PTTG and PBF Repress the Human Sodium Iodide Symporter

K Boelaert1,3, VE Smith1,3, AL Stratford1, T Kogai2, LA Tannahill1, JC Watkinson1, MC Eggo1, JA Franklyn1 and CJ McCabe1

1Department of Medicine, Division of Medical Sciences, Institute of Biomedical Research, University of Birmingham, Birmingham, UK and 2Department of Medicine, Endocrinology and Diabetes Division, VA Greater Los Angeles Healthcare System, University College Los Angeles, Los Angeles, CA, USA

The ability of the thyroid to accumulate iodide provides Some mammalian cells, most notably thyroid follicular the basis for radioiodine ablation of differentiated thyroid cells, take up iodide, organify it and incorporate it into cancers and their metastases. Most thyroid tumours proteins. In 1996, the gene encoding the molecule exhibit reduced iodide uptake, although the mechanisms responsible for iodide transport, the human sodium accounting for this remain poorly understood. Pituitary iodide symporter (NIS), was cloned (Dai et al., 1996; tumour transforming gene (PTTG) is a proto-oncogene Smanik et al., 1996). The ability of malignant thyroid implicated in the pathogenesis of thyroid tumours. We cells to actively transport iodide via NIS function now show that PTTG and its binding factor PBF repress provides a unique and effective delivery system for expression of sodium iodide symporter (NIS) messenger detection and destruction of these cells with therapeutic RNA (mRNA), and inhibit iodide uptake. This process is doses of radioiodine. Unfortunately, however, NIS mediated at least in part through fibroblast growth factor- expression and function are generally reduced in 2. In detailed studies of the NIS promoter in rat FRTL-5 differentiated thyroid cancers compared with normal cells, PTTG and PBF demonstrated specific inhibition of thyroid tissue. Understanding of the factors repressing promoter activity via the human upstream enhancer NIS activity in thyroid tumours is thus important in element (hNUE). Within this B1 kb element, a complex improving 131I delivery to those tumours that fail to PAX8-upstream stimulating factor 1 (USF1) response uptake radioiodine effectively. element proved critical both to basal promoter activity and Numerous factors have been shown to influence NIS to PTTG and PBF repression of NIS. In particular, activity in vitro, including thyrotropin (TSH), dexa- repression by PTTG was contingent upon the USF1, but methazone and all-trans retinoic acid (Kogai et al., not the PAX8, site. Finally, in human primary thyroid 1997, 2000; Spitzweg et al., 1999). One previous study in cells, PTTG and PBF similarly repressed the NIS rat thyroid FRTL-5 cells implicated the pituitary tumor promoter via hNUE. Taken together, our data suggest transforming gene (PTTG) in the downregulation of the that the reported overexpression of PTTG and PBF in NIS (Heaney et al., 2001). More recently, an association differentiated thyroid cancer has profound implications between PTTG overexpression and decreased radio- for activity of the NIS gene, and hence significantly iodine uptake during follow-up has been reported (Saez impacts upon the efficacy of radioiodine treatment. et al., 2006). PTTG stimulates expression of basic Oncogene (2007) 26, 4344–4356; doi:10.1038/sj.onc.1210221; fibroblast growth factor (FGF-2) (Zhang et al., 1999b; published online 5 February 2007 Ishikawa et al., 2001) and vascular endothelial growth factor (VEGF) (McCabe et al., 2002), and has been Keywords: PTTG; PBF; NIS; thyroid cancer implicated in the pathogenesis of numerous neoplastic conditions (see McCabe, 2001; Yu and Melmed, 2001). PTTG is a multifunctional human securin, with a role in the control of mitosis (Zou et al., 1999; Yu et al., 2000; Zur and Brandeis, 2001), cell transformation (Pei and Introduction Melmed, 1997; Zhang et al., 1999b), DNA repair (Romero et al., 2001), gene regulation (Zhang et al., Thyroid cancer is the most common endocrine malig- 1999b; Pei, 2000; McCabe et al., 2002) and fetal nancy, and radioiodine (131I) is the primary adjunctive development (Boelaert et al., 2003b). PTTG overexpres- treatment for patients with differentiated thyroid cancer. sion has been reported in tumours of the thyroid (Heaney et al., 2001), pituitary (Zhang et al., 1999a; Correspondence: Dr CJ McCabe, Division of Medical Sciences, McCabe et al., 2003), colon (Heaney et al., 2000), ovary Institute for Biomedical Research, University of Birmingham, (Puri et al., 2001) and breast (Puri et al., 2001), as well as Birmingham, B15 2TH, UK. in haematopoietic neoplasms (Dominguez et al., 1998). E-mail: [email protected] In thyroid, pituitary, oesophageal and colorectal tu- 3These two authors contributed equally to this work. Received 13 June 2006; revised 16 October 2006; accepted 30 October mours, high PTTG expression correlates with poor 2006; published online 5 February 2007 prognosis (Zhang et al., 1999a; Heaney et al., 2000; PTTG, PBF and NIS K Boelaert et al 4345 Shibata et al., 2002; Boelaert et al., 2003a; McCabe previously reported in thyroid tumours. Our results et al., 2003). We and others have previously demon- show that PTTG and PBFinhibit NIS messenger RNA strated aberrant expression of FGF-2 and its receptor in (mRNA) expression and iodide uptake in vitro. Further, thyroid cancer (Eggo et al., 1995), and we have reported we have identified a critical promoter site at which a significant association between PTTG expression in PTTG and PBFmediate their repression of the NIS the primary thyroid tumour and recurrence of that gene in human and rat thyroid cells. We therefore tumour during early follow-up (Boelaert et al., 2003a). propose that the levels of expression of PTTG and PBF In addition, our studies revealed that FGF-2 over- in papillary and follicular thyroid tumours may directly expression in thyroid cancers was significantly asso- affect the treatment outcome following radioiodine ciated with lymph node invasion and distant metastasis therapy. at presentation (Boelaert et al., 2003a). The mechanism by which PTTG regulates FGF-2 was clarified through the isolation of PTTG-binding factor Results (PBF) (Chien and Pei, 2000). PBF is a 22-kDa protein, also known as c21orf3 (Yaspo et al., 1998), that exhibits NIS expression is reduced in thyroid cancer nuclear and cytoplasmic expression in a manner similar We assessed NIS mRNA and protein expression in our to PTTG. PBFpossesses a C-terminus nuclear localiza- cohort of normal and malignant thyroid samples. tion signal, ablation of which prevents PTTG regulation Details of patients with a diagnosis of thyroid cancer of FGF-2 (Chien and Pei, 2000). We characterized PBF are given in Table 1. NIS mRNA was significantly expression in thyroid tumours, and demonstrated it to reduced in thyroid cancers (47% reduction, n ¼ 27, be a transforming gene in vitro, and to be tumorigenic P ¼ 0.005) compared with normal thyroid (n ¼ 11). in vivo (Stratford et al., 2005). Further, NIS mRNA was lower in cancers displaying Given that PTTG and PBFare upregulated in thyroid recurrence early during follow-up (n ¼ 6) than in non- cancer (Boelaert et al., 2003a; Stratford et al., 2005; Saez recurrent cancers (n ¼ 18, P ¼ 0.02), as well as in node- et al., 2006) and stimulate FGF-2 expression (Zhang positive (n ¼ 9) compared with node-negative tumours et al., 1999b), which has been shown to repress iodide (n ¼ 15, P ¼ 0.03) (Figure 1a). Taking into account uptake (Cocks et al., 2003), and that PTTG is associated known prognostic indicators of age, gender, tumour with reduced iodide uptake in vivo (Saez et al., 2006), we size and tumour type, NIS expression was independently assessed whether PTTG and PBFmight have a direct associated with early recurrence (R2 ¼ 0.47, P ¼ 0.03) role in the repression of NIS expression and function and nodal involvement (R2 ¼ 0.67, Po0.001).

Table 1 Characteristics of patients with differentiated thyroid carcinoma Patient Age Sex Type T N M R FU

1 >40 Female Pap 2 0 0 0 61 2 o40 Male Pap 2 1a 0 1 52 3 o40 Female Pap 2 0 0 0 18 4 o40 Male Pap 3 1b 1 0 22 5 >40 Female Foll 4 0 0 1 27 6 >40 Female Pap 3 1a 0 0 34 7 >40 Male Pap 1 0 0 0 15 8 >40 Female Foll 3 0 0 0 48 9 >40 Female Foll 3 0 0 0 24 10 >40 Female Foll 3 0 0 0 29 11 >40 Female Pap x 1b 1 1 27 12 o40 Female Pap 3 1b 0 0 8 13 >40 Female Pap 1 0 0 0 64 14 o40 Female Pap 3 0 0 0 68 15 o40 Female Foll 2 0 0 1 56 16 >40 Male Pap 2 1b 1 1 63 17 >40 Male Pap 3 1b 0 0 58 18 o40 Female Pap 1 0 0 0 7 19 >40 Female Foll 2 0 0 0 6 20 >40 Female Pap 2 0 0 0 9 21 >40 Female Pap 1 0 0 1 28 22 o40 Male Pap 1 1b 1 0 12 23 >40 Female Foll 3 0 0 0 8 24 >40 Male Pap 3 1b 1 0 5

Abbreviations: foll, follicular; FU, follow-up; Pap, papillary. These details were available for 24 patients from the group of 27 cancer specimens studied. Demographic details (age, sex), carcinoma type (pap; foll), TNMa staging, recurrence status (R) and FU period in months are displayed for each patient aT:X primary tumour size cannot be assessed. (1), intrathyroidal tumour p1 cm in greatest dimension; (2), intrathyroidal tumour >1–4 cm in greatest dimension; (3), intrathyroidal tumour >4 cm in greatest dimension; (4), tumour of any size, extending beyond thyroid capsule. N0, no nodes involved; (1a), ipsilateral cervical nodes involved; (1b), bilateral, midline or contralateral cervical nodes or mediastinal nodes. M0, no distant metastases; (1), distant metastases.

Oncogene PTTG, PBF and NIS K Boelaert et al 4346 a 1.2 R2= 0.470 R2= 0.673 R2= 0.425 1 P = 0.034 P < 0.001 P = 0.079

0.8 * * **

0.6

0.4

Relative NIS expression 0.2

0 Normal --++ - +

Recurrence Nodes Metastases Number 11 18 6 15 9 19 5

Mean ∆CT ± SEM 9.8±0.2 10.6± 0.2 11.4± 0.3 10.5± 0.2 11.4± 0.3 10.5± 0.1 12.0± 0.2

b NIS 97 kDa β-Actin 45 kDa NT1 NT2 NT3 NT4 FC1 FC2 PC1 PC2

0.5 *

0.4

0.3

0.2

0.1

0 Relative protein expression Normal Tumor c Normal -ve Normal +ve Follicular Papillary

Figure 1 NIS mRNA and protein expression in normal and tumourous thyroids. (a) NIS mRNA expression in normal thyroid tissue (n ¼ 11) and in thyroid cancers (n ¼ 27) displaying presence and absence of early recurrence, nodal involvement at diagnosis and metastasis. In this and following histograms, gene expression is displayed relative to a value of 1.0 for control (normal thyroid). The number of samples used and the mean DCt7s.e.m. values obtained using quantitative RT–PCR for each group are given in the corresponding columns in the table underneath the graph. R2 and P-values given above each pair of histogram bars correspond to regression analyses taking into account known prognostic indicators. (b) Western blot analysis of NIS protein expression in four randomly selected normal thyroids, two follicular cancers (FC) and two papillary cancers (PC), with protein loading determined through b-actin expression. (c) Scanning densitometry of Western-blot analyses performed on four normal and four tumourous (two follicular, two papillary) thyroids, each repeated twice and corrected for b-actin expression. *Po0.05. (c) Immunohistochemical assessment of NIS protein at Â 40 magniﬁcation in a normal thyroid-negative control (no primary antibody), a normal thyroid with primary antibody, and in a representative follicular and papillary tumour. *Po0.05; **Po0.01.

Western blotting in a subset of samples confirmed PTTG and PBF downregulate NIS expression and our finding of reduced NIS mRNA expression in iodide uptake in vitro differentiated thyroid tumours compared with We and others have previously demonstrated that normal thyroid. Scanning densitometry (Figure 1b) thyroid cancers show increased expression of PTTG indicated that the reduction in NIS protein expression (Heaney et al., 2001; Boelaert et al., 2003a; Saez et al., was statistically significant (normal ¼ 0.3770.06, 2006), and we recently reported that PBFis also tumour ¼ 0.2170.02 scanning densitometry units; overexpressed in differentiated thyroid tumours com- Po0.05). Further, immunohistochemical assessment, pared with normal tissue (Stratford et al., 2005). In although not formally quantified, showed NIS protein addition, two reports have indicated that PTTG expression to be reduced in papillary and follicular represses NIS (Heaney et al., 2001) and that PTTG tumour samples compared with normal (Figure 1c). protein expression is negatively correlated with radio- Thus, in common with several previous reports (Liou iodine uptake in thyroid tumours (Saez et al., 2006). We et al., 2000; Arturi et al., 2001; Ringel et al., 2001), NIS therefore investigated whether PTTG and PBFcan expression is reduced in our samples of differentiated repress NIS expression and iodide uptake in primary thyroid cancer compared with normal thyroid tissue. thyroid cells in vitro.

Oncogene PTTG, PBF and NIS K Boelaert et al 4347 a 1.2

0.8

0.6

0.4 * NIS mRNA Expression ** 0.2 *** *** *** 0 VO PBF WT-PTTG SH3- PBF+PTTG

Number 6 6 15 6 6 Mean ∆CT ± SEM 11.1±0.6 15.3±0.6 14.0±0.6 13.5±0.4 15.6±0.5

b 4000 * 3500 * ** 3000 *** 2500

2000 *** *** 1500 ***

Iodide Uptake (cpm) 1000

500

0 VOPBF WT-PTTG SH3- PBF+PTTG

Figure 2 PTTG and PBFinhibition of NIS expression and activity in primary cultures of thyroid cells. ( a) NIS mRNA expression 48 h after transfection with WT PTTG and PBF, as well as with the SH3- mutant of PTTG, compared with only vector control (VO). (b) NIS protein activity in primary thyrocytes assessed through iodide uptake assays in 24-well plates, 48 h after transient transfection. Data have been adjusted for transfection efﬁciency, as assessed by b-gal staining.

Transient transfection of a full-length PBFcDNA in To assess whether PTTG and PBF’s inﬂuence on NIS primary human thyrocytes resulted in a 95% inhibition mRNA was associated with changes at the functional of NIS mRNA (n ¼ 6, Po0.001, compared with vector- level, NIS activity was assessed through measurement of only control (VO)) (Figure 2a). Similarly, when we 125I uptake in parallel experiments (Figure 2b). PTTG investigated PBF’s binding partner PTTG, PTTG over- and PBFboth repressed 125I uptake (PTTG – 59% expression also signiﬁcantly reduced NIS mRNA reduction vs VO, n ¼ 6, Po0.001; PBF– 68% reduction expression (86% reduction vs VO, n ¼ 15, Po0.001). vs VO, n ¼ 6, Po0.001). Co-transfection of PTTG and Co-transfection of PTTG and PBFresulted in an its interacting factor PBFresulted in a synergistic enhanced repression compared to PTTG alone (PBF/ inhibition of NIS activity compared with either gene PTTG: 96% inhibition, n ¼ 6, Po0.001 compared with alone (PTTG/PBF– 83% reduction compared with VO; P ¼ 0.05 PBF/PTTG compared with PTTG). A VO, n ¼ 6, Po0.001; 46% reduction compared with mutant of PTTG (SH3-), which is unable to transacti- PBF, Po0.05; 59% reduction compared with PTTG, vate FGF-2 (Boelaert et al., 2004), also repressed NIS Po0.05). In common with the mRNA data, SH3-PTTG mRNA, albeit to a slightly lower degree than wild type demonstrated a reduced ability to repress NIS compared (WT) (81% compared with VO, n ¼ 6, Po0.01) with WT PTTG (SH3 34% inhibition, WT 59% (Figure 2a). inhibition, n ¼ 6, Po0.01).

Oncogene PTTG, PBF and NIS K Boelaert et al 4348 a *** *** 60

10 FGF-2 Secretion (pg/ml) 0 VO PTTG PTTG + Ab

*** *** b 1000 *** *** 900 800 *** 700 600 P = NS 500 P = 0.06 400 300 Iodide Uptake (cpm) 200 100 0 Ig Ab Ig Ab Ig Ab Ig Ab

VO PBF P TTG PBF+PTTG

Figure 3 (a) Measurement of FGF-2 by ELISA in primary thyroid cultures. PTTG increased FGF-2 secretion in primary thyrocytes B1.4 fold after 48 h in the presence of control (Ig) treatment (n ¼ 8, Po0.001), and FGF-2 secretion was reduced to basal levels by the addition of an anti-FGF-2 antibody (Ab). (b) Iodide uptake assays. Addition of FGF-2 antibody to cells transiently transfected with VO increased basal iodide uptake (n ¼ 12, Po0.001). PBFoverexpression signiﬁcantly inhibited 125I uptake, but anti-FGF-2 antibody treatment did not alter this (n ¼ 12, P ¼ NS). Transfection of WT PTTG resulted in a reduction in 125I uptake, which could be signiﬁcantly abrogated by FGF-2 Ab treatment (n ¼ 12, Po0.001). Co-transfection of PTTG and PBFrepressed NIS activity, although this was only minimally affected by depletion of secreted FGF-2 (n ¼ 12, P ¼ 0.06; Po0.001 compared with VO).

PTTG, but not PBF, represses NIS via FGF-2 303721 c.p.m.; PBF þ Ab: 341738 c.p.m.; n ¼ 12, Given that PTTG and PBFboth repress NIS, and that P ¼ 0.42). In contrast, transfection of WT PTTG the SH3 mutant of PTTG was less effective than WT, we resulted in a reduction in 125I uptake, which was signi- investigated whether NIS repression is mediated via ficantly abrogated by FGF-2 Ab treatment (PTTG þ Ig: FGF-2 in thyroid cells. Enzyme-linked immunosorbent 306726 c.p.m.; PTTG þ Ab: 554741 c.p.m.; n ¼ 12, assay (ELISA) (Figure 3a) demonstrated that transfec- Po0.001). Co-transfection of PTTG and PBFresulted tion of PTTG increased FGF-2 secretion in primary in the strongest repression of NIS activity, which was thyrocytes roughly 1.4-fold after 48 h (immunoglo- minimally abrogated by depletion of secreted FGF-2 bulin (Ig) control ¼ 35.071.6 pg/ml secreted FGF-2, (PBF/PTTG þ Ig: 272720 c.p.m.; PBF/PTTG þ Ab: WT PTTG ¼ 49.272.4 pg/ml FGF-2, n ¼ 8, Po0.001), 341727 c.p.m.; n ¼ 12, P ¼ 0.06; Po0.001 compared and that this could be reduced to basal levels by the with VO). addition of an anti-FGF-2 antibody (Ab) (PTTG þ Taken together, these data suggest that PTTG Ab ¼ 33.771.3 pg/ml secreted FGF-2). Using this ap- repression of NIS is influenced by FGF-2 secretion in proach to disrupt FGF-2 signalling, we investigated the thyrocytes, whereas PBFdownregulation of NIS is not influence of PTTG and PBFon 125I uptake in primary affected by FGF-2 secretion. thyrocytes. Addition of FGF-2 antibody to cells transiently transfected with VO increased basal iodide uptake (Ig PTTG and PBF repression via the human NIS promoter control: 677722 c.p.m.; Ab: 882725 c.p.m., n ¼ 12, To examine repression of NIS via its promoter, we next Po0.001) (Figure 3b). Transient overexpression of performed a series of experiments in rat thyroid FRTL-5 PBFsignificantly inhibited 125I uptake, and addition of cells, which represent a homogeneous and well-charac- an anti-FGF-2 antibody failed to alter this (PBF þ Ig: terized thyroid line in which to study NIS promoter

Oncogene PTTG, PBF and NIS K Boelaert et al 4349 activity. We employed a number of pGL3-luc promoter To determine whether PTTG can repress the NIS constructs previously used in NIS studies (Figure 4a; promoter via the proximal 544 bp, or else via the Taki et al., 2002). These included 544 bp of the proximal upstream enhancer, we co-transfected reporter con- NIS promoter (basal-NIS), the human NIS upstream structs and PTTG into FRTL-5 cells and examined enhancer element (hNUE), and a fusion of the two luciferase activity. Compared to VO controls, PTTG (hNUE-basal NIS). The proximal 544 bp of the NIS was unable to repress the basal promoter, but signiﬁ- promoter contains the transcription initiation site and cantly reduced activity of the hNUE element (4577% has been shown to mediate basal NIS activity (Behr reduction, Po0.001, n ¼ 9; VO promoter activity taken et al., 1998; Ryu et al., 1998), whereas hNUE confers as 100% throughout) (Figure 4b). A reporter construct thyroid-speciﬁc and TSH-cAMP responsive transcrip- containing both elements was also repressed by PTTG tional activity (Schmitt et al., 2001; Taki et al., 2002). (1973% reduction, Po0.001, n ¼ 9).

a -375 +1 hNIS

ATG

SV40 Luc pGL3 SV40

hNIS (-812~-268) Luc basal-NIS

-9847~-8968 SV40 Luc hNUE-SV40

-9847~-8968 hNIS (-812~-268) Luc hNUE-basal NIS

b 1.2 VO PTTG 1 *** 0.8 *** 0.6

0.4

Relative Fold Activation 0.2

0 basal-NIS hNUE-SV40 hNUE-Basal NIS

VO c 1.2 PBF 1

*** 0.8 ***

0.6 *** 0.4

Relative Fold Activation 0.2

0 basal-NIS hNUE-SV40 hNUE-Basal NIS Figure 4 (a) pGL3 plasmid constructs used in the study of NIS regulation (not to scale). The transcription initiation site is at À375 within the 544 bp basal-NIS construct. hNUE-SV40 contained 1149 bp of the NIS promoter, between bases À9847 and À8968, within which lies the 296 bp hNUE, driven by SV40. hNUE-basal NIS comprised the basal 544 bp downstream of hNUE. The pGL3 SV40 construct was used as control. All plasmid constructs were as published previously (Taki et al., 2002). (b) VO and PTTG transfection of FRTL-5 cells co-transfected with basal-NIS, hNUE-SV40 and hNUE-basal NIS. Luciferase activity was corrected for Renilla expression, and was expressed relative to VO ( ¼ 1.0). ***Po0.001. (c) The inﬂuence of PBFoverexpression on NIS promoter activity, relative to VO. ***Po0.001.

Oncogene PTTG, PBF and NIS K Boelaert et al 4350 In separate experiments, we examined the influence of region of hNUE might confer PTTG’s transcriptional PBFon the same NIS elements. In contrast to PTTG, regulation of NIS. PBFsignificantly repressed both the basal promoter We created two mutants, one abrogating the USF1 (2874% repression, Po0.001, n ¼ 9) and hNUE consensus sequence, but retaining the PAX8 site (USF1 (5974%, Po0.001, n ¼ 9) compared to VO, and when mutant), and one removing the PAX8 consensus but both elements were combined, still elicited significant retaining USF1 (PAX8 mutant) (see Figure 5a). We then repression (2275%, Po0.001, n ¼ 9). performed initial experiments to examine the influence Taken together, these experiments show that PTTG of mutation on the basal activity of WT and mutated and PBFare able to repress specific regions of the hNUE. As expected, compared with empty vector human NIS promoter. (pGL3), the simian virus (SV)40 construct expressed significant luciferase activity (14.771.8-fold induction vs pGL3; Figure 5b), and addition of the hNUE The PAX8/USF1 site is critical to PTTG and PBF action sequence augmented this effect (44.873.5-fold vs Next, we examined the hNUE element in detail, pGL3, n ¼ 9, Po0.001; 3.070.4-fold vs pGL3-SV40, searching for standard promoter elements that might n ¼ 9, Po0.001). Although both mutants resulted in a help us understand in more detail how PTTG and PBF significant disruption of promoter activity compared to exert their effects on the human NIS promoter. Between hNUE-SV40, they retained greater activity than the bases À9286 and À9298 of hNUE lies a previously SV40 construct alone, that is, both mutants showed characterized PAX8 site, which has been reported to partial inactivation of the hNUE element (Figure 5b). mediate basal NIS expression (Taki et al., 2002). To determine whether PTTG and PBFwere still able Interestingly, Lin et al. (2004) previously noted that to repress the hNUE element in the face of disrupted a complexed upstream stimulating factor 1 (USF1) USF1 and PAX8 sites, we co-transfected FRTL-5 cells domain lies within the PAX8 consensus (Figure 5a), and with WT and mutated promoter constructs, as well as that this is conserved in rat, mouse and human NIS with VO, PTTG, SH3 PTTG and PBF. Again, WT genes. Three genes that show transcriptional regulation PTTG repressed promoter activity via hNUE (5175% by PTTG – FGF-2 (Zhang et al., 1999b), VEGF reduction, n ¼ 9, Po0.001) (Figure 5c). In contrast, the (McCabe et al., 2002) and ID3 (Kim et al., 2006) – also SH3 mutant lost the ability to repress at the hNUE site, harbour USF1 sites (unpublished observations), and and in fact yielded an augmentation of promoter activity USF1 has been shown to be critical to PTTG regulation (4875% increase, n ¼ 9, Po0.001). Interestingly, sub- of c-myc (Pei, 2001). Therefore, we considered that this stitution of two bases within the USF1 consensus

a -9847~-8968 SV40 Luc hNUE-SV40 c 2.5 VO 2 *** SH3- PTTG *** 1.5

GTCCACGTGGTTC PAX8 mutant 1 T_ _YGCGTGAR_ _ -9313 PAX8 consensus -9272 *** *** CCGGCTGTCAAGCAGTTCCACGTGAGTGCCCTGGGGGACTCC 0.5 Relative Fold Activation USF1 consensus _RYCAC 0 USF1 mutant TTCTGCGTGAGTG hNUE-SV40 USF1 Mutant PAX8 Mutant

80 ** * b 1.8 *** 70 d *** 1.6 VO 60 1.4 PBF 1.2 50 1 40 0.8 *** 30 0.6 0.4

20 Relative Fold Activation Relative Fold Activation 0.2 10 0 hNUE-SV40 USF1 Mutant PAX8 Mutant 0 pGL3 pGL3-SV40 hNUE-SV40 USF1 Mutant PAX8 Mutant Figure 5 (a) The location and sequence of the USF1 and PAX8 consensus sequences within the hNUE element. R ¼ A/G; Y ¼ C/T. Base substitutions in the USF1 and PAX8 mutants are arrowed and underlined. (b) Endogenous promoter activity of WT and mutated constructs, compared to the native pGL3 vector ( ¼ 1.0). The hNUE-SV40 construct demonstrated signiﬁcantly enhanced luciferase activity compared with pGL3-SV40, which was partially abrogated by the USF1 and PAX8 mutations. (c) The inﬂuence of the USF1 and PAX8 mutations on PTTG and SH3-mutant regulation of hNUE in FRTL-5 cells. (d) PBFinhibition of hNUE in comparison to VO-transfected FRTL-5 cells. *Po0.05; ***Po0.001.

Oncogene PTTG, PBF and NIS K Boelaert et al 4351 abrogated the ability of PTTG to inhibit NIS activity Taken together, these data suggest that PTTG and (VO ¼ 100%, PTTG ¼ 106725%, n ¼ 9, P ¼ NS). SH3 PBFrepress NIS mRNA expression and iodide uptake, data were consistent with those for WT hNUE-SV40. and that, in rat and human thyroid cells, the critical Disruption of PAX8 in the presence of WT USF1 failed region of the NIS promoter is the hNUE enhancer to significantly diminish PTTG’s ability to repress the element. hNUE-SV40 element (55710% repression, n ¼ 9, Po0.001). Again, the SH3 mutant was unable to repress the PAX8-mutated hNUE sequence, and showed Discussion no difference from VO control. In parallel experiments, we determined the influence NIS is an integral membrane glycoprotein which of the same mutations on PBFrepression of hNUE. mediates active iodide (IÀ) transport into thyroid cells, Again, PBFinhibited hNUE activity (50 74% repres- as the crucial first step in thyroid hormone biosynthesis sion, n ¼ 9, Po0.001; Figure 5d), and this was (see Boelaert and Franklyn, 2003; Dohan et al., 2003). abrogated by mutation of the USF1 site (VO ¼ 100%, The ability of the thyroid to accumulate iodide has USF1 ¼ 5712% inhibition, n ¼ 9, P ¼ NS). Of note, provided an effective means for therapeutic doses of deletion of the PAX8 site also prevented PBFrepres- radioiodine to target and destroy iodide-transporting sion of the hNUE element, and in fact resulted in differentiated thyroid cancers and their metastases. an upregulation of hNUE activity (VO ¼ 100%, However, most thyroid tumours exhibit reduced iodide PAX8 ¼ 155728%, n ¼ 9, Po0.05). uptake, although mRNA (Smanik et al., 1997; Lazar Overall, our data suggest that the USF1/PAX8 site et al., 1999; Ryu et al., 1999; Arturi et al., 2000; Park plays a critical role in mediating the repression of PTTG et al., 2000; Tanaka et al., 2000) and protein (Caillou and PBFon the human NIS promoter. PBFrequires et al., 1998; Jhiang et al., 1998; Saito et al., 1998; Castro integrity of both USF1 and PAX8, whereas PTTG et al., 1999) studies have demonstrated inconsistent signals via the USF1 site. findings regarding reduction of NIS expression in thyroid cancer per se. In our series of papillary and follicular tumours, NIS PTTG and PBF repression of NIS in human thyroid cells mRNA expression showed a mean reduction of Having examined NIS promoter regulation in rat approximately 50% compared with normal thyroid thyroid cells, we returned to primary human thyroid samples. We noted that, taking into account known cell cultures to investigate whether PTTG and PBF prognostic indicators of age, gender, tumour size and could repress the NIS promoter in human cells tumour type, low NIS mRNA expression was indepen- (Figure 6). Data were broadly in agreement with the dently associated with nodal involvement at diagnosis FRTL-5 findings, although PBF did not repress the and early recurrence. In addition, Western blotting and 7 basal promoter (VO ¼ 100%, PBF ¼ 102 13%, n ¼ 9, immunohistochemical analyses supported the mRNA P ¼ NS). However, hNUE, the critical response element findings of reduced NIS expression in thyroid tumours. for PTTG and PBFregulation of NIS, remained Our observation of reduced NIS mRNA expression in 7 strongly repressed by both genes (PTTG: 46 13% thyroid tumours (especially those demonstrating adverse 7 inhibition, n ¼ 9, P ¼ 0.004; PBF: 45 9% inhibition, behaviour) is consistent with reduced NIS function in n ¼ 9, Po0.001). follicular and papillary tumours. Several potential mechanisms for this have been proposed. Recently, PTTG has been shown to repress iodide uptake in rat thyroid cells (Heaney et al., 2001), and to inversely VO correlate with decreased radioiodine uptake during PTTG follow-up (Saez et al., 2006). We therefore investigated

1.4 PBF *** whether PTTG and its binding factor PBFwere able to ** repress the expression and function of the NIS gene 1.2 in vitro. 1 Both PTTG and PBFsigniﬁcantly downregulated 0.8 NIS mRNA expression and iodide uptake in primary 0.6 cultures of human thyroid cells. Furthermore, when co- transfected, a synergistic effect was apparent, in that 0.4 mutual repression was greater than with PBFor PTTG Relative Fold Activation 0.2 alone. The SH3 mutant of PTTG, which is unable to 0 upregulate FGF-2 (Boelaert et al., 2004), showed basal-NIS hNUE-SV40 enhanced iodide uptake compared with WT PTTG, Figure 6 Activity of the hNUE region of the NIS promoter in suggesting that PTTG repression of NIS activity is at human primary thyroid cells. Primary human thyroid cells were least partially dependent on FGF-2. This was conﬁrmed cultured and co-transfected with either pGL3-basic or hNUE-SV40 by depletion of FGF-2 in cell media using an anti-FGF- vectors, along with VO, PTTG or PBF. Data were adjusted for Renilla luciferase activity, and are expressed relative to VO ( ¼ 1.0). 2 antibody, which resulted in reduced NIS down- PTTG and PBFwere unable to repress the basal NIS promoter, regulation. An alternative pathway is also likely to but both inhibited hNUE activity. **Po0.01; ***Po0.001. exist, given that PBFalso inhibited NIS expression and

Oncogene PTTG, PBF and NIS K Boelaert et al 4352 activity, despite being unable to stimulate FGF-2 in the repression of NIS promoter activity and iodide expression (Stratford et al., 2005). To this end, we uptake. In a further set of investigations, we are now examined the transcriptional regulation of NIS at its investigating whether PTTG and PBFbind directly at promoter, in a discrete set of experiments in rat thyroid the hNUE site to mediate their effects, and whether this FRTL-5 cells. binding is prevented by subtle mutations of USF1 and Employing a series of constructs used in previous NIS PAX8. Our hypothesis, based on our current under- promoter studies (Taki et al., 2002), we examined the standing, is that PTTG and PBFrepress NIS by influence of PTTG and PBFon two critical regions. The interfering with the binding of the two transcriptional first encompassed 544 bp, the basal NIS promoter, regulators PAX8 and USF1 to the NIS promoter, and which contains the transcription initiation site, has been that PTTG and PBFshow different affinities of binding shown to mediate basal NIS activity (Behr et al., 1998; at the USF1/PAX8 consensus. However, the data Ryu et al., 1998). The second 1149-bp fragment included arising from the current investigation suggest that the the 296 bp hNUE, which confers thyroid-specific and USF1/PAX8 site of the hNUE confers alternative TSH-cAMP responsive transcriptional activity (Schmitt regulation of NIS expression by two genes not et al., 2001; Taki et al., 2002), and contains a PAX8 previously predicted to interact directly at this site. binding site and a CRE-like sequence. These separate An alternative element of the hNUE, which we did and critical regions of the human NIS promoter were not consider in the current investigation, is the CRE-like regulated in subtly different manners by PTTG and site between bases À9244 and À9250 of the human NIS PBF. gene, approximately 50 bp downstream of the PAX8 The basal NIS promoter was repressed by PBF, but consensus. This degenerate CRE motif has been not by PTTG. Both genes inhibited promoter activity reported along with the PAX8 site as being necessary most strongly via the hNUE element, however. To for full hNUE activity (Taki et al., 2002). The absence of narrow down the potential region of hNUE essential a putative CRE binding protein in human papillary for PTTG and PBFregulation, we focused upon a thyroid cancer cells was suggested to confer reduced NIS previously characterized PAX8 site, which has been promoter activity compared with normal thyroid cells, reported to mediate basal NIS expression (Taki et al., which expressed the as yet unidentified protein abun- 2002). Of note, the PAX8 consensus harbours an dantly (Taki et al., 2002). Subsequently, numerous internal and evolutionarily conserved USF1 site (Lin proteins have been demonstrated to bind at this site, et al., 2004). USF1 sites are present in the promoters of including both the Fos/Jun and CREB/ATF sub- FGF-2, VEGF and ID3 – genes all regulated by PTTG – families of b-ZIP transcription factors (Chun et al., and USF1 has been shown to be critical to PTTG 2004). These intriguing findings add an extra layer of regulation of c-myc (Pei, 2001). Therefore, we consi- complexity to the regulation of hNUE. dered the hypothesis that this region of hNUE is As our initial observations of PTTG and PBF necessary for PTTG’s transcriptional regulation of NIS. repression of NIS expression and function were in The basal activity of the hNUE element was reduced primary thyroid cells, we finally examined whether both by USF1 and PAX8 mutations, but retained hNUE was active in human cells. Both PTTG and activity above that of the control pGL3-SV40 vector. PBFwere able to significantly inhibit hNUE in a similar When we abrogated the USF1 site, but kept PAX8 manner to their action observed in FRTL-5 cells, intact, PTTG lost the ability to repress hNUE. PAX8 confirming that in human thyroid cells, hNUE is deletion failed to influence PTTG’s action. Conversely, targeted by these two genes, which show upregulation PBFrequired integrity of both the USF1and PAX8 in differentiated thyroid cancer (Heaney et al., 2001; consensus sequences in order to inhibit hNUE activity. Boelaert et al., 2003a; Stratford et al., 2005; Saez et al., The use of the SH3 mutant of PTTG provided 2006). intriguing data. SH3-PTTG was able to repress NIS The clinical relevance of PTTG and PBFrepression mRNA expression and iodide uptake, although to a of NIS activity relates to their likely influence upon lesser degree than WT PTTG. When we examined its the efficacy of 131I therapy. The ability of the thyroid influence on WT and mutated hNUE constructs, it was to accumulate IÀ provides the basis for radioiodine apparent that abrogation of the SH3-binding domain ablation of iodide-transporting differentiated thyroid rendered PTTG unable to repress at hNUE. As SH3- cancers and their metastases. Taken together, we retains the ability to regulate NIS mRNA expression propose that by downregulating NIS, particularly at (Figure 2a), it is likely that its effect is mediated via NIS the USF1/PAX8 consensus of hNUE, increased PTTG promoter region(s) other than the relatively small hNUE and PBFfundamentally influence the prognosis of element examined here. Interestingly, the SH3-PTTG differentiated thyroid cancers, at least in part by actually induced promoter activity of the native hNUE affecting their sensitivity to ablative 131I therapy. construct and the USF-1 mutant. We hypothesize that this reflects interference with the endogenous repression of NIS mediated by WT PTTG expression in FRTL5 Materials and methods cells, although this would need to be tested in different experimental systems. Thyroid samples and thyroid cell culture Overall, the findings of the current work shed light on Collection of thyroid samples was in accord with approval of the differential mechanisms of action of PTTG and PBF the Local Research Ethics Committee, and subjects gave

Oncogene PTTG, PBF and NIS K Boelaert et al 4353 informed written consent. None of the patients had been on 1 mg of total RNA, 30 pmol random hexamer primers, 4 mlof radioiodine treatment. Findings from 27 tumour specimens Â 5 AMV reverse transcriptase buffer, 2 ml of deoxynucleotide were compared with those from 11 samples of histologically triphosphate (dNTP) mix (200 mM each), 20 U of ribonuclease normal thyroid tissue obtained from patients undergoing inhibitor (Rnasin, Promega) and 15 U of AMV reverse laryngectomy for laryngeal cancer; no normal thyroid speci- transcriptase (Promega). men had any histological evidence of tumour invasion or small occult primary thyroid tumours. Tissues were immediately Quantitative PCR 1 snap frozen and stored at À80 C. Expression of specific messenger RNAs was determined using Patients’ demographic details and thyroid function pre- and the ABI PRISM 7700 Sequence Detection System. RT–PCR postoperatively were recorded. The tumour node metastasis was carried out in 25 ml volumes on a 96-well plates, in a (TNM) staging of tumours at presentation, as well as early reaction buffer containing Â 1 TaqMan Universal PCR recurrence of the cancer during follow-up, were recorded. Master Mix, 175 nmol TaqMan probe and 900 nmol primers, Recurrence was defined as evidence on imaging for recurrent as we have described previously (McCabe et al., 2002; Boelaert disease in the thyroid bed or elsewhere or rising serum et al., 2003b; Kim et al., 2005, 2006). All reactions were thyroglobulin in association with TSH suppression on multiplexed with a pre-optimized control probe for 18S thyroxine (T4) therapy. Subsequently, tumour recurrence was ribosomal RNA (PE Biosystems, Warrington, UK). NIS confirmed histologically in four out of six cases, and in the primer and probe sequences were: forward primer: CCCCAG remaining two, by demonstrating regression of lesions on CTCAGGAATGGA; reverse primer: CGTAATAGAGATA imaging and falling thyroglobulin after ablative radioiodine GGAGATGGCATAGAA; probe: CCAGCCGGCCCGCCT therapy. TAGC. Human thyroid follicular cells were prepared from surgical Before the determination of NIS mRNA expression through specimens as described previously (Eggo et al., 1996; Ramsden TaqMan RT–PCR, validation experiments were carried out et al., 2001). In brief, thyroid tissue was digested using 0.2% across a range of starting mRNA quantities (1–100 ng) to collagenase. Follicles were plated in medium described by determine the linearity and efficiency of amplification, and Ambesi-Impiombato et al. (1980), supplemented with TSH 5 to assess the independence of 18S rRNA and NIS amplifica- (300 mU/l), insulin (100 mg/l), penicillin (10 U/l), streptomycin tion. Linear amplification was confirmed across the range of (100 mg/l) and 2% newborn bovine calf serum. After 72 h, starting mRNA concentrations, and the gradients of NIS and serum was omitted, and experiments were performed following 18S rRNA differed by less than 0.1, confirming their effective 8–11 days of culture. FRTL-5 cells were grown in identical independence. As per the manufacturer’s guidelines, data were medium to primary thyroid cells, except with 5% fetal bovine expressed as cycle threshold (C ) values, and used to determine serum. t DCt values (DCt ¼ Ct of the target gene (NIS) minus Ct of 18S rRNA). To exclude potential bias owing to averaging data Transient transfection and plasmids which had been transformed through the equation 2ÀDDCt to Before transfection experiments, cells were washed in phos- give fold changes in gene expression, all statistics were phate-buffered saline (PBS) (FRTL5s) or Hanks’balanced performed with DCt values, as we have described previously saline solution (HBSS) (for primary cultures). Cells were (Boelaert et al., 2003b; Kim et al., 2005). The target gene probe transfected in a 12- or 24-well plates using Fugene 6 reagent was labelled with FAM, and the 18S rRNA probe with VIC. (Roche, Indianapolis, IN, USA), as per the manufacturer’s Reactions were as follows: 501C for 2 min, 951C for 10 min; instructions. WT and mutated PTTG and PBFplasmids were then 40 cycles of 951C for 15 s and 601C for 1 min. as described previously (Boelaert et al., 2004; Stratford et al., 2005). For luciferase assays of NIS promoter activity, Western blotting constructs were as described previously (Taki et al., 2002). Whole cell protein extracts were prepared from thyroid tissues The QuickChange Site-Directed Mutagenesis Kit (Stratagene, in lysis buffer (100 mM sodium chloride, 0.1% Triton X-100 Cambridge, UK) was used to disrupt the putative USF1 and and 50 mM Tris (pH 8.3)) containing enzyme inhibitors. PAX8 sites of the human NIS promoter hNUE element. Protein concentration before loading was measured by the Primers used were: USF1 – GCTGTCAAGCAGTTCTGCGT Bradford assay with bovine serum albumin as standard. GAGTGCCCTGG; PAX8 – GGCTGTCAAGCAGGTCCA Western blot analyses were performed as we have described CGTGGTTCCCCTGGGGG. Underlined bases represent the previously (McCabe et al., 2002; Boelaert et al., 2003a). actual nucleotide substitutions. Following transfection, cells Briefly, soluble proteins (30 mg) were separated by elec- were harvested in 0.5 ml tri reagent 48 h later, or in 250 mlof trophoresis in 12.5% sodium dodedecyl sulphate (SDS) passive lysis buffer for luciferase assays. Control transfections polyacrylamide gels, transferred to polyvinylidene fluoride utilized equal amounts of blank plasmid. Transfection membranes, incubated in 5% non-fat milk in PBS with 0.1% efficiency in primary thyrocytes was determined through Tween, and followed by incubation with a rabbit polyclonal b-Gal staining, and ranged from 45 to 95%. In FRTL-5 NIS antibody (1:1500), kindly provided by Dr Nancy Carrasco experiments, transfection efficiency was gauged through (Albert Einstein College of Medicine, New York, USA). For Renilla expression. In either case, fold changes were adjusted scanning densitometric analysis, four tumours (two papillary in each experiment to reflect individual transfection efficien- and two follicular) and four normal thyroid samples were cies. chosen at random, and run twice against b-actin expression (monoclonal anti-b-actin clone AC-15, used at 1:10 000; RNA extraction and reverse transcription Sigma–Aldrich, Poole, UK). Subsequently, data were normal- Total RNA was extracted from primary thyroid cell cultures ized to b-actin expression. utilizing the Sigma Trisol kit – a single step acid guanidinium phenol–chloroform extraction procedure – following manu- NIS immunohistochemistry facturer’s guidelines. RNA was reverse transcribed using avian Formalin-fixed paraffin-embedded sections of representative myeloblastosis virus (AMV) reverse transcriptase (Promega, normal and tumourous thyroid were immunostained using an Madison, WI, USA) in a total reaction volume of 20 ml, with avidin–biotin peroxidase technique (Vectastain Elite, Vector

Oncogene PTTG, PBF and NIS K Boelaert et al 4354 Laboratories, Peterborough, UK). All reagents were prepared medium was then centrifuged at 12 000 g for 15 min at 41C. as per the kit instructions. Briefly, after dewaxing and FGF-2 concentration was assayed in 200 ml of the supernatant rehydration the sections were processed in 1 mg/ml hyalu- using the bFGF ELISA assay (Quantikine HS Human FGF ronidase in 0.1 mol/l sodium citrate buffer (pH 5.5) for 30 s for Basic Immunoassay Kit, R and D Systems Inc., Abingdon, antigen retrieval. Slides were then rinsed in washing buffer Oxon, UK) as described previously (Ishikawa et al., 2001). All (TBS/0.3% Tween 20) and incubated with 0.03% hydrogen treatments (VO or PTTG transfection þ either Ig or FGF-2- peroxide in TBS (pH 7.4) to block endogenous peroxidase blocking antibody) were performed in quadruplicate on two activity. After washing in 0.02 M Tris/0.15 M NaCl (pH 7.4; different occasions. TBS), the slides were overlain with 5% washing buffer for 30 min at room temperature, before incubation with a specific mouse monoclonal antibody to human NIS (1:1000; kindly Luciferase assays provided by Dr J Morris, Mayo Clinic, Rochester, USA). For FRTL-5 cells or primary thyrocytes were transfected with a negative controls the primary antibody was replaced by non- total of 1 mg of DNA per well of a 12-well plate, comprising immune serum. After three 5 min washes in TBS, the sections 0.45 mg promoter construct, 0.05 mg phRL Renilla (Promega, were incubated with biotinylated secondary antibody for Poole, UK) and 0.5 mg of VO, PTTG or PBFcDNAs. Forty- 30 min, followed, after further TBS washes, by addition of eight hours post-transfection, cells were washed in PBS, the avidin–biotin peroxidase complex. The reaction was harvested in 250 ml Â 1 passive lysis buffer (Promega), and developed by incubation in NovaRed (Vector Laboratories, subjected to one freeze-thaw cycle at À801C. Subsequently, the Peterborough, UK) for 5–10 min. Sections were lightly dual-luciferase reporter assay system (Promega) was used as counterstained with Mayers Haematoxylin, dehydrated, per the manufacturer’s instructions. To compare hNUE cleared and mounted in synthetic resin. activity in the presence and absence of PTTG and PBF, parallel experiments employed a pGL3-SV40 control con- Iodide uptake assays struct, with specific hNUE activity calculated by subtraction of Primary thyrocytes were grown on 2 cm2 culture wells in 0.5 ml the mean constitutive SV40 component. Data were expressed medium at equal density. Thyroid cell function was assayed by as a ratio of Renilla luciferase activity, which was used to addition of NaI (final concentration 10À7 mol/l) and 0.05 mCi control for transfection efficiency. 125I (Amersham International, Amersham, UK) per well for 2 h as we have described previously (Eggo et al., 1996). The cell layer was rapidly washed with HBSS to remove unincorpo- Statistical analyses rated iodide and the cells lysed in 1% SDS. Incorporated Data were analysed using SigmaStat and SPSS Version 11.5. radioactivity was counted in a gamma counter. Student’s t-test and the Mann–Whitney U-test were used for comparison between two groups of parametric and non- FGF-2-blocking studies parametric data respectively. Analysis of variance and PTTG has been shown to induce both the expression and Kruskal–Wallis tests were used for between-group compari- secretion of FGF-2 and previous attempts by ourselves and sons of multiple groups of parametric and non-parametric others have been successful in depleting secreted FGF-2 by the data respectively. Significance was taken as Po0.05. addition of an anti-FGF-2 blocking antibody (Ishikawa et al., 2001; McCabe et al., 2002). Either azide-free anti-FGF-2 antibody (Santa-Cruz Biotechnology, Santa Cruz, USA) or an Acknowledgements equal dose (200 ng/ml culture medium) of rabbit immunoglo- bulins (Ig, Sigma Aldrich, UK) used as a control, was added This work was supported by the Wellcome Trust, the Medical immediately following transfection with plasmids containing Research Council (UK), the Endowment Fund of the Former VO, PTTG or PBF. Primary thyrocytes were then grown for United Birmingham Hospitals and the Marjorie Robinson 48 h before ELISA or 125I assays. Fund. We thank Dr John Morris (Mayo Clinic, Rochester, USA) and Dr Nancy Carrasco (Albert Einstein College of bFGF ELISA Medicine, New York, USA) for the provision of NIS Conditioned medium from primary thyrocytes was harvested antibodies, and we acknowledge Roger Holder, Department 48 h following transfection with VO and WT PTTG. The of Statistics, University of Birmingham, for statistical advice.

References

Ambesi-Impiombato FS, Parks LA, Coon HG. (1980). Culture Boelaert K, Franklyn JA. (2003). Sodium iodide symporter: a of hormone-dependent functional epithelial cells from rat novel strategy to target breast, prostate, and other cancers? thyroids. Proc Natl Acad Sci USA 77: 3455–3459. Lancet 361: 796–797. Arturi F, Russo D, Bidart JM, Scarpelli D, Schlumberger M, Boelaert K, McCabe CJ, Tannahill LA, Gittoes NJ, Filetti S. (2001). Expression pattern of the pendrin and Holder RL, Watkinson JC et al. (2003a). Pituitary sodium/iodide symporter genes in human thyroid carcinoma tumor transforming gene and ﬁbroblast growth cell lines and human thyroid tumors. Eur J Endocrinol 145: factor-2 expression: potential prognostic indicators in dif- 129–135. ferentiated thyroid cancer. J Clin Endocrinol Metab 88: Arturi F, Russo D, Giuffrida D, Schlumberger M, Filetti S. 2341–2347. (2000). Sodium-iodide symporter (NIS) gene expression in Boelaert K, Tannahill LA, Bulmer JN, Kachilele S, Chan SY, lymph-node metastases of papillary thyroid carcinomas. Eur Gittoes NJL et al. (2003b). A potential role for PTTG/ J Endocrinol 143: 623–627. securin in the developing human fetal brain. FASEB J 17: Behr M, Schmitt TL, Espinoza CR, Loos U. (1998). Cloning 1631–1639. of a functional promoter of the human sodium/iodide- Boelaert K, Yu R, Tannahill LA, Stratford AL, Khanim FL, symporter gene. Biochem J 331(Pt 2): 359–363. Eggo MC et al. (2004). PTTG’s C-terminal PXXP motifs

Oncogene PTTG, PBF and NIS K Boelaert et al 4355 modulate critical cellular processes in vitro. J Mol Endocrinol (PTTG) induces genetic instability in thyroid cells. Oncogene 33: 663–677. 24: 4861–4866. Caillou B, Troalen F, Baudin E, Talbot M, Filetti S, Kogai T, Endo T, Saito T, Miyazaki A, Kawaguchi A, Onaya T. Schlumberger M et al. (1998). Na+/I- symporter distribu- (1997). Regulation by thyroid-stimulating hormone of sodium/ tion in human thyroid tissues: an immunohistochemical iodide symporter gene expression and protein levels in study. J Clin Endocrinol Metab 83: 4102–4106. FRTL-5 cells. Endocrinology 138: 2227–2232. Castro MR, Bergert ER, Beito TG, Roche PC, Ziesmer SC, Kogai T, Schultz JJ, Johnson LS, Huang M, Brent GA. (2000). Jhiang SM et al. (1999). Monoclonal antibodies against the Retinoic acid induces sodium/iodide symporter gene expres- human sodium iodide symporter: utility for immunocyto- sion and radioiodide uptake in the MCF-7 breast cancer cell chemistry of thyroid cancer. J Endocrinol 163: 495–504. line. Proc Natl Acad Sci USA 97: 8519–8524. Chien W, Pei L. (2000). A novel binding factor facilitates Lazar V, Bidart JM, Caillou B, Mahe C, Lacroix L, Filetti S nuclear translocation and transcriptional activation function et al. (1999). Expression of the Na+/I- symporter gene in of the pituitary tumor-transforming gene product. J Biol human thyroid tumors: a comparison study with Chem 275: 19422–19427. other thyroid-specific genes. J Clin Endocrinol Metab 84: Chun JT, Di DV, D’Andrea B, Zannini M, Di Lauro R. 3228–3234. (2004). The CRE-like element inside the 50-upstream region Lin X, Ryu KY, Jhiang SM. (2004). Cloning of the 50-flanking of the rat sodium/iodide symporter gene interacts with region of mouse sodium/iodide symporter and identification diverse classes of b-Zip molecules that regulate transcrip- of a thyroid-specific and TSH-responsive enhancer. Thyroid tional activities through strong synergy with Pax-8. Mol 14: 19–27. Endocrinol 18: 2817–2829. Liou MJ, Lin JD, Chan EC, Liu FH, Chao TC, Weng HF. Cocks HC, Thompson S, Turner FE, Logan A, Franklyn JA, (2000). Detection of mRNA of sodium iodide symporter in Watkinson JC et al. (2003). Role and regulation of the benign and malignant human thyroid tissues. Cancer Lett fibroblast growth factor axis in human thyroid follicular 160: 75–80. cells. Am J Physiol Endocrinol Metab 285: E460–E469. McCabe CJ, Boelaert K, Tannahill LA, Heaney AP, Stratford AL, Dai G, Levy O, Carrasco N. (1996). Cloning and characteri- Khaira JS et al. (2002). Vascular endothelial growth zation of the thyroid iodide transporter. Nature 379: factor (VEGF), its receptor KDR and pituitary tumor 458–460. transforming gene in pituitary tumors. J Clin Endocrinol Dohan O, De LV, Paroder V, Riedel C, Artani M, Reed M Metab 87: 4238–4244. et al. (2003). The sodium/iodide symporter (NIS): character- McCabe CJ, Khaira JS, Boelaert K, Heaney AP, Tannahill LA, ization, regulation, and medical significance. Endocr Rev 24: Hussain S et al. (2003). Expression of pituitary tumour 48–77. transforming gene (PTTG) and fibroblast growth factor-2 Dominguez A, Ramos-Morales F, Romero F, Rios RM, (FGF-2) in human pituitary adenomas: relationships to Dreyfus F, Tortolero M et al. (1998). hPTTG, a human clinical tumour behaviour. Clin Endocrinol (Oxford) 58: homologue of rat PTTG, is overexpressed in hematopoietic 141–150. neoplasms. Evidence for a transcriptional activation func- McCabe CJ. (2001). Genetic targets for the treatment of tion of hPTTG. Oncogene 17: 2187–2193. pituitary adenomas – focus on the pituitary tumor trans- Eggo MC, Hopkins JM, Franklyn JA, Johnson GD, forming gene. Curr Opinion Pharmacol 1: 620–625. Sanders DS, Sheppard MC. (1995). Expression of fibroblast Park HJ, Kim JY, Park KY, Gong G, Hong SJ, Ahn IM. growth factors in thyroid cancer. J Clin Endocrinol Metab (2000). Expressions of human sodium iodide symporter 80: 1006–1011. mRNA in primary and metastatic papillary thyroid carci- Eggo MC, King WJ, Black EG, Sheppard MC. (1996). nomas. Thyroid 10: 211–217. Functional human thyroid cells and their insulin-like growth Pei L, Melmed S. (1997). Isolation and characterization of a factor- binding proteins: regulation by thyrotropin, cyclic pituitary tumor-transforming gene (PTTG). Mol Endocrinol 30,50 adenosine monophosphate, and growth factors. J Clin 11: 433–441. Endocrinol Metab 81: 3056–3062. Pei L. (2000). Activation of mitogen-activated protein kinase Heaney AP, Nelson V, Fernando M, Horwitz G. (2001). cascade regulates pituitary tumor-transforming gene trans- Transforming events in thyroid tumorigenesis and their activation function. J Biol Chem 275: 31191–31198. association with follicular lesions. J Clin Endocrinol Metab Pei L. (2001). Identification of c-myc as a down-stream target 86: 5025–5032. for pituitary tumor-transforming gene. J Biol Chem 276: Heaney AP, Singson R, McCabe CJ, Nelson V, Nakashima M, 8484–8491. Melmed S. (2000). Expression of pituitary-tumour trans- Puri R, Tousson A, Chen L, Kakar SS. (2001). Molecular forming gene in colorectal tumours. Lancet 355: 716–719. cloning of pituitary tumor transforming gene 1 from ovarian Ishikawa H, Heaney AP, Yu R, Horwitz GA, Melmed S. tumors and its expression in tumors. Cancer Lett 163: 131–139. (2001). Human pituitary tumor-transforming gene induces Ramsden JD, Cocks HC, Shams M, Nijjar S, Watkinson JC, angiogenesis. J Clin Endocrinol Metab 86: 867–874. Sheppard MC et al. (2001). Tie-2 is expressed on thyroid Jhiang SM, Cho JY, Ryu KY, DeYoung BR, Smanik PA, follicular cells, is increased in goiter, and is regulated by McGaughy VR et al. (1998). An immunohistochemical study thyrotropin through cyclic adenosine 30,50-monophosphate. of Na+/I- symporter in human thyroid tissues and salivary J Clin Endocrinol Metab 86: 2709–2716. gland tissues. Endocrinology 139: 4416–4419. Ringel MD, Anderson J, Souza SL, Burch HB, Tambascia M, Kim DS, Franklyn JA, Boelaert K, Eggo MC, Watkinson JC, Shriver CD, Tuttle Reuben Maitland. (2001). Expression McCabe CJ. (2006). Pituitary tumor transforming gene of the sodium iodide symporter and thyroglobulin genes are (PTTG) stimulates thyroid cell proliferation via a vascular reduced in papillary thyroid cancer. Mod Pathol 14: 289–296. endothelial growth factor/kinase insert domain receptor/ Romero F, Multon MC, Ramos-Morales F, Dominguez A, inhibitor of DNA binding-3 autocrine pathway. J Clin Bernal JA, Pintor-Toro JA et al. (2001). Human securin, Endocrinol Metab 91: 4603–4611. hPTTG, is associated with Ku heterodimer, the regulatory Kim DS, Pemberton H, Stratford AL, Buelaert K, Watkinson JC, subunit of the DNA-dependent protein kinase. Nucleic Acids Lopes V et al. (2005). Pituitary tumour transforming gene Res 29: 1300–1307.

Oncogene PTTG, PBF and NIS K Boelaert et al 4356 Ryu KY, Senokozlieff ME, Smanik PA, Wong MG, Siperstein Taki K, Kogai T, Kanamoto Y, Hershman JM, Brent GA. AE, Duh QY et al. (1999). Development of reverse (2002). A thyroid-specific far-upstream enhancer in the transcription-competitive polymerase chain reaction method human sodium/iodide symporter gene requires Pax-8 bind- to quantitate the expression levels of human sodium iodide ing and cyclic adenosine 30,50-monophosphate response symporter. Thyroid 9: 405–409. element-like sequence binding proteins for full activity and Ryu KY, Tong Q, Jhiang SM. (1998). Promoter characteriza- is differentially regulated in normal and thyroid cancer cells. tion of the human Na+/I- symporter. J Clin Endocrinol Mol Endocrinol 16: 2266–2282. Metab 83: 3247–3251. Tanaka K, Otsuki T, Sonoo H, Yamamoto Y, Udagawa K, Saez C, Martinez-Brocca MA, Castilla C, Soto A, Navarro E, Kunisue H et al. (2000). Semi-quantitative comparison of Tortolero M et al. (2006). Prognostic significance of hPTTG the differentiation markers and sodium iodide symporter immunohistochemical expression in differentiated thyroid messenger ribonucleic acids in papillary thyroid carcinomas cancer. J Clin Endocrinol Metab 91: 1404–1409. using RT–PCR. Eur J Endocrinol 142: 340–346. Saito T, Endo T, Kawaguchi A, Ikeda M, Katoh R, Kawaoi A Yaspo ML, Aaltonen J, Horelli-Kuitunen N, Peltonen L, et al. (1998). Increased expression of the sodium/iodide Lehrach H. (1998). Cloning of a novel human putative type symporter in papillary thyroid carcinomas. J Clin Invest 101: Ia integral membrane protein mapping to 21q22.3. Genomics 1296–1300. 49: 133–136. Schmitt TL, Espinoza CR, Loos U. (2001). Transcriptional Yu R, Melmed S. (2001). Oncogene activation in pituitary regulation of the human sodium/iodide symporter gene by tumors. Brain Pathol 11: 328–341. Pax8 and TTF-1. Exp Clin Endocrinol Diabetes 109: 27–31. Yu R, Ren SG, Horwitz GA, Wang Z, Melmed S. (2000). Shibata Y, Haruki N, Kuwabara Y, Nishiwaki T, Kato J, Pituitary tumor transforming gene (PTTG) regulates pla- Shinoda N et al. (2002). Expression of PTTG (pituitary cental JEG-3 cell division and survival: evidence from live tumor transforming gene) in esophageal cancer. Jpn J Clin cell imaging. Mol Endocrinol 14: 1137–1146. Oncol 32: 233–237. Zhang X, Horwitz GA, Heaney AP, Nakashima M, Prezant TR, Smanik PA, Liu Q, Furminger TL, Ryu K, Xing S, Mazzaferri Bronstein MD et al. (1999a). Pituitary tumor trans- EL et al. (1996). Cloning of the human sodium lodide forming gene (PTTG) expression in pituitary adenomas. symporter. Biochem Biophys Res Commun 226: 339–345. J Clin Endocrinol Metab 84: 761–767. Smanik PA, Ryu KY, Theil KS, Mazzaferri EL, Jhiang SM. Zhang X, Horwitz GA, Prezant TR, Valentini A, Nakashima M, (1997). Expression, exon-intron organization, and chromo- Bronstein MD et al. (1999b). Structure, expression, and some mapping of the human sodium iodide symporter. function of human pituitary tumor-transforming gene Endocrinology 138: 3555–3558. (PTTG). Mol Endocrinol 13: 156–166. Spitzweg C, Joba W, Morris JC, Heufelder AE. (1999). Zou H, McGarry TJ, Bernal T, Kirschner MW. (1999). Regulation of sodium iodide symporter gene expression in Identification of a vertebrate sister-chromatid separation FRTL-5 rat thyroid cells. Thyroid 9: 821–830. inhibitor involved in transformation and tumorigenesis. Stratford AL, Boelaert K, Tannahill LA, Kim DS, Warfield A, Science 285: 418–422. Eggo MC et al. (2005). Pituitary tumor transforming gene Zur A, Brandeis M. (2001). Securin degradation is mediated by binding factor: a novel transforming gene in thyroid fzy and fzr, and is required for complete chromatid tumorigenesis. J Clin Endocrinol Metab 90: 4341–4349. separation but not for cytokinesis. EMBO J 20: 792–801.

Oncogene