( 12 ) United States Patent

US010316337B2 (12 ) United States Patent (10 ) Patent No. : US 10 ,316 , 337 B2 Koepke et al. (45 ) Date of Patent: * Jun . 11 , 2019 (54 ) GENETICALLY ENGINEERED BACTERIUM C12P 7162 ( 2006 .01 ) FOR THE PRODUCTION OF ISOBUTYLENE C12N 9 / 04 (2006 .01 ) C12N 9 / 16 ( 2006 . 01 ) (71 ) Applicant: Lanza Tech New Zealand Limited , C12P 7 / 24 ( 2006 . 01 ) Skokie , IL (US ) U . S . CI. CPC ...... C12P 7 / 42 ( 2013 .01 ) ; C12N 9 /0006 (72 ) Inventors : Michael Koepke, Skokie , IL (US ) ; (2013 . 01 ) ; C12N 9 /0008 (2013 . 01 ) ; C12N Rasmus Overgaard Jensen , Skokie , IL 9 / 1029 (2013 .01 ) ; C12N 9/ 1217 ( 2013 .01 ) ; (US ) C12N 9/ 16 ( 2013 .01 ); C12P 5 /007 (2013 . 01 ) ; ( 73 ) Assignee : LANZATECH NEW ZEALAND C12P 5 /026 (2013 .01 ) ; C12P 7 /04 ( 2013 .01 ) ; LIMITED , Auckland ( NZ ) C12P 7 / 18 ( 2013 . 01 ) ; C12P 7/ 24 ( 2013 .01 ) ; C12P 7 / 28 (2013 . 01 ) ; C12P 7 /625 ( 2013 .01 ); ( * ) Notice : Subject to any disclaimer, the term of this C12Y 101/ 01001 ( 2013 .01 ) ; C12Y 101 /01002 patent is extended or adjusted under 35 ( 2013 .01 ) ; C12Y 102 /07005 ( 2013 .01 ) ; C12Y U . S . C . 154 ( b ) by 0 days. 203 / 01008 ( 2013 . 01 ) ; C12Y 203/ 01009 ( 2013 . 01 ); C12Y 203 /01019 ( 2013 . 01 ) ; C12Y This patent is subject to a terminal dis 207 /02001 (2013 .01 ) ; C12Y 207/ 02007 claimer . ( 2013 .01 ) ; C12Y 301/ 0202 ( 2013 . 01 ) ; YO2E 50 / 343 (2013 .01 ) (21 ) Appl. No. : 15 /922 , 451 (58 ) Field of Classification Search CPC ...... C12N 9 / 1029 ( 22 ) Filed : Mar. 15 , 2018 USPC ...... 435 / 252 . 3 (65 ) Prior Publication Data See application file for complete search history . US 2018 /0208952 A1 Jul. 26 , 2018 ( 56 ) References Cited Related U . S . Application Data U . S . PATENT DOCUMENTS (63 ) Continuation of application No. 15/ 658 , 668, filed on 9 , 738 ,875 B2 * 8 / 2017 Koepke ...... C12N 9 / 1029 Jul. 25 , 2017 , now Pat. No . 9 , 957 ,531 , which is a continuation of application No . 15 /293 , 191 , filed on * cited by examiner Oct. 13 , 2016 , now Pat. No. 9 , 738 ,875 . Primary Examiner — Tekchand Saidha (60 ) Provisional application No. 62/ 240, 850 , filed on Oct. ( 74 ) Attorney, Agent, or Firm - Andrea Schoen 13 , 2015 . (57 ) (51 ) Int. Ci. ABSTRACT C12N 1 / 20 ( 2006 . 01 ) The invention relates to a genetically engineered bacterium C12P 7 /42 ( 2006 .01 ) having an enzyme that converts 3 -hydroxyisovaleryl - CoA to C12N 9 / 02 ( 2006 . 01 ) 3 -hydroxyisovalerate and an enzyme that converts 3 - hy C12N 9 / 10 ( 2006 .01 ) droxyisovalerate to isobutylene . Typically , the bacterium is C12N 9 / 12 ( 2006 .01 ) capable of producing isobutylene from a gaseous substrate C12P 5 / 00 ( 2006 .01 ) containing CO , CO2, and / or H2, such as syngas or an C12P 7 /04 ( 2006 .01 ) industrial waste gas . C12P 7 / 28 ( 2006 .01 ) C12P 5 /02 ( 2006 . 01 ) 11 Claims, 43 Drawing Sheets C12P 7 / 18 ( 2006 . 01 ) Specification includes a Sequence Listing . atent Jun 11 , 2019 Sheet 1 of 43 US 10 ,316 ,337 B2

?????? ?? ? " ?? ?? ?? ?? ??? ?? ???? :: : ??? ???? ?? ?? ?????????? - ???? 2 ???- ????

???? ? ? ???? ?? ????? ????

??? ????.?? :??? .?? ..

?? ?? ???????????? ??? ? ???? ???? ? ? ?? 19

? ??? ????? ?? ???? ?? ????? ???? : ???? ???? ?? ?? ????? ?? ??

FIG . I atent Jun . 11 , 2019 Sheet 2 of 43 US 10 , 316 , 337 B2

SH - COA Pib ( 2 . 3 . 1. 19 Buk ( 2. 7. 2. 7 ) DemonicoButanoy -COA . ;L Paremmin tungan Commoderecensie Butanoyl- p fram houerswwwwwwwwww a Konsertpapapapugaen ButyrateBuenos + ATPAir

FIG . 2 atent Jun . 11 , 2019 Sheet 3 of 43 US 10 , 316 , 337 B2

CoA transferase (ABE pathway )

cercetate hiotaso twa transferase xarburyluse (8023 , . 9 2x manuscreening PCS - { EC2839 ) Acetyl- CoA CA Amtesketyl- CoA Acetate Acetyl- CoÅ Acetoacetate co Acelone Isobutylene AFP . . Carlsransferase requires high Coocentratons of acetate • No direct ATP generation ,A uced to be Sescratca via acetate biosynthesis. requiring 2 . dustiona acetyl- CVA

Thjoesterase Acetoacetate Thiolase Soesterase sketboxylase isopropanol {{ C: 2 . 3 . 3 . 9 } 9 9 EC 3 , 3 , 2 , 110 EC3 .12 . 313 2x * * * 5- 6 mennesker ino ns -com arraren Acetil- cos Acéloacetyl -Coi Acetoacetate Isobutytebe Arciyl. Cos de vetate

NO ATP generation, ATP ncut to lx generated via acetate biosyäthesis , reurrizg * additionalsery - Cod Accideres zat yetiscycled and thus occiolates

. - - . - . - . - . - . - . - . - .

Phasszibati Acebuxose Siofase lawyspirzosterase Butyrate Kluse iterackoxylase Isopropano (EC :231 . 3 EC : 3 . 1. 19 ) ( EC 27. 2 . 7 ) ( EC4. 3 . 1 . )

Acetyl- cus E Acetoacetylcos, Acetoacetys - > Avetiquetate Acetone Isobutylene • Dudi ATP ucucration via substrate ievei phosphorylation • No requirement fi acetate lossation os RUS tooniacetylcox

FIG . 3 atent Jun . 11 , 2019 Sheet 4 of 43 US 10 , 316 , 337 B2

Acetoneproduction[g/l

.. . . . ?020. 04 06 0 .02 ......

BL21(DE3)+PACYC-ptb. ThitAdcalone{E.coli BL21(DE3)+PCOLA-thiA. ThltPtb-Buk+Adc(E.coli Noplasmidcontrol[E.coli BL21(DE3)] Mediacontrol Ptb-Bukalone{E.coli BL21(DE3)+PACYC-ptbbuk

FIG . 4

0 . 2 ...... 0 . 18 0 .16 . . . : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : :: : : : 0 . 14 ...... 0 . 12 .. . . . Acetone(g/L) 0 . 1 ......

0 .04 0 .02

10uM IPTG 50 UM IPTG 100 UM IPTG OUMIPTG (uninduced )

FIG . 5 atent Jun . 11 , 2019 Sheet 5 of 43 US 10 , 316 , 337 B2

Acetoacetate from ** *

Acetone

FIG . 6

acetate WF? acetaldehyde NADPM than Oh OH OH 3 -hydroxybutyrate 3 - 1ydroxybutyraldehyde 1 , 3 -butanediol

FIG . 7 atent Jun . 11 , 2019 Sheet 6 of 43 US 10 , 316 , 337 B2

FIG . 8 atent Jun . 11 , 2019 Sheet 7 of 43 US 10 , 316 , 337 B2

FIG . 9 atent Jun . 11 , 2019 Sheet 8 of 43 US 10 , 316 , 337 B2

soukzuoso?00123ay

FIG.10 atent Jun . 11 , 2019 Sheet 9 of 43 US 10 , 316 , 337 B2

2 Acetyl- COA thlA

Acetoacetyl- CoA NADPH phaB NADP ( R ) - 3 -hydroxybutyryl - COA NADH bld NAD 4 COA ( R )- 3 -hydroxybutyraldehyde NADH AVVVV aonadh NADNAD J be 1 , 3 -BDO

FIG . 11 atent Jun . 11 , 2019 Sheet 10 of 43 US 10 , 316 , 337 B2

[Isopropanol)(g/l

50 Time (h )

FIG . 12 atent Jun . 11 , 2019 Sheet 11 of 43 US 10 ,316 ,337 B2

thiA -adc / ptb - buk / phaB 00 10 50 X 100 2. 50 2 . 00 1 .50

1 . 00 ...... 0 . 50 0 .00 3HB acetate ethanol acetone FIG . 13A

thlA - adc/ ptb - buk / phaB -bdh1 80 610 50 X 100 2 . 50

2 . 00

1 .00 0 .50 0 .00 .. . .W 3HB acetate e thanol acetone ...... FIG , 13B atent Jun . 11 , 2019 Sheet 12 of 43 US 10 , 316 , 337 B2

thiA - adc / phaB -bdh1 0 8 10 53 6 100 2 . 50 2 .00 1. 50 1 .00 0 .50

3?8 acetate ethanol acetone FIG . 13C

thlA - adc 0 10 50 100 2 .50 2 .00 1 .50 -. 1 . 00 0 . 50 0 .00 ...... 3HB acetate ethanol acetone FIG . 13D atent Jun . 11 , 2019 Sheet 13 of 43 US 10 , 316 , 337 B2

phab -bdh1 30 * 10 50 X 100 2 . 50 2 .00 1 . 50 1 .00 0 .50

...... 3HB acetate ethanol acetone FIG . 13E

phaB 0 10 50 $ 100 2 . 50 2 .00 1 .50 1 .00 0 .50

??? acetate ethanol acetone FIG . 13F atent Jun . 11 , 2019 Sheet 14 of 43 US 10 ,316 ,337 B2

TEDAODS

PMTL8225 -budAsthlA - .. . 10 , 922 bp

FIG . 14

W 1 4 7 9

FIG . 15 atent Jun . 11 , 2019 Sheet 15 of 43 US 10 , 316 , 337 B2

Acetate w Ethanol Biomass 3HB 1 , 3 - 8DO 40 1 ,650 1 ,550 1 ,450 1 ,350 1 , 250 1 , 150 Ethanol,BiomassAceticacidConc.(g/L) 1 , 050 950 850 3-H8,1BDO(ppm) 750 650

- 550 450 350

- 250 150 SO - - - . . -50

Time [d ]

FIG . 16 atent Jun . 11 , 2019 Sheet 16 of 43 US 10 , 316 , 337 B2

+ 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 1 + 1 -

0 .09

+ .

+ ======......

171561 9 PMTL8315- Pfdx - thtA -phaB - bld FIG . 17A

Biomass

OD6000

- 0 .5 150 200

:71561 PMTL8315 -Pfdx - th A -phaB -bld FIG . 17B atent Jun . 11 , 2019 Sheet 17 of 43 US 10 , 316 , 337 B2

www MARCASCAtitut

Www

FIG . 18A

:.-

internete min Net

FIG . 18B U . S . Patent Jun . 11, 2019 Sheet 18 of 43 US 10 ,316 ,337 B2

D=1.0 ContinuousD=0.5 3HB 1 ,3 - BDO GC -FID

3-HBConc.(g/L)

oacononemam 1,3-BDOConc.(g/l)

0 . 1 0 2 4 6 8 10 12 14 16 Time [ d ] FIG . 19 atent Jun . 11 , 2019 Sheet 19 of 43 US 10 , 316 , 337 B2

PMTL82256 - ptb - buk

OMTL82256 -ptb -buk bluuwr

200 PMTL82256 -ptb -buk

3- ydroxybutyry - COA 2- hydroxyisobutyryl - COA

FIG . 20A

????

PMTL82256 -ptb -buk FIG . 20B U .S . Patentatent Jun . 11 , 2019 Sheet 20 of 43 US 10 , 316 , 337 B2

0 .0008

0 . 0006 0. 0005 an/uwjour

3Carok 3ca0 - 10A 2H18 - COA 2 -HIH -COA CT 2640 12 072640 LZ CT2640

FIG . 21A

FIG . 21B U . S . Patent Jun. 11 , 2019 Sheet 21 of 43 US 10 ,316 ,337 B2

Isopropanol pr OD600 (& /1 / 00 )

FIG . 22 atent Jun . 11 , 2019 Sheet 22 of 43 US 10 , 316 , 337 B2

.' ......

.':

.:'

.:' A CAETHG 1780 °C . autoethanogenum FIG . 23A

Isopropanol(c) .' enemies

. andwomenpromotion .' :.

funwomen .

.' FIG . 23B atent Jun . 11 , 2019 Sheet 23 of 43 US 10 , 316 , 337 B2

rescrivincias - . - . - . - . - . - . - . - . - . - . rescriviriiiiiiiiiii

A CAETHG _ 1780 °C, autocthanogenum FIG . 23C

ERE 0 20 40 60 80 100 120 140 160

FIG . 23D U . S . Patent Jun . 11, 2019 Sheet 24 of 43 US 10 ,316 ,337 B2

Woo SA fruit

3 .

WWW

"Hirit

FIG . 24 atent Jun . 11 , 2019 Sheet 25 of 43 US 10, 316, 337 B2

W 1 2 3 4 5 6 ? ?????

FIG , 25 atent Jun . 11 , 2019 Sheet 26 of 43 US 10 , 316 , 337 B2

.*,-4 secco.ccccccccccccccccccccccc

FIG . 26 atent Jun . 11 , 2019 Sheet 27 of 43 US 10 , 316 , 337 B2

wwwwwwwwwwwwwwwww888 umol/mainmgprotein

BL21 pro - Ac & Pro - Bok Acetoacetyl - coA 3H3 - C04 2 - HIBA - DOA FIG . 27 U . S . Patent Jun . 11, 2019 Sheet 28 of 43 US 10 ,316 ,337 B2

BL21 + thIA / ptb -buk / hbd * 0 * 10 50 * 100 M PTG

* * * * * * * * . *" " " " " " " " " " " " " " " " " " *" . " " " " " " " " " " " " "

EEEEEEEEEEEEEEEEEE ...... UTE www XXXXXXXXXX 11 * ** * * * * * * * * * * * * * * * * * * * * * * * * 3-11ydroxybutyrate acelloadid ethanol lactioacid

FIG . 28A

BL21 * thIA / ptb - buk / phaB

3- droxybutyrate ????? # # etanol lacticacid

FIG . 28B atent Jun . 11 , 2019 Sheet 29 of 43 US 10 , 316 , 337 B2

3 59 FIG . 29A

oooooo

WAY. VN , , ,

FIG . 29B U. S. Patentatent Jun 11 , 2019 Sheet 30 of 43 US 10, 316 ,337 B2

???

" ????? ?? ???

?? ?? ?? ?? ?????? ? ? ?? ? ?? ?? ?? ?? - ????? - ????? ------FIG . 29C ???????????????????????????????? : ????????????????????????????? ? ??? ????????????????????? ????? ????FIG . 29D ????? atent Jun . 11 , 2019 Sheet 31 of 43 US 10 , 316 , 337 B2

u uuuuuuuuu

...... va

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! + + + + + + + + + + + + + + + + + + + + + + + + + + + + + ...... + + + + + + ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' p epp p p p p p p p p p p p p p p ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' '

4 WWW.

- - -

FIG . 30 U . S . Patent Jun . 11 , 2019 Sheet 32 of 43 US 10 , 316 , 337 B2

. Visssssss

. 3

????? 3740LZ1561 37°C71561

???

.BEEEEEEEEEEEEEEE ,1 HA

. FIG.31

LZ156130°C . 156130°CLZ???????

Ppta-ack . um een Pwog .

??????

*** : :: :: E.Coli30°C E.Coli30°C

. . * borbonero atent Jun . 11 , 2019 Sheet 33 of 43 US 10 , 316 , 337 B2

C3)

AnAlcohol/Diol R-OH 2-Propanoi

R-COH AnAldehyde Propionaldehyde FIG.32 .

COOH-R AnAcid

:: Propanoy-COA -HSCOA ACOA atent Jun . 11 , 2019 Sheet 34 of 43 US 10 , 316 , 337 B2

X -COA DTNB pto Coa \ TNB anion + TNB- COA

ADRbuk XP Oxyluciferin /CO /AMP / PP , ATP D - luciferin /O , X- acid Luciferase light

FIG . 33 U . S . Patent Jun . 11 , 2019 Sheet 35 of 43 US 10 ,316 ,337 B2

HARA** * * *

*** * * 22 *** **** * * * *

FIG . 34 atent Jun . 11 , 2019 Sheet 36 of 43 US 10 , 316 , 337 B2

3 - wydroxybutyrys - COA

*** ** * * *** * * * A 28 A AA

crotonate *32 acetobutyryl- CoA crotonaldehyde 36 33

3 -hydroxyhexanoxi - COA acetobutyrate 2 - buten - i - ol 37

3 -hydrolyhexanoate acetylacetone 38

1 , 3 -hexaldehyde retkiy - - f?????;

FIG . 35 U . S . Patent Jun . 11 , 2019 Sheet 37 of 43 US 10 ,316 ,337 B2

acetyl- Com fungum substrate

Ured

FIG . 36 atent Jun . 11 , 2019 Sheet 38 of 43 US 10 , 316 , 337 B2

1 . 0

......

FIG . 37 atent Jun . 11 , 2019 Sheet 39 of 43 US 10 , 316 , 337 B2

2 4 6 8 10 12

FIG . 38A

(Metabolitesg/ WAZY

Hydroxybutyrate 3 & Isopropanol

FIG . 38B atent Jun . 11 , 2019 Sheet 40 of 43 US 10 , 316 , 337 B2

S Acetoacyl- cos Co acetoacid www . acetone / methyl - 2. 01 3 -OH - COA w 5 -oh - acio 6 : 2, 3 - diol C . Enoyl- COA Co Engate 42-en -1 - o ! CA ACY -COA Coacid C , alcohol Cuti Acetoacyl- CoA m in C , Acetoacia xez Acetone / Croszmethyl - 2 - 01 43- OH -COA C21 , 3- dio gi2 Conta Enoyl -CoA Com Engate Cosa 2- en -1 - o ! Emin Acyl- CoA . zi- alcohol Cni Acetoacyl -COA Car Acetoacid Cinsi Acetone /Con methyl- 2 - o ! Cortes etc etc etc

FIG . 39 U . S . Patent Jun . 11, 2019 Sheet 41 of 43 US 10 ,316 ,337 B2

03 -HO 11, 3 - 000

Titering/l

???????????????????????????????????????????????????????????????????????????

FIG . 40

20 ......

. . .

FIG . 41 atent Jun . 11 , 2019 Sheet 42 of 43 US 10 , 316 , 337 B2

3-hydroxybutyrate[g/L) .

. . 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

FIG . 42A

3-hydroxybutyrate(g/L]

. 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M Time ( d ) FIG . 42B atent Jun . 11 , 2019 Sheet 43 of 43 US 10 , 316 , 337 B2

Bng ait -buk

2 & ".

FIG . 43

V lll FIG . 44 US 10 ,316 , 337 B2

GENETICALLY ENGINEERED BACTERIUM ( Ptb ) and exogenous butyrate kinase (Buk ) ( Ptb - Buk ). Gen FOR THE PRODUCTION OF ISOBUTYLENE erally , the Ptb -Buk acts on a non - native substrate , e . g ., a substrate other than butanoyl- CoA and /or butanoyl phos CROSS REFERENCE TO RELATED phate , and produces a non - native product, e . g . , a product APPLICATIONS 5 other than butanoyl phosphate or butyrate . In certain This application is a continuation of U . S . patent applica embodiments , the Ptb -Buk converts acetoacetyl- CoA to tion Ser . No . 15 /658 ,668 filed Jul. 25, 2017 , which is a acetoacetate , 3- hydroxyisovaleryl - CoA to 3 -hydroxyisoval continuation of U . S . patent application Ser. No. 15 /293 . 191 erate , 3 -hydroxybutyryl - CoA to 3 - hydroxybutyrate , or 2 -hy filed Oct. 13 , 2016 (now U . S . Pat. No . 9, 738 ,875 ), which droxyisobutyryl- CoA to 2 -hydroxyisobutyrate . claims the benefit of U .S . Provisional Patent Application No . The bacterium may produce one or more of an acid , an 62 /240 ,850 filed Oct. 13 , 2015 , the entireties of which are alkene , a ketone , an aldehyde , an alcohol, or a diol . More incorporated herein by reference . specifically , the bacterium may produce one or more of BACKGROUND OF THE INVENTION acetone or a precursor thereof, isopropanol or a precursor 15 thereof, isobutylene or a precursor thereof, 3 -hydroxybu With recent advances in fermentation and metabolic engi tyrate or a precursor thereof, 1 , 3 -butanediol or a precursor neering , fermentation routes to various products have been thereof, 2 -hydroxyisobutyrate or a precursor thereof, adipic identified and developed (Clomburg , Appl Microbiol Bio acid or a precursor thereof, 1 ,3 -hexanediol or a precursor technol, 86 : 419 - 434 , 2010 ; Peralta - Yahya , Biotechnol J, 5 : thereof, 3 -methyl - 2 -butanol or a precursor thereof, 2 - buten 147 - 162 , 2010 ; Cho , Biotechnol Adv, pii : S0734 - 9750 (14 ) 20 1 -ol or a precursor thereof, isovalerate or a precursor thereof, 00181 - 5 , 2014 . However , all of these fermentation routes are or isoamyl alcohol or a precursor thereof. The bacterium energy ( ATP ) - consuming or, at best , energy (ATP ) -neutral , does not typically produce butanol . which restricts product yield in energy -limited systems and The bacterium may further comprise a disruptive muta uncouples product production from microorganism growth . tion in a phosphotransacetylase (Pta ) and an acetate kinase The present invention provides energy (ATP ) - generating 2525 (Ack ). The bacterium may further comprise a disruptive pathways that overcome these limitations by providing novel fermentation routes and pathways to a variety of mutation in a thioesterase . In another embodiment, the products , including acids, alkenes , aldehydes , alcohols , and invention provides a genetically engineered bacterium com diols . These pathways are directly coupled to microorganism prising exogenous Ptb - Buk and exogenous or endogenous growth and offer high product yields . aldehyde : ferredoxin oxidoreductase . tion relates to fermentation path - 30 The invention further provides a method of producing a waysIn particularinvolving , Ptbthe - Buk invention . Phosphate relates butyryltransferase to fermentation path( Ptb )- 3 product comprising culturing the bacterium of any of the ( EC 2 . 3 . 1 . 19 ) natively catalyzes the reaction of butanoyl- aforementioned embodiments in the presence of a substrate . CoA and phosphate to form CoA and butanoyl phosphate . The product may be , for example , acetone or a precursor Butyrate kinase ( Buk ) (EC 2 . 7 . 2 . 7 ) natively catalyzes the thereof , isopropanol or a precursor thereof, isobutylene or a reaction of butanoyl phosphate and ADP to form butyrate 35 precursor thereof, 3 - hydroxybutyrate or a precursor thereof, (butanoate ) and ATP . Accordingly , these enzymes together 1 , 3 - butanediol or a precursor thereof , 2 -hydroxyisobutyrate (Ptb - Buk ) natively catalyze the conversion of butanoyl- CoA or a precursor thereof, adipic acid or a precursor thereof, to butyrate and generate one ATP via substrate level phos - 1 , 3 - hexanediol or a precursor thereof, 3 -methyl - 2 - butanol or phorylation (SLP ). a precursor thereof, 2 -buten - 1 -ol or a precursor thereof, The inventors have discovered that Ptb is promiscuous 40 isovalerate or a precursor thereof , or isoamyl alcohol or a and is capable of accepting a variety of acyl- CoAs and precursor thereof. Typically , the substrate is a gaseous enoyl- CoAs as substrates, such that Ptb - Buk may be used to substrate comprising, for example , one or more of CO , CO2, convert a number of acyl - CoAs and enoyl -CoAs to their and H , . In one embodiment, the gaseous substrate is syngas . corresponding acids or alkenates , respectively , while simul- In another embodiment, the gaseous substrate is an indus taneously generating ATP via substrate level phosphory - 45 trial waste gas . lation . Furthermore , in combination with an aldehyde ferredoxin BRIEF DESCRIPTION OF THE DRAWINGS oxidoreductase (AOR ) and an alcohol dehydrogenase , acids formed via the Ptb - Buk system can be further converted to FIG . 1 is a diagram of metabolic pathways for the their respective aldehydes, alcohols , or diols . AOR (EC 50 production of various products , including acetone, isopro 1 . 2 . 7 . 5 ) catalyzes the reaction of an acid and reduced panol, isobutylene , 3 - hydroxybutyrate , 1 , 3 -butanediol , and ferredoxin (which can , for example , be generated from 2 -hydroxyisobutyrate from acetyl- CoA . Acetyl- CoA may be oxidation of CO or hydrogen ) to form an aldehyde and generated from any suitable substrate , such as a carbohy oxidized ferredoxin . Alcohol dehydrogenase ( EC 1 . 1 . 1 . 1 drate ( e . g ., sugar ) substrate or a gaseous substrate . In the and EC 1. 1 . 1. 2 ) can convert an aldehyde and NAD ( P ) H to 55 present invention , acetyl- CoA is often generated from a an alcohol and NAD ( P ) . gaseous substrate . Bold arrows indicate steps that may be Introduction of Ptb - Buk and /or AOR into a heterologous catalyzed by Ptb - Buk . species, therefore , provides a novel , alternate route to the FIG . 2 is a diagram showing the reactions natively cata formation of native and non - native products, such as acids, lyzed by Ptb - Buk , namely the conversion of butanoyl- CoA alkenes, ketones, aldehydes, alcohols , and diols at high 60 to butyrate and the generation of one ATP . yields, thus overcoming limitations of the current state of the FIG . 3 is a diagram comparing the activities of COA art . transferase , thioesterase , and Ptb -Buk . FIG . 4 is a graph showing average acetone production in SUMMARY OF THE INVENTION E . coli BL21 (D3 ) modified with plasmids comprising 65 exogenous genes . This data demonstrates the ability of The invention provides a genetically engineered bacte - Ptb -Buk to convert acetoacetyl -CoA to acetoacetate in E . rium comprising exogenous phosphate butyryltransferase coli in vivo . US 10 ,316 , 337 B2 FIG . 5 is a graph showing the effect of induction of E . coli FIG . 20A and FIG . 20B are graphs showing increased BL21 (DE3 ) carrying both the PACYC -ptb -buk and COA hydrolysis activity on a range of acyl- CoAs (ac PCOLA - th1A - adc plamids ( expressing thiolase , Ptb - Buk , etoacetyl- CoA , 3 - hydroxybutyryl- CoA and 2 - hydroxy and acetoacate decarboxylase ) . isobutyryl- CoA ) in C . autoethanogenum expressing the Ptb FIG . 6 is a diagram of a pathway designed to use Ptb - Buk 5 Buk system from plasmid pMTL82256 - ptb -buk compared for acetone production , while recycling the reducing equiva - to wild - type (WT ) . lents produced in the production of (R )- 3 -hydroxybutyryl - FIG . 21A and FIG . 21B are graphs showing reduced COA and the ATP generated by Ptb - Buk . acyl- CoA hydrolysis activity of C . autoethanogenum strains FIG . 7 is a diagram showing the role of aldehyde : with inactivated thioesterases (CT2640 = thioesterase 1 , CT ferredoxin oxidoreductase (AOR ) , ferredoxin , and Adh in 10 1524 = thioesterase 2 , CT1780 - thioesterase 3 ) compared to the production of 1 , 3 - butanediol in C . autoethanogenum . activity found in C . autoethanogenum LZ1560 or LZ1561. More generally , AOR may be used to catalyze the conver FIG . 22 is a graph showing increased specific isopropanol sion of an acid to an aldehyde and Adh may be used to production in a C . autoethanogenum strain with disrupted catalyze the conversion of the aldehyde to an alcohol/ diol . 1 thioesterase 3 CAETHG _ 1780 compared to wild - type C . FIG . 8 is a diagram showing the stereospecificity of autoethanogenum . Ptb - Buk for the production of ( R ) - 3 -hydroxybutyrate and FIGS. 23A - D are graphs showing growth (FIG . 23A ) and 2 -hydroxyisobutyrate . The term “ native ” in FIG . 8 refers to isopropanol (FIG . 23B ), acetate (FIG . 23C ) , and ethanol native thioesterase . ( FIG . 23D ) production profiles of C . autoethanogenum FIG . 9 is a diagram showing the production of isobutene 20 wild - type and strain with disrupted thioesterase 3 via Ptb -Buk conversion of 3 -hydroxyisovaleryl - CoA and (CAETHG _ 1780 ) compared to wild - type C . autoethanoge 3 -hydroxyisovalerate using alternative pathway 1 . ???. FIG . 10 is a diagram showing the production of isobutene FIG . 24 is a plasmid map of pMTL8225 -pta -ack :: ptb -buk . via Ptb - Buk conversion of 3 - hydroxyisovaleryl - CoA and FIG . 25 is a gel image indicating the replacement of pta 3 -hydroxyisovalerate using alternative pathway 2 . 25 and ack genes replaced with ptb and buk genes and ermB FIG . 11 is a diagram showing the production of 1 , 3 - cassette . butanediol via 3 - butyraldehyde dehydrogenase ( Bld ) . FIG . 26 is a graph showing increased conversion 3 -hy FIG . 12 is a graph showing isopropanol production in C . droxybutyrate to 13 -BDO by overexpression of the alde autoethanogenum using the Ptb - Buk system over a control. O pMTL85147- th1A - adc, • pMTL85147 - th1A - ptb -buk - 30 hydeFT : ferredoxin oxidoreductase gene aorl . adc . FIG . 27 is a graph showing the activity of thioesterase FIGS. 13A - F are graphs showing production of 3 -hy TesB , Pta - Ack , and Ptb -Buk system on COA hydrolysis of droxybutyrate , acetate , ethanol, and acetone with modular acetoacetyl- CoA , 3 -hydroxybutyryl - CoA and 2 -hydroxy plasmids in E . coli with different concentrations of inducer isobutyryl- CoA compared to control ( BL21 strain ). Ptb - Buk IPTG (0 , 50 , 100 UM ). FIG . 13A : PACYC -ptb -buk , 35 showsSb highest activity , while Pta - Ack shows no activity . PCOLA - th1A - adc , PCDF -phaB . FIG . 13B : PACYC -ptb FIGS . 28A and 28B are graphs showing production of buk , PCOLA -th1A - adc , PCDF - phaB -bdh1 . FIG . 13C : 3 -hydroxybutyrate via Ptb - Buk in combination with an PCOLA -th1A - adc , pCDF -phaB - bdh1. FIG . 13D : pCOLA - (S ) -specific (Hbd ) ( FIG . 28A ) or ( R ) -specific 3 -hydroxybu thlA - adc . FIG . 13E : pCDFDE -Dhab phaB -- bdh1 . FIG . 13513F : pCDFOCDE tyrate ( PhaB ) (FIG . 28B ) dehydrogenase. phaB . 40 FIGS. 29A - D are graphs showing LC -MS / MS detection FIG . 14 is a plasmid map of plasmid pMTL8225 -budA : : of 2 -hydroxyisobutyric acid ( 2 -HIB ) and 2 -hydroxybutyrate thlA -phaB . (2 - HB ). FIG . 29A : 1 mM 2 -HIB standard . FIG . 29B : 1 mM FIG . 15 is a gel image of PCR verification of replacement 2 -HB standard . of acetolactate synthase (budA ) genes with thiolase (th1A ) FIG . 29C : 0 . 5 mM 2 -HB and 2 -HIB standard . FIG . 29D : and 3 - hydroxybutyryl- CoA dehydrogenase (phaB ) genes in 45 duplicate of C . autoethanogenum sample showing 2 -HIB C . autoethanogenum for 4 clones ( 1 , 4 , 7 , 9 ) compared to and 2 -HB production from gas . wild - type ( W ) . All clones are positive as seen by a larger FIG . 30 is a set of graphs showing GC -MS confirmation PCR fragment size compared to wild -type . of 2 -hydroxyisobutyric acid ( 8 .91 min ) production . First FIG . 16 is a graph showing fermentation profile of a batch panel: C . autoethanogenum +pMTL83155 - th1A - hbd -Pwl fermentation C . autoethanogenum budA : : thlAphaB strain 50 meaBhcmA -hcmB + pMTL82256 - tesB . Second panel : C . and demonstrating 3 -hydroxybutyrate and 1 , 3 - butanediol autoethanogenum + pMTL83155 - th1A - hbd -Pwl -meaBh formation from gas . cmA -hcmB + pMTL82256 -ptb -buk ( spectrum ). Third panel: FIG . 17A is a graph showing production of 1 ,3 -BDO via E . coli + pMTL83155 - th1A -hbd - Pwl- meaBhcmA -hcmB + thiolase , 3 -hydroxybutyryl - CoA dehydrogenase ( Bld ), and PMTL82256 - tesB . Fourth panel: E . coli +pMTL83155 - th1A butyraldehyde dehydrogenase . FIG . 17B is a graph showing 55 hbd - Pwl- meaBhcmA -hcmB + pMTL82256 - ptb -buk . the impact of bld expression on growth . FIG . 31 is a set of graphs of real time PCR showing FIG . 18A is a graph showing the formation of 3 -hydroxy - expression of genes of the 2 -HIBA pathway ( th1A , hba , butyrate and 1 , 3 -butanediol from gaseous substrate in C . meaBhcmA , hcmB from pta -ack promoter and respectively autoethanogenum PMTL8315 - Pfdx -hbd1 - th1A . FIG . 18B is Wood - Ljungdahl operon promoter ) in E . coli, C . autoetha a graph showing the reduction of acetate to ethanol in the 60 nogenum LZ1561 at 30° C . , and C . autoethanogenum same culture . LZ1561 at 37° C . FIG . 19 is a graph showing the fermentation profile for FIG . 32 is a diagram showing the production of various strain C . autoethanogenum pMTL8315 - Pfdx -hbd1 - th1A products in a microorganism comprising Ptb - Buk , AOR , and demonstrating formation of 3 -hydroxybutyrate and 1 , 3 -bu - Adh . tanediol from gaseous substrate in continuous culture (where 65 FIG . 33 is a diagram showing the coupling firefly indicated , media was replenished continuously with given luciferase ( Luc ) to the Ptb -Buk system to characterize dilution rate D ). Ptb -Buk variants . US 10 , 316 , 337 B2 FIG . 34 is a diagram of metabolic pathways for the Cupriavidus necator (WP _ 011615089. 1) (SEQ ID NO : 3 ), production of various products , including adipic acid . Bold or AtoB from Escherichia coli (NP _ 416728 . 1 ) (SEQ ID NO : arrows indicate steps that may be catalyzed by Ptb - Buk . 4 ) . Clostridium autoethanogenum , Clostridium ljungdahlii , FIG . 35 is a diagram of metabolic pathways for the and Clostridium ragsdalei do not have known native activity production of various products , including 1 , 3 -hexanediol , 5 for this step . Escherichia coli has native activity for this step . 2 -methyl - 2 -butanol , and 2 -buten - 1 -o1 . Bold arrows indicate Step 2 shows the conversion of acetoacetyl- CoA to steps that may be catalyzed by Ptb - Buk . acetoacetate . This step may be catalyzed by CoA - transferase FIG . 36 is a diagram of metabolic pathways for the ( i . e . , acetyl -CoA :acetoacetyl - CoA transferase ) ( EC 2 . 8 . 3 . 9 ) . production of various products , including isovalerate and The COA - transferase may be , for example , CtfAB , a het isoamyl alcohol. Bold arrows indicate steps that may be 10 erodimer comprising subunits CtfA and CtfB , from catalyzed by Ptb - Buk . Clostridium beijerinckii (CtfA , WP _ 012059996 . 1 ) (SEQ ID FIG . 37 is a graph of 3 -HB production in C . autoetha - NO : 5 ) ( CtfB , WP_ 012059997 . 1 ) (SEQ ID NO : 6 ) . This step nogenum containing plasmid pMTL82256 - thlA - ctfAB at may also be catalyzed by thioesterase ( EC 3 . 1 . 2 . 20 ) . The various points of growth . thioesterase may be , for example , TesB from Escherichia FIG . 38A is a graph showing the growth and ethanol and 15 coli (NP _ 414986 . 1 ) ( SEQ ID NO : 7 ). This step may also be 2 , 3 -butanediol production profile of strain C . autoethano - catalyzed by a putative thioesterase , e . g ., from Clostridium genum pta -ack :: ptb -buk + pMTL85147 -th1A -ptb - buk -adc . autoethanogenum or Clostridium ljungdahlii . In particular, FIG . 38B is a graph showing the isopropanol and 3 -HB three putative thioesterases have been identified in production profile of strain C . autoethanogenum pta -ack : : Clostridium autoethanogenum : ( 1 ) " thioesterase 1 ” ptb -buk + pMTL85147- th1A - ptb - buk - adc . 20 (AGY74947 . 1 ; annotated as palmitoyl -CoA hydrolase ; SEQ FIG . 39 is a diagram of a pathway scheme for producing ID NO : 8 ), ( 2 ) “ thioesterase 2” (AGY75747 . 1 ; annotated as a range of C4, C . , C3, C10 , C12 , C14 alcohols , ketones, enols 4 -hydroxybenzoyl - CoA thioesterase ; SEQ ID NO : 9 ) , and or diols via combining known chain elongation pathway ( 3 ) “ thioesterase 3 ” ( AGY75999 . 1 ; annotated as putative (Hbd , Crt, Bcd -EtfAB , Thl) with Ptb - Buk + AOR / Adc - Adh . thioesterase ; SEQ ID NO : 10 ) . Three putative thioesterases FIG . 40 is a graph showing production of 3 -HB and 25 have also been identified in Clostridium ljungdahlii : ( 1 ) 1 , 3 -BDO by C . autoethanogenum transformed with plasmid “ thioesterase 1 ” (ADK15695 . 1 ; annotated as predicted acyl pMTL83159 -phaB - th1A at various points of growth . COA thioesterase 1 ; SEQ ID NO : 11 ) , ( 2 ) “ thioesterase 2 ” FIG . 41 is a graph showing production of 3 -HB and (ADK16655 . 1 ; annotated as predicted thioesterase; SEQ ID 1 , 3 -BDO by C . autoethanogenum comprising budA knock - NO : 12 ) , and ( 3 ) “ thioesterase 3 " (ADK16959 . 1 ; annotated out and pMTL -HBD - Th1A at various points of growth . 30 as predicted thioesterase ; SEQ ID NO : 13 ) . This step may FIG . 42A is a graph showing production of 3 -HB in a C . also be catalyzed by phosphate butyryltransferase (EC autoethanogenum PMTL83159 -phaB - th1A + pMTL82256 2 .3 . 1 .19 ) + butyrate kinase ( EC 2 . 7 .2 .7 ) . Exemplary sources fermentation . FIG . 42B is a graph showing production of for phosphate butyryltransferase and butyrate kinase are 3 -HB in a C . autoethanogenum pMTL83159 - phaB -th1A + described elsewhere in this application . Native enzymes in PMTL82256 -buk - ptb fermentation . 35 Clostridium autoethanogenum , Clostridium ljungdahlii , and FIG . 43 is a graph showing the production of 3 -HB in a Clostridium ragsdalei (or Escherichia coli) , such as thio C . autoethanogenum strain with thioesterase knockout esterases from Clostridium autoethanogenum , may catalyze (ACAETHG _ 1524 ) expressing plasmid PMTL83156 -phaB - this step and result in the production of some amount of thlA with and without Ptb - Buk expression plasmid downstream products . However, introduction of an exog PMTL82256 -buk - ptb . 40 enous enzyme or overexpression of an endogenous enzyme FIG . 44 is a graph showing ethanol and 1 , 3 - BDO pro - may be required to produce downstream products at desir duction in a C . autoethanogenum strain expressing plasmid able levels . Additionally , in certain embodiments , a disrup PMTL82256 -hbd - th1A (2pf ) with and without AOR overex tive mutation may be introduced to an endogenous enzyme , pression plasmid PMTL83159 - aorl ( + aorl ) . such as an endogenous thioesterase , to reduce or eliminate 45 competition with introduced Ptb - Buk . DETAILED DESCRIPTION OF THE Step 3 shows the conversion of acetoacetate to acetone . INVENTION This step may be catalyzed by an acetoacetate decarboxylase (EC 4 . 1 . 1 . 4 ) . The acetoacetate decarboxylase may be , for Metabolic Pathways of FIGS. 1 and 34 - 36 example , Adc from Clostridium beijerinckii FIGS . 1 and 34 - 36 are diagrams of metabolic pathways 50 (WP _ 012059998 . 1 ) (SEQ ID NO : 14 ) . This step may also be for the production of various acid , alkene, ketone , aldehyde, catalyzed by an alpha -ketoisovalerate decarboxylase (EC alcohol, and diol products, including acetone , isopropanol, 4 . 1 . 1 .74 ) . The alpha -ketoisovalerate decarboxylase may be , isobutylene, 3 - hydroxybutyrate (R - and S -isomers ), 1, 3 for example , KivD from Lactococcus lactis (SEQ ID NO : butanediol, 2 -hydroxyisobutyrate , adipic acid , 1, 3 -hexane 15 ) . Clostridium autoethanogenum , Clostridium ljungdahlii , diol, 2 -methyl - 2 - butanol, 2 -buten - 1 -ol , isovalerate , and iso - 55 and Clostridium ragsdalei do not have known native activity amyl alcohol from a substrate . Bold arrows indicate steps for this step . Additionally , Escherichia coli does not have that may be catalyzed by Ptb - Buk . Exemplary enzymes are known native activity for this step . Rarely , conversion of provided for each of the steps and enzymatic pathways acetoacetate to acetone may occur spontaneously . However , detailed in FIGS . 1 and 34 - 36 . However, additional suitable spontaneous conversion is highly inefficient and unlikely to enzymes may be known to a person of ordinary skill in the 60 result in the production of downstream products at desirable art . levels . Step 1 shows the conversion of acetyl- CoA to acetoacetyl Step 4 shows the conversion of acetone to isopropanol. COA . This step may be catalyzed by thiolase ( i .e . , acetyl This step may be catalyzed by a primary : secondary alcohol COA acetyltransferase ) (EC 2 . 3 .1 . 9 ) . The thiolase may be , dehydrogenase ( EC 1. 1 .1 . 2 ). The primary :secondary alcohol for example , Th1A from Clostridium acetobutylicum 65 dehydrogenase may be , for example , SecAdh from (WP _ 010966157 . 1 ) (SEQ ID NO : 1 ), PhaA from Cupriavi Clostridium autoethanogenum (AGY74782 . 1 ) (SEQ ID dus necator (WP _ 013956452. 1 ) (SEQ ID NO : 2 ) , Bkt? from NO : 16 ) , SecAdh from Clostridium ljungdahlii US 10 , 316 , 337 B2 ( ADK15544 .1 ) (SEQ ID NO : 17 ), SecAdh from Clostridium COA thioesterase 1 ; SEQ ID NO : 11 ), (2 ) “ thioesterase 2 ” ragsdalei (WP _ 013239134 . 1 ) (SEQ ID NO : 18 ) , or SecAdh (ADK16655 . 1 ; annotated as predicted thioesterase ; SEQ ID from Clostridium beijerinckii (WP _ 026889046 . 1) (SEQ ID NO : 12 ) , and ( 3 ) “ thioesterase 3 ” (ADK16959 . 1 ; annotated NO : 19 ) . This step may also be catalyzed by a primary : as predicted thioesterase ; SEQ ID NO : 13 ) . This step may secondary alcohol dehydrogenase (EC 1 . 1 . 1 . 80 ) , such as 5 also be catalyzed by phosphate butyryltransferase (EC SecAdh from Thermoanaerobacter brokii (3FSR _ A ) (SEQ 2 .3 . 1 . 19 ) + butyrate kinase ( EC 2 . 7 . 2 . 7 ) . Exemplary sources ID NO : 20 ) . Clostridium autoethanogenum , Clostridium for phosphate butyryltransferase and butyrate kinase are ljungdahlii , and Clostridium ragsdalei have native activity described elsewhere in this application . Native enzymes in for this step (Köpke , Appl Environ Microbiol, 80 : 3394 - Clostridium autoethanogenum , Clostridium ljungdahlii , and 3403 , 2014 ) . However, Escherichia coli does not have 10 Clostridium ragsdalei (or Escherichia coli) , such as thio known native activity for this step . Knocking down or esterases from Clostridium autoethanogenum , may catalyze knocking out this enzyme in Clostridium autoethanogenum , this step and result in the production of some amount of Clostridium ljungdahlii , or Clostridium ragsdalei results in downstream products . However, introduction of an exog the production and accumulation of acetone rather than enous enzyme or overexpression of an endogenous enzyme isopropanol (WO 2015 /085015 ) . 15 may be required to produce downstream products at desir Step 5 shows the conversion of acetone to 3 -hydroxyis - able levels . Additionally , in certain embodiments, a disrup ovalerate . This step may be catalyzed by a hydroxyisoval tive mutation may be introduced to an endogenous enzyme, erate synthase , such as hydroxymethylglutaryl - CoA syn - such as an endogenous thioesterase , to reduce or eliminate thase (HMG -CoA synthase ) (EC 2 . 3 . 3 . 10 ) from Mus competition with introduced Ptb -Buk . musculus ( SEQ ID NO : 21 ) (US 2012 /0110001 ) . The 20 Step 9 shows the conversion of acetyl- CoA to 3 -methyl hydroxymethylglutaryl- CoA synthase may be engineered to 2 -oxopentanoate . This step encompasses a number of enzy improve activity . Clostridium autoethanogenum , matic reactions involved in the isoleucine biosynthesis path Clostridium ljungdahlii , and Clostridium ragsdalei do not way, which is natively present in many bacteria , including have known native activity for this step . Escherichia coli Clostridium autoethanogenum , Clostridium ljungdahlii , and does not have known native activity for this step . 25 Clostridium ragsdalei ( and Escherichia coli ). Enzymes Step 6 shows the conversion of 3 -hydroxyisovalerate to involved in the conversion of acetyl- CoA to 3 -methyl - 2 isobutylene ( isobutene ). This step may be catalyzed by a oxopentanoate may include citramalate synthase ( EC hydroxyisovalerate phosphorylase /decarboxylase . This step 2 .3 . 1 . 182 ) , 3 - isopropylmalate dehydratase (EC 4 .2 . 1. 35 ) , may also be catalyzed by mevalonate diphosphate decar - 3 -isopropylmalate dehydrogenase ( EC 1 . 1 . 1 . 85 ) , acetolac boxylase ( hydroxyisovalerate decarboxylase) (EC 4 . 1 . 1 .33 ). 30 tate synthase (EC 2 .2 . 1 .6 ), ketol- acid reductoisomerase ( EC The mevalonate diphosphate decarboxylase may be, for 1 . 1 . 1 . 86 ) , and / or dihydroxyacid dehydratase ( EC 4 . 2 . 1 . 9 ) . example , Mdd from Saccharomyces cerevisiae The citramalate synthase may be, for example , CimA from (CAA96324 . 1 ) (SEQ ID NO : 22 ) or Mdd from Picrophilus Clostridium autoethanogenum (AGY76958 .1 ) ( SEQ ID torridus (WP _ 011178157 . 1 ) (SEQ ID NO : 23 ) ( US 2011/ NO : 24 ) or CimA from Methanocaldococcus jannaschii 0165644 ; van Leeuwen , Appl Microbiol Biotechnol, 93 : 35 (NP _ 248395 . 1 ) (SEQ ID NO : 25) . The 3 - isopropylmalate 1377 - 1387 , 2012 ) . Clostridium autoethanogenum , dehydratase may be , for example , LeuCD from Clostridium Clostridium ljungdahlii , and Clostridium ragsdalei do not autoethanogenum ( WP 023162955 . 1 , LeuC ; AGY77204 . 1 , have known native activity for this step . Escherichia coli LeuD ) (SEQ ID NOs : 26 and 27 , respectively ) or LeuCD does not have known native activity for this step from Escherichia coli (NP _ 414614 . 1 , LeuC ; NP _ 414613 . 1 , Step 7 shows the conversion of acetone to 3 -hydroxyis - 40 LeuD ) (SEQ ID NOs : 28 and 29 , respectively ) . The 3 - iso ovaleryl- CoA . This step may be catalyzed by a 3 -hydroxy - propylmalate dehydrogenase may be, for example , LeuB isovaleryl- CoA synthase . Clostridium autoethanogenum , from Clostridium autoethanogenum (WP _ 023162957. 1 ) Clostridium ljungdahlii , and Clostridium ragsdalei do not (SEQ ID NO : 30 ) or LeuB from Escherichia coli have known native activity for this step . Escherichia coli (NP _ 414615 . 4 ) (SEQ ID NO : 31 ) . The acetolactate synthase does not have known native activity for this step 45 may be , for example, IlvBN from Clostridium autoethano Step 8 shows the conversion of 3 -hydroxyisovaleryl - CoA genum ( AGY74359. 1 , IlvB ; AGY74635 . 1 , IlvB ; to 3 -hydroxyisovalerate . This step may be catalyzed by AGY74360 . 1 , IlvN ) (SEQ ID NOs: 32 , 33 , and 34 , respec COA - transferase (i . e ., acetyl- CoA :acetoacetyl - CoA trans tively ) or IlvBN from Escherichia coli (NP _ 418127 . 1 , IlvB ; ferase ) (EC 2 . 8 . 3 . 9 ) . The CoA - transferase may be , for NP _ 418126 . 1 , IlvN ) (SEQ ID NOs: 35 and 36 , respec example , CtfAB , a heterodimer comprising subunits CtfA 50 tively ) . The ketol - acid reductoisomerase may be, for and CtfB , from Clostridium beijerinckii (CtfA , example , Ilvc from Clostridium autoethanogenum WP _ 012059996 . 1 ) (SEQ ID NO : 5 ) ( CtfB , (WP _ 013238693 . 1 ) (SEQ ID NO : 37 ) or IlvC from Escheri WP _ 012059997. 1 ) (SEQ ID NO : 6 ) . This step may also be chia coli (NP _ 418222 . 1 ) (SEQ ID NO : 38 ) . The dihydroxy catalyzed by thioesterase (EC 3 . 1 . 2 .20 ) . The thioesterase acid dehydratase may be, for example, Ilvd from may be , for example , TesB from Escherichia coli 55 Clostridium autoethanogenum (WP _ 013238694 . 1 ) (SEQ ID (NP _ 414986 . 1 ) (SEQ ID NO : 7 ) . This step may also be NO : 39 ) or IlvD from Escherichia coli ( YP _ 026248 . 1 ) (SEQ catalyzed by a putative thioesterase , e . g . , from Clostridium ID NO : 40 ) . Clostridium autoethanogenum , Clostridium autoethanogenum or Clostridium ljungdahlii . In particular, ljungdahlii , and Clostridium ragsdalei have native activity three putative thioesterases have been identified in for this step . Clostridium autoethanogenum : ( 1 ) " thioesterase 1 " 60 Step 10 shows the conversion of 3 -methyl - 2 -oxopentoate (AGY74947 . 1 ; annotated as palmitoyl- CoA hydrolase; SEQ to 2 -methylbutanoyl - CoA . This step may be catalyzed by ID NO : 8 ) , ( 2 ) “ thioesterase 2 ” ( AGY75747 . 1 ; annotated as ketoisovalerate oxidoreductase ( EC 1 . 2 . 7 . 7 ) . The ketois 4 -hydroxybenzoyl - CoA thioesterase ; SEQ ID NO : 9) , and ovalerate oxidoreductase may be, for example , the Vor ( 3 ) “ thioesterase 3 ” ( AGY75999 .1 ; annotated as putative ABCD from Methanothermobacter thermautotrophicus thioesterase ; SEQ ID NO : 10 ). Three putative thioesterases 65 (WP _ 010876344 . 1 , VorA ; WP _ 010876343 . 1 , VorB ; have also been identified in Clostridium ljungdahlii : ( 1 ) WP _ 010876342 . 1, VorC ; WP _ 010876341. 1 , VorD ) (SEQ " thioesterase 1 ” ( ADK15695 .1 ; annotated as predicted acyl- ID NOs: 41 -44 , respectively ) or VorABCD from Pyococcus US 10 , 316 , 337 B2 10 furiosus (WP _ 011012106 . 1, VorA ; WP _ 011012105 .1 , Step 14 shows the conversion of 3 -hydroxybutyryl - CoA VorB ; WP_ 011012108 . 1 , VorC ; WP _ 011012107 . 1 , Vord ) to 3 -hydroxybutyrate . This step may be catalyzed by thio ( SEQ ID NOs : 45 -48 , respectively ) . VorABCD is a 4 -sub esterase ( EC 3 . 1 . 2 . 20 ) . The thioesterase may be, for unit enzyme. Clostridium autoethanogenum , Clostridium ljungdahlii, and Clostridium ragsdalei do not have known 5 example , TesB from Escherichia coli (NP _ 414986 .1 ) (SEQ native activity for this step . Escherichia coli does not have ID NO : 7 ) . This step may also be catalyzed by a putative known native activity for this step . thioesterase , e . g ., from Clostridium autoethanogenum or Step 11 shows the conversion of 2 -methylbutanoyl - CoA Clostridium ljungdahlii. In particular, three putative thio to 2 -methylcrotonyl - CoA . This step may be catalyzed by esterases have been identified in Clostridium autoethanoge 2 -methylbutanoyl - CoA dehydrogenase ( EC 1 . 3 . 99 . 12 ) . The 10 num : ( 1 ) “ thioesterase 1 ” (AGY74947 . 1 ; annotated as 2 -methylbutanoyl - CoA dehydrogenase may be , for example , palmitoyl- CoA hydrolase ; SED ID NO : 8 ) , ( 2 ) “ thioesterase AcdH from Streptomyces avermitilis (AAD44196 . 1 or 2 ” ( AGY75747 . 1 ; annotated as 4 -hydroxybenzoyl - CoA BAB69160 .1 ) (SEQ ID NO : 49) or AcdH from Streptomyces thioesterase ; SEQ ID NO : 9 ), and (3 ) “ thioesterase 3 ” coelicolor (AAD44195 . 1 ) (SEQ ID NO : 50 ) . Clostridium 15 (AGY75999 . 1 ; annotated as putative thioesterase ; SEQ ID autoethanogenum , Clostridium ljungdahlii , and Clostridium NO : 10 ). Three putative thioesterases have also been iden ragsdalei do not have known native activity for this step . Escherichia coli does not have known native activity for this tified in Clostridium ljungdahlii : ( 1 ) “ thioesterase 1 ” step . (ADK15695 . 1 ; annotated as predicted acyl - CoA thio Step 12 shows the conversion of 2 -methylcrotonyl - CoA 20 esterase 1 ; SEQ ID NO : 11 ) , ( 2 ) “ thioesterase 2 ” to 3 -hydroxyisovaleryl - CoA . This step may be catalyzed by ( ADK16655 . 1 ; annotated as predicted thioesterase ; SEQ ID crotonase/ 3 -hydroxybutyryl - CoA dehydratase ( EC NO : 12 ), and (3 ) “ thioesterase 3 ” (ADK16959 . 1; annotated 4 . 2 . 1 . 55 ) . The crotonase / 3 -hydroxybutyryl - CoA dehy as predicted thioesterase ; SEQ ID NO : 13 ) . This step may dratase may be , for example , Crt from Clostridium beijer also be catalyzed by phosphate butyryltransferase (EC inckii (ABR34202 . 1 ) (SEQ ID NO : 51 ), Crt from | 25 2 .3 . 1. 19 ) + butyrate kinase ( EC 2 .7 .2 . 7 ). Exemplary sources Clostridium acetobutylicum (NP _ 349318 . 1) (SEQ ID NO : for phosphate butyryltransferase and butyrate kinase are 52 ) , or LiuC from Myxococcus xanthus (WP _ 011553770 . 1 ). described elsewhere in this application . Native enzymes in This step may also be catalyzed by crotonyl - CoA carboxy Clostridium autoethanogenum , Clostridium ljungdahlii , and lase - reductase ( EC 1 . 3 . 1 . 86 ) . The crotonyl- CoA carboxy - 30 Clostridium ragsdalei ( or Escherichia coli ), such as thio lase- reductase may be , for example , Ccr from Treponema esterases from Clostridium autoethanogenum , may catalyze denticola (NP _ 971211. 1 ) (SEQ ID NO : 53 ) . This step may this step and result in the production of some amount of also be catalyzed by crotonyl- CoA reductase (EC 1. 3 .1 .44 ). downstream products . However, introduction of an exog The crotonyl -CoA reductase may be, for example , Ter from 35 enous enzyme or overexpression of an endogenous enzyme Euglena gracilis (AAW66853 . 1 ) (SEQ ID NO : 54 ) . This may be required to produce downstream products at desir step may also be catalyzed by a 3 -hydroxypropionyl - CoA able levels . Additionally , in certain embodiments , a disrup dehydratase (EC 4 .2 . 1 . 116 ). This 3 -hydroxypropionyl - CoA tive mutation may be introduced to an endogenous enzyme , dehydratase may be , for example , Msed _ 2001 from Metal such as an endogenous thioesterase , to reduce or eliminate losphaera sedula (WP 012021928 . 1 ) . This step may also be 40 competition with introduced Ptb -Buk . Step 15 shows the conversion of 3 - hydroxybutyrate to catalyzed by a enoyl- CoA hydratase . This enoyl- CoA acetoacetate . This step may be catalyzed by 3 - hydroxybu hydratase ( 4 . 2 . 1 . 17) may be , for example , YngF from Bacil tyrate dehydrogenase ( EC 1 . 1 . 1 . 30 ). The 3 - hydroxybutyrate lus anthracis (WP _ 000787371. 1 ). Clostridium autoethano dehydrogenase may be, for example , Bdh1 from Ralstonia genum , Clostridium ljungdahlii , and Clostridium ragsdalei 45 pickettii (BAE72684 . 1 ) (SEO ID NO : 60 ) or Bdh2 from do not have known native activity for this step . Escherichia Ralstonia pickettii (BAE72685 . 1 ) ( SEO ID NO : 61 ) . The coli does not have known native activity for this step . reverse reaction , the conversion of acetoacetate to 3 -hy Step 13 shows the conversion of acetoacetyl- CoA to droxybutyrate , may be catalyzed by different 3 -hydroxybu 3 - hydroxybutyryl- CoA . This step may be catalyzed by 3 -hy - tyrate dehydrogenase (EC 1 . 1 . 1 . 30 ) enzymes. For example , droxybutyryl- CoA dehydrogenase (EC 1 . 1 . 1 . 157 ) . The 50 the conversion of acetoacetate to 3 - hydroxybutyrate may be 3 - hydroxybutyryl - CoA dehydrogenase may be , for example , catalyzed by Bdh from Clostridium autoethanogenum Hbd from Clostridium beijerinckii (WP _ 011967675 . 1 ) ( AGY75962) ( SEQ ID NO : 62 ) . Clostridium ljungdahlii and (SEQ ID NO : 55 ) , Hbd from Clostridium acetobutylicum Clostridium ragsdalei likely have enzymes with similar (NP _ 349314 . 1 ) (SEQ ID NO : 56 ) , or Hbdl from activity . Escherichia coli does not have known native activ Clostridium kluyveri (WP _ 011989027 . 1 ) (SEQ ID NO : 57 ) . 55 ity for this step . This step may also be catalyzed by acetoacetyl - CoA reduc Step 16 shows the conversion of 3 -hydroxybutyrate to tase (EC 4 . 2 . 1 . 36 ) . The acetoacetyl- CoA reductase may be , 3 -hydroxybutyrylaldehyde . This step may be catalyzed by for example , PhaB from Cupriavidus necator aldehyde : ferredoxin oxidoreductase (EC 1 . 2 . 7 . 5 ) . The alde (WP _ 010810131. 1 ) (SEQ ID NO : 58 ) . This step may also be hyde: ferredoxin oxidoreductase ( AOR ) may be, for catalyzed by acetoacetyl - CoA hydratase ( EC 4 . 2 . 1 . 119 ) . Of 60 example , AOR from Clostridium autoethanogenum note , PhaB is R -specific and Hbd is S - specific . Additionally , (WP _ 013238665 . 1 ; WP _ 013238675 . 1 ) (SEQ ID NOs: 63 Hbdl from Clostridium kluyveri is NADPH - dependent and and 64 , respectively ) or AOR from Clostridium ljungdahlii Hbd from Clostridium acetobutylicum and Clostridium bei ( ADK15073 . 1 ; ADK15083 . 1 ) (SEQ ID NOs: 65 and 66 , jerinckii are NADH - dependent. Clostridium autoethanoge- respectively ) . In further embodiments , the aldehyde : ferre num , Clostridium ljungdahlii, and Clostridium ragsdalei do 65 doxin oxidoreductase may be or may be derived , for not have known native activity for this step . Escherichia coli example , from any of the following sources, the sequences does not have known native activity for this step . of which are publically available : US 10 ,316 ,337 B2 11

Description Microrganism Accession GeneID aldehyde: ferredoxin oxidoreductase Acidilobus saccharovorans 345 - 15 NC _014374 . 1 9498931 aldehyde: ferredoxin oxidoreductase Acidilobus saccharovorans 345 - 15 NC _ 014374 . 1 9499504 aldehyde: ferredoxin oxidoreductase Acidilobus saccharovorans 345 - 15 NC 014374 . 1 9499550 aldehyde : ferredoxin oxidoreductase Acidilobus saccharovorans 3 NC 014374 . 1 9498997 aldehyde: ferredoxin oxidoreductase Aciduliprofundum boonei T469 NC _ 013926 . 1 8828075 aldehyde : ferredoxin oxidoreductase Aciduliprofundum boonei T469 NC 013926 . 1 8828511 aldehyde: ferredoxin oxidoreductase Aciduliprofundum boonei T469 NC _ 013926 . 1 8828305 aldehyde : ferredoxin oxidoreductase Aciduliprofundum boonei 1469 NC 013926 . 1 8827762 aldehyde : ferredoxin oxidoreductase Aciduliprofundum boonei T469 NC 013926 . 1 8827370 aldehvde : ferredoxin oxidoreductase Aciduliprofundum sp . MAR08 - 339 NC 019942 . 1 14306579 aldehyde : ferredoxin oxidoreductase Aciduliprofundum sp . MAR08 - 339 NC _ 019942 . 1 14306982 aldehyde : ferredoxin oxidoreductase Aciduliprofundum sp . MAR08 - 339 NC _ 0 9942 . 1 14306639 aldehyde : ferredoxin oxidoreductase Aciduliprofundum sp . MAR08 - 339 NC _ 019942 . 1 14307339 aldehyde : ferredoxin oxidoreductase Aeropyrum pernix K1 NC _ 000854 . 2 1444491 aldehyde : ferredoxin oxidoreductase Archaeoglobus fulgidus DSM 4304 NC _ 000917 . 1 1483287 aldehyde : ferredoxin oxidoreductase Archaeoglobus fulgidus DSM 4304 NC _ 000917 . 1 1483233 aldehyde : ferredoxin oxidoreductase Archaeoglobus fulgidus DSM 4304 NC _ 000917 . 1 1483554 aldehyde : ferredoxin oxidoreductase Archaeoglobus fulgidus DSM 4304 NC _ 000917 . 1 1485513 aldehyde: ferredoxin oxidoreductase Archaeoglobus profundus DSM NC _ 013741 . 1 8738726 5631 aldehyde: ferredoxin oxidoreductase Archaeoglobus profundus DSM NC _ 013741. 1 8740019 5631 aldehyde :ferredoxin oxidoreductase Archaeoglobus sulfaticallidus NC _ 021169 . 1 15392228 PM70 - 1 aldehyde: ferredoxin oxidoreductase Archaeoglobus sulfaticallidus NC _ 021169. 1 15393814 PM70 - 1 aldehyde: ferredoxin oxidoreductase Archaeoglobus sulfaticallidus NC _ 021169. 1 15391826 PM70 - 1 aldehyde: ferredoxin oxidoreductase Archaeoglobus sulfaticallidus NC _ 021169. 1 15393763 PM70 - 1 aldehyde: ferredoxin oxidoreductase Archaeoglobus sulfaticallidus NC _ 021169. 1 15393491 PM70 - 1 aldehyde: ferredoxin oxidoreductase Archaeoglobus veneficus SNP6 NC 015320 . 1 10393142 aldehyde: ferredoxin oxidoreductase Archaeoglobus veneficus SNP6 NC 015320 . 1 10395048 aldehyde: ferredoxin oxidoreductase Caldisphaera lagunensis DSM NC 019791 . 1 14212403 15908 aldehyde: ferredoxin oxidoreductase Caldisphaera lagunensis DSM NC _ 019791. 1 14211524 15908 aldehyde: ferredoxin oxidoreductase Caldisphaera lagunensis DSM NC _ 019791 . 1 14212092 15908 aldehyde: ferredoxin oxidoreductase Caldisphaera lagunensis DSM NC _ 019791 . 1 14212561 15908 aldehyde : ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC _ 009954 . 1 5710116 aldehyde : ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC _ 009954 . 1 5710117 aldehyde : ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC _ 009954 . 1 5709088 aldehyde: ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC 009954 . 1 5708891 aldehyde :ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC 009954 . 1 5710478 aldehyde : ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC _ 009954 . 1 5710457 aldehyde : ferredoxin oxidoreductase Caldivirga maquilingensis IC - 167 NC 009954 . 1 5709696 aldehyde: ferredoxin oxidoreductase Candidatus Caldiarchaeum NC _ 022786 . 1 17602865 subterraneum aldehyde: ferredoxin oxidoreductase Candidatus Korarchaeum NC _ 010482 . 1 6094361 cryptofilum OPF8 aldehyde: ferredoxin oxidoreductase Candidatus Korarchaeum NC _ 010482 . 1 6094198 cryptofilum OPF8 aldehyde :ferredoxin oxidoreductase Candidatus Korarchaeum NC _ 010482 .1 6093546 cryptofilum OPF8 aldehyde: ferredoxin oxidoreductase Candidatus Korarchaeum NC _ 010482 . 1 6093319 cryptofilum OPF8 aldehyde: ferredoxin oxidoreductase Candidatus Korarchaeum NC _ 010482 . 1 6094057 cryptofilum OPF8 aldehyde : ferredoxin oxidoreductase Candidatus Korarchaeum NC _ 010482 . 1 6093563 cryptofilum OPF8 aldehyde : ferredoxin oxidoreductase Chloroflexus aurantiacus J - 10 - f1 NC _ 010175 . 1 5828639 aldehyde : ferredoxin oxidoreductase Clostridium acetobutylicum ATCC NC _ 003030 . 1 1118201 824 aldehyde: ferredoxin oxidoreductase Clostridium botulinum A sfr. ATCC NC _ 009495 . 1 5187636 3502 aldehyde : ferredoxin oxidoreductase Clostridium botulinum A str. Hall NC _ 009698 . 1 5400593 aldehyde : ferredoxin oxidoreductase Desulfovibrio vulgaris str. NC _ 002937 . 3 2796664 Hildenborough aldehyde :ferredoxin oxidoreductase Desulfovibrio vulgaris str . NC _ 002937. 3 2795337 Hildenborough aldehyde: ferredoxin oxidoreductase Desulfurococcus fermentans DSM NC _ 018001. 1 13061477 16532 aldehyde : ferredoxin oxidoreductase Desulfurococcus fermentans DSM NC _018001 . 1 13061068 16532 aldehyde: ferredoxin oxidoreductase Desulfurococcus fermentans DSM NC _ 018001. 1 13062247 16532 US 10 , 316 , 337 B2 14 -continued Description Microrganism Accession GeneID aldehyde: ferredoxin oxidoreductase Desulfurococcus kamchatkensis NC _011766 . 1 7171099 1221n aldehyde :ferredoxin oxidoreductase Desulfurococcus kamchatkensis NC _ 011766 . 1 7171759 1221n aldehyde :ferredoxin oxidoreductase Desulfurococcus kamchatkensis NC _ 011766 . 1 7170725 1221n aldehyde : ferredoxin oxidoreductase Desulfurococcus mucosus DSM NC _ 014961. 1 10152801 2162 aldehyde: ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC _ 013849 . 1 8778536 aldehyde : ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC _ 013849 . 1 8779007 aldehyde : ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC 013849 . 1 8778940 aldehyde: ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC _ 013849 . 1 8779639 aldehyde: ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC _ 013849 . 1 8778820 aldehyde: ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC _ 013849 . 1 8778745 aldehyde : ferredoxin oxidoreductase Ferroglobus placidus DSM 10642 NC 013849 . 1 8779874 aldehyde: ferredoxin oxidoreductase Fervidicoccus fontis Kam940 NC 017461 . 1 12449263 aldehyde : ferredoxin oxidoreductase Fervidicoccus fontis Kam940 NC _ 017461. 1 12449994 aldehyde: ferredoxin oxidoreductase Fervidicoccus fontis Kam940 NC 017461 . 1 12449294 aldehyde : ferredoxin oxidoreductase Fervidicoccus fontisis Kam940K NC 017461 . 1 12449682 aldehyde : ferredoxin oxidoreductase Geobacter sulfurreducens PCA NC _ 002939 . 5 2685730 aldehyde : ferredoxin oxidoreductase Geobacter sulfurreducens PCA NC 002939 . 5 2687039 aldehyde: ferredoxin oxidoreductase Halalkalicoccus jeotgali B3 NC _ 014297 . 1 9418623 aldehyde : ferredoxin oxidoreductase Halalkalicoccus jeotgali B3 NC 014297 . 1 9418760 aldehyde : ferredoxin oxidoreductase Halalkalicoccus jeotgali B3 NC _ 014297 . 1 9420819 aldehyde: ferredoxin oxidoreductase Halalkalicoccus jeotgali B3 NC 014297 . 1 9418748 aldehyde: ferredoxin oxidoreductase Haloarcula hispanica ATCC 33960 NC _ 015948 . 1 11051410 aldehyde: ferredoxin oxidoreductase Haloarcula hispanica ATCC 33960 NC _ 015948 . 1 11050783 aldehyde: ferredoxin oxidoreductase Haloarcula hispanica ATCC 33960 NC _ 015948 . 1 11051433 aldehyde : ferredoxin oxidoreductase Haloarcula hispanica N601 NC _ 023013 . 1 23805333 aldehyde: ferredoxin oxidoreductase Haloarcula hispanica N601 NC 023013 . 1 23805138 aldehyde: ferredoxin oxidoreductase Haloarcula hispanica N601 NC _ 023013 . 1 23804665 aldehyde: ferredoxin oxidoreductase Haloarcula marismortui ATCC NC _ 006396 . 1 3127969 43049 aldehyde: ferredoxin oxidoreductase Haloarcula marismortui ATCC NC _ 006396 .1 3129232 43049 aldehyde: ferredoxin oxidoreductase Haloferax mediterranei ATCC NC _ 017941. 2 13028168 33500 aldehyde : ferredoxin oxidoreductase Haloferax mediterranei ATCC NC _ 017941. 2 13028399 33500 aldehyde: ferredoxin oxidoreductase Haloferax volcanii DS2 NC _ 013964 . 1 8919329 aldehyde: ferredoxin oxidoreductase Haloferax volcanii DS2 NC _ 013964 . 1 8919033 aldehyde: ferredoxin oxidoreductase Haloferax volcanii DS2 NC _ 013967 . 1 8926544 aldehyde: ferredoxin oxidoreductase Halogeometricum borinquense DSM NC _014735 .1 9989054 11551 aldehyde: ferredoxin oxidoreductase Halogeometricum borinquense DSM NC _ 014729. 1 9994424 11551 aldehyde: ferredoxin oxidoreductase Halogeometricum borinquense DSM NC _ 014729 . 1 9992444 11551 aldehyde : ferredoxin oxidoreductase halophilic archaeon DL31 NC _ 015954 . 1 11095016 aldehyde: ferredoxin oxidoreductase halophilic archaeon DL31 NC _ 015954 . 1 11095541 aldehyde: ferredoxin oxidoreductase halophilic archaeon DL31 NC _ 015954 . 1 11094595 aldehyde: ferredoxin oxidoreductase halophilic archaeon DL31 NC _ 015954 . 1 11096497 aldehyde : ferredoxin oxidoreductase halophilic archaeon DL31 NC _ 015954 . 1 11094563 aldehyde: ferredoxin oxidoreductase halophilic archaeon DL31 NC 015954 . 1 11095602 aldehyde : ferredoxin oxidoreductase Halopiger xanaduensis SH - 6 NC 015666 . 1 10799161 aldehyde : ferredoxin oxidoreductase Halopiger xanaduensis SH - 6 NC 015658 . 1 10795465 aldehyde : ferredoxin oxidoreductase Halopiger xanaduensis SH - 6 NC _ 015666 . 1 10798686 aldehyde : ferredoxin oxidoreductase Halopiger xanaduensis SH - 6 NC 015666 . 1 10796679 aldehyde : ferredoxin oxidoreductase Halorubrum lacusprofundi ATCC NC _ 012029 . 1 7400122 49239 aldehyde :ferredoxin oxidoreductase Halorubrum lacusprofundi ATCC NC _ 012029 . 1 7400291 49239 aldehyde: ferredoxin oxidoreductase Halorubrum lacusprofundi ATCC NC _012029 .1 7400689 49239 aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013744 . 1 8744461 5511 aldehyde : ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013744 . 1 8744695 5511 aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013743 . 1 8740954 5511 aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013745 . 1 8745418 5511 aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013743 . 1 8742968 5511 US 10 , 316 , 337 B2 15 16 - continued Description Microrganism Accession GeneID aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _013743 . 1 8741246 5511 aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013743. 1 8741269 5511 aldehyde: ferredoxin oxidoreductase Haloterrigena turkmenica DSM NC _ 013745 . 1 8745313 5511 aldehyde : ferredoxin oxidoreductase Hyperthermus butylicus DSM 5456 NC _ 008818 . 1 4781896 aldehyde : ferredoxin oxidoreductase Hyperthermus butylicus DSM 5456 NC _ 008818 . 1 4782266 aldehyde : ferredoxin oxidoreductase Hyperthermus butylicus DSM 5456 NC _ 008818 . 1 4782804 aldehyde : ferredoxin oxidoreductase Hyperthermus butylicus DSM 5456 NC _ 008818 . 1 4781774 aldehyde : ferredoxin oxidoreductase Ignicoccus hospitalis KIN4 / I NC _ 009776 . 1 5562477 aldehyde : ferredoxin oxidoreductase Ignicoccus hospitalis KIN4/ I NC 009776 . 1 5562774 aldehyde: ferredoxin oxidoreductase Ignisphaera aggregans DSM 17230 NC _ 014471. 1 9716798 aldehyde : ferredoxin oxidoreductase Methanocaldococcus jannaschii NC _ 000909 . 1 1452083 DSM 2661 aldehyde : ferredoxin oxidoreductase Methanocella arvoryzae MRE50 NC _ 009464 . 1 5142690 aldehyde : ferredoxin oxidoreductase Methanocella arvoryzae MRE50 NC 009464 . 1 5143773 aldehyde: ferredoxin oxidoreductase Methanocella conradii HZ254 NC _ 017034 . 1 11972399 aldehyde : ferredoxin oxidoreductase Methanocella conradii HZ254 NC 017034 . 1 11971349 aldehyde : ferredoxin oxidoreductase Methanocella paludicola SANAE NC _ 013665 . 1 8680711 aldehyde: ferredoxin oxidoreductase Methanocella paludicola SANAE NC 013665 . 1 8680676 aldehyde : ferredoxin oxidoreductase Methanocorpusculum labreanum Z NC 008942 . 1 4795790 aldehyde : ferredoxin oxidoreductase Methanoculleus marisnigri JR1 NC _ 009051. 1 4847673 aldehyde: ferredoxin oxidoreductase Methanohalobium evestigatum Z NC _014253 . 1 9347460 7303 aldehyde: ferredoxin oxidoreductase Methanohalobium evestigatum Z NC _ 014253. 1 9347022 7303 aldehyde: ferredoxin oxidoreductase Methanolobus psychrophilus R15 NC _018876 . 1 13845119 aldehyde : ferredoxin oxidoreductase Methanomethylovorans hollandica NC _ 019977 . 1 14408029 DSM 15978 aldehyde : ferredoxin oxidoreductase Methanosaeta harundinacea 6AC NC _ 017527 . 1 12511443 aldehyde : ferredoxin oxidoreductase Methanosaeta thermophila PT NC _ 008553 . 1 4462364 aldehyde : ferredoxin oxidoreductase Methanosalsum zhilinae DSM 4017 NC _ 015676 . 1 10822365 aldehyde : ferredoxin oxidoreductase Methanosarcina acetivorans C2A NC _ 003552 . 1 1475882 aldehyde : ferredoxin oxidoreductase Methanosarcina acetivorans C2A NC _ 003552 . 1 1474856 aldehyde : ferredoxin oxidoreductase Methanosarcina acetivorans C2A NC _ 003552 . 1 1473602 aldehyde : ferredoxin oxidoreductase Methanosarcina barkeri str . Fusaro NC _ 007355 . 1 3625763 aldehyde : ferredoxin oxidoreductase Methanosarcina mazei Gol NC 003901 . 1 1479263 aldehyde : ferredoxin oxidoreductase Methanosarcina mazei Gol NC 003901. 1 1481668 aldehyde : ferredoxin oxidoreductase Methanosarcina mazei Gol NC 003901. 1 1480987 aldehyde : ferredoxin oxidoreductase Methanosarcina mazei Tuc01 NC _ 020389 . 1 14656065 aldehyde : ferredoxin oxidoreductase Methanosarcina mazei Tuc01 NC 020389 . 1 14656771 aldehyde : ferredoxin oxidoreductase Methanosarcina mazei Tuco1 NC _ 020389 . 1 14654304 aldehyde: ferredoxin oxidoreductase Methanosphaerula palustris E1 -90N C _ 011832. 1 7271108 aldehyde : ferredoxin oxidoreductase Methanospirillum hungatei JF - 1 NC 007796 . 1 3924565 aldehyde: ferredoxin oxidoreductase Methylomicrobium alcaliphilum 20Z NC _ 016112 . 1 11361147 aldehyde :ferredoxin oxidoreductase Moorella thermoacetica ATCC NC _ 007644 . 1 3831332 39073 aldehyde :ferredoxin oxidoreductase Moorella thermoacetica ATCC NC _ 007644 . 1 3830998 39073 aldehyde: ferredoxin oxidoreductase Moorella thermoacetica ATCC NC _ 007644 . 1 3831866 39073 aldehyde :ferredoxin oxidoreductase Natrialba magadii ATCC 43099 NC _ 013922 . 1 8824961 aldehyde : ferredoxin oxidoreductase Natrialba magadii ATCC 43099 NC _ 013922. 1 8823392 aldehyde : ferredoxin oxidoreductase Natrialba magadii ATCC 43099 NC _ 013923 . 1 8826737 aldehyde : ferredoxin oxidoreductase Natrialba magadii ATCC 43099 NC 013922 . 1 8825516 aldehyde : ferredoxin oxidoreductase Natrinema pellirubrum DSM 15624 NC _ 019962 . 1 14335278 aldehyde : ferredoxin oxidoreductase Natrinema pelli rubrum DSM 15624 NC _ 019962 . 1 14333050 aldehyde : ferredoxin oxidoreductase Natrinema pelli rubrum DSM 15624 NC _ 019962 . 1 14333754 aldehyde : ferredoxin oxidoreductase Natrinema sp . J7 - 2 NC _ 018224 . 1 13349954 aldehyde : ferredoxin oxidoreductase Natronobacterium gregoryi SP2 NC 019792 . 1 14210296 aldehyde : ferredoxin oxidoreductase Natronobacterium gregoryi SP2 NC _ 019792. 1 14207133 aldehyde: ferredoxin oxidoreductase Natronobacterium gregoryi SP2 NC _019792 . 1 14209682 aldehyde: ferredoxin oxidoreductase Natronobacterium gregoryi SP2 NC _019792 . 1 14207576 aldehyde : ferredoxin oxidoreductase Natronobacterium gregorvi SI NC _ 019792 . 1 14206941 aldehyde: ferredoxin oxidoreductase Natronobacterium gregoryi SP2 NC _ 019792. 1 14206532 aldehyde :ferredoxin oxidoreductase Natronococcus occultus SP NC 019974 . 1 14403316 aldehyde :ferredoxin oxidoreductase Natronococcus occultus SP4 NC _ 019974 . 1 14405255 aldehyde: ferredoxin oxidoreductase Natronococcus occultus SP4 NC _ 019974 . 1 14403781 aldehyde : ferredoxin oxidoreductase Natronococcus occultus SP4 NC _ 019974 . 1 14402014 aldehyde : ferredoxin oxidoreductase Natronomonas moolapensis 8 . 8 . 11 NC 020388 . 1 14651997 aldehyde : ferredoxin oxidoreductase Natronomonas moolapensis 8 . 8 . 11 NC _ 020388 . 1 14652892 aldehyde : ferredoxin oxidoreductase Natronomonas moolapensis 8 . 8 . 11 NC _ 020388 . 1 14651999 aldehyde : ferredoxin oxidoreductase Natronomonas pharaonis DSM 2160 NC _ 007427 . 1 3694680 aldehyde: ferredoxin oxidoreductase Natronomonas pharaonis DSM 2160 NC _ 007426 . 1 3702508 aldehyde : ferredoxin oxidoreductase Natronomonas pharaonis DSM 2160 NC _ 007426 . 1 3702507 aldehyde: ferredoxin oxidoreductase Natronomonas pharaonis DSM 2160 NC _ 007426 . 1 3702509 US 10 , 316 , 337 B2 17 -continued Description Microrganism Accession GeneID aldehyde : ferredoxin oxidoreductase Pyrobaculum aerophilum str. IM2 NC _ 003364 . 1 1464236 aldehyde: ferredoxin oxidoreductase Pyrobaculum aerophilum str . IM2 NC _ 003364 . 1 1464102 aldehyde :ferredoxin oxidoreductase Pyrobaculum aerophilum str. IM2 NC 003364 . 1 1465126 aldehyde: ferredoxin oxidoreductase Pyrobaculum aerophilum str . IM2 NC _ 003364 . 1 1465445 aldehyde : ferredoxin oxidoreductase Pyrobaculum arsenaticum DSM NC _ 009376 . 1 5055904 13514 aldehyde: ferredoxin oxidoreductase Pyrobaculum arsenaticum DSM NC _ 009376 . 1 5055700 13514 aldehyde: ferredoxin oxidoreductase Pyrobaculum arsenaticum DSM NC _ 009376 . 1 5054881 13514 aldehyde: ferredoxin oxidoreductase Pyrobaculum arsenaticum DSM 9376 . 1 5054644 13514 aldehyde: ferredoxin oxidoreductase Pyrobaculum arsenaticum DSM NC _ 009376 . 1 5054547 13514 aldehyde: ferredoxin oxidoreductase Pyrobaculum calidifontis JCM NC _ 009073 . 1 4910224 11548 aldehyde: ferredoxin oxidoreductase Pyrobaculum calidifontis JCM NC _ 009073. 1 4908822 11548 aldehyde: ferredoxin oxidoreductase Pyrobaculum calidifontis JCM NC _ 009073 . 1 4909927 11548 aldehyde: ferredoxin oxidoreductase Pyrobaculum calidifontis JCM NC _ 009073 . 1 4910099 11548 aldehyde: ferredoxin oxidoreductase Pyrobaculum islandicum DSM 4184 NC _ 008701. 1 4617364 aldehyde : ferredoxin oxidoreductase Pyrobaculum islandicum DSM 4184 NC _ 008701 . 1 4616724 aldehyde : ferredoxin oxidoreductase Pyrobaculum islandicum DSM 4184 NC _ 008701 . 1 4617494 aldehyde: ferredoxin oxidoreductase Pyrobaculum neutrophilum V24Sta NC _ 010525 . 1 6165427 aldehyde : ferredoxin oxidoreductase Pyrobaculum neutrophilum V24Sta NC _ 010525 . 1 6164958 aldehyde: ferredoxin oxidoreductase Pyrobaculum neutrophilum V24Sta NC _ 010525 . 1 6164976 aldehyde: ferredoxin oxidoreductase Pyrobaculum oguniense TEZ NC _ 016885 . 1 11853778 aldehyde : ferredoxin oxidoreductase Pyrobaculum oguniense TEZ NC _016885 . 1 11854024 aldehyde : ferredoxin oxidoreductase Pyrobaculum oguniense TEZ NC _ 016885 . 1 11856490 aldehyde : ferredoxin oxidoreductase Pyrobaculum oguniense TE7 NC _ 016885 . 1 11856176 aldehyde : ferredoxin oxidoreductase Pyrobaculum oguniense TE7 NC _ 016885 . 1 11854908 aldehyde : ferredoxin oxidoreductase Pyrobaculum sp . 1860 NC 016645 . 1 11594868 aldehyde : ferredoxin oxidoreductase Pyrobaculum sp . 1860 NC _ 016645 . 1 11596631 aldehyde : ferredoxin oxidoreductase Pyrobaculum sp . 1860 NC 016645 . 1 11594049 aldehyde : ferredoxin oxidoreductase Pyrococcus abyssi GE5 NC 000868 . 1 1496313 aldehyde: ferredoxin oxidoreductase Pyrococcus abyssi GE5 NC 000868 . 1 1495669 aldehyde :ferredoxin oxidoreductase Pyrococcus abyssi GE5 NC 000868 . 1 1496580 aldehyde : ferredoxin oxidoreductase Pyrococcus abyssi GE5 NC 000868 . 1 1495287 aldehyde : ferredoxin oxidoreductase Pyrococcus furiosus COM1 NC _ 018092 . 1 13302148 aldehyde : ferredoxin oxidoreductase Pyrococcus furiosus COM1 NC O 18092 . 1 13301806 aldehyde : ferredoxin oxidoreductase Pyrococcus furiosus COM1 NC _ 018092 . 1 13301219 aldehyde: ferredoxin oxidoreductase Pyrococcus furiosus COM1 NC 018092 . 1 13300785 aldehyde : ferredoxin oxidoreductase Pyrococcus furiosus DSM 3638 NC _ 003413 . 1 1468181 aldehyde: ferredoxin oxidoreductase Pyrococcus furiosus DSM 3638 NC _ 003413 . 1 1469073 aldehyde : ferredoxin oxidoreductase Pyrococcus furiosus DSM 3638 NC 003413 . 1 1469843 aldehyde: ferredoxin oxidoreductase Pyrococcus horikoshii OT3 NC _ 000961. 1 1443218 aldehyde : ferredoxin oxidoreductase Pyrococcus horikoshii OT3 NC _ 000961. 1 1443341 aldehyde : ferredoxin oxidoreductase Pyrococcus horikoshii OT3 NC 000961 . 1 1443932 aldehyde: ferredoxin oxidoreductase Pyrococcus horikoshii OT3 NC 000961. 1 1443598 aldehyde: ferredoxin oxidoreductase Pyrococcus sp . NA2 NC 015474 . 1 10555029 aldehyde : ferredoxin oxidoreductase Pyrococcus sp . NA2 NC 015474 . 1 10554020 aldehyde: ferredoxin oxidoreductase Pyrococcus sp . NA2 NC _ 015474 . 1 10555341 aldehyde : ferredoxin oxidoreductase Pyrococcus sp . ST04 NC 017946 . 1 13022107 aldehyde : ferredoxin oxidoreductase Pyrococcus sp . ST04 NC 017946 . 1 13022436 aldehyde : ferredoxin oxidoreductase Pyrococcus sp . ST04 NC _ 017946 . 1 13021314 aldehyde : ferredoxin oxidoreductase Pyrococcus yayanosii CH1 NC _ 015680 . 1 10837518 aldehyde : ferredoxin oxidoreductase Pyrococcus yayanosii CH1 NC 015680 . 1 10837112 aldehyde : ferredoxin oxidoreductase Pyrococcus yayanosii CH1 NC _ 015680 . 1 10837264 aldehyde : ferredoxin oxidoreductase Pyrolobus fumarii 1A NC 015931 . 1 11138144 aldehyde : ferredoxin oxidoreductase Pyrolobus fumarii 1A NC 015931 . 1 11138776 aldehyde : ferredoxin oxidoreductase Pyrolobus fumarii 1A NC 015931 . 1 11139127 aldehyde: ferredoxin oxidoreductase Rhodospirillum rubrum ATCC NC _ 007643 . 1 3833668 11170 aldehyde: ferredoxin oxidoreductase Staphylothermus hellenicus DSM NC _ 014205 . 1 9234557 12710 aldehyde: ferredoxin oxidoreductase Staphylothermus hellenicus DSM NC _ 014205. 1 9233414 12710 aldehyde: ferredoxin oxidoreductase Staphylothermus hellenicus DSM NC 014205 . 1 9234134 12710 aldehyde :ferredoxin oxidoreductase Staphylothermus hellenicus DSM NC _ 014205 . 1 9234110 12710 aldehyde : ferredoxin oxidoreductase Staphylothermus marinus F1 NC _ 009033. 1 4907444 aldehyde : ferredoxin oxidoreductase Staphylothermus marinus F1 NC _ 009033 . 1 4907343 aldehyde: ferredoxin oxidoreductase Thermanaerovibrio NC _ 013522 . 1 8630284 acidaminovorans DSM 6589 US 10 , 316 , 337 B2 19 20 - continued Description Microrganism Accession GeneID aldehyde: ferredoxin oxidoreductase Thermanaerovibrio NC _ 013522 . 1 8630027 acidaminovorans DSM 6589 aldehyde: ferredoxin oxidoreductase Thermanaerovibrio NC _ 013522 . 1 8630623 acidaminovorans DSM 6589 aldehyde: ferredoxin oxidoreductase Thermoanaerobacter wiegelii NC _ 015958 . 1 11082596 Rt8 .B1 aldehyde : ferredoxin oxidoreductase Thermococcus barophilus MP NC _ 014804 . 1 10041639 aldehyde : ferredoxin oxidoreductase Thermococcus barophilus MP NC 014804 . 1 10041106 aldehyde : ferredoxin oxidoreductase Thermococcus barophilus MP NC 014804 . 1 10042460 aldehyde : ferredoxin oxidoreductase Thermococcus cleftensis NC _ 018015 . 1 13037745 aldehyde : ferredoxin oxidoreductase Thermococcus cleftensis NC 018015 . 1 13038896 aldehyde : ferredoxin oxidoreductase Thermococcus cleftensis NC 018015 . 1 13037242 aldehyde : ferredoxin oxidoreductase Thermococcus gammatolerans EJ3 NC _ 012804 . 1 7988317 aldehyde : ferredoxin oxidoreductase Thermococcus gammatolerans EJ3 NC _ 012804 . 1 7987451 aldehyde: ferredoxin oxidoreductase Thermococcus kodakarensis KODI NC _ 006624 . 1 3233851 ald hy ferredoxin oxidoreductase Thermococcus kodakarensis KOD1 NC 006624 . 1 3233735 aldehyde : ferredoxin oxidoreductase Thermococcus litoralis DSM 5473 NC _ 022084 . 1 16550741 aldehyde: ferredoxin oxidoreductase Thermococcus litoralis DSM 5473 NC _ 022084 . 1 16548761 aldehyde: ferredoxin oxidoreductase Thermococcus litoralis DSM 5473 NC _ 022084 . 1 16550885 aldehyde : ferredoxin oxidoreductase Thermococcus onnurineus NA1 NC 011529 . 1 7018383 aldehyde : ferredoxin oxidoreductase Thermococcus onnurineus NA1 NC 011529 . 1 7016739 aldehyde : ferredoxin oxidoreductase Thermococcus onnurineus NA1 NC 011529 . 1 7017051 aldehyde : ferredoxin oxidoreductase Thermococcus onnurineus NAI NC 011529 . 1 7017476 aldehyde : ferredoxin oxidoreductase Thermococcus sibiricus MM 739 NC 012883 . 1 8096638 aldehyde : ferredoxin oxidoreductase Thermococcus sibiricus MM 739 NC 012883 . 1 8096005 aldehyde: ferredoxin oxidoreductase Thermococcus sibiricus MM 739 NC 012883 . 1 8096629 aldehyde : ferredoxin oxidoreductase Thermococcus sibiricus MM 739 NC 012883 . 1 8095463 aldehyde: ferredoxin oxidoreductase Thermococcus sibiricus MM 739 NC _ 012883 . 1 8096131 aldehyde : ferredoxin oxidoreductase Thermococcus sibiricus MM 739 NC _ 012883 . 1 8096636 aldehyde : ferredoxin oxidoreductase Thermococcus sp . 4557 NC _ 015865 . 1 11015504 aldehyde : ferredoxin oxidoreductase Thermococcus sp . 4557 NC _ 015865 . 1 11015249 aldehyde : ferredoxin oxidoreductase Thermococcus sp . 4557 NC _ 015865 . 1 11015571 aldehyde : ferredoxin oxidoreductase Thermococcus sp . AM4 NC _ 016051 . 1 7419050 aldehyde : ferredoxin oxidoreductase Thermococcus sp . AM4 NC _ 016051 . 1 7418514 aldehyde : ferredoxin oxidoreductase Thermococcus sp . AM4 NC _ 016051. 1 7420292 aldehyde : ferredoxin oxidoreductase Thermodesulfovibrio vellowstoniiy NC _ 011296 . 1 6941429 DSM 11347 aldehyde: ferredoxin oxidoreductase Thermodesulfovibrio yellowstonii NC _ 011296 . 1 6943174 DSMT 11347 aldehyde: ferredoxin oxidoreductase Thermodesulfovibrio yellowstonii NC _ 011296 . 1 6941905 DSM 11347 aldehyde: ferredoxin oxidoreductase Thermofilum pendens Hrk 5 NC _ 008698 . 1 4602054 aldehyde : ferredoxin oxidoreductase Thermofilum pendens Hrk 5 NC _ 008698 . 1 4601386 aldehyde: ferredoxin oxidoreductase Thermofilum pendens Hrk 5 NC 008698 . 1 4600878 aldehyde : ferredoxin oxidoreductase Thermofilum pendens Hrk 5 NC _ 008698 . 1 4600730 aldehyde : ferredoxin oxidoreductase Thermofilum sp . 1910b NC _ 0220931 . 16572780 aldehyde : ferredoxin oxidoreductase Thermofilum sp . 1910b NC _ 0220931 . 16572926 aldehyde: ferredoxin oxidoreductase Thermofilum sp . 1910b NC _ 022093 . 1 16573009 aldehyde: ferredoxin oxidoreductase Thermofilum sp . 1910b NC _ 022093. 1 16574342 aldehyde : ferredoxin oxidoreductase Thermogladius cellulolyticus 1633 NC 017954 . 1 13012904 aldehyde: ferredoxin oxidoreductase Thermoplasma acidophilum DSM NC _ 002578 . 1 1456355 1728 aldehyde: ferredoxin oxidoreductase Thermoplasma acidophilum DSM NC _ 002578 . 1 1456646 1728 aldehyde: ferredoxin oxidoreductase Thermoplasma volcanium GSS1 NC _ 002689 . 2 1441901 aldehyde : ferredoxin oxidoreductase Thermoplasma volcanium GSS1 NC _ 002689 . 2 1441379 aldehyde : ferredoxin oxidoreductase Thermoproteus tenax Kra 1 NC _ 016070 . 1 11262174 aldehyde : ferredoxin oxidoreductase Thermoproteus tenax Kra 1 NC 016070 . 1 11262275 aldehyde : ferredoxin oxidoreductase Thermoproteus tenax Kra 1 NC 016070 . 1 11262652 aldehyde : ferredoxin oxidoreductase Thermoproteus tenax Kra 1 NC _ 016070 . 1 11262926 aldehyde : ferredoxin oxidoreductase Thermoproteus uzoniensis 768 - 20 NC 015315 . 1 10361668 aldehyde : ferredoxin oxidoreductase Thermoproteus uzoniensis 768- 20 NC _ 015315 . 1 10361250 aldehyde : ferredoxin oxidoreductase Thermoproteus uzoniensis 768 - 20 NC _ 015315 . 1 10360972 aldehyde: ferredoxin oxidoreductase Thermosphaera aggregans DSM NC _014160 . 1 9165115 11486 aldehyde: ferredoxin oxidoreductase Thermosphaera aggregans DSM NC _ 014160 . 1 9165462 11486 aldehyde: ferredoxin oxidoreductase Thermus thermophilus HB8 NC _ 006461. 1 3168554 aldehyde : ferredoxin oxidoreductase Thermus thermophilus HB8 NC 006461. 1 3168612 aldehyde : ferredoxin oxidoreductase Vulcanisaeta distributa DSM 14429 NC 014537. 1 9753145 aldehyde: ferredoxin oxidoreductase Vulcanisaeta distributa DSM 14429 NC _ 014537 . 1 9750947 aldehyde : ferredoxin oxidoreductase Vulcanisaeta distributa DSM 14429 NC _ 014537 . 1 9750989 aldehyde : ferredoxin oxidoreductase Vulcanisaeta distributa DSM 14429 NC _ 014537 . 1 9753486 aldehyde : ferredoxin oxidoreductase Vulcanisaeta distributa DSM 14429 NC _ 014537 . 1 9751414 aldehyde: ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 -28 NC _ 015151. 1 10288238 aldehyde : ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 -28 NC _ 015151 . 1 10288894 aldehyde: ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 -28 NC _ 015151. 1 10288574 US 10 , 316 , 337 B2 21 -continued Description Microrganism Accession GeneID aldehyde: ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 -28 NC _ 015151. 1 10288827 aldehyde: ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 -28 NC 015151. 1 10288607 ald ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 - 28 NC 015151. 1 10288523 aldehyde : ferredoxin oxidoreductase Vulcanisaeta moutnovskia 768 - 28 NC _ 015151 . 1 10288815

AOR catalyzes the reaction of an acid and reduced 10 have known native activity for this step . Escherichia coli ferredoxin to form an aldehyde and oxidized ferredoxin . In does not have known native activity for this step . acetogens, this reaction can be coupled to oxidation CO ( via Step 19 shows the conversion of 3 -hydroxybutyryl - CoA CO dehydrogenase , EC 1 . 2 .7 . 4 ) or hydrogen ( via ferre - to 2 -hydroxyisobutyryl - CoA . This step may be catalyzed by doxin - dependent hydrogenase , EC 1. 12. 7 . 2 or 1 . 12. 1 . 4 ) that 2 -hydroxyisobutyryl - CoA mutase (EC 5 . 4 .99 . - ) . The 2 -hy both yield reduced ferredoxin (Köpke , Curr Opin Biotech - droxyisobutyryl- CoA mutase may be , for example, HcmAB nol 22 : 320 - 325 , 2011 ; Köpke , PNAS USA , 107 : 13087 from Aquincola tertiaricarbonis ( AFK77668 . 1 , large sub 13092, 2010 ) . Clostridium autoethanogenum , Clostridium unit ; AFK77665 . 1 , small subunit ) (SEQ ID NOs: 81 and 82 , ljungdahlii, and Clostridium ragsdalei have native activity respectively ) or HcmAB from Kyrpidia tusciae for this step . However , overexpression of endogenous AOR 20 (WP _ 013074530 . 1 , large subunit ; WP _ 013074531. 1 , small or introduction of an exogenous AOR in Clostridium subunit ) (SEQ ID NOs: 83 and 84 , respectively ) . Chaperone autoethanogenum , Clostridium ljungdahlii , or Clostridium MeaB (AFK77667 . 1 , Aquincola tertiaricarbonis ; ragsdalei may be desirable to enhance product yields. Alter - WP _ 013074529 . 1 , Kyrpidia tusciae ) (SEQ ID NOs: 85 and natively , exogenous AOR may be introduced into a micro - 86 , respectively ) has been described to improve activity of organism that does not natively comprise AOR , e . g. , E . coli. 25 HcmAB by reactivating HcmAB , although MeaB is not In particular, the co -expression of Ptb -Buk and AOR (and , required for HcmAB function ( Yaneva , J Biol Chem , 287 : optionally , Adh ) may enable such a microorganism to pro - 15502 -15511 , 2012 ) . Clostridium autoethanogenum , duce new non - native products . Clostridium ljungdahlii, and Clostridium ragsdalei do not Step 17 shows the conversion of 3 - hydroxybutyrylalde - have known native activity for this step . Escherichia coli hyde to 1 , 3 -butanediol . This step may be catalyzed by 30 does not have known native activity for this step . alcohol dehydrogenase ( EC 1 . 1 . 1 . 1 . or 1 . 1 . 1 . 2 . ) . Alcohol Step 20 shows the conversion of 2 -hydroxyisobutyryl dehydrogenase can convert an aldehyde and NAD ( P ) H to an COA to 2 - hydroxyisobutyrate . This step may be catalyzed by alcohol and NAD ( P ) . The alcohol dehydrogenase may be, phosphate butyryltransferase ( EC 2 . 3. 1 . 19 ) + butyrate kinase for example, Adh from Clostridium autoethanogenum (EC 2 . 7 . 2 . 7 ) . Exemplary sources for phosphate butyryltrans ( AGY76060 . 1 ) ( SEO ID NO : 67 ) . Clostridium liungdahlij 35 ferase and butyrate kinase are described elsewhere in this application . Clostridium autoethanogenum , Clostridium ( ADK17019. 1 ) (SEQ ID NO : 68) , or Clostridium ragsdalei , ljungdahlii, and Clostridium ragsdalei do not have known Bdh? from Clostridium acetobutylicum (NP _ 349891. 1 ) native activity for this step . Escherichia coli does not have (SEQ ID NO : 69 ) , Bdh from Clostridium beijerinckii known native activity for this step . (WP _ 041897187 . 1) (SEQ ID NO : 70 ) , Bdh1 from a40 Step 21 shows the conversion of acetyl- CoA to succinyl Clostridium ljungdahlii ( YP _ 003780648 .1 ) (SEQ ID NO : COA . This step encompasses a number of enzymatic reac 71 ) , Bdhl from Clostridium autoethanogenum tions involved in the reductive TCA pathway , which is ( AGY76060 . 1 ) (SEQ ID NO : 72 ) , Bdh2 from Clostridium natively present in many bacteria , including Clostridium ljungdahlii (YP _ 003782121 . 1 ) (SEQ ID NO : 73 ) , Bdh2 autoethanogenum , Clostridium ljungdahlii, and Clostridium from Clostridium autoethanogenum ( AGY74784 . 1 ) (SEQ 45 ragsdalei (and Escherichia coli ) (Brown , Biotechnol Biofu ID NO : 74 ), AdhEl from Clostridium acetobutylicum els , 7 : 40 , 2014 ; U . S . Pat. No. 9 ,297 ,026 ) . Enzymes involved (NP _ 149325 . 1 ) ( SEQ ID NO : 75 ) , AdhE2 from Clostridium in the conversion of acetyl- CoA to succinyl- CoA may acetobutylicum (NP _ 149199 . 1 ) (SEQ ID NO : 76 ) , AdhE include pyruvate : ferredoxin oxidoreductase (PFOR ) (EC from Clostridium beijerinckii (WP _ 041893626 . 1 ) (SEQ ID 1 . 2 . 7 . 1 ) , pyruvate carboxylase (PYC ) ( EC 6 .4 . 1 . 1 ) , malic NO : 77 ) , AdhEl from Clostridium autoethanogenum 50 enzyme/ malate dehydrogenase ( EC 1 . 1 . 1. 38 , EC 1 . 1 . 1 . 40 ) , (WP _ 023163372 . 1) ( SEQ ID NO : 78 ) , or AdhE2 from pyruvate phosphate dikinase (PPDK ) (EC : 2 . 7 . 9 . 1 ), PEP Clostridium autoethanogenum (WP _ 023163373 . 1 ) ( SEQ ID carboxykinase (PCK ) ( EC 4 . 1 . 1 . 49 ) , fumarate hydratase / NO : 79 ) . Clostridium autoethanogenum , Clostridium ljung fumerase (EC 4 .2 . 1. 2 ), fumarate reductase (EC 1 .3 . 5 .1 )/ dahlii, and Clostridium ragsdalei have native activity for succinate dehydrogenase ( EC 1 . 3 . 5 . 4 ) , and succinyl- CoA this step . However, overexpression of endogenous alcohol 55 synthetase ( EC 6 . 2 .1 . 5 ) . The pyruvate : ferredoxin oxi dehydrogenase or introduction of an exogenous alcohol doreductase may be , for example , from Clostridium dehydrogenase in Clostridium autoethanogenum , autoethanogenum ( AGY75153 , AGY77232 ) or Escherichia Clostridium ljungdahlii , or Clostridium ragsdalei may be coli (NP _ 415896 ) . The pyruvate carboxylase may be , for desirable to enhance product yields. Escherichia coli likely example , from Clostridium autoethanogenum ( AGY75817 ) . does not have native activity for this step . 60 The malic enzyme /malate dehydrogenase may be , for Step 18 shows the conversion of 3 -hydroxybutyryl - CoA example , from Clostridium autoethanogenum ( AGY76687 ) to 3 -hydroxybutyrylaldehyde . This step may be catalyzed by or Escherichia coli (NP _ 416714 , NP _ 417703 ). The pyru butyraldehyde dehydrogenase (EC 1 .2 .1 . 57 ). The butyral - vate phosphate dikinase (PPDK ) may be, for example, from dehyde dehydrogenase may be , for example , Bld from Clostridium autoethanogenum (AGY76274 , AGY77114 ) . Clostridium saccharoperbutylacetonicum (AAP42563 . 1 ) 65 The PEP carboxykinase ( PCK ) may be , for example , from ( SEQ ID NO : 80 ) . Clostridium autoethanogenum , Clostridium autoethanogenum ( AGY76928 ) or Escherichia Clostridium ljungdahlii , and Clostridium ragsdalei do not coli (NP _ 417862 ). The fumarate hydratase/ fumerase may US 10 ,316 , 337 B2 23 24 be, for example , from Clostridium autoethanogenum such as thioesterases from Clostridium autoethanogenum , ( AGY76121 , AGY76122 ) or Escherichia coli (NP _ 416128 , may catalyze this step and result in the production of some NP _ 416129 , NP _ 418546 ). The fumarate reductase /succi - amount of downstream products . However , introduction of nate dehydrogenase may be , for example , from Clostridium an exogenous enzyme or overexpression of an endogenous autoethanogenum (AGY74573 , AGY74575 , AGY75257 , 5 enzyme may be required to produce downstream products at AGY77166 ) or Escherichia coli ( NP _ 415249, NP _ 415250 , desirable levels . Additionally , in certain embodiments , a NP _ 415251, NP _ 415252, NP _ 418575 , NP _ 418576 , disruptive mutation may be introduced to an endogenous NP _ 418577 , NP _ 418578 ) . The succinyl - CoA synthetase enzyme, such as an endogenous thioesterase , to reduce or may be , for example, from Escherichia coli (NP _ 415256 , eliminate competition with introduced Ptb - Buk . NP _ 415257 ) . 10 Step 27 shows the conversion of shows the conversion of Step 22 shows the conversion of acetyl -CoA and succinyl- 3 -hydroxbutyryl -CoA to crotonyl- CoA . This step may be COA to 3 -oxo - adipyl - CoA . This step may be catalyzed by catalyzed by a crotonyl- CoA hydratase ( crotonase ) (EC B -ketoadipyl - CoA thiolase ( EC 2 .3 . 1. 16 ). The ketoisovaler 4 .2 .1 . 17 ) or crotonyl -CoA reductase ( EC 1. 3 .1 . 38 ). The ate oxidoreductase may be , for example, PaaJ from Escheri - crotonyl- CoA hydratase (crotonase ) or crotonyl- CoA reduc chia coli (WP _ 001206190 . 1 ) . Clostridium autoethanoge - 15 tase may be, for example, Crt from C . acetobutylicum num , Clostridium ljungdahlii, and Clostridium ragsdalei do (NP _ 349318 . 1 ) ( SEQ ID NO : 52 ) or PhaJ from Aeromonas not have known native activity for this step . Escherichia coli caviae ( 032472 ) . Clostridium autoethanogenum , does not have known native activity for this step . Clostridium ljungdahlii, and Clostridium ragsdalei do not Step 23 shows the conversion of 3 - oxo -adipyl - CoA to have known native activity for this step . Escherichia coli 3 -hydroxyadipyl - CoA . This step may be catalyzed by 3 -hy - 20 does not have known native activity for this step . droxybutyryl- CoA dehydrogenase (EC 1 . 1 . 1 . 157 ) or Step 28 shows the conversion of crotonyl -CoA to croto acetoacetyl - CoA hydratase (EC 4 . 2 . 1 . 119 ) . The 3 -hydroxy - nate . This step may be catalyzed by phosphate butyryltrans butyryl- CoA dehydrogenase or acetoacetyl- CoA hydratase ferase (EC 2. 3 . 1. 19) + butyrate kinase (EC 2 .7 . 2 .7 ) . Exem may be, for example , Hbd from Clostridium beijerinckii plary sources for phosphate butyryltransferase and butyrate ( WP _ 011967675 . 1 ) ( SEQ ID NO : 55 ), Hbd from 25 kinase are described elsewhere in this application . Native Clostridium acetobutylicum (NP _ 349314 . 1 ) (SEQ ID NO : enzymes in Clostridium autoethanogenum , Clostridium 56 ) , Hbdl from Clostridium kluyveri (WP _ 011989027 . 1 ) ljungdahlii , and Clostridium ragsdalei (or Escherichia coli ) , ( SEQ ID NO : 57 ) , or PaaH1 from Cupriavidus necator such as thioesterases from Clostridium autoethanogenum , (WP _ 010814882 . 1 ) . Of note , PhaB is R -specific and Hbd is may catalyze this step and result in the production of some S -specific . Additionally , Hbdl from Clostridium kluyveri is 30 amount of downstream products . However , introduction of NADPH - dependent and Hbd from Clostridium acetobutyli - an exogenous enzyme or overexpression of an endogenous cum and Clostridium beijerinckii are NADH -dependent . enzyme may be required to produce downstream products at Clostridium autoethanogenum , Clostridium ljungdahlii , and desirable levels . Additionally , in certain embodiments , a Clostridium ragsdalei do not have known native activity for disruptive mutation may be introduced to an endogenous this step . Escherichia coli does not have known native 35 enzyme, such as an endogenous thioesterase , to reduce or activity for this step . eliminate competition with introduced Ptb - Buk . Step 24 shows the conversion of 3 -hydroxyadipyl - CoA to Step 29 shows the conversion of crotonate to crotonalde 2 , 3 - dehydroadipyl- CoA . This step may be catalyzed by an hyde. This step may be catalyzed by aldehyde: ferredoxin enoyl- CoA hydratase ( EC : 4 . 2 . 1 . 17 ) or enoyl- CoA reductase oxidoreductase (EC 1 . 2 . 7 . 5 ) . Exemplary sources for alde ( EC : 1 . 3 . 1 .38 ) . The enoyl -CoA hydratase or enoyl- CoA 40 hyde :ferredoxin oxidoreductases are described elsewhere in reductase may be , for example , Crt from C . acetobutylicum this application . AOR catalyzes the reaction of an acid and (NP _ 349318 . 1 ) or PhaJ from Aeromonas caviae (032472 ) reduced ferredoxin to form an aldehyde and oxidized ferre (Seq . ID No . 52) . Clostridium autoethanogenum , doxin . In acetogens, this reaction can be coupled to oxida Clostridium ljungdahlii, and Clostridium ragsdalei do not tion CO ( via CO dehydrogenase , EC 1 . 2 . 7 . 4 ) or hydrogen have known native activity for this step . Escherichia coli 45 (via ferredoxin -dependent hydrogenase , EC 1 . 12 .7 . 2 or does not have known native activity for this step . 1 .12 . 1 . 4 ) that both yield reduced ferredoxin (Köpke , Curr Step 25 shows the conversion of 2 , 3 - dehydroadipyl- CoA Opin Biotechnol 22 : 320 - 325 , 2011; Köpke, PNAS USA , to adipyl- CoA . This step may be catalyzed by trans - 2 -enoyl 107 : 13087- 13092, 2010 ) . Clostridium autoethanogenum , CoA reductase (EC 1 . 3 . 8 . 1 , EC 1 . 3 . 1 . 86 , EC 1 . 3 . 1 . 85 , EC Clostridium ljungdahlii, and Clostridium ragsdalei have 1 . 3 . 1 .44 ). The trans - 2 - enoyl- CoA reductase may be , for 50 native activity for this step . However, overexpression of example , Bcd from C . acetobutylicum (NP _ 349317 . 1 ) that endogenous AOR or introduction of an exogenous AOR in forms a complex with electron flavoproteins EtfAB Clostridium autoethanogenum , Clostridium ljungdahlii, or ( NP _ 349315, NP _ 349316 ), Ccr from Streptomyces collinus Clostridium ragsdalei may be desirable to enhance product (AAA92890 ) , Cor from Rhodobacter sphaeroides yields. AOR of Pyrococcus furiosus has been demonstrated ( YP _ 354044 . 1 ) , Ter from T reponema denticola 55 activity converting crotonaldehyde and crotonate (Loes , J (NP _ 971211 . 1 ), or Ter from Euglena gracilis Bacteriol, 187 : 7056 -7061 , 2005 ). Alternatively , exogenous ( AY741582. 1 ) . Clostridium autoethanogenum , Clostridium AOR may be introduced into a microorganism that does not ljungdahlii, and Clostridium ragsdalei do not have known natively comprise AOR , e . g . , E . coli. In particular, the native activity for this step . Escherichia coli does not have co - expression of Ptb -Buk and AOR ( and , optionally , Adh ) known native activity for this step . 60 may enable such a microorganism to produce new non Step 26 shows the conversion of adipyl - CoA to adipic native products . acid . This step may be catalyzed by phosphate butyryltrans - Step 30 shows the conversion of crotonaldehyde to ferase (EC 2 . 3 . 1 . 19 ) + butyrate kinase (EC 2 . 7 . 2 . 7 ) . Exem - 2 -buten - 1 - ol. This step may be catalyzed by alcohol dehy plary sources for phosphate butyryltransferase and butyrate drogenase (EC 1 . 1 . 1 . 1 . or 1 . 1 . 1 . 2 . ) . Alcohol dehydrogenase kinase are described elsewhere in this application . Native 65 can convert an aldehyde and NAD ( P ) H to an alcohol and enzymes in Clostridium autoethanogenum , Clostridium NAD ( P ) . The alcohol dehydrogenase may be , for example , ljungdahlii , and Clostridium ragsdalei (or Escherichia coli ), Adh from Clostridium autoethanogenum (AGY76060 .1 ) US 10 ,316 , 337 B2 25 26 (SEQ ID NO : 67 ), Clostridium ljungdahlii (ADK17019 . 1) certain embodiments , a disruptive mutation may be intro ( SEO ID NO : 68 ) , or Clostridium ragsdalei, Bdh? from duced to an endogenous enzyme, such as an endogenous Clostridium acetobutylicum (NP _ 349891. 1) (SEQ ID NO : thioesterase, to reduce or eliminate competition with intro 69) , Bdh from Clostridium beijerinckii (WP _ 041897187 . 1 ) duced Ptb - Buk . (SEQ ID NO : 70 ), Bdhl from Clostridium ljungdahlii 5 Step 34 shows the conversion of acetobutyrate to acety ( YP _ 003780648 . 1 ) (SEQ ID NO : 71) , Bdh1 from lacetone . This step may be catalyzed by an acetoacetate Clostridium autoethanogenum (AGY76060 . 1 ) ( SEQ ID decarboxylase (EC 4 . 1 . 1 . 4 ) . The acetoacetate decarboxylase NO : 72 ) , Bdh2 from Clostridium ljungdahlii may be , for example , Adc from Clostridium beijerinckii ( YP _ 003782121. 1 ) (SEQ ID NO : 73 ) , Bdh2 from (WP _ 012059998 . 1 ) (SEQ ID NO : 14 ) . This step may also be Clostridium autoethanogenum (AGY74784 .1 ) (SEQ ID 10 catalyzed by an alpha -ketoisovalerate decarboxylase (EC NO : 74 ) , AdhE1 from Clostridium acetobutylicum 4 . 1 . 1 .74 ) . The alpha -ketoisovalerate decarboxylase may be , (NP _ 149325 . 1 ) ( SEQ ID NO : 75 ) , AdhE2 from Clostridium for example , KivD from Lactococcus lactis (SEQ ID NO : acetobutylicum (NP _ 149199 .1 ) (SEQ ID NO : 76 ) , AdhE 15) . Clostridium autoethanogenum , Clostridium ljungdahlii, from Clostridium beijerinckii (WP _ 041893626 . 1 ) (SEQ ID and Clostridium ragsdalei do not have known native activity NO : 77 ) , AdhEl from Clostridium autoethanogenum 15 for this step . Additionally , Escherichia coli does not have (WP _ 023163372 .1 ) (SEQ ID NO : 78 ), or AdhE2 from known native activity for this step . Rarely , conversion of Clostridium autoethanogenum (WP _ 023163373 . 1 ) (SEQ ID acetoacetate to acetone may occur spontaneously . However, NO : 79 ) . Clostridium autoethanogenum , Clostridium ljung - spontaneous conversion is highly inefficient and unlikely to dahlii , and Clostridium ragsdalei have native activity for result in the production of downstream products at desirable this step . However, overexpression of endogenous alcohol 20 levels . dehydrogenase or introduction of an exogenous alcohol Step 35 shows the conversion of acetylacetone to dehydrogenase in Clostridium autoethanogenum , 3 -methyl - 2 - butanol. This step may be catalyzed by a prima Clostridium ljungdahlii, or Clostridium ragsdalei may be ry :secondary alcohol dehydrogenase (EC 1. 1 . 1. 2 ) . The pri desirable to enhance product yields. Escherichia coli likely mary :secondary alcohol dehydrogenase may be , for does not have native activity for this step . 25 example , SecAdh from Clostridium autoethanogenum Step 31 shows the conversion of crotonyl -CoA to butyryl- ( AGY74782 . 1 ) (SEQ ID NO : 16 ) , SecAdh from Clostridium COA . This step may be catalyzed by butyryl- CoA dehydro ljungdahlii ( ADK15544 . 1 ) ( SEQ ID NO : 17 ) , SecAdh from genase or trans - 2 - enoyl - CoA reductase ( EC 1 . 3 . 8 . 1 , EC Clostridium ragsdalei (WP 013239134 . 1 ) (SEO ID NO : 1 .3 . 1. 86 , EC 1 .3 . 1. 85 , EC 1. 3 .1 .44 ). The butyryl- CoA dehy - 18 ), or SecAdh from Clostridium beijerinckii drogenase or trans- 2 -enoyl - CoA reductase may be , for 30 (WP _ 026889046 . 1 ) (SEQ ID NO : 19 ) . This step may also be example, Bcd from C . acetobutylicum (NP _ 349317 . 1 ) that catalyzed by a primary: secondary alcohol dehydrogenase forms a complex with electron flavoproteins EtfAB ( EC 1 . 1 . 1 .80 ) , such as SecAdh from Thermoanaerobacter (NP _ 349315 , NP _ 349316 ), Cer from Streptomyces collinus brokii ( 3FSR _ A ) (SEQ ID NO : 20 ). Clostridium autoetha (AAA92890 ) , Cor from Rhodobacter sphaeroides nogenum , Clostridium ljungdahlii , and Clostridium ragsda ( YP _ 354044 . 1 ) , Ter from Treponema denticola 35 lei have native activity for this step (Köpke , Appl Environ ( NP _ 971211. 1 ), or Ter from Euglena gracilis Microbiol , 80 : 3394 -3403 , 2014 ). However , Escherichia (AY741582 .1 ) . Clostridium autoethanogenum , Clostridium coli does not have known native activity for this step . ljungdahlii, and Clostridium ragsdalei do not have known Knocking down or knocking out this enzyme in Clostridium native activity for this step . Escherichia coli does not have autoethanogenum , Clostridium ljungdahlii , or Clostridium known native activity for this step . 40 ragsdalei results in the production and accumulation of Step 32 shows the conversion of butyryl- CoA to aceto - acetylacetone rather than 3 -methyl - 2 -butanol (WO 2015 / butyryl- CoA . This step may be catalyzed by thiolase or 085015 ) . acyl- CoA acetyltransferase ( EC 2 .3 .1 . 9 ). The thiolase may Step 36 shows the conversion of acetobutyryl- CoA to be, for example , ThlA from Clostridium acetobutylicum 3 -hydroxyhexanoyl - CoA . This step may be catalyzed by ( WP _ 010966157 . 1 ) (SEQ ID NO : 1 ) , Th1A1 from 45 3 -hydroxybutyryl - CoA dehydrogenase (EC 1 . 1 . 1. 157 ) or Clostridium kluyveri ( EDK35681 ), Th1A2 from Clostridium acetoacetyl- CoA hydratase ( EC 4 . 2 . 1 . 119 ) . The 3 -hydroxy kluyveri (EDK35682 ) , Th1A3 from Clostridium kluyveri butyryl- CoA dehydrogenase or acetoacetyl- CoA hydratase (EDK35683 ) , Phall from Cupriavidus necator may be , for example , Hbd from Clostridium beijerinckii (WP _ 013956452 . 1 ) ( SEQ ID NO : 2 ) , Bkt? from Cupriavi- (WP _ 011967675 . 1 ) (SEQ ID NO : 55 ) , Hbd from dus necator (WP _ 011615089 . 1 ) ( SEQ ID NO : 3 ), or AtoB 50 Clostridium acetobutylicum (NP _ 349314 . 1 ) (SEQ ID NO : from Escherichia coli (NP _ 416728 . 1 ) (SEQ ID NO : 4 ) . 56 ) , Hbdl from Clostridium kluyveri (WP _ 011989027 . 1 ) Clostridium autoethanogenum , Clostridium ljungdahlii , and (SEQ ID NO : 57 ) , Hbd2 from Clostridium kluyveri Clostridium ragsdalei do not have known native activity for (EDK34807 ), or PaaHi from Cupriavidus necator this step . Escherichia coli has native activity for this step . (WP _ 010814882 . 1 ) . Of note , PhaB is R - specific and Hbd is Step 33 shows the conversion of acetobutyryl - CoA to 55 S -specific . Additionally , Hbd1 from Clostridium kluvveri is acetobutyrate . This step may be catalyzed by phosphate NADPH -dependent and Hbd from Clostridium acetobutyli butyryltransferase (EC 2 . 3 . 1 . 19 ) + butyrate kinase ( EC cum and Clostridium beijerinckii are NADH - dependent. 2 .7 . 2. 7 ). Exemplary sources for phosphate butyryltrans Clostridium autoethanogenum , Clostridium ljungdahlii, and ferase and butyrate kinase are described elsewhere in this Clostridium ragsdalei do not have known native activity for application . Native enzymes in Clostridium autoethanoge - 60 this step . Escherichia coli does not have known native num , Clostridium ljungdahlii , and Clostridium ragsdalei (or activity for this step . Escherichia coli) , such as thioesterases from Clostridium Step 37 shows the conversion of 3 -hydroxyhexanoyl - CoA autoethanogenum , may catalyze this step and result in the to 3 -hydroxyhexanoate . This step may be catalyzed by production of some amount of downstream products . How - phosphate butyryltransferase (EC 2 . 3 . 1 . 19 ) +butyrate kinase ever, introduction of an exogenous enzyme or overexpres - 65 (EC 2 . 7 . 2 . 7 ) . Exemplary sources for phosphate butyryltrans sion of an endogenous enzymemay be required to produce ferase and butyrate kinase are described elsewhere in this downstream products at desirable levels . Additionally , in application . Native enzymes in Clostridium autoethanoge US 10 , 316 , 337 B2 27 28 num , Clostridium ljungdahlii, and Clostridium ragsdalei ( or COA synthase) ( EC 2 . 3 . 3 . 10 ) . HMG -CoA synthases are Escherichia coli ), such as thioesterases from Clostridium widespread across many genera and kingdoms of life and autoethanogenum , may catalyze this step and result in the include , e . g . , MvaS from Staphylococcus aureus production of some amount of downstream products . How - (WP _ 053014863 . 1 ) , ERG13 from Saccharomyces cerevi ever, introduction of an exogenous enzyme or overexpres - 5 siae (NP _ 013580 . 1 ) , HMGCS2 from Mus musculus sion of an endogenous enzymemay be required to produce (NP _ 032282 . 2 ), and many other members of the EC downstream products at desirable levels . Additionally , in 2 . 3 . 3 . 10 group of enzymes . Clostridium autoethanogenum , certain embodiments , a disruptive mutation may be intro - Clostridium ljungdahlii , and Clostridium ragsdalei do not duced to an endogenous enzyme, such as an endogenous have known native activity for this step . Escherichia coli thioesterase , to reduce or eliminate competition with intro - 10 does not have known native activity for this step . duced Ptb -Buk . Step 41 shows the conversion of 3 -hydroxy - 3 -methyl Step 38 shows the conversion of 3 - hydroxyhexanoate to glutanoyl- CoA to 3 -methylgluconyl - CoA . This step may be 1 , 3 -hexaldehyde . This step may be catalyzed by aldehyde : catalyzed by a 3 - hydroxybutyryl- CoA dehydratase (EC ferredoxin oxidoreductase (EC 1 . 2 . 7 . 5 ) . Exemplary sources 4 . 2 . 1. 55 ) . The 3 - hydroxybutyryl -CoA dehydratase may be , for aldehyde: ferredoxin oxidoreductases are described else - 15 for example , Liuc from Myxococcus xanthus where in this application . AOR catalyzes the reaction of an (WP _ 011553770. 1 ) . This step may also be catalyzed by a acid and reduced ferredoxin to form an aldehyde and oxi short - chain - enoyl- CoA hydratase ( EC 4 . 2 . 1 . 150 ) or an dized ferredoxin . In acetogens , this reaction can be coupled enoyl- CoA hydratase (EC 4 .2 . 1. 17 ) . Clostridium autoetha to oxidation CO ( via CO dehydrogenase , EC 1 . 2 . 7 . 4 ) or nogenum , Clostridium ljungdahlii , and Clostridium ragsda hydrogen (via ferredoxin -dependent hydrogenase, EC 20 lei do not have known native activity for this step . Escheri 1 .12 . 7 . 2 or 1 . 12 . 1 . 4 ) that both yield reduced ferredoxin chia coli does not have known native activity for this step . ( Köpke, Curr Opin Biotechnol 22 : 320 - 325 , 2011; Köpke , Step 42 shows the conversion of 3 -methylgluconyl - CoA PNAS USA , 107: 13087 - 13092 , 2010 ) . Clostridium to 2 -methylcrotonyl - CoA . This step may be catalyzed by a autoethanogenum , Clostridium ljungdahlii , and Clostridium methylcrotonyl- CoA decarboxylase (with high structural ragsdalei have native activity for this step . However, over - 25 similarity to glutaconate - CoA transferase ( EC 2 . 8 . 3 . 12 ) ) , expression of endogenous AOR or introduction of an exog - e . g . , aibAB from Myxococcus xanthus (WP _ 011554267 . 1 enous AOR in Clostridium autoethanogenum , Clostridium and WP _ 011554268 . 1 ) . This step may also be catalyzed by ljungdahlii , or Clostridium ragsdalei may be desirable to a methylcrotonoyl- CoA carboxylase ( EC 6 . 4 . 1 . 4 ) , e . g . , enhance product yields . Alternatively , exogenous AOR may LiuDB from Pseudomonas aeruginosa (NP _ 250702 . 1 and be introduced into a microorganism that does not natively 30 NP _ 250704 . 1 ) or MCCA and MCCB from Arabidopsis comprise AOR , e . g . , E . coli . In particular, the co -expression thaliana (NP _ 563674 . 1 and NP _ 567950 . 1) . Clostridium of Ptb - Buk and AOR ( and , optionally , Adh ) may enable such autoethanogenum , Clostridium ljungdahlii, and Clostridium a microorganism to produce new non -native products . ragsdalei do not have known native activity for this step . Step 39 shows the conversion of 1 , 3 - hexaldehyde to Escherichia coli does not have known native activity for this 1 , 3 -hexanediol . This step may be catalyzed by alcohol 35 step . dehydrogenase ( EC 1 . 1 . 1 . 1 . or 1 . 1 . 1 . 2 . ) . Alcohol dehydro - Step 43 shows the conversion ofmethylcrotonyl - CoA to genase can convert an aldehyde and NAD ( P ) H to an alcohol isovaleryl - CoA . This step may be catalyzed by an oxi and NAD ( P ) . The alcohol dehydrogenase may be , for doreductase , zinc -binding dehydrogenase . This oxidoreduc example , Adh from Clostridium autoethanogenum tase , zinc -binding dehydrogenase may be, for example , ( AGY76060 . 1 ) ( SEO ID NO : 67 ) , Clostridium ljungdahlii 40 AibC from Myxococcus xanthus (WP _ 011554269. 1 ) . ( ADK17019 . 1 ) (SEQ ID NO : 68 ) , or Clostridium ragsdalei , Clostridium autoethanogenum , Clostridium ljungdahlii , and Bdh? from Clostridium acetobutylicum (NP _ 349891 . 1 ) Clostridium ragsdalei do not have known native activity for (SEQ ID NO : 69 ), Bdh from Clostridium beijerinckii this step . Escherichia coli does not have known native (WP _ 041897187 . 1 ) (SEQ ID NO : 70 ) , Bdh1 from activity for this step . Clostridium ljungdahlii (YP _ 003780648 . 1 ) (SEQ ID NO : 45 Step 44 shows the conversion of isovaleryl- CoA to isoval 71 ), Bdh1 from Clostridium autoethanogenum e rate . This step may be catalyzed by CoA - transferase ( i .e . , ( AGY76060 . 1 ) (SEQ ID NO : 72 ) , Bdh2 from Clostridium acetyl- CoA :acetoacetyl - CoA transferase ) ( EC 2 . 8 . 3 . 9 ) . The ljungdahlii (YP _ 003782121. 1 ) (SEQ ID NO : 73 ), Bdh2 COA - transferase may be , for example , CtfAB , a heterodimer from Clostridium autoethanogenum ( AGY74784 . 1 ) ( SEQ comprising subunits CtfA and CtfB , from Clostridium bei ID NO : 74 ) , AdhE1 from Clostridium acetobutylicum 50 jerinckii ( CtfA , WP _ 012059996 . 1 ) ( SEQ ID NO : 5 ) (CtfB , (NP _ 149325 . 1 ) (SEQ ID NO : 75 ) , AdhE2 from Clostridium WP _ 012059997 . 1 ) (SEQ ID NO : 6 ) . This step may also be acetobutylicum (NP _ 149199 . 1 ) (SEQ ID NO : 76 ) , AdhE catalyzed by thioesterase (EC 3 . 1 . 2 .20 ) . The thioesterase from Clostridium beijerinckii (WP _ 041893626 .1 ) (SEQ ID may be , for example , TesB from Escherichia coli NO : 77 ) , AdhEl from Clostridium autoethanogenum (NP _ 414986 . 1 ) (SEQ ID NO : 7 ) . This step may also be (WP _ 023163372 .1 ) (SEQ ID NO : 78 ), or AdhE2 from 55 catalyzed by a putative thioesterase, e . g. , from Clostridium Clostridium autoethanogenum (WP _ 023163373 . 1 ) (SEQ ID autoethanogenum or Clostridium ljungdahlii . In particular, NO : 79 ) . Clostridium autoethanogenum , Clostridium ljung three putative thioesterases have been identified in dahlii, and Clostridium ragsdalei have native activity for Clostridium autoethanogenum : (1 ) " thioesterase 1” this step . However, overexpression of endogenous alcohol (AGY74947 . 1 ; annotated as palmitoyl- CoA hydrolase; SEQ dehydrogenase or introduction of an exogenous alcohol 60 ID NO : 8 ) , ( 2 ) “ thioesterase 2 ” ( AGY75747. 1 ; annotated as dehydrogenase in Clostridium autoethanogenum , 4 -hydroxybenzoyl - CoA thioesterase; SEQ ID NO : 9 ) , and Clostridium ljungdahlii , or Clostridium ragsdalei may be ( 3 ) “ thioesterase 3 ” ( AGY75999 . 1 ; annotated as putative desirable to enhance product yields. Escherichia coli likely thioesterase; SEQ ID NO : 10 ). Three putative thioesterases does not have native activity for this step . have also been identified in Clostridium ljungdahlii : ( 1 ) Step 40 shows the conversion of acetoacetyl- CoA to 65 " thioesterase 1 ” ( ADK15695 . 1 ; annotated as predicted acyl 3 - hydroxy - 3 -methylglutaryl - CoA . This step may be cata - COA thioesterase 1 ; SEQ ID NO : 11) , ( 2 ) “ thioesterase 2 " lyzed by a hydroxymethylglutaryl - CoA synthase (HMG - (ADK16655 . 1 ; annotated as predicted thioesterase ; SEQ ID US 10 , 316 , 337 B2 29 30 NO : 12 ) , and ( 3 ) “ thioesterase 3 ” ( ADK16959 . 1 ; annotated desirable to enhance product yields. Escherichia coli likely as predicted thioesterase ; SEQ ID NO : 13 ) . This step may does not have native activity for this step . also be catalyzed by phosphate butyryltransferase (EC Step 47 shows the conversion of isovaleryl- CoAto isoval 2 . 3 . 1 .19 ) + butyrate kinase ( EC 2 . 7 . 2 . 7 ) . Exemplary sources eraldehyde . This step may be catalyzed by butyraldehyde for phosphate butyryltransferase and butyrate kinase are 5 dehydrogenase (EC 1 . 2 . 1 .57 ) . The butyraldehyde dehydro described elsewhere in this application . Native enzymes in genase may be, for example , Bld from Clostridium saccha Clostridium autoethanogenum , Clostridium ljungdahlii, and roperbutylacetonicum (AAP42563 . 1 ) (SEQ ID NO : 80 ) . Clostridium ragsdalei (or Escherichia coli ), such as thio - Clostridium autoethanogenum , Clostridium ljungdahlii, and esterases from Clostridium autoethanogenum , may catalyze Clostridium ragsdalei likely do not have native activity for this step and result in the production of some amount of 10 this step . Escherichia coli does not have known native downstream products . However , introduction of an exog - activity for this step . enous enzyme or overexpression of an endogenous enzyme Overview of Ptb - Buk may be required to produce downstream products at desir - The invention provides new pathways utilizing the Ptb able levels . Additionally , in certain embodiments , a disrup - Buk enzyme system . In nature , this enzyme system is found tive mutation may be introduced to an endogenous enzyme , 15 in a range of butyrate producing microorganisms, such as such as an endogenous thioesterase, to reduce or eliminate butyrate - producing Clostridia or Butyrivibrio . In particular, competition with introduced Ptb -Buk . phosphate butyryltransferase (Ptb ) (EC 2 .3 .1 .19 ) natively Step 45 shows the conversion of isovalerate to isovaler catalyzes the reaction of butanoyl- CoA + phosphate to form aldehyde . This step may be catalyzed by aldehyde: ferre - COA + butanoyl phosphate and butyrate kinase (Buk ) ( EC doxin oxidoreductase (EC 1 . 2 . 7 . 5 ) . The aldehyde: ferredoxin 20 2 . 7 . 2 . 7 ) natively catalyzes the reaction of butanoyl phos oxidoreductase (AOR ) may be , for example , AOR from phate and ADP to form butyrate (butanoate ) and ATP . Clostridium autoethanogenum (WP _ 013238665 . 1 ; WP Accordingly , these enzymes together ( Ptb -Buk ) natively 013238675 . 1 ) (SEQ ID NOs: 63 and 64 , respectively ) or catalyze the conversion of butanoyl - CoA to butyrate and AOR from Clostridium ljungdahlii (ADK15073 . 1 ; generate one ATP via substrate level -phosphorylation ( FIG . ADK15083 . 1 ) ( SEQ ID NOs: 65 and 66 , respectively ) . 25 2 ) . However, the inventors have discovered that Ptb is Further exemplary sources for aldehyde: ferredoxin oxi- promiscuous and is capable of accepting a variety of acyl doreductases are described elsewhere in this application . CoAs and enoyl - CoAs as substrates , such that Ptb - Buk may Clostridium autoethanogenum , Clostridium ljungdahlii , and be used to convert a number of acyl- CoAs and enoyl - CoAs Clostridium ragsdalei have native activity for this step to their corresponding acids or alkenates , respectively , while However , overexpression of endogenous AOR or introduc - 30 simultaneously generating ATP . It has been reported Ptb is tion of an exogenous AOR in Clostridium autoethanoge - active on a range of acyl- CoAs including acetoacetyl -CoA , num , Clostridium ljungdahlii, or Clostridium ragsdaleimay in vitro (Thompson , Appl Environ Microbiol, 56 : 607 -613 , be desirable to enhance product yields . Alternatively , exog - 1990 ) . It has not previously been shown that acetoacetyl enous AOR may be introduced into a microorganism that phosphate could be a substrate for Buk . Although Buk is does not natively comprise AOR , e . g . , E . coli . In particular, 35 known to accept a broad substrate range (Liu , Appl Micro the co - expression of Ptb - Buk and AOR ( and , optionally , biol Biotechnol, 53 : 545 - 552 , 2000 ) , no activity has been Adh ) may enable such a microorganism to produce new shown in vivo . non -native products . Additionally , the inventors have discovered that the intro Step 46 shows the conversion of isovaleraldehyde to duction of exogenous Ptb - Buk enables certain microorgan isoamyl alcohol. This step may be catalyzed by alcohol 40 isms to produce useful products , including acetone, isopro dehydrogenase (EC 1 . 1 . 1 . 1 . or 1 . 1 . 1. 2 . ) . Alcohol dehydro - panol, isobutylene , 3 - hydroxybutyrate , 1 , 3 -butanediol , and genase can convert an aldehyde and NAD ( P ) H to an alcohol 2 -hydroxyisobutyrate , as well as other products such as and NAD ( P ) . The alcohol dehydrogenase may be, for propionate , caproate , and octonate . example , Adh from Clostridium autoethanogenum New pathways that rely on Ptb - Buk offer several major ( AGY76060. 1 ) (SEQ ID NO : 67 ), Clostridium ljungdahlii 45 advantages over other known and existing pathway routes ( ADK17019 . 1 ) (SEQ ID NO : 68 ) , or Clostridium ragsdalei , for production of products that rely on a COA - transferase — Bdh? from Clostridium acetobutylicum (NP 349891 . 1 ) as in the classic Clostridial acetone -butanol - ethanol ( ABE ) ( SEQ ID NO : 69 ), Bdh from Clostridium beijerinckii fermentation pathway or a thioesterase ( Jones, Microbiol (WP _ 041897187 .1 ) (SEQ ID NO : 70 ) , Bdh1 from Rev, 50 : 484 -524 , 1986 ; Matsumoto, Appl Microbiol Bio Clostridium ljungdahlii ( YP _ 003780648 . 1 ) (SEQ ID NO : 50 technol, 97 : 205 - 210 , 2013 ;May , Metabol Eng , 15 : 218 -225 , 71 ), Bdh1 from Clostridium autoethanogenum 2013 ) ( FIG . 3 ) . In particular , these new pathways ( 1 ) are not (AGY76060 .1 ) (SEQ ID NO : 72 ), Bdh2 from Clostridium dependent on the presence or production of particular mol ljungdahlii ( YP _ 003782121. 1 ) (SEQ ID NO : 73 ), Bdh2 ecules, such as organic acids, e . g. , butyrate or acetate , from Clostridium autoethanogenum ( AGY74784 . 1 ) ( SEQ required for the CoA - transferase reaction and ( 2 ) allow for ID NO : 74 ), AdhEl from Clostridium acetobutylicum 55 generation of ATP via substrate level phosphorylation that (NP _ 149325 . 1 ) (SEQ ID NO : 75 ) , AdhE2 from Clostridium would not be conserved in a thioesterase or COA - transferase acetobutylicum ( NP _ 149199 . 1 ) (SEQ ID NO : 76 ), AdhE reaction . The same advantages also apply when using the from Clostridium beijerinckii (WP _ 041893626 . 1 ) (SEQ ID Ptb - Buk system for other reactions , such as the conversion NO : 77 ) , AdhEl from Clostridium autoethanogenum of 3 -hydroxybutyryl - CoA to 3 -hydroxybutyrate . Thus , these (WP _ 023163372 . 1 ) ( SEQ ID NO : 78 ) , or AdhE2 from 60 new pathways have the potential to yield much higher Clostridium autoethanogenum (WP _ 023163373 . 1 ) ( SEQ ID production titers and rates by generating additional energy NO : 79 ) . Clostridium autoethanogenum , Clostridium ljung - and producing target products without co -production of dahlii , and Clostridium ragsdalei have native activity for undesired byproducts, such as acetate . this step . However, overexpression of endogenous alcohol Particularly on a commercial scale , it is not desirable for dehydrogenase or introduction of an exogenous alcohol 65 microorganisms to produce acetate (or other organic acids dehydrogenase in Clostridium autoethanogenum , required for the CoA transferase reaction ) as byproduct , Clostridium ljungdahlii , or Clostridium ragsdalei may be since acetate diverts carbon away from target products and US 10 , 316 , 337 B2 31 32 thus affects the efficiency and yield of target products . (Schiel - Bengelsdorf , FEBS Lett, 586 : 2191 -2198 , 2012 ). Additionally, acetate may be toxic to microorganisms and / or The Ptb - Buk pathways described herein , however, provide may serve as a substrate for the growth of contaminating an alternative mechanism for the microorganism to generate microorganisms. Furthermore , the presence of acetate makes ATP via substrate level phosphorylation and , therefore , it more difficult to recover and separate target products and 5 avoid acetate production . In particular , acetate - forming to control fermentation conditions to favor the production of enzymes , such as Pta - Ack , that would otherwise be essential target products . (Nagarajan , Microb Cell Factories , 12 : 118 , 2013 ) can be ATP generation through substrate level phosphorylation replaced with Ptb - Buk as an alternative means of ATP can be used as a driving force for product synthesis , espe - generation . Since the microorganism can then rely on ATP cially in ATP - limited systems. In particular , acetogenic 10 generation via Ptb -Buk , this system provides a driving force bacteria are known to live on the thermodynamic edge of life that ensures maximum flux through the new pathways that ( Schuchmann , Nat Rev Microbiol, 12 : 809 - 821 , 2014 ) . As use Ptb - Buk . The generation of ATP may also be crucial for such , all acetogenic microorganisms isolated to date have downstream pathways that require ATP . For example , fer been described to produce acetate ( Drake , Acetogenic Pro - mentative production of isobutylene from acetone requires karyotes , In : The Prokaryotes, 3rd edition , pages 354 - 420 , 15 ATP. While the complete pathway from acetyl- CoA to New York , N . Y . , Springer, 2006 ) since the production of isobutylene is ATP - consuming when using a COA - trans acetate provides the microorganism with an option to ferase or a thioesterase, the pathway is energy neutralwhen directly generate ATP from substrate level phosphorylation using Ptb - Buk . via Pta (phosphotransacetylase ) ( EC 2 . 3 . 1 . 8 ) and Ack ( ac - Exemplary sources for Ptb and Buk are provided . How etate kinase ) (EC 2 . 7 . 2 . 1 ) . Although mechanisms such as 20 ever , it should be appreciated that other suitable sources for membrane gradients and electro bifurcation enzymes Ptb and Buk may be available . Additionally , Ptb and Buk coupled to ion or proton translocating systems, e . g . , the Rnf may be engineered to improve activity and / or genes encod complex (Schuchmann , Nat Rev Microbiol , 12 : 809 -821 , ing Ptb -Buk may be codon - optimized for expression in 2014 ) , conserve ATP in these microorganisms, direct ATP particular host microorganisms. generation remains critical for their survival. As a result , 25 The phosphate butyryltransferase may be or may be when introducing heterologous pathways that do not allow derived , for example , from any of the following sources , the for ATP generation , acetate is produced as a byproduct sequences of which are publically available :

Description Microorganism Accession phosphate butyryltransferase Clostridium sp . EKQ52186 phosphate butyryltransferase Clostridium sp . WP _ 009167896 phosphate butyryltransferase Clostridium saccharoperbutylacetonicum WP _015390396 phosphate butyryltransferase Clostridium saccharobutylicum WP 022743598 phosphate butyryltransferase Clostridium beijerinckii WP 026886639 phosphate butyryltransferase Clostridium beijerinckii WP 041893500 phosphate butyryltransferase Clostridium butyricum WP 003410761 phosphate butyryltransferase Clostridium sp . CDB14331 phosphate butyryltransferase Clostridium botulinum WP _ 049180512 phosphate butyryltransferase Clostridium sp . CDB74819 phosphate butyryltransferase Clostridium paraputrificum WP _ 027098882 phosphate butyryltransferase Clostridium sp . WP _ 024615655 phosphate butyryltransferase Clostridium celatum WP _ 005211129 phosphate butyryltransferase Clostridium baratii WP _ 039312969 phosphate butyryltransferase Clostridium intestinale WP _ 021800215 phosphate butyryltransferase Clostridium sp . WP 042402499 phosphate butyryltransferase Clostridium sp . WP 032117069 phosphate butyryltransferase Clostridium perfringens ABG85761 phosphate butyryltransferase Clostridium botulinum WP _ 003374233 phosphate butyryltransferase Clostridium perfringens WP 004460499 phosphate butyryltransferase Clostridium perfringens WP _ 003454254 phosphate butyryltransferase Clostridium perfringens WP _ 041707926 phosphate butyryltransferase Clostridium perfringens BAB82054 phosphate butyryltransferase Clostridium sp . WP 008681116 phosphate butyryltransferase Clostridium chauvoei WP _ 021876993 phosphate butyryltransferase Clostridium colicanis WP _ 002598839 phosphate butyryltransferase Clostridium cadaveris WP _ 027637778 phosphate butyryltransferase Clostridium acetobutylicum WP _ 010966357 phosphate butyryltransferase Clostridium pasteurianum WP _ 015617430 phosphate butyryltransferase Clostridium arbusti WP _ 010238988 phosphate butyryltransferase Clostridium pasteurianum WP 003445696 phosphate butyryltransferase Clostridium scatologenes WP 029160341 phosphate butyryltransferase Clostridium sp . WP _ 032120461 phosphate butyryltransferase Clostridium drakei WP _ 032078800 phosphate butyryltransferase Clostridium sp . WP _ 021281241 phosphate butyryltransferase Clostridium argentinense WP_ 039635970 phosphate butyryltransferase Clostridium akagii WP_ 026883231 phosphate butyryltransferase Clostridium sp . WP 053242611 phosphate butyryltransferase Clostridium carboxidivorans WP _ 007063154 phosphate butyryltransferase Clostridium sp . WP _ 035292411 phosphate butyryltransferase Clostridium sulfidigenes WP 035133394 phosphate butyryltransferase Clostridium tetanomorphum WP 035147564 phosphate butyryltransferase Clostridium hydrogeniformans WP _ 027633206 phosphate butyryltransferase Clostridium sp . WP _ 040212965 US 10 , 316 ,337 B2 33 34 -continued Description Microorganism Accession phosphate butyryltransferase Candidatus Clostridium WP_ 040327613 phosphate butyryltransferase Clostridium sp . WP_ 040192242 phosphate butyryltransferase Clostridium sp . WP _ 050606427 phosphate butyryltransferase Clostridium lundense WP _ 027625137 phosphate butyryltransferase Clostridium algidicarnis WP _ 029451333 phosphate butyryltransferase Clostridium sp . WP_ 035306567 phosphate butyryltransferase Clostridium acetobutylicum AAA75486 phosphate butyryltransferase Clostridium botulinum WP _ 025775938 phosphate butyryltransferase Clostridium botulinum WP 045541062 phosphate butyryltransferase Clostridium botulinum WP 003357252 phosphate butyryltransferase Clostridium botulinum WP 030037192 phosphate butyryltransferase Clostridium bornimense WP 044039341 phosphate butyryltransferase Clostridium botulinum WP 041346554 phosphate butyryltransferase Clostridium sp . WP _ 053468896 phosphate butyryltransferase Clostridiales bacterium WP _ 034572261 phosphate butyryltransferase Clostridium tetani WP 023439553 phosphate butyryltransferase Clostridiales bacterium ERI95297 phosphate butyryltransferase Clostridium botulinum WP_ 047403027 phosphate butyryltransferase Clostridium tetani WP _ 011100667 phosphate butyryltransferase Clostridium tetani WP _ 035111554 phosphate butyryltransferase Clostridium senegalense WP_ 010295062 phosphate butyryltransferase Caloramator sp . WP 027307587 phosphate butyryltransferase Thermobrachium celere WP 018661036 phosphate butyryltransferase Clostridium cellulovorans WP_ 010073683 phosphate butyryltransferase Coprococcus comes CDB84786 phosphate butyryltransferase Coprococcus comes WP_ 008371924 phosphate butyryltransferase Eubacterium sp . CCZ03827 phosphate butyryltransferase Clostridium sp . CCZ05442 phosphate butyryltransferase Caloramator australicus WP_ 008907395 phosphate butyryltransferase Clostridium sp . CCY59505 phosphate butyryltransferase Lachnospiraceae bacterium WP _ 035626368 phosphate butyryltransferase Lachnospiraceae bacterium WP _ 027440767 phosphate butyryltransferase Fervidicella metallireducens WP_ 035381340 phosphate butyryltransferase Clostridium sp . CCX89274 phosphate butyryltransferase Eubacterium xylanophilum WP _ 026834525 phosphate butyryltransferase Roseburia sp . CDF44203 phosphate butyryltransferase Butyrivibrio crossotus WP _ 005600912 phosphate butyryltransferase Lachnospiraceae bacterium WP_ 027117626 phosphate butyryltransferase Clostridium sp . CDA68345 phosphate butyryltransferase Peptostreptococcaceae bacterium WP 026899905 phosphate butyryltransferase Butyrivibrio crossotus CCY77124 phosphate butyryltransferase Clostridium sp . CDE44914 phosphate butyryltransferase Coprococcus eutactus WP_ 004853197 phosphate butyryltransferase Firmicutes bacterium CCY23248 phosphate butyryltransferase Lachnospiraceae bacterium WP_ 027111007 phosphate butyryltransferase Lachnospiraceae bacterium WP_ 016293387 phosphate butyryltransferase Clostridium sp . WP_ 046822491

In a preferred embodiment, the phosphate butyryltrans - 45 - continued ferase is Ptb from Clostridium acetobutylicum (WP _ 010966357 ; SEQ ID NO : 87 ) or Clostridium beijer Description Microorganism Accession inckii (WP _ 026886639 ; SEQ ID NO : 88 ) (WP _ 041893500 ; butyrate kinase Clostridium sp . WP_ 008681112 SEQ ID NO : 89 ) . Clostridium autoethanogenum , butyrate kinase Clostridium sp . WP 008681114 Clostridium ljungdahlii, and Clostridium ragsdalei do not so butyrate kinase Clostridium sp . WP _ 009167897 natively contain phosphate butyryltransferase . butyrate kinase Clostridium perfringens WP 011010889 The butyrate kinase may be or may be derived , for butyrate kinase Clostridium beijerinckii WP 011967556 butyrate kinase Clostridium botulinum WP 012422882 example , from any of the following sources , the sequences butyrate kinase Clostridium botulinum WP 012450845 of which are publically available : butyrate kinase Clostridium saccharoper WP_ 015390397 butylacetonicum butyrate kinase Clostridium beijerinckii WP_ 017209677 Description Microorganism butyrate kinase Clostridium botulinum WP 017825911 Accession butyrate kinase Clostridium chauvoei WP _ 021876994 butyrate kinase Clostridium pasteurianum ALB48406 butyrate kinase Clostridium saccharobutylicum WP _ 022743599 butyrate kinase Clostridium sp . CDB14330 butyrate kinase Clostridium sp . WP 024615656 butyrate kinase Clostridium sp . CDB74820 butyrate kinase Clostridium perfringens WP_ 025648345 butyrate kinase Clostridium sp . EKQ52187 60 butyrate kinase Clostridium beijerinckii WP_ 026886638 butyrate kinase Clostridium perfringens QOSOKO butyrate kinase Clostridium paraputrificum WP_ 027098883 butyrate kinase Clostridium sp . WP_ 002582660 butyrate kinase Clostridium sp . WP_ 032117070 butyrate kinase Clostridium colicanis WP 002598838 butyrate kinase Clostridium botulinum WP_ 035786166 butyrate kinase Clostridium botulinum WP 003371719 butyrate kinase Clostridium baratii WP _ 039312972 butyrate kinase Clostridium perfringens WP 003454444 butyrate kinase Clostridium diolis WP 039772701 butyrate kinase Clostridium perfringens WP 004459180 65 butyrate kinase Clostridium botulinum WP_ 041082388 butyrate kinase Clostridium celatum WP _ 005211128 butyrate kinase Clostridium beijerinckii WP_ 041893502 US 10 , 316 , 337 B2 35 36 -continued design based on available crystal structures of Ptb and Buk with and without a bound substrate where the binding pocket Description Microorganism Accession would be changed to accommodate the new substrate or butyrate kinase Clostridium sp . WP_ 042402497 through saturation mutagenesis . When activity is obtained , it butyrate kinase Clostridium baratii WP_ 045725505 can be further improved through iterative cycles of enzyme butyrate kinase Clostridium perfringens WP 049039634 engineering . These engineering efforts would be combined butyrate kinase Clostridium botulinum WP 049180514 with assays to test enzyme activity . These types of strategies butyrate kinase Clostridium botulinum WP 053341511 have previously proven effective ( see , e . g ., Huang , Nature , butyrate kinase Clostridium butyricum ABU40948 butyrate kinase Clostridium sp . CDE44915 537: 320 -327 , 2016 ; Khoury , Trends Biotechnol, 32: 99 -109 , butyrate kinase Clostridium senegalense WP 010295059 10 2014 ; Packer , Nature Rev Genetics, 16 : 379 - 394 , 2015 ; butyrate kinase Clostridium intestinale WP 021800216 Privett , PNAS USA , 109 : 3790 - 3795 , 2012 ) . butyrate kinase Eubacterium ventriosum WP 005363839 To improve substrate specificity of Ptb - Buk towards a butyrate kinase Clostridiales bacterium WP 021657038 butyrate kinase Clostridium sp . WP _ 021281242 specific acyl- CoA substrate , Ptb - Buk variants from public butyrate kinase Clostridium sporogenes WP _ 045520059 databases or generated Ptb -Buk mutants ( for example , from butyrate kinase Clostridium sp . WP 050606428 15 directed evolution ) can be screened using a high throughput butyrate kinase Clostridium botulinum WP _ 012048334 assay , namely overexpressing Ptb - Buk enzyme pairs in E . butyrate kinase Clostridium botulinum WP 012343352 butyrate kinase Clostridium botulinum WP 003401518 coli , adding a test substrate , and screening for ATP produc butyrate kinase Clostridium argentinense WP _ 039635972 tion with a bioluminescence assay . The assay can use the butyrate kinase Clostridium botulinum WP _ 003357547 well -established practice of correlating ATP concentration butyrate kinase Clostridium hydrogeniformans WP _ 027633205 butyrate kinase Clostridium botulinum WP 033066487 20 with firefly luciferase enzyme bioluminescence . The ame butyrate kinase Roseburia sp . CDF44202 nability of this assay to multi -well plate formats would butyrate kinase Lachnospiraceae bacterium WP 027111008 facilitate efficient screening of substrate preference across butyrate kinase Clostridium sp . CDA68344 new Ptb - Buk combinations (FIG . 33 ) . butyrate kinase Lachnospiraceae bacterium WP 022782491 By screening for ATP production rather than depletion of butyrate kinase Clostridium botulinum WP 012101111 butyrate kinase Clostridium carboxidivorans WP_ 007063155 25 substrate or accumulation of product , the assay avoids butyrate kinase Clostridium botulinum WP 041346556 measuring spontaneous hydrolysis of the CoA group . How butyrate kinase Clostridium drakei WP _ 032078801 ever, an alternative approach described in literature , is to use butyrate kinase Clostridium sp . WP _ 032120462 butyrate kinase Clostridium sp . WP _ 053468897 free CoA can be measured using the established assay using butyrate kinase Firmicutes bacterium CCZ27888 Ellman ' s reagent ( 5 , 5 ' - dithiobis - ( 2 - nitrobenzoic acid ) or butyrate kinase Clostridium sp . WP _ 035306569 30 DTNB ) ( Thompson , Appl Environ Microbiol, 56 : 607 -613 , butyrate kinase Coprococcus comes CDB84787 1990 . ) in order to estimate the coupling efficiency of the butyrate kinase Clostridium sp . WP _ 035292410 butyrate kinase Clostridium sp . CCX89275 Ptb -Buk reactions (FIG . 33 ) . Acyl- CoAs and corresponding butyrate kinase Clostridium sp . WP 040212963 free acids and phospho - intermediates can also be measured butyrate kinase Clostridium pasteurianum WP _ 003445697 during the validation phase using LC -MS / MS . butyrate kinase Clostridium sp . WP _ 053242610 In a high - throughput screening approach , it is difficult butyrate kinase Lachnospiraceae bacterium WP 016299320 butyrate kinase Lachnospiraceae bacterium WP _ 022785085 gather kinetic data due to the labor involved in protein butyrate kinase Lachnospiraceae bacterium WP 016281561 quantification . Instead , for each preparation of E . coli lysate butyrate kinase Eubacterium sp . CDA28786 containing Ptb - Buk enzymes , the activity against each sub butyrate kinase Clostridium scatologenes WP 029160342 butyrate kinase Lachnospiraceae bacterium WP 016228168 strate of interest (measured as luminescence per unit time) butyrate kinase Clostridium pasteurianum WP 015617429 40 can be compared to the activity against the positive control butyrate kinase Clostridium algidicarnis WP 029451332 substrate (butyryl - CoA ) and against acetyl- CoA (the physi butyrate kinase Lachnospiraceae bacterium WP _ 016293388 ological substrate that will likely provide the greatest com butyrate kinase Clostridium sulfidigenes WP 035133396 petition for enzyme active sites against target acyl - CoA ) . butyrate kinase Clostridium tetani WP 011100666 butyrate kinase Clostridium tetanomorphum WP_ 035147567 In order to ensure that the assay is not biased due to native butyrate kinase Subdoligranulum variabile WP 007045828 45 phosphotransacetylase (Pta ) and /or acetate kinase ( Ack ) butyrate kinase Eubacterium sp . CCZ03826 activity , the assay can also be evaluated in an E . coli strain butyrate kinase Firmicutes bacterium CDF07483 where pta and/ or ack genes have been knocked out. butyrate kinase Eubacterium sp . CDB13677 butyrate kinase Clostridium sp . WP 008400594 Production of Acetone and Isopropanol butyrate kinase Clostridium tetani WP _ 023439552 Acetone and isopropanol are important industrial solvents butyrate kinase Clostridiales bacterium WP _022787536 50 with a combined market size of 8 million tons and a global butyrate kinase Lachnospiraceae bacterium WP 027434709 market value of $ 8 . 5 - 11 billion . In addition , acetone and butyrate kinase Firmicutes bacterium CCY23249 isopropanol are precursors to valuable downstream prod butyrate kinase Clostridium acetobutylicum WP _ 010966356 ucts , including polymethyl methacrylate (PMMA ) , which has a global market value of $ 7 billion , isobutylene , which In a preferred embodiment, the butyrate kinase is Buk 55 has a global market value of $ 25 -29 billion, and propylene , from Clostridium acetobutylicum (WP _ 010966356 ; SEQ ID which has a global market value of $ 125 billion . Addition NO : 90 ) or Clostridium beijerinckii (WP _ 011967556 ; SEQ ally , a route from acetone to jet fuel has recently been ID NO : 91 ) (WP 017209677 ; SEQ ID NO : 92 ) reported . Currently , industrial acetone production is directly (WP _ 026886638 ; SEQ ID NO : 93 ) (WP _ 041893502 ; SEQ linked to petrochemical phenol production , as it is a by ID NO : 94 ) . Clostridium autoethanogenum , Clostridium 60 product of the cumene process . Around 92 % of acetone ljungdahlii , and Clostridium ragsdalei do not natively con - output by volume is a co - product of phenol production from tain butyrate kinase . cumene. This has significant implications on both environ Since Ptb - Buk has been shown to function on a broad ment and market. In the cumene process, per mol phenol range of substrates it is reasonable to assume that if Ptb - Buk produced one mol of sodium sulfite accumulates posing a does not exhibit any activity and a desired substrate it can be 65 serious waste management problem and a challenge to engineered to achieve activity on the substrate in question . natural environments and human health . The world market A strategy could be (but would not be limited to ) rational demand for phenol is expected to stagnate or decline , while US 10 , 316 , 337 B2 37 38 the demand for acetone is predicted to rise . Alternative Clostridium autoethanogenum , Clostridium ljungdahlii , or phenol production routes from direct oxidation of benzene Clostridium ragsdalei ) , the microorganism may bemodified are in development and expected to commercialize soon ; to knock down or knock out the expression of primary : this could result in a complete elimination of acetone secondary alcohol dehydrogenase ( e . g ., by disrupting the production . 5 gene encoding the primary : secondary alcohol dehydroge Acetone has been produced at industrial scale for almost nase ) , such that the microorganism produces acetone with 100 years , as a by - product of butanol in ABE fermentation out converting it to isopropanol (WO 2015 /085015 ) . While industrial ABE fermentation declined in the second In one embodiment, the microorganism may comprise half of the 20th century due to low oil prices and high sugar more than one pathway for the production of acetone . costs , it has recently revived , with several commercial plants 10 The invention provides a microorganism capable of pro built during the last few years . Multiple groups have also ducing isopropanol or precursors thereof from a substrate . demonstrated acetone production from sugar in heterolo - The invention further provides a method of producing gous hosts that express the corresponding enzymes from isopropanol or precursors thereof by culturing such a micro ABE fermentation organisms, in particular E . coli and yeast organism in the presence of a substrate . In preferred embodi through metabolic engineering and synthetic biology 15 ments , the microorganism is derived from a parentalmicro approaches by several academic groups. However, low organism selected from the group consisting of Clostridium yields and high costs associated the pre - treatment needed to autoethanogenum , Clostridium ljungdahlii, or Clostridium release the polysaccharide - component of biomass make the ragsdalei . However , the microorganism may also be derived production of acetone via standard fermentation uneco - from an entirely different microorganism , e . g ., Eschericia nomic as current biochemical conversion technologies do 20 coli. The enzymatic pathways described for the production not utilize the lignin component of biomass , which can of isopropanol may comprise endogenous enzymes and, constitute up to 40 % of this material. where endogenous enzyme activity is absent or low , exog The invention provides a microorganism capable of pro - enous enzymes. ducing acetone or precursors thereof from a substrate . The Isopropanol via steps 1 , 2 , 3 , and 4 : In one embodiment, invention further provides a method of producing acetone or 25 the invention provides a microorganism comprising precursors thereof by culturing such a microorganism in the enzymes for steps 1 , 2 , 3 , and 4 , whereby the microorganism presence of a substrate . In preferred embodiments , the is capable of producing isopropanol or precursors thereof microorganism is derived from a parental microorganism from a substrate , such as a gaseous substrate. Typically , at selected from the group consisting of Clostridium autoetha - least one of the enzymes in this pathway is exogenous to the nogenum , Clostridium ljungdahlii , or Clostridium ragsdalei. 30 microorganism . In a preferred embodiment, step 2 is cata However, the microorganism may also be derived from an lyzed by Ptb - Buk . Exemplary types and sources of enzymes entirely different microorganism , e. g ., Eschericia coli . The for steps 1 , 2 , 3 , and 4 are described elsewhere in this enzymatic pathways described for the production of acetone application . If the microorganism is derived from a parental may comprise endogenous enzymes and , where endogenous microorganism that natively contains a primary :secondary enzyme activity is absent or low , exogenous enzymes . 35 alcohol dehydrogenase capable of converting acetone to Acetone via steps 1 , 2 , and 3 : In one embodiment, the isopropanol (step 4 ) (e . g ., Clostridium autoethanogenum , invention provides a microorganism comprising enzymes Clostridium ljungdahlii , or Clostridium ragsdalei) , intro for steps 1 , 2 , and 3 , whereby the microorganism is capable duction of an exogenous enzyme for step 4 is not required of producing acetone or precursors thereof from a substrate , to produce isopropanol. However, modification of the such as a gaseous substrate . Typically , at least one of the 40 microorganism , for example , to overexpress a native prima enzymes in this pathway is exogenous to the microorganism . ry :secondary alcohol dehydrogenase may result in enhanced In a preferred embodiment, step 2 is catalyzed by Ptb -Buk . production of isopropanol . Exemplary types and sources of enzymes for steps 1 , 2 , and Isopropanol via steps 1 , 13 , 14 , 15 , 3 , and 4 : In one 3 are described elsewhere in this application . If the micro - embodiment, the invention provides a microorganism com organism is derived from a parental microorganism that 45 prising enzymes for steps 1 , 13 , 14 , 15 , 3 , and 4 , whereby the natively contains a primary :secondary alcohol dehydroge microorganism is capable of producing isopropanol or pre nase capable of converting acetone to isopropanol (step 4 ) cursors thereof from a substrate , such as a gaseous substrate . ( e. g ., Clostridium autoethanogenum , Clostridium ljungdah - Typically , at least one of the enzymes in this pathway is lii , or Clostridium ragsdalei) , the microorganism may be exogenous to the microorganism . In a preferred embodi modified to knock down or knock out the expression of 50 ment, step 14 is catalyzed by Ptb -Buk . Exemplary types and primary : secondary alcohol dehydrogenase ( e . g . , by disrupt - sources of enzymes for steps 1 , 13 , 14 , 15 , 3 , and 4 are ing the gene encoding the primary : secondary alcohol dehy described elsewhere in this application . If the microorgan drogenase ) , such that the microorganism produces acetone ism is derived from a parental microorganism that natively without converting it to isopropanol (WO 2015 /085015 ). contains a primary : secondary alcohol dehydrogenase Acetone via steps 1 , 13 , 14 , 15 , and 3 : In one embodiment, 55 capable of converting acetone to isopropanol ( step 4 ) ( e . g . , the invention provides a microorganism comprising exog - Clostridium autoethanogenum , Clostridium ljungdahlii , or enous enzymes for steps 1, 13, 14 , 15 , and 3, whereby the Clostridium ragsdalei) , introduction of an exogenous microorganism is capable of producing acetone or precur - enzyme for step 4 is not required to produce isopropanol. sors thereof from a substrate , such as a gaseous substrate . However, modification of the microorganism , for example , Typically , at least one of the enzymes in this pathway is 60 to overexpress a native primary : secondary alcohol dehydro exogenous to the microorganism . In a preferred embodi- genase may result in enhanced production of isopropanol. ment, step 14 is catalyzed by Ptb -Buk . Exemplary types and In one embodiment, the microorganism may comprise sources of enzymes for steps 1 , 13 , 14 , 15 , and 3 are more than one pathway for the production of isopropanol. described elsewhere in this application . If the microorgan - Production of Isobutylene ism is derived from a parental microorganism that natively 65 Isobutylene is a major chemical building block with a contains a primary : secondary alcohol dehydrogenase market size of over 15 million tons and a global market capable of converting acetone to isopropanol ( step 4 ) ( e . g ., value of $ 25 - 29 billion . Beyond its use in chemistry and as US 10 , 316 , 337 B2 39 40 a fuel additive (15 Mt/ yr ), isobutylene may be converted to Production of 3 -Hydroxybutyrate isooctane , a high performance , drop - in fuel for gasoline cars . 3 -Hydroxybutyrate (3 - HB ) is a four carbon carboxylic Global Bioenergies has filed patent applications on the acid in the family of betahydroxy acids. 3 -hydroxybutyrate fermentative production of isobutene ( i. e ., isobutylene ) from is a cosmetic ingredient for oily skin clarification , an inter acetone , but none of the disclosed routes involve Ptb - Buk 5 mediate for anti - aging cream formulations, an intermediate ( WO 2010 /001078 ; EP 2295593 ; WO 2011 /076691 ; van for polyhydroxybutyrate (PHB ) , a biodegradable polymer Leeuwen , Appl Microbiol Biotechnol, 93 : 1377 - 1387 , 2012 ) . resin , and co -monomer with other polyhydroxy acids for The invention provides a microorganism capable of pro novel bioplastics. Additionally , 3 -hydroxybutyrate has spe ducing isobutylene or precursors thereof from a substrate . cialty applications in biocompatible and biodegradable The invention further provides a method of producing 10 isobutylene or precursors thereof by culturing such a micro nanocomposites, particularly for medical implants, interme organism in the presence of a substrate . In preferred embodi diate for C3 / C4 chemicals, chiral building blocks, and fine ments, the microorganism is derived from a parental micro chemicals . Although the production of ( R ) - and ( S ) - 3 organism selected from the group consisting of Clostridium hydroxybutyrate by recombinant E . coli grown on glucose , autoethanogenum , Clostridium ljungdahlii , or Clostridium 15 the production of 3 -hydroxybutyrate has not been demon ragsdalei. However, the microorganism may also be derived strated from microorganisms grown on gaseous substrates from an entirely different microorganism , e . g ., Eschericia ( Tseng , Appl Environ Microbiol, 75 : 3137 -3145 , 2009 ). coli . The enzymatic pathways described for the production Notably , the system previously demonstrated in E . coli was of isobutylene may comprise endogenous enzymes and , not directly transferrable to acetogens , including C . where endogenous enzyme activity is absent or low , exog - 20 autoethanogenum , due to the presence of native thio enous enzymes . esterases in acetogens. Although E . coli also has a thio FIG . 1 shows two alternative routes to isobutylene . The esterase TesB that can act on 3 - HB - COA , Tseng showed that first involves the production of isobutylene via steps 1 , 2 , 3 , background activity is minimal ( < 0 . 1 g /L ) . While in E . coli 5 , and 6 . The second involves the production of isobutylene production of stereopure isomers were reported , the inven via steps 1 , 2 , 3 , 7 , 8 , and 6 . Steps 2 and 8 may be catalyzed 25 tors surprisingly found that a mix of isomers were produced by Ptb - Buk . Accordingly , each route may involve Ptb - Buk . in C . autoethanogenum . Without being bound to this theory , Isobutylene via steps 1 , 2 , 3 , 5 , and 6 : In one embodiment, the invention provides a microorganism comprising this is likely a result of native isomerase activity . This enzymes for steps 1 , 2 , 3 , 5 , and 6 , whereby the microor enables the combination of an (S ) -specific 3 -hydroxybu ganism is capable of producing isobutylene or precursors 30 tyryl- CoA dehydrogenase ( Hbd ) to be combined with the thereof from a substrate , such as a gaseous substrate . Typi ( R ) -specific Ptb - Buk for optimized production . To produce cally , at least one of the enzymes in this pathway is exog stereopure isomers , this activity can be knocked -out . Taken enous to the microorganism . In a preferred embodiment, together , it this invention enables to produce several g /L of step 2 is catalyzed by Ptb - Buk . Exemplary types and sources 3 - HB compared to low production in E . coli and using of enzymes for steps 1 , 2 , 3 , 5 , and 6 are described elsewhere 355 Ptb -Buk any combination of (R )- or ( S ) -specific 3 -hydroxy in this application . If the microorganism is derived from a butyryl- CoA dehydrogenase and native Clostridium parental microorganism that natively contains a primary : autoethanogenum thioesterase . secondary alcohol dehydrogenase capable of converting The invention provides a microorganism capable of pro acetone to isopropanol ( step 4 ) ( e . g ., Clostridium autoetha - ducing 3 -hydroxybutyrate or precursors thereof from a sub nogenum , Clostridium ljungdahlii , or Clostridium ragsda - 40 strate . The invention further provides a method of producing lei) , the microorganism may be modified to knock down or 3 -hydroxybutyrate or precursors thereof by culturing such a knock out the expression of primary : secondary alcohol microorganism in the presence of a substrate . In preferred dehydrogenase ( e . g . , by disrupting the gene encoding the embodiments , the microorganism is derived from a parental primary : secondary alcohol dehydrogenase ) to prevent the microorganism selected from the group consisting of conversion of acetone to isopropanol and maximize the 45 Clostridium autoethanogenum , Clostridium ljungdahlii, or conversion of acetone to isobutylene . Clostridium ragsdalei. However, the microorganism may Isobutylene via steps 1 , 2 , 3 , 7 , 8 , and 6 : In one embodi - also be derived from an entirely different microorganism , ment, the invention provides a microorganism comprising e . g ., Eschericia coli . The enzymatic pathways described for enzymes for steps 1 , 2 , 3 , 7 , 8 , and 6 , whereby the micro - the production of 3 - hydroxybutyrate may comprise endog organism is capable of producing isobutylene or precursors 50 enous enzymes and , where endogenous enzyme activity is thereof from a substrate , such as a gaseous substrate . Typi - absent or low , exogenous enzymes . cally , at least one of the enzymes in this pathway is exog - FIG . 1 shows two alternative routes to 3 -hydroxybutyrate . enous to the microorganism . In a preferred embodiment . The first involves the production of 3 -hydroxybutyrate via step 2 and /or step 8 are catalyzed by Ptb - Buk . Exemplary steps 1 , 2 , and 15 . The second involves the production of types and sources of enzymes for steps 1 , 2 , 3 , 7 , 8 , and 6 55 3 -hydroxybutyrate via steps 1 , 13, and 14 . Steps 2 and 14 are described elsewhere in this application . If the microor - may be catalyzed by Ptb -Buk . Accordingly , each route may ganism is derived from a parental microorganism that involve Ptb -Buk . In one embodiment, the microorganism natively contains a primary :secondary alcohol dehydroge may comprise more than one pathway for the production of nase capable of converting acetone to isopropanol ( step 4 ) 3 -hydroxybutyrate , wherein Ptb - Buk may catalyze more ( e . g . , Clostridium autoethanogenum , Clostridium ljungdah - 60 than one step ( e . g . , steps 2 and 14 ) . lii, or Clostridium ragsdalei) , the microorganism may be 3 -Hydroxybutyrate via steps 1, 2, and 15 : In one embodi modified to knock down or knock out the expression of ment, the invention provides a microorganism comprising primary : secondary alcohol dehydrogenase ( e . g ., by disrupt enzymes for steps 1 , 2 , and 15 , whereby the microorganism ing the gene encoding the primary: secondary alcohol dehy is capable of producing 3 -hydroxybutyrate or precursors drogenase ) to prevent the conversion of acetone to isopro - 65 thereof from a substrate , such as a gaseous substrate . Typi panol and maximize the conversion of acetone to cally , at least one of the enzymes in this pathway is exog isobutylene . enous to the microorganism . In a preferred embodiment, US 10 , 316 , 337 B2 42 step 2 is catalyzed by Ptb - Buk . Exemplary types and sources prising enzymes for steps 1 , 13 , 14 , 16 , and 17, whereby the of enzymes for steps 1 , 2 , and 15 are described elsewhere in microorganism is capable of producing 1 , 3 - butanediol or this application . precursors thereof from a substrate , such as a gaseous 3 -Hydroxybutyrate via steps 1 , 13 , and 14 : In one substrate . Typically , at least one of the enzymes in this embodiment, the invention provides a microorganism com - 5 pathway is exogenous to the microorganism . In a preferred prising enzymes for steps 1 , 13 , and 14 , whereby the embodiment, step 14 is catalyzed by Ptb -Buk . Exemplary microorganism is capable of producing 3 - hydroxybutyrate types and sources of enzymes for steps 1 , 13, 14 , 16 , and 17 or precursors thereof from substrate , such as a gaseous are described elsewhere in this application . substrate . Typically, at least one of the enzymes in this 1, 3 -Butanediol via steps 1 , 13 , 18 , and 17 : In one embodi pathway is exogenous to the microorganism . In a preferred 10 ment , the invention provides a microorganism comprising embodiment, step 14 is catalyzed by Ptb - Buk . Exemplary enzymes for steps 1 , 13 , 18 , and 17 , whereby the microor types and sources of enzymes for steps 1 , 13 , and 14 are ganism is capable of producing 1, 3 - butanediol or precursors described elsewhere in this application . thereof from a substrate, such as a gaseous substrate ( FIG . Production of 1 ,3 -Butanediol 11 ) . Typically , at least one of the enzymes in this pathway is 1, 3 -Butanediol ( 1, 3 -BDO ) is commonly used as a solvent 15 exogenous to the microorganism . Exemplary types and for food flavoring agents and is a co -monomer used in sources of enzymes for steps 1 , 13 , 18 , and 17 are described certain polyurethane and polyester resins. More importantly, elsewhere in this application . A similar route has been 1 , 3 -butanediol may be catalytically converted to 1 , 3 -buta - demonstrated in E . coli , but not in acetogens such as diene (Makshina , Chem Soc Rev, 43 : 7917 -7953 , 2014 ) . Clostridium autoethanogenum , Clostridium ljungdahlii , and Butadiene is used to produce rubber, plastics, lubricants , 20 Clostridium ragsdalei (Kataoka , J Biosci Bioeng , 115 : 475 latex , and other products . While much of the butadiene 480 , 2013 ) . Although the use of Ptb -Buk results in the produced today is used for the rubber in automobile tires , it production of ( R ) - 1 , 3 -butanediol , this route , which does not can also be used to produce adiponitrile , which can be used require the use of Ptb - Buk , may result in the production of in the manufacture of nylon 6 , 6 . Global demand for buta ( 5 ) - 1 , 3 -butanediol . diene is on the rise . In 2011 , there was an estimated 10 . 5 25 Production of 2 -Hydroxyisobutyrate million tons of demand , valued at $ 40 billion . 2 - Hydroxyisobutyrate ( 2 -HIB ) is a four carbon carboxylic The invention provides a microorganism capable of pro - acid that may serve as a building block for many types of ducing 1 , 3 -butanediol or precursors thereof from a substrate . polymers . The methyl ester of methacrylic acid , which can The invention further provides a method of producing be synthesized by dehydration of 2 -hydroxyisobutyrate or 1, 3 -butanediol or precursors thereof by culturing such a 30 via the corresponding amide, is polymerized to polymeth microorganism in the presence of substrate . In preferred ylmethacrylate (PMMA ) for the production of acrylic glass , embodiments , the microorganism is derived from a parental durable coatings, and inks . For this compound alone , the microorganism selected from the group consisting of global market exceeds 3 million tons . Other branched C4 Clostridium autoethanogenum , Clostridium ljungdahlii , or carboxylic acids , e .g ., chloro - and amino -derivatives of Clostridium ragsdalei . However, the microorganism may 35 2 -hydroxyisobutyrate , as well as isobutylene glycol and its also be derived from an entirely different microorganism , oxide , are also used in polymers and for many other appli e . g ., Eschericia coli . The enzymatic pathways described for c ations . the production of 1 , 3 -butanediol may comprise endogenous The stereospecificity of the Ptb -Buk system is particularly enzymes and , where endogenous enzyme activity is absent useful in overcoming the limitations of the current state of or low , exogenous enzymes. 40 art with respect to the production of 2 -hydroxyisobutyrate . In certain embodiments, the microorganism may produce Both Ptb - Buk and thioesterases are promiscuous, such that 1 , 3 -butanediol without co - production of ethanol ( or with side activity with 3 - hydroxybutyryl - CoA may divert production of only a small amount of ethanol, e . g. , less than resources away from target pathways for the production of 0 . 1 - 1 .0 g / L ethanol or less than 1 - 10 g / L ethanol) . 2 -hydroxyisobutyryl -CoA ( see , e . g . , FIG . 1 and FIG . 8 ) . FIG . 1 shows three alternative routes to 1, 3 -butanediol . 45 However, Ptb -Buk is able to distinguish between stereoiso The first involves the production of 1 , 3 -butanediol via steps mers and will act on ( R ) - 3 -hydroxybutyryl - CoA , but not on 1 , 2 , 15 , 16 , and 17 . The second involves the production of ( S ) - 3 -hydroxybutyryl - CoA . In contrast , thioesterases are not 1 , 3 -butanediol via steps 1 , 13 , 14 , 16 , and 17 . The third able to distinguish between 3 -hydroxybutyryl - CoA stereoi involves the production of 1 , 3 - butanediol via steps 1 , 13 , 18 , somers. In a preferred embodiment, an ( S ) -specific and 17 . Steps 2 and 14 may be catalyzed by Ptb -Buk . 50 acetoacetyl- CoA hydratase ( EC 4 .2 . 1. 119 ) (step 13 ) is cho Accordingly , at least the first and second routes may involve sen in combination with the Ptb -Buk (step 20 ) to avoid Ptb - Buk . In one embodiment, the microorganism may com - losses to 3 -hydroxybutyrate and maximize 2 - hydroxyisobu prise more than one pathway for the production of 1 ,3 tyrate yield (FIG . 8 ). The (S ) -specific form of 3 -hydroxy butanediol. In a related embodiment, the Ptb - Buk may butyryl- CoA is also the preferred substrate for the 2 -hy catalyze more than one step ( e . g ., steps 2 and 14 ) . 55 droxyisobutyryl- CoA mutase ( EC 5 . 4 . 99 . - ) (step 19 ) 1 , 3 - Butanediol via steps 1 , 2 , 15 , 16 , and 17 : In one ( Yaneva, J Biol Chem , 287 : 15502 - 15511 , 2012 ) . embodiment, the invention provides a microorganism com - The invention provides a microorganism capable of pro prising enzymes for steps 1, 2 , 15 , 16 , and 17 , whereby the ducing 2 -hydroxyisobutyrate or precursors thereof from a microorganism is capable of producing 1 , 3 -butanediol or substrate . The invention further provides a method of pro precursors thereof from a substrate , such as a gaseous 60 ducing 2 -hydroxyisobutyrate or precursors thereof by cul substrate . Typically , at least one of the enzymes in this turing such a microorganism in the presence of a substrate . pathway is exogenous to the microorganism . In a preferred In preferred embodiments , the microorganism is derived embodiment, step 2 is catalyzed by Ptb - Buk . Exemplary from a parental microorganism selected from the group types and sources of enzymes for steps 1 , 2 , 15 , 16 , and 17 consisting of Clostridium autoethanogenum , Clostridium are described elsewhere in this application . 65 ljungdahlii , or Clostridium ragsdalei . However , the micro 1 , 3 - Butanediol via steps 1 , 13 , 14 , 16 , and 17 : In one organism may also be derived from an entirely different embodiment, the invention provides a microorganism com - microorganism , e .g . , Eschericia coli. The enzymatic path US 10 ,316 , 337 B2 43 44 ways described for the production of 2 -hydroxyisobutyrate In one embodiment, the microorganism may comprise may comprise endogenous enzymes and , where endogenous more than one pathway for the production of adipic acid . enzyme activity is absent or low , exogenous enzymes . Production of 1 , 3 -Hexanediol 2 -Hydroxyisobutyrate via steps 1 , 13 , 19 , and 20 : In one The invention provides a microorganism capable of pro embodiment, the invention provides a microorganism com - 5 ducing 1 , 3 -hexanediol or precursors thereof from a substrate prising enzymes for steps 1 , 13 , 19 , and 20 , whereby the ( FIG . 35 ) . The invention further provides a method of microorganism is capable of producing 2 -hydroxyisobu - producing 1 , 3 -hexanediol or precursors thereof by culturing tyrate or precursors thereof from a substrate , such as a such a microorganism in the presence of a substrate . In gaseous substrate . Typically , at least one of the enzymes in preferred embodiments , the microorganism is derived from this pathway is exogenous to the microorganism . In a 10 a parental microorganism selected from the group consisting preferred embodiment, step 20 is catalyzed by Ptb -Buk . of Clostridium autoethanogenum , Clostridium ljungdahlii , Exemplary types and sources of enzymes for steps 1 , 13 , 19 , or Clostridium ragsdalei. However , the microorganism may and 20 are described elsewhere in this application . also be derived from an entirely different microorganism , In certain embodiments , the invention also provides a e . g ., Eschericia coli . The enzymatic pathways described for microorganism capable of producing 2 -hydroxybutyrate 15 the production of 1 , 3 - hexanediol may comprise endogenous ( 2 - HB ) or precursors thereof from a substrate. The invention enzymes and , where endogenous enzyme activity is absent further provides a method of producing 2 -hydroxybutyrate or low , exogenous enzymes . or precursors thereof by culturing such a microorganism in The pathways depicted in FIG . 35 begin with 3 -hydroxy the presence of a substrate . Without wishing to be bound by butyryl - CoA , which may be produced via steps 1 and 13 , as any particular theory , the inventors believe the observed 20 depicted in FIG . 1 . production of 2 - hydroxybutyrate is attributable to nonspe 1 , 3 -Hexanediol via steps 1 , 13, 27 , 31 , 32, 36 , 37 , 38 , and cific mutase activity in microorganisms such as Clostridium 39: In one embodiment, the invention provides a microor autoethanogenum , Clostridium ljungdahlii , and Clostridium ganism comprising enzymes for steps 1 , 13, 27 , 31, 32 , 36 , ragsdalei. 37 , 38 , and 39 , whereby the microorganism is capable of Production of Adipic Acid 25 producing 1 , 3 - hexanediol or precursors thereof from a sub Adipic acid is the most important dicarboxylic acid with strate , such as a gaseous substrate . Typically , at least one of an estimated market of greater US $ 4 . 5 billion with about the enzymes in this pathway is exogenous to the microor 2 .5 billion kgs produced annually . Over 60 % of produced ganism . In a preferred embodiment, step 37 is catalyzed by adipic acid is being used as monomer precursor for the Ptb -Buk . Exemplary types and sources of enzymes for steps production of nylon and the global market for adipic acid is 30 1 , 13 , 27 , 31 , 32 , 36 , 37 , 38 , and 39 are described elsewhere expected to reach US $ 7 . 5 billion by 2019 . Currently , adipic in this application . acid is almost excusively produced petrochemically , e . g . by Production of 3 -Methyl - 2 -butanol carbonylation of butadiene. The invention provides a microorganism capable of pro The invention provides a microorganism capable of pro - ducing 3 -methyl - 2 - butanol or precursors thereof from a ducing adipic acid or precursors thereof from a substrate 35 substrate ( FIG . 35 ) . The invention further provides a method ( FIG . 34 ) . The invention further provides a method of of producing 3 -methyl - 2 -butanol or precursors thereof by producing adipic acid or precursors thereof by culturing culturing such a microorganism in the presence of a sub such a microorganism in the presence of a substrate . In strate . In preferred embodiments , the microorganism is preferred embodiments , the microorganism is derived from derived from a parental microorganism selected from the a parental microorganism selected from the group consisting 40 group consisting of Clostridium autoethanogenum , of Clostridium autoethanogenum , Clostridium ljungdahlii , Clostridium ljungdahlii , or Clostridium ragsdalei . However, or Clostridium ragsdalei . However, the microorganism may the microorganism may also be derived from an entirely also be derived from an entirely different microorganism , different microorganism , e . g . , Eschericia coli . The enzy e . g . , Eschericia coli . The enzymatic pathways described for matic pathways described for the production of 3 -methyl the production of adipic acid may comprise endogenous 45 2 -butanol may comprise endogenous enzymes and , where enzymes and , where endogenous enzyme activity is absent endogenous enzyme activity is absent or low , exogenous or low , exogenous enzymes . enzymes . Adipic acid via steps 22 , 23 , 24 , 25 , and 26 : In one The pathways depicted in FIG . 35 begin with 3- hydroxy embodiment, the invention provides a microorganism com - butyryl- CoA , which may be produced via steps 1 and 13 , as prising enzymes for steps 22 , 23 , 24 , 25 , and 26 , whereby the 50 depicted in FIG . 1 . microorganism is capable of producing adipic acid or pre 3 -Methyl - 2 -butanol via steps 1, 13, 27 , 31, 32, 33 , 34 , and cursors thereof from a substrate , such as a gaseous substrate . 35 : In one embodiment, the invention provides a microor Typically , at least one of the enzymes in this pathway is ganism comprising enzymes for steps 1 , 13 , 27 , 31 , 32 , 33 , exogenous to the microorganism . In a preferred embodi- 34 , and 35 , whereby the microorganism is capable of pro ment, step 26 is catalyzed by Ptb -Buk . Exemplary types and 55 ducing 3 -methyl - 2 -butanol or precursors thereof from a sources of enzymes for steps 22 , 23 , 24 , 25 , and 26 are substrate , such as a gaseous substrate . Typically , at least one described elsewhere in this application . of the enzymes in this pathway is exogenous to the micro Adipic acid via steps 21 , 22 , 23 , 24 , 25 , and 26 : In one organism . In a preferred embodiment, step 33 is catalyzed by embodiment, the invention provides a microorganism com - Ptb - Buk . Exemplary types and sources of enzymes for steps prising enzymes for steps 21, 22 , 23, 24 , 25 , and 26 , 60 1 , 13 , 27 , 31, 32 , 33 , 34 , and 35 are described elsewhere in whereby the microorganism is capable of producing adipic this application . acid or precursors thereof from a substrate , such as a gaseous Production of 2 - Buten - 1 -ol substrate . Typically , at least one of the enzymes in this The invention provides a microorganism capable of pro pathway is exogenous to the microorganism . In a preferred ducing 2 -buten - 1 -ol or precursors thereof from a substrate embodiment, step 26 is catalyzed by Ptb - Buk . Exemplary 65 (FIG . 35 ) . The invention further provides a method of types and sources of enzymes for steps 21, 22 , 23 , 24 , 25 , producing 2 - buten - 1 -ol or precursors thereof by culturing and 26 are described elsewhere in this application . such a microorganism in the presence of a substrate . In US 10 ,316 , 337 B2 45 46 preferred embodiments , the microorganism is derived from as a gaseous substrate . Typically , at least one of the enzymes a parental microorganism selected from the group consisting in this pathway is exogenous to the microorganism . In a of Clostridium autoethanogenum , Clostridium ljungdahlii, preferred embodiment, step 44 is catalyzed by Ptb -Buk . or Clostridium ragsdalei. However, the microorganism may Exemplary types and sources of enzymes for steps 1 , 40 , 41 , also be derived from an entirely different microorganism , 5 42, 43 , 44 , 45 , and 46 are described elsewhere in this e . g ., Eschericia coli . The enzymatic pathways described for application . the production of 2 -buten - 1 - ol may comprise endogenous enzymes and , where endogenous enzyme activity is absent Isoamyl alcohol via steps 1, 40 , 41, 42 , 43 , 47 and 46 : In or low , exogenous enzymes . one embodiment, the invention provides a microorganism The pathways depicted in FIG . 35 begin with 3 -hydroxy - 10 comprising enzymes for steps 1 , 40 , 41, 42, 43 , 47 and 46 , butyryl- CoA , which may be produced via steps 1 and 13 , as whereby themicroorganism is capable of producing isoamyl depicted in FIG . 1 . alcohol or precursors thereof from a substrate , such as a 2 - Buten - 1 - ol via steps 1 , 13, 27, 28 , 29 , and 30 : In one gaseous substrate . Typically , at least one of the enzymes in embodiment, the invention provides a microorganism com this pathway is exogenous to themicroorganism . Exemplary prising enzymes for steps 1, 13 , 27, 28 , 29 , and 30 , whereby 15 types and sources of enzymes for steps 1 , 40 , 41, 42, 43 , 47 the microorganism is capable of producing 2 - buten - 1 - ol or and 46 are described elsewhere in this application . precursors thereof from a substrate , such as a gaseous In one embodiment, the microorganism may comprise substrate . Typically, at least one of the enzymes in this more than one pathway for the production of isoamyl pathway is exogenous to the microorganism . In a preferred alcohol. embodiment, step 28 is catalyzed by Ptb -Buk . Exemplary 20 Production of Additional Products types and sources of enzymes for steps 1, 13 , 27 , 28 , 29, and The invention provides a microorganism comprising 30 are described elsewhere in this application . exogenous Ptb - Buk and exogenous or endogenous alde Production of Isovalerate hyde :ferredoxin oxidoreductase ( AOR ) . Such a microorgan The invention provides a microorganism capable of pro - ism may produce , for example , 1 - propanol, 1 - butanol, ducing isovalerate or precursors thereof from a substrate 25 1 -hexanol , and 1 - octanol or precursors thereof from acetyl ( FIG . 36 ) . The invention further provides a method of COA generated , for example , from a gaseous substrate ( FIG . producing isovalerate or precursors thereof by culturing 32 ) . The invention further provides a method of producing such a microorganism in the presence of a substrate . In 1 -propanol , 1 - butanol, 1 - hexanol, and 1 - octanol or precur preferred embodiments , the microorganism is derived from sors thereof by culturing such a microorganism in the a parental microorganism selected from the group consisting 30 presence of a gaseous substrate . Clostridium autoethanoge of Clostridium autoethanogenum , Clostridium ljungdahlii , num , Clostridium ljungdahlii , and Clostridium ragsdalei or Clostridium ragsdalei . However, the microorganism may natively comprise AOR . However , AOR may be overex also be derived from an entirely different microorganism , pressed in such microorganisms in combination with expres e . g . , Eschericia coli . The enzymatic pathways described for s ion of exogenous Ptb -Buk . Alternatively , exogenous AOR the production of isovalerate may comprise endogenous 35 and exogenous Ptb -Buk may be expressed in a microorgan enzymes and , where endogenous enzyme activity is absent ism other than Clostridium autoethanogenum , Clostridium or low , exogenous enzymes . ljungdahlii , and Clostridium ragsdalei, such as Escherichia Isovalerate via steps 1 , 40 , 41, 42 , 43 , and 44 : In one coli. embodiment, the invention provides a microorganism com - Production of Precursors and Intermediates prising enzymes for steps 1 , 40 , 41, 42 , 43 , and 44 , whereby 40 The pathways depicted in FIGS. 1 , 34 , 35 , and 36 may be the microorganism is capable of producing isovalerate or modified to produce precursors or intermediates of the precursors thereof from a substrate , such as a gaseous aforementioned products. In particular, partial enzymatic substrate . Typically, at least one of the enzymes in this pathways for any of the pathways described herein may be pathway is exogenous to the microorganism . In a preferred inserted in a host microorganism to obtain production of embodiment, step 44 is catalyzed by Ptb -Buk . Exemplary 45 precursors or intermediates . types and sources of enzymes for steps 1 , 40 , 41 , 42 , 43 , and Definitions and Background 44 are described elsewhere in this application . The term “ genetic modification ” or “ genetic engineering ” Production of Isoamyl Alcohol broadly refers to manipulation of the genome or nucleic The invention provides a microorganism capable of pro - acids of a microorganism . Likewise , the term " genetically ducing isoamyl alcohol or precursors thereof from a sub - 50 engineered ” refers to a microorganism comprising a strate ( FIG . 36 ) . The invention further provides a method of manipulated genome or nucleic acids. Methods of genetic producing isoamyl alcohol or precursors thereof by culturing modification of include , for example , heterologous gene such a microorganism in the presence of a substrate . In expression , gene or promoter insertion or deletion , nucleic preferred embodiments , the microorganism is derived from acid mutation , altered gene expression or inactivation , a parental microorganism selected from the group consisting 55 enzyme engineering, directed evolution , knowledge -based of Clostridium autoethanogenum , Clostridium ljungdahlii, design , random mutagenesis methods, gene shuffling , and or Clostridium ragsdalei. However, the microorganism may codon optimization . also be derived from an entirely different microorganism , “Recombinant ” indicates that a nucleic acid , protein , or e .g ., Eschericia coli. The enzymatic pathways described for microorganism is the product of genetic modification , engi the production of isoamyl alcohol may comprise endog - 60 neering, or recombination . Generally , the term " recombi enous enzymes and , where endogenous enzyme activity is nant” refers to a nucleic acid , protein , or microorganism that absent or low , exogenous enzymes . contains or is encoded by genetic material derived from Isoamyl alcohol via steps 1 , 40 , 41, 42, 43 , 44 , 45 , and 46 : multiple sources , such as two or more different strains or In one embodiment, the invention provides a microorganism species of microorganisms. As used herein , the term “ recom comprising enzymes for steps 1, 40 , 41, 42 , 43 , 44 , 45 , and 65 binant" may also be used to describe a microorganism that 46 , whereby the microorganism is capable of producing comprises a mutated nucleic acid or protein , including a isoamyl alcohol or precursors thereof from a substrate , such m utated form of an endogenous nucleic acid or protein . US 10 , 316 , 337 B2 47 48 “ Endogenous ” refers to a nucleic acid or protein that is “ Mutated ” refers to a nucleic acid or protein that has been present or expressed in the wild - type or parental microor - modified in the microorganism of the invention compared to ganism from which the microorganism of the invention is the wild - type or parental microorganism from which the derived . For example , an endogenous gene is a gene that is microorganism of the invention is derived . In one embodi natively present in the wild -type or parental microorganism 5 ment, the mutation may be a deletion , insertion , or substi from which the microorganism of the invention is derived . tution in a gene encoding an enzyme. In another embodi In one embodiment, the expression of an endogenous gene ment, the mutation may be a deletion , insertion , or may be controlled by an exogenous regulatory element, such substitution of one or more amino acids in an enzyme. as an exogenous promoter. In particular, a " disruptive mutation ” is a mutation that " Exogenous” refers to a nucleic acid or protein that is not reduces or eliminates (i . e ., " disrupts ” ) the expression or present in the wild - type or parental microorganism from activity of a gene or enzyme. The disruptive mutation may which the microorganism of the invention is derived . In one partially inactivate , fully inactivate , or delete the gene or embodiment, an exogenous gene or enzyme may be derived enzyme. The disruptive mutation may be a knockout (KO ) from a heterologous (i . e. , different ) strain or species and 15 mutation . The disruptive mutation may be any mutation that introduced to or expressed in the microorganism of the reduces , prevents , or blocks the biosynthesis of a product invention . In another embodiment , an exogenous gene or produced by an enzyme. The disruptive mutation may enzyme may be artificially or recombinantly created and include , for example , a mutation in a gene encoding an introduced to or expressed in the microorganism of the enzyme, a mutation in a genetic regulatory element involved invention . Exogenous nucleic acids may be adapted to 20 in the expression of a gene encoding an enzyme, the integrate into the genome of the microorganism of the introduction of a nucleic acid which produces a protein that invention or to remain in an extra - chromosomal state in the reduces or inhibits the activity of an enzyme, or the intro microorganism of the invention , for example , in a plasmid duction of a nucleic acid ( e . g . , antisense RNA , siRNA , “ Enzyme activity, ” or simply " activity, ” refers broadly to CRISPR ) or protein which inhibits the expression of an enzymatic activity , including, but not limited , to the activity 25 enzyme . The disruptive mutation may be introduced using of an enzyme, the amount of an enzyme, or the availability any method known in the art. of an enzyme to catalyze a reaction . Accordingly , “ increas- Introduction of a disruptive mutation results in a micro ing ” enzyme activity includes increasing the activity of an organism of the invention that produces no target product or enzyme, increasing the amount of an enzyme, or increasing substantially no target product or a reduced amount of target the availability of an enzyme to catalyze a reaction . Simi- 30 product compared to the parental microorganism from larly , " decreasing ” enzyme activity includes decreasing the which the microorganism of the invention is derived . For activity of an enzyme, decreasing the amount of an enzyme, example , the microorganism of the invention may produce or decreasing the availability of an enzyme to catalyze a no target product or at least about 1 % , 3 % , 5 % , 10 % , 20 % , reaction . 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , or 95 % less target With respect to enzyme activity , a " substrate ” is a mol - 35 product than the parental microorganism . For example , the ecule upon which an enzyme acts and a " product" is a microorganism of the invention may produce less than about molecule produced by the action of an enzyme. A " native 0 .001 , 0 .01 , 0 . 10 , 0 . 30 , 0 . 50 , or 1 . 0 g / L target product. substrate , " therefore, is a molecule upon which an enzyme “ Codon optimization ” refers to the mutation of a nucleic natively acts in a wild -type microorganism and a “ native acid , such as a gene , for optimized or improved translation product ” is a molecule natively produced by the action of the 40 of the nucleic acid in a particular strain or species . Codon enzyme in the wild -type microorganism . For example , optimization may result in faster translation rates or higher butanoyl - CoA is the native substrate of Ptb and butanoyl translation accuracy . In a preferred embodiment, the genes phosphate and is the native substrate of Buk . Additionally , of the invention are codon optimized for expression in butanoyl phosphate is the native product of Ptb and butyrate Clostridium , particularly Clostridium autoethanogenum , (butanoate ) is the native product of Buk . Likewise , a " non - 45 Clostridium ljungdahlii , or Clostridium ragsdalei . In a fur native substrate ” is a molecule upon which an enzyme does ther preferred embodiment, the genes of the invention are not natively act in a wild - type microorganism and a “ non - codon optimized for expression in Clostridium autoethano native product” is a molecule not natively produced by the genum LZ1561, which is deposited under DSMZ accession action of the enzyme in the wild - type microorganism . An number DSM23693 . enzyme that is capable of acting on multiple different 50 " Overexpressed ” refers to an increase in expression of a substrates, whether native or non - native , is typically referred nucleic acid or protein in the microorganism of the invention to as a “ promiscuous ” enzyme. The inventors have discov - compared to the wild - type or parental microorganism from ered that Ptb is promiscuous and is capable of accepting a which the microorganism of the invention is derived . Over variety of acyl- CoAs and enoyl- CoAs as substrates, such expression may be achieved by any means known in the art , that Ptb - Buk may be used to convert a number of acyl - CoAs 55 including modifying gene copy number, gene transcription and enoyl - CoAs to their corresponding acids or alkenates , rate , gene translation rate , or enzyme degradation rate . respectively , while simultaneously generating ATP. Thus, in The term “ variants” includes nucleic acids and proteins preferred embodiments , the Ptb - Buk of the invention acts on whose sequence varies from the sequence of a reference non - native substrates ( i .e . , substrates other than butanoyl- nucleic acid and protein , such as a sequence of a reference COA and / or butanoyl phosphate ) to produce non - native 60 nucleic acid and protein disclosed in the prior art or exem products ( i . e ., products other than butanoyl phosphate and / or plified herein . The invention may be practiced using variant butyrate (butanoate ) ) . nucleic acids or proteins that perform substantially the same The term “ butyryl- CoA ” may be used interchangeably function as the reference nucleic acid or protein . For herein with “ butanoyl -CoA .” example , a variant protein may perform substantially the The term “ energy - generating " or the like may be used 65 same function or catalyze substantially the same reaction as interchangeably herein with “ energy -conserving ” or the like . a reference protein . A variant gene may encode the same or Both of these terms are commonly used in the literature . substantially the same protein as a reference gene . A variant US 10 , 316 , 337 B2 49 50 promoter may have substantially the same ability to promote way promoter , a ferredoxin promoter , a pyruvate : ferredoxin the expression of one ormore genes as a reference promoter. oxidoreductase promoter , an Rnf complex operon promoter , Such nucleic acids or proteins may be referred to herein an ATP synthase operon promoter , or a phosphotransacety as “ functionally equivalent variants .” By way of example , lase /acetate kinase operon promoter . functionally equivalent variants of a nucleic acid may 5 A “ microorganism ” is a microscopic organism , especially include allelic variants , fragments of a gene , mutated genes , a bacterium , archaeon , virus , or fungus . The microorganism polymorphisms, and the like . Homologous genes from other microorganisms are also examples of functionally equiva of the invention is typically a bacterium . As used herein , lent variants. These include homologous genes in species recitation of “ microorganism ” should be taken to encompass such as Clostridium acetobutylicum , Clostridium beijer - 10 " bacterium . ” inckii , or Clostridium ljungdahlii , the details of which are A " parental microorganism ” is a microorganism used to publicly available on websites such as Genbank or NCBI. generate a microorganism of the invention . The parental Functionally equivalent variants also include nucleic acids microorganism may be a naturally - occurring microorganism whose sequence varies as a result of codon optimization for ( i . e . , a wild -type microorganism ) or a microorganism that a particular microorganism . A functionally equivalent vari . 15 has been previously modified ( i. e . , a mutant or recombinant ant of a nucleic acid will preferably have at least approxi microorganism ). The microorganism of the invention may mately 70 % , approximately 80 % , approximately 85 % , be modified to express or overexpress one or more enzymes approximately 90 % , approximately 95 % , approximately that were not expressed or overexpressed in the parental 98 % , or greater nucleic acid sequence identity (percent microorganism . Similarly, the microorganism of the inven homology ) with the referenced nucleic acid . A functionally 20 tion may be modified to contain one or more genes that were equivalent variant of a protein will preferably have at least not contained by the parental microorganism . The microor approximately 70 % , approximately 80 % , approximately ganism of the invention may also be modified to not express 85 % , approximately 90 % , approximately 95 % , approxi or to express lower amounts of one or more enzymes that mately 98 % , or greater amino acid identity (percent homol- were expressed in the parental microorganism . In one ogy ) with the referenced protein . The functional equivalence 25 embodiment, the parental microorganism is Clostridium of a variant nucleic acid or protein may be evaluated using autoethanogenum , Clostridium ljungdahlii , or Clostridium any method known in the art . ragsdalei. In a preferred embodiment , the parental micro Nucleic acids may be delivered to a microorganism of the organism is Clostridium autoethanogenum LZ1561, which invention using any method known in the art. For example , is deposited under DSMZ accession number DSM23693 . nucleic acids may be delivered as naked nucleic acids or 30 The term " derived from ” indicates that a nucleic acid , may be formulated with one or more agents , such as protein , or microorganism is modified or adapted from a liposomes. The nucleic acids may be DNA, RNA , DNA , or different ( e . g . , a parental or wild - type ) nucleic acid , protein , combinations thereof, as is appropriate . Restriction inhibi- or microorganism , so as to produce a new nucleic acid , tors may be used in certain embodiments . Additional vectors protein , or microorganism . Such modifications or adapta may include plasmids, viruses , bacteriophages , cosmids, and 35 tions typically include insertion , deletion , mutation , or sub artificial chromosomes . In a preferred embodiment, nucleic stitution of nucleic acids or genes . Generally , the microor acids are delivered to the microorganism of the invention ganism of the invention is derived from a parental using a plasmid . By way of example , transformation ( includ microorganism . In one embodiment, the microorganism of ing transduction or transfection ) may be achieved by elec - the invention is derived from Clostridium autoethanogenum , troporation , ultrasonication , polyethylene glycol- mediated 40 Clostridium ljungdahlii, or Clostridium ragsdalei. In a pre transformation , chemical or natural competence, protoplast ferred embodiment, the microorganism of the invention is transformation , prophage induction , or conjugation . In cer derived from Clostridium autoethanogenum LZ1561, which tain embodiments having active restriction enzyme systems, is deposited under DSMZ accession number DSM23693 . it may be necessary to methylate a nucleic acid before The microorganism of the invention may be further clas introduction of the nucleic acid into a microorganism . 45 sified based on functional characteristics . For example , the Furthermore , nucleic acids may be designed to comprise microorganism of the invention may be or may be derived a regulatory element, such as a promoter , to increase or from a C1 - fixing microorganism , an anaerobe, an acetogen , otherwise control expression of a particular nucleic acid . an ethanologen , a carboxydotroph , and / or a methanotroph . The promoter may be a constitutive promoter or an inducible Table 1 provides a representative list of microorganisms and promoter. Ideally , the promoter is a Wood- Ljungdahl path identifies their functional characteristics . TABLE 1 C1- fixing Anaerobe Acetogen Ethanologen Autotroph Carboxydotroph Methanotroph

L Acetobacterium woodii + + + +/ - 1

+ + Alkalibaculum bacchii + + + + + + Blautia producta + + + 1 Butyribacterium methylotrophicum + + + + + + Clostridium aceticum + + + + + Clostridium autoethanogenum + + + + + +

+ + Clostridium carboxidivorans + + + + Clostridium coskatii + + + + + + Clostridium drakei + + + + + Clostridium formicoaceticum + + + + + + Clostridium ljungdahlii + + + + + Clostridium magnum + + + + + Clostridium ragsdalei + + + + + I Clostridium scatologenes + + + + + I Eubacterium limosum + + + + + US 10 , 316 , 337 B2 51 TABLE 1 - continued C1- fixing Anaerobe Acetogen Ethanologen Autotroph Carboxydotroph Methanotroph

Moorella thermautotrophica + + + + + + + Moorella thermoacetica ( formerly + + +^I + Clostridium thermoaceticum ) + + Oxobacter pfennigii + + + Sporomusa ovata + + + + + _ 4 TLIII + Sporomusa silvacetica + + + +/ _ S + Sporomusa sphaeroides + + + 76 + Thermoanaerobacter kiuvi + + + II ' Acetobacterium woodi can produce ethanol from fructose , but not from gas. 2It has not been investigated whether Clostridium magnum can grow on CO . One strain ofMoorella thermoacetica , Moorella sp . HUC22 - 1 , has been reported to produce ethanol from gas. " It has not been investigated whether Sporomusa ovata can grow on CO . ' It has not been investigated whether Sporomusa silvacetica can grow on CO . It has not been investigated whether Sporomusa sphaeroides can grow on CO . " C1” refers to a one -carbon molecule , for example , CO , preferred embodiment, the microorganism of the invention CO2, CH4, or CH2OH . “ C1- oxygenate ” refers to a one - is derived from an autotroph identified in Table 1. carbon molecule that also comprises at least one oxygen 20 A “ carboxydotroph ” is a microorganism capable of uti atom , for example , CO , CO . , or CH .OH . “ C1 -carbon lizing CO as a sole source of carbon . Typically , the micro source ” refers a one carbon -molecule that serves as a partial organism of the invention is a carboxydotroph . In a preferred or sole carbon source for the microorganism of the inven embodiment, the microorganism of the invention is derived from a carboxydotroph identified in Table 1 . tion . For example , a Cl - carbon source may compriseerably one the or 25 A “ methanotroph ” is a microorganism capable of utilizing more of CO , CO2, CH4, CH2OH , or CH2O2. Preferably , the methane as a sole source of carbon and energy . In certain C1- carbon source comprises one or both of CO and CO2. A embodiments, the microorganism of the invention is derived “ C1 - fixing microorganism ” is a microorganism that has the from a methanotroph . ability to produce one or more products from a C1- carbon More broadly , the microorganism of the invention may be source . Typically , the microorganism of the invention is a" 30 derived from any genus or species identified in Table 1 . Cl- fixing bacterium . In a preferred embodiment, the micro - In a preferred embodiment, the microorganism of the organism of the invention is derived from a Cl- fixing invention is derived from the cluster of Clostridia compris microorganism identified in Table 1 . ing the species Clostridium autoethanogenum , Clostridium An “ anaerobe” is a microorganism that does not require ljungdahlii, and Clostridium ragsdalei. These species were oxygen for growth . An anaerobe may react negatively or 35 first reported and characterized by Abrini, Arch Microbiol , even die if oxygen is present above a certain threshold 161 : 345 - 351, 1994 (Clostridium autoethanogenum ), Tan Typically , the microorganism of the invention is an anaer - ner, Int J System Bacteriol, 43 : 232 - 236 , 1993 (Clostridium obe. In a preferred embodiment, the microorganism of the ljungdahlii ), and Huhnke , WO 2008 /028055 (Clostridium invention is derived from an anaerobe identified in Table 1 . ragsdalei) . An " acetogen " is a microorganism that produces or is 40 These three species have many similarities . In particular , capable of producing acetate ( or acetic acid ) as a product of these species are all C1- fixing, anaerobic , acetogenic , etha anaerobic respiration . Typically , acetogens are obligately n ologenic , and carboxydotrophic members of the genus anaerobic bacteria that use the Wood - Ljungdahl pathway as Clostridium . These species have similar genotypes and their main mechanism for energy conservation and for phenotypes and modes of energy conservation and fermen synthesis of acetyl -CoA and acetyl -CoA - derived products , 45 tative metabolism . Moreover , these species are clustered in such as acetate (Ragsdale , Biochim Biophys Acta , 1784 : clostridial rRNA homology group I with 16S rRNA DNA 1873 - 1898 , 2008 ) . Acetogens use the acetyl - CoA pathway that is more than 99 % identical, have a DNA G + C content as a ( 1 ) mechanism for the reductive synthesis of acetyl of about 22 - 30 mol % , are gram -positive , have similar COA from CO ,, ( 2 ) terminal electron -accepting , energy morphology and size ( logarithmic growing cells between conserving process , ( 3 ) mechanism for the fixation (assimi - 50 0 . 5 - 0 . 7x3 -5 um ), are mesophilic ( grow optimally at 30 - 37° lation ) of Co , in the synthesis of cell carbon (Drake , C . ) , have similar pH ranges of about 4 - 7 . 5 (with an optimal Acetogenic Prokaryotes , In : The Prokaryotes, 3rd edition , p . pH of about 5 . 5 - 6 ), lack cytochromes , and conserve energy 354 , New York , N . Y ., 2006 ) . All naturally occurring aceto via an Rnf complex . Also , reduction of carboxylic acids into gens are C1 - fixing , anaerobic , autotrophic , and non -metha - their corresponding alcohols has been shown in these spe notrophic . Typically , the microorganism of the invention is 55 cies (Perez , Biotechnol Bioeng, 110 : 1066 - 1077, 2012 ) . an acetogen . In a preferred embodiment, the microorganism Importantly , these species also all show strong autotrophic of the invention is derived from an acetogen identified in growth on CO - containing gases , produce ethanol and acetate Table 1 . ( or acetic acid ) as main fermentation products , and produce An “ ethanologen ” is a microorganism that produces or is small amounts of 2 , 3 -butanediol and lactic acid under cer capable of producing ethanol. Typically , the microorganism 60 tain conditions . of the invention is an ethanologen . In a preferred embodi. However , these three species also have a number of ment, the microorganism of the invention is derived from an differences. These species were isolated from different ethanologen identified in Table 1 . sources : Clostridium autoethanogenum from rabbit gut , An “ autotroph ” is a microorganism capable of growing in Clostridium ljungdahlii from chicken yard waste , and the absence of organic carbon . Instead , autotrophs use 65 Clostridium ragsdalei from freshwater sediment. These spe inorganic carbon sources , such as CO and /or CO2. Typically, cies differ in utilization of various sugars ( e . g . , rhamnose , the microorganism of the invention is an autotroph . In a arabinose ), acids ( e. g. , gluconate , citrate ), amino acids (e .g ., US 10 , 316 , 337 B2 53 54 arginine, histidine ) , and other substrates ( e . g ., betaine , buta - ( e . g ., syngas ) . In some embodiments , the substrate may nol) . Moreover, these species differ in auxotrophy to certain comprise a relatively low amount of CO , such as about 1 - 10 vitamins (e .g . , thiamine , biotin ). These species have differ or 1 - 20 mol % CO . The microorganism of the invention ences in nucleic and amino acid sequences of Wood -Ljung typically converts at least a portion of the CO in the substrate dahl pathway genes and proteins, although the general 5 to a product. In some embodiments , the substrate comprises organization and number of these genes and proteins has no or substantially no CO . been found to be the same in all species (Köpke , Curr Opin The substrate may comprise some amount of Hg. For Biotechnol, 22 : 320 - 325 , 2011) . example , the substrate may comprise about 1 , 2 , 5 , 10 , 15 , Thus, in summary , many of the characteristics of 20 , or 30 mol % H , . In some embodiments, the substrate Clostridium autoethanogenum , Clostridium ljungdahlii, or 10 may comprise a relatively high amount of H , , such as about Clostridium ragsdalei are not specific to that species , but are 60 , 70 , 80 , or 90 mol % H . In further embodiments , the rather general characteristics for this cluster of C1- fixing , substrate comprises no or substantially no H . anaerobic , acetogenic , ethanologenic , and carboxydotrophic The substrate may comprise some amount of CO2. For members of the genus Clostridium . However, since these example , the substrate may comprise about 1 - 80 or 1 - 30 mol species are, in fact, distinct, the genetic modification or 15 % CO2. In some embodiments , the substrate may comprise manipulation of one of these species may not have an less than about 20 , 15 , 10 , or 5 mol % CO2 . In another identical effect in another of these species . For instance , embodiment, the substrate comprises no or substantially no differences in growth , performance, or product production CO2. may be observed . Although the substrate is typically gaseous , the substrate The microorganism of the invention may also be derived 20 may also be provided in alternative forms. For example , the from an isolate or mutant of Clostridium autoethanogenum , substrate may be dissolved in a liquid saturated with a Clostridium ljungdahlii, or Clostridium ragsdalei . Isolates CO - containing gas using a microbubble dispersion genera and mutants of Clostridium autoethanogenum include JA1- 1 tor. By way of further example, the substrate may be (DSM10061 ) ( Abrini, Arch Microbiol, 161 : 345 -351 , 1994 ), adsorbed onto a solid support . LBS1560 (DSM19630 ) (WO 2009 /064200 ) , and LZ1561 25 The substrate and / or C1 - carbon source may be a waste (DSM23693 ). Isolates and mutants of Clostridium ljung - gas obtained as a byproduct of an industrial process or from dahlii include ATCC 49587 ( Tanner, Int J Syst Bacteriol, 43 : some other source , such as from automobile exhaust fumes 232 - 236 , 1993 ) , PETCT (DSM13528 , ATCC 55383 ), ERI- 2 or biomass gasification . In certain embodiments , the indus ( ATCC 55380 ) ( U . S . Pat. No . 5 ,593 ,886 ) , C -01 ( ATCC trial process is selected from the group consisting of ferrous 55988 ) ( U . S . Pat. No . 6 , 368 , 819 ) , 0 - 52 (ATCC 55989 ) 30 metal products manufacturing , such as a steel mill manu ( U . S . Pat. No . 6 , 368, 819 ) , and OTA - 1 ( Tirado - Acevedo , facturing , non - ferrous products manufacturing, petroleum Production of bioethanol from synthesis gas using refining processes , coal gasification , electric power produc Clostridium ljungdahlii , PhD thesis , North Carolina State tion , carbon black production , ammonia production , metha University , 2010 ). Isolates and mutants of Clostridium rags - nol production , and coke manufacturing . In these embodi dalei include PI 1 (ATCC BAA -622 , ATCC PTA -7826 ) (WO 35 ments , the substrate and /or C1 -carbon source may be 2008 /028055 ). captured from the industrial process before it is emitted into In some embodiments , however , the microorganism of the the atmosphere , using any convenient method . invention is a microorganism other than Clostridium The substrate and / or C1 -carbon source may be syngas , autoethanogenum , Clostridium ljungdahlii , or Clostridium such as syngas obtained by gasification of coal or refinery ragsdalei. For example , the microorganism may be selected 40 residues , gasification of biomass or lignocellulosic material , from the group consisting of Escherichia coli, Saccharomy - or reforming of natural gas . In another embodiment, the ces cerevisiae , Clostridium acetobutylicum , Clostridium syngas may be obtained from the gasification of municipal beijerinckii , Clostridium saccharbutyricum , Clostridium solid waste or industrial solid waste . saccharoperbutylacetonicum , Clostridium butyricum , The composition of the substrate may have a significant Clostridium diolis, Clostridium kluyveri, Clostridium pas- 45 impact on the efficiency and / or cost of the reaction . For terianium , Clostridium novyi, Clostridium difficile , example , the presence of oxygen (02 ) may reduce the Clostridium thermocellum , Clostridium cellulolyticum , efficiency of an anaerobic fermentation process . Depending Clostridium cellulovorans , Clostridium phytofermentans , on the composition of the substrate , it may be desirable to Lactococcus lactis , Bacillus subtilis , Bacillus licheniformis , treat, scrub , or filter the substrate to remove any undesired Zymomonas mobilis , Klebsiella oxytoca , Klebsiella pneu - 50 impurities , such as toxins, undesired components , or dust monia , Corynebacterium glutamicum , Trichoderma reesei, particles , and /or increase the concentration of desirable Cupriavidus necator, Pseudomonas putida , Lactobacillus components . plantarum , and Methylobacterium extorquens. The microorganism of the invention may be cultured to “ Substrate ” refers to a carbon and / or energy source for the produce one or more products . For instance , Clostridium microorganism of the invention . Typically , the substrate is 55 autoethanogenum produces or can be engineered to produce gaseous and comprises a C1- carbon source , for example , ethanol (WO 2007/ 117157) , acetate (WO 2007 /117157 ), CO , CO , , and / or CH4. Preferably , the substrate comprises a butanol (WO 2008 / 115080 and WO 2012 /053905 ), butyrate C1 - carbon source of CO or CO + CO , . The substrate may (WO 2008 / 115080 ) , 2 , 3 -butanediol (WO 2009 / 151342 ) , lac further comprise other non -carbon components , such as H2, tate (WO 2011/ 112103 ) , butene (WO 2012 /024522 ) , buta N2, or electrons. 60 diene (WO 2012 /024522 ) , methyl ethyl ketone ( 2 - butanone ) The substrate generally comprises at least some amount of (WO 2012 /024522 and WO 2013 / 185123 ) , ethylene (WO CO , such as about 1 , 2 , 5 , 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , 2012 /026833 ) , acetone (WO 2012 / 115527 ) , isopropanol or 100 mol % CO . The substrate may comprise a range of (WO 2012 / 115527 ) , lipids (WO 2013 / 036147 ) , 3 - hydroxy CO , such as about 20 - 80 , 30 -70 , or 40 -60 mol % CO . propionate ( 3 -HP ) (WO 2013 / 180581 ), isoprene (WO 2013 / Preferably , the substrate comprises about 40 - 70 mol % CO 65 180584 ), fatty acids (WO 2013 / 191567 ) , 2 - butanol (WO ( e . g . , steelmill or blast furnace gas ), about 20 -30 mol % CO 2013 /185123 ), 1 ,2 -propanediol (WO 2014 /0369152 ), and ( e . g . , basic oxygen furnace gas) , or about 15 - 45 mol % CO 1 -propanol (WO 2014 /0369152 ). In addition to one or more US 10 , 316 , 337 B2 55 56 target products , the microorganism of the invention may also inoculum level, maximum gas substrate concentrations to produce ethanol, acetate , and / or 2 , 3 - butanediol. In certain ensure that gas in the liquid phase does not become limiting , embodiments , microbial biomass itself may be considered a and maximum product concentrations to avoid product product. inhibition . In particular, the rate of introduction of the A “ native product” is a product produced by a genetically 5 substrate may be controlled to ensure that the concentration unmodified microorganism . For example , ethanol, acetate , of gas in the liquid phase does not become limiting , since and 2 , 3 -butanediol are native products of Clostridium products may be consumed by the culture under gas - limited autoethanogenum , Clostridium ljungdahlii , and Clostridium conditions. ragsdalei. A “ non -native product ” is a product that is pro Operating a bioreactor at elevated pressures allows for an duced by a genetically modified microorganism , but is not 10 increased rate of gas mass transfer from the gas phase to the produced by a genetically unmodified microorganism from liquid phase . Accordingly , it is generally preferable to per which the genetically modified microorganism is derived . form the culture / fermentation at pressures higher than atmo The terms “ intermediate ” and “ precursor, ” which may be spheric pressure . Also , since a given gas conversion rate is , referred to interchangeably herein , refer to a molecular in part, a function of the substrate retention time and entity in an enzymatic pathway upstream of an observed or 15 retention time dictates the required volume of a bioreactor, target product . the use of pressurized systems can greatly reduce the volume " Selectivity ” refers to the ratio of the production of a of the bioreactor required and , consequently , the capital cost target product to the production of all fermentation products of the culture / fermentation equipment. This , in turn , means produced by a microorganism . The microorganism of the that the retention time, defined as the liquid volume in the invention may be engineered to produce products at a certain 20 bioreactor divided by the input gas flow rate, can be reduced selectivity or at a minimum selectivity . In one embodiment, when bioreactors are maintained at elevated pressure rather a target product account for at least about 5 % , 10 % , 15 % , than atmospheric pressure . The optimum reaction conditions 20 % , 30 % , 50 % , or 75 % of all fermentation products will depend partly on the particular microorganism used . produced by the microorganism of the invention . In one However , in general , it is preferable to operate the fermen embodiment, the target product accounts for at least 10 % of 25 tation at a pressure higher than atmospheric pressure . Also , all fermentation products produced by the microorganism of since a given gas conversion rate is in part a function of the invention , such that the microorganism of the invention substrate retention time and achieving a desired retention has a selectivity for the target product of at least 10 % . In time in turn dictates the required volume of a bioreactor, the another embodiment, the target product accounts for at least use of pressurized systems can greatly reduce the volume of 30 % of all fermentation products produced by the microor - 30 the bioreactor required , and consequently the capital cost of ganism of the invention , such that the microorganism of the the fermentation equipment. invention has a selectivity for the target product of at least Target products may be separated or purified from a 30 % . fermentation broth using any method or combination of " Increasing the efficiency, ” “ increased efficiency, ” and the methods known in the art , including, for example , fractional like include , but are not limited to , increasing growth rate , 35 distillation , evaporation , pervaporation , gas stripping , phase product production rate or volume, product volume per separation , and extractive fermentation , including for volume of substrate consumed , or product selectivity . Effi example , liquid - liquid extraction . In certain embodiments , ciency may be measured relative to the performance of target products are recovered from the fermentation broth by parental microorganism from which the microorganism of continuously removing a portion of the broth from the the invention is derived . 40 bioreactor , separating microbial cells from the broth ( con Typically , the culture is performed in a bioreactor. The veniently by filtration ) , and recovering one or more target term “ bioreactor” includes a culture / fermentation device products from the broth . Alcohols and / or acetone may be consisting of one or more vessels , towers , or piping arrange recovered , for example , by distillation . Acids may be recov ments , such as a continuous stirred tank reactor ( CSTR ) , ered , for example, by adsorption on activated charcoal. immobilized cell reactor ( ICR ) , trickle bed reactor ( TBR ) , 45 Separated microbial cells are preferably returned to the bubble column , gas lift fermenter , static mixer , or other bioreactor . The cell - free permeate remaining after target vessel or other device suitable for gas - liquid contact. In products have been removed is also preferably returned to some embodiments , the bioreactor may comprise a first the bioreactor. Additional nutrients ( such as B vitamins ) may growth reactor and a second culture / fermentation reactor. be added to the cell - free permeate to replenish the medium The substrate may be provided to one or both of these 50 before it is returned to the bioreactor . reactors . As used herein , the terms “ culture ” and “ fermen tation ” are used interchangeably . These terms encompass EXAMPLES both the growth phase and product biosynthesis phase of the culture / fermentation process. The following examples further illustrate the invention The culture is generally maintained in an aqueous culture 55 but, of course , should not be construed to limit its scope in medium that contains nutrients , vitamins, and / or minerals any way . sufficient to permit growth of the microorganism . Preferably the aqueous culture medium is an anaerobic microbial Example 1 growth medium , such as a minimal anaerobic microbial growth medium . Suitable media are well known in the art. 60 This example demonstrates the ability of Ptb - Buk to The culture / fermentation should desirably be carried out convert acetoacetyl- CoA to acetoacetate in E . coli in vivo under appropriate conditions for production of the target and its use in production of acetone, isopropanol, 3 -hy product . Typically, the culture / fermentation is performed droxybutyrate , and isobutylene under anaerobic conditions. Reaction conditions to consider Pathways that rely on the Ptb - Buk system for acetoacetate include pressure (or partial pressure ), temperature, gas flow 65 production from acetoacetyl- CoA were designed and con rate , liquid flow rate , media pH , media redox potential, structed . This was done in a modular fashion using a PDUET agitation rate ( if using a continuous stirred tank reactor ) , vector system (Novagen ) . One module contained ptb -buk US 10 , 316 , 337 B2 57 58 genes from C . beijerinckii NCIMB8052 (GenBank Growth was carried out for another 64 h of induction . The NC _ 009617 , position 232027 . . . 234147 ; Cbei _ 0203 -204 ; experiment was repeated in triplicate . NCBI- GenelD 5291437 -38 ) on plasmid PACYC . Another Acetone concentrations, as well as the concentrations of module contained the thiolase gene thlA of C . acetobutyli - other metabolites such as isobutylene , were measured using cum (Genbank NC _ 001988 , position 82040 . . . 83218 ; 5 gas chromatography (GC ) analysis , employing an Agilent CA _ P0078 ; NCBI- GenelD 1116083 ) and the acetoacetate 6890N headspace GC equipped with a Supelco polyethylene decarboxylase gene adc of C . beijerinckii NCIMB8052 glycol (PEG ) 60 - um solid - phase microextraction fiber, a (Genbank NC _ 009617 , position 4401916 . . . 4402656 ; Restek Rtx - 1 ( 30 mx0 . 32 umx5 um ) column, and a flame Cbei _ 3835 ; NCBI- GeneID 5294996 ) on plasmid pCOLA . ionization detector ( FID ) . Samples ( 4 ml) were transferred Ptb and buk genes were amplified from genomic DNA of C . 10 into a 20 -ml headspace vial , upon which the fiber was beijerinckii NCIMB8052 and thlA and adc genes from an incubated ( exposed ) for 10 min at 50° C . The sample was existing acetone plasmid PMTL85147 - thlA -ctfAB -adc (WO desorbed in the injector at 250° C . for 9 min . Chromatog 2012 /115527 ) and cloned under control of the T7 promoter raphy was performed with an oven program of 40° C . ( 5 - min present in the pDUET vectors via restriction independent hold ) and 10° C ./ min to 200° C . , followed by a 5 -min hold cloning with the circular polymerase extension cloning 15 at 220° C . The column flow rate was 1 ml/min , with (CPEC ) method ( Quan , PloS One , 4 : e6441 , 2009) . hydrogen as the carrier gas. The FID was kept at 250° C . , Oligonucleotides Used for Amplification of Ptb and Buk with hydrogen at 40 ml/min , air at 450 ml/min , and nitrogen Genes : at 15 ml/min as the makeup gas.

SEQ ID NO : Name Sequence Direction 95 PACYCDuet - ptb -buk AAGTTTTTACTCATATGTATATC reverse PACYC - ptb -R1 ?cc??c??????????? PACYCDuet - ptb - buk - ptb - AGAAGGAGATATACATATGAGT forward PACYC - F1 AAAAACTTTGATGAGTTA

97 PACYCDuet - ptb - buk ACCAGACTCGAGGGTACCTAGT reverse buk - PACYC - R1 AAACCTTAGCTTGTTC 98 PACYCDuet - ptb - buk TAAGGTTTACTAGGTACCCTCG forward PACYC - buk - F1 AGTCTGGTAAAGAAAC

Oligonucleotides Used for Amplification of th1A and Adc It was immediately obvious that acetone was produced in Genes : the strain carrying both the PACYC - ptb - buk and PCOLA

SEQ ID NO : Name Sequence Direction 99 pCOLADuet - thlA - adc - ACATATGTATATCTCCTTCTTAC reverse thlA - adc - R1 TAGCACTTTTCTAGCAATATTG 100 pCOLADuet - thlA - adc - AGTAAGAAGGAGATATACATAT forward adc - ThlA - F1 GTTAGAAAGTGAAGTATCTAAAC 101 PCOLADuet - thlA - adc - CAGACTCGAGGGTACCTTATTT reverse adc - PCOLA -R1 TACTGAAAGATAATCATGTAC 102 PCOLADuet - thlA - adc - TCTTTCAGTAAAATAAGGTACC forward pCOLA - adc - F1 CTCGAGTCTGGTAAAGAAAC 103 PCOLADuet - thlA - adc - GAAGGAGATATACATATGAAA forward thla - pCOLA - F1 GAAGTTGTAATAGCTAGTG 104 PCOLADuet - thlA - adc - ACAACTTCTTTCATATGTATATC reverse PCOLA - thlA - R1 ?cc??????????????

After the plasmids PACYC -ptb -buk (SEQ ID NO : 105 ) . thlA - adc plamids ( expressing thiolase , Ptb - Buk , and and pCOLA -th1A - adc (SEQ ID NO : 106 ) were constructed , acetoacetate decarboxylase ). Average final acetone produc they were transformed individually and together into E . coli BL21 (DE3 ) ( Novagen ) and growth experiments carried out tion of 0 . 19 g / L was measured , whereas no acetone was in quadruplicates in 1 . 5 mL cultures in 12 -well plates at 28° produced in a no plasmid control ,media control, and single C . with 160 rpm orbital shaking using M9 minimal medium plasmid controls PACYC - ptb -buk ( expressing Ptb -Buk ) or (Sambrook , Molecular Cloning : A Laboratory Manual , Vol PCOLA - th1A - adc plamid ( expressing thiolase and acetoac 3 , Cold Spring Harbour Press , 1989 ) with glucose (FIG . 4 ) . etate decarboxylase ) (below reliable detection limit ). The The cultures were inoculated at an OD600 nm of 0 . 1 and induced with different concentrations of IPTG ( 0 , 50 , 100 uninduced culture of the strain carrying both the PACYC UM ) after 2 h of growth (FIG . 5 ). The plates were sealed 65 ptbP -buk and PCOLA -th1A -adc plamids (expressing thiolase , using plate tape strips and each well was pierced with a Ptb -Buk , and acetoacetate decarboxylase ) did not produce green tipped needle to provide micro -aerobic conditions . appreciable amounts of acetone . US 10 , 316 , 337 B2 Average Acetone Production in E . coli BL21 (DE3 ) : (Heap , J Microbiol Methods, 78 : 79 - 85 , 2009. The genes of interest ( i. e ., hbd , phaB , th1A , ptb , buk , and aorl ) were cloned into the lacZ region of the plasmids using common Strain Acetone ( g / L ) techniques in molecular biology including dna restriction Thl + Ptb - Buk + Adc [ E . coli BL21 0 . 19 + 0 . 04 digestion followed by ligation , and the golden gate dna ( DE3 ) + PACYC - ptb - buk + pCOLA - thla assembly technology when more than one pieces of dna adc ] fragments were to be cloned simultaneously into the plas Thl + Adc alone [ E . coli BL21 ( DE3 ) + 0 . 04 ++ 0 . 01 mid . The constructed plasmids are verified by DNA sequenc pCOLA - thlA - adc ] ing . 10 Production of acetone and isopropanol was previously Ptb - Buk alone [ E . coli BL21 ( DE3) + 0 . 03 +– 0 . 01 demonstrated in C . autoethanogenum using a plasmid PACYC - ptb - buk ] pMTL85147 - thlA - ctfAB - adc encoding thl+ ctfAB + adc (WO No plasmid control [ E . coli BL21 0 . 04 + 0 . 01 2012 / 115527 ) under the control of a clostridial promoter ( DE3 ) ] from the Wood - Ljungdahl gene cluster. In this plasmid the 0 . 03 + 0 . 01 ctfAB genes encoding the COA transferase were replaced Media control directly with ptb - buk genes encoding the Ptb - Buk system . This was done as described in Example 1 using the CPEC This experiment clearly demonstrates that Ptb - Buk is able method . The resulting plasmid is pMTL85147 - th1A -ptb to perform the conversion of acetoacetyl -CoA to acetoac buk - adc. etate can be used in place of a COA - transferase or a 20 Oligonucleotides used for the amplification of oth - buk thioesterase for the production of acetone , exemplified using and cloning into pMTL8317 - thl- ptb -buk - adc are described a route that comprises steps 1 , 2 , and 3 of FIG . 1 . below . It is well known that isopropanol can be produced from acetone by addition of a primary :secondary alcohol dehy drogenase (Köpke , Appl Environ Microbiol, 80 : 3394 -3403 , 25 SEO 2014 ) (step 4 in FIG . 1) and that isobutylene can be ID produced from acetone via addition of a hydroxyisovalerate NO : Name Sequence Direction synthase ( step 5 in FIG . 1 ) and decarboxylase (step 6 in FIG . 107 thlA - ptb -R1 ATTTCCTCCCTTTCTAGCACTTT reverse 1 ) (van Leeuwen , Appl Microbiol Biotechnol, 93 : 1377 - 30 TCTAGCAATATTG 1387 , 2012 ). A pathway can be constructed that includes the 108 adc - buk - F1 TAAGGTTTACTAAGGAGGTTGT forward above - demonstrated acetone route via Ptb -Buk with the TTTATGTTAGAAAG genes th1A , ptb -buk , and adc and a primary :secondary 109 thiA - ptb - F1 GCTAGAAAAGTGCTAGAAAGG forward alcohol dehydrogenase gene ( e . g . , Genbank accession num GAGGAAATGAACATG ber NC _ 022592 , pos. 609711 . . . 610766 ; CAETHG _ 0553 ; 35 NCBI- GenelD : 17333984 ) that would allow isopropanol 110 Buk - adc - R1 AAAACAACCTCCTTAGTAAACC reverse production via the Ptb - Buk system in E . coli comprising TTAGCTTGTTCTTC steps 1 , 2 , 3 , and 4 of FIG . 1 . Similarly , a pathway can be constructed that includes the above -demonstrated acetone C . autoethanogenum DSM10061 and DSM23693 ( a deri route via Ptb -Buk conversion of acetoacetyl -CoA to acetoac - 40 vate ofDSM10061 ) were sourced from DSMZ ( The German etate with the genes th1A , ptb -buk , and adc and genes for a Collection of Microorganisms and Cell Cultures , Inhoffen hydroxyisovalerate synthase and decarboxylase that would straße 7 B , 38124 Braunschweig , Germany ) . allow isobutylene production via the Ptb -Buk system in E . Strains were grown at 37° C . in PETC medium at pH 5 . 6 coli comprising of steps 1 , 2 , 3 , 5 , and 6 of FIG . 1 . using standard anaerobic techniques (Hungate , Meth Micro Acetoacetete can also be converted to 3 - hydroxybutyrate via 45 biol , 3B : 117 - 132 , 1969; Wolfe , Adv Microb Physiol. 6 : a 3 - hydroxybutyrate dehydrogenase Bdh . This can be com - 107 - 146 , 1971 ) . 30 psi CO - containing steel mill gas ( col bined with Ptb -Buk conversion of acetoacetyl- CoA to lected from New Zealand Steel site in Glenbrook , NZ ) or a acetoacetate for 3 - hydroxybutyrate production in a strain synthetic gas blend with same composition of 44 % CO , 32 % expressing genes th1A , ptb - buk , and bdh resulting in a N2, 22 % CO . , 2 % H , was used as substrate for autotrophic pathway comprising steps 1 , 2 , and 15 of FIG . 1. 50 growth . For solid media , 1 . 2 % bacto agar (BD , Franklin Lakes , N . J . 07417 , USA ) was added . Example 2 The construct was synthesized and then transformed into C . autoethanogenum via conjugation . For this , the expres This example demonstrates the ability of Ptb - Buk to s ion vector was first introduced into the conjugative donor convert acetoacetyl -CoA to acetoacetate in C . autoethano - 55 strain E . coli HB101 +R702 (CA434 ) (Williams , J Gen genum in vivo and the use of Ptb -Buk in the production of Microbiol , 1136 : 819 - 826 , 1990 ) (the donor ) using standard acetone , isopropanol, 3 -hydroxybutyrate , and isobutylene heat shock transformation . Donor cells were recovered in from a gaseous substrate . SOC medium ( Sambrook , Molecular Cloning : A Laboratory To demonstrate that the Ptb - Buk system also allows Manual, Vol 3 , Cold Spring Harbour Press, 1989 ) at 37° C . acetone, isopropanol, or isobutylene synthesis from gaseous 60 for 1 h before being plated on to LB medium (Sambrook , substrates, a plasmid was constructed that contains the same Molecular Cloning : A Laboratory Manual , Vol 3 , Cold genes as in Example 1 , thl + ptb -buk + ade under control of a Spring Harbour Press , 1989 ) plates containing 100 ug /ml clostridial promoter on a shuttle vector that allows expres spectinomycin and 25 ug/ ml chloramphenicol. LB plates sion in acetogens such as C . autoethanogenum , C . ljung were incubated at 37° C . overnight. The next day, 5 mlLB dahlii or C . ragsdalei. 65 aliquots containing 100 ug /ml spectinomycin and 25 ug /ml The PMTL plasmid is a shuttle plasmid system for intro - chloramphenicol were inoculated with several donor colo ducing circular dna into Clostridia via E . coli conjugation nies and incubated at 37° C . , shaking for approximately 4 h , US 10 , 316 , 337 B2 62 or until the culture was visibly dense but had not yet entered column ( 300 mmx7 . 8 mmx9 um ) at 0 . 6 mL /min and 35° C . stationary phase . 1 . 5 ml of the donor culture was harvested under isocratic conditions , using 5 mM sulphuric acid in a microcentrifuge tube at room temperature by centrifu - mobile phase . gation at 4000 rpm for 2 min , and the supernatant was C . autoethanogenum bearing the pMTL85147 - th1A - ptb discarded . The donor cells were gently resuspended in 500 5 buk -adc produced isopropanol up to 0 .804 g IPA / g of ul sterile PBS buffer ( Sambrook , Molecular Cloning : A biomass , whereas control strain C . autoethanogenum with Laboratory Manual . Vol 3 . Cold Spring Harbour Press. pMTL85147 - th1A - adc that does not contain Ptb -Buk pro 1989 ) and centrifuged at 4000 rpm for 2 min and the PBS duced no IPA (FIG . 12 ). supernatantwas discarded . The pellet was introduced into an This experiment clearly demonstrates that Ptb -Buk is able d in 200 ul during 10 to perform the conversion of acetoacetyl- CoA to acetoac anaerobic chamber and gently resuspended in 200 ul during etate in the isopropanol pathway when using a gaseous late exponential phase C . autoethanogenum culture ( the substrate . Ptb - Buk can be used in place of a COA transferase recipient ). The conjugation mixture (the mix of donor and or a thioesterase in a gas - fermenting acetogen such as C . recipient cells ) was spotted onto PETC -MES + fructose agar autoethanogenum , exemplified using a route that comprises plates and left to dry. When the spots were no longer visiblyY 15 steps 1, 2, 3 , and 4 of FIG . 1 . wet, the plates were introduced into a pressure jar, pressur C . autoethanogenum contains a native primary : secondary ized with syngas to 25 - 30 psiand incubated at 37° C . for ~ 24 alcohol dehydrogenase that converts acetone to isopropanol h . After 24 h incubation , the conjugation mixture was (Köpke , Appl Environ Microbiol, 80 : 3394 -3403 , 2014 ). It removed from the plates by gently scraping it off using a 10 has been demonstrated that knock - out of this gene elimi ul inoculation loop . The removed mixture was suspended in 20 nates conversion of acetone to isopropanol in C . autoetha 200 - 300 ul PETC medium . 100 ul aliquots of the conjuga - nogenum (WO 2015 /085015 ). In background of this knock tion mixture were plated on to PETC medium agar plates out, it becomes possible to produce acetone (rather than supplemented 15 ug /ml thiamphenicol to select for trans isopropanol ) via the Ptb -Buk system from a gaseous feed formants bearing the plasmid , which confers resistance to stock , using the same genes comprising steps 1 , 2 , and 3 of thiamphenicol via expression of chloramphenicol acetyl- 25 FIG . 1 . Addition ofhydroxyisovalerate synthase and decar transferase . boxylase genes ( van Leeuwen , Appl Microbiol Biotechnol, Three distinct colonies of C . autoethanogenum bearing 93 : 1377 - 1387 , 2012 ) to this strain would enable isobutylene the pMTL85147 - th1A - ptb -buk -adc plasmid were inoculated production from gas in C . autoethanogenum or similar into 2 mL of PETC -MES medium with 15 ug /ml thiam bacteria comprising of steps 1 , 2 , 3 , 5 , and 6 of FIG . 1 . phenicol and grown autotrophically at 37° C . with 100 rpm 30 Acetoacetate can also be converted to 3 - hydroxybutyrate via a 3 -hydroxybutyrate dehydrogenase Bdh . A 3 -hydroxy orbital shaking for three days . Cultures were diluted to butyrate dehydrogenase was identified in the genome of C . OD 600 mm = 0 .05 in 10 mL PETC -MES medium with 15 ug /ml autoethanogenum ( AGY75962 ) and other acetogens as C . thiamphenicol in serum bottles and grown autotrophically at ljungdahlii (ADK16920 . 1) . This activity can be combined 37° C . with 100 rpm orbital shaking for five days , sampling§ 35z with Ptb - Buk (or COA transferase ) conversion of daily to measure biomass and metabolites. In parallel a acetoacetyl- CoA to acetoacetate for 3 - hydroxybutyrate pro control strain was examined where the expression plasmid duction in a strain expressing genes thlA , ptb -buk ( or ctfAB ) encoded only thl and adc under the control of the Wood and bdh resulting a pathway comprising steps 1 , 2 , and 15 Ljungdahl cluster promoter , with no ctfAB or ptb -buk genes ofFIG . 1 . Low levels of 3 -hydroxybutyrate formation (up to to catalyse the formation of acetoacetate from acetoacetyl- 40 2 g/ L ) via this route have been demonstrated in C . autoetha COA ( PMTL85147 -th1A -adc ). Cultures were sampled for nogenum . These levels could be enhanced by overexpress five days in order to monitor metabolites and biomass ing the Bdh gene that is only expressed in at low levels accumulation . natively . Isopropanol concentrations as well as concentrations of In one experiment , C . autoethanogenum was transformed ethanol, acetic acid , 2 , 3 -butanediol and lactic acid were 45 with plasmid pMTL82256 - thlA -ctfAB as described in measured by high -performance liquid chromatography Example 2 . The production was monitored for 10 days from ( HPLC ) on an Agilent LC with refractive index (RI ) detec six biological replicates under autotrophic conditions as tion at 35° C . Samples were prepared by diluting 400 uL described in Example 2 . The average of 3 -HB after 10 days with 100 uL of 5 - sulfosalicylic acid solution ( 1 % w / v in 1 was 1 . 86 + 0 . 14 g / L . At day 10 , 1 , 3 - butanediol was produced M sulphuric acid ) , followed by a 3 minute centrifugation at 50 ( from 3 -HB ) at an average titer of 0 .38 + 0 .05 g / L (FIG . 37 ) . 14 ,000 rpm ; the supernatant was transferred to a glass vial No acetone or isopropanol was formed . This demonstrates for analysis . Separation was carried out with a 10 uL that 3 -HB can be produced efficiently via acetoacetate injection on to an Alltech IOA - 2000 column (150 mmx6 . 5 through native enzymes . mmx8 um ) at 0 . 7 mL /min and 65° C . under isocratic In certain embodiments , it may be desirable to knock out conditions , using 5 mM sulphuric acid mobile phase . 55 or knock down expression of 3 -hydroxybutyrate dehydro In some instances, a longer HPLC method was used to genases, such as Bdh , to prevent carbon drain to 3 -HB and improve peak separation . In this method , isopropanol, etha - therefore boost production of products such as acetone , nol, acetate , 2 , 3 - butanediol, and also 3 - hydroxybutyrate isopropanol, and isobutylene . ( which is not separated using the shorter method ) concen trations were measured by high -performance liquid chroma - 60 Example 3 tography ( HPLC ) on an Agilent 1260 Infinity LC with refractive index (RI ) detection at 35° C . Samples were This example demonstrates the ability of Ptb -Buk to prepared by diluting 400 uL with 100 uL of 5 - sulfosalicylic convert (R )- 3 - hydroxybutyryl- CoA to ( R ) -3 - hydroxybu acid solution ( 1 % w / v in 1 M sulphuric acid ) , followed by tyryrate in E . coli in vivo for production of ( R ) - hydroxybu a 3 minute centrifugation at 14 , 000 rpm ; the supernatant was 65 tyrate , acetone, isopropanol, or isobutylene . transferred to a glass vial for analysis . Separation was Pathways were designed and constructed that rely on the carried out with a 10 uL injection on to an Aminex HPX - 87H Ptb - Buk system for ( R ) - 3 -hydroxybutyrate production from US 10 , 316 , 337 B2 63 64 ( R ) - 3 -hydroxybutyryl - CoA . Additionally , a 3 - hydroxybu - to providemicro -aerobic conditions. Growth was carried out tyrate dehydrogenase (Bdh ) was utilized for conversion of for another 64 h of induction . The experiment was repeated ( R ) - 3 -HB to acetoacetate . It has been reported that Ralstonia 3 times. Metabolites were measured as described in previous pickettii have two 3 -hydroxybutyrate dehydrogenases Bdh1 examples . and Bdh2 that are able to convert 3 -hydroxybutyrate to 5 Cultures containing a combination of plasmids PACYC acetoacetate in vitro ( Takanashi, J Biosci Bioeng, 101 : ptb -buk , pCOLA - th1A - adc and pCDF -phaB produced 501- 507 , 2006 ). One pathway was designed making use of between 1. 65 - 2 .4 g/ L ( R )- 3 -hydroxybutyrate (depending on this enzyme for acetone production (steps 1 , 13 , 14 , 15 , 3 of level of inducer ) , with only very small amounts of byprod FIG . 1 ), while recycling the reducing equivalents produced ucts (FIGS . 13A - F ) , demonstrating the efficiency of the in the production of (R )- 3 -hydroxybutyryl - CoA and the ATP 10 Ptb -Buk system to convert (R )- 3 - hydroxybutyryl- CoA to generated by Ptb -Buk (FIG . 6 ) . ( R ) - 3 - hydroxybutyryrate and support growth ( FIG . 13A - F ) . The pathways were constructed in a modular fashion In cultures that also expressed bdh1 ( containing a combi using the pDUET vector system (Novagen ) . The two mod nation of plasmids PACYC -ptb -buk , pCOLA - th1A - adc , and ules described in example above (PACYC -ptb -buk for PCDF -phaB -bdhl ) only small amounts of ( R ) - 3 -hydroxy expression of Ptb -Buk and pCOLA - th1A -adc for expression 15 butyryrate were found in the culture media , while between of thiolase and acetoacetate decarboxylase ) were used 0 .89 - 1 .16 g / L acetone was found (depending on level of together with two additional modules containing either inducer) , indicating that bdhl gene is efficient in converting ( R ) - specific 3 -hydroxybutyrate dehydrogenase phaB of ( R ) - 3 -hydroxybutyrate to acetoacetate and further to Cupravidus necator (WP _ 010810131. 1 ) alone (PCDF - acetone . In all plasmid combinations that lack Ptb - Buk , no phaB ) and one with 3 -hydroxybutyrate dehydrogenase bdh1 20 3 - hydroxybutyrate or acetone was found (FIG . 13A - F ). In gene of Rasltonia pickettii (BAE72684 . 1 ) (PCDF - phaB - these cultures , acetate levels were significantly higher . bdhl) in vector pCDF. Both phaB and bdhl gene were This experiment clearly demonstrates that Ptb - Buk is able synthesized from GeneArt and cloned under control of the to perform the conversion of (R )- 3 -hydroxybutyrate - CoA to T7 promoter present in via restriction independent cloning 3 - hydroxybutyrate and also that Bdh1 is able in vivo to with the circular polymerase extension cloning (CPEC ) 25 convert 3 - hydroxybutyrate further to acetoacetate by recy method ( Quan , PloS One, 4 : e6441 , 2009 ) . cling the reducing equivalents produced in the production of Oligonucleotides Used for Amplification of Bdh1 Gene: (R ) -3 -hydroxybutyryl - CoA . The experiment also highlights

SEQ ID NO : Name Sequence Direction 111 pDuet - insert2 - R1 CATATGTATATCTCCTTCTTATA forward CTTAAC 112 insert2 - pDuet - F1 GTTAAGTATAAGAAGGAGATAT forward ACATATG 113 pDuet - insert2 - F1 CCTCGAGTCTGGTAAAGAAAC forward 114 insert 2 - pDuet - R1 GTTTCTTTACCAGACTCGAGG forward

Oligonucleotides Used for Amplification of phaB Gene:

SEQ ID NO : Name Sequence Direction 115 PCDF -phaB - PACYC - CTATTCTTTGTGTCATGGTATAT forward 115 pCDEphaB -- PhaBR1 -PACYCH CTCCTTATTAAAG 116 PCDF - phaB - phaB - ATAAGGAGATATACCATGACAC forward PACYC - F1 AAAGAATAGCATAC 117 PCDF -phaB - PACYC - TGGTTTACACATGGGATAAGAT forward phaB - F1 CCGAATTCGAGCTC 118 PCDF - phaB - phaB - AGCTCGAATTCGGATCTTATCC forward PACYC - R1 CATGTGTAAACCAC

55 After the plasmids PACYC -ptb - buk ( SEQ ID NO : 105 ), that Ptb -Buk is able to support growth and therefore acetate PCOLA - th1A - adc (SEQ ID NO : 106 ) , PCDF - phaB (SEQ ID production becomes unnecessary . Production of ( R ) - 3 -hy NO : 119 ) and pCDF- phaB -bdh1 (SEQ ID NO : 120 ) were droxybutyrate formation was exemplified in a strain that constructed , they were transformed individually and in com - comprises steps 1 , 13 , and 14 of FIG . 1 . Production of binations into E . coli BL21 (DE3 ) (Novagen ) and growth 60 acetone was exemplified via a route that comprises steps 1 , experiments were carried out in quadruplicate in 1 . 5 mL 13 , 14 , 15 , and 3 of FIG . 1 . cultures in 12 -well plates at 28° C . with 160 rom orbital It is well known that isopropanol can be produced from acetone by addition of a primary : secondary alcohol dehy shaking using M9 minimal medium with glucose . The drogenase ( step 4 in FIG . 1 ) (Köpke , Appl Environ Micro cultures were inoculated at an OD600 nm of 0V . 1 and alterafter 2 biol, 80 : 3394 -3403 , 2014 ) and that isobutylene can be h of growth induced with different concentrations of IPTG 65 produced from acetone via addition of a hydroxyisovalerate ( 0 , 50 , 100 uM ) . The plates were sealed using BioRad plate synthase (step 5 in FIG . 1 ) and decarboxylase (step 6 in FIG . tape strips and each well pierced with a green tipped needle 1 ) ( van Leeuwen , Appl Microbiol Biotechnol, 93: 1377 US 10 ,316 , 337 B2 65 66 1387 , 2012 ). A pathway can be constructed that includes the flanked with loxP sites was PCR amplified using primers above - demonstrated acetone route via Ptb - Buk with the SN05mod /SN06 . tet3no promoter flanked by Fsel and Pmel genes th1A , ptb - buk , and adc and a primary: secondary was synthesized and treated with restriction enzymes Fsel alcohol dehydrogenase gene ( e . g . , Genbank NC _ 022592 , and Pmel and cleaned . The PCR products and digested pos. 609711 . . . 610766 ; CAETHG _ 0553 ; NCBI- GeneID : 5 vector were assembled using GeneArt Seamless cloning kit 17333984 ) that would allow isopropanol production via the from Life Technologies and plasmid pMTL8225 -budA : : Ptb - Buk system in E . coli ( steps 1 , 13, 14 , 15 , 3 , and 4 of thlA -phaB (SEQ ID NO : 121) with no mutations in the FIG . 1 ) . Similarly , a pathway can be constructed that inserted fragments was used to transform C . autoethanoge includes the above - demonstrated acetone route via Ptb -Buk n um by conjugation as described in previous examples . with the genes th1A , ptb - buk , and adc and genes for a Following conjugation and selection on trimethoprim and hydroxyisovalerate synthase and decarboxylase that would clarithromycin , 9 colonies were streaked twice on PETC allow isobutylene production via the Ptb - Buk system in E . MES agar plates with clarithromycin and anhydrotetracy coli ( steps 1 , 13, 14 , 15 , 3 , 5 , and 6 of FIG . 1 ) . cline to induce the expression of mazF genes. The colonies Example 4 15 from clarithromycin and anhydrotetracycline should have the budA genes replaced with th1A and phaB genes and This example demonstrates the production of (R )- 3 -hy - ermb cassette . This was verified by PCR using primers droxybutyrate and 1 , 3 -butanediol in C . autoethanogenum . It Og31f/ Og32r flanking the homology arms and KAPA poly also demonstrates production of 1 , 3 - butanediol in absence mer of 2 , 3 - butanediol. 20 While a band of ~ 3 . 3 kb is amplified from the wild type A strain of C . autoethanogenum was constructed in which strain , bands of - 5 . 7 kb were amplified from colonies 1 , 4 , the native pathway for 2 , 3 -butanediol production was inac - 7 and 9 indicating the replacement of budA gene with thlA , tivated and replaced with genes for ( R ) - 3 -hydroxybutyryl - phaB and erm? cassette . The above event was further COA formation . This was achieved by replacing the aceto confirmed by sequencing the PCR products of all 4 clones. lactate decarboxylase gene (budA ) on genome of C . 25 With the resulting modification the expression of th1A and autoethanogenum with genes for thiolase ( thlA of C . aceto phaB genes is driven by the promoter upstream of budA butylicum ; GenBank NC _ 001988 , position 82040 . . . 83218 ;

SEO ID NO : Description Sequence 122 SN01 ATTTACAAATTCGGCCGGCCTACCTCCTCGTATAAATAAGATG 123 SNO2 CTAGCTATTACAACTTCTTTCATATTACATTCACCTCTATGTC 124 SNO3 GACATAGAGGTGAATGTAATATGAAAGAAGTTGTAATAGCTAG 125 SN04mod GTATAGCATACATTATACGAACGGTATTATCCCATGTGTAAACC ACCGT 126 SN05mod TTCGTATAATGTATGCTATACGAAGTTATCCTTAGAAGCAAACT TAAG 127 SN06 GTCTAGTGTTTTTTTCTATCAATACTCTAGATACCGTTCGTATAGC 128 SN07 TGTATGCTATACGAACGGTAAGTATTGATAGAAAAAAACACTA GAC 129 SN08 CAAAAAGGAGTTTAAACAAAAAGTCATAAACCTGGATAAC 130 Og31f CCGTTTCTCACAACAACAATACCAG 131 Og32r AAACCACCTTGACGATGAAACCATA

CA _ P0078 ; NCBI- GeneID 1116083) and ( R ) -specific 3 -hy A fermentation with C . autoethanogenum budA : : th1A droxybutyrate dehydrogenase ( phaB of Cupravidus necator ; phaB strain was carried out. The culture was grown at 37° GenBank WP _ 010810131 . 1 ) resulting in strain C . autoetha - C . under synthetic gas (50 % CO , 18 % CO2, 2 % H2, and 30 % nogenum budA :: thlAphaB . 55 N , ) that was continuously fed into the bioreactor. The gas To replace budA gene with th1A and phaB genes a flow was initially set at 50 ml/min , increasing to 400 ml/ min plasmid , pMTL8225 - budA : : th1A -phaB (FIG . 14 ), with E . over the course of the experiment, while the agitation was coli toxin gene mazF under tet3n0 tetracycline inducible increased from 200 rpm to 500 rpm . The fermentation was promoter ( for counter selection ), ~ 1 kb upstream homology carried out for close to 5 days . Metabolites were measured arm of budA gene , th1A , phaB , erm? cassette flanked by 60 as described in examples above . loxP sites and ~ 1 kb downstream homology arm of budA The concentration of 1 , 3 -butanediol and other metabo gene were assembled on plasmid PMTL -tet3no . lites, such as 2 -hydroxyisobutyric acid , were measured using The ~ 1 kb upstream and downstream homology arms of gas chromatography (GC ) analysis , employing an Agilent budA were PCR amplified from C . autoethanogenum with 6890N GC equipped a Agilent CP -SIL 5CB -MS (50 mx0 .25 primers SN01/ SNO2 and SN07/ SN08 . th1A and phaB genes 65 umx0 . 25 um ) column, autosampler and a flame ionization were PCR amplified from genomic DNA of Cupriavidus detector ( FID ) . Samples were prepared by diluting 400 uL of necator using primers SNO3/ SN04mod . The erm? cassette sample with 400 uL of acetonitrile , followed by a 3 minute US 10 ,316 , 337 B2 68 centrifugation at 14 , 000 rpm ; the supernatant was trans conducted in serum bottles with 50 -mL PETC media and ferred to a glass vial and the sample was dried in a Thermo pressurized at 30 psi with CO - containing steel mill gas SpeedVac . Once dry, the samples were then suspended in a ( collected from New Zealand Steel site in Glenbrook , NZ ) solution of 400 uL of N , O -Bistrifluoroacetamide (BSTFA ) or a synthetic gas blend with same composition of 44 % CO , and pyridine ( 3 : 1 ratio ) and heated in a sealed glass vial for 5 32 % N . , 22 % CO . , 2 % H . . 60 minutes at 60° C . Samples were transferred to an autosampler for analysis using a 1 uL injection , a split ration 1 ,3 - BDO production was demonstrated via this route of 30 to 1 , and an inlet temperature of 250° C . Chromatog from gas ( FIG . 17A ), but production was less (up to 67 mg /L raphy was performed with an oven program of 70° C . ( no 1 , 3 -BDO ) than via the AOR route and , in contrast to the hold ) to a ramp of 3° C ./ min to 110° C . to a ramp of 15° 10 AOR route , growth was impacted when expressing the bld C . /min to 230° C ., followed by a final ramp of 40° C . /min gene comparing to the C . autoethanogenum wild - type ( FIG . to 310° C . with a 3 -min hold . The column flow rate was 1 . 8 17B ). ml/min , with helium as the carrier gas. The FID was kept at In another experiment, C . autoethanogenum transformed 320° C ., with hydrogen at 40 ml/min , air at 400 ml/min , and with plasmid pMTL83159 - phaB - th1A as described in helium at 20 ml/ min as the makeup gas . 15 Example 2 produced 0. 33 and 0 .46 g / L of 3- HB and 1, 3 Surprisingly , up to 1 . 55 g / L 3 -hydroxybutyrate was pro BDO , respectively , in a bottle experiment under autotrophic duced from gas in a C . autoethanogenum budA :: th1A - phaB strain expressing th1A and phaB (FIG . 16 ) . A native thio conditions as described in Example 2 (FIG . 40 ). esterase may convert the formed 3 -hydroxybutyryl - CoA to 3 -hydroxybutyrate . In the genome sequence , three putative 20 Example 5 thioesterases were identified . Even more surprising , it was also found that , along This example demonstrates the production of (S )- 3 -hy 3 -hydroxybutyrate formation , there was also 1, 3 -butanediol formation of up to 150 mg/ L (FIG . 16 ) . This may be due to droxybutyrate and 1 , 3 -butanediol in C . autoethanogenum . native aldehyde: ferredoxin oxidoreductase ( AOR ) and alco - 25 A plasmid was constructed that expresses a thiolase ( thlA hol dehydrogenase activity . Two AOR genes and several from C . acetobutylicum ; SEQ ID NO : 136 ) and an (S ) alcohol dehydrogenases are present in the genome of C . specific 3 -hydroxybutyrate dehydrogenase (hbd1 from C . autoethanogenum (Mock , J Bacteriol, 197 : 2965 - 2980 , kluyveri; SEQ ID NO : 137 ) under either a ferredoxin pro 2015 ) . This reduction of 3 -hydroxybutyrate is powered by moter ( Ptd isolated from C . autoethanogenum ; SEQ ID NO : reduced ferredoxin and thus can be directly coupled to CO 30 138 ) or a pyruvate - ferredoxin oxidoreductase promoter oxidation , which provides reduced ferredoxin (CO + (Potor isolated from C . autoethanogenum ; SEQ ID NO : 139 ) . Fdox ?CO2 + Fdred ) ( FIG . 7 ). The plasmid was constructed as follows: P -hbd1 - rbs2 - th1A 1, 3 -BDO production was also demonstrated from gas via and pieced together and cloned into the pMTL83151 vector an alternative route using a butyraldehyde dehydrogenase (Heap , J Microbiol Meth , 78 : 79 -85 , 2009) by routine Bld from Clostridium saccharoperbutylacetonicum 35 methods in molecular cloning, including restrictive enzyme ( AAP42563 . 1 ) (SEQ ID NO : 80 ) . The bld gene was syn - digestion followed by ligation , overlap extension poly thesized and cloned together with the same thiolase ( thlA of merase chain reaction , seamless cloning ( Thermo Fisher C . acetobutylicum ) and ( R ) - specific 3 -hydroxybutyrate Scientific ) , and GeneArt Type IIs ( Thermo Fisher Scientific ) dehydrogenase ( phaB of Cupravidus necator ) into a plasmid . The operon P - hbd1 - rbs2 -thlA was cloned in between pMTL8315 - Pfdx - th1A -phaB - bld (SEQ ID NO : 132 ) . Bld 40 restriction sites Noth and Xhol found in the multiple cloning and phaB genes were amplified from the above plasmid via region of the plasmid . P is the constitutive promoter which primers in table below and cloned into existing plasmid contains an intact ribosome binding site ( rbs ) . rbs2 (SEQ ID PMTL85147 -th1A (WO 2012 /115527 ) . NO : 140 ) is the ribosome binding site for expressing th1A .

SEQ ID NO : Primer Sequence Direction 133 bid -phaB - F1 ACATGGGATAAGAAGGAGATATACATATGAT forward AAAAG 134 bld - pMTL - R1 CGTCGACTCTAGATTAACCTGCTAAAACACAT forward CTTC

135 PMTL - bld - F1 GTGTTTTAGCAGGTTAATCTAGAGTCGACGTC forward ACGC

The resulting construct was transformed into C . autoetha - The stepwise procedures were amplification of the P, hbd1, nogenum as described above and a growth experiment was and th1A from existing templates with primers listed below .

SEQ ID NO : Name Sequence Direction 141 Pfdx - F1 AAAGGTCTCCGGCCGCGCTCACTATCTGCG forward GAACC 142 Pfdx -R1 TTTGGTCTCGAATTCTGTAACACCTCCTTAA reverse TTTTTAG US 10 ,316 , 337 B2 69 - continued SEQ ID NO : Name Sequence Direction

143 Ppfor - F1 AAAGGTCTCCGGCCGCAAAATAGTTGATAA forward TAATGCAGAG 144 Ppfor - R1 TTTGGTCTCGAATTCCTCTCCTTTTCAAGCAT reverse ATA 145 hbd1 - F1 AAAGGTCTCGAATTCAAAGATCTATGTCTAT forward TAAATCAGTTGCAG

146 hbdi -R1 TTTGGTCTCCCTCCTTTCTATTTCTAATATGC reverse GAAAAATCCTTTACC 147 thlA - F1 AAAGGTCTCAGGAGGTGTTACATATGAAAG forward AAGTTGTAATAGCTAGTGC

148 thlA - R1 TTTGGTCTCCTCGAGTATGGATCCCTAGCAC reverse TTTTCTAGCAATATTGC 20 The polymerase chain reactions were performed as follow genome sequence , three putative thioesterases were identi using Kapa Taq PCR Kit (Kapa Biosystems ) . Set annealing fied . In the strain carrying pMTL8315 - Pfdx -hbd1 - thlA up to temperature at 56° C . , and extension for 1 minute . Repeat 2 .55 g / L 3 -hydroxybutyrate was found ( FIG . 18A ) . PCR reaction for 30 cycles. Afterwards , PCR products were of Even more surprising, it was also found that 3 -hydroxy desalted using the DNA Clean & Concentrator Kit ( Zymo butyrate is over time converted to 1, 3 -butanediol , at the end Research Corporation ) . of growth up to 1 . 1 g /L 1 ,3 -butanediol was produced in PMTL83151 plasmid backbone was prepared by carrying strain carrying plasmid PMTL8315 -Pfdx -hbd1 -th1A (FIG . out the Notl/ Xhol double digestion using the FastDigest 18A ) . This may be due to native aldehyde: ferredoxin oxi NotI and FastDigest Xhol ( Thermo Fisher Scientific ) fol- 30 doreductase ( AOR ) and alcohol dehydrogenase activity . lowing the protocol provided , followed by treatment with Two AOR genes and several alcohol dehydrogenases are alkaline phosphate , using the FastAP Alkaline Phosphatase present in the genome of C . autoethanogenum (Mock , J ( Thermo Fisher Scientific ) and the protocols provided . The Bacteriol, 197 : 2965- 2980 , 2015 ) . This reduction of 3 -hy digested backbone was then desalted with the DNA Clean & droxybutyrate (and reduction of acetate to ethanol; FIG . Concentrator Kit (Zymo Research Corporation ) . 35 18B ) is powered by reduced ferredoxin and thus can be The assembly of the PCR products and the plasmid directly coupled to CO oxidation , which provides reduced backbone was carried out using the Gene Art Type IIs Kit ferredoxin (CO + Fdox ?C0z+ Fdred ) (FIG . 7 ) . ( Thermo Fisher Scientific ). The resulting plasmid was then The same strain of C . autoethanogenum carrying plasmid isolated from the E . coli plasmid expression host using the PMTL8315 - Pfdx - hbd1- thlA was also tested in continuous QIAprep Spin Miniprep Kit ( Qiagen ) . 40 fermentation . Fermentation was carried out as described in To introduce the assembled plasmids pMTL8315 - Pfdx - previous example , but the culture was turned continuos with hbd1 - th1A and pMTL8315 - Ppfor- hbd1- thlA consisting of a dilution rate with fresh media of around 0 .05 at day 2 and the operons, the plasmid was first introduced into the E . coli then increased to 1. 0 at day 3 . High 3- hydroxybutyrate CA434 strain by chemical transformation . Afterwards, con production of up to 7 g / L was observed with 1 , 3 - BDO jugation was performed by mixing the transformed CA434 45 production of 0 . 5 g / L . strain with a C . autoethanogenum production host on a solid To improve production of ( S ) - 3 - hydroxybutyrate and 1 , 3 LB - agar media , and incubation in an anaerobic environment butanediol and avoid synthesis of another form of butanediol under pressure with a mix consisting of carbon monoxide ( 2 , 3 - butanediol) , plasmid PMTL - HBD - ThlA was introduced and hydrogen as described in Example 2 . C . autoethanoge - into a strain that has an inactivated 2 , 3 -butanediol pathway num , after conjugation , was selected by successive growth 50 where the acetolactate decarboxylase gene BudA has been on the solid media containing the proper antibiotic and deleted ( U . S . Pat. No . 9 , 297 , 026 ). This budA knockout trimethroprim to remove the remaining E . coli CA434 strain , eliminated the major pathway to 2 , 3 -BDO , increasing the under the anaerobic conditions . Spospecificity for 3 - HB and 1 , 3 -BDO production . When pMTL The C . autoethanogenum strains carrying the introduced HBD - ThlA was expressed in the budA deletion strain , a total pMTL8315 -Pfdx -hbdi - th1A or PMTL8315 -Ppfor -hbd1 - 55 of 15 % C -mol was achieved for both 3 -HB and 1 , 3 -BDO thlA plasmids consisting of the operon P -hbdl - rbs2 - th1A (FIG . 41 ) . were grown in a 10 -mL PETC media in a 250 -ml Schott bottle , sealed tight with rubber septum and cap , and pres surized at 30 psi with CO - containing steel mill gas (col Selectivity lected from New Zealand Steel site in Glenbrook , NZ ) or a 60 ( C -mol % ) synthetic gas blend with same composition of 44 % CO , 32 % Acetate 14 . 7 N2, 22 % CO2, 2 % Hz. Metabolites were measured as Ethanol 64 . 9 described in previous examples. 2 , 3 - BDO 1 . 3 Biomass 3 . 7 Surprisingly , there was 3 -hydroxybutyrate produced from 3 - HB 10 .4 gas in C . autoethanogenum cultures expressing thlA and 65 1 , 3 - BDO 5 . 0 hbd1 (FIG . 18A ). A native thioesterase may convert the formed 3 - hydroxybutyryl- CoA to 3 -hydroxybutyrate . In the US 10 ,316 , 337 B2 72 As a comparison , in a strain expressing the same plasmid , quartz cuvette ( 1 ml cuvette with a read length of 1 cm ) pMTL83159 -hbd - thlA without budA knockout, the total except the protein . The assay was started by adding the cell specificity for the production of 3 -HB and 1 , 3 -BDO at the lysate and following the reaction in a spectrophotometer at steady state was only 6 .9 % 405 nm , 30° C . for 3 min . A control without lysate was run to measure autolysis of the acyl- CoA . To determine activity , slope on the linear part of the curve Selectivity ( usually in the first 30 s ), was calculated . The protein amount ( C -mol % ) was normalized and slope was divided by protein amount . Acetate 0 . 4 Ethanol 84 . 3 An extinction coefficient ( 14 , 150 M - cm - ) was used to 2 , 3 - BDO 6 . 2 calculate the specific activity in M / s/ mg . The activity of the Biomass 2 . 2 negative control was subtracted . 3 - HB The assay was performed with acetoacetyl- CoA , a race 1 , 3 - BDO mic mix of 3 - hydroxybutyryl- CoA (3 -HB -COA ) and 2 -hy droxyisobutyryl- CoA ( 2 -HIB -COA ) . The possibility of arti 15 ficially low hydrolysis rates for 3 -HB - COA and 2 - HIB -COA Example 6 due to potential substrate limitation was addressed by repeating the hydrolysis assays for C . autoethanogenum This example demonstrates that the Ptb - Buk system is lysates using different concentrations of acyl -CoA , 500 UM efficient in C . autoethanogenum on a range of acyl -CoAs and 200 uM . including acetoacetyl -CoA , 3 -hydroxybutyryl - CoA , and “ The results of the assay show significantly increased COA 2 -hydroxyisobutyryl - CoA hydrolysis in lysates of C . autoethanogenum carrying plas The Ptb -Buk system was expressed from a plasmid in C . mid PMTL82256 -ptb - buk expressing the Ptb -Buk system on autoethanogenum and its activity measured using a COA a range of acyl- CoAs including acetoacetyl -CoA , 3 -hy hydrolysis assay . For this, ptb - buk genes from C . beijerinckii d roxybutyryl- CoA and 2 -hydroxyisobutyryl - CoA ( FIGS . NCIMB8052 (GenBank NC _ 009617 , position 232027 . . . 20A - B ) . Notably, there is also CoA hydrolysis for acyl 234147 ; Cbei_ 0203 - 204 ; NCBI-GeneID 5291437 - 38 ) were COAs as 2 -hydroxyisobutyryl -CoA that are not hydrolysed amplified from genomic DNA of C . beijerinckii by the C . autoethanogenum wild - type. With acetoacetyl NCIMB8052 and cloned under control of a pyruvate - ferre COA and 3 -hydroxybutyryl - CoA some native CoA hydroly doxin oxidoreductase promoter (Ppfor isolated from C . sis activity was observed . autoethanogenum ; SEQ ID NO : 139 ) into pMTL8225150 vector ( (Heap , J Microbiol Meth , 78 : 79 - 85, 2009) by Example 7 routine methods in molecular cloning, including restrictive enzyme digestion followed by ligation , overlap extension This example demonstrates the disruption of identified polymerase chain reaction , seamless cloning ( Thermo Fisher of native thioesterase genes improve efficiency of the Ptb -Buk Scientific ) , and Gene Art Type IIs ( Thermo Fisher Scientific ) and CoA transferase system by increasing the pool of as described in Example 5 . Oligonucleotides are described available acyl- CoAs such as acetoacetyl- CoA , 3 -hydroxy below . butyryl- CoA or 2 -hydroxyisobutyryl - CoA .

SEQ ID NO : Name Sequence Direction 149 Ppfor - F2 aaacagctatgaccgcGGCCGCAAAATAGT forward 150 Ppfor - R2 ttactcat TGGATTCCTCTCCTTT reverse 151 Ptb - Buk - F2 ggaatccaATGAGTAAAAACTTTGATGAG forward 152 Ptb - Buk -R2 caggcctcgagatctcCTAGTAAACCTTAGCTTGTTC reverse

The resulting plasmid pMTL82256 -ptb -buk (SEQ ID NO : 30 In contrast to the Ptb -Buk system , where energy is con 153 ) was introduced into C . autoethanogenum as described served in the form of ATP during conversion of acyl- CoAs in previous examples . to their respective acids, no energy is conserved if the CoAs Acyl- CoA hydrolysis assays were performed as follows. are simply hydrolyzed . C . autoethanogenum cells were harvested at OD 2 ( late 55 In hydrolase assays it was found that there is native exponential phase ) by centrifugation ( 14 ,000 rpm for 1 min hydrolysis activity for acetoacetyl- CoA and 3 -hydroxybu at 4° C . ) . Cells were re -suspended in 500 ul lysis buffer tyryl -CoA in C . autoethanogenum . (potassium phosphate buffer, pH 8 ). Cells were lysed using Acyl- CoA hydrolysis assays with acetoacetyl -CoA , a a freeze thaw cycle (optional ) , sonication 6x30 s at ampli - racemic mix of 3 - hydroxybutyryl - CoA ( 3 -HB - COA ) and tude 20 on ice . Samples were centrifuged for 10 min at 60 2 -hydroxyisobutyryl - COA ( 2 - HIB -COA were performed as 14 ,000 rpm at 4° C . and the supernatant with soluble described in previous example . The results of the assay show proteins was removed . The protein concentration was mea - cleavage of acetoacetyl - CoA and 3 -HB - COA , but not 2 -HIB sured , e . g . , with a Bradford assay . CoA , and confirm native activity is present in C . autoetha The assay mix contained : 484 ul of potassium phosphate nogenum ( FIG . 11 ) . buffer pH 8 . 0 , 1 ul of DTNB ( final concentration of 0 . 1 65 An analysis of the genome of C . autoethanogenum led to mM ) , 10 ul of cell lysate , and 5 ul of COA ( final concen - identification of three putative CoA - thioesterases ( thioester tration of 500 UM ) . All the components were mixed in a hydrolases) that could be responsible for to the cleavage of US 10 , 316 , 337 B2 73 74 acetoacetyl - CoA or 3 -hydroxybutyryl - CoA thioester bond . were found when expressing this plasmid in the C . autoetha These are also present in other acetogens such as C . ljung nogenum wild type strain ). No competing activity for 3 - hy dahlii. droxybutyryl - CoA is present in this strain .

SEQ SEQ ID ID Description Annotation C . autoethanogenum NO : C . ljungdahlii NO : thioesterase 1 Palmitoyl- CoA AGY74947. 1 154 ADK15695 .1 157 (CAETHG _ 0718 ) hydrolase thioesterase2 4 - Hydroxybenzoyl- AGY75747. 1 155 ADK16655 . 1 158 ( CAETHG _ 1524 ) COA thioesterase thioesterase 3 Putative AGY75999 . 1 156 ADK16959. 1 159 ( CAETHG _ 1780 ) Thioesterase

15 Inactivation of these three putative CoA - thioesterases These results demonstrate that by reducing thioesterase lead to higher product titers , improving efficiency of the activity , a higher CoA pool for the Ptb - Buk system and Ptb - Buk system . The three putative thioesterases were inac - product synthesis is available . tivated using Clos Tron technology . In brief , the targeting Additionally , the production of 3 - HB and 1 , 3 -BDO can be domain of the type II Ltr was reprogrammed using the 20 increased by overexpression of ptb - buk . In a control experi ClosTron website and the retargeted ClosTron plasmids ment, whereby C . autoethanogenum as described in were ordered from DNA 2. 0 . The Clos Tron knock out Example 2 was transformed with plasmids PMTL83159 vectors PMTL007C - E2 - Cau -2640 -571s targeting the thio - phaB -th1A from Example 4 plus pMTL82256 (Heap , J esterase 1 (CAETHG 0718 ) , pMTL007C - E2 - PBor3782 - Microbiol Methods, 78 : 79 - 85 , 2009 ) , in which the latter is 166s targeting the thioesterase 2 (CAETHG 1524 ), and 25 an empty plasmid used as a background control, the fer PMTL007C - E2 -PBor4039 - 199s targeting the thioesterase 3 mentation of such strain resulted in a production of 3 -HB with highest titer at 1 .68 g / L at day 10 ( FIG . 42A ) . When ( CAETHG _ 1780 ) were introduced into C . autoethanoge PMTL82256 -buk -ptb , instead of the empty plasmid num using conjugation . PMTL82256 , was coexpressed with pMTL83159 - phaB Selection for integration was done by selecting PETCí .30 th1A in C . autoethanogenum , the fermentation resulted in a supplemented with 5 ug /ml clarithromycin and successful higher titter of 3 -HB , at 4 . 76 g / L , at an earlier time, day 4 inactivation by integration of the type II intron was con (FIG . 42B ) . firmed by PCR across the insertion site . Deletion of native thioesterases enhances the efficiency of The CoA hydrolase activity on acetoacetyl- CoA of both the ptb -buk system , which has preference for ( R ) - 3 -HB wild type C . autoethanogenum and each of the C . autoetha - 35 COA . The locus of the thioesterase gene in the genome was nogenum with one of the putative genes inactivated was deleted and replaced with the buk -ptb dna fragment via the measured using the assay described above . It was shown that common molecular biology technique known as homolo all three strains with the inactivated putative thioesterases gous recombination . The substitution of the thioesterase showed less hydrolysis activity on acetoacetyl- CoA and gene by the buk -ptb was confirmed by PCR , followed by 3 -hydroxybutyryl - CoA (FIGS . 21A - B ) . 40 agarose gel electrophoresis and dna sequencing . To demonstrate that the decreased CoA hydrolase activity . In a bottle experiment, when PMTL83156 - phaB - thlA was and thus an increased pool in acetoacetyl -CoA , is beneficial expressed without ptb -buk in the thioesterase deletion for production of acetoacetyl - CoA derived products , the mutant, described above , the average maximum titer of isopropanol plasmid pMTL85147 -thlA - ctfAB -adc encoding 3 -HB produced was 0 . 50 - 0 .05 g /L , similar to the titer thl + ctfAB + ade (WO 2012 / 115527 ) was introduced into the 45 obtained using an unmodified C . autoethanogenum strain . C . autoethanogenum wild -type strain and the strain with When PMTL82256 -buk -ptb was coexpressed with the inactivated thioesterase 1 . A growth experiment was carried PMTL83156 - phaB -th1 A plasmid in a thioesterase knockout out 40 ml PETC medium in 1 L Schott bottles in technical strain , the production of 3 - HB increased to 1 . 29 + 0 . 10 g / L triplicates with Co gas at 37° C . at 110 rpm shaking . (FIG . 43 ) . Synthetic gas (50 % CO , 18 % CO2, 2 % H2, and 30 % N2) was 50 used as sole energy and carbon source . Headspace Example 8 exchanged once and gassed to 21 psi ( 1. 5 bar ) at 37° C . under synthetic gas (50 % CO , 18 % CO2, 2 % H2, and 30 % This example demonstrates that it is possible to eliminate N2) . Samples for OD and analytics were taken twice a day . acetate production system in an acetogen C . autoethanoge The strain with inactivated thioesterase 3 CAETHG _ 1780 55 num with the Ptb - buk system . produced significantly higher levels of isopropanol than the All acetogenic microorganisms are described to produce wild - type (FIG . 22 and FIGS. 23A - D ) . acetate ( Drake , Acetogenic Prokaryotes , In : The Prokary Similarly , knockout of thioesterases in C . autoethanoge otes, 3rd edition , pages 354 -420 , New York , N . Y ., Springer, num would increase the pool of 3 - hydroxybutyryl - CoA , 2006 ) as the production of acetate provides the microorgan allowing more efficient utilization of 3 -hydroxybutyryl - CoA 60 ism with an option to directly generate ATP from substrate by Ptb - Buk and leading to higher production of acetone , level phosphorylation via Pta (phosphotransacetylase ) and isopropanol, isobutylene , ( R ) - 3 -hydroxybutyrate , 1 , 3 -bu - Ack ( phosphotransacetylase - acetate kinase ). Native acetate tanediol, and /or 2 -hydroxyisobutyric acid . When plasmid forming enzymes such as Pta -Ack are therefore considered pMTL8315 -Pfdx -hbd1 -thlA of Example 5 was introduced to be essential in acetogens (Nagarajan , Microb Cell Fac into C . autoethanogenum strain with interrupted thioesterase 65 tories, 12 : 118 , 2013 ) . Since Ptb -Buk provides an alternative 2 CAETHG _ 1524 , 3 -hydroxybutyrate synthesis was abol- means for energy generation , it becomes possible to replace ished ( compared to the up to 2 . 55 g / L 3 -hydroxybutyrate that the native Pta - Ack system with Ptb -Buk . US 10 ,316 , 337 B2 75 76 The pta and ack genes in C . autoethanogenum are in one No acetate production was observed , while isopropanol (up operon . To replace pta and ack genes with ptb and buk genes to 0 .355 g / L ) and 3 - HB ( up to 0 .29 g / L ) was still produced a plasmid , pMTL8225 - pta -ack : :ptb -buk ( FIG . 24 ) , with alongside ethanol and 2 , 3 -butanediol (FIGS . 39 A and 39B ) . mazF counter selection marker that is under tetracycline This demonstrates that it is possible to produce isopropanol inducible promoter, ~ 1 kb upstream homology arm , ptb , 5 and 3 -HB without acetate production from gaseous sub buk , erm? cassette flanked by loxP sites and ~ 1 kb down - strates CO and / or CO , and H , using the Ptb - Buk system . stream homology arm was assembled (SEQ ID NO : 160 ) . If acetone rather than isopropanol is the target product, the The ~ 1 kb upstream and downstream homology arms primary : secondary alcohol dehydrogenase gene (SEQ ID were PCR amplified from C . autoethanogenum with primers SN22f/ SN23r and SN28f/ SN29r . Ptb and buk genes were NO : 17 ) can be further knocked out this strain C . autoetha PCR amplified from pIPA _ 16 plasmid using primers SN24f1 10 nogenum pta -ack : :ptb -buk using methods described above SN25r . The erm? cassette with loxP sites was PCR ampli and in detail in WO 2015 /085015 . Introducing plasmid fied using primers SN26f/ SN27r. The plasmid backbone was PMTL85147- th1A - adc into this strain results in production PCR amplified with primers SN30f/ SN31r . KAPA poly of acetone at similar levels as described above for isopro merase was used for all PCR amplifications . The PCR panolwithout co - production of acetate . Ethanol, 2 , 3 -butane products were assembled using GeneArt Seamless cloning 15 diol and 3 -HB may be further products . kit from Life Technologies and plasmid with no mutations in By further knock - outs it is possible to eliminate these the insert fragments was used to transform C . autoethano products as well, e . g ., knock -out of the acetolactate decar genum by conjugation as described earlier . boxylase gene BudA results in a strain unable to produce Following conjugation and selection on trimethoprim and 2 ,3 -butanediol (U .S . Pat. No . 9, 297 ,026 ). 3 -HB production clarithromycin , 7 colonies were streaked twice on PETC - 20 may be reduced or eliminated by deletion of 3 - hydroxybu MES agar plates with clarithromycin and anhydrotetracy tyrate dehydrogenase gene Bdh (SEQ ID NO : 62 ) . cline to induce the expression of mazf genes . The colonies from clarithromycin and anhydrotetracycline should have Example 9 the pta and ack genes replaced with ptb and buk genes and erm? cassette . This was verified by PCR using primers Og29f /Og30r flanking the homology arms and KAPA poly - 25 This example demonstrates improvement of conversion merase (FIG . 25 ) . While a band of ~ 4 . 6 kb is amplified from of 3 -hydroxybutyrate to 1 , 3 -BDO by overexpression of the the wildtype strain , bands of - 5 . 7 kb was amplified from aldehyde: ferredoxin oxidoreductase gene aorl. colonies 1 and 4 - 7 , indicating the replacement of pta and ack The pMTL82251 plasmid backbone was used for over genes replaced with ptb and buk genes and erm? cassette . expression of the C . autoethanogenum aorl gene . The The above event was further confirmed by sequencing the 30 PMTL82251 plasmid was selected since it has a different PCR products from clones 4 - 7 . replication origin and antibiotic marker , but could be co With the resulting modification the expression of ptb and expressed with , the plasmid used in Example 5 that con buk genes is driven by the promoter upstream of pta gene. tained hbd1 and th1A . Preparation of the plasmid backbone SEQ ID NO : Name Sequence 161 SN22f TTTACAAATTCGGCCGGCCAAAGATTGCTCTATGTTTAAGCT 162 SN23r CATCAAAGTTTTTACTCATCAATTTCATGTTCATTTCCTCCCT 163 SN24f AGGGAGGAAATGAACATGAAATTGATGAGTAAAAACTTTGAT GAGT 164 SN25r GTATAGCATACATTATACGAACGGTACTAGTAAACCTTAGCTT GTTCTTC 165 SN26f GAAGAACAAGCTAAGGTTTACTAGTACCGTTCGTATAATGTAT GCTATAC 166 SN27r AGAGATGAGCATTAAAAGTCAAGTCTACCGTTCGTATAGCATA CA 167 SN28f TGTATGCTATACGAACGGTAGACTTGACTTTTAATGCTCATCTCT 168 SN29r CATGAGATTATCAAAAAGGAGTTTAAATATCTATTTTGTCCTTA GGA 169 SN3Of TCCTAAGGACAAAATAGATATTTAAACTCCTTTTTGATAATCTC ATG 170 SN31r AGCTTAAACATAGAGCAATCTTTGGCCGGCCGAATTTGTAAA 171 Og29f AGCCACATCCAGTAGATTGAACTTT 172 Og30r AATTCGCCCTACGATTAAAGTGGAA

The resulting strain C . autoethanogenum pta - ack : :ptb - and the assembly reaction were carried out following the buk , in which the pta - ack operon was replaced by the procedures listed above , first generating plasmid ptb -buk operon was transformed as described above with the PMTL82256 by introducing the C . autoethanogenum ferre isopropanol production plasmid pMTL85147 - th1A -adc from 65 doxin promoter into plasmid pMTL82251 and then adding Example 2 . A growth study was carried out under auto - the aor1 genes to form plasmid pMTL82256 -aorl . The trophic conditions and analyzed for metabolic end products . following primers were used . US 10 ,316 , 337 B2 77

SEQ ID NO : Name Sequence Direction 173 Pfdx - F1 AAAGGTCTCCGGCCGCGCTCACTATCTGCGGAACC forward 174 Pfdx - R1 TTTGGTCTCGAATTCTGTAACACCTCCTTAATTTT reverse TAG 175 aorl - Fi AAAGGTCTCGAATTCAAAGATCTATGTATGGTTA forward TGATGGTAAAGTATTAAG 176 aorl - Ri TTTGGTCTCCTCGAGTATGGATCCCTAGAACTTAC reverse ?????????????????cc

After transforming the resulting plasmid pMTL82256 - 15 Example 10 aorl into the E . coli CA434 strain , conjugation was per This example demonstrates the stereospecificity of Ptb formed on the previous C . autoethanogenum 1 , 3 -BDO pro Buk that allows for the production of 2 - hydroxyisobutyric duction host . Thus, the resulting C . autoethanogenum strain acid without the production of unwanted byproducts. carried two plasmids, one for overexpressing hbd1 and th1A , 2 -hydroxyisobutyric acid can be produced in E . coli and and another for aor1, under different replication origins and C . autoethanogenum by introduction of a thiolase and a selection marker. The production for 1 , 3 -BDO was charac - 3 - hydroxybutyryl- CoA dehydrogenase to convert acetyl CoA to 3 -hydroxybutyryl - CoA , a 2 -hydroxyisobutyryl - CoA terized and quantified following the procedures above. mutase enzyme for conversion of 3 - hydroxybutyryl - CoA to The results clearly show that 1 ,3 - BDO production can be 2 -hydroxyisobutyryl - CoA and an enzyme that can hydrolyse improved by overexpressing aor1 . Likewise other aldehyde : 25 the CoA to form 2 -hydroxyisobutyric acid . The 3 -hydroxy ferredoxin oxidoreductase genes could be expressed in C . butyryl- CoA dehydrogenase can either be ( R )- or ( S ) - spe autoethanogenum to facilitate convserion of 3 -hydroxybu cific and the enzyme converting 2 -hydroxyisobutyryl - CoA tyrate to 1 , 3 - butanediol. to 2 - hydroxybutyrate according to steps 1, 13 , 19 , and 20 of To improve of 1 , 3 -BDO production , AOR was overex - 30 FIGthe .Ptb 1 . -Buk This lastsystem step . can either be done via a thioesterase or pressed to improve conversion of 3 -HB to 3 -HB - aldehyde . Three potential candidate genes, E . coli thioesterase type To do this , pMTL82256 -hbd - th1A and pMTL83159 -aor1 II TesB , the C . autoethanogenum phosphate acetyltrans were coexpressed in C . autoethanogenum . As compared to ferase / acetate kinase pair and the C . beijerinckii butyryl the strain that carried p MTL82256 - hbd - th1 A alone , the aori transferase /butyrate kinase pair were cloned into E . coli coexpressed strain produced higher ethanol and 1 ,3 -BDO PDUET T7 expression vectors via methods described above ( FIG . 44 ) . and primers below .

SEQ ID NO : Primer Sequence 177 PETDuet - pta - ack - GGGTACCTTATTTATTTTCAACTATTTCTTTTGTATC ack -Duet I2 - R1 178 PETDuet - pta - ack - TTGAAAATAAATAAGGTACCCTCGAGTCTGGTAAAG Duet12 - ack - F1

179 pETDuet - pta - ack TTTTTTCCATATGTATATCTCCTTCTTATACTTAAC Duet 12 - pta - Ri

180 PETDuet - pta - ack AGGAGATATACATATGGAAAAAATTTGGAGTAAGGC pta - DuetI2 - F1

181 PETDuet - tesB GAAATCATAATTAAGGTACCCTCGAGTCTGGTAAAG DuetI2 - tesB - F1

182 PETDuet - tesB CCTGACTCATATGTATATCTCCTTCTTATACTTAAC Duet 12 - tesB -R1 183 PETDuet - tesB - tesB - AAGAAGGAGATATACATATGAGTCAGGCACTTAAAA Duet 12 - F1

184 pETDuet - tesB AGGGTACCTTAATTATGATTTCTCATAACACCTTC testB - Duet12 - R1 US 10 , 316 , 337 B2 79 80 The obtained plasmids PDUET- pta -ack (SEQ ID NO : (SEQ ID NO : 193 ) and cloning into vector PMTL83151 185 ) , PDUET- ptb -buk ( SEQ ID NO : 186 ) , pDUET- tesB (FJ797647 . 1 ; Heap , J Microbiol Meth , 78 : 79 - 85 , 2009 ) (SEQ ID NO : 187 ) and introduced into E . coli BL21 (DE3 ) using Not? and Ndel restriction sites before introducing for expression and then assayed for their activity on genes thlA and hbd or respectively phaB via Ndel and KpnI acetoacetyl- CoA , 3 - hydroxybutyryl -CoA and 2 -hydroxy - 5 in a double ligation reaction . isobutyryl- CoA . The results are shown in FIG . 27 . E . coli In addition , compatible plasmid modules for expressing BL21 has a small but measurable amount of activity on all ptb -buk or tesB were built . For this , the respective genes three substrates . Pta - Ack resulted in no activity above back were amplified from genomic DNA and introduced into ground , while both thioesterase TesB and Ptb - Buk showed plasmid pMTL82256 described in Example 9 and then high activity on all three substrates, including 2 -hydroxy - 10 introducing either ptb -buk or phaB using Ndel and Ncol and isobutyryl- CoA . Seamless Cloning kit (Life technologies ) to form plasmids The activity of both thioesterase TesB and Ptb -Buk was PMTL82256 - ptb - buk (SEQ ID NO : 194 ) and pMTL82256 higher on linear acetoacetyl- CoA , 3- hydroxybutyryl - CoA tesB (SEQ ID NO : 195) . than on branched 2 -hydroxyisobutyryl - CoA . This creates a Plasmids PMTL83155 - th1A - hbd - Pwl- meaBhcmA -hcmB , problem in the pathway as it results in early termination of 15 PMTL83155 - thlA - phaB -Pwl - meaBhcmA -hcmB , the pathway at 3 - hydroxybutyryl- CoA , in particular as PMTL82256 -ptb - buk and pMTL82256 - tesB were intro activities are higher than activities on the 2 - hydroxyisobu duced into E . coli Top - 10 (all steps at 28° C .) and C . tyryl- CoA mutase enzyme. autoethanogenum by transformation as described in previ However , Ptb - Buk in contrast to thioesterases is able to ous examples in the following combinations : PMTL83155 distinguish between stereoisomers and will only ( or prefer - 20 th1A -hbd - Pwl- meaBhcmA -hcmB + pMTL82256 -ptb - buk , entially ) act on ( R ) -3 -hydroxybutyryl - CoA but not on ( S )- PMTL83155 -th1A -hbd -Pwl -meaBhcmA -hcmB + 3 - hydroxybutyryl- CoA . This was demonstrated by express - pMTL82256 - tesB , PMTL83155 - th1A - phaB -Pwl -meaBh ing the Ptb - Buk system either with Th1A and ( S ) -specific cmA -hcmB + pMTL82256 - ptb -buk and pMTL83155 - th1A Hbd (FIG . 28A ) or ( R ) - specific phaB (FIG . 28B ) in the phaB -Pwl -meaBhcmA -hcmB + pMTL82256 - tesB . pDuet system in E . coli. The constructs were constructed as 25 Growth experiments were carried out with E . coli in LB described in Examples 1 and 3 . Growth studies confirmed medium at 30° C . for 4 days and C . autoethanogenum in that appreciable amounts of 3 -hydroxybutyrate were only PETC medium with 30 psi CO - containing steel mill gas formed when Ptb -Buk was expressed in combination with collected from New Zealand Steel site in Glenbrook , NZ ) the ( S ) - specific Hbd but not the ( R ) - specific phaB . at 30° C . and 37° C . for 6 days . Metabolites were measured Therefore, a route via an ( S ) -specific 3 -hydroxybutyryl - 30 as described above . In addition to measurement by GC -MS , COA dehydrogenase and the Ptb - Buk provides significant 2 -Hydroxyisobutyric acid production was also confirmed advantages, as the Ptb - Buk system ( unlike thioesterases ) is using liquid chromatography tandem mass spectrometry not active on ( S ) - 3 -hydroxybutyryl - CoA but ( S ) - 3 -hydroxy - (LC -MS / MS ) and ' H nuclear magnetic resonance (NMR ) butyryl - CoA is also the preferred isomer of the 2 -hydroxy - spectroscopy . isobutyryl- CoA mutase ( Yaneva , J Biol Chem , 287 : 15502 - 35 Liquid chromatography tandem mass spectrometry (LC 15511, 2012 ) . The produced 2 -hydroxyisobutyryl -CoA can MS/ MS ) data was acquired on a Dionex UltiMate 3000 then be used via the Ptb - Buk to produce 2 -hydroxyisobu - liquid chromatography system (Dionex , Calif. , USA ) tyric acid and ( unlike thioesterases ) 2 -hydroxyisobutyryl - coupled to an ABSciex 4000 QTRAP mass spectrometer COA hydrolysis provides additional energy (FIG . 8 ) . (ABSciex , Concord , Canada ) . The liquid chromatography Modular constructs were designed to compare perfor- 40 system was controlled by Chromeleon software (Dionex ), mance of the pathway . A gene cassette containing the and chromatographic separation was achieved by injecting Wood -Ljungdahl promoter in front of the genes meaB , 104 onto a Gemini- NX C18 150 mmx2 mm I . D ., 3 um 110 hcmA and hcmB was codon optimized and synthesized Å particle column (Phenomenex , Aschaffenburg , Germany ) (SEQ ID NO : 188 ) . HcmA and hcmB encode a 2 -hydroxy equipped with a pre - column Security Guard Gemini - NX isobutyryl -CoA mutase and meaB a chaperon from Aquin - 45 C18 4 mmx2 mm I . D . cartridge . The column oven tempera cola tertiaricarbonis , in the construct hcmA and meaB ture was controlled and maintained at 55° C . throughout the genes were fused together as one protein as described (SEQ acquisition and the mobile phases were as follows : 7 .5 mM ID NO : 189 ) ( Yaneva, J Biol Chem , 287 : 15502 - 15511 , aqueous tributylamine adjusted to pH 4 .95 ( 0 .05 ) with 2012 ) . The gene cassette was cloned into either a plasmid glacial acetic acid (eluent A ) and acetonitrile ( eluent B ) . The containing thiolase ( thlA from C . acetobutylicum ; SEQ ID 50 mobile phase flow rate was maintained at 300 uL /min NO : 136 ) and an ( S ) -specific 3 -hydroxybutyrate dehydro - throughout a gradient profile and was introduced directly genase (hbd from C . acetobutylicum ; SEQ ID NO : 190 ) into the mass spectrometer with no split . The mass spec (PMTL83155 - th1A -hbd ) or an ( R ) -specific 3 - hydroxybu - trometer was controlled by Analyst 1 . 5 . 2 software ( AB tyrate dehydrogenase (phaB from R . eutropha ) Sciex ) and was equipped with a TurboV electrospray source (PMTL83155 -thlA -phaB ) using the restriction enzymes 55 operated in negative ionisation mode. The following previ KpnI and Ncol to form plasmids pMTL83155 - th1A -hbd ously optimized ( and therefore general) parameters were Pwl-meaBhcmA -hcmB (SER ID NO : 191) and used to acquire scheduled Multiple Reaction Monitoring PMTL83155- th1A -phaB -Pwl - meaBhcmA -hcmB (SEQ ID (MRM ) data : ionspray voltage - 4500V , nebulizer (GS1 ) , NO : 192 ), respectively . Sub -cloning of the codon optimized auxiliary (GS2 ) , curtain ( CUR ) and collision (CAD ) gases 2 -hydroxyisobutyryl - CoA mutase casette in E . coli Top - 10 60 were 60 , 60 , 20 and medium (arbitrary units ), respectively , was only successful after some initial cloning complications ; generated via a N300DR nitrogen generator (Peak Scientific , it was found that the 2 -hydroxyisobutyryl - CoA mutase Massachusetts , USA ). The auxiliary gas temperature was casette could only be cloned into the plasmid at a lower maintained at 350° C . The entrance potential ( EP ) was - 10 temperature ( 28° C .) . volts . This method is also able to detect and separate Vector pMTL83155 - th1A -hbd and PMTL83155 - th1A - 65 2 -hydroxybutyric acid . phaB were created by first amplifying a promoter region of ' H nuclear magnetic resonance (NMR ) spectroscopy at a the phosphate acetyltransferase of C . autoethanogenum field strength of 400 MHz. Samples were prepared by US 10 , 316 , 337 B2 8) 82 diluting 400 uL of sample with 400 uL of 20 mM phosphate ration of 200 uL of supernatant to dryness . The pellet was buffer prepared with D20 and containing trimethylsily1 then re - suspended in 100 % Isopropanol and sonicated under proprionic acid ( TMSP ) as internal standard ( pH of 7 ) . The heat for 1 hour. Centrifugation was repeated and the super samples were then transferred glass NMR tube ( 5 mmx8 natant transferred to an HPLC vial for analysis . Separation inches) and analysed by ' H NMR using presaturation for 5 was achieved with a 5 uL injection on to a TCI Chiral MB - S water suppression with a 30° excitation pulse, 15 second column ( 250 mmx4 . 6 mmx3 um ) at 1 . 5 mL /min and 40° C . relaxation delay and 64 scans at a temperature of 27° C . under isocratic conditions, using 95 - 5 hexane - isopropanol Once acquired the spectrum was transformed , flattened and mobile phase containing 0 .1 % trifluoracetic acid . integrated using Agilent VnmrJ software . The known con - stereospecific analysis of produce 3 - HB has been centration of TMSP was used for quantitation of 2 -hydroxy - 1 performed . Surprisingly it was found that in C . autoetha isobutyric using the resonance at 1 . 36 ppm ( singlet ). nogenum , a mix of isomers was produced . Enzymes Hbd In both E . coli growing heterotrophically as well as C . and PhaB are described to be stereospecific , PhaB is R - spe autoethanogenum growing autotrophically , 2 -hydroxyisobu cific and Hbd is S - specific and when expressing these tyric acid could be detected in constructs PMTL83155 - th1A 15 enzymes in E . coli a stereopure product has been observed hbd - Pwl-meaBhcmA - hcmB + pMTL82256 - tesB ( 1 . 5 mg / L 13 ( Tseng , Appl Environ Microbiol, 75 : 3137 -3145 , 2009 ) . in LC -MS / MS method and 8 mg/ L in GC -MS in C . autoethanogenum ; 0 . 5 mg/ L in LC -MS / MS method and 2 The following table indicates the distribution of ( R ) - and mg/ L in GC -MS in E . coli ) and pMTL83155 - th1A -phaB ( S ) - form of 3 - HB at equilibrium produced via three different Pwl- meaBhcm A - hcmB + pMTL82256 -ptb -buk (15 mg/ L in routes in C . autoethanogenum . These data suggest the LC -MS / MS method and 75 mg/ L in GC -MS in C . autoetha - 2020 presence of isomerase in the C . autoethanogenum . nogenum ; 1 . 1 mg/ L in LC -MS /MS method and 8 . 5 mg/ L in GC -MS in E . coli) , but not in constructs all other constructs % S - form including the control. By far the highestproduction occurred Route % R - form in strain carrying plasmid pMTL83155 - th1A -hbd - Pwl-me ThlA - PhaB 55 7 53 It- 5 aBhcmA - hcmB + pMTL82256 - ptb - buk ( 10x higher than all 25 Th1A -HBD 12 3 88 It 3 other routes ) , that has the optimal pathway with thiolase , ThlA - ctfAB 16 + 7 84 It+ 7 ( S )- specific ( S )- specific 3 -hydroxybutyryl - CoA dehydroge nase , the 2 -hydroxyisobutyryl - CoA mutase , and the Ptb -Buk Knockout of native isomerases may prevent interconver system ( FIGS . 29A - D ) . Surprisingly , also production of sion of ( R ) and ( S ) forms of 3 -HB . Alternatively , expression 2 -hydroxybutyrate ( 2 -HB ) (up to 64 mg/ L by LC -MS / MS 30 or overexpression of isomerases could enable new ptb -buk and 50 mg/ L by GC -MS in C . autoethanogenum ; 12 mg/ L routes . For example, Hbd could be used to generate ( S ) - 3 by LC -MS /MS and 9 . 5 mg/ L by GC -MS in E . coli ) was HB , isomerase could convert ( S ) - 3 -HB to ( R ) - 3 - HB , and found in this strain , indicating unspecific mutase activity ptb - buk could act on ( R ) - 3 -HB to produce products of ( FIG . 30 ) . This was also found in the tesB strain , but again interest . at significant lower levels ( 18 mg/ L in LC -MS -MS and 9 33 mg/ L in GC -MS in C . autoethanogenum ) . Production of Example 11 2 - hydroxyisobutyric acid was also confirmed by NMR . In addition , also qRT- PCR was carried out to confirm This example demonstrates the production of isobutylene expression of the genes th1A . hbd , meaBhcmA and hcmB via Ptb -Buk conversion of 3 -hydroxyisovaleryl - CoA and ( FIG . 31 ). 40 3 - hydroxyisovalerate . The RT- PCR graphs show that th1A gene product is Different routes for production of isobutylene have been expressed to slightly higher levels with the Ppta - ack promoter described , for example the conversion of acetone to isobu than hbd (as expected with a second gene in an operon ) and tyleneLylene viavia aa hydroxyisovaleratenyaroxyisovale synthase and decarboxylase that hmcB shows slightly lower expression levels than (van Leeuwen , Appl Microbiol Biotechnol, 93 : 1377 - 1387 , meaBhcmA. Also there is lower expression in CC . autoethaautoethe - -45 2012 ). However , the hydroxyisovalerate decarboxylase step nogenum at 30° C . than at 37° C . and E . coli at 30° C . For is an ATP requiring step and kinetics of this enzyme may not be ideal. Two alternative routes to isobutylene using the specific cycle numbers see below . Ptb - Buk system have been identified through 3 -hydroxyis ovaleryl -CoA which has been shown in vitro to be a viable Condition Target Cg Mean Cg Std Dev 50 substrate for the Ptb - Buk system (Liu , Appl Microbiol Biotechnol, 53 : 545 - 552 , 2000 ) . E . coli/ 30° C . thlA 18 . 26 0 . 243 hbd 20 . 6 0 .603 Alternative pathway 1 consists of a synthase that converts meaBhcmA 16 . 20 0 . 108 acetone into 3 - hydroxyisovaleryl -CoA (FIG . 9 ) . hmcB 18 .30 0 .666 Alternative pathway 2 proceeds via known intermediate C . autoethanogenum / 30° C . thlA 26 . 10 0 . 169 55 3 -methyl - 2 -oxopentanoate of the isoleucine biosynthesis Hbd 27 . 54 0 . 415 meaBhcmA 20 . 63 0 . 604 that is common to bacteria such as E . coli or C . autoetha hmcB 22 .64 0 .697 nogenum (FIG . 10 ) . C . autoethanogenum / 37° C . thlA 18 . 48 0 . 069 hbd 21. 85 0 . 222 Example 12 meaBhcmA 16 . 72 0 . 119 60 hmcB 19 .62 0 . 173 This example describes methods for characterizing Ptb Buk variants . The ratio of ( S ) - 3 -hydroxybutyric acid to (R ) - 3 -hydroxy - Given the substrate promiscuity of Ptb - Buk , it is likely butyric acid was measured by high -performance liquid chro - that Ptb - Buk systems of varying amino acid sequences will matography (HPLC ) on an Agilent 1260 Infinity LC with 65 possess varying preferences for given substrates . In order to UV detection at 210 nm . Samples were prepared by cen - identify a Ptb -Buk system that favors a desired substrate trifugation at 14 ,000 rpm for 3 minutes, followed by evapo ( e . g . acetoacetyl- CoA , 3 -hydroxybutyryl - CoA , 2 - hydroxy US 10 ,316 , 337 B2 83 84 isobutyryl- CoA , acetyl- CoA , and /or butyryl- CoA ), a high - It is desirable to construct strains where the target non throughput screen is desirable . Such a screen can be accom - native chemical must be produced for cell growth . FBA plished by coupling firefly luciferase (Luc ) to the Ptb -Buk predicts that in most cases it would be difficult to couple system (FIG . 33) . Luc reacts with D - luciferin , generating target chemical production with growth when using a thio oxyluciferin , carbon dioxide , and light . In addition to mag - 5 esterase or a COA transferase ; instead , native products nesium and molecular oxygen , Luc requires ATP for the acetate and ethanol would be favored . However, when using reaction to proceed . ATP is a product generated by Ptb - Buk Ptb -Buk , many growth - coupled chemical production strain when provided an appropriate acyl- CoA or enoyl- CoA sub designs exist, often incorporating a disruption of the phos strate . Therefore , Ptb -Buk reaction rates and preferences can umma be compared for varying substrates by quantifying the 10 rizes the growth coupling ability of each strain . amount of light generated by a reaction containing Ptb -Buk , Luc , d - luciferin , magnesium , molecular oxygen , phosphate , ADP, and an acyl- CoA or enoyl- CoA . TABLE 3 Potential to couple non -native chemical production with Example 13 growth in C . autoethanogenum during growth on CO when 15 reconfiguring the metabolic network with up to ten This example uses genome- scale modeling to demon gene knockouts . strate that high non - native product selectivities can be Ability to couple non -native chemical achieved using Ptb -Buk . Furthermore, it shows that the use production with growth of Ptb - Buk could permit the coupling of cellular growth with product production , allowing the construction of stable and 20 Non -native product Thioesterase COA -transferase Ptb -Buk high -yielding fermentation strains. Acetone No No Yes A genome- scale metabolic model of C . autoethanogenum Isopropanol No No Yes similar to the one described by Marcellin , Green Chem , 18 : Isobutylene No No No 3 - Hydroxybutyrate No No Yes 3020 -3028 , 2006 was utilized . Variants of this model were 25 1, 3 - Butanediol No Yes Yes created that incorporate additional metabolic reactions , each Yes one representing a different genetically modified microor 2 -Hydroxyisobutyrate No No ganism for non - native product formation . Three model ver sions were created for each non -native product pathway, While both Ptb -Buk and CoA transferase can support high incorporating either a thioesterase , acetate Co A -transferase selectivities, flux balance analysis predicts that in most or Ptb -Buk reaction . 30 cases, only Ptb - Buk would allow the construction of stable , Maximum selectivities were calculated using flux balance high - yielding fermentation strains that couple non - native analysis ( FBA ) , using scripts from the COBRA Toolbox chemical production with growth . v2 . 0 in MATLAB R2014a ( The Mathworks, Inc . ) with Gurobi version 6 . 0 . 4 as the solver (Gurobi Optimization , Example 14 Inc . ). Exchange reactions were constrained to represent a 5 chemically defined minimal growth medium with CO as the This example demonstrates the production of adipic acid source of carbon and energy . An evolutionary algorithm was via Ptb - Buk from gaseous feedstock . used to search for the existence of strain designs incorpo Production of adipic acid in E . coli from sugar has been rating up to ten gene knockouts that couple target non - native described by a pathway utilizing Ptb -Buk ( Yu , Biotechnol chemical production with growth . 40 Bioeng, 111 : 2580 - 2586 , 2014 ). However production was FBA predicts that pathways using Ptb - Buk or CoA trans low , in the ug / L range . Without wishing to be bound by any ferase offer the highest product selectivities due to ATP gain particular theory , the inventors believe that this is likely a through substrate level phosphorylation . The results are function of lacking driving force in forms of reducing power illustrated in Table 2 . However, it should be noted that one and surplus ATP . Using a reduced gaseous substrate as CO limitation ofGenome -scale models and FRA analysis is that 45 and H , and an acetogenic bacterium such as C . autoetha nogenum , this current limitation can be overcome. CO and enzyme kinetics are not captured . The CoA transferase H , oxidation provide sufficient driving force for reduction of reaction requires a certain base level of acetate for function 3 -oxo - adipyl- CoA to 3 -hydroxyadipyl - CoA by 3 - hydroxy ality , therefore in reality the maximum selectivity using a butyryl- CoA dehydrogenase or acetoacetyl- CoA hydratase COA transferase would be less than 100 % due to a base level 50 and 2 , 3 -dehydroadipyl - CoA to adipyl- CoA by enoyl- CoA of acetate required to be present. hydrolase or enoyl- CoA reductase ( FIG . 34 , steps 23 and 25 ), in contrast to E . coli growing heterotrophically on more TABLE 2 oxidized sugars . Acetogenic bacteria live on the energetic Flux balance analysis ( FBA ) showing the maximum possible limit of life and therefore ATP generating reactions like the non -native product selectivities in C . autoethanogenum Ptb -Buk system have a strong driving force , ensuring effi for a set of products and candidate enzymes. cient conversion of adipyl- CoA to adipic acid (FIG . 34 , step Maximum selectivity % ( C in target product / 26 ) , in contrast to E . coli growing heterotrophically on C in all fermentation products ) sugars generating surplus ATP from glycolysis . To produce adipic acid from gas in C . autoethanogenum , Non - native product Thioesterase COA - transferase Ptb - Buk 60 genes encoding a succinyl- CoA synthetase from E . coli Acetone 82. 0 100 100 (NP _ 415256 , NP _ 415257 ) , a ketoisovalerate oxidoreduc Isopropanol 82 . 1 100 100 tase PaaJ from E . coli (WP 001206190 . 1 ) , a 3 - hydroxybu Isobutylene 55 . 9 80 . 2 80 . 2 3 - Hydroxybutyrate 86 . 0 100 100 tyryl -CoA dehydrogenase Hbd from Clostridium beijer 1 , 3 -Butanediol 88 . 6 100 100 inckii (WP _ 011967675 . 1 ) , a trans - 2 - enoyl- CoA reductase 2 -Hydroxyisobutyrate 86 . 0 100 100 65 Crt from C . acetobutylicum (NP _ 349318 . 1 ) , trans - 2 -enoyl CoA reductase Bcd from C . acetobutylicum (NP _ 349317 . 1 ) and electron flavoproteins EtfAB (NP _ 349315 , NP _ 349316 ) US 10 , 316 , 337 B2 85 86 are cloned on an expression plasmid and then transformed as autoethanogenum strains pta -ack :: ptb - buk or described above in C . autoethanogenum strains pta -ack :: ptb CAETHG _ 1524 :: ptb -buk from previous examples for pro buk or CAETHG _ 1524: :ptb -buk from previous examples . duction of 2 -buten - 1 - ol, 3 -methyl - 2 -butanol , 1 , 3 -hexanediol Adipic acid is produce according to the steps depicted in (HDO ) . 2 -Buten - 1 -ol , 3 -methyl - 2 - butanol, and 1 , 3 -hexane 5 diol (HDO ) may be precursors for further downstream FIG . 34 . products . While these are only a few examples , it should be clear Example 15 that this pathway can be further extended using the same This example demonstrates the production of various enzymes or engineered variants thereof that have specificity products including 2 -buten -1 -ol , 3 -methyl -2 -butanol tanol, 1 ,3 3 - 1010 forTor higher chain length to produce a range of C4 , C6 , C8 , hexanediol (HDO ) via Ptb - Buk and AOR . C10 , C12 , C14 alcohols, ketones , enols or diols ( FIG . 39 ) . As demonstrated in Example 6 , Ptb - Buk is highly pro Different type of molecules can be obtained also by using miscuous and acts on a wide range of CoAs as substrates or primer or extender units different than acetyl- CoA in the can be engineered to use a range of non - natural CoAs as thiolase step as been described elsewhere (Cheong , Nature substrates . Likewise AOR enzyme has been shown to act on 15 Biotechnol , 34 : 556 - 561 , 2016 ) . a wide range of substrates . Together these two enzymes can All references , including publications, patent applica convert a wide range of CoAs via their acids into aldehydes , tions, and patents , cited herein are hereby incorporated by which then can be further converted to alcohols , ketones or reference to the same extent as if each reference were enols via alcohol dehdydrogeneses, for which a wide variety individually and specifically indicated to be incorporated by exists in nature . While under standard conditions the reduc - 20 referencelei and were set forth in its entirety herein . The tion of acids with ferredoxin to aldehydes via the AOR is reference to any prior art in this specification is not, and endergonic ( Thauer , Bacteriol Rev , 41 : 100 - 180 , 1977 ) and should not be taken as , an acknowledgement that that prior as such not feasible , it surprisingly is in carboxydotrophic art forms part of the common general knowledge in the field acetogens such as C . autoethanogenum that operate at low of endeavour in any country . The use of the terms “ a ” and “ an ” and “ the ” and similar pH and with CO or H , as substrate (Mock , J Bacteriol, 197 : 25 referents in the context of describing the invention ( espe 2965 - 2980 , 2015 ) . One common limitation working with cially in the context of the following claims) are to be acetogens is that they are ATP - limited , living on the ther construed to cover both the singular and the plural, unless modynamic edge of life (Schuchmann , Nat Rev Microbiol, otherwise indicated herein or clearly contradicted by con 12 : 809 - 821, 2014 ) , which can be overcome by coupling this text. The terms " comprising, " " having ,” “ including ,” and acid reduction to ATP - linked formation of acids from CoAs 30 “ containing ” are to be construed as open - ended terms ( i. e . , via the Ptb - Buk system . meaning " including, but not limited to ” ) unless otherwise The Ptb -Buk system and AOR system has been demon - noted . Recitation of ranges of values herein are merely strated in above examples for several different products , but intended to serve as a shorthand method of referring indi can be extended to further products , for example production vidually to each separate value falling within the range , of 2 -buten - 1 -o1 , 3 -methyl - 2 -butanol , 1 , 3 -hexanediol (HDO ). 35 unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually 2 -Buten - 1 - ol can be produced via Ptb -Buk , AOR and an recited herein . All methods described herein can be per alcohol dehydrogenase from crotonyl- CoA (FIG . 35 ) . 1 , 3 formed in any suitable order unless otherwise indicated Hexanediol can be produced via Ptb - Buk , AOR and an herein or otherwise clearly contradicted by context. The use alcohol dehydrogenase from 3 -hydroxy -hexanoyl - CoA of any and all examples, or exemplary language ( e . g ., “ such ( FIG . 35 ). By combining Ptb - Buk , Adc and an alcohol 40 as” ) provided herein , is intended merely to better illuminate dehydrogenase ( such as native primary : secondary alcohol the invention and does not pose a limitation on the scope of dehydrogenase ), 3 -methyl - 2 -butanol can be formed from the invention unless otherwise claimed . No language in the acetobutyryl- CoA . specification should be construed as indicating any non All of these precursors , crotonyl- CoA , 3 -hydroxy - claimed element as essential to the practice of the invention . hexanoyl- CoA , or acetobutyryl- CoA can be formed by 45 Preferred embodiments of this invention are described reduction and elongation of acetyl- CoA , acetoacetyl- CoA herein . Variations of those preferred embodiments may and 3 -HB - CoA which are described in previous examples become apparent to those of ordinary skill in the art upon via known fermentation pathways of, for example , reading the foregoing description . The inventors expect Clostridium kluyveri (Barker , PNAS USA , 31 : 373 -381 , skilled artisans to employ such variations as appropriate , and 1945 ; Seedorf , PNAS USA , 105 : 2128 - 2133 , 2008 ) and other 50 the inventors intend for the invention to be practiced other Clostridia . Involved enzymes include crotonyl- CoA wise than as specifically described herein . Accordingly , this hydratase ( crotonase ) or crotonyl- CoA reductase , butyryl invention includes all modifications and equivalents of the COA dehydrogenase or trans - 2 - enoyl- CoA reductase , thio - subject matter recited in the claims appended hereto as lase or acyl - CoA acetyltransferase and 3 -hydroxybutyryl - permitted by applicable law . Moreover , any combination of COA dehydrogenase or acetoacetyl- CoA hydratase ( FIG . 55 the above - described elements in all possible variations 35 ) . Respective genes from C . kluyveri or other Clostridia thereof is encompassed by the invention unless otherwise have be cloned on an expression plasmid (U . S . 2011/ indicated herein or otherwise clearly contradicted by con 0236941) and then transformed as described above in C . text.

SEQUENCE LISTING

< 160 > NUMBER OF SEO ID NOS : 195 < 210 > SEQ ID NO 1 < 211 > LENGTH : 392 US 10 ,316 ,337 B2 87 88 - continued < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium acetobutylicum < 220 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : ThiA , WP _ 010966157 . 1 < 400 > SEQUENCE : 1 Met Lys Glu Val Val Ile Ala Ser Ala Val Arq Thr Ala Ile Gly Ser

Tyr Gly Lys Ser Leu Lys Asp Val Pro Ala Val Asp Leu Gly Ala Thr 20 30 Ala Ile Lys Glu Ala Val Lys Lys Ala Gly Ile Lys Pro Glu Asp Val 35 40 Asn Glu Val Ile Leu Gly Asn Val Leu Gin Ala Gly Leu Gly Gin Asn

Pro Ala Arg Gln Ala Ser Phe Lys Ala Gly Leu Pro Val Glu Ile Pro

Ala Met Thr Ile Asn Lys Val Cys Gly Ser Gly Leu Arg Thr Val Ser

Leu Ala Ala Gln Ile Ile Lys Ala Gly Asp Ala Asp Val Ile Ile Ala 100 110 Gly Gly Met Glu Asn Met Ser Arg Ala Pro Tyr Leu Ala Asn Asn Ala 115 120 Arg Trp Gly Tyr Arg Met Gly Asn Ala Lys Phe Val Asp Glu Met Ile Thr Asp Gly Leu Trp Asp Ala Phe Asn Asp Tyr His Met Gly Ile Thr

Ala Glu Asn Ile Ala Glu Arg Trp Asn Ile Ser Arg Glu Glu Gin Asp

Glu Phe Ala Leu Ala Ser Gin Lys Lys Ala Glu Glu Ala Ile Lys Ser 180 190 Gly Gin Phe Lys Asp Glu Ile Val Pro Val Val Ile Lys Gly Arg Lys 195 200 Gly Glu Thr Val Val Asp Thr Asp Glu His Pro Arg Phe Gly Ser Thr Ile Glu Gly Leu Ala Lys Leu Lys Pro Ala Phe Lys Lys Asp Gly Thr

Val Thr Ala Gly Asn Ala Ser Gly Leu Asn Asp Cys Ala Ala Val Leu

Val Ile Met Ser Ala Glu Lys Ala Lys Glu Leu Gly Val Lys Pro Leu 260 270 Ala Lys Ile Val Ser Tyr Gly Ser Ala Gly Val Asp Pro Ala Ile Met 275 280 Gly Tyr Gly Pro Phe Tyr Ala Thr Lys Ala Ala Ile Glu Lys Ala Gly

Trp Thr Val Asp Glu Leu Asp Leu Ile Glu Ser Asn Glu Ala Phe Ala

Ala Gln Ser Leu Ala Val Ala Lys Asp Leu Lys Phe Asp Met Asn Lys

Val Asn Val Asn Gly Gly Ala Ile Ala Leu Gly His Pro Ile Gly Ala 340 350 Ser Gly Ala Arg Ile Leu Val Thr Leu Val His Ala Met Gin Lys Arg 355 360 Asp Ala Lys Lys Gly Leu Ala Thr Leu Cys Ile Gly Gly Gly Gin Gly 370 380 US 10 ,316 , 337 B2 89 ?? - continued

Thr Ala Ile Leu Leu Glu Lys Cys 385 390

< 210 > SEQ ID NO 2 < 211 > LENGTH : 393 < 212 > TYPE : PRT < 213 > ORGANISM : Cupriavidus necator V 20 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : PhaA , WP _ 013956452 . 1 < 400 > SEQUENCE : 2 Met Thr Asp Val Val Ile Val Ser Ala Ala Arg Thr Ala Val Gly Lys

Phe Gly Gly Ser Leu Ala Lys Ile Pro Ala Pro Glu Leu Gly Ala Val 20 25

Val Ile Lys Ala Ala Leu Glu Arg Ala Gly Val Lys Pro Glu Gin Val 40 45 Ser Glu Val Ile Met Gly Gin Val Leu Thr Ala Gly Ser Gly Gin Asn

Pro Ala Arg Gln Ala Ala Ile Lys Ala Gly Leu Pro Ala Met Val Pro 75 Ala Met Thr Ile Asn Lys Val Cys Gly Ser Gly Leu Lys Ala Val Met

Leu Ala Ala Asn Ala Ile Met Ala Gly Asp Ala Glu Ile Val Val Ala 100 105 Gly Gly Gin Glu Asn Met Ser Ala Ala Pro His Val Leu Pro Gly Ser 120 125 Arg Asp Gly Phe Arg Met Gly Asp Ala Lys Leu Val Asp Thr Met Ile

Val Asp Gly Leu Trp Asp Val Tyr Asn Gin Tyr His Met Gly Ile Thr 155 Ala Glu Asn Val Ala Lys Glu Tyr Gly Ile Thr Arg Glu Ala Gin Asp Glu Leu Ala Val Gly Ser Gin Asn Lys Ala Glu Ala Ala Gin Lys Ala 180 185 Gly Lys Phe Asp Glu Glu Ile Val Pro Val Leu Ile Pro Gin Arg Lys 200 205 Gly Asp Pro Val Ala Phe Lys Thr Asp Glu Phe Val Arg Gin Gly Ala Thr Leu Asp Ser Met Ser Gly Leu Lys Pro Ala Phe Asp Lys Ala Gly 235 Thr Val Thr Ala Ala Asn Ala Ser Gly Leu Asn Asp Gly Ala Ala Ala Val Val Val Met Ser Ala Ala Lys Ala Lys Glu Leu Gly Leu Thr Pro 260 265 Leu Ala Thr Ile Lys Ser Tyr Ala Asn Ala Gly Val Asp Pro Lys Val 280 285

Met Gly Met Gly Pro Val Pro Ala Ser Lys Arq Ala Leu Ser Arq Ala

Glu Trp Thr Pro Gin Asp Leu Asp Leu Met Glu Ile Asn Glu Ala Phe 315

Ala Ala Gln Ala Leu Ala Val His Gin Gin Met Gly Trp Asp Thr Ser 335 Lys Val Asn Val Asn Gly Gly Ala Ile Ala Ile Gly His Pro Ile Gly US 10 ,316 ,337 B2 91 - continued 340 345 350 Ala Ser Gly Cys Arg Ile Leu Val Thr Leu Leu His Glu Met Lys Arg 355 360 365 Arg Asp Ala Lys Lys Gly Leu Ala Ser Leu Cys Ile Gly Gly Gly Met 370 375 380 Gly Val Ala Leu Ala Val Glu Arg Lys 385 390

< 210 > SEO ID NO 3 < 211 > LENGTH : 394 < 212 > TYPE : PRT < 213 > ORGANISM : Cupriavidus necator < 220 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : BktB , WP _ 011615089 . 1 < 400 > SEQUENCE : 3 Met Thr Arg Glu Val Val Val Val Ser Gly Val Arg Thr Ala Ile Gly Thr Phe Gly Gly Ser Leu Lys Asp Val Ala Pro Ala Glu Leu Gly Ala 30 Leu Val Val Arg Glu Ala Leu Ala Arg Ala Gin Val Ser Gly Asp Asp 40 Val Gly His Val Val Phe Gly Asn Val Ile Gin Thr Glu Pro Arg Asp 55 Met Tyr Leu Gly Arg Val Ala Ala Val Asn Gly Gly Val Thr Ile Asn 65 75 Ala Pro Ala Leu Thr Val Asn Arg Leu Cys Gly Ser Gly Leu Gin Ala

Ile Val Ser Ala Ala Gln Thr Ile Leu Leu Gly Asp Thr Asp Val Ala 100 110 Ile Gly Gly Gly Ala Glu Ser Met Ser Arg Ala Pro Tyr Leu Ala Pro 120 Ala Ala Arg Trp Gly Ala Arg Met Gly Asp Ala Gly Leu Val Asp Met 135 Met Leu Gly Ala Leu His Asp Pro Phe His Arq Ile His Met Gly Val 145 155 Thr Ala Glu Asn Val Ala Lys Glu Tyr Asp Ile Ser Arg Ala Gln Gln

Asp Glu Ala Ala Leu Glu Ser His Ara Ara Ala Ser Ala Ala Ile Lys 180 190 Ala Gly Tyr Phe Lys Asp Gin Ile Val Pro Val Val Ser Lys Gly Arg 200 Lys Gly Asp Val Thr Phe Asp Thr Asp Glu His Val Arg His Asp Ala 215 Thr Ile Asp Asp Met Thr Lys Leu Arg Pro Val Phe Val Lys Glu Asn 225 235 240 Gly Thr Val Thr Ala Gly Asn Ala Ser Gly Leu Asn Asp Ala Ala Ala

Ala Val Val Met Met Glu Arg Ala Glu Ala Glu Arg Arg Gly Leu Lys 260 Pro Leu Ala Arg Leu Val Ser Tyr Gly His Ala Gly Val Asp Pro Lys 280 Ala Met Gly Ile Gly Pro Val Pro Ala Thr Lys Ile Ala Leu Glu Arg 295 US 10 ,316 , 337 B2 93 94 - continued Ala Gly Leu Gin Val Ser Asp Leu Asp Val Ile Glu Ala Asn Glu Ala 310 315 320 Phe Ala Ala Gin Ala Cys Ala Val Thr Lys Ala Leu Gly Leu Asp Pro 325 330 335 Ala Lys Val Asn Pro Asn Gly Ser Gly Ile Ser Leu Gly His Pro Ile 340 345 350 Gly Ala Thr Gly Ala Leu Ile Thr Val Lys Ala Leu His Glu Leu Asn 355 360 365 Arg Val Gin Gly Arg Tyr Ala Leu Val Thr Met Cys Ile Gly Gly Gly 375 380 Gin Gly Ile Ala Ala Ile Phe Glu Arg Ile 385 390

< 210 > SEQ ID NO 4 < 211 > LENGTH : 394 < 212 > TYPE : PRT < 213 > ORGANISM : Escherichia coli < 220 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : AtoB , NP _ 416728 . 1 < 400 > SEQUENCE : 4 Met Lys Asn Cys Val Ile Val Ser Ala Val Arg Thr Ala Ile Gly Ser

Phe Asn Gly Ser Leu Ala Ser Thr Ser Ala Ile Asp Leu Gly Ala Thr Val Ile Lys Ala Ala Ile Glu Arg Ala Lys Ile Asp Ser Gin His Val 40

Asp Glu Val Ile Met Gly Asn Val Leu Gln Ala Gly Leu Gly Gln Asn

Pro Ala Arg Gin Ala Leu Leu Lys Ser Gly Leu Ala Glu Thr Val Cys 75 Gly Phe Thr Val Asn Lys Val Cys Gly Ser Gly Leu Lys Ser Val Ala

Leu Ala Ala Gin Ala Ile Gin Ala Gly Gin Ala Gin Ser Ile Val Ala

Gly Gly Met Glu Asn Met Ser Leu Ala Pro Tyr Leu Leu Asp Ala Lys 120 Ala Arg Ser Gly Tyr Arg Leu Gly Asp Gly Gin Val Tyr Asp Val Ile Leu Arg Asp Gly Leu Met Cys Ala Thr His Gly Tyr His Met Gly Ile 155 Thr Ala Glu Asn Val Ala Lys Glu Tyr Gly Ile Thr Arg Glu Met Gin

Asp Glu Leu Ala Leu His Ser Gln Arg Lys Ala Ala Ala Ala Ile Glu

Ser Gly Ala Phe Thr Ala Glu Ile Val Pro Val Asn Val Val Thr Arg 200

Lys Lys Thr Phe Val Phe Ser Gin Asp Glu Phe Pro Lys Ala Asn Ser

Thr Ala Glu Ala Leu Gly Ala Leu Arg Pro Ala Phe Asp Lys Ala Gly 235 240 Thr Val Thr Ala Gly Asn Ala Ser Gly Ile Asn Asp Gly Ala Ala Ala 255

Leu Val Ile Met Glu Glu Ser Ala Ala Leu Ala Ala Gly Leu Thr Pro Ser Ala Ala Leu Ala Ala Gly 270Leu Thr Pro US 10 , 316 , 337 B2 95 96 - continued Leu Ala Arg Ile Lys Ser Tyr Ala Ser Gly Gly Val Pro Pro Ala Leu 275 280 285 Met Gly Met Gly Pro Val Pro Ala Thr Gin Lys Ala Leu Gin Leu Ala 290 295 300 Gly Leu Gin Leu Ala Asp Ile Asp Leu Ile Glu Ala Asn Glu Ala Phe 315 320 Ala Ala Gin Phe Leu Ala Val Gly Lys Asn Leu Gly Phe Asp Ser Glu 335 Lys Val Asn Val Asn Gly Gly Ala Ile Ala Leu Gly His Pro Ile Gly 345 350 Ala Ser Gly Ala Arg Ile Leu Val Thr Leu Leu His Ala Met Gin Ala 355 360 365 Arg Asp Lys Thr Leu Gly Leu Ala Thr Leu Cys Ile Gly Gly Gly Gin 370 375 380 Gly Ile Ala Met Val Ile Glu Arq Leu Asn 385 390

< 210 > SEQ ID NO 5 < 211 > LENGTH : 217 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium beijerinckii < 220 > FEATURE : 21 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : CtfA , WP _ 012059996 . 1 < 400 > SEQUENCE : 5 Met Asn Lys Leu Val Lys Leu Thr Asp Leu Lys Arg Ile Phe Lys Asp 5 Gly Met Thr Ile Met Val Gly Gly Phe Leu Asp Cys Gly Thr Pro Glu 25 30

Asn Ile Ile Asp Met Leu Val Asp Leu Asn Ile Lys Asn Leu Thr Ile

Ile Ser Asn Asp Thr Ala Phe Pro Asn Lys Gly Ile Gly Lys Leu Ile Val Asn Gly Gin Val Ser Lys Val Ile Ala Ser His Ile Gly Thr Asn 70 Pro Glu Thr Gly Lys Lys Met Ser Ser Gly Glu Leu Lys Val Glu Leu

Ser Pro Gin Gly Thr Leu Ile Glu Arg Ile Arg Ala Ala Gly Ser Gly 105 110 Leu Gly Gly Val Leu Thr Pro Thr Gly Leu Gly Thr Ile Val Glu Glu Gly Lys Lys Lys Val Thr Ile Asp Gly Lys Glu Tyr Leu Leu Glu Leu

Pro Leu Ser Ala Asp Val Ser Leu Ile Lys Gly Ser Ile Val Asp Glu 150 Phe Gly Asn Thr Phe Tyr Arg Ala Ala Thr Lys Asn Phe Asn Pro Tyr

Met Ala Met Ala Ala Lys Thr Val Ile Val Glu Ala Glu Asn Leu Val 185 190 Lys Cys Glu Asp Leu Lys Arg Asp Ala Ile Met Thr Pro Gly Val Leu 195 Val Asp Tyr Ile Val Lys Glu Ala Ala US 10 ,316 , 337 B2 97 98 - continued < 210 > SEO ID NO 6 < 211 > LENGTH : 221 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium beijerinckii FEATURE : 21NOM > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : CtfB , WP _ 012059997 . 1 < 400 > SEQUENCE : 6 Met Ile Val Asp Lys Val Leu Ala Lys Glu Ile Ile Ala Lys Arg Val Ala Lys Glu Leu Lys Lys Asp Gin Leu Val Asn Leu Gly Ile Gly Leu

Pro Thr Leu Val Ala Asn Tyr Val Pro Lys Glu Met Asn Ile Thr Phe 40

Glu Ser Glu Asn Gly Met Val Gly Met Ala Gln Met Ala Ser Ser Gly 60 Glu Asn Asp Pro Asp Ile Ile Asn Ala Gly Gly Glu Tyr Val Thr Leu Leu Pro Gin Gly Ser Phe Phe Asp Ser Ser Met Ser Phe Ala Leu Ile

Arg Gly Gly His Val Asp Val Ala Val Leu Gly Ala Leu Glu Val Asp

Glu Lys Gly Asn Leu Ala Asn Trp Ile Val Pro Asn Lys Ile Val Pro 120 Gly Met Gly Gly Ala Met Asp Leu Ala Ile Gly Ala Lys Lys Ile Ile 140 Val Ala Met Gin His Thr Gly Lys Ser Lys Pro Lys Ile Val Lys Lys

Cys Thr Leu Pro Leu Thr Ala Lys Ala Gin Val Asp Leu Ile Val Thr

Glu Leu Cys Val Ile Asp Val Thr Asn Asp Gly Leu Leu Leu Lys Glu

Ile His Lys Asp Thr Thr Ile Asp Glu Ile Lys Phe Leu Thr Asp Ala 200 Asp Leu Ile Ile Pro Asp Asn Leu Lys Ile Met Asp Ile 210 220

< 210 > SEQ ID NO 7 < 211 > LENGTH : 286 < 212 > TYPE : PRT < 213 > ORGANISM : Escherichia coli < 220 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : TesB , NP _ 414986 . 1 < 400 > SEQUENCE : 7 Met Ser Gin Ala Leu Lys Asn Leu Leu Thr Leu Leu Asn Leu Glu Lys n Ala Leu Lys Aøn Leu Leu Thr10 Leu Leu Aøn Leu 15alu Ly? Ile Glu Glu Gly Leu Phe Arg Gly Gin Ser Glu Asp Leu Gly Leu Arg 25 Gin Val Phe Gly Gly Gin Val Val Gly Gin Ala Leu Tyr Ala Ala Lys 35 40 45

Glu Thr Val Pro Glu Glu Arq Leu Val His Ser Phe His Ser Tyr Phe 55 Leu Arg Pro Gly Asp Ser Lys Lys Pro Ile Ile Tyr Asp Val Glu Thr 65 70 Leu Arg Asp Gly Asn Ser Phe Ser Ala Arg Arg Val Ala Ala Ile Gin US 10 ,316 ,337 B2 99 100 - continued 85 95 Asn Gly Lys Pro Ile Phe Tyr Met Thr Ala Ser Phe Gin Ala Pro Glu 100 110 Ala Gly Phe Glu His Gin Lys Thr Met Pro Ser Ala Pro Ala Pro Asp 115 120 125 Gly Leu Pro Ser Glu Thr Gln Ile Ala Gln Ser Leu Ala His Leu Leu 135 Pro Pro Val Leu Lys Asp Lys Phe Ile Cys Asp Arg Pro Leu Glu Val 145 160 Ara Pro Val Glu Phe His Asn Pro Leu Lys Gly His Val Ala Glu Pro 175 His Arg Gin Val Trp Ile Arg Ala Asn Gly Ser Val Pro Asp Asp Leu 180 190 Arg Val His Gin Tyr Leu Leu Gly Tyr Ala Ser Asp Leu Asn Phe Leu 195 200 205 Pro Val Ala Leu Gin Pro His Gly Ile Gly Phe Leu Glu Pro Gly Ile 215 Gin Ile Ala Thr Ile Asp His Ser Met Trp Phe His Arg Pro Phe Asn 225 240 Leu Asn Glu Trp Leu Leu Tyr Ser Val Glu Ser Thr Ser Ala Ser Ser 255 Ala Arg Gly Phe Val Arg Gly Glu Phe Tyr Thr Gin Asp Gly Val Leu 260 270 Val Ala Ser Thr Val Gln Glu Gly Val Met Arq Asn His Asn 275 280 285

< 210 > SEQ ID NO 8 < 211 > LENGTH : 436 < 212 > TYPE : PRT 13 > ORGANISM : Clostridium autoethanogenum < 220MO > FEATURE : 21 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : putative thioesterase 1 , AGY74947 . 1 < 400 > SEQUENCE : 8 Met Asn Asn Asp Asn Cys Thr Ile Lys Ile Thr Pro Glu Val Ser Arq

Val Asp Glu Pro Val Asp Ile Lys Ile Asn Gly Leu Pro Lys Asn Glu 20 Lys Val Ile Ile Arg Ala Val Ser Ser Asp Tyr Tyr Cys Ile Asn Ala 35 Ser Ile Leu Glu Ile Gly Asp Asn Thr Leu Trp Glu Ser Tyr Ala Val 55 Phe Glu Thr Asp Glu Cys Gly Asn Ile Asn Phe Glu Asn Ala Val Pro 80 Val Asp Gly Thr Tyr Ser Asn Cys Asp Lys Met Gly Leu Phe Tyr Ser

Met Arg Pro Lys Gin Ile Arg Lys Ser Lys Leu Ile Gin Lys Leu Ser 100 Ser Ile Asn Glu Asn Arg Lys Tyr Lys Ile Thr Phe Thr Val Glu Lys 115 Asn Gly Lys Ile Ile Gly Ser Lys Glu His Thr Arg Val Tyr Cys Asp 135

Asp Thr Ile Lys Ser Ile Asp Val Val Glu Lys Asn Leu Leu Ala Ara 160 US 10 ,316 , 337 B2 101 102 - continued Tyr Phe Thr Ser Lys Asp Asn Ile Lys His Pro Ala Ile Ile Val Leu 170 175 Ser Gly Ser Asp , Arq Ile Glu Lys Ala Gln Ala Ile Ala Glu Leu 190 Phe Ala Met Arg Gly Tyr Ser Ala Leu Ala Val Cys Tyr Phe Gly Leu 195 200 Glu Gly Thr Pro Glu Asp Leu Asn Met Ile Pro Leu Glu Tyr Val Glu 215 Asn Ala Val Lys Trp Leu Lys Arg Gin Asp Thr Val Asp Glu Asn Lys 225 240 Ile Ala Ile Tyr Gly Arg Ser Lys Gly Gly Glu Leu Val Leu Leu Ala 250 255 Ala Ser Met Phe Lys Asp Ile Ala Cys Val Ile Ala Asn Thr Pro Ser 270 Cys Tyr Val Tyr Glu Gly Ile Lys Ser Asn Lys Leu Pro Ser His His 275 280 Ser Ser Trp Met Tyr Arg Gly Arg Glu Ile Pro Tyr Leu Lys Phe Asn 295 Phe His Ile Ile Leu Arg Leu Ile Ile Lys Met Met Lys Lys Glu Lys 305 320

Gly Ala Leu Ala Trp Met Tyr Lys Lys Leu Ile Glu Glu Gly Asp Arg 330 335 Asp Lys Ala Thr Ile Ala Leu Asp Lys Ile Asn Gly Ser Val Leu Met 350 Ile Ser Ser Ala Ala Asp Glu Ile Trp Pro Ser Lys Met His Ser Glu 355 360 Thr Val Cys Ser Ile Phe Glu Lys Ser His Phe Lys His Glu Tyr Lys 375 His Ile Thr Phe Ala Lys Ser Gly His Ile Leu Thr Val Pro Phe Gin 385 400 Ser Ile Tyr Pro Ser Glu Lys Tyr Pro Tyr Asp Val Glu Ser Trp Ala 410 415 Lys Ala Asn Met Asp Ser Trp Asn Glu Thr Ile Lys Phe Leu Glu Lys 425 430 Trp Ala Ser Lys 435

< 210 > SEQ ID NO 9 < 211 > LENGTH : 137 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium autoethanogenum < 220 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE < NNN223NNNPP > OTHER INFORMATION : putative thioesterase 2 , AGY75747 . 1 < 400 > SEQUENCE : 9 Met Tyr Ile Asn Glu Thr Lys Val Val Val Arq Tyr Ala Glu Thr Asp 15 Lys Met Gly Ile Val His His Ser Asn Tyr Tyr Ile Tyr Phe Glu Glu 25 30 Ala Arg Thr Gin Phe Ile Lys Lys Thr Gly Ile Ser Tyr Ser Gin Met 40 Glu Lys Asp Gly Ile Met Phe Pro Leu Val Glu Ser Asn cys Arg Tyr 55 60 Leu Gin Gly Ala Lys Tyr Glu Asp Glu Leu Leu Ile Lys Thr Trp Ile 65 70 75 US 10 ,316 , 337 B2 103 104 - continued Lys Glu Leu Thr Pro Val Lys Ala Glu Phe Asn Tyr Ser Val Ile Arg 95 Glu Asn Asp Gin Lys Glu Ile Ala Lys Gly Ser Thr Leu His Ala Phe 100 110

Val Asn Asn Asn Phe Lys Ile Ile Asn Leu Lys Lys Asn His Thr Glu 115 120 125 Leu Phe Lys Lys Leu Gin Ser Leu Ile 130 135

< 210 > SEQ ID NO 10 < 211 > LENGTH : 128 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium autoethanogenum < 220 > FEATURE : 21 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : putative thioesterase 3 , AGY75999 . 1 < 400 > SEQUENCE : 10 Met Asp Phe Ser Lys Leu Phe Lys Val Gly Ser Thr Tyr Val Ser Glu

Tyr Ile Val Lys Pro Glu Asp Thr Ala Asn Phe Ile Gly Asn Asn Gly 25 30 Val Val Met Leu Ser Thr Pro Ala Met Ile Lys Tyr Met Glu Tyr Thr 35 Thr Leu His Ile Val Asp Asn Val Ile Pro Lys Asn Tyr Arg Pro Val 60 Gly Thr Lys Ile Asp Val Glu His Ile Lys Pro Ile Pro Ala Asn Met 70 80 Lys Val Val Val Lys Val Thr Leu Ile Ser Ile Glu Gly Lys Lys Leu Arg Tyr Asn Val Glu Ala Phe Asn Glu Lys Asn Cys Lys Val Gly Phe 105 110 Gly Ile Tyr Glu Gln Gln Ile Val Asn Leu Glu Gln Phe Leu Asn Arq 115 120 Asn Leu Glu Gin

< 210 > SEQ ID NO 11 < 211 > LENGTH : 436 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium ljungdahlii 20 > FEATURE : < 221 > NAME / KEY : MISC _ FEATURE 23 > OTHER INFORMATION : putative thioesterase 1 . ADK15695 1 < 400 > SEQUENCE : 11 Met Asn Asn Asp Asn Cys Thr Ile Lys Ile Thr Pro Glu Val Ser Arg 15 Val Asp Glu Pro Val Asp Ile Lys Ile Asn Gly Leu Pro Lys Asn Glu 25 Lys Val Ile Ile Arg Ala Val Ser Ser Asp Tyr Tyr Cys Ile Asn Ala 35 40

Ser Ile Leu Glu Ile Gly Asp Asn Thr Leu Trp Glu Ser Tyr Ala Val 55 Phe Glu Thr Asp Glu Cys Gly Asn Ile Asn Phe Glu Asn Ala Val Pro 70 Val Asp Gly Thr Tyr Ser Asn cys Asp Lys Met Gly Leu Phe Tyr Ser 85 95 Met Arg Pro Lys Gin Ile Arg Lys Ser Lys Leu Ile Gin Lys Leu Ser 100 105 US 10 , 316 , 337 B2 105 106 - continued

Ser Ile Asn Glu Asn Arg Lys Tyr Lys Ile Thr Phe Thr Val Glu Lys 120 Asn Gly Lys Ile Ile Gly Ser Lys Glu His Thr Arg Val Tyr Cys Asp

Asp Thr Ile Lys Ser Ile Asp Val Val Glu Lys Asn Leu Leu Ala Arg 145 155 160 Tyr Phe Thr Ser Lys Asp Asn Ile Lys His Pro Ala Ile Ile Val Leu 175 Ser Gly Ser Asp Gly Arg Ile Glu Lys Ala Gin Ala Ile Ala Glu Leu Phe Ala Met Arg Gly Tyr Ser Ala Leu Ala Val Cys Tyr Phe ly Leu 200 Glu Gly Thr Pro Glu Asp Leu Asn Met Ile Pro Leu Glu Tyr Val Glu Asn Ala Val Lys Trp Leu Lys Arg Gin Asp Thr Val Asp Glu Asn Lys 225 235 240 Ile Ala Ile Tyr Gly Arg Ser Lys Gly Gly Glu Leu Val Leu Leu Ala 255

Ala Ser Met Phe Lys Asp Ile Ala Cys Val Ile Ala Asn Thr Pro Ser

Cys Tyr Val Tyr Glu Gly Ile Lys Ser Asn Lys Leu Pro Ser His His 280 Ser Ser Trp Met Tyr Arg Gly Arg Glu Ile Pro Tyr Leu Lys Phe Asn

Phe His Ile Ile Leu Arg Leu Ile Ile Lys Met Met Lys Lys Glu Lys 305 315 320 Gly Ala Leu Ala Trp Met Tyr Lys Lys Leu Ile Glu Glu Gly Asp Arg 335

Asp Lys Ala Thr Ile Ala Leu Asp Lys Ile Asn Gly Ser Val Leu Met

Ile Ser Ser Ala Ala Asp Glu Ile Trp Pro Ser Lys Met His Ser Glu 360 Thr Val Cys Ser Ile Phe Glu Lys Ser His Phe Lys His Glu Tyr Lys

His Ile Thr Phe Ala Lys Ser Gly His Ile Leu Thr Val Pro Phe Gin 385 395 400 Ser Ile Tyr Pro Ser Glu Lys Tyr Pro Tyr Asp Val Glu Ser Trp Ala 415 Lys Ala Asn Met Asp Ser Trp Asn Glu Thr Ile Lys Phe Leu Glu Lys

Trp Ala Ser Lys 435

< 210 > SEQ ID NO 12 < 211 > LENGTH : 137 < 212 > TYPE : PRT V< 213 > ORGANISM : Clostridium ljungdahlii V< 220N > FEATURE : V< 221N > NAME / KEY : MISC _ FEATURE V< 223N > OTHER INFORMATION : putative thioesterase 2 , ADK16655 . 1 < 400 > SEQUENCE : 12 Met Tyr Ile Asn Glu Thr Lys Val Val Val Arg Tyr Ala Glu Thr Asp 10 15 Lys Met Gly Ile Val His His Ser Asn Tyr Tyr Ile Tyr Phe Glu Glu US 10 ,316 ,337 B2 107 108 - continued 20 25 30 Ala Arq Thr Gln Phe Ile Lys Lys Thr Gly Ile Ser Tyr Ser Gin Met 35 40 45Tyr Ser Gin Met Glu Lys Asp Gly Ile Met Phe Pro Leu Val Glu Ser Asn Cys Arg Tyr 50 Leu Gin Gly Ala Lys Tyr Glu Asp Glu Leu Leu Ile Lys Thr Trp Ile 75 Lys Glu Leu Thr Pro Val Lys Ala Glu Phe Asn Tyr Ser Val Ile Arg

Glu Asn Asp Gin Lys Glu Ile Ala Lys Gly Ser Thr Leu His Ala Phe 100 105 110 Val Asn Asn Asn Phe Lys Ile Ile Asn Leu Lys Lys Asn His Thr Glu 115 120 125 Leu Phe Lys Lys Leu Gin Ser Leu Ile 130 135

< 210 > SEQ ID NO 13 < 211 > LENGTH : 128 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium ljungdahlii < 220 > FEATURE : < 221 > NAME / KEY : MISC FEATURE < 223 > OTHER INFORMATION : putative thioesterase 3 , ADK16959 . 1 < 400 > SEQUENCE : 13 Met Asp Phe Ser Lys Leu Phe Lys Val Gly Ser Thr Tyr Val Ser Glu Tyr Ile Val Lys Pro Glu Asp Thr Ala Asn Phe Ile Gly Asn Asn Gly 25 Val Val Met Leu Ser Thr Pro Ala Met Ile Lys Tyr Met Glu Tyr Thr 40 Thr Leu His Ile Val Asp Asn Val Ile Pro Lys Asn Tyr Arg Pro Val 55 Gly Thr Lys Ile Asp Val Glu His Ile Lys Pro Ile Pro Ala Asn Met

Lys Val Val Val Lys Val Thr Leu Ile Ser Ile Glu Gly Lys Lys Leu Arg Tyr Asn Val Glu Ala Phe Asn Glu Lys Asn Cys Lys Val Gly Phe 105 Gly Ile Tyr Glu Gin Gin Ile Val Asn Leu Glu Gin Phe Leu Asn Arg 120

< 210 > SEQ ID NO 14 < 211 > LENGTH : 246 < 212 > TYPE : PRT < 213 > ORGANISM : Clostridium beijerinckii < 220OWN > FEATURE : < 221NNPP > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : Adc , WP _ 012059998 . 1 < 400 > SEQUENCE : 14 Met Leu Glu Ser Glu Val Ser Lys Gin Ile Thr Thr Pro Leu Ala Ala 10 Pro Leu 15Aba Ala Pro Ala Phe Pro Arg Gly Pro Tyr Arg Phe His Asn Arg Glu Tyr Leu 20 25 30 Asn Ile Ile Tyr Arg Thr Asp Leu Asp Ala Leu Arg Lys Ile Val Pro 35 40

Glu Pro Leu Glu Leu Asp Arq Ala Tyr Val Arq Phe Glu Met Met Ala US 10 ,316 ,337 B2 109 110 - continued 60 Met Pro Asp Thr Thr Gly Leu Gly Ser Tyr Thr Glu Cys Gly Gin Ala 75 Ile Pro Val Lys Tyr Asn Gly Val Lys Gly Asp Tyr Leu His Met Met 85 95

Tyr Leu Asp Asn Glu Pro Ala Ile Ala Val Gly Arg Glu Ser Ser Ala

Tyr Pro Lys Lys Leu Gly Tyr Pro Lys Leu Phe Val Asp Ser Asp Thr 115 120 Leu Val Gly Thr Leu Lys Tyr Gly Thr Leu Pro Val Ala Thr Ala Thr Met Gly Tyr Lys His Glu Pro Leu Asp Leu Lys Glu Ala Tyr Ala Gin 155 Ile Ala Arg Pro Asn Phe Met Leu Lys Ile Ile Gin Gly Tyr Asp Gly 165 175 Lys Pro Arg Ile Cys Glu Leu Ile Cys Ala Glu Asn Thr Asp Ile Thr

Ile His Gly Ala Trp Thr Gly Ser Ala Arg Leu Gin Leu Phe Ser His 195 200 Ala Leu Ala Pro Leu Ala Asp Leu Pro Val Leu Glu Ile Val Ser Ala

Ser His Ile Leu Thr Asp Leu Thr Leu Gly Thr Pro Lys Val Val His 235 240 Asp Tyr Leu Ser Val Lys 245

< 210 > SEQ ID NO 15 < 211 > LENGTH : 548 < 212 > TYPE : PRT 13 > ORGANISM : Lactococcus lactis < 220MO > FEATURE : 21 > NAME / KEY : MISC _ FEATURE < 223 > OTHER INFORMATION : KivD < 400 > SEQUENCE : 15 Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gin Phe Leu 25 30 Asp Gin Ile Ile Ser His Lys Asp Met Lys Trp Val Gly Asn Ala Asn Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys

Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val 75 Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile

Val Gly Ser Pro Thr Ser Lys Val Gin Asn Glu Gly Lys Phe Val His 105 110 His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu

Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val

Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val 155 160 US 10 ,316 , 337 B2 111 112 - continued Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 175 Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gin 185 190 Glu Ile Leu Asn Lys Ile Gin Glu Ser Leu Lys Asn Ala Lys Lys Pro 195 200 205 Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr 220 Val Thr Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn 225 Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile 255 Tyr Asn Gly Thr Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser 265 270

Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285 Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn 300 Ile Asp Glu Gly Lys Ile Phe Asn Glu Arg Ile Gin Asn Phe Asp Phe 305 Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys 335 Gly Lys Tyr Ile Asp Lys Lys Gin Glu Asp Phe Val Pro Ser Asn Ala 345 350 Leu Leu Ser Gin Asp Arg Leu Trp Gin Ala Val Glu Asn Leu Thr Gin 355 360 365 Ser Asn Glu Thr Ile Val Ala Glu Gin Gly Thr Ser Phe Phe Gly Ala

Ser Ser Ile Phe Leu Lys Ser Lys Ser His Phe Ile Gly Gln Pro Leu 385 400 Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gin Ile 415 Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu 425 430 Gln Leu Thr Val Gin Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn 435 440 445 Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu Ile His Gly Pro Asn Gin Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr 465 480 Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Asp Arg Val Val Ser 495 Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala 505 510 Gin Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys 515 520 525 Glu Gly Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Phe Ala Glu 530 535 Gln Asn Lys Ser 545

< 210 > SEQ ID NO 16 < 211 > LENGTH : 351 < 212 > TYPE : PRT