated in long- term memory as administration of N-methyl-D-aspartate (NDMA) receptor antagonists, or compounds which inhibit the ERK pathway, blocked learning-induced increases in histone acetylation.

Later studies using chromatin immunoprecipitation (ChIP) assays determined that these changes in histone acetylation are not genome-wide, but rather are specific to a subset of genes

(Peixoto & Abel, 2013). For example, the acquisition and/or retrieval of long-term memory increases histone acetylation (concomitant with increases in messenger RNA [mRNA] expression) at the promoter regions of BDNF and the transcriptional coactivator, CBP (Bredy et al., 2007; Koshibu et al., 2009; Lubin & Sweatt, 2007). Given the known functional relevance of these genes, these findings suggest that histone acetylation may be a crucial regulator of the altered transcriptional states necessary for long-term memory.

Further support for the role of histone acetylation in memory has come from observing the consequences of manipulating HDACs and HATs in vivo. Numerous studies have demonstrated that HATs are essential for memory, as mice lacking CBP show significant impairments in LTP and long-term memory for contextual fear and object location (Alarcon et al., 2004; Barrett et al., 2011; Korzus, Rosenfeld, & Mayford, 2004). In contrast, HDACs 14 constrain the molecular processes necessary for memory consolidation. Acute administration of HDAC inhibitors before or immediately after training facilitates long-term memory consolidation in healthy rodents (Intlekofer et al., 2013; Levenson et al., 2004; Ploense et al.,

2013; Vecsey et al., 2007), while chronic treatment rescues memory deficits in animal models of neurodegenerative disorders (Fischer, Sananbenesi, Wang, Dobbin, & Tsai, 2007; Kilgore et al., 2010). Further, treatment with an HDAC inhibitor can transform a subthreshold learning event into one that results in a lasting memory and perpetuate the storage of long-term memory to a point beyond which normal memory fails (Stefanko, Barrett, Ly, Reolon, & Wood, 2009).

This suggests that events that would typically lead to a transient memory trace become well- learned under the influence of an HDAC inhibitor. However, it should be noted that these effects vary according to dose, as well as route (systemic vs. micro-infusion) and time-frame of administration (acute vs. chronic; Graff & Tsai, 2013b).

Just as histone acetylation is critical for the acquisition of long-term memory, so too is it important for extinction (Bredy & Barad, 2008; Lattal, Barrett, & Wood, 2007; Stafford,

Raybuck, Ryabinin, & Lattal, 2012). Bredy et al. (2007) found that post-session administration of VPA or NaB resulted in long-term retention of cued fear extinction under parameters that, following vehicle injections, yielded no lasting memory for extinction. Extinction training also increased histone acetylation (concomitant with increases in mRNA expression) at multiple

BDNF promoters within the PFC. Importantly, these changes were further enhanced by treatment with VPA, suggesting that HDAC inhibitors act to potentiate increases in acetylation that result from consolidation of the memory itself, presumably leading to a stronger and more persistent extinction memory.

A later study using intracranial microinfusions provided additional evidence for a functional role of histone acetylation in brain regions implicated in extinction. Stafford et al. 15

(2013) demonstrated that infusion of NaB into the vmPFC immediately following extinction of conditioned fear produced a significant extinction enhancement that was evident 14 days after training. This effect was not observed if the treatment was infused four hours after extinction sessions, indicating that NaB has no effect on behavior when administered outside of the acute phase of gene transcription necessary for memory consolidation. Taken together, these findings suggest that following training, functionally relevant changes in histone acetylation occur in regions of the brain implicated in extinction and that augmentation of this process results in a significant extinction enhancement.

In summary, these studies provide compelling evidence that histone acetylation is a key regulator of the altered transcriptional states necessary for the acquisition and extinction of long-term memory. For these reasons, histone acetylation has become a prime candidate mechanism underlying the establishment and maintenance of memories associated with drug use and represents a potential target for the pharmacological enhancement of extinction learning to prevent reinstatement of drug-seeking.

Regulation of histone acetylation by drugs of abuse

Addictive drugs regulate the expression of chromatin modifying enzymes (Fig. 1.4).

Even a single drug exposure is sufficient to induce alterations in histone acetylation throughout the regions of the brain implicated in reward, learning and memory (Kumar et al., 2005; Martin et al., 2012; Pandey, Ugale, Zhang, Tang, & Prakash, 2008). Though is it clear that nicotine increases histone acetylation at specific gene promoters (Gozen, Balkan, Yildirim, Koylu, &

Pogun, 2013; Levine et al., 2011), much of what is known about the effects of drugs on chromatin modifications has come from studies using cocaine as the reward.

Figure 1.4. Transcriptional and epigenetic regulation by drugs of abuse. By interacting with their synaptic targets, such as neurotransmitter (NT) receptors, ion channels and reuptake mechanisms, addictive drugs activate several intracellular signaling pathways. This in turn regulates the expression of transcription factors as well as chromatin and DNA modifying enzymes. This process ultimately results in the activation or silencing of specific protein- coding and regulatory genes. CREB = cyclic AMP-responsive element binding protein; DNMTs = DNA methyltransferases; HATs = histone acetyltransferases; HDACs = histone deacetylases; HDMs = histone demethylases; HMTs = histone methyltransferases; MEF2 = myocyte-specific enhancer factor 2; NF-κB = nuclear factor-κB; pol II = RNA polymerase II. From Robison and Nestler (2011).

For instance, although cocaine typically increases histone acetylation, these increases do not occur universally across the genome (Renthal et al., 2009). Rather, chromatin modifications are abundant at the promoter regions of genes known to be transcriptionally activated by cocaine, suggesting that drug-induced changes in histone acetylation occur at functionally relevant loci. Chronic exposure to cocaine (injected, yoked or self-administered) increases histone H3 acetylation at the promoter regions of genes relevant to long-term memory and addiction, including transcriptional coactivators (CBP), protein kinases (cyclin-dependent kinase 5 [Cdk5]), neuronal growth factors (BDNF Exon II/III/IV) and glutamate receptors

(GluR2, GRIN2A, GRIN2B; Kumar et al., 2005; Wang et al., 2010a). Importantly, several of these changes are persistent, detectable after a full week of abstinence from the drug (Freeman et al., 2008; Kumar et al., 2005; Schmidt et al., 2012).

The consequences of nicotine on these processes have been largely unexplored. As a result, it currently remains unclear the degree to which these changes are specific to individual drug types. However, the fact that mere cocaine exposure induces enduring changes in acetylation at these sites could explain why memories formed under the influence of addictive drugs are rendered aberrantly powerful and persistent. It may be the case that by creating a more permissive chromatin structure at promoters of genes involved in learning and memory, addictive drugs allow normally transient memory traces to be retained across an extended period of time.

The role of histone acetylation in drug reward and motivation

Manipulation of HAT and HDAC activity has revealed that histone acetylation is critical for the expression of addictive behaviors. In the first instance, histone acetylation regulates the transcriptional changes necessary for the acute rewarding effects of drugs. Genetic 18 deletion of CBP (a potent HAT) in the NAc attenuates cocaine-induced increases in histone acetylation and immediate early gene expression, resulting in an impairment of cocaine- associated behaviors, such as hyperlocomotion and CPP (Malvaez, Mhillaj, Matheos, Palmery,

& Wood, 2011).

Analogous results are obtained when HDAC inhibitors are administered prior to CPP acquisition trials. Pre-session treatment with an HDAC inhibitor potentiates cocaine and morphine-induced increases in histone acetylation and gene transcription, which enhances the acute rewarding effects of the drugs (Kumar et al., 2005; Sanchis-Segura, Lopez-Atalaya, &

Barco, 2009; Schroeder et al., 2008). Interestingly, administration of sodium 4-phenylbutyrate

(PhB) impairs the CPP for nicotine, suggesting that histone acetylation may play an opposing role in nicotine reward (Pastor, Host, Zwiller, & Bernabeu, 2011). However, it is also plausible that these effects vary according to the specific type/dose of HDAC inhibitor used or the experimental procedures used to establish preference.

Extending these results to the acquisition and maintenance of an instrumental response has confirmed the importance of HDACs in the motivation to obtain drug reinforcement.

Simon-O'Brien et al. (2014) demonstrated that following ten weeks of training, pre-session administration of NaB (600 mg/kg, intraperitoneal [i.p.]) decreases not only ethanol self- administration, but also excessive drinking and escalation of intake amongst alcohol-dependent rats. This effect is also observed when the treatment is centrally delivered (500 µg), suggesting that these results are unlikely to be caused by a peripheral (i.e. non-specific) effect of the drug.

Studies investigating the consequences of pre-session HDAC inhibition on cocaine reinforcement have yielded inconsistent results. When injected during the acquisition phase

(prior to the first day of training), Romieu et al. (2008) found that trichostatin A (TsA; 0.3 mg/kg) dose-dependently decreases cocaine, but not sucrose, self-administration. In addition, 19 the treatment significantly reduces the breaking point under a progressive-ratio (PR) schedule, indicative of a decreased motivation to obtain cocaine. In contrast, when administered during the maintenance phase (i.e. once self-administration is well established), HDAC inhibitors delivered both systemically (NaB; 450 mg/kg) and directly into the NAcSh (165 pmol TsA; bilateral) have the opposite effect, augmenting cocaine (but not sucrose) self-administration on a fixed-ratio and PR schedule (Sun et al., 2008; Wang et al., 2010a).

These results indicate that histone acetylation is critically involved in the reinforcing and motivational effects of cocaine, yet may play opposing roles in distinct phases of self- administration. However, this will require further investigation given the variability in the type/dose of HDAC inhibitor used, route of administration and behavioral training parameters.

One clear finding from these studies is that HDAC inhibitors do not alter operant responding for sucrose, suggesting that histone acetylation may be particularly important for drug-related rewards, as opposed to motivated behaviors more generally. This would support the notion that there is a cumulative effect of drugs and HDAC inhibitors on histone acetylation (and subsequent gene expression) that does not occur following exposure to a natural reward.

The role of histone acetylation in drug-associated contextual memory

In addition to its role in the rewarding aspects of addictive drugs, histone acetylation is also a candidate mechanism underlying the establishment and maintenance of drug-associated memories. Indeed, just as HDACs negatively regulate memory formation in paradigms such as conditioned fear and object recognition, there is evidence to suggest they also constrain the molecular processes required for the consolidation of drug-context associations.

In one study, Rogge, Singh, Dang, and Wood (2013) investigated the role of HDAC3 during the consolidation phase of cocaine-induced CPP. The authors found that in the absence 20 of cocaine (i.e. following a CS- conditioning trial), HDAC3 associates with the promoter regions of the transcription factors c-fos and nuclear receptor subfamily 4 group A, member 2

(Nr4a2), acting to suppress their expression when they are not required for the consolidation of a salient learning event. Following cocaine conditioning trials, however, HDAC3 is removed from the c-fos and Nr4a2 promoters. This in turn results in an increase in promoter H4K8 acetylation and mRNA expression, allowing these immediately early genes to initiate the sequence of molecular cascades necessary for memory consolidation. The authors also found that mice with homozygous deletions of HDAC3 in the NAc show enhanced acquisition of cocaine-induced CPP. This indicates that in wild-type mice, HDAC3 functions to constrain the formation of cocaine-context associations.

Further support for the role of HDACs in the consolidation of drug-associated memories comes from studies reporting an enhancement of cocaine and morphine-induced CPP following post-session administration of an HDAC inhibitor (Itzhak, Liddie, & Anderson,

2013; Raybuck, McCleery, Cunningham, Wood, & Lattal, 2013; Wang, Zhang, Qing, Liu, &

Yang, 2010b; Wang et al., 2014). This finding is important, as it demonstrates that in the absence of any acute interaction between the treatment and the reinforcer, HDAC inhibitors facilitate the acquisition of drug-induced CPP via enhanced consolidation of the drug-context association.

Taken together, these data suggest that histone acetylation is critical for at least two distinct yet interdependent aspects of addictive behavior: the regulation of the acute transcriptional response to drugs, and the changes in gene expression necessary for the consolidation of drug-related memories. 21

Histone acetylation and the extinction of drug-seeking

Histone acetylation also represents a potential target for the pharmacological enhancement of extinction learning to prevent reinstatement of drug-seeking. In the first demonstration of this effect, Malvaez, Sanchis-Segura, Vo, Lattal, and Wood (2010) found that mice treated with NaB during extinction consolidation (i.e. immediately after each session) extinguish cocaine-induced CPP faster and to a greater extent than animals treated with a vehicle solution. Importantly, this enhancement is persistent, attenuating reinstatement of drug- seeking upon re-exposure to cocaine, a finding since replicated with other HDAC inhibitors and addictive drugs (Itzhak et al., 2013; Malvaez et al., 2013; Raybuck et al., 2013; Wang et al., 2010b; Wang et al., 2014).

In order to ensure the observed effects of NaB could be attributed to a facilitation of extinction consolidation (and not to non-specific effects of treatment on motivation or performance), Malvaez et al. (2010) included several control procedures. Firstly, NaB had no effect on extinction when administered ten hours after the session (i.e. outside the window of memory consolidation), suggesting a temporally contiguous relation between NaB and extinction is required for the extinction enhancement. Further, mice treated with NaB without re-exposure to the CPP apparatus did not differ from saline treated animals on subsequent test, indicating that, in the absence of extinction training, there is no effect of treatment on preference. Finally, to address the possibility that NaB was producing an aversion to the previously drug-paired context (a behavior resembling enhanced extinction), an additional control group of mice were confined to one compartment following exposure to NaB.

Importantly, these animals showed no evidence of avoidance behavior when tested 24 hours later. 22

Together, these data demonstrate that the effects of NaB on extinction and reinstatement cannot be attributed to deficits in motivation or to an aversive association with the drug-paired compartment (i.e. mediated conditioning). Rather, it appears that histone acetylation is critically involved in the changes in gene expression necessary for the consolidation of extinction. This suggests that HDAC inhibitors may be a potential target for the pharmacological enhancement of extinction learning to prevent reinstatement of nicotine- seeking.

Extending Pavlovian conditioning studies to an instrumental paradigm

Until now, studies examining the consequences of HDAC inhibitors on the extinction of drug-seeking have been restricted to the CPP procedure. Though research conducted using this protocol has revealed crucial information about the role of histone acetylation in the extinction of drug-associated contextual memory, paradigms involving passive drug administration are not intended to model addictive behavior in humans (Sanchis-Segura &

Spanagel, 2006). Extending the results of Pavlovian conditioning studies to an instrumental model of extinction learning may be important to the study of drug addiction, as this type of procedure more closely approximates drug-taking behavior in humans.

Further, active, response-contingent drug-administration has distinct neurobiological consequences, which could influence the therapeutic potential of HDAC inhibitors. For example, rats trained to self-administer cocaine show an elevated dopamine response (Hemby,

Co, Koves, Smith, & Dworkin, 1997) and more persistent form of LTP (Chen et al., 2008) than rats that receive non-contingent, yoked infusions of cocaine. In addition, self-administered cocaine increases acetylation at gene promoters unaffected by brief exposure to the drug

(Kumar et al., 2005), as is often the case in CPP studies. For these reasons, extending the current 23 findings to an instrumental self-administration procedure represents the crucial next step for the investigation of the role of histone acetylation in the extinction of drug-seeking (Madsen,

Brown, & Lawrence, 2012).

To our knowledge, there are no studies explicitly examining the effect of HDAC inhibition on the extinction of drug-seeking using an operant conditioning paradigm. However, there is some evidence that HDAC inhibitors attenuate reinstatement of self-administration, although this occurs in the absence of any effects on extinction. In one study, Romieu et al.

(2011) found that administration of TsA or PhB across the last five days of home-cage abstinence (i.e. no extinction) reduces reinstatement induced by a combination of a cocaine- priming injection and presentation of response-contingent cues. The authors suggest that these results can be taken as evidence that histone acetylation regulates the neuroplastic changes that underlie drug craving during withdrawal from drug use.

This finding is inconsistent with the notion that HDAC inhibitors attenuate reinstatement of drug-seeking by facilitating the consolidation of extinction learning (Malvaez et al., 2010). One possible explanation for this discrepancy is that the final injection of treatment in the Romieu et al. (2011) study occurred 30 minutes prior to the cocaine-primed reinstatement session. Accordingly, the results observed here could be attributed to an acute interaction between the HDAC inhibitor and the cocaine, which interfered with the rewarding or motivational properties of the drug, as described above (Romieu et al., 2008; Simon-O'Brien et al., 2014). In light of this, future studies will be required to determine whether simple exposure to an HDAC inhibitor is sufficient to attenuate reinstatement of drug-seeking.

In summary, these findings provide evidence that histone acetylation plays a critical role in the formation and extinction of memories associated with drug use. Following conditioning, cocaine reduces HDAC occupancy at the promoter regions of genes involved in 24 long-term memory, releasing the inhibitory constraint on their transcription. Potentiating this effect, genetically or pharmacologically, enhances the acquisition of drug-induced CPP. In addition, the administration of HDAC inhibitors during the period of extinction consolidation facilitates the extinction of CPP in a persistent manner that provides resistance to reinstatement.

For these reasons, histone acetylation is a candidate mechanism underlying the establishment and maintenance of memories associated with drug use and a potential target for the pharmacological enhancement of extinction learning.

The role of these processes in the extinction of nicotine-seeking has remained unexplored. Given that nicotine has the highest relapse rate of any addictive drug (Lopez-

Quintero et al., 2011), nicotine self-administration represents the ideal paradigm for assessing the effect of HDAC inhibitors on the extinction and reinstatement of drug-seeking.

Research Aims

The overarching aim of this thesis is to examine the involvement of histone acetylation in the extinction of nicotine self-administration and subsequent susceptibility to relapse.

To address this aim, the first experimental chapter investigated whether administration of the HDAC inhibitor, NaB, facilitates the extinction of nicotine-seeking. Based on the findings of Malvaez et al. (2010), it was hypothesized that when administered during the period of extinction consolidation (but not outside of this window) NaB would enhance the rate of extinction and attenuate reinstatement upon re-exposure to nicotine and/or its associated cues.

The second experimental chapter aimed to examine the molecular mechanisms underpinning any observed behavioral effects. To this end, I used a combination of ChIP and quantitative polymerase chain reaction (qPCR) to investigate the consequences of nicotine self- administration and NaB treatment on mRNA expression and chromatin modifications in the 25 vmPFC and NAc. It was hypothesized that during the period of extinction consolidation NaB treatment would increase histone acetylation at the promoter regions of genes involved in learning and memory. Further, given that cocaine self-administration induces lasting epigenetic changes at these loci (Kumar et al., 2005; Schmidt et al., 2012; Wang et al., 2010a), it was expected that the effects of NaB would interact with persistent chromatin modifications induced by a prior history of nicotine exposure. 26

Chapter II: Inhibition of histone deacetylases facilitates extinction and attenuates

reinstatement of nicotine self-administration

Histone acetylation is critical for long-term memory for extinction. Indeed, several studies have shown that treatment with an HDAC inhibitor facilitates the extinction of drug-induced CPP

(Itzhak et al., 2013; Malvaez et al., 2013; Malvaez et al., 2010; Raybuck et al., 2013; Wang et al., 2010b; Wang et al., 2014). This enhancement is persistent, conferring resistance to reinstatement in response to brief re-exposures to the drug (Malvaez et al., 2010). These findings are significant as identifying the molecular mechanisms of relapse is a major focus of preclinical studies of addictive behavior.

Until now, examination of the consequences of HDAC inhibition on the extinction of drug-seeking has been restricted to the CPP procedure. This protocol involves the pairing of a specific context with the rewarding properties of the drug, but not the active administration of the drug by the animal. Extending the results of CPP studies to a self-administration paradigm is a crucial next step in exploring the role of histone acetylation in extinction, as this procedure more closely approximates voluntary drug-taking behavior in humans (Sanchis-Segura &

Spanagel, 2006). Further, active, response-contingent drug administration has neurobiological consequences distinct from passive administration (Chen et al., 2008; Hemby et al., 1997), which may influence the ability of HDAC inhibitors to facilitate extinction.

Much of what is known about the epigenetic regulation of drug-seeking has been established with cocaine as the reward. The role of histone acetylation in the extinction of other drugs, including nicotine, remains unclear. Determining whether the behavioral effects of

HDAC inhibitors are generalized across drug classes will be necessary to assess the therapeutic potential of these compounds. Further, relapse is a characteristic feature of nicotine dependence 27 in both humans and animals (D'Souza & Markou, 2011), making it an ideal drug of investigation.

Accordingly, the aim of the first experimental chapter was to investigate the effect of

NaB treatment across extinction on subsequent reinstatement of nicotine-seeking. To achieve this aim, I carried out a series of experiments to examine the consequences of NaB on extinction learning itself, cue- and drug-primed reinstatement and responding for a natural, non-drug reward.

Experiment 1 used a standard continuous reinforcement (fixed-ratio 1 [FR-1]) self- administration and extinction protocol, where NaB was administered either immediately or six hours after each session. This ensured that results could be attributed to enhanced consolidation of the extinction memory specifically (Lattal et al., 2007), rather than any non-specific effects of treatment on motivation, locomotor activity or attention. Under these conditions, a clear attenuation of reinstatement was observed amongst rats treated with NaB immediately, but not six hours, after extinction sessions. No effect of treatment was detected across extinction itself, though this was most likely due to the very rapid extinction of nicotine-seeking and subsequent floor effect.

In order to elevate responding across this phase, and hence increase sensitivity to detect an effect of NaB on extinction (as has been reported previously with CPP; Malvaez et al.,

2010), two additional approaches were used. Experiment 2 involved training rats to acquire nicotine self-administration on a variable-ratio (VR) schedule. This manipulation was introduced as behaviors intermittently reinforced with drug delivery are less rapidly extinguished than those that are continuously reinforced (Valles, Rocha, & Nation, 2006). In

Experiment 3, rats trained under an FR-1 schedule underwent a cue-extinction procedure, where response-contingent cue presentations were maintained across extinction. In this 28 protocol, the conditioned reinforcing properties of previously nicotine-paired cues act to sustain drug-seeking behavior in the absence of nicotine itself (Caggiula et al., 2001; Cohen,

Perrault, Griebel, & Soubrié, 2004; Macnamara et al., 2016). The latter of these approaches allowed for the detection of an effect of NaB on responding across extinction.

The final experiment aimed to determine whether the effects of NaB are specific to a drug reward. As administration of an HDAC inhibitor attenuates cocaine and ethanol, but not sucrose self-administration (Romieu et al., 2008; Simon-O'Brien et al., 2014), it may be the case that histone acetylation plays a unique role in drug-seeking behavior. Under our conditions, NaB had no impact on the extinction or reinstatement of sucrose-seeking.

Methods

Subjects

Male Sprague Dawley rats (N = 106; 175 g - 200 g; Animal Resource Centre, WA,

Australia) were housed four per cage on a 12 hour reverse light/dark cycle (lights off at 7 a.m.).

All procedures took place during the dark cycle. Rats received ad libitum access to food and water until two days prior to the commencement of self-administration when food was restricted to 20 g/rat/day (Donny et al., 1998). All procedures were approved by the Animal

Care and Ethics Committee of the University of New South Wales (12/155B) and were conducted in accordance with the Australian Code for the Care and Use of Animals for

Scientific Purposes (8th ed, 2013). 29

Drugs

Nicotine hydrogen tartrate and NaB (Sigma, MO, USA) were dissolved in sterile saline

(0.9% sodium chloride [NaCl]). Nicotine solutions for subcutaneous (s.c.) priming injections were pH adjusted to 7.4 using sodium hydroxide. All doses of nicotine refer to the free base form.

Surgery for the implantation of intravenous catheters (Experiments 1-3)

Approximately two weeks after arrival in the laboratory rats were anaesthetized with 2-

3% isoflurane in oxygen (0.2 L/min) and implanted with a chronic intravenous catheter into the right jugular vein. Catheters consisted of a 14 cm length of silastic tubing (internal diameter

[ID] = 0.44 mm; outer diameter [OD] = 0.64 mm) connected at one end to a back mount cannula connector pedestal (Plastics One, CT, USA). A silicone bead placed 2.5 cm from the opposite end of the tubing prevented the catheter from traveling deep into the vein. Polypropylene mesh

(2 cm in diameter) was secured to the back mount to ensure the externalized catheter did not shift underneath the skin.

Once animals were anaesthetized a portion of fur was shaved from the center of the back posterior to the scapulae and from beneath the left side of the neck above the jugular vein.

Each shaved area was thoroughly swabbed with antibacterial iodine solution in preparation for incisions that were made on the neck (~ 1 cm) and to the right of center on the back (~ 3 cm).

The catheter was then passed subcutaneously from the back to the neck and inserted into the jugular vein towards the heart. After the neck wound was cleaned and sutured the back mount was placed underneath the skin, with one end exiting the animal through a small incision on the back. The external segment of the cannula was sealed with a small plastic cap in order to 30 minimize the risk of infection. This was further protected with a brass cap that screwed onto the back mount to prevent interference from other rats.

Immediately following surgery, and for two subsequent days, rats were treated with a non-steroidal analgesic (carprofen; 5 mg/kg, s.c.) and catheters flushed with saline containing cefazolin sodium antibiotic (0.2 ml; 100 mg/ml). To ensure long term patency catheters were flushed immediately after each behavioral session with 0.2 ml of heparinized saline (300

I.U/ml) containing cefazolin sodium antibiotic.

Apparatus

All self-administration studies were carried out in 16 identical operant conditioning chambers (31.8 x 34.3 x 25.4 cm; MED Associates, VT, USA) enclosed in sound attenuating wooden boxes (40.6 x 55.9 x 55.9 cm) fitted with in-built exhaust fans. Floors of the operant chambers were comprised of stainless steel rods, 3.2 mm in diameter, spaced 10 mm apart. The door, ceiling and rear wall of the chambers consisted of a clear polycarbonate, whilst the side walls were constructed out of aluminum panels. The test wall contained a magazine that separated the ‘active’ and ‘inactive’ nose-poke holes (counterbalanced left vs. right), each containing a yellow cue-light. Chambers were fitted with a 100 mA house-light and four infrared locomotor activity detectors positioned on the front and rear walls of the chamber (2.9 cm above the floor).

Nicotine (Experiments 1-3) was delivered via syringe pumps (external to the sound attenuating boxes) that were connected with PE50 tubing (Plastics One) to a fluid swivel assembly suspended above the chamber by an adjustable counterbalance weight (Instech, PA,

USA). The swivel was attached to a spring connector (Plastics One), enclosing the PE50 tubing, which descended into the chamber to be attached to the back mount of the rat. 31

In Experiment 4 the tether port in the ceiling of the chamber was blocked with a Perspex slide.

Data from all behavioral sessions were collected and recorded by a computer running

MED-PC IV software (Med Associates).

Procedure

A schematic representation of the experimental procedures can be seen in Fig. 2.1.

Experiment 1: The effect of HDAC inhibition on the extinction and reinstatement of nicotine-seeking behavior

To examine the role of histone acetylation in the extinction and reinstatement of nicotine-seeking, rats were treated with either NaB or vehicle (Veh) immediately after each extinction session. A third group of rats received NaB injections six hours after the session to determine whether any treatment effects were dependent on NaB being administered during the period of extinction consolidation.

Nicotine self-administration

Forty-two rats commenced self-administration training with two daily one hour habituation sessions with nose-pokes covered and the house-light on. On the third day, nicotine self-administration commenced when the active and inactive nose-pokes were revealed. Each of the 12 self-administration sessions lasted for one hour and began with the illumination of the house-light. Each response on the active nose-poke resulted in a single infusion of nicotine

(30 µg/kg/100 µL over 3 s), presentation of the cue-light positioned inside the nose-poke hole

Experiments 1, 2, 4 Experiment 3 Nicotine Sucrose Nicotine Self-Administration (12 d) Self-Administration (12 d) Self-Administration (12 d) FR-1 (Expt. 1) or VR-2 (Expt. 2) FR-1 (Expt. 4) FR-1

Extinction (≥ 6 d) Extinction (≥ 6 d) NaB or Veh NaB or Veh Response-contingent cues No response-contingent cues

Reward + Cue Reinstatement Cue-Reinstatement

Extinction (≥ 2 d) NaB or Veh

Reward-Primed Reinstatement

Extinction (≥ 2 d) NaB or Veh

Reward + Cue Reinstatement

Figure 2.1. Schematic representation of Experiments 1-4. Four experiments were designed to examine the effect of sodium butyrate (NaB) on the extinction and reinstatement of nicotine and sucrose-seeking. FR-1 = fixed-ratio 1; VR-2 = variable-ratio 2; Veh = vehicle.

(3 s) and termination of the house-light (20 s). Responses during this 20 s time-out period, or on the inactive nose-poke, were recorded but were of no scheduled consequence.

Rats were determined to have successfully acquired nicotine self-administration if they averaged a minimum of six infusions per session across the last three sessions and demonstrated a preference for the active nose-poke (2 active: 1 inactive; Clemens, Castino,

Cornish, Goodchild, & Holmes, 2014; Liechti, Lhuillier, Kaupmann, & Markou, 2007;

Paterson, Froestl, & Markou, 2004).

Extinction

Rats were allocated to one of three treatment conditions matched for self-administration performance (average active and inactive nose-pokes). Group ‘NaB’ and ‘NaB + 6 h’ received an i.p. injection of NaB immediately or six hours after each extinction session, respectively.

Group ‘Veh’ received an equivalent volume of saline immediately after each session. Sodium butyrate was administered at a dose of 100 mg/kg (1 ml/kg; Kumar et al., 2005). This low dose of NaB (relative to previous studies; e.g. Malvaez et al., 2010; Raybuck et al., 2013) was selected in order to minimize any non-specific effects of treatment on motivation, attention or locomotor activity.

During extinction training, responses on the active nose-poke no longer produced nicotine or its associated cues. Training continued in this manner for a minimum of six days or until active responses were less than 30% of the last three days of acquisition (or a maximum of six responses) for two consecutive days. 34

Reinstatement

Once each rat achieved the extinction criteria, reinstatement of nicotine-seeking was assessed during three reinstatement tests. Testing began with cue-reinstatement, as this manipulation typically produces the lowest elevation of responding in our hands. Here, responses on the active nose-poke resulted in presentation of the nicotine-paired cue-light, termination of the house-light and activation of the syringe pump, but not delivery of nicotine itself. If no active responses were made during the first ten minutes of the session, rats were given a single non-contingent cue-light presentation to signal the change in conditions.

Rats then received a minimum of two re-extinction sessions to criterion, each followed by post-session injections of NaB or Veh. During this re-extinction period, rats were habituated to the nicotine prime injection procedure with an s.c. injection of saline (1 ml/kg) immediately prior to each session. Nicotine reinstatement involved rats receiving a single nicotine priming injection (0.3 mg/kg; 1 ml/kg, s.c.) immediately prior to a test session performed under extinction conditions (responses recorded but of no scheduled consequence).

Following a second period of re-extinction to criterion, the final combined nicotine + cue reinstatement test was conducted. Rats received a priming injection of nicotine before a test session where nicotine-paired cues were again presented in a response-contingent manner.

Importantly, NaB was not administered following reinstatement tests to prevent any acute interaction between NaB and nicotine. 35

Experiment 2: The effect of HDAC inhibition on the extinction and reinstatement of nicotine-seeking following acquisition under a variable-ratio schedule

In Experiment 1 it was possible that low levels of responding across extinction obscured evidence of NaB-potentiated extinction learning. Experiment 2 addressed this possibility by training rats to acquire nicotine self-administration on a VR schedule, as partial reinforcement creates resistance to extinction of drug-seeking (Valles et al., 2006).

Nicotine self-administration

Following six days on the FR-1 schedule described above, 16 rats received three days training on a VR-1.5 schedule, followed by a further three days training on a VR-2 schedule.

Parameters for acquisition of self-administration (e.g. infusion dose, session length, time-out period) were identical to those in Experiment 1 except that nicotine and its associated cues were delivered every 1.5 and 2 responses on average, respectively.

Extinction and reinstatement

Rats were allocated to receive an injection of either NaB or Veh (groups matched for self-administration performance) immediately after each extinction session. Extinction and reinstatement tests were conducted under the same conditions as Experiment 1, except that response-contingent cues during reinstatement were presented on a VR-2 schedule. 36

Experiment 3: The effect of HDAC inhibition on cue-extinction of nicotine self- administration

Rats in Experiment 3 underwent a cue-extinction procedure, a second approach to elevating responding across this phase. Under these conditions, rats continued to receive response-contingent cue presentations across extinction, a procedure that maintains drug- seeking behavior in the absence of nicotine itself (Caggiula et al., 2001; Cohen et al., 2004;

Macnamara et al., 2016).

Nicotine self-administration

Twenty-four rats self-administered nicotine under equivalent conditions to those described in Experiment 1.

Extinction and reinstatement

Following acquisition rats underwent a cue-extinction procedure, where conditions were identical to those during acquisition except that saline was substituted for nicotine. Based on performance during self-administration, rats were allocated to receive an injection of either

NaB or Veh immediately after each session. Once the extinction criteria were achieved, or a maximum of 18 sessions elapsed, a single nicotine + cue reinstatement test was conducted, as described above. Prior work in our laboratory has indicated that rats still responding after 18 days of extinction will continue to respond for the cue alone for several weeks. 37

Experiment 4: The effect of HDAC inhibition on the extinction and reinstatement of sucrose-seeking

As administration of an HDAC inhibitor attenuates cocaine and ethanol, but not sucrose self-administration (Romieu et al., 2008; Simon-O'Brien et al., 2014), it may be the case that histone acetylation plays a unique role in drug-seeking behavior. Accordingly, Experiment 4 examined the consequences of NaB treatment on the extinction and reinstatement of responding for a natural reward.

Sucrose self-administration

Twenty-four rats underwent sucrose self-administration under identical conditions to those in Experiments 1 and 3 with three exceptions: (1) rats did not undergo surgery; (2) active nose-pokes were reinforced with a single 45 mg sucrose pellet (AIN-76A; TestDiet, MO, USA) delivered into the magazine; and (3) sessions lasted until a maximum of 30 pellets were earned or 30 minutes had elapsed.

Extinction and reinstatement

Following acquisition, rats underwent the same extinction/reinstatement procedure described in Experiment 1 over 30 minute sessions. Sucrose reinstatement tests involved placing three sucrose pellets in the magazine prior to test.

Statistical analysis

For all experiments, active and inactive nose-pokes across the last three days of self- administration (including those during the time-out) were analyzed using a mixed model 38

ANOVA with the between-subjects factor of treatment (NaB, Veh, and NaB + 6 h [Expt. 1 only]) and the within-subjects factor of nose-poke (active vs. inactive). Total nicotine infusions were analyzed using a one-way ANOVA with the between-subjects factor of treatment.

All rats were required to complete a minimum of six extinction sessions before undergoing the reinstatement procedure. Beyond this time point the number of rats remaining in extinction decreased significantly in all experiments. For this reason, analysis of these data was confined to the first six days of training. Total active and inactive responses during extinction were analyzed using a mixed model ANOVA with the between-subjects factor of treatment and the within-subjects factors of session (days 1 – 6) and nose-poke. As the greatest effect of NaB was expected on the first session after treatment (Malvaez et al., 2010), a planned contrast compared responding amongst the treatment groups across the first two days of extinction (between-subjects factor of treatment; within-subjects factors of session and nose- poke). A Kaplan-Meier survival analysis was also conducted to determine whether NaB reduced the number of sessions required for rats to reach the extinction criteria (Portero-

Tresserra, Marti-Nicolovius, Guillazo-Blanch, Boadas-Vaello, & Vale-Martinez, 2013).

During reinstatement responding declined rapidly across the session, therefore analysis of these data were confined to the first 30 minutes of each test. Active and inactive responses across reinstatement were analyzed using planned orthogonal contrasts (Bird, 2004) with the between-subjects factor of treatment and the within-subjects factor of nose-poke. In

Experiment 1, the critical contrast examined whether responding in group NaB differed from that in the remaining groups (Veh and NaB + 6 h). The second contrast examined whether responding in group Veh differed from that in group NaB + 6 h. In Experiments 2, 3 and 4, active and inactive nose-pokes in group NaB were compared to that in group Veh.

Alpha was fixed at 0.05 for all analyses. 39

Results

Experiment 1: NaB administered immediately, but not six hours, after extinction attenuates reinstatement of nicotine-seeking

Twelve rats were excluded from data analysis due to a failure to satisfy the acquisition criteria or loss of catheter patency (NaB = 5; NaB + 6 h = 3; Veh = 4). One rat (NaB) was excluded due to responding more than 2 SD above the mean on reinstatement tests. This resulted in final group sizes of NaB = 9, NaB + 6 h = 9 and Veh = 11.

Nicotine self-administration

At the conclusion of self-administration rats clearly discriminated the drug source, showing a strong preference for the nicotine-paired nose-poke (main effect of nose-poke: F1,26

= 33.15, p < 0.001; Fig. 2.2). Importantly, there were no significant main effects or interactions involving treatment, suggesting that groups did not differ on levels of active or inactive responding during the last three days of training (Fs < 1). Further, there were no group differences in the number of nicotine infusions received (NaB: 13.67 + 1.61; NaB + 6 h: 15.56

+ 1.44; Veh: 15.91 + 1.81; Fs < 1).

Extinction

Following removal of nicotine and its associated cues, responding on the active nose- poke declined across extinction training (session x nose-poke interaction: F5,22 = 6.60, p < 0.01;

30 NaB - Active NaB - Inactive

NaB + 6 h - Active s

e 20 NaB + 6 h - Inactive

n Veh - Active o

p Veh - Inactive s

R 10

0 IVSA E1 E2 E3 E4 E5 E6

Session

Figure 2.2. Experiment 1: Acquisition and extinction of nicotine self-administration. Active and inactive responses during acquisition of intravenous nicotine self-administration (IVSA; average of the last 3 sessions) and the first six days of extinction (E1 – E6). Rats were treated with sodium butyrate (NaB), vehicle (Veh) or NaB administered six hours after the session (NaB + 6 h). Data points represent group means + SEM.

Fig. 2.2). A significant session by treatment interaction (F10,46 = 2.12, p < 0.05) indicated that this reduction differed among treatment groups. However, this was due to differences in levels of inactive responding only (session x treatment x nose-poke interaction: p > 0.05).

There was no effect of treatment on the number of days required for rats to reach the extinction criteria (NaB: 6.22 + 0.22; NaB + 6 h: 6.88 + 0.31; Veh: 6.45 + 0.25; Kaplan Meier survival analysis: 2 = 2.22, df = 2, p > 0.05).

Reinstatement

During the cue-induced reinstatement test, one rat (NaB) was given a single non- contingent cue presentation due to a lack of active nose-pokes in the first ten minutes of the session.

As seen in Fig. 2.3A, responding across cue-reinstatement was greater on the active nose-poke (F1,26 =10.15, p < 0.01), yet there were no significant group differences in levels of active or inactive nose-pokes (ps > 0.05). This suggests that NaB had no detectable impact on cue-induced reinstatement of nicotine-seeking.

During nicotine-primed reinstatement, rats showed a significant preference for the active nose-poke (F1,26 = 30.27, p < 0.001; Fig. 2.3B). Notably, overall levels of responding were significantly lower in group NaB compared to the average of NaB + 6 h and Veh groups

(F1,26 = 4.26, p < 0.05). This reduction was greatest for the active nose-poke (F1,26 = 4.78, p <

0.05), suggesting that the effects of NaB were limited to the conditioned aspect of responding.

There were no significant differences between Veh and NaB + 6 h groups (Fs < 1), demonstrating that treatment with NaB outside the window of memory consolidation had no significant effect on nicotine-primed reinstatement. 42

Cue Reinstatement A 25 Active Inactive 20

s 15

n o

e 10 R 5 0 NaB NaB + 6 h Veh

Nicotine-Primed Reinstatement B 25 * Active Inactive 20

s 15

s e 10

R 5

0 NaB NaB + 6 h Veh

Nicotine + Cue Reinstatement C 25 * Active Inactive 20

e s 15 n

e 10

R 5

0 NaB NaB + 6 h Veh

Figure 2.3. Experiment 1: Reinstatement of nicotine-seeking. Active and inactive responses for each treatment group during cue-reinstatement (A), nicotine-primed reinstatement (B) and nicotine + cue reinstatement (C). Bars represent group means + SEM. Asterisks indicate significant differences when p < 0.05. NaB = sodium butyrate; Veh = vehicle; NaB + 6 h = NaB administered six hours after extinction sessions. 43

Responding during the nicotine + cue reinstatement test was greatest on the active nose- poke (F1,25 = 60.37, p < 0.001; Fig. 2.3C). Again, treatment with NaB immediately after the session decreased overall levels of responding compared to the average of the remaining groups

(F1,25 = 5.42, p < 0.05). This reduction was greatest for the active nose-poke (F1,25 = 6.03, p <

0.05). Levels of active and inactive responding did not differ amongst NaB + 6 h and Veh groups (Fs < 1).

Therefore, when administered immediately, but not six hours, following extinction sessions NaB attenuates reinstatement of nicotine-seeking.

Experiment 2: HDAC inhibition has no effect on extinction or reinstatement when rats acquire nicotine self-administration under a variable-ratio schedule

Two rats were excluded from data analysis for failing to satisfy the acquisition criteria

(NaB = 1; Veh = 1). This resulted in final group sizes of n = 7 for all. One Veh rat was excluded from the analysis of nicotine and nicotine + cue reinstatement tests for responses greater than

2 SD above the mean.

Nicotine self-administration

Rats in Experiment 2 showed a significant preference for the nicotine-paired nose-poke across the last three days of training (main effect of nose-poke: F1,12 = 48.60, p < 0.001; Fig.

2.4). Importantly, there were no group differences in responding (ps > 0.05) or the amount of nicotine infusions received (NaB: 17.29 + 2.39; Veh: 14.43 + 2.55; Fs < 1). 44

60 NaB - Active NaB - Inactive Veh - Active

s Veh - Inactive

e 40

R 20

0 IVSA E1 E2 E3 E4 E5 E6 Session

Figure 2.4. Experiment 2: Acquisition and extinction of nicotine self-administration. Active and inactive responses during acquisition of intravenous nicotine self-administration (IVSA; average of the last 3 sessions) and the first six days of extinction (E1 – E6) for rats treated with sodium butyrate (NaB) or vehicle (Veh) immediately after the session. Data points represent group means + SEM.

Extinction

Removal of nicotine and its associated cues resulted in a significant decrease in responding on the active nose-poke (session x nose-poke interaction: F5,8 = 8.22, p < 0.01; Fig.

2.4). There was no effect of NaB on responding (active or inactive) during extinction or on the number of sessions required for rats to reach the extinction criteria (all rats required six days of training; Kaplan Meier survival analysis: 2 = 1, df = 1, p > 0.05).

Reinstatement

Across cue-reinstatement there was a clear preference for the nose-poke previously paired with nicotine (F1,12 = 17.40, p < 0.01; Fig. 2.5A), yet responding was greater in the NaB- treated group (F1,12 = 6.07, p < 0.05).

During nicotine-primed reinstatement there were higher levels of responding on the active nose-poke (F1,11 = 48.34, p < 0.001; Fig. 2.5B). However, there was no effect of NaB on active or inactive nose-pokes.

Similarly, rats demonstrated a significant preference for the active nose-poke during nicotine + cue reinstatement (F1,11 = 19.68, p < 0.01; Fig. 2.5C). There were no group differences in responding on either nose-poke, indicating that treatment with NaB had no effect on reinstatement.

Cue Reinstatement A

25 Active Inactive 20 s *

s 15

e 10 R 5

0 NaB Veh

Nicotine-Primed Reinstatement B 25 Active Inactive 20

s 15 n

e 10

R 5

0 NaB Veh

Nicotine + Cue Reinstatement C 25 Active Inactive 20

e s 15

e 10 R 5 0 NaB Veh

Figure 2.5. Experiment 2: Reinstatement of nicotine-seeking. Active and inactive responses for each treatment group during cue-reinstatement (A), nicotine-primed reinstatement (B) and nicotine + cue reinstatement (C). Bars represent group means + SEM. Asterisks indicate significant differences when p < 0.05. NaB = sodium butyrate; Veh = vehicle.

Experiment 3: HDAC inhibition facilitates cue-extinction of nicotine self-administration

Seven rats were excluded (NaB = 3; Veh = 4) for failing to satisfy the acquisition criteria or loss of catheter patency. This resulted in group sizes of NaB = 9 and Veh = 8.

Nicotine self-administration

Responding across the last three days of training was greater on the nicotine-paired nose-poke (main effect of nose-poke: F1,15 = 30.64, p < 0.001; Fig. 2.6A). There were no group differences in responding (ps > 0.05) or infusions received (NaB: 15.63 + 2.23; Veh: 15.50 +

1.53; Fs < 1), suggesting groups did not differ following acquisition of self-administration.

Extinction and reinstatement

Substitution of nicotine for saline resulted in a reduction in responding on the active nose-poke (session x nose-poke interaction: F5,11 =3.74, p < 0.05; Fig. 2.6A). A significant effect of NaB on cue-extinction was detected (session x treatment interaction: F5,11 =3.74, p <

0.05). Indeed, NaB reduced responding on the second day of extinction, the first session after treatment (F1,15 = 5.55, p < 0.05). Sodium butyrate also accelerated the rate of extinction, as

NaB-treated rats required significantly fewer sessions to reach the extinction criteria (NaB:

8.44 ± 1.02, Veh: 12.88 ± 1.88; Kaplan Meier survival analysis: 2 = 4.39, df = 1, p < 0.05;

Fig. 2.6B). Thirty-eight percent of rats in group Veh failed to reach criteria at all (maximum

18 extinction sessions). This suggests that NaB facilitates the extinction of nicotine-seeking that is otherwise maintained by nicotine-associated cues.

Following extinction, there were no group differences in responding during the nicotine-primed reinstatement test (Fs < 1; Fig. 2.7). 48

A 30 NaB - Active NaB - Inactive Veh - Active s Veh - Inactive e 20

s *

R 10

0 IVSA E1 E2 E3 E4 E5 E6 Session

B 100 NaB

n Veh

c 75

t x

n 50

25 * e

0 0 5 10 15 20 Session

Figure 2.6. Experiment 3: Acquisition and extinction of nicotine self-administration. (A) Active and inactive responses during acquisition of intravenous nicotine self-administration (IVSA; average of the last 3 sessions) and the first six days of extinction (E1 – E6) for rats treated with sodium butyrate (NaB) or vehicle (Veh) immediately after each extinction sessions. Data points represent group means + SEM. (B) Survival curve showing the percentage of rats in each group yet to meet the extinction criteria. Dotted vertical line indicates the minimum number of extinction sessions (6). Asterisks indicate significant differences when p < 0.05.

Nicotine + Cue Reinstatement

25 Active Inactive 20

e s 15 n

e 10 R 5

0 NaB Veh

Figure 2.7. Experiment 3: Reinstatement of nicotine-seeking. Active and inactive responses for each treatment group during the nicotine + cue reinstatement test. Bars represent group means + SEM. NaB = sodium butyrate; Veh = vehicle.

Experiment 4: NaB has no effect on the extinction and reinstatement of sucrose-seeking

Sucrose self-administration

All rats rapidly learned to respond for sucrose pellets, resulting in a preference for the active nose-poke (main effect of nose-poke: F1,22 = 193.60, p < 0.001; Fig. 2.8). Importantly, there were no group differences in responding (ps > 0.05) or rewards earned (all rats received the maximum number of pellets) across the last three days of training.

Extinction

Following removal of sucrose and its associated cues, a significant reduction in responding on the active nose-poke was observed (nose-poke x session interaction: F5,18 =

32.82, p < 0.001; Fig. 2.8). Despite initial high levels of responding, there was no effect of NaB on active or inactive nose-pokes (ps > 0.05), or on the number of sessions required for rats to reach the extinction criteria (all rats required six days of training; Kaplan Meier survival analysis: 2 = 1, df = 1, p > 0.05).

Reinstatement

Fig. 2.9A shows that rats responded preferentially on the active nose-poke during cue- reinstatement (F1,22 = 73.94, p < 0.001). There were no significant group differences in active or inactive responding (ps > 0.05).

Responding during sucrose-primed reinstatement was greatest on the nose-poke previously paired with sucrose delivery (F1,22 = 61.87, p < 0.001; Fig. 2.9B), however, responding did not differ between group NaB and group Veh (ps > 0.05). 51

200 NaB - Active n NaB - Inactive

s Veh - Active

s 150

e Veh - Inactive

s 100 e

s 50

R 0 SA E1 E2 E3 E4 E5 E6

Session

Figure 2.8. Experiment 4: Acquisition and extinction of sucrose self-administration. Active and inactive responses during acquisition of sucrose self-administration (SA; average of the last 3 sessions) and the first six days of extinction (E1 – E6) for rats treated with sodium butyrate (NaB) or vehicle (Veh) immediately after each session. Data points represent group means + SEM.

Cue Reinstatement A 50 Active Inactive 40

e s 30

e 20 R 10 0 NaB Veh

Sucrose-Primed Reinstatement B 50 Active Inactive 40

e s 30

e 20

R 10

0 NaB Veh

Sucrose + Cue Reinstatment C 50 Active Inactive 40

e s 30

e 20 R 10 0 NaB Veh

Figure 2.9. Experiment 4: Reinstatement of sucrose-seeking. Active and inactive responses for each treatment group during cue-reinstatement (A), sucrose-primed reinstatement (B) and sucrose + cue reinstatement (C). Bars represent group means + SEM. NaB = sodium butyrate; Veh = vehicle.

On the combined sucrose + cue reinstatement test, rats clearly preferred the active nose- poke (F1,22 = 87.44, p < 0.001; Fig. 2.9C). There were no significant main effects or interactions involving treatment.

Discussion

The present series of experiments provide two novel contributions to our understanding of the role of histone acetylation in addictive behavior. Firstly, treatment with an HDAC inhibitor during extinction consolidation facilitates the extinction of nicotine-seeking. This enhancement is persistent, providing resistance to reinstatement in response to subsequent re- exposure to nicotine. Secondly, these results extend the findings of prior CPP studies to an instrumental paradigm that more closely approximates drug-seeking behavior in humans.

In Experiment 1, administration of NaB immediately following extinction sessions attenuated the reinstatement of nicotine-seeking. This was evidenced by a marked decrease in active responding in NaB-treated rats during the nicotine alone and nicotine + cue reinstatement tests. Sodium butyrate did not impact inactive nose-poking, nor locomotor activity (see

Appendix), indicating that the reduction in active nose-pokes was specific to the conditioned aspect of responding and not due to a general response decrement or deficit in motivation.

These findings confirm previous reports using CPP, where HDAC inhibition during extinction reduces reinstatement of preference for a context previously paired with cocaine or morphine (Itzhak et al., 2013; Malvaez et al., 2010; Raybuck et al., 2013; Wang et al., 2014).

Extending these results to an operant self-administration paradigm is an important advance, as models which allow rats to freely regulate their own drug-intake exhibit a higher degree of face validity (O'Brien & Gardner, 2005). Further, it is now clear that NaB modulates both the reflexive, automatic responses that dominate in Pavlovian conditioning (i.e. CPP) and the 54 deliberate, motivated actions that accompany active drug-seeking behavior (Sanchis-Segura &

Spanagel, 2006).

Consistent with the existing literature (Lattal et al., 2007; Malvaez et al., 2010; Stafford et al., 2012), the observed behavioral effects are due specifically to the effect of NaB on extinction learning, rather than a non-specific effect of treatment. Administration of NaB six hours after each session had no impact on subsequent reinstatement, demonstrating that NaB must be delivered during the acute phase of transcription necessary for long-term memory formation (Alberini, 2009). This suggests that by potentiating promoter acetylation, HDAC inhibition increased the expression of genes involved in the consolidation of extinction learning into long-term memory.

The observation that rats treated six hours after the session reinstate equivalently to control animals also confirms that mere exposure to NaB did not interfere with the reinforcing properties of nicotine at test the following day. This is an important point, as NaB attenuates cocaine-primed reinstatement when administered 30 minutes prior to the session (Romieu et al., 2011). Why this is the case is not clear, but may be a consequence of NaB interfering with the acute rewarding effects of the drug (Romieu et al., 2011; Romieu et al., 2008; Simon-

O'Brien et al., 2014), as distinct from influencing the expression of drug-associated memories.

Sodium butyrate produced a robust decrease in responding following nicotine-primed reinstatement, yet results were less clear on the cue only test. The absence of an effect on cue- reinstatement was unexpected here, but may be attributable to the low levels of responding across the test session. Indeed, responding during cue-reinstatement was no greater than the prior extinction day. Previously nicotine-associated cues can produce reliable reinstatement of responding (e.g. Gipson et al., 2013), but this appears to be sensitive to variations in self- administration conditions, such as training dose, response operandum (lever vs. nose-poke) and 55 the use of food training prior to acquisition (Clemens, Caillé, & Cador, 2010; Liu et al., 2006).

Parameters which promote responding to nicotine-paired cues may allow for future experiments to examine the effect of NaB on cue-induced reinstatement. This may be imperative given the well-described role of cues in prompting relapse in abstinent smokers

(Caggiula et al., 2001).

Extinction of nicotine-seeking in Experiment 1 was very rapid, reaching floor after just three days of training. Such low levels of responding did not permit detection of the HDAC inhibitor-potentiated extinction learning reported elsewhere (Malvaez et al., 2010). To address this possibility, and confirm that the reduction in reinstatement is due specifically to the effect of NaB on consolidation of extinction, Experiments 2 and 3 introduced two manipulations designed to elevate responding across this phase. In the first instance, rats were trained on a

VR schedule, as partially reinforced behaviors take longer to extinguish than those that are continuously reinforced (Valles et al., 2006). Under these conditions, levels of responding across the first three days of extinction were clearly elevated compared to those in Experiment

1. However, there was no discernible effect of NaB on extinction of nicotine-seeking. In contrast to results from Experiment 1, NaB also did not attenuate responding during reinstatement. In fact, NaB-treated rats showed greater levels of responding during cue- reinstatement, although this appears to represent a failure of Veh rats to reinstate, rather than an elevation amongst treated animals. This is not surprising given that the parameters used in these experiments do not achieve reliable levels of cue-reinstatement.

The source of the difference between Experiments 1 and 2 is not immediately clear.

Importantly, however, it cannot be attributed to baseline differences in the amount of nicotine received, which was comparable across all studies. One possibility is that varying the acquisition schedule altered the underlying brain structures supporting the task (Everitt &

Robbins, 2005) or the acetylation state produced by the learning itself (Bredy et al., 2007; 56

Levenson et al., 2004), causing a shift in the dose-response curve of the drug (Stafford et al.,

2012). Indeed, the dose of NaB used here is quite low compared to prior CPP studies (e.g.

Malvaez et al., 2013; Raybuck et al., 2013). This demonstrates that NaB has therapeutic potential at much lower concentrations than previously thought, which may be useful in reducing any off-target effects of treatment on behavior. Future investigation of the dose- response curve of NaB in response to variations in acquisition conditions (i.e. FR-1 vs. VR-2) may be necessary to explain why NaB is less effective following training under a VR schedule.

In contrast, when a cue-extinction procedure was adopted to elevate responding, an effect of NaB on nicotine-seeking across extinction was clearly evident. Consistent with findings from CPP studies (Malvaez et al., 2013; Raybuck et al., 2013), NaB significantly reduced nose-poking on the second day of extinction, the first session after treatment.

Furthermore, it markedly reduced the number of sessions required for rats to reach the extinction criteria. Though no effect was detected on nicotine-primed reinstatement, these data are difficult to interpret given that several vehicle-treated rats did not extinguish responding prior to test. In summary, results from this experiment demonstrate that NaB facilitates the extinction of nicotine-seeking that is otherwise maintained by the reinforcing properties of previously nicotine-paired cues.

Importantly, the effect of HDAC inhibition appears to be specific to nicotine-associated memories. In rats trained to nose-poke for sucrose pellets, treatment with NaB across extinction had no effect on extinction or reinstatement. This was despite the use of near identical training parameters to those in Experiment 1 and the initial high levels of responding across extinction.

This finding is consistent with previous research demonstrating that HDAC inhibitors decrease cocaine and ethanol, but not sucrose, self-administration in rats (Romieu et al., 2008; Simon-

O'Brien et al., 2014; Sun et al., 2008). It may be the case that the enduring changes in histone 57 acetylation produced by the initial nicotine (Levine et al., 2011), but not sucrose, exposure results in a behavior that is more amenable to manipulation by HDAC inhibitors.

There is some evidence for the notion that drug-associated memories are supported by unique neurobiological processes. For example, Young et al. (2013) found that inhibition of myosin II completely abolishes the CPP for methamphetamine, yet has no effect on behavior when sweetened food is used as the reward. This finding may have important implications for addiction treatment, as it suggests that certain compounds may selectively disrupt memories associated with drug use without impairing appetitive memories more generally.

These studies clearly illustrate that treatment with NaB facilitates extinction of nicotine- seeking in a persistent manner that provides resistance to reinstatement. However, the molecular mechanisms underlying these behavioral data require further investigation. Though

NaB is more selective than once thought, predominantly inhibiting class I (HDAC1, 2, 3 and

8) but not class IIa/b HDACs (Kilgore et al., 2010), it currently remains unclear which specific enzymes it targets to produce the behavioral effects observed here. Accordingly, future studies may consider the use of an isoform-selective inhibitor. For example, a recent study conducted by Malvaez et al. (2013) found that RGFP966, a compound with greatest selectivity for

HDAC3 (Rai et al., 2010), mimics the effects of NaB on the extinction of cocaine-induced

CPP. In addition, it will be necessary for future studies to confirm that NaB administered at

100 mg/kg increases histone acetylation in relevant brain regions. This can be achieved through a combination of ChIP and qPCR, which is the focus of Chapter III of the thesis.

In summary, this study shows for the first time that treatment with the HDAC inhibitor,

NaB, facilitates the extinction of nicotine-seeking. This enhancement is persistent, conferring resistance to reinstatement in response to subsequent nicotine exposure. It is also the first study demonstrating that increasing histone acetylation during memory consolidation facilitates the 58 extinction of an intravenously self-administered drug, a finding not observed when rats respond for a natural reward. This may have important implications for the development of pharmacotherapies to aid the cessation of cigarette smoking.

Chapter III: Molecular mechanisms underlying NaB-potentiated extinction of nicotine-

seeking

In Chapter II, treatment with NaB facilitated the extinction of nicotine-seeking in a persistent manner that provided resistance to reinstatement. This suggests that by potentiating promoter acetylation, HDAC inhibition increased the expression of genes involved in the consolidation of extinction learning into long-term memory. Furthermore, the observation that NaB had no effect on the extinction and reinstatement of a natural reward indicates that key NaB-induced molecular changes occurred only amongst rats with a history of nicotine exposure. Therefore, it appears that long-lasting alterations in chromatin structure following nicotine self- administration may interact with the potential of NaB to facilitate extinction.

This chapter aimed to investigate this hypothesis. To achieve this aim, I adopted the same behavioral procedure used in the first experiment of Chapter II. Rats underwent nicotine or saline (procedural control) self-administration followed by a period of extinction training, where they received post-session injections of either NaB or Veh (2 x 2 design). Due to the well-defined role of the vmPFC and the NAc in the extinction of drug-seeking (LaLumiere et al., 2010; Peters et al., 2008), these regions were dissected after the sixth (and final) day of extinction training. This time point (prior to reinstatement) allowed for investigation of the enduring effects of nicotine self-administration, the consequences of NaB treatment, and their interaction, without interference from any acute effects of nicotine.

Genes of interest were based on prior studies in the published literature. Initially these included transcription factors, glutamate receptors, protein kinases and neurotrophins involved in synaptic plasticity related to addiction and long-term memory (Kumar et al., 2005; Levine et al., 2011; Rogge et al., 2013; Vecsey et al., 2007; Wang et al., 2010a). As Cdk5 and BDNF 60 genes showed evidence of transcriptional regulation by nicotine exposure and/or NaB treatment, ChIP assays were performed on these specific targets to determine whether changes in mRNA expression were correlated with levels of H3K14ac. This mark was selected due to its association with memory consolidation (Levenson et al., 2004), NaB treatment (Raybuck et al., 2013; Stafford et al., 2012) and chronic psychostimulant administration (Malvaez et al.,

2011; Wang et al., 2010a). I further explored the relationship between nicotine exposure and chromatin modifications through analysis of H3K4 and H3K27 trimethylation (H3K4me3,

H3K27me3) as well as H3K9 dimethylation (H3K9me2), due to the emerging role of these marks in cocaine-induced transcriptional changes (Damez-Werno et al., 2012; Feng et al.,

2014).

There is now compelling evidence to suggest that chromatin modifications regulate gene expression though interactions with long non-coding RNAs (lncRNAs; Modarresi et al.,

2012; Roberts, Morris, & Wood, 2014; Vadaie & Morris, 2013). For this reason, I investigated whether nicotine-induced epigenetic changes within the BDNF promoter region were correlated with the expression of a novel BDNF antisense (BDNFas) transcript.

Method

Subjects

Twenty eight male Sprague Dawley rats (175 g - 200 g; Animal Resource Centre, WA,

Australia) were housed in groups of four on a 12 hour reverse light/dark cycle (lights off from

7 a.m. to 7 p.m.). All procedures took place during the dark cycle. Rats were given ad libitum access to food and water until two days prior to the commencement of nicotine self- administration when food was restricted to 20 g/rat/day (Donny et al., 1998). All procedures described were approved by The Animal Care and Ethics Committee of the University of New 61

South Wales (12/155B) and were conducted in accordance with the Australian Code for the

Care and Use of Animals for Scientific Purposes (8th ed.).

Drugs

Nicotine hydrogen tartrate and NaB (Sigma) were dissolved in sterile saline (0.9%

NaCl). Reported doses of nicotine refer to the free-base form.

Behavioral procedures

A schematic of the experimental design for Chapter III can be seen in Fig. 3.1.

Intravenous self-administration

All rats underwent surgery for the implantation of a chronic intravenous catheter into the right jugular vein (as described in Chapter II). Between one and two weeks following surgery, behavioral training began with two daily one hour habituation sessions with nose- pokes covered and house-light on. Sixteen rats were then trained to self-administer nicotine for

12 days on an FR-1 schedule of reinforcement. The remaining control rats infused saline under identical conditions (n = 12).

Self-administration sessions lasted for one hour and began with the illumination of the house-light. Each response on the active nose-poke resulted in a single infusion of nicotine (30

µg/kg/100 µL; 3 s) or saline (100 µL over 3 s), presentation of the cue-light inside the nose- poke (3 s) and termination of the house-light (20 s). Responses during the 20 s time-out period or on the inactive nose-poke were recorded but were of no scheduled consequence. Rats that

Self-administration Extinction Nic or Sal NaB or Veh

(12 days) (6 days)

Tissue dissection

vmPFC NAc

Homogenize tissue Homogenize tissue

RNA expression RNA expression Chromatin modifications Extract RNA Formaldehyde Extract RNA cross-link cDNA cDNA Strand-specific reverse Sonication transcriptions Quantitative PCR

Chromatin Quantitative PCR immunoprecipitation (H3K14ac, H3K4me3, H3K27me3, H3K9me2)

DNA purification

Quantitative PCR

Figure 3.1. Schematic representation of the experimental procedure of Chapter III. Following 12 days of nicotine (Nic) or saline (Sal) self-administration rats underwent extinction training, where active responses were recorded but were of no scheduled consequence. Immediately after each session rats were treated with either the HDAC inhibitor, sodium butyrate (NaB; 100 mg/kg), or vehicle (Veh). Following the sixth and final extinction session rats were sacrificed before the ventromedial prefrontal cortex (vmPFC) and nucleus accumbens (NAc) were dissected on ice. Tissue was then homogenized and separate aliquots taken for the analysis of RNA expression and chromatin modifications using a combination of chromatin immunoprecipitation (ChIP) and quantitative polymerase chain reaction (qPCR). RNA = ribonucleic acid; cDNA = complimentary deoxyribonucleic acid; H3K14ac = histone H3 lysine 14 acetylation; H3K4me3 = histone H3 lysine 4 trimethylation; H3K27me3 = histone H3 lysine 27 trimethylation; H3K9me2 = histone H3 lysine 9 dimethylation. 63 infused nicotine were determined to have successfully acquired self-administration if they averaged a minimum of six infusions per session across the last three days and demonstrated a preference for the active nose-poke (2 active: 1 inactive).

Extinction

Following self-administration training all rats underwent six daily extinction sessions, where responses on the active nose-poke were recorded but were of no scheduled consequence.

Based on performance across the last three days of acquisition (active and inactive nose-pokes), rats were allocated to receive an i.p. injection of either NaB (100 mg/kg; 1 ml/kg) or Veh

(saline; 1 ml/kg) administered immediately after the session. This resulted in four groups:

Nic/NaB, Nic/Veh, Sal/NaB and Sal/Veh.

Thirty minutes after the final extinction session rats were anaesthetized with pentobarbitone sodium (325 mg/ml/rat) before brains were rapidly removed and the vmPFC

(bregma: 5.16 mm – 2.76 mm) and NAc (bregma: 2.76 mm – 1.32 mm) dissected onto dry ice using a scalpel blade (Fig. 3.2). Samples were stored at -80° C until assays were performed.

Molecular assays

Brain tissue from the vmPFC and NAc was homogenized in 1 ml ice cold phosphate buffered saline (PBS) using a glass dounce tissue grinder. Separate aliquots were then taken for the analysis of RNA expression and chromatin modifications.

PL P

L IL IVO V

L O

CPu

NAcc Bregma + 3.72 mm

NAcSh

Bregma + 2.16 mm

Figure 3.2. Brain dissections. Schematic representation of the dissections of the ventromedial prefrontal cortex (left) and nucleus accumbens (right). PL = prelimbic cortex; IL = infralimbic cortex; NAcc = nucleus accumbens core; NAcSh = nucleus accumbens shell; VO = ventral orbitofrontal cortex; CPu = caudate putamen (striatum). Adapted from Paxinos and Watson (2005).

65 mRNA expression

Transcriptional changes were first analyzed in order to identify candidate genes for

ChIP-qPCR.

RNA extraction and reverse transcriptions

The Trizol extraction method (Invitrogen, CA, USA) was used to isolate RNA from the vmPFC and NAc. First, 250 µl of homogenized tissue was added to 750 µl of Trizol reagent.

Samples were incubated on ice for 7 mins to allow complete dissociation of the nucleoprotein complex. The addition of 200 µl of chloroform followed by a 5 min incubation period (at room temperature) and 15 min centrifugation (12 000 x g at 4° C) separated RNA, DNA and protein into three distinct phases. The upper aqueous phase (containing RNA) was then removed and placed into a clean microcentrifuge tube. The remaining sample was discarded.

Total RNA was recovered by adding 250 µl of isopropanol and 30 µg of the co- precipitant, GlycoBlue (Thermo Fisher, MA, USA), and centrifuging at 12 000 x g for 20 mins

(4° C). The resultant RNA pellet was washed twice with 500 µl of 75% ethanol (each followed by a 20 min centrifuge; 12 000 x g at 4° C), air dried and resuspended in nuclease-free water

(Invitrogen). Spectrophotometric measurements were taken using a Nanodrop 1000 (Thermo

Fisher) to assay RNA concentration and purity, while agarose gels were used to evaluate RNA integrity.

Six hundred and fifty nanograms of RNA were DNase-treated and reverse transcribed in a C1000 Touch Thermal Cycler (Bio-Rad Laboratories, CA, USA) using the QuantiTect

Reverse Transcription Kit (Qiagen, CA, USA) according to the manufacturer’s instructions.

Quantitative polymerase chain reaction (qPCR)

Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select

Master Mix (Applied Biosystems, VIC, Australia). All qPCR primers (Integrated DNA

Technologies, IA, USA) were designed using Primer3 software (Untergasser et al., 2012) and verified using the basic local alignment tool (BLAT; Kent, 2002). Annealing temperatures for each primer were optimized using temperature-graded PCR, before specificity for target sequences confirmed with 1.5% agarose gels. Primer efficiencies were also determined using a standard curve. For each target (run in triplicate for each sample), mRNA levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. There were no group differences in expression of the house-keeper gene at any time. A list of primers used can be found in Table 3.1.

Chromatin immunoprecipitation (ChIP)

As the vmPFC, but not the NAc, showed evidence of transcriptional regulation, this region was selected as the target for ChIP. These assays determined whether changes in Cdk5 and BDNF mRNA expression were correlated with levels of specific histone modifications (i.e. acetylation and methylation) within the promoter region of that gene.

To cross-link DNA-protein complexes, formaldehyde was added to 750 µl of homogenized vmPFC tissue to a final concentration of 1%. Samples were incubated for 5 mins at room temperature before formaldehyde was quenched with 0.125 M glycine. Tissue was then washed twice with ice-cold PBS containing protease inhibitor cocktail tablets (PIs; Roche,

NSW, Australia) and resuspended in sodium dodecyl sulfate (SDS) lysis buffer (1% SDS,

10mM ethylenediaminetetraacetic acid [EDTA], 50 mM Tris hydrochloride [Tris-Hcl], pH 8.0) with PIs. After incubation on ice for 5 mins, brain lysates were sheared using an ultrasonicator 67

Table 3.1. Primer sequences for mRNA expression

Target qPCR primers Amplicon

F: GGAAGTTGCTATACCTGTCGG NPAS4 R: GTCGTAAATACTGTCACCCTGG 89 bp F: TCTTGCTTCTCTGGCTTTGT Homer2 R: CTGCGTAAACGGCTAAGGTA 88 bp F: GTGAGAGATTTGCCAGGGTC FosB R: AGAGAGAAGCCGTCAGGTTG 130 bp F: TTCCACTATCAATAATTTAACTTCTTTGC BDNF Exon IV R: CTCTTACTATATATTTCCCCTTCTCTTCAGT 114 bp F: TGGCTGACACTTTTGAGCAC BDNF Exon IX R: CAAAGGCACTTGACTGCTGA 131 bp F: CTGTTGCAGAACCTGTTGAAG Cdk5 R: CCAGGGTCAGAGAGTCTAC 111 bp F: TCCTTCCGCTCCAAGAAACC mGlu5 R: TGGGCATCGGAAGGTACAAC 185 bp F: CCCAGTCTGTGGCTTTTGTCA ARC R: GCCAGTGGGTGAGAAGGTGT 96 bp F: AGGATGAAGACACCAAAGTGC CamKIIa R: GGTTCAAAGGCTGTCATTCC 130 bp F: ACCTCATTTGAGCCTGAAGC CamKIIb R: CAGGATAGTGGTGTGGATCG 114 bp F: GGGACAGCCTTTCCTACTACCATT c-fos R: TTGGCACTAGAGACGGACAGATC 106 bp F: AGGCGCTGGTGGAGACAAGT EGR-1 R: GAAGCGGCCAGTATAGGTGATG 71 bp F: TGCGCCTAGAAACCAGACCTT EGR-2 R: AAGATGCCCGCACTCACAAT 114 bp F: AACAGCAACTCCCATTCTTC GAPDH R: TGGTCCAGGGTTTCTTACTC 164 bp F: GCTTGTGGTGATCGTGCTGAA GRIN2A R: AATGCTGAGGTGGTTGTCATCTG 145 bp F: TGGCTATCCTGCAGCTGTTTG GRIN2B R: TGGCTGCTCATCACCTCATTC 103 bp F: CATCAAACCCCCAAAATGCT GRIN3A R: GAAAGGCAAAACATACAGAAAATGG 75 bp F: CACCCACCTCTCCGAACTGT Nr4a1 R: GGCCTTGGTGGAGGTTACGG 65 bp F: AGTCTGATCAGTGCCCTCGT Nr4a2 R: ATAGTCAGGGTTTGCCTGGAA 93 bp

(Covaris S220, MA, USA; 5% duty, 4 intensity, 200 cycles/burst, 25 cycles of 60 s). Parameters for formaldehyde cross-linking and chromatin shearing required extensive optimization in order to achieve DNA fragments of 200 – 1000 bp (confirmed on agarose gel). Sonicated lysate was then centrifuged (12 000 x g for 20 mins at 4° C) to remove debris and 100 µl aliquots of supernatant were placed into separate, cold microcentrifuge tubes. Samples were stored at

-80° C until the commencement of ChIP.

Histone acetylation

Four micrograms of the antibody specific to H3K14ac (catalogue # 07-353, Millipore,

VIC, Australia) was precleared for 2 hrs at 4° C with 50 µl of Dynabeads Protein G (Thermo

Fisher) and 250 µl of ChIP dilution buffer (CDB; 0.01% SDS, 1.1% Triton X-100, 1.2 mM

EDTA, 16.7 mM Tris-HCl, pH 8.0, and 167 mM NaCl). Beads containing bound antibody were then washed and incubated overnight (4° C on a rotating platform) in 100 µl of sample lysate diluted 1:2 with CDB containing PIs. To ensure the specificity of antibody binding, a parallel immunoprecipitation was performed with a normal rabbit immunoglobulin G (IgG; catalogue

# 2719; Cell Signaling Technology, MA, USA), which precipitated negligible levels of DNA for the genes analyzed. A further 10 µl of sample, diluted to a final volume of 300 µl with

CDB, was used as Input (i.e. non-immunoprecipitated) as a measure of starting DNA.

Following incubation, chromatin-antibody-bead complexes were washed three times each with 250 µl of low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-

HCl, pH 8.0, 150 mM NaCl) and 300 µl of high-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.0, 500 mM NaCl). Formaldehyde cross-links were then reversed, in immunoprecipitated and Input samples, by heating to 95° C (for 4 hrs on a rotation stand), before proteins were digested with proteinase K (40 µg; 45 mins, 50° C; Invitrogen). 69

DNA was recovered with a phenol/chloroform extraction and ethanol precipitation.

Here, 600 µl of phenol:chloroform:isoamyl alcohol (25:24:1; Sigma) was added to the samples, which were then centrifuged for 15 min at 12 000 x g (4° C). The resultant supernatant

(containing DNA) was transferred to a new tube and incubated overnight (-80° C) in 100% ethanol (2x the volume of the supernatant), 25 µg of glycogen and 20 µl of 5M NaCl. The following day, samples were centrifuged (12 000 x g; 15 mins at 4° C), before DNA pellets were washed with 75% ethanol, air dried and eluted with 50 µl of nuclease-free water.

Histone methylation

This protocol was modified slightly for antibodies targeting histone methylation

(H3K4me3, catalogue # Ab8898; H3K27me3, catalogue # Ab6002; H3K9me2, catalogue #

Ab1220; Abcam, MA, USA). Separate aliquots of Dynabeads Protein G were precleared with the sample lysate (100 µl in 200 µl CDB; one hour at room temperature) and the desired antibody (3 µg in 1 ml CDB; 1.5 hours at room temperature). Beads containing bound antibody were then washed and incubated overnight in the precleared lysate (4° C on a rotating platform). A mock immunoprecipitation (bead alone) was included as a negative control, while

10 µl of sample (diluted 1:10 in CDB) was used as Input. Following incubation, immunoprecipitated and mock samples were washed twice with low-salt buffer and four times with high-salt buffer (5 mins at 4° C on rotating platform), before DNA:protein complexes were eluted off the beads with 100 μl ChIP elution buffer (1% SDS, 100 mM NaHCO3, pH 8).

After heating to 65° C for 10 min, beads were removed from the sample. Formaldehyde cross- links (in both immunoprecipitated and Input samples) were then reversed and samples RNase

A (20 µg; 65 °C, overnight; Invitrogen) and proteinase K (24 µg; 45 °C, 1 hr; Sigma) treated.

DNA was recovered using a PCR purification kit (Qiagen) and eluted in 50 µl of nuclease-free water. 70 qPCR

Levels of H3K14ac, H3K4me3, H3K27me3 and H3K9me2 at gene promoters of interest were measured using qPCR (95° C for 30 s, followed by 40 cycles of 95° C for 3 s and

60° C for 30 s). For each target (run in triplicate for each sample), relative enrichment was calculated as a percentage of corresponding Input. A table of primers used for ChIP can be found in Table 3.2.

BDNF antisense (BDNFas)

Both humans and mice encode a natural antisense transcript to the BDNF gene

(BDNFas). It has been hypothesized that this lncRNA suppresses the expression of BDNF mRNA by recruiting repressive chromatin marks to the BDNF promotor (Modarresi et al.,

2012). In light of this finding, I investigated whether nicotine-induced chromatin modifications within the BDNF promoter region were correlated with the expression of a BDNFas transcript.

Strand-specific quantitative reverse transcription PCR (qRT-PCR)

As BDNFas has not yet been described in rats, a pilot study was first conducted to confirm the existence of the transcript. Reverse transcriptions were performed using a series of strand-specific primers (Table 3.3) chosen to give wide coverage of the BDNF locus. Here,

RNA extracted from rat cortical tissue (1 µg/reaction) was DNase treated (DNase I; Sigma) and then reverse transcribed using antisense-directed primers with the SuperScript III First-

Strand Synthesis System (Invitrogen), according to the manufacturer’s instructions.

Table 3.2. Primer sequences for ChIP-qPCR

Target qPCR primers Amplicon

BDNF F: GCAGTTGGACAGTCATTGGTAACC Exon I R: ACGCAAACGCCCTCATTCTG 93bp BDNF F: AACAAGAGGCTGTGACACTATGCTC Exon IV R: CAGTAAGTAAAGGCTAGGGCAGGC 103bp F: CAGGCAATCTTGGGAAACAT Cdk5 R: GGCCCTCGGTTCTAAGACTC 139bp 72

Table 3.3. Primer sequences for BDNFas

Reverse transcription primers qPCR primers and amplicon sizes

GAAAGCTGCTTCAGGAAACG BDNF F (overlapping with Exon I): AACGCCCTCATTCTGAGA GAAAGCTGCTTCAGGAAACG 124 bp TTCCACTATCAATAATTTAACTTCTTTGC BDNF F (overlapping with Exon IV): CTCTTACTATATATTTCCCCTTCTCTTCAGT TTCCACTATCAATAATTTAACTTCTTTGC 114 bp TGGCTGACACTTTTGAGCAC BDNF F (intronic region): CAAAGGCACTTGACTGCTGA ATGCGGTGTTTAGGCAAAAG 131bp AACAGCAACTCCCATTCTTC GAPDH R: TGGTCCAGGGTTTCTTACTC TGGTCCAGGGTTTCTTACTC 164bp

Note: The reverse transcription primer overlapping with the Exon IV region showed the most robust amplification. Accordingly, this primer was selected for examination of nicotine- induced changes in BDNFas expression. 73

PCR was then performed (50°C for 2 min, 95° C for 10 min, followed by 40 cycles of

95° C for 3 s and 60° C for 30 s) using primer pairs designed to amplify the target sequences.

To validate the PCR, several control procedures were performed. Firstly, a no-reverse transcriptase control (NRC) was included to ensure there was no genomic DNA contamination.

Secondly, PCR plates contained a no-template control (NTC) to confirm that amplification was not due to non-specific primer binding. After completion of the qPCR, final products of

BDNFas, as well as corresponding controls, were visualized on a 1.5% agarose gel.

The reverse transcription primer overlapping with BDNF Exon IV showed robust amplification, providing preliminary evidence of a rat BDNFas. This was further supported by

Sanger sequencing of the PCR product (Ramaciotti Centre for Genomics, NSW, Australia), which confirmed alignment to the BDNF locus (BLAT; Kent, 2002). Therefore, this primer was selected for subsequent strand-specific rtPCR to examine nicotine-induced changes in

BDNFas expression in the vmPFC. Procedures were identical to those described above, except that a single-strand GAPDH primer was included in the reverse transcriptions, allowing for the inclusion of a house-keeper gene in the qPCR.

Statistical analysis

Active and inactive nose-pokes across the last three days of self-administration were analyzed using a mixed model ANOVA with the between-subjects factors of infusion drug

(Nic vs. Sal) and treatment (NaB vs. Veh) and the within-subjects factor of nose-poke (active vs. inactive). Responses during extinction were analyzed in the same manner with the additional within-subjects factor of session (days 1 – 6).

Normalized mRNA (2(Target Ct – GAPDH Ct)) and ChIP (2(Input Ct – Target Ct) x 100) data were subjected to a two-way ANOVA with the between-subjects factors of infusion drug and 74 treatment. As it was predicted that levels of BDNFas would mirror nicotine-induced chromatin modifications at the BDNF promoter, expression (2(Target Ct – GAPDH Ct)) of this transcript was analyzed with a one-way ANOVA with the single between-subjects factor of infusion drug.

For molecular analyses, data are presented in figures and tables as a fraction of control

(Sal/Veh). Data points greater than 2 SD from the group mean and the overall sample mean were excluded from analysis of that target gene (indicated in figure legends where appropriate).

Alpha was fixed at 0.05 for all analyses.

Results

Behavior

Four rats were excluded from data analysis for failing to acquire nicotine self- administration (Nic/NaB = 2; Nic/Veh = 2). This resulted in final group sizes of n = 6.

Intravenous self-administration

Across the last three days of training, rats that infused nicotine made significantly more active nose-pokes than rats that infused saline (main effect of drug: F1,20 = 60.11, p < 0.001; drug x nose-poke interaction: F5,15 = 23.58, p < 0.001; Fig. 3.3). Inspection of Fig. 3.3 suggests that levels of inactive responding were higher in group ‘Nic/Veh’ compared to remaining groups. However, this did not reach statistical significance (ps > 0.05), suggesting discrimination was equivalent across the conditions. Importantly, there were no main effects or interactions involving treatment (ps < 0.05), suggesting that any subsequent effects of NaB could not be attributed to baseline differences in self-administration.

30 Sal - Veh Active Sal - Veh Inactive

s Sal - NaB Active

e 20

s Sal - NaB Inactive n

o Nic - Veh Active p s Nic - Veh Inactive e 10 R Nic - NaB Active Nic - NaB Inactive

0 IVSA E1 E2 E3 E4 E5 E6 Session

Figure 3.3. Acquisition and extinction of self-administration. Active and inactive responses during acquisition (average of the last 3 sessions) and extinction (E1 – E6) of intravenous nicotine (Nic) and saline (Sal) self-administration (IVSA) for rats treated with sodium butyrate (NaB) or vehicle (Veh). Data points represent group means + SEM.

Extinction

As seen in Fig. 3.3, responding on the active nose-poke decreased across extinction training (session x nose-poke interaction: F5,15 = 7.67, p < 0.01). Overall levels of responding were greater among rats that previously self-administered nicotine than those that infused saline (main effect of drug: F1,20 = 22.05, p < 0.001). There were no main effects or interactions involving treatment, indicating that NaB had no effect on responding during extinction on either the active or inactive nose-poke. This is consistent with findings of the first experiment of Chapter II, where NaB had no detectable effect on extinction itself, yet attenuated reinstatement of nicotine-seeking.

Molecular assays mRNA expression

Ventromedial prefrontal cortex

Following the sixth day of extinction training three genes in the vmPFC showed evidence of transcriptional regulation by NaB.

Firstly, expression of the protein kinase, Cdk5, was significantly increased in rats treated with NaB across extinction (main effect of treatment: F1,20 = 4.41, p < 0.05; Fig. 3.4A).

This upregulation of Cdk5 mRNA was not dependent on a prior history of nicotine exposure, as expression was similar in rats that self-administered nicotine and saline during acquisition

(drug x treatment interaction: F < 1).

The expression of BDNF was also significantly influenced by NaB treatment, although this effect varied across individual splice variants. As for Cdk5, NaB treatment increased 77

A B Cdk5 mRNA BDNF Exon I mRNA

)

H H 1.5 2.0

* D *

F 5 1.5

1.0 D

(

o r 1.0

C 0.5

0.5

F 0.0 0.0 Veh NaB Veh NaB Treatment F Veh NaB Veh NaB Treatment Sal Nic Drug Sal Nic Drug

C D BDNF Exon IV mRNA BDNF Exon IX mRNA

) )

H 2.0 H 1.5 *

D * D

P P

F 1.5 F

N N

D D 1.0

(

l l

o 1.0 o

o o

C C 0.5

0.5

n n

r 0.0 r 0.0

F F Veh NaB Veh NaB Treatment Veh NaB Veh NaB Treatment

Sal Nic Drug Sal Nic Drug

Figure 3.4. Cdk5 and BDNF mRNA in the ventromedial prefrontal cortex. The effects of nicotine (Nic) and sodium butyrate (NaB) on the expression of (A) Cdk5, (B) BDNF Exon I, (C) BDNF Exon IV and (D) BDNF Exon IX mRNA in the ventromedial prefrontal cortex (vmPFC). Data are presented as group means + SEM of normalized mRNA expression relative to control (Saline/Vehicle [Sal/Veh]). Note: * indicates a significant main effect of treatment (NaB vs. Veh), p < 0.05.

BDNF Exon I mRNA (main effect of treatment: F1,20 = 6.31, p < 0.05; Fig. 3.4B) irrespective of history with nicotine (drug x treatment interaction: F < 1).

In contrast, BDNF Exon IV and IX mRNA showed evidence of regulation by both nicotine exposure and NaB treatment. Analysis of BDNF Exon IV revealed a significant main effect of treatment (F1,20 = 4.57, p < 0.05), indicating that administration of NaB increased the expression of this transcript. Inspection of Fig. 3.4C suggests that this increase was greatest amongst rats that infused saline across acquisition, a result supported by a strong statistical trend (F1,20 = 4.28, p < 0.052).

A similar pattern was observed for BDNF Exon IX. As seen in Fig. 3.4D, NaB induced a significant increase in the expression of BDNF Exon IX mRNA (main effect of treatment:

F1,20 = 4.57, p < 0.05) that appeared to be specific to rats that self-administered saline. However, there was no significant drug by treatment interaction (F1,20 = 2.88, p < 0.11).

Finally, treatment with NaB across extinction decreased Nr4a2 mRNA in the vmPFC

(F1,20 = 5.18, p < 0.05; Table 3.4). This effect was not dependent on a prior history of nicotine, as expression was similar in rats that self-administered nicotine and saline during acquisition

(drug x treatment interaction: F < 1).

There were no detectable group differences in any other genes examined, including transcription factors (e.g. c-fos and FosB) and glutamate receptors (e.g. GRIN2A and mGlu5) previously implicated in synaptic plasticity related to chronic drug exposure or learning and memory more generally (Table 3.4). This indicates that only a specific subset of genes in the vmPFC were differentially regulated during the extinction of nicotine-seeking in the presence of NaB treatment.

Table 3.4. mRNA expression in the ventromedial prefrontal cortex

Target Nic/NaB Nic/Veh Sal/NaB Sal/Veh

Arc 1.01 (0.14) 1.13 (0.15) 0.93 (0.17) 1.00 (0.11) CamKIIa 1.18 (0.09) 1.05 (0.11) 1.08 (0.10) 1.00 (0.08)

CamKIIb 0.95 (0.06) 1.02 (0.06) 1.05 (0.06) 1.00 (0.06) c-fos 0.87 (0.17) 1.07 (0.15) 0.81 (0.14) 1.00 (0.09) EGR-1 0.97 (0.14) 1.02 (0.11) 1.07 (0.14) 1.00 (0.09) EGR-2 1.05 (0.22) 1.23 (0.19) 1.20 (0.23) 1.00 (0.10) FosB 1.05 (0.16) 1.22 (0.14) 1.14 (0.22) 1.00 (0.12) GRIN2A 1.11 (0.10) 0.99 (0.11) 1.12 (0.11) 1.00 (0.11) GRIN2B 1.03 (0.11) 0.98 (0.11) 1.11 (0.13) 1.00 (0.13) GRIN3A 1.04 (0.12) 0.91 (0.10) 1.00 (0.11) 1.00 (0.13) Homer2 1.18 (0.15) 1.03 (0.15) 1.10 (0.13) 1.00 (0.15) mGlu5 1.03 (0.11) 0.95 (0.09) 1.05 (0.09) 1.00 (0.11) NPAS4 0.66 (0.18) 0.89 (0.23) 0.67 (0.15) 1.00 (0.23) Nr4a1 1.20 (0.22) 1.30 (0.19) 1.04 (0.21) 1.00 (0.10) Nr4a2 0.97 (0.13) 1.32 (0.11) 0.94 (0.09) 1.00 (0.06)

Note: Gene expression in the ventromedial prefrontal cortex following nicotine (Nic) self- administration and sodium butyrate (NaB) treatment. Data are presented as group means (and SEM) of normalized mRNA expression relative to control (Saline/Vehicle [Sal/Veh]).

Nucleus accumbens

Changes in mRNA expression were examined in the NAc due to its well-established role in nicotine reinforcement and the extinction of drug-seeking. Examination of mRNA expression in this region yielded no significant group differences for any of the genes examined, including Cdk5 and BDNF.

Chromatin immunoprecipitation (ChIP)

The vmPFC showed evidence of transcriptional regulation. As a result, this region was selected as the target for ChIP assays which determined whether changes in mRNA expression were associated with corresponding alterations in histone acetylation and methylation.

Histone acetylation (H3K14ac)

Nicotine self-administration induced a significant decrease in H3K14ac at the BDNF

Exon IV promoter that was evident after six days of extinction training (main effect of drug:

F1,19 = 4.69, p < 0.05; Fig. 3.5A). This decrease appeared to be greatest for rats that were injected with Veh across extinction, although this was not statistically significant (drug x treatment interaction: F1,19 = 1.69, p < 0.21).

Despite the NaB-induced upregulation of Cdk5 and BDNF Exon I mRNA, there was no evidence of a corresponding increase in H3K14ac within the Cdk5 or BDNF Exon I promoter regions (Fig. 3.5B - C; Fs < 1 for all).

In summary, these findings demonstrate that a history of nicotine self-administration induces a persistent decrease in H3K14ac at the BDNF Exon IV promoter that is detectable six days after the final drug exposure. 81

A BDNF Exon IV H3K14ac 1.5 *

) t

(

l 1.0

o 0.5

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug B BDNF Exon I H3K14ac 1.5

)

(

l 1.0

o 0.5 n

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug C Cdk5 H3K14ac 2.0

)

I 1.5

(

o 1.0

t 0.5

F 0.0 Veh NaB Veh NaB Treatment

Sal Nic Drug

Figure 3.5. H3K14 acetylation at BDNF and Cdk5 promoter regions. The effects of nicotine (Nic) and sodium butyrate (NaB) on H3K14ac at the (A) BDNF Exon IV, (B) BDNF Exon I and (C) Cdk5 promoters. Data are presented as group means + SEM of normalized H3K14ac enrichment relative to control (Saline/Vehicle [Sal - Veh]). One rat (Nic/Veh) was excluded from the analysis of BDNF Exon IV and BDNF Exon I data. Note: * indicates a significant main effect of infusion drug (Nic vs. Sal), p < 0.05. 82

Histone methylation (H3K27me3, H3K9me2 and H3K4me3)

Given the emerging role of histone methylation in cocaine-induced transcriptional changes (Damez-Werno et al., 2012), I further explored the consequences of nicotine self- administration on H3K4me3, H3K27me3 and H3K9me2.

As seen in Fig. 3.6A, rats that self-administered nicotine across acquisition showed significantly lower levels of H3K27me3 within the Cdk5 promoter (main effect of drug: F1,19

= 4.83, p < 0.05). There were no group differences in enrichment of H3K9me2 or H3K4me3

(Fig. 3.6B – C; ps > 0.05 for all). There was no evidence of an effect of NaB on histone methylation at this locus.

Examination of histone methylation at the BDNF Exon IV promoter yielded similar results. A history of nicotine self-administration induced a significant decrease in both

H3K27me3 (main effect of drug: F1,19 = 8.00, p < 0.05; Fig. 3.7A) and H3K9me2 (main effect of drug: F1,19 = 5.08, p < 0.05; Fig. 3.7B) that was evident six days after the final drug exposure.

There were no group differences in enrichment of H3K4me3 (p > 0.05; Fig. 3.7C). Further, there was no evidence of an effect of NaB on histone methylation at any of these marks.

These findings demonstrate that a history of nicotine self-administration is associated with persistent decreases in histone methylation at the promoter regions of Cdk5 and BDNF

Exon IV. These data also confirm that NaB treatment does not induce universal changes in chromatin modifications in the vmPFC.

A Cdk5 H3K27me3

2.0

)

t *

I 1.5

(

o 1.0

t 0.5

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug B Cdk5 H3K9me2 2.0

)

I 1.5

(

o 1.0

i t 0.5

r F 0.0 Veh NaB Veh NaB Treatment

Sal Nic Drug

C Cdk5 H3K4me3 2.5

)

I 2.0

(

r 1.5

f 1.0

c 0.5

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug

Figure 3.6. Histone methylation at the Cdk5 promoter region. The effects of nicotine (Nic) and sodium butyrate (NaB) on (A) H3K27me3, (B) H3K9me2 and (C) H3K4me3 at the Cdk5 promoter. Data are presented as group means + SEM of normalized enrichment relative to control (Saline/Vehicle [Sal/Veh]). One rat was excluded from the analysis of H3K27me3 (Nic/Veh), H3K9me2 (Nic/Veh) and H3K4me3 (Sal/Veh) data. Note: * indicates a significant main effect of drug (Nic vs. Sal), p < 0.05. 84

A BDNF Exon IV H3K27me3 2.5

)

t *

I 2.0

(

r 1.5

f 1.0

c 0.5

a r

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug B BDNF Exon IV H3K9me2 2.5

) t u *

I 2.0

(

r 1.5 t

f 1.0

c 0.5

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug

C BDNF Exon IV H3K4me3 4.0

)

I 3.0

(

o 2.0

t 1.0

F 0.0 Veh NaB Veh NaB Treatment Sal Nic Drug

Figure 3.7. Histone methylation at the BDNF Exon IV promoter region. The effects of nicotine (Nic) and sodium butyrate (NaB) on (A) H3K27me3, (B) H3K9me2 and (C) H3K4me3 at the BDNF Exon IV promoter. Data are presented as group means + SEM of normalized enrichment relative to control (Saline/Vehicle [Sal/Veh]). One rat (Nic/Veh) was excluded from the analysis of H3K27me3 and H3K9me2 data. Note: * indicates a significant main effect of drug (Nic vs. Sal), p < 0.05. 85

BDNF antisense (BDNFas)

Preliminary studies indicated the presence of a BDNFas transcript in the rat brain.

Figure 3.8 shows an agarose gel depicting qPCR products generated following reverse transcriptions with an anti-sense directed primer overlapping with the Exon IV region. This yielded a single band with the fragment size predicted by a BLAT search (114 bp; Kent, 2002).

The absence of any detectable bands in NRC and NTC control reactions demonstrates that this amplification cannot be attributed to the presence of genomic DNA contamination or non- specific binding of qPCR primers, respectively. Finally, Sanger sequencing confirmed that the qPCR product aligned to the desired locus within the BDNF gene (Fig. 3.9).

Following this validation procedure expression of BDNFas was compared across treatment groups. For one animal (Sal/Veh), insufficient quantities of RNA were available to complete the reverse transcription.

As seen in Fig. 3.10, rats that infused nicotine during self-administration showed significantly greater levels of antisense BDNF than those that infused saline (F1,19 = 4.69 p <

0.05).

In summary, these data provide evidence of the existence of a novel transcript to the rat

BDNF gene. Further, I demonstrate that the expression of BDNFas is upregulated by a history of nicotine self-administration.

GAPDH GAPDH Total mRNA Single strand + + NRC NTC + + NRC NTC

1000 bp -

200 bp -

100 bp -

BDNF BDNFas Total mRNA Single strand

+ + NRC NTC + + NRC NTC

1000 bp -

200 bp -

100 bp -

Figure 3.8. Validation of BDNF antisense on an agarose gel. BDNF and GAPDH (total mRNA and single strand) products (+) as well as corresponding no-reverse transcriptase (NRC) and no-template (NTC) controls visualized on a 1.5% agarose gel.

Figure 3.9. Sanger sequencing data aligned to genome assembly. Specificity of the qPCR product to the BDNF locus was verified with Sanger sequencing (Ramaciotti Centre for Genomics). The resultant sequences were entered into at BLAT search on the University of California, Santa Cruz (UCSC) Genome Browser (https://genome.ucsc.edu/index.html; Assembly: March, 2012 [RGSC 5.0/rn5]). The images above show sequencing data from the forward qPCR primer at two resolutions.

BDNFas

)

D 2.5 P *

s 2.0

D 1.5

(

r t n 1.0

o 0.5

a 0.0

F Veh NaB Veh NaB Treatment

Sal Nic Drug

Figure 3.10. BDNF antisense expression in the ventromedial prefrontal cortex. The effects of nicotine (Nic) history and sodium butyrate (NaB) treatment on antisense BDNF (BDNFas) expression. Data are presented as group means + SEM of normalized RNA expression relative to control (Saline/Vehicle [Sal/Veh]). Note: * indicates a significant main effect of infusion drug (Nic vs. Veh), p < 0.05.

Discussion

These experiments provide several original contributions to our understanding of the role of chromatin modifications in learning and addiction. Firstly, I identify potential molecular substrates of HDAC inhibitor-potentiated extinction of operant nicotine self-administration.

Treatment with NaB across extinction increased the expression of Cdk5 and BDNF Exon I mRNA, genes with well-described roles in synaptic plasticity related to long-term memory consolidation. Secondly, I provide the first description of the enduring consequences of intravenous nicotine self-administration on chromatin modifications in the brain. Rats with a history of nicotine exposure showed significantly lower levels of H3K14ac, H3K27me3 and

H3K9me2 at the BDNF Exon IV promoter that persisted despite almost a full week of extinction training. Finally, I report the discovery of a novel antisense transcript to the BDNF gene in the rat brain and demonstrate that the expression of this transcript is sensitive to a prior history of nicotine self-administration.

This study examined the transcriptional and epigenetic consequences of NaB treatment, nicotine self-administration and their interaction. In the first instance, I identified molecular mechanisms that may underlie the behavioral effects of NaB outlined in Chapter II. Treatment with NaB across extinction increased the expression of the neuronal protein kinase, Cdk5, in the vmPFC. Through phosphorylation of several pre- and post-synaptic proteins, including glutamate receptors, ion channels and intracellular signaling molecules, Cdk5 regulates the dendritic spine morphogenesis and synapse formation necessary for long-term memory consolidation (Angelo, Plattner, & Giese, 2006; Fischer, Sananbenesi, Pang, Lu, & Tsai, 2005;

Lai & Ip, 2009; Li et al., 2001; Plattner et al., 2014).

A role for Cdk5 in long-term memory comes from studies showing an impairment in the consolidation of both context-dependent fear (Fischer, Sananbenesi, Schrick, Spiess, & 90

Radulovic, 2002, 2003) and cocaine-induced CPP (Li et al., 2010) following systemic administration of a Cdk5 inhibitor. However, there is evidence to suggest that these effects vary across different brain regions and behavioral tasks, as inhibition of Cdk5 in the hippocampus facilitates the extinction of contextual fear conditioning (Hawasli et al., 2007;

Sananbenesi et al., 2007). One possible explanation for these findings is that Cdk5 can have opposing effects on dendritic spine formation depending on the specific pathways that regulate its activation (Lai & Ip, 2009). Therefore, it may be the case that different behavioral paradigms result in the Cdk5-mediated phosphorylation of distinct synaptic proteins, resulting in contrasting experimental results.

In accordance with the existing literature (Intlekofer et al., 2013), treatment with NaB also increased the expression of BDNF Exon I mRNA. Through multiple mechanisms of action, the neurotrophic factor, BDNF, regulates the reorganization of neuronal structure that is essential for long-term memory formation (Cunha, Brambilla, & Thomas, 2010). For example, activity-dependent BDNF release modulates the number and shape of dendritic spines

(Tolwani et al., 2002; Zagrebelsky et al., 2005), the surface expression of glutamate receptors

(Reimers, Loweth, & Wolf, 2014) and the transcriptional and translational processes required for LTP (Bekinschtein et al., 2007; Bekinschtein et al., 2008). Perhaps not surprisingly, BDNF plays a key role in the acquisition and extinction of long-term memory. Infusion of BDNF into the vmPFC facilitates the extinction of both conditioned fear (Peters, Dieppa-Perea, Melendez,

& Quirk, 2010; Rosas-Vidal, Do-Monte, Sotres-Bayon, & Quirk, 2014) and the CPP for cocaine (Otis, Fitzgerald, & Mueller, 2014). This suggests that increases in BDNF Exon I mRNA in the vmPFC may contribute to NaB-potentiated extinction of nicotine-seeking.

The impact of NaB on the expression of Cdk5 and BDNF Exon I mRNA suggests that

HDAC inhibitors (by potentiating promoter acetylation) facilitate the transcription of genes 91 necessary for the consolidation of new learning into long-term memory. It may be the case that by increasing the expression of these transcripts, NaB facilitates the functional reorganization of synapses necessary for a strong and persistent extinction memory. It should be noted that this increase in mRNA expression was also evident in saline controls. As these animals would experience little or no learning across extinction, it could be that some actions of NaB occur independently of learning itself. Accordingly, confirming the functional relevance of these transcriptional changes is a crucial next step. The data obtained here would predict that infusing or virally overexpressing Cdk5 or BDNF in the vmPFC would mimic the enhancement of extinction induced by NaB. However, it should be noted that extensive optimization would be required to identify the optimal level of expression needed for the desired effects on behavior.

The effect of HDAC inhibition on BDNF mRNA varied across different splice variants.

Treatment with NaB induced a significant increase in the expression of BDNF Exon IV and

Exon IX mRNA that appeared to be attenuated amongst rats with a prior history of nicotine exposure. Though this effect did not reach significance (p = 0.05-0.1), it provides some indication that the inducibility of individual BDNF transcripts may be reduced by chronic exposure to nicotine (Nestler, 2014). If this is the case, it would suggest that a higher dose of

NaB is required to achieve the same effect observed amongst saline animals.

The observation that this pattern of results is specific to some, but not all (i.e. Exon I),

BDNF transcripts may have important implications. Within the brain, BDNF splice variants are expressed in a tissue-specific manner (Timmusk et al., 1993) and display distinct subcellular localization (i.e. cell body, dendrites; Baj, Leone, Chao, & Tongiorgi, 2011), allowing for the spatially precise effects of BDNF on plasticity. Accordingly, this may be one mechanism through which nicotine induces changes within highly specific brain regions and cell types. However, how nicotine regulates individual BDNF splice variants, and the significance of these changes, has not yet been investigated. 92

As the vmPFC, but not the NAc, showed evidence of transcriptional regulation, this region was selected as the target for ChIP assays examining H3K14ac. Though no group differences were observed for Cdk5 or BDNF Exon I, rats that infused nicotine during self- administration showed significantly lower levels of H3K14ac at the BDNF Exon IV promoter.

This is indicative of a repressive chromatin structure that is resistant to transcription. The observation that NaB-induced increases in BDNF Exon IV mRNA are attenuated by prior exposure to nicotine may be a consequence of hypoacetylation of histone proteins at this locus.

Our findings diverge from previous studies of cocaine self-administration, which have reported persistent increases in the binding of acetylated histone H3 at BDNF promoters in the

NAc, mPFC and VTA (Kumar et al., 2005; Sadri-Vakili et al., 2010; Schmidt et al., 2012).

There may be two possible explanations for these different results. Firstly, it is clear that not all drugs of abuse increase acetylation at this locus. In a paper examining the epigenetic basis of opiate-induced suppression of BDNF mRNA, Koo et al. (2015) found that withdrawal from chronic morphine administration (14 days of morphine injections followed by 14 days of withdrawal) was associated with a decrease in H3 acetylation at the BDNF promoter.

Therefore, it is possible that individual drugs induce unique patterns of chromatin modifications and that these contrasting findings can be explained by the distinct pharmacodynamics of nicotine and cocaine (e.g. nicotine receptor agonist vs. dopamine reuptake inhibitor). The finding that different drugs of abuse induce distinct patterns of chromatin modifications raises the question as to whether these effects are necessary for the development of addiction. However, the addictive phenotype varies greatly across different drug types (Badiani, Belin, Epstein, Calu, & Shaham, 2011), which is likely to be a result of their unique neurobiological effects.

Secondly, the current study examined chromatin modifications after a period of extinction training as opposed to home-cage withdrawal (Kumar et al., 2005; Sadri-Vakili et al., 2010; Schmidt et al., 2012). Not only does extinction induce its own set of neuroadaptations

(Ghasemzadeh, Vasudevan, Mueller, Seubert, & Mantsch, 2009; Knackstedt et al., 2010), it also reverses molecular and cellular responses to chronic drug administration, such as deficits in tyrosine hydroxylase and NMDA receptor expression (Self, Choi, Simmons, Walker, &

Smagula, 2004). An extinction protocol was selected for this experiment as it models key aspects of abstinence from nicotine use in humans. During quit attempts, smokers frequently encounter discrete and environmental cues previously paired with nicotine, which induce potent cravings for the drug (Caggiula et al., 2001; Janes et al., 2009). This process is analogous to extinction training, where animals are re-exposed to the context where they previously received nicotine. Accordingly, this procedure is useful for investigating the epigenetic processes engaged during the active inhibition of drug-seeking as opposed to the adaptations to drug exposure itself.

The decrease in H3K14ac at the BDNF Exon IV promoter appeared to be reversed by treatment with NaB. Though this effect did not reach statistical significance, this finding is consistent with prior literature. For example, NaB administered during abstinence from cocaine self-administration normalizes increases in BDNF Exon IV mRNA in the PFC, which is associated with an attenuation of subsequent cocaine-primed reinstatement (Peterson, Abel, &

Lynch, 2014). If persistent alterations in histone acetylation at the BDNF promoter contribute to the enduring vulnerability to reinstatement conferred by drugs of abuse, the finding that these changes can be reversed by HDAC inhibitors may have relevance to relapse prevention in human drug users. 94

A history of nicotine self-administration was also associated with persistent decreases in H3K27me3 and H3K9me2 at the BDNF Exon IV promoter. This result is consistent with a previous study conducted by Chase and Sharma (2013), who demonstrated that acute nicotine exposure (in both mice and cortical cell culture) decreases H3K9me2 binding at the BDNF

Exon I, IV and IXa promoters. Both H3K9me2 and H3K27me3 are signature marks of repressed chromatin and hence are associated with a state of transcriptional repression (Young et al., 2011). The nicotine-induced decrease in both H3K14ac (i.e. indicative of heterochromatin) and H3K27me3/H3K9me2 (i.e. indicative of euchromatin) at histone tails within the BDNF Exon IV promoter region is difficult to interpret. However, it is likely that the combinatorial effects of multiple histone modifications ultimately determines subsequent gene expression (Strahl & Allis, 2000). Such an account may explain the poor correlation between these modifications and BDNF Exon IV mRNA expression, as has been reported previously (Kumar et al., 2005). Future studies will be required to understand how these epigenetic marks interact to regulate gene expression at the BDNF locus. For example, it may be possible to adopt a similar approach to that of Koo et al. (2015), who used ChIP assays to carry out a comprehensive analysis of the chromatin modifying enzymes present at the BDNF locus following chronic exposure to morphine. Key enzymes of interest were then virally overexpressed to observe the consequences on BDNF gene expression and morphine-seeking behavior.

Recently, it has been hypothesized that chromatin modifications regulate gene expression through interactions with lncRNAs (Roberts et al., 2014). Accordingly, I investigated whether nicotine-induced epigenetic changes at the BDNF promoter were correlated with the expression of BDNFas. To this end, I identified and validated the existence of a novel antisense transcript to the BDNF gene in the rat brain. Further, I provide the first evidence that the expression of this transcript is sensitive to drug exposure, as rats that infused 95 nicotine across self-administration showed significantly greater levels of BDNFas in the vmPFC. The functional relevance of this finding is unclear, as although several microRNAs

(miRNAs; ~ 22 nucleotides) have been implicated in addictive behavior (Chandrasekar &

Dreyer, 2009, 2011; Huang & Li, 2009; Wu, Zhang, Law, Wei, & Loh, 2009), the role of lncRNAs (> 200 nucleotides) has yet to be characterized.

At a mechanistic level, the potential importance of BDNFas is well supported. Indeed,

BDNFas has been shown to regulate levels of H3K27me3, an epigenetic mark shown here to be sensitive to nicotine exposure. Inhibition of BDNFas by targeted oligonucleotides decreases occupancy of H3K27me3 at the BDNF locus, releasing this inhibitory constraint on transcription of BDNF mRNA (Modarresi et al., 2012). However, it should be noted that these results would predict a positive correlation between levels of BDNFas expression and

H3K27me3, while an inverse relationship was observed here. Additional studies will be required to understand this complex interaction, which will be discussed further in the next chapter.

Interestingly, only a subset of genes within the vmPFC, but not the NAc, were differentially regulated by a history of nicotine or treatment with NaB across extinction. For example, there were no group differences in the expression of glutamate receptors (e.g.

GRIN2A, GRIN2B, GRIN3A, mGLu5) or transcription factors (e.g. c-fos, FosB) previously implicated in synaptic plasticity related to chronic drug exposure or learning and memory more generally. In addition, there were no NaB-induced increases in gene expression or histone acetylation that were specific to animals that infused nicotine, as was predicted by the data obtained in Chapter II. This result was surprising, but may be due the timing of tissue collection. The ability of HDAC inhibitors to increase histone acetylation is known to be potentiated when the chromatin structure is rendered permissive by the original learning itself 96

(Bredy et al., 2007; Graff & Tsai, 2013b). At the behavioral level, nicotine-seeking was well extinguished by the fourth day of training. From this point onward, there may have been little additional learning to prime the epigenetic and transcriptional effects of NaB. Similarly, prior studies have demonstrated that although several alterations in histone acetylation and gene expression persist long after drug exposure (> one week), others are more transient (e.g. Cdk5, neuropeptide Y), reverting to control levels following protracted abstinence (Freeman et al.,

2008; Kumar et al., 2005; Schmidt et al., 2012). Such an explanation would account for the finding that nicotine-induced decreases in H3K14ac are not reflected in levels of BDNF mRNA. This hypothesis could be tested directly by examining gene expression after the first or second extinction session.

Three limitations to the current study require acknowledgement. Firstly, it is likely the epigenetic and transcriptional consequences of NaB treatment and nicotine exposure are highly region-specific. As a result, relevant molecular changes may have eluded detection when the entirety of the vmPFC and NAc were extracted. Several studies have indicated that the IL and the NAcSh, but not the PL or NAc core (NAcc), are required for the consolidation and expression of extinction (LaLumiere et al., 2010; Peters et al., 2008). Further, infusion of NaB into the IL, but not PL, facilitates the extinction of contextual fear conditioning (Stafford et al.,

2012). Accordingly, future studies may consider the use of micropunch dissection techniques to extract tissue from individual brain regions with a high degree of precision.

Further, it is likely that molecular changes within a structure are limited to a subset of cells. In line with this interpretation, Li et al. (2015) found that cue-induced reinstatement of methamphetamine-seeking was associated with minimal changes in gene expression when

RNA was extracted from all neurons in the dorsal striatum. However, using fluorescence activated cell sorting (FACS) to identify fos-positive neurons, the authors then examined 97 mRNA expression within the sub-population of cells activated during the test session. Amongst these cue-activated, fos-positive neurons, numerous transcriptional changes were detected, including increased expression of transcription factors, glutamate receptors and chromatin modifying enzymes. In light of these findings, future studies could use FACS to investigate the consequences of nicotine exposure and NaB treatment amongst the sub-population of cells that are engaged across the course of extinction or even during nicotine-primed reinstatement. This technique may also provide insight into the complex pattern of histone modifications present at the BDNF promoter following nicotine self-administration. In particular, it would be of interest to examine whether the observed changes in histone acetylation and methylation occur within the same cells or whether they are specific to discrete populations of neurons within the brain (e.g. excitatory vs. inhibitory neurotransmitter systems).

Secondly, the behavioral paradigm adopted here does not allow for discrimination between the transcriptional and epigenetic changes that follow the initial nicotine exposure and those that arise as a consequence of the extinction training. Specifically, as nicotine, but not saline, animals undergo extinction of drug-seeking, distinguishing between the effects of nicotine self-administration and extinction training is problematic. In order to resolve this ambiguity, future studies may consider additional groups of rats that undergo nicotine withdrawal in the home cage. Any effects observed in these animals can be attributed to the nicotine self-administration specifically.

Finally, there was insufficient brain tissue available to investigate the consequences of the observed transcriptional and epigenetic changes on levels of the BDNF protein. This may be important, as it is the protein that ultimately carries out the neurotrophic effects of BDNF on synaptic plasticity. As a result, future studies may consider the use of enzyme-linked immunosorbent assays (ELISAs) to measure levels of BDNF protein in the vmPFC. 98

In conclusion, this study is the first to identify potential molecular substrates underlying

NaB-potentiated extinction of drug-seeking using an instrumental paradigm. In addition, I report that intravenous nicotine self-administration induces persistent alterations in chromatin modifications and BDNFas expression that are evident six days after the final drug exposure.

These data suggest that interactions between lncRNAs and chromatin modifications may underlie the neuroadaptations that contribute to the persistent vulnerability to relapse conferred by chronic nicotine exposure. Future studies will be required to confirm the functional relevance of NaB-induced changes in gene expression and the existence of a causal relationship between chromatin modifications and BDNFas expression.

Chapter IV: General discussion

Summary of key findings

The principle aim of this thesis was to examine the role of histone acetylation in the extinction and reinstatement of nicotine self-administration.

To achieve this aim, Chapter II examined the effect of HDAC inhibition across extinction on subsequent reinstatement of nicotine-seeking. It was hypothesized that when administered during the period of extinction consolidation (but not outside of this window),

NaB would enhance the rate of extinction and attenuate reinstatement upon re-exposure to nicotine or its associated cues.

Consistent with this hypothesis, NaB administered immediately after extinction sessions attenuates reinstatement induced by priming injections of the drug. This reduction in reinstatement appears to be due to the effect of NaB on extinction learning and not to mere exposure to the treatment itself. Sodium butyrate administered six hours after each session has no impact on subsequent reinstatement, indicating that the observed behavioral effects are dependent on NaB being administered during extinction consolidation. Further, when a cue- extinction procedure is used to elevate responding, not only does NaB reduce nose-poking on the second day of extinction, it also markedly decreases the number of sessions required for rats to reach the extinction criteria. These data suggest that by potentiating histone acetylation,

HDAC inhibition regulates the expression of genes required for the consolidation of extinction, which in turn provides resistance to reinstatement.

The second experimental chapter aimed to confirm this hypothesis by investigating the transcriptional and epigenetic changes underlying NaB-potentiated extinction of nicotine- seeking. In support of my predictions, treatment with NaB across extinction increases the 100 expression of Cdk5 as well as BDNF Exon I, IV and IX mRNA in the vmPFC. This is consistent with previous reports demonstrating that Cdk5 and BDNF modulate the dendritic spine morphogenesis and synapse formation essential for long-term memory consolidation (Cunha et al., 2010; Lai & Ip, 2009). It may be the case that by increasing the expression of these transcripts, NaB facilitates the functional reorganization of synapses necessary for a strong and persistent extinction of drug-seeking.

In addition, I demonstrate that nicotine self-administration induces enduring epigenetic changes in the vmPFC. A history of nicotine exposure is associated with decreases in H3K14ac,

H3K27me3 and H3K9me2 within the BDNF Exon IV promoter region that persist despite almost a full week of extinction training. As will be explored below, this represents a potential mechanism through which nicotine facilitates the formation of aberrantly powerful memories that continue to prompt relapse across abstinence.

Finally, I report the discovery of a novel antisense transcript to the BDNF gene in the rat brain and show that the expression of this transcript is increased following nicotine self- administration. This finding may have important implications for addiction as lncRNAs are becoming increasingly implicated in the pathology of several neurological disorders (Roberts et al., 2014). Accordingly, this chapter will discuss avenues for future research that may reveal the role of this transcript in addictive behavior.

Together, these data further our understanding of the molecular processes underlying the extinction of drug-seeking and the persistent vulnerability to relapse conferred by chronic nicotine exposure. 101

Epigenetic mechanisms in drug addiction

This thesis makes two major contributions to our understanding of the role of chromatin modifications in drug-seeking behavior across extinction. Firstly, it extends the results of prior

CPP studies to an instrumental paradigm, a model that more closely approximates drug-taking behavior in humans. Secondly, it provides the first description of the enduring effects of nicotine self-administration on chromatin modifications in the brain.

Extending prior CPP studies to an instrumental conditioning paradigm

Until now, investigations into the effect of HDAC inhibition on the extinction of drug- seeking have been restricted to the CPP procedure. These studies have been critical for identifying the role of epigenetic processes in the extinction of drug-associated contextual memory. However, it is clear that protocols involving experimenter-administered drug injections do not accurately model drug-seeking and taking in humans (Sanchis-Segura &

Spanagel, 2006). Rather, the multiple interacting components of drug addiction, such as motivation, decision-making and compulsion are only modelled when animals are permitted to freely regulate their own drug intake (Deroche-Gamonet et al., 2004). By extending the results of prior CPP studies to an operant self-administration paradigm, this thesis achieved its aim of demonstrating that NaB modulates the deliberate, motivated actions that accompany voluntary drug-seeking behavior. This provides additional support for the therapeutic potential of HDAC inhibitors in promoting cessation from drug use in humans.

The content of the learning altered by treatment with NaB warrants further consideration. In the first instance, extinction of nicotine self-administration involves learning about the consequences of both Pavlovian conditioned cues (i.e. cue/context ≠ nicotine) and 102 instrumental actions (i.e. response ≠ nicotine; Todd, Vurbic, & Bouton, 2014). Accordingly, it is possible that either (or both) of these processes are strengthened by NaB treatment.

Future studies may consider investigating whether HDAC inhibitors facilitate learning about the operant response specifically. This could be important, as some pharmacological compounds have differential effects on Pavlovian and instrumental learning processes (e.g. dopamine receptor antagonists; Wassum, Ostlund, Balleine, & Maidment, 2011). To achieve this aim, it may be possible to adopt a similar design to that used by Buffalari, Feltenstein, and

See (2013), who explored whether restricting access to the response operandum during extinction of cocaine-seeking influenced subsequent cue-induced reinstatement. This would involve testing the effects of NaB amongst rats exposed to the extinction context without access to the nose-poke holes. A reduction in reinstatement here would suggest that the instrumental response is not central to the effect of NaB on extinction. Rather, it would indicate that the treatment is reducing the ability of Pavlovian conditioned cues to drive nicotine-seeking behavior.

Secondly, the effects of NaB on the reinstatement of nicotine-seeking could be taken as evidence that HDAC inhibition impairs reconsolidation of memories acquired during acquisition of self-administration (i.e. cue/response = drug; Lattal & Wood, 2013; Stafford &

Lattal, 2011). However, this is unlikely given that HDAC inhibitors have positive effects on the formation of long-term memory (Graff & Tsai, 2013b; Levenson et al., 2004; Malvaez et al., 2013; McQuown & Wood, 2011; Rogge et al., 2013). In support of this claim, when acquisition of an object location task is conducted immediately after extinction of cocaine-CPP

(within-subjects design), treatment with an HDAC inhibitor facilitates the reduction of an established place preference while simultaneously enhancing long-term memory for object location (Malvaez et al., 2013). This pattern of results is inconsistent with the notion that the 103 reduction in drug-seeking behavior is a product of impaired reconsolidation. Future experiments may adopt a similar design to confirm that NaB attenuates reinstatement by enhancing extinction of nicotine-seeking.

In summary, this thesis achieved its aim of extending the results of prior CPP studies to an instrumental self-administration paradigm. Additional studies will be required to identify the content of the learning altered by NaB treatment. An understanding of these processes will be necessary to design an optimal set of parameters that promote the strongest effects of treatment on behavior, which may ultimately guide the use of NaB in a clinical setting.

Nicotine induces enduring epigenetic changes within the BDNF promoter

Previous studies examining the epigenetic consequences of nicotine exposure have been limited to procedures involving oral or experimenter-administered nicotine (Chase &

Sharma, 2013; Gozen et al., 2013; Levine et al., 2011). Further, these reports have focused on the short-term effects of the drug, without exploring the persistence of these changes across abstinence. As a result, the contribution of enduring epigenetic changes to the reinstatement of nicotine-seeking behavior remains unknown.

In light of this, Chapter III aimed to investigate the long-term consequences of intravenous nicotine self-administration on chromatin modifications in the brain. To this end,

I demonstrate that a history of nicotine exposure is associated with decreases in H3K14ac,

H3K27me3 and H3K9me2 within the BDNF Exon IV promoter region. Importantly, this is observed after almost a full week of extinction training, suggesting that these epigenetic changes persist well after responding (and the acute effects of the drug) have subsided.

These findings may underlie the ability of nicotine to create aberrantly powerful memories that continue to prompt drug use across abstinence. Through modulation of dendritic 104 spine density, as well as transcriptional and translational processes (Bekinschtein et al., 2007;

Bekinschtein et al., 2008), BDNF regulates the reorganization of neuronal structure that is essential for long-term memory (Cunha et al., 2010). Accordingly, it may be the case that by altering the chromatin structure at the BDNF locus, nicotine allows normally transient memory traces to be maintained across an extended period of time. This may contribute to the intense cravings experienced by abstinent smokers upon re-exposure to nicotine-associated cues and contexts.

These results suggest that across abstinence, the heightened responsiveness to nicotine and its associated cues could be encoded at the level of chromatin, rather than in steady-state changes in gene or protein expression. In support of this claim, several studies have now shown that cocaine-induced epigenetic changes alter the inducibility of specific genes in response to subsequent cue or drug exposures, without affecting their basal levels of expression (Baker-

Andresen et al., 2015; Damez-Werno et al., 2012; Massart et al., 2015). In the context of these experiments, nicotine-induced chromatin modifications may act to prime or desensitize changes in BDNF mRNA expression that occur when rats are re-exposed to nicotine and its associated discrete and environmental stimuli (Fig. 4.1). This interpretation could explain why relapse to smoking is observed long after changes in gene and protein expression have reverted back to baseline (Cosgrove et al., 2009). Indeed, the epigenetic changes observed here were not reflected in levels of BDNF Exon IV mRNA, which were largely unaffected by a prior history of nicotine.

Consistent with this interpretation, Damez-Werno et al. (2012) found no evidence of an induction of FosB mRNA during withdrawal from chronic cocaine injections. However, relative to control animals, rats with a prior history of cocaine exposure showed increased locomotor activity and FosB mRNA expression in response to a subsequent cocaine challenge. 105

Figure 4.1. Epigenetic priming and desensitisation. For select genes, the epigenetic consequences of nicotine self-administration may be latent, meaning they are not reflected in the steady-state levels of mRNA expression. Instead, nicotine may alter chromatin structure to prime or desensitize gene expression in response to subsequent drug or cue exposures, like those given to induce reinstatement. In the case of BDNF, the permissive chromatin structure created by persistent decreases in H3K27me3 and H3K9me2 may prime the expression of this gene in response to later encounters with the drug or its associated cues. A = acetylation; M = methylation; P = phosphorylation; pol II = ribonucleic acid (RNA) polymerase II. Adapted from Robison and Nestler (2011).

106

This priming of the transcriptional and behavioral response was associated with decreases in

H3K9me2 at the FosB promoter, indicative of a permissive chromatin structure at this locus.

Therefore, it may be the case that these persistent ‘epigenetic signatures’ result in an altered transcriptional response to subsequent drug and/or cue exposures, which promotes drug- seeking behavior during abstinence.

Interestingly, the nicotine-induced decrease in H3K14ac at the BDNF Exon IV promoter appeared to be reversed by treatment with NaB. Though this effect did not reach statistical significance, this pattern of results is supported by prior literature. For example, NaB injected during abstinence from cocaine self-administration normalizes increases in BDNF

Exon IV mRNA in the mPFC, which is associated with a reduction in subsequent cocaine- primed reinstatement (Peterson et al., 2014). Further, administration of TsA reverses changes in BDNF protein expression and dendritic spine density induced by chronic alcohol exposure

(You, Zhang, Sakharkar, Teppen, & Pandey, 2014). If persistent alterations in histone acetylation at the BDNF promoter contribute to the enduring vulnerability to reinstatement conferred by drugs of abuse, the finding that these changes can be reversed by HDAC inhibitors may have relevance to relapse prevention in human drug users.

It should be acknowledged that nicotine self-administration produced a pattern of chromatin modifications that was unexpected based on my review of the literature. Increases in histone acetylation are associated with an active state of gene transcription that promotes memory formation (Korzus et al., 2004; Stefanko et al., 2009). For this reason, it was hypothesized that, like cocaine (Kumar et al., 2005; Schmidt et al., 2012; Wang et al., 2010a), nicotine would increase histone acetylation at genes critical for long-term memory formation.

In contrast, nicotine had the opposite effect, decreasing H3K14ac at the BDNF Exon IV promoter, suggestive of a repressive chromatin structure that is resistant to transcription. 107

However, it is unlikely that alterations in a single mark will explain the complexity of the epigenetic regulation of long-term memory. Not only can acetylation occur at multiple lysine residues (Graff & Tsai, 2013a), individual histone proteins are subject to multiple chromatin modifications at different sites (Kouzarides, 2007). Indeed, I observed decreases in

H3K27me3 and H3K9me2 within the BDNF Exon IV promoter, indicating that histone methylation may be important for creating the permissive chromatin structure that allows nicotine to create strong and persistent memories. Future studies will be required to understand how these epigenetic modifications act in concert to regulate the long-term changes in neuronal function that manifest in the enduring susceptibility to relapse observed amongst abstinent smokers.

Future directions

The field of epigenetics is rapidly expanding, creating numerous avenues for additional research. Firstly, future studies may consider investigating the specific HDAC enzymes and neuronal circuitry targeted by NaB during the extinction of nicotine-seeking. Secondly, given the established role of lncRNAs in the epigenetic regulation of gene expression, it would be of interest to determine whether nicotine regulates the chromatin landscape at the BDNF promoter by increasing the expression of BDNFas. Finally, future studies will be required to determine whether NaB has potential in a clinical setting for the treatment of nicotine addiction in human smokers.

The role of individual HDACs in the extinction of drug-seeking

Sodium butyrate is broad-spectrum HDAC inhibitor, predominantly inhibiting class I

(HDAC1, 2, 3 and 8) but not class IIa/b HDACs (Kilgore et al., 2010). As a result, it currently 108 remains unknown which specific enzymes are targeted by NaB to facilitate the extinction of nicotine-seeking. An understanding of these mechanisms will be required for the development of more selective compounds, which will reduce any off-target effects of treatment on behavior.

Recent studies using genetic and pharmacological approaches have identified HDAC2 and 3 as promising candidates underlying the effects of NaB on long-term memory. For example, HDAC2-deficient mice exhibit enhanced long-term memory for hippocampal- dependent tasks, including contextual fear conditioning and spatial learning (Guan et al., 2009).

These behavioral improvements are accompanied by enhanced synapse formation, LTP and expression of memory-related genes (e.g. BDNF, EGR1 and NDMA receptors). Analogous results are obtained following focal hippocampal and accumbal deletion of HDAC3, which facilitates both object location memory and cocaine-induced CPP, respectively (McQuown et al., 2011; Rogge et al., 2013).

These findings are consistent with those from studies using isoform-selective HDAC inhibitors. In a recent study, Malvaez et al. (2013) found that systemic administration of the

HDAC3-selective inhibitor, RGFP966 (Rai et al., 2010), mimics the effects of NaB (Malvaez et al., 2010) on the extinction and reinstatement of cocaine-induced CPP. However, the memory-enhancing effects of this compound have not been consistently replicated. For example, while RGFP963 (an inhibitor of HDAC1, 2 and 3) enhances consolidation of cued fear extinction, no effect is observed following treatment with the HDAC3-selective inhibitor

(Bowers, Xia, Carreiro, & Ressler, 2015). Similarly, RGFP963, but not RGFP966, rescues memory deficits in a mouse model of Alzheimer’s disease (Rumbaugh et al., 2015). Taken together, these results suggest that inhibition of both HDAC2 and HDAC3 may provide the most robust behavioral outcomes. 109

In summary, these studies suggest that NaB may facilitate the extinction of nicotine- seeking through inhibition of HDAC2 and 3. Future studies may consider using genetic or pharmacological techniques to inhibit the function of these enzymes during the extinction of nicotine self-administration. This will inform the development of novel compounds with greater specificity for individual HDAC isoforms, which will ultimately reduce any non- specific effects of broad-spectrum inhibitors.

The role of histone acetylation in the ventromedial prefrontal cortex

To date, research investigating the effect of HDAC inhibitors on the extinction of drug- seeking has been restricted to systemic routes of administration. As a result, microinfusion studies will be required to identify a causal role for the neuronal circuitry underlying these behavioral data. Uncovering the neurobiological mechanisms of extinction has implications for addiction and anxiety disorders, treatments for which often incorporate extinction-based procedures.

Consistent with prior research (Bredy et al., 2007; Malvaez et al., 2013), I found that treatment with NaB leads to changes in gene expression in the vmPFC, suggesting that this region may be critical for the observed extinction enhancement. The vmPFC has been heavily implicated in extinction (Chandler & Gass, 2013; LaLumiere et al., 2010; Laurent &

Westbrook, 2009), yet only one study has identified a causal role for histone acetylation in this region. Here, Stafford et al. (2012) found that infusion of NaB into the IL, but not PL, enhances the extinction of context-dependent fear, an effect observed up to two weeks after treatment.

A similar approach could be used to examine the role of the histone acetylation in the

IL during the extinction of nicotine-seeking. To extend upon previous work, future studies may 110 also consider the infusion of a more selective compound in order to identify the specific

HDACs underlying NaB-potentiated extinction.

It would also be of interest to further explore the effects of NaB on Cdk5 and BDNF mRNA in the vmPFC. This may be important, as the increased expression of these transcripts was observed amongst animals that infused both nicotine and saline across acquisition. In addition, there was no evidence of a corresponding change in levels of H3K14ac at the Cdk5 or BDNF promoters. Consequently, future studies may investigate whether NaB induces changes in histone acetylation at alternate lysine residues (e.g. H3K9ac) or loci within the Cdk5 and BDNF genomic regions (e.g. transcription start site). In addition, these transcripts could be virally overexpressed in the IL during extinction of nicotine-seeking. Based on the data obtained here, it would be expected that this manipulation would mimic the effects of NaB on extinction and reinstatement, and potentiate the changes in cellular morphology that accompany long-term memory formation.

Antisense BDNF

This thesis provides the first demonstration that BDNFas is differentially expressed following drug exposure. Several lines of evidence suggest that this transcript may play a crucial role in addiction. Firstly, lncRNAs, including BDNFas (Modarresi et al., 2012), are abundantly expressed in the mammalian brain (Belgard et al., 2011; Roberts et al., 2014). As they are often localized in the synapse and in dendritic compartments (Mercer, Dinger, Sunkin,

Mehler, & Mattick, 2008), they are well-positioned to regulate the synaptic changes that accompany chronic exposure to drugs of abuse. Additionally, BDNFas is hypothesized to alter the expression of BDNF mRNA through interactions with chromatin modifying enzymes. For example, knockdown of BDNFas using synthetic antisense oligodeoxynucleotides (ODNs) 111 results in a marked decrease in promoter H3K27me3 (Modarresi et al., 2012), a mark shown here to be sensitive to a prior history of nicotine self-administration. Finally, a subset of lncRNAs are differentially expressed in the NAc of former heroin addicts (Michelhaugh et al.,

2011), which may account for the widespread transcriptional changes observed in addicted users. Taken together, these findings suggest that interactions between chromatin modifications and BDNFas may underlie the synaptic changes that follow chronic nicotine exposure.

The investigation of a functional role of BDNFas in regulating nicotine-induced chromatin modifications represents an exciting avenue for future research. In the first instance,

RNA sequencing could be used to map the entire BDNFas structure and identify any existing splice variants. This would allow for the development of viral vectors (Saayman et al., 2014) or antisense ODNs (Modarresi et al., 2012), which could be used to examine the behavioral and neurobiological consequences (i.e. on chromatin modifications and mRNA expression) of inhibiting the expression of BDNFas in vivo. Finally, it may also be of interest to determine whether levels of BDNFas are associated with the changes in BDNF mRNA expression observed in the brains of former drug addicts (Jiang, Zhou, Mash, Marini, & Lipsky, 2009).

This would provide evidence for of the clinical relevance of these molecular changes.

Implications for smokers

The finding that NaB treatment induces a rapid and persistent extinction that is resistant to recovery provides evidence that HDAC inhibitors may be a potential pharmacological treatment for promoting smoking cessation. One application could be as an adjunct to cue- exposure therapy, where smokers are repeatedly presented with smoking-related cues in order to extinguish conditioned craving and hence reduce the likelihood of relapse (Myers &

Carlezon, 2010). 112

In support for this claim, multiple studies have now shown that VPA facilitates the extinction of conditioned fear in healthy human subjects (Kuriyama, Honma, Soshi, Fujii, &

Kim, 2011; Kuriyama, Honma, Yoshiike, & Kim, 2013). Further, both NaB and VPA are already approved for human consumption, while several isoform-selective inhibitors are currently in clinical trials for the treatment of neurological disorders (Falkenberg & Johnstone,

2014). This suggests that HDAC inhibitors can be safely used in humans and may be useful for helping smokers to develop inhibitory control over cues and contexts associated with smoking.

However, it should be noted that numerous compounds (such as corticotropin-releasing hormone [CRF] antagonists) that have shown tremendous promise in preclinical addiction studies have proven ineffective in human clinical trials (e.g. Kwako et al., 2015; Schwandt et al., 2016). This suggests that the development of highly robust and relevant animal models is required to successfully translate findings from the laboratory to a clinical setting. In this regard, future studies should consider examining the effects of HDAC inhibitors on the extinction of nicotine-seeking following more protracted exposure to nicotine, or amongst rats displaying characteristic features of addiction, such as the persistence of use despite the associated negative consequences (Deroche-Gamonet et al., 2004). This may be particularly important as we have previously demonstrated that nicotine self-administration is initially goal- directed yet becomes habitual after more extended training (> 40 days; Clemens et al., 2014).

Demonstrating the effectiveness of NaB using such models would provide further evidence of its potential to treat nicotine addiction in human smokers.

Conclusion

In summary, these studies show for the first time that treatment with an HDAC inhibitor facilitates the extinction of nicotine-seeking in a persistent manner that provides resistance to 113 reinstatement. In doing so, this thesis achieved its aim of extending the results of prior CPP studies to an instrumental paradigm, a model that more closely approximates drug-taking behavior in humans. Further, this is the first investigation of the enduring consequences of intravenous nicotine self-administration on epigenetic mechanisms in the brain. Together, these data suggest that chromatin modifications are a prime candidate mechanism underlying the persistence of nicotine-associated memories and a potential therapeutic target for aiding smoking cessation in humans.

114

References

Alarcon, J. M., Malleret, G., Touzani, K., Vronskaya, S., Ishii, S., Kandel, E. R., & Barco, A.

(2004). Chromatin acetylation, memory, and LTP are impaired in CBP+/- mice: a

model for the cognitive deficit in Rubinstein-Taybi syndrome and its amelioration.

Neuron, 42(6), 947-959. doi: 10.1016/j.neuron.2004.05.021

Alberini, C. M. (2009). Transcription factors in long-term memory and synaptic plasticity.

Physiological Reviews, 89(1), 121-145. doi: 10.1152/physrev.00017.2008

Albuquerque, E. X., Pereira, E. F. R., Alkondon, M., & Rogers, S. W. (2009). Mammalian

Nicotinic Acetylcholine Receptors: From Structure to Function. Physiological Reviews,

89(1), 73-120. doi: 10.1152/physrev.00015.2008

Allfrey, V. G., Faulkner, R., & Mirsky, A. E. (1964). Acetylation and methylation of histones

and their possible role in the regulation of RNA synthesis. Proceedings of the National

Academy of Sciences of the United States of America, 51(5), 786-794.

Angelo, M., Plattner, F., & Giese, K. P. (2006). Cyclin-dependent kinase 5 in synaptic

plasticity, learning and memory. Journal of Neurochemistry, 99(2), 353-370. doi:

10.1111/j.1471-4159.2006.04040.x

Badiani, A., Belin, D., Epstein, D., Calu, D., & Shaham, Y. (2011). Opiate versus

psychostimulant addiction: the differences do matter. Nature Reviews Neuroscience,

12(11), 685-700. doi: 10.1038/nrn3104

Baj, G., Leone, E., Chao, M. V., & Tongiorgi, E. (2011). Spatial segregation of BDNF

transcripts enables BDNF to differentially shape distinct dendritic compartments. 115

Proceedings of the National Academy of Sciences, 108(40), 16813-16818. doi:

10.1073/pnas.1014168108

Baker-Andresen, D., Zhao, Q., Li, X., Jupp, B., Chesworth, R., Lawrence, A. J., & Bredy, T.

(2015). Persistent variations in neuronal DNA methylation following cocaine self-

administration and protracted abstinence in mice. Neuroepigenetics, 4, 1-11. doi:

10.1016/j.nepig.2015.10.001

Banks, E., Joshy, G., Weber, M. F., Liu, B., Grenfell, R., Egger, S., . . . Beral, V. (2015).

Tobacco smoking and all-cause mortality in a large Australian cohort study: findings

from a mature epidemic with current low smoking prevalence. BMC Medicine, 13, 38.

doi: 10.1186/s12916-015-0281-z

Bardo, M. T., & Bevins, R. A. (2000). Conditioned place preference: What does it add to our

preclinical understanding of drug reward? Psychopharmacology, 153(1), 31-43. doi:

10.1007/s002130000569

Barrett, R. M., Malvaez, M., Kramar, E., Matheos, D. P., Arrizon, A., Cabrera, S. M., . . .

Wood, M. A. (2011). Hippocampal focal knockout of CBP affects specific histone

modifications, long-term potentiation, and long-term memory.

Neuropsychopharmacology, 36(8), 1545-1556. doi: 10.1038/npp.2011.61

Bekinschtein, P., Cammarota, M., Igaz, L. M., Bevilaqua, L. R., Izquierdo, I., & Medina, J. H.

(2007). Persistence of long-term memory storage requires a late protein synthesis- and

BDNF- dependent phase in the hippocampus. Neuron, 53(2), 261-277. doi:

10.1016/j.neuron.2006.11.025

Bekinschtein, P., Cammarota, M., Katche, C., Slipczuk, L., Rossato, J. I., Goldin, A., . . .

Medina, J. H. (2008). BDNF is essential to promote persistence of long-term memory 116

storage. Proceedings of the National Academy of Sciences, 105(7), 2711-2716. doi:

10.1073/pnas.0711863105

Bekkers, J. M., & Stevens, C. F. (1990). Presynaptic mechanism for long-term potentiation in

the hippocampus. Nature, 346(6286), 724-729. doi: 10.1038/346724a0

Belgard, T. G., Marques, A. C., Oliver, P. L., Abaan, H. O., Sirey, T. M., Hoerder-Suabedissen,

A., . . . Ponting, C. P. (2011). A transcriptomic atlas of mouse neocortical layers.

Neuron, 71(4), 605-616. doi: 10.1016/j.neuron.2011.06.039

Bird, K. D. (2004). Analysis of Variance via Confidence Intervals. London: SAGE

Publications.

Borrelli, E., Nestler, E. J., Allis, C. D., & Sassone-Corsi, P. (2008). Decoding the epigenetic

language of neuronal plasticity. Neuron, 60(6), 961-974. doi:

10.1016/j.neuron.2008.10.012

Bowers, M. E., Xia, B., Carreiro, S., & Ressler, K. J. (2015). The Class I HDAC inhibitor

RGFP963 enhances consolidation of cued fear extinction. Learning & Memory, 22(4),

225-231. doi: 10.1101/lm.036699.114

Bredy, T. W., & Barad, M. (2008). The histone deacetylase inhibitor valproic acid enhances

acquisition, extinction, and reconsolidation of conditioned fear. Learning & Memory,

15(1), 39-45. doi: 10.1101/lm.801108

Bredy, T. W., Wu, H., Crego, C., Zellhoefer, J., Sun, Y. E., & Barad, M. (2007). Histone

modifications around individual BDNF gene promoters in prefrontal cortex are

associated with extinction of conditioned fear. Learning & Memory, 14(4), 268-276.

doi: 10.1101/lm.500907 117

Broide, R. S., Redwine, J. M., Aftahi, N., Young, W., Bloom, F. E., & Winrow, C. J. (2007).

Distribution of histone deacetylases 1-11 in the rat brain. Journal of Molecular

Neuroscience, 31(1), 47-58. doi: 10.1385/jmn/31:01:47

Brown, R. W., & Kolb, B. (2001). Nicotine sensitization increases dendritic length and spine

density in the nucleus accumbens and cingulate cortex. Brain Research, 899(1-2), 94-

100.

Buczek, Y., Le, A. D., Wang, A., Stewart, J., & Shaham, Y. (1999). Stress reinstates nicotine

seeking but not sucrose solution seeking in rats. Psychopharmacology, 144(2), 183-

188.

Buffalari, D. M., Feltenstein, M. W., & See, R. E. (2013). The effects of varied extinction

procedures on contingent cue-induced reinstatement in Sprague-Dawley rats.

Psychopharmacology, 230(2), 319-327. doi: 10.1007/s00213-013-3156-z

Caggiula, A. R., Donny, E. C., White, A. R., Chaudhri, N., Booth, S., Gharib, M. A., . . . Sved,

A. F. (2001). Cue dependency of nicotine self-administration and smoking.

Pharmacology Biochemistry and Behavior, 70(4), 515-530. doi: 10.1016/S0091-

3057(01)00676-1

Centers for Disease Control and Prevention [CDC]. (2014). The Health Consequences of

Smoking-50 Years of Progress: A Report of the Surgeon General. Atlanta (GA):

National Center for Chronic Disease Prevention and Health Promotion (US) Office on

Smoking and Health.

Chandler, L. J., & Gass, J. T. (2013). The plasticity of extinction: contribution of the prefrontal

cortex in treating addiction though inhibitory learning. Frontiers in Psychiatry, 4. doi:

10.3389/fpsyt.2013.00046 118

Chandrasekar, V., & Dreyer, J. L. (2009). microRNAs miR-124, let-7d and miR-181a regulate

cocaine-induced plasticity. Molecular and Cellular Neuroscience, 42(4), 350-362. doi:

10.1016/j.mcn.2009.08.009

Chandrasekar, V., & Dreyer, J. L. (2011). Regulation of MiR-124, Let-7d, and MiR-181a in

the accumbens affects the expression, extinction, and reinstatement of cocaine-induced

conditioned place preference. Neuropsychopharmacology, 36(6), 1149-1164. doi:

10.1038/npp.2010.250

Chase, K. A., & Sharma, R. P. (2013). Nicotine induces chromatin remodelling through

decreases in the methyltransferases GLP, G9a, Setdb1 and levels of H3K9me2.

International Journal of Neuropsychopharmacology, 16(5), 1129-1138. doi:

10.1017/s1461145712001101

Chen, B. T., Bowers, M. S., Martin, M., Hopf, F. W., Guillory, A. M., Carelli, R. M., . . . Bonci,

A. (2008). Cocaine but Not Natural Reward Self-Administration nor Passive Cocaine

Infusion Produces Persistent LTP in the VTA. Neuron, 59(2), 288-297. doi:

10.1016/j.neuron.2008.05.024

Chiamulera, C., Borgo, C., Falchetto, S., Valerio, E., & Tessari, M. (1996). Nicotine

reinstatement of nicotine self-administration after long-term extinction.

Psychopharmacology, 127(2), 102-107. doi: 10.1007/BF02805981

Clemens, K. J., Caillé, S., & Cador, M. (2010). The effects of response operandum and prior

food training on intravenous nicotine self-administration in rats. Psychopharmacology,

211(1), 43-54. doi: 10.1007/s00213-010-1866-z

Clemens, K. J., Castino, M. R., Cornish, J. L., Goodchild, A. K., & Holmes, N. M. (2014).

Behavioral and neural substrates of habit formation in rats intravenously self- 119

administering nicotine. Neuropsychopharmacology, 39(11), 2584-2593. doi:

10.1038/npp.2014.111

Cohen, C., Perrault, G., Griebel, G., & Soubrié, P. (2004). Nicotine-associated cues maintain

nicotine-seeking behavior in rats several weeks after nicotine withdrawal: Reversal by

the cannabinoid (CB1) receptor antagonist, rimonabant (SR141716).

Neuropsychopharmacology, 30(1), 145-155. doi: 10.1038/sj.npp.1300541

Cosgrove, K. P., Batis, J., Bois, F., Maciejewski, P. K., Esterlis, I., Kloczynski, T., . . . Staley,

J. K. (2009). beta2-Nicotinic acetylcholine receptor availability during acute and

prolonged abstinence from tobacco smoking. Archives of General Psychiatry, 66(6),

666-676. doi: 10.1001/archgenpsychiatry.2009.41

Cunha, C., Brambilla, R., & Thomas, K. L. (2010). A simple role for BDNF in learning and

memory? Frontiers in Molecular Neuroscience, 3, 1. doi: 10.3389/neuro.02.001.2010

D'Souza, M. S., & Markou, A. (2011). Neuronal mechanisms underlying development of

nicotine dependence: implications for novel smoking-cessation treatments. Addiction

science & clinical practice, 6(1), 4-16.

Damez-Werno, D., LaPlant, Q., Sun, H., Scobie, K. N., Dietz, D. M., Walker, I. M., . . . Nestler,

E. J. (2012). Drug experience epigenetically primes Fosb gene inducibility in rat

nucleus accumbens. Journal of Neuroscience, 32(30), 10267-10272. doi:

10.1523/jneurosci.1290-12.2012 del Olmo, N., Miguens, M., Higuera-Matas, A., Torres, I., Garcia-Lecumberri, C., Solis, J. M.,

& Ambrosio, E. (2006). Enhancement of hippocampal long-term potentiation induced

by cocaine self-administration is maintained during the extinction of this behavior.

Brain Research, 1116(1), 120-126. doi: 10.1016/j.brainres.2006.07.001 120

Deroche-Gamonet, V., Belin, D., & Piazza, P. V. (2004). Evidence for addiction-like behavior

in the rat. Science, 305(5686), 1014-1017. doi: 10.1126/science.1099020

Di Chiara, G. (1999). Drug addiction as dopamine-dependent associative learning disorder.

European Journal of Pharmacology, 375(1–3), 13-30. doi: 10.1016/S0014-

2999(99)00372-6

Diergaarde, L., de Vries, W., Raaso, H., Schoffelmeer, A. N., & De Vries, T. J. (2008).

Contextual renewal of nicotine seeking in rats and its suppression by the cannabinoid-

1 receptor antagonist Rimonabant (SR141716A). Neuropharmacology, 55(5), 712-716.

doi: 10.1016/j.neuropharm.2008.06.003

Donny, E. C., Caggiula, A. R., Mielke, M. M., Jacobs, K. S., Rose, C., & Sved, A. F. (1998).

Acquisition of nicotine self-administration in rats: The effects of dose, feeding

schedule, and drug contingency. Psychopharmacology, 136(1), 83-90. doi:

10.1007/s002130050542

Engert, F., & Bonhoeffer, T. (1999). Dendritic spine changes associated with hippocampal

long-term synaptic plasticity. Nature, 399(6731), 66-70. doi: 10.1038/19978

Euston, D. R., Gruber, A. J., & McNaughton, B. L. (2012). The Role of Medial Prefrontal

Cortex in Memory and Decision Making. Neuron, 76(6), 1057-1070. doi:

10.1016/j.neuron.2012.12.002

Everitt, B. J., & Robbins, T. W. (2005). Neural systems of reinforcement for drug addiction:

from actions to habits to compulsion. Nature Neuroscience, 8(11), 1481-1489. doi:

10.1038/nn1579 121

Falkenberg, K. J., & Johnstone, R. W. (2014). Histone deacetylases and their inhibitors in

cancer, neurological diseases and immune disorders. Nature Reviews Drug Discovery,

13(9), 673-691. doi: 10.1038/nrd4360

Feng, J., Wilkinson, M., Liu, X., Purushothaman, I., Ferguson, D., Vialou, V., . . . Shen, L.

(2014). Chronic cocaine-regulated epigenomic changes in mouse nucleus accumbens.

Genome Biology, 15(4), R65-R65. doi: 10.1186/gb-2014-15-4-r65

Fischer, A., Sananbenesi, F., Pang, P. T., Lu, B., & Tsai, L. H. (2005). Opposing roles of

transient and prolonged expression of p25 in synaptic plasticity and hippocampus-

dependent memory. Neuron, 48(5), 825-838. doi: 10.1016/j.neuron.2005.10.033

Fischer, A., Sananbenesi, F., Schrick, C., Spiess, J., & Radulovic, J. (2002). Cyclin-dependent

kinase 5 is required for associative learning. Journal of Neuroscience, 22(9), 3700-

3707. doi: 20026286

Fischer, A., Sananbenesi, F., Schrick, C., Spiess, J., & Radulovic, J. (2003). Regulation of

contextual fear conditioning by baseline and inducible septo-hippocampal cyclin-

dependent kinase 5. Neuropharmacology, 44(8), 1089-1099. doi: 10.1016/S0028-

3908(03)00102-3

Fischer, A., Sananbenesi, F., Wang, X., Dobbin, M., & Tsai, L.-H. (2007). Recovery of

learning and memory is associated with chromatin remodelling. Nature, 447(7141),

178-182. doi: 10.1038/nature05772

Fole, A., Miguens, M., Higuera-Matas, A., Alguacil, L. F., Ambrosio, E., & Del Olmo, N.

(2014). Cocaine facilitates protein synthesis-dependent LTP: the role of metabotropic

glutamate receptors. European Neuropsychopharmacology, 24(4), 621-629. doi:

10.1016/j.euroneuro.2013.10.013 122

Freeman, W. M., Patel, K. M., Brucklacher, R. M., Lull, M. E., Erwin, M., Morgan, D., . . .

Vrana, K. E. (2008). Persistent alterations in mesolimbic gene expression with

abstinence from cocaine self-administration. Neuropsychopharmacology, 33(8), 1807-

1817. doi: 10.1038/sj.npp.1301577

Ghasemzadeh, M. B., Vasudevan, P., Mueller, C., Seubert, C., & Mantsch, J. R. (2009).

Neuroadaptations in the cellular and postsynaptic group 1 metabotropic glutamate

receptor mGluR5 and Homer proteins following extinction of cocaine self-

administration. Neuroscience Letters, 452(2), 167-171. doi:

10.1016/j.neulet.2008.12.028

Gipson, C. D., Reissner, K. J., Kupchik, Y. M., Smith, A. C. W., Stankeviciute, N., Hensley-

Simon, M. E., & Kalivas, P. W. (2013). Reinstatement of nicotine seeking is mediated

by glutamatergic plasticity. Proceedings of the National Academy of Sciences, 110(22),

9124-9129. doi: 10.1073/pnas.1220591110

Gozen, O., Balkan, B., Yildirim, E., Koylu, E. O., & Pogun, S. (2013). The epigenetic effect

of nicotine on dopamine D1 receptor expression in rat prefrontal cortex. Synapse, 67(9),

545-552. doi: 10.1002/syn.21659

Graff, J., & Tsai, L. H. (2013a). Histone acetylation: molecular mnemonics on the chromatin.

Nature Reviews Neuroscience, 14(2), 97-111. doi: 10.1038/nrn3427

Graff, J., & Tsai, L. H. (2013b). The potential of HDAC inhibitors as cognitive enhancers.

Annual Review of Pharmacology and Toxicology, 53, 311-330. doi: 10.1146/annurev-

pharmtox-011112-140216

Grimm, J. W., Hope, B. T., Wise, R. A., & Shaham, Y. (2001). Incubation of cocaine craving

after withdrawal. Nature, 412(6843), 141-142. doi: 10.1038/35084134 123

Grosshans, D. R., Clayton, D. A., Coultrap, S. J., & Browning, M. D. (2002). LTP leads to

rapid surface expression of NMDA but not AMPA receptors in adult rat CA1. Nature

Neuroscience, 5(1), 27-33. doi: 10.1038/nn779

Grunstein, M. (1997). Histone acetylation in chromatin structure and transcription. Nature,

389(6649), 349-352.

Guan, J. S., Haggarty, S. J., Giacometti, E., Dannenberg, J. H., Joseph, N., Gao, J., . . . Tsai, L.

H. (2009). HDAC2 negatively regulates memory formation and synaptic plasticity.

Nature, 459(7243), 55-60. doi: 10.1038/nature07925

Hawasli, A. H., Benavides, D. R., Nguyen, C., Kansy, J. W., Hayashi, K., Chambon, P., . . .

Bibb, J. A. (2007). Cyclin-dependent kinase 5 governs learning and synaptic plasticity

via control of NMDAR degradation. Nature Neuroscience, 10(7), 880-886. doi:

10.1038/nn1914

Hawkins, J., Hollingworth, W., & Campbell, R. (2010). Long-term smoking relapse: a study

using the british household panel survey. Nicotine & Tobacco Research, 12(12), 1228-

1235. doi: 10.1093/ntr/ntq175

Hemby, S. E., Co, C., Koves, T. R., Smith, J. E., & Dworkin, S. I. (1997). Differences in

extracellular dopamine concentrations in the nucleus accumbens during response-

dependent and response-independent cocaine administration in the rat.

Psychopharmacology, 133(1), 7-16. doi: 10.1007/s002130050365

Hu, M., Liu, Q. S., Chang, K. T., & Berg, D. K. (2002). Nicotinic regulation of CREB

activation in hippocampal neurons by glutamatergic and nonglutamatergic pathways.

Molecular and Cellular Neuroscience, 21(4), 616-625. doi: 10.1006/mcne.2002.1202 124

Huang, C. C., Lin, H. J., & Hsu, K. S. (2007). Repeated cocaine administration promotes long-

term potentiation induction in rat medial prefrontal cortex. Cerebral Cortex, 17(8),

1877-1888. doi: 10.1093/cercor/bhl096

Huang, W., & Li, M. D. (2009). Differential allelic expression of dopamine D1 receptor gene

(DRD1) is modulated by microRNA miR-504. Biological Psychiatry, 65(8), 702-705.

doi: 10.1016/j.biopsych.2008.11.024

Inoue, Y., Yao, L., Hopf, F. W., Fan, P., Jiang, Z., Bonci, A., & Diamond, I. (2007). Nicotine

and ethanol activate protein kinase A synergistically via G(i) betagamma subunits in

nucleus accumbens/ventral tegmental cocultures: the role of dopamine D(1)/D(2) and

adenosine A(2A) receptors. Journal of Pharmacology and Experimental Therapeutics,

322(1), 23-29. doi: 10.1124/jpet.107.120675

Intlekofer, K. A., Berchtold, N. C., Malvaez, M., Carlos, A. J., McQuown, S. C., Cunningham,

M. J., . . . Cotman, C. W. (2013). Exercise and sodium butyrate transform a subthreshold

learning event into long-term memory via a brain-derived neurotrophic factor-

dependent mechanism. Neuropsychopharmacology, 38(10), 2027-2034. doi:

10.1038/npp.2013.104

Itzhak, Y., Liddie, S., & Anderson, K. L. (2013). Sodium butyrate-induced histone acetylation

strengthens the expression of cocaine-associated contextual memory. Neurobiology of

Learning and Memory, 102, 34-42. doi: 10.1016/j.nlm.2013.03.007

Janes, A. C., Frederick, B., Richardt, S., Burbridge, C., Merlo-Pich, E., Renshaw, P. F., . . .

Kaufman, M. J. (2009). Brain fMRI reactivity to smoking-related images before and

during extended smoking abstinence. Experimental and Clinical Psychopharmacology,

17(6), 365-373. doi: 10.1037/a0017797 125

Jiang, X., Zhou, J., Mash, D. C., Marini, A. M., & Lipsky, R. H. (2009). Human BDNF

isoforms are differentially expressed in cocaine addicts and are sorted to the regulated

secretory pathway independent of the Met66 substitution. NeuroMolecular Medicine,

11(1), 1-12. doi: 10.1007/s12017-008-8051-0

Kalivas, P. W., Peters, J., & Knackstedt, L. (2006). Animal models and brain circuits in drug

addiction. Molecular Interventions, 6(6), 339-344. doi: 10.1038/sj.npp.1301220

Kandel, E. R. (2012). The molecular biology of memory: cAMP, PKA, CRE, CREB-1, CREB-

2, and CPEB. Molecular Brain, 5, 14. doi: 10.1186/1756-6606-5-14

Kauer, J. A., & Malenka, R. C. (2007). Synaptic plasticity and addiction. Nature Reviews

Neuroscience, 8(11), 844-858. doi: 10.1038/nrn2234

Kelley, A. E. (2004). Memory and Addiction. Neuron, 44(1), 161-179. doi:

10.1016/j.neuron.2004.09.016

Kent, W. J. (2002). BLAT--the BLAST-like alignment tool. Genome Research, 12(4), 656-

664. doi: 10.1101/gr.229202

Kilgore, M., Miller, C. A., Fass, D. M., Hennig, K. M., Haggarty, S. J., Sweatt, J. D., &

Rumbaugh, G. (2010). Inhibitors of class 1 histone deacetylases reverse contextual

memory deficits in a mouse model of Alzheimer's disease. Neuropsychopharmacology,

35(4), 870-880. doi: 10.1038/npp.2009.197

Kivinummi, T., Kaste, K., Rantamaki, T., Castren, E., & Ahtee, L. (2011). Alterations in BDNF

and phospho-CREB levels following chronic oral nicotine treatment and its withdrawal

in dopaminergic brain areas of mice. Neuroscience Letters, 491(2), 108-112. doi:

10.1016/j.neulet.2011.01.015 126

Knackstedt, L. A., Moussawi, K., Lalumiere, R., Schwendt, M., Klugmann, M., & Kalivas, P.

W. (2010). Extinction Training after Cocaine Self-Administration Induces

Glutamatergic Plasticity to Inhibit Cocaine Seeking. Journal of Neuroscience, 30(23),

7984-7992. doi: 10.1523/jneurosci.1244-10.2010

Koo, J. W., Mazei-Robison, M. S., LaPlant, Q., Egervari, G., Braunscheidel, K. M., Adank, D.

N., . . . Nestler, E. J. (2015). Epigenetic basis of opiate suppression of Bdnf gene

expression in the ventral tegmental area. Nature Neuroscience, 18(3), 415-422. doi:

10.1038/nn.3932

Kornberg, R. D. (1977). Structure of Chromatin. Annual Review of Biochemistry, 46(1), 931-

954. doi: doi:10.1146/annurev.bi.46.070177.004435

Korzus, E., Rosenfeld, M. G., & Mayford, M. (2004). CBP histone acetyltransferase activity is

a critical component of memory consolidation. Neuron, 42(6), 961-972. doi:

10.1016/j.neuron.2004.06.002

Koshibu, K., Graff, J., Beullens, M., Heitz, F. D., Berchtold, D., Russig, H., . . . Mansuy, I. M.

(2009). Protein phosphatase 1 regulates the histone code for long-term memory.

Journal of Neuroscience, 29(41), 13079-13089. doi: 10.1523/jneurosci.3610-09.2009

Kouzarides, T. (2007). Chromatin modifications and their function. Cell, 128(4), 693-705. doi:

10.1016/j.cell.2007.02.005

Kumar, A., Choi, K.-H., Renthal, W., Tsankova, N. M., Theobald, D. E. H., Truong, H.-T., . .

. Nestler, E. J. (2005). Chromatin Remodeling Is a Key Mechanism Underlying

Cocaine-Induced Plasticity in Striatum. Neuron, 48(2), 303-314. doi:

10.1016/j.neuron.2005.09.023 127

Kuriyama, K., Honma, M., Soshi, T., Fujii, T., & Kim, Y. (2011). Effect of D-cycloserine and

valproic acid on the extinction of reinstated fear-conditioned responses and habituation

of fear conditioning in healthy humans: a randomized controlled trial.

Psychopharmacology, 218(3), 589-597. doi: 10.1007/s00213-011-2353-x

Kuriyama, K., Honma, M., Yoshiike, T., & Kim, Y. (2013). Valproic acid but not d-cycloserine

facilitates sleep-dependent offline learning of extinction and habituation of conditioned

fear in humans. Neuropharmacology, 64, 424-431. doi:

10.1016/j.neuropharm.2012.07.045

Kwako, L. E., Spagnolo, P. A., Schwandt, M. L., Thorsell, A., George, D. T., Momenan, R., .

. . Heilig, M. (2015). The Corticotropin Releasing Hormone-1 (CRH1) Receptor

Antagonist Pexacerfont in Alcohol Dependence: A Randomized Controlled

Experimental Medicine Study. Neuropsychopharmacology, 40(5), 1053-1063. doi:

10.1038/npp.2014.306

Lai, K.-O., & Ip, N. Y. (2009). Recent advances in understanding the roles of Cdk5 in synaptic

plasticity. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1792(8),

741-745. doi: 10.1016/j.bbadis.2009.05.001

LaLumiere, R. T., Niehoff, K. E., & Kalivas, P. W. (2010). The infralimbic cortex regulates

the consolidation of extinction after cocaine self-administration. Learning & Memory,

17(4), 168-175. doi: 10.1101/lm.1576810

Lambe, E. K., Picciotto, M. R., & Aghajanian, G. K. (2003). Nicotine induces glutamate release

from thalamocortical terminals in prefrontal cortex. Neuropsychopharmacology, 28(2),

216-225. doi: 10.1038/sj.npp.1300032 128

Lattal, K. M., Barrett, R. M., & Wood, M. A. (2007). Systemic or intrahippocampal delivery

of histone deacetylase inhibitors facilitates fear extinction. Behavioral Neuroscience,

121(5), 1125-1131. doi: 10.1037/0735-7044.121.5.1125

Lattal, K. M., & Wood, M. A. (2013). Epigenetics and persistent memory: implications for

reconsolidation and silent extinction beyond the zero. Nature Neuroscience, 16(2), 124-

129. doi: 10.1038/nn.3302

Laurent, V., & Westbrook, R. F. (2009). Inactivation of the infralimbic but not the prelimbic

cortex impairs consolidation and retrieval of fear extinction. Learning & Memory,

16(9), 520-529. doi: 10.1101/lm.1474609

Levenson, J. M., O'Riordan, K. J., Brown, K. D., Trinh, M. A., Molfese, D. L., & Sweatt, J. D.

(2004). Regulation of histone acetylation during memory formation in the

hippocampus. Journal of Biological Chemistry, 279(39), 40545-40559. doi:

10.1074/jbc.M402229200

Levine, A., Huang, Y., Drisaldi, B., Griffin, E. A., Jr., Pollak, D. D., Xu, S., . . . Kandel, E. R.

(2011). Molecular mechanism for a gateway drug: epigenetic changes initiated by

nicotine prime gene expression by cocaine. Science Translational Medicine, 3(107),

107ra109. doi: 10.1126/scitranslmed.3003062

Li, B.-S., Sun, M.-K., Zhang, L., Takahashi, S., Ma, W., Vinade, L., . . . Pant, H. C. (2001).

Regulation of NMDA receptors by cyclin-dependent kinase-5. Proceedings of the

National Academy of Sciences of the United States of America, 98(22), 12742-12747.

doi: 10.1073/pnas.211428098

Li, F. Q., Xue, Y. X., Wang, J. S., Fang, Q., Li, Y. Q., Zhu, W. L., . . . Lu, L. (2010). Basolateral

amygdala cdk5 activity mediates consolidation and reconsolidation of memories for 129

cocaine cues. Journal of Neuroscience, 30(31), 10351-10359. doi:

10.1523/jneurosci.2112-10.2010

Li, X., Rubio, F. J., Zeric, T., Bossert, J. M., Kambhampati, S., Cates, H. M., . . . Shaham, Y.

(2015). Incubation of methamphetamine craving is associated with selective increases

in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-

activated fos-expressing dorsal striatal neurons. Journal of Neuroscience, 35(21), 8232-

8244. doi: 10.1523/JNEUROSCI.1022-15.2015

Liechti, M. E., Lhuillier, L., Kaupmann, K., & Markou, A. (2007). Metabotropic glutamate 2/3

receptors in the ventral tegmental area and the nucleus accumbens shell are involved in

behaviors relating to nicotine dependence. Journal of Neuroscience, 27(34), 9077-

9085. doi: 10.1523/jneurosci.1766-07.2007

Liu, X., Caggiula, A. R., Yee, S. K., Nobuta, H., Poland, R. E., & Pechnick, R. N. (2006).

Reinstatement of nicotine-seeking behavior by drug-associated stimuli after extinction

in rats. Psychopharmacology, 184(3-4), 417-425. doi: 10.1007/s00213-005-0134-0

Lomo, T. (1966). Frequency potentiation of excitatory synaptic activity in the dentate area of

the hippocampal formation. Acta Physiologica, 68(277), 128.

Lopez-Quintero, C., Hasin, D. S., de los Cobos, J. P., Pines, A., Wang, S., Grant, B. F., &

Blanco, C. (2011). Probability and predictors of remission from life-time nicotine,

alcohol, cannabis or cocaine dependence: results from the National Epidemiologic

Survey on Alcohol and Related Conditions. Addiction, 106(3), 657-669. doi:

10.1111/j.1360-0443.2010.03194.x 130

Lu, L., Grimm, J. W., Hope, B. T., & Shaham, Y. (2004). Incubation of cocaine craving after

withdrawal: a review of preclinical data. Neuropharmacology, 47, Supplement 1, 214-

226. doi: 10.1016/j.neuropharm.2004.06.027

Lu, W.-Y., Man, H.-Y., Ju, W., Trimble, W. S., MacDonald, J. F., & Wang, Y. T. (2001).

Activation of Synaptic NMDA Receptors Induces Membrane Insertion of New AMPA

Receptors and LTP in Cultured Hippocampal Neurons. Neuron, 29(1), 243-254. doi:

10.1016/S0896-6273(01)00194-5

Lubin, F. D., & Sweatt, J. D. (2007). The IκB Kinase Regulates Chromatin Structure during

Reconsolidation of Conditioned Fear Memories. Neuron, 55(6), 942-957. doi:

10.1016/j.neuron.2007.07.039

Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., & Richmond, T. J. (1997). Crystal

structure of the nucleosome core particle at 2.8 A resolution. Nature, 389(6648), 251-

260. doi: 10.1038/38444

Macnamara, C. L., Holmes, N. M., Westbrook, R. F., & Clemens, K. J. (2016). Varenicline

impairs extinction and enhances reinstatement across repeated cycles of nicotine self-

administration in rats. Neuropharmacology, 105, 463-470. doi:

10.1016/j.neuropharm.2016.02.023

Madsen, H. B., Brown, R. M., & Lawrence, A. J. (2012). Neuroplasticity in addiction: cellular

and transcriptional perspectives. Frontiers in Molecular Neuroscience, 5, 99. doi:

10.3389/fnmol.2012.00099

Malvaez, M., McQuown, S. C., Rogge, G. A., Astarabadi, M., Jacques, V., Carreiro, S., . . .

Wood, M. A. (2013). HDAC3-selective inhibitor enhances extinction of cocaine- 131

seeking behavior in a persistent manner. Proceedings of the National Academy of

Sciences, 110(7), 2647-2652. doi: 10.1073/pnas.1213364110

Malvaez, M., Mhillaj, E., Matheos, D. P., Palmery, M., & Wood, M. A. (2011). CBP in the

nucleus accumbens regulates cocaine-induced histone acetylation and is critical for

cocaine-associated behaviors. Journal of Neuroscience, 31(47), 16941-16948. doi:

10.1523/JNEUROSCI.2747-11.2011

Malvaez, M., Sanchis-Segura, C., Vo, D., Lattal, K. M., & Wood, M. A. (2010). Modulation

of chromatin modification facilitates extinction of cocaine-induced conditioned place

preference. Biological Psychiatry, 67(1), 36-43. doi: 10.1016/j.biopsych.2009.07.032

Martin, S. J., Grimwood, P. D., & Morris, R. G. (2000). Synaptic plasticity and memory: an

evaluation of the hypothesis. Annual Review of Neuroscience, 23, 649-711. doi:

10.1146/annurev.neuro.23.1.649

Martin, T. A., Jayanthi, S., McCoy, M. T., Brannock, C., Ladenheim, B., Garrett, T., . . . Cadet,

J. L. (2012). Methamphetamine causes differential alterations in gene expression and

patterns of histone acetylation/hypoacetylation in the rat nucleus accumbens. PLoS

One, 7(3), e34236. doi: 10.1371/journal.pone.0034236

Massart, R., Barnea, R., Dikshtein, Y., Suderman, M., Meir, O., Hallett, M., . . . Yadid, G.

(2015). Role of DNA methylation in the nucleus accumbens in incubation of cocaine

craving. Journal of Neuroscience, 35(21), 8042-8058. doi:

10.1523/JNEUROSCI.3053-14.2015

McNally, G. P. (2014). Extinction of drug seeking: Neural circuits and approaches to

augmentation. Neuropharmacology, 76 Pt B, 528-532. doi:

10.1016/j.neuropharm.2013.06.007 132

McQuown, S. C., Barrett, R. M., Matheos, D. P., Post, R. J., Rogge, G. A., Alenghat, T., . . .

Wood, M. A. (2011). HDAC3 is a critical negative regulator of long-term memory

formation. Journal of Neuroscience, 31(2), 764-774. doi: 10.1523/JNEUROSCI.5052-

10.2011

McQuown, S. C., & Wood, M. A. (2011). HDAC3 and the molecular brake pad hypothesis.

Neurobiology of Learning and Memory, 96(1), 27-34. doi: 10.1016/j.nlm.2011.04.002

Mercer, T. R., Dinger, M. E., Sunkin, S. M., Mehler, M. F., & Mattick, J. S. (2008). Specific

expression of long noncoding RNAs in the mouse brain. Proceedings of the National

Academy of Sciences, 105(2), 716-721. doi: 10.1073/pnas.0706729105

Meyer, H. C., & Bucci, D. J. (2014). The contribution of medial prefrontal cortical regions to

conditioned inhibition. Behavioral Neuroscience, 128(6), 644-653. doi:

10.1037/bne0000023

Michelhaugh, S. K., Lipovich, L., Blythe, J., Jia, H., Kapatos, G., & Bannon, M. J. (2011).

Mining Affymetrix microarray data for long non-coding RNAs: altered expression in

the nucleus accumbens of heroin abusers. Journal of Neurochemistry, 116(3), 459-466.

doi: 10.1111/j.1471-4159.2010.07126.x

Modarresi, F., Faghihi, M. A., Lopez-Toledano, M. A., Fatemi, R. P., Magistri, M., Brothers,

S. P., . . . Wahlestedt, C. (2012). Inhibition of natural antisense transcripts in vivo results

in gene-specific transcriptional upregulation. Nature Biotechnology, 30(5), 453-459.

doi: 10.1038/nbt.2158

Myers, K. M., & Carlezon, W. A. (2010). Extinction of drug- and withdrawal-paired cues in

animal models: Relevance to the treatment of addiction. Neuroscience and

Biobehavioral Reviews, 35(2), 285-302. doi: 10.1016/j.neubiorev.2010.01.011 133

Nakayama, H., Numakawa, T., Ikeuchi, T., & Hatanaka, H. (2001). Nicotine-induced

phosphorylation of extracellular signal-regulated protein kinase and CREB in PC12h

cells. Journal of Neurochemistry, 79(3), 489-498. doi: 10.1046/j.1471-

4159.2001.00602.x

Nestler, E. J. (2014). Epigenetic mechanisms of drug addiction. Neuropharmacology, 76, Part

B, 259-268. doi: 10.1016/j.neuropharm.2013.04.004

Niaura, R., Abrams, D., Demuth, B., Pinto, R., & Monti, P. (1989). Responses to smoking-

related stimuli and early relapse to smoking. Addictive Behaviors, 14(4), 419-428. doi:

10.1016/0306-4603(89)90029-4

O'Brien, C. P., & Gardner, E. L. (2005). Critical assessment of how to study addiction and its

treatment: human and non-human animal models. Pharmacology & Therapeutics,

108(1), 18-58. doi: 10.1016/j.pharmthera.2005.06.018

Otis, J. M., Fitzgerald, M. K., & Mueller, D. (2014). Infralimbic BDNF/TrkB enhancement of

GluN2B currents facilitates extinction of a cocaine-conditioned place preference.

Journal of Neuroscience, 34(17), 6057-6064. doi: 10.1523/JNEUROSCI.4980-13.2014

Pandey, S. C., Ugale, R., Zhang, H., Tang, L., & Prakash, A. (2008). Brain chromatin

remodeling: a novel mechanism of alcoholism. Journal of Neuroscience, 28(14), 3729-

3737. doi: 10.1523/jneurosci.5731-07.2008

Panlilio, L. V., & Goldberg, S. R. (2007). Self-administration of drugs in animals and humans

as a model and an investigative tool. Addiction, 102(12), 1863-1870. doi:

10.1111/j.1360-0443.2007.02011.x 134

Pastor, V., Host, L., Zwiller, J., & Bernabeu, R. (2011). Histone deacetylase inhibition

decreases preference without affecting aversion for nicotine. Journal of

Neurochemistry. doi: 10.1111/j.1471-4159.2010.07149.x

Paterson, N. E., Froestl, W., & Markou, A. (2004). Repeated Administration of the GABAB

Receptor Agonist CGP44532 Decreased Nicotine Self-Administration, and Acute

Administration Decreased Cue-Induced Reinstatement of Nicotine-Seeking in Rats.

Neuropsychopharmacology, 30(1), 119-128.

Pavlov, I. P. (1927). Conditioned Reflexes. Oxford, UK: Oxford University Press.

Paxinos, G., & Watson, C. (2005). The Rat Brain in Stereotaxic Coordinates (5th ed.): Elsevier

Academic Press.

Peixoto, L., & Abel, T. (2013). The Role of Histone Acetylation in Memory Formation and

Cognitive Impairments. Neuropsychopharmacology, 38(1), 62-76. doi:

10.1038/npp.2012.86

Peters, J., Dieppa-Perea, L. M., Melendez, L. M., & Quirk, G. J. (2010). Induction of fear

extinction with hippocampal-infralimbic BDNF. Science, 328(5983), 1288-1290. doi:

10.1126/science.1186909

Peters, J., Kalivas, P. W., & Quirk, G. J. (2009). Extinction circuits for fear and addiction

overlap in prefrontal cortex. Learning & Memory, 16(5), 279-288. doi:

10.1101/lm.1041309

Peters, J., LaLumiere, R. T., & Kalivas, P. W. (2008). Infralimbic prefrontal cortex is

responsible for inhibiting cocaine seeking in extinguished rats. Journal of

Neuroscience, 28(23), 6046-6053. doi: 10.1523/jneurosci.1045-08.2008 135

Peterson, A. B., Abel, J. M., & Lynch, W. J. (2014). Dose-dependent effects of wheel running

on cocaine-seeking and prefrontal cortex Bdnf exon IV expression in rats.

Psychopharmacology, 231(7), 1305-1314. doi: 10.1007/s00213-013-3321-4

Plattner, F., Hernandez, A., Kistler, T. M., Pozo, K., Zhong, P., Yuen, E. Y., . . . Bibb, J. A.

(2014). Memory enhancement by targeting Cdk5 regulation of NR2B. Neuron, 81(5),

1070-1083. doi: 10.1016/j.neuron.2014.01.022

Ploense, K. L., Kerstetter, K. A., Wade, M. A., Woodward, N. C., Maliniak, D., Reyes, M., . .

. Kippin, T. E. (2013). Exposure to histone deacetylase inhibitors during Pavlovian

conditioning enhances subsequent cue-induced reinstatement of operant behavior.

Behavioural Pharmacology, 24(3), 164-171. doi: 10.1097/FBP.0b013e32836104ea

Portero-Tresserra, M., Marti-Nicolovius, M., Guillazo-Blanch, G., Boadas-Vaello, P., & Vale-

Martinez, A. (2013). D-cycloserine in the basolateral amygdala prevents extinction and

enhances reconsolidation of odor-reward associative learning in rats. Neurobiology of

Learning and Memory, 100, 1-11. doi: 10.1016/j.nlm.2012.11.003

Rai, M., Soragni, E., Chou, C. J., Barnes, G., Jones, S., Rusche, J. R., . . . Pandolfo, M. (2010).

Two new pimelic diphenylamide HDAC inhibitors induce sustained frataxin

upregulation in cells from Friedreich's ataxia patients and in a mouse model. PLoS One,

5(1), e8825. doi: 10.1371/journal.pone.0008825

Raybuck, J. D., McCleery, E. J., Cunningham, C. L., Wood, M. A., & Lattal, K. M. (2013).

The histone deacetylase inhibitor sodium butyrate modulates acquisition and extinction

of cocaine-induced conditioned place preference. Pharmacology Biochemistry and

Behavior, 106, 109-116. doi: 10.1016/j.pbb.2013.02.009 136

Reimers, J. M., Loweth, J. A., & Wolf, M. E. (2014). BDNF contributes to both rapid and

homeostatic alterations in AMPA receptor surface expression in nucleus accumbens

medium spiny neurons. Journal of Neuroscience, 39(7), 1159-1169. doi:

10.1111/ejn.12422

Renthal, W., Kumar, A., Xiao, G., Wilkinson, M., Covington, H. E., 3rd, Maze, I., . . . Nestler,

E. J. (2009). Genome-wide analysis of chromatin regulation by cocaine reveals a role

for sirtuins. Neuron, 62(3), 335-348. doi: 10.1016/j.neuron.2009.03.026

Roberts, T. C., Morris, K. V., & Wood, M. J. (2014). The role of long non-coding RNAs in

neurodevelopment, brain function and neurological disease. Philosophical

Transactions of the Royal Society of London B Biological Sciences, 369(1652). doi:

10.1098/rstb.2013.0507

Robinson, T. E., & Kolb, B. (1999). Alterations in the morphology of dendrites and dendritic

spines in the nucleus accumbens and prefrontal cortex following repeated treatment

with amphetamine or cocaine. Journal of Neuroscience, 11(5), 1598-1604.

Robison, A. J., & Nestler, E. J. (2011). Transcriptional and epigenetic mechanisms of

addiction. Nature Reviews Neuroscience, 12(11), 623-637. doi: 10.1038/nrn3111

Rogge, G. A., Singh, H., Dang, R., & Wood, M. A. (2013). HDAC3 Is a Negative Regulator

of Cocaine-Context-Associated Memory Formation. Journal of Neuroscience, 33(15),

6623-6632. doi: 10.1523/jneurosci.4472-12.2013

Romieu, P., Deschatrettes, E., Host, L., Gobaille, S., Sandner, G., & Zwiller, J. (2011). The

inhibition of histone deacetylases reduces the reinstatement of cocaine-seeking

behavior in rats. Current Neuropharmacology, 9(1), 21-25. doi:

10.2174/157015911795017317 137

Romieu, P., Host, L., Gobaille, S., Sandner, G., Aunis, D., & Zwiller, J. (2008). Histone

deacetylase inhibitors decrease cocaine but not sucrose self-administration in rats.

Journal of Neuroscience, 28(38), 9342-9348. doi: 10.1523/JNEUROSCI.0379-08.2008

Rosas-Vidal, L. E., Do-Monte, F. H., Sotres-Bayon, F., & Quirk, G. J. (2014). Hippocampal--

prefrontal BDNF and memory for fear extinction. Neuropsychopharmacology, 39(9),

2161-2169. doi: 10.1038/npp.2014.64

Rumbaugh, G., Sillivan, S. E., Ozkan, E. D., Rojas, C. S., Hubbs, C. R., Aceti, M., . . . Miller,

C. A. (2015). Pharmacological Selectivity Within Class I Histone Deacetylases Predicts

Effects on Synaptic Function and Memory Rescue. Neuropsychopharmacology. doi:

10.1038/npp.2015.93

Saayman, S., Ackley, A., Turner, A.-M. W., Famiglietti, M., Bosque, A., Clemson, M., . . .

Morris, K. V. (2014). An HIV-Encoded Antisense Long Noncoding RNA

Epigenetically Regulates Viral Transcription. Molecular Therapy, 22(6), 1164-1175.

doi: 10.1038/mt.2014.29

Sadri-Vakili, G., Kumaresan, V., Schmidt, H. D., Famous, K. R., Chawla, P., Vassoler, F. M.,

. . . Cha, J. H. (2010). Cocaine-induced chromatin remodeling increases brain-derived

neurotrophic factor transcription in the rat medial prefrontal cortex, which alters the

reinforcing efficacy of cocaine. Journal of Neuroscience, 30(35), 11735-11744. doi:

10.1523/jneurosci.2328-10.2010

Sananbenesi, F., Fischer, A., Wang, X., Schrick, C., Neve, R., Radulovic, J., & Tsai, L.-H.

(2007). A hippocampal Cdk5 pathway regulates extinction of contextual fear. Nature

Neuroscience, 10(8), 1012-1019. doi: 10.1038/nn1943 138

Sanchis-Segura, C., Lopez-Atalaya, J. P., & Barco, A. (2009). Selective boosting of

transcriptional and behavioral responses to drugs of abuse by histone deacetylase

inhibition. Neuropsychopharmacology, 34(13), 2642-2654. doi: 10.1038/npp.2009.125

Sanchis-Segura, C., & Spanagel, R. (2006). Behavioural assessment of drug reinforcement and

addictive features in rodents: An overview. Addiction Biology, 11(1), 2-38. doi:

10.1111/j.1369-1600.2006.00012.x

Santa Ana, E. J., Rounsaville, B. J., Frankforter, T. L., Nich, C., Babuscio, T., Poling, J., . . .

Carroll, K. M. (2009). d-Cycloserine Attenuates Reactivity to Smoking Cues in

Nicotine Dependent Smokers: A Pilot Investigation. Drug and Alcohol Dependence,

104(3), 220-227. doi: 10.1016/j.drugalcdep.2009.04.023

Schmidt, H. D., Sangrey, G. R., Darnell, S. B., Schassburger, R. L., Cha, J. H., Pierce, R. C.,

& Sadri-Vakili, G. (2012). Increased brain-derived neurotrophic factor (BDNF)

expression in the ventral tegmental area during cocaine abstinence is associated with

increased histone acetylation at BDNF exon I-containing promoters. Journal of

Neurochemistry, 120(2), 202-209. doi: 10.1111/j.1471-4159.2011.07571.x

Schnoll, R. A., & Lerman, C. (2006). Current and emerging pharmacotherapies for treating

tobacco dependence. Expert Opinion on Emerging Drugs, 11(3), 429-444. doi:

10.1517/14728214.11.3.429

Schroeder, F. A., Penta, K. L., Matevossian, A., Jones, S. R., Konradi, C., Tapper, A. R., &

Akbarian, S. (2008). Drug-induced activation of dopamine D(1) receptor signaling and

inhibition of class I/II histone deacetylase induce chromatin remodeling in reward

circuitry and modulate cocaine-related behaviors. Neuropsychopharmacology, 33(12),

2981-2992. doi: 10.1038/npp.2008.15 139

Schwandt, M. L., Cortes, C. R., Kwako, L. E., George, D. T., Momenan, R., Sinha, R., . . .

Heilig, M. (2016). The CRF1 Antagonist Verucerfont in Anxious Alcohol-Dependent

Women: Translation of Neuroendocrine, But not of Anti-Craving Effects.

Neuropsychopharmacology, 41(12), 2818-2829. doi: 10.1038/npp.2016.61

Self, D. W., Choi, K. H., Simmons, D., Walker, J. R., & Smagula, C. S. (2004). Extinction

training regulates neuroadaptive responses to withdrawal from chronic cocaine self-

administration. Learning & Memory, 11(5), 648-657. doi: 10.1101/lm.81404

Simon-O'Brien, E., Alaux-Cantin, S., Warnault, V., Buttolo, R., Naassila, M., & Vilpoux, C.

(2014). The histone deacetylase inhibitor sodium butyrate decreases excessive ethanol

intake in dependent animals. Addiction Biology. doi: 10.1111/adb.12161

Skinner, B. F. (1938). The behavior of organisms: an experimental analysis. Oxford, England:

Appleton-Century.

Stafford, J. M., & Lattal, K. M. (2011). Is an epigenetic switch the key to persistent extinction?

Neurobiology of Learning and Memory, 96(1), 35-40. doi: 10.1016/j.nlm.2011.04.012

Stafford, J. M., Raybuck, J. D., Ryabinin, A. E., & Lattal, K. M. (2012). Increasing Histone

Acetylation in the Hippocampus-Infralimbic Network Enhances Fear Extinction.

Biological Psychiatry. doi: 10.1016/j.biopsych.2011.12.012

Stefanko, D. P., Barrett, R. M., Ly, A. R., Reolon, G. K., & Wood, M. A. (2009). Modulation

of long-term memory for object recognition via HDAC inhibition. Proceedings of the

National Academy of Sciences, 106(23), 9447-9452. doi: 10.1073/pnas.0903964106

Strahl, B. D., & Allis, C. D. (2000). The language of covalent histone modifications. Nature,

403(6765), 41-45. doi: 10.1038/47412 140

Sun, J., Wang, L., Jiang, B., Hui, B., Lv, Z., & Ma, L. (2008). The effects of sodium butyrate,

an inhibitor of histone deacetylase, on the cocaine- and sucrose-maintained self-

administration in rats. Neuroscience Letters, 441(1), 72-76. doi:

10.1016/j.neulet.2008.05.010

Sutton, M. A., Schmidt, E. F., Choi, K. H., Schad, C. A., Whisler, K., Simmons, D., . . . Self,

D. W. (2003). Extinction-induced upregulation in AMPA receptors reduces cocaine-

seeking behaviour. Nature, 421(6918), 70-75. doi: 10.1038/nature01249

Taylor, J. R., Olausson, P., Quinn, J. J., & Torregrossa, M. M. (2009). Targeting extinction and

reconsolidation mechanisms to combat the impact of drug cues on addiction.

Neuropharmacology, 56(1), 186-195. doi: 10.1016/j.neuropharm.2008.07.027

Timmusk, T., Palm, K., Metsis, M., Reintam, T., Paalme, V., Saarma, M., & Persson, H.

(1993). Multiple promoters direct tissue-specific expression of the rat BDNF gene.

Neuron, 10(3), 475-489. doi: 10.1016/0896-6273(93)90335-O

Todd, T. P., Vurbic, D., & Bouton, M. E. (2014). Behavioral and neurobiological mechanisms

of extinction in Pavlovian and instrumental learning. Neurobiology of Learning and

Memory, 108, 52-64. doi: 10.1016/j.nlm.2013.08.012

Tolwani, R. J., Buckmaster, P. S., Varma, S., Cosgaya, J. M., Wu, Y., Suri, C., & Shooter, E.

M. (2002). BDNF overexpression increases dendrite complexity in hippocampal

dentate gyrus. Neuroscience, 114(3), 795-805.

Torregrossa, M. M., Corlett, P. R., & Taylor, J. R. (2011). Aberrant learning and memory in

addiction. Neurobiology of Learning and Memory, 96(4), 609-623. doi:

10.1016/j.nlm.2011.02.014 141

Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B. C., Remm, M., & Rozen, S.

G. (2012). Primer3--new capabilities and interfaces. Nucleic Acids Research, 40(15),

e115. doi: 10.1093/nar/gks596

Vadaie, N., & Morris, K. V. (2013). Long antisense non-coding RNAs and the epigenetic

regulation of gene expression. Biomolecular Concepts, 4(4), 411-415. doi:

10.1515/bmc-2013-0014

Valles, R., Rocha, A., & Nation, J. R. (2006). The effects of acquisition training schedule on

extinction and reinstatement of cocaine self-administration in male rats. Experimental

and Clinical Psychopharmacology, 14(2), 245-253. doi: 10.1037/1064-1297.14.2.245

Vecsey, C. G., Hawk, J. D., Lattal, K. M., Stein, J. M., Fabian, S. A., Attner, M. A., . . . Wood,

M. A. (2007). Histone deacetylase inhibitors enhance memory and synaptic plasticity

via CREB: CBP-dependent transcriptional activation. Journal of Neuroscience, 27(23),

6128-6140. doi: 10.1523/JNEUROSCI.0296-07.2007

Walters, C. L., Cleck, J. N., Kuo, Y. C., & Blendy, J. A. (2005). Mu-opioid receptor and CREB

activation are required for nicotine reward. Neuron, 46(6), 933-943. doi:

10.1016/j.neuron.2005.05.005

Wang, L., Lv, Z., Hu, Z., Sheng, J., Hui, B., Sun, J., & Ma, L. (2010a). Chronic cocaine-induced

H3 acetylation and transcriptional activation of CaMKIIalpha in the nucleus accumbens

is critical for motivation for drug reinforcement. Neuropsychopharmacology, 35(4),

913-928. doi: 10.1038/npp.2009.193

Wang, R., Zhang, Y., Qing, H., Liu, M., & Yang, P. (2010b). The extinction of morphine-

induced conditioned place preference by histone deacetylase inhibition. Neuroscience

Letters, 483(2), 137-142. doi: 10.1016/j.neulet.2010.07.080 142

Wang, Y., Lai, J., Cui, H., Zhu, Y., Zhao, B., Wang, W., & Wei, S. (2014). Inhibition of Histone

Deacetylase in the Basolateral Amygdala Facilitates Morphine Context-Associated

Memory Formation in Rats. Journal of Molecular Neuroscience. doi: 10.1007/s12031-

014-0317-4

Wassum, K. M., Ostlund, S. B., Balleine, B. W., & Maidment, N. T. (2011). Differential

dependence of Pavlovian incentive motivation and instrumental incentive learning

processes on dopamine signaling. Learning & Memory, 18(7), 475-483. doi:

10.1101/lm.2229311

Wu, Q., Zhang, L., Law, P.-Y., Wei, L.-N., & Loh, H. H. (2009). Long-Term Morphine

Treatment Decreases the Association of μ-Opioid Receptor (MOR1) mRNA with

Polysomes through miRNA23b. Molecular Pharmacology, 75(4), 744-750. doi:

10.1124/mol.108.053462

You, C., Zhang, H., Sakharkar, A. J., Teppen, T., & Pandey, S. C. (2014). Reversal of deficits

in dendritic spines, BDNF and Arc expression in the amygdala during alcohol

dependence by HDAC inhibitor treatment. International Journal of

Neuropsychopharmacology, 17(2), 313-322. doi: 10.1017/s1461145713001144

Young, E. J., Aceti, M., Griggs, E. M., Fuchs, R. A., Zigmond, Z., Rumbaugh, G., & Miller,

C. A. (2013). Selective, Retrieval-Independent Disruption of Methamphetamine-

Associated Memory by Actin Depolymerization. Biological Psychiatry, 75(2), 96-104.

doi: 10.1016/j.biopsych.2013.07.036

Young, M. D., Willson, T. A., Wakefield, M. J., Trounson, E., Hilton, D. J., Blewitt, M. E., . .

. Majewski, I. J. (2011). ChIP-seq analysis reveals distinct H3K27me3 profiles that 143

correlate with transcriptional activity. Nucleic Acids Research, 39(17), 7415-7427. doi:

10.1093/nar/gkr416

Zagrebelsky, M., Holz, A., Dechant, G., Barde, Y. A., Bonhoeffer, T., & Korte, M. (2005). The

p75 neurotrophin receptor negatively modulates dendrite complexity and spine density

in hippocampal neurons. Journal of Neuroscience, 25(43), 9989-9999. doi:

10.1523/jneurosci.2492-05.2005

144

Appendix

Locomotor activity

Experiment 1 Experiment 2 2000 NaB 2000 NaB NaB + 6 h Veh 1500 Veh 1500

t 1000 t 1000

500 500

0 0 E1 E2 E3 E4 E5 E6 E1 E2 E3 E4 E5 E6 Session Session

Experiment 3 Experiment 4

2000 NaB 2000 NaB Veh Veh 1500 1500

t t 1000 1000

500 500

0 0 E1 E2 E3 E4 E5 E6 E1 E2 E3 E4 E5 E6 Session Session

Figure A1.1. Sodium butyrate has no effect on locomotor activity. Locomotor activity for each treatment group during the first six days of extinction (E1 – E6) in Experiments 1 - 4. Data points represent group means + SEM. NaB = sodium butyrate; Veh = vehicle; NaB + 6 h = NaB administered six hours after extinction sessions.