UCP2 Is a Mitochondrial Transporter with an Unusual Very Short Half-Life

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

FEBS Letters 581 (2007) 479–482

UCP2 is a mitochondrial transporter with an unusual very short half-life

Sophie Rousseta,1, Julien Mozoa,1,2, Genevie`ve Dujardinb, Yalin Emrea, Sandrine Masscheleyna, Daniel Ricquiera, Anne-Marie Cassard-Doulciera,* a CNRS-UPR 9078; Universite´ Paris Descartes, Faculte´ de Me´decine, site Necker, 75730 Paris Cedex 15, France b CNRS-UPR 2167, Avenue de la Terrasse, Baˆt. 26, 91198 Gif-Sur-Yvette Cedex, France

Received 23 October 2006; revised 16 December 2006; accepted 8 January 2007

Available online 16 January 2007

Edited by Berend Wieringa

UCP2 protein level also changes during the oestrus cycle in Abstract This study focused on the stability of UCP2 (uncoupling protein 2), a mitochondrial carrier located in the inner ovary and uterus [12] or during kainic acid-induced seizure membrane of mitochondrion. UCP2 is very unstable, with a in neurons [13]. Taken together, these data suggest the exis- half-life close to 30 min, compared to 30 h for its homologue tence of protein regulation, allowing a rapid decrease in UCP1, a difference that may highlight different physiological UCP2 expression, while translational regulation accounts for functions. Heat production by UCP1 in brown adipocytes is gen- the rapid increase in UCP2 expression. These results suggested erally a long and adaptive phenomenon, whereas control of mito- that UCP2 is very less stable than its homologue UCP1 since chondrial ROS by UCP2 needs more subtle regulation. We show Puigserver et al. described that the half-life of UCP1 was very that a mutation in UCP2 shown to modify its activity, actually long from 20 to 30 h [14]. We show here that the half-life of decreases its stability. UCP2 is short, approximately 30 min, compared with about Ó 2007 Federation of European Biochemical Societies. Published 30 h for UCP1 [14]. We also investigated the effect on UCP2 by Elsevier B.V. All rights reserved. half-life of three polymorphic sites in the translated region Keywords: UCP; Mitochondria; Polymorphism; Proteolysis [15,16], and of the dominant negative D212N mutation [17].

2. Materials and methods

2.1. Plasmids and mutagenesis 1. Introduction A pYeDP plasmid containing human UCP2 was used [18]. Muta- genesis was done using the QuikChange multisite-directed mutagenesis The uncoupling proteins (UCPs) belong to the family of kit (Stratagen). All clones were sequenced to confirm the targeted mutations. Oligonucleotide sequences were as follows: mitochondrial carriers located in the inner membrane. UCP1 C/T 164:: A55V 50 GTGCGCGCTACAGTCAGCGCCCAGTACCGC is specifically expressed in brown adipocytes, and acts as a pro- G/A 253:: G85S 50 GGTTGCCAGCCTGCAGCGCCAAATGAGCTT ton carrier in uncoupling oxidative phosphorylation [1,2], G/A 634:: D212N 50 AAAGCCAACCTCATGACAAATGACCTCCCT thereby ensuring the non-shivering thermogenesis of brown G/A 694:: A232T 50 ACCACTGTCATCACCTCCCCTGTAGACGTG adipose tissue [3,4]. UCP1 and its first homologue, UCP2 [5], share 59% homol- 2.2. Yeast culture, electroporation and half-life analysis The W303 strain was transformed by electroporation as described ogy, but in many respects. First, UCP1 is involved in non-shiv- previously [19], with pYeDP plasmid containing UCP1, UCP2 or each ering thermogenesis, whereas UCP2 plays no role in of the mutated UCP2 clones. After 3–4 days of growth on a selected thermogenesis [6]. Second, whereas UCP1 is specifically ex- medium at 30 °C, colonies were seeded in a minimum medium without pressed in brown adipose tissue, UCP2 is expressed in many uracil until OD = 0.5. Galactose (0.1%) was added for 2 h in the ab- tissues, such as spleen, lung, intestine, pancreatic b cells, and sence of glucose to induce the UCP promoter. Galactose was removed, and a sample was taken for the first point of the time course. Cyclohex- immune cells [7–9]. Third, UCP1 expression is transcription- imide (100 lg/ml) was added to the rest of the culture. The time course ally regulated, whereas UCP2 protein level can change without was recorded from 30 min to 24 h. any alteration in mRNA level [7]. Several physiological situations highlight the importance of 2.3. Cell culture and treatments regulation for UCP2 expression, since UCP2 protein level in- Stable CHO cells expressing UCP2 were obtained as previously decreases and decreases in a very short time. LPS injection in scribed for UCP1 [20] and were cultured in Ham/F12 medium supple- mice leads to rapid downregulation of UCP2 protein in macro- mented with 10% foetal calf serum (FCS). Caco-2 (from Dr. E. Laroche) and POGRS-1 (from Dr. A. Amterdam) cell lines were phages, whereas its expression increases strongly and tran- grown in DMEM/F12 supplemented with 10% FCS and 2 mM gluta- siently in the lung 16 hours after LPS injection [6,7,10,11]. mine. Nonessential amino acids (1 mM) were added to Caco-2 culture. All media contained penicillin (100 IU/ml) and streptomycin (50 lg/ * mL). Cell lines were grown in a humidified atmosphere of 5% CO2 Corresponding author. Present address: INSERM, U764, Clamart, and 37 °C. To determine UCP half-life, cells were treated with cyclo- F-92140, France. Fax: +33 1 46 32 79 93. heximide (10 lg/ml). The time course was recorded from 0 to 24 h. E-mail address: [email protected] (A.-M. Cas- sard-Doulcier). 1These authors contributed equally to this work. 2.4. Animals and treatment 2Present address: Institut Curie, UMR 146 baˆt 110, centre universi- Studies on mice were performed in agreement with the institu- taire, 91405 Orsay. tional CNRS guidelines defined by the European Community guiding

0014-5793/$32.00 Ó 2007 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2007.01.010 480 S. Rousset et al. / FEBS Letters 581 (2007) 479–482 principles, and by French decree No. 87/848. C57BL/6 J mice (Elevage the three organs tested (Fig. 1B). These data agree with previ- Janvier) were maintained under a 12-h light, 12-h dark schedule, with ous descriptions of rapid variations in UCP2 level in tissues food and water ad libitum. Mice were injected with cycloheximide [7,12]. (2 mg/kg) and sacrificed by cervical dislocation. Tissues were removed and kept at 20 °C until protein extraction. 3.2. Half-life of UCPs and UCP2 mutant proteins in yeast 2.5. Western blot analysis We analysed whether a mutation in its sequence could mod- Mitochondrial proteins were prepared from cells, tissues or yeasts as ify UCP2 stability. To avoid the establishment of stable cell described [7,19]. In Western blots [7], membranes were hybridised with line expressing each mutant, we chose the yeast Saccharomyces appropriate antibodies as previously published: UCP2, hUCP2-605 antibody [7], UCP1, 375-5 antibody [21]. In each experiment, the cerevisiae since previous studies have shown that yeast is a rel- amounts of UCP1 and UCP2 were normalized by using an antibody evant model to analyse UCPs function [22]. against porin. Chemiluminescence (ECL kit, Amersham) was recorded In this heterologous system, the half-life of UCP2 was calcu- using a CCD camera. lated to be around 60 min (Fig. 2A), confirming the results obtained in mammalian cells and mammalian tissues. We tested the effect of three polymorphisms in the coding region of 3. Results human UCP2, A55V, G85S and A232T. No significant differ- ences were observed in the half-life of these isoforms compared 3.1. Half-life of UCP1 and UCP2 in mammalian cells to the wild-type UCP2 (Fig. 2B). A UCP2 mutant protein, The half-life of UCP2 was measured in two cell lines endog- enously expressing UCP2, Caco-2, a human colon carcinoma cell line and POGRS-1, a granulosa cell line. We also used a stable CHO clone expressing UCP2 heterogeneously. Fig. 1A shows the kinetics of degradation of UCP2 in these cells after treatment with cycloheximide, a translation inhibitor. Interest- ingly, 25 min after the treatment, UCP2 expression was already decreased by 50%. Similar experiments in CHO cells with UCP1 showed a half-life close to 30 h (data not shown), as previously described [14]. UCP2 half-life was also measured in vivo. After injection of cycloheximide in C57BL/6 J mice, UCP2 was assayed in spleen, lung and duodenum. In agreement with our in vitro studies, UCP2 rapidly decreased in

Fig. 1. Half-life of UCP2 in vitro and in vivo: (A) Cell lines (CHO Fig. 2. Half-life of UCP2 and modiﬁed UCP2 in yeast: the kinetics of n = 2, Caco-2 n = 4 and POGRS1 n = 6) were treated with cyclohex- degradation of UCPs in the yeast Saccharomyces cerevisiae was imide (10 lg/ml). UCP2 level was determined by Western blot analysis recorded as described in Section 2. (A) UCP expression was analysed with 30 lg of proteins. (B) Mice were injected i.p. with cycloheximide by Western blot with 15 lg of proteins (n = 5). (B) Histograms (2 mg/kg). Tissues were removed 1 and 2 h later. 15 lg were loaded represent the half-life determined for each UCP2 form (n = 3). onto polyacrylamide gel (n = 2 with three animals for each time point). *P < 0.05. S. Rousset et al. / FEBS Letters 581 (2007) 479–482 481

D212N, whose activity is decreased, had a signiﬁcantly shorter associations with such diseases in appropriate cohorts of pa- half-life than wild-type UCP2 (Fig. 2B). tients should be considered.

4. Discussion Acknowledgements: We thank D. Chamereau for help in the breeding of mice, and Dr. D. Pompon for the gift of the yeast plasmid pYeDP. This work was supported in part by the Centre National de la Recher- UCP2 has a shorter half-life (around 30 min) than its UCP1 che Scientifique (CNRS), the Institut National de la Sante´ et de la homologue (30 h) [12]. Degradation of mitochondrial proteins Recherche Me´dicale (INSERM), the Association pour la Recherche in the inner membrane is controlled by the AAA proteases contre le Cancer (ARC), the Institut de Recherche Servier and by (ATPases Associated with a variety of cellular Activities) ECFP6 funding (Contract No. LSHM-CT-2003-503041). S.R. received a grant from the ARC, J.M. a grant from Servier laboratories, and [23], which have been largely studied in yeast. To investigate Y.E. a grant from the Ministe`re de la Recherche. the role of these proteases in the half-life of UCPs, we tested the stability of UCP1 and UCP2 in wild-type and mutant yeasts. We first ruled out degradation by the proteasome, since References addition of inhibitor of this pathway does not modify UCP half-life. We then tested involvement of the iAAA protease [1] Heaton, G.M., Wagenvoord, R.J., Kemp, A. and Nicholls Jr., (yme1) and the mAAA proteases (afg3 and rca1) by using D.G. (1978) Brown-adipose-tissue mitochondria: photoaffinity yeast since it was described mammal proteases are able to re- labelling of the regulatory site of energy dissipation. Eur. J. store degradation function of protease disruptant yeast Biochem. 82, 515–521. [2] Ricquier, D. and Kader, J.C. (1976) Mitochondrial protein [24,25]. However, whatever the protease mutant used, the alteration in active brown fat: a sodium dodecyl sulfate–poly- half-life of UCP1, as well as UCP2, remained unchanged (data acrylamide gel electrophoretic study. Biochem. Biophys. Res. not shown), so these proteases are not involved in UCP degra- Commun. 73, 577–583. dation. Two recently reported proteases, Oma1 [26] or [3] Cannon, B., Shabalina, I.G., Kramarova, T.V., Petrovic, N. and Nedergaard, J. (2006) Uncoupling proteins: a role in protection Mop112 [27], or as yet unknown proteases, may be involved against reactive oxygen species-or not? Biochim. Biophys. Acta in proteolysis of UCP1 and UCP2. 1757, 449–458. The difference in UCP half-lives may be related to their dif- [4] Nicholls, D.G. and Locke, R.M. (1984) Thermogenic mechanisms ferent physiological functions. Cold-induced thermogenesis in brown fat. Physiol. Rev. 64, 1–64. due to UCP1 activity in brown adipocytes is generally not [5] Fleury, C., Neverova, M., Collins, S., Raimbault, S., Champigny, O., Levi-Meyrueis, C., Bouillaud, F., Seldin, M.F., Surwit, R.S., transient, and, therefore, it is important for UCP1 to be ex- Ricquier, D. and Warden, C.H. (1997) Uncoupling protein-2: a pressed at a high level over a long period of time. In contrast, novel gene linked to obesity and hyperinsulinemia. Nat. Genet. UCP2 is present in many tissues whose role is not to produce 15, 269–272. heat. UCP2 is implicated in the immune response by regulating [6] Arsenijevic, D., Onuma, H., Pecqueur, C., Raimbault, S., Manning, B.S., Miroux, B., Couplan, E., Alves-Guerra, M.C., ROS production [6,11,28]. After infection by a pathogen, the Goubern, M., Surwit, R., Bouillaud, F., Richard, D., Collins, S. ROS pathway plays an important role leading to activation and Ricquier, D. (2000) Disruption of the uncoupling protein-2 of macrophages and other immune cells that eliminate the gene in mice reveals a role in immunity and reactive oxygen pathogen. However, this ROS production must not last if tis- species production. Nat. Genet. 26, 435–439. sue damage is to be avoided. Moreover, during the oestrus cy- [7] Pecqueur, C., Alves-Guerra, M.C., Gelly, C., Levi-Meyrueis, C., Couplan, E., Collins, S., Ricquier, D., Bouillaud, F. and Miroux, cle in females, UCP2 rapidly decreases to allow the production B. (2001) Uncoupling protein 2, in vivo distribution, induction of ROS [12]. This event is necessary to oocyte release, but must upon oxidative stress, and evidence for translational regulation. J. be strictly regulated in order to avoid side effects, such as a Biol. Chem. 276, 8705–8712. destruction of the oocyte. The regulation of ROS level must [8] Ricquier, D. and Bouillaud, F. (2000) The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem. be subtle, and it is clear that UCP2, as a regulator of ROS le- J. 345 (Pt 2), 161–179. vel, is both rapidly synthesised and degraded. [9] Rousset, S., Emre, Y., Join-Lambert, O., Hurtaud, C., Ricquier, The UCP2 half-life measured here is short and unusual. D. and Cassard-Doulcier, A.M. (2006) The uncoupling protein 2 Although the half-lives of mitochondrial carriers have not of- modulates the cytokine balance in innate immunity. Cytokine 35, ten been investigated, it is accepted that they are over 10 h. 135–142. [10] Bai, Y., Onuma, H., Bai, X., Medvedev, A.V., Misukonis, M., Few data are available, but the half life of P450cc (cholesterol Weinberg, J.B., Cao, W., Robidoux, J., Floering, L.M., Daniel, side chain cleavage cytochrome P450), an inner membrane K.W. and Collins, S. (2005) Persistent nuclear factor-{kappa}B mitochondrial protein, is around 20 h [29]. activation in Ucp2/ mice leads to enhanced nitric oxide and We analysed variations in UCP2 half-life using known inflammatory cytokine production. J. Biol. Chem. 280, 19062– 19069. mutations. For the three known polymorphisms already de- [11] Emre, Y., Hurtaud, C., Nubel, T., Criscuolo, F., Ricquier, D. scribed, a slight, but not significant, decrease in half-life was and Cassard-Doulcier, A.M. (2007) Mitochondria contribute to observed. For the D212N mutation, UCP2 half-life was signif- LPS-induced MAPK activation via uncoupling protein UCP2 icantly reduced by 60%. Mills et al. demonstrated that the in macrophages. Biochem. J. 401, in press, doi:10.1042/ D212N mutation led to an increase in the mitochondrial mem- BJ20061430. [12] Rousset, S., Alves-Guerra, M.C., Ouadghiri-Bencherif, S., Kozak, brane potential [17], suggesting that this mutation was impair- L.P., Miroux, B., Richard, D., Bouillaud, F., Ricquier, D. and ing UCP2 activity. Our data imply that the reported decreased Cassard-Doulcier, A.M. (2003) Uncoupling protein 2, but not activity of the D212 mutation should, in fact, be explained by a uncoupling protein 1, is expressed in the female mouse reproduc- decreased stability of the mutant. The absence of UCP2 in tive tract. J. Biol. Chem. 278, 45843–45847. [13] Sullivan, P.G., Dube, C., Dorenbos, K., Steward, O. and Baram, mice promotes atherosclerosis [28], chronic inflammatory dis- T.Z. (2003) Mitochondrial uncoupling protein-2 protects the eases like experimental autoimmune encephalomyelitis [30], immature brain from excitotoxic neuronal death. Ann. Neurol. and cancers [31], and the search for D212N polymorphic site 53, 711–717. 482 S. Rousset et al. / FEBS Letters 581 (2007) 479–482

[14] Puigserver, P., Herron, D., Gianotti, M., Palou, A., Cannon, B. [23] Langer, T. (2000) AAA proteases: cellular machines for degrading and Nedergaard, J. (1992) Induction and degradation of the membrane proteins. Trends Biochem. Sci. 25, 247–251. uncoupling protein thermogenin in brown adipocytes in vitro and [24] Atorino, L., Silvestri, L., Koppen, M., Cassina, L., Ballabio, A., in vivo. Evidence for a rapidly degradable pool. Biochem. J. 284 Marconi, R., Langer, T. and Casari, G. (2003) Loss of m-AAA (Pt 2), 393–398. protease in mitochondria causes complex I deficiency and [15] Kubota, T., Mori, H., Tamori, Y., Okazawa, H., Fukuda, T., increased sensitivity to oxidative stress in hereditary spastic Miki, M., Ito, C., Fleury, C., Bouillaud, F. and Kasuga, M. paraplegia. J. Cell Biol. 163, 777–787. (1998) Molecular screening of uncoupling protein 2 gene in [25] Shah, Z.H., Hakkaart, G.A., Arku, B., de Jong, L., van der Spek, patients with noninsulin-dependent diabetes mellitus or obesity. J. H., Grivell, L.A. and Jacobs, H.T. (2000) The human homologue Clin. Endocrinol. Metab. 83, 2800–2804. of the yeast mitochondrial AAA metalloprotease Yme1p com- [16] Otabe, S., Clement, K., Rich, N., Warden, C., Pecqueur, C., plements a yeast yme1 disruptant. FEBS Lett. 478, 267–270. Neverova, M., Raimbault, S., Guy-Grand, B., Basdevant, A., [26] Kaser, M., Kambacheld, M., Kisters-Woike, B. and Langer, T. Ricquier, D., Froguel, P. and Vasseur, F. (1998) Mutation (2003) Oma1, a novel membrane-bound metallopeptidase in screening of the human UCP 2 gene in normoglycemic and mitochondria with activities overlapping with the m-AAA prote- NIDDM morbidly obese patients: lack of association between ase. J. Biol. Chem. 278, 46414–46423. new UCP 2 polymorphisms and obesity in French Caucasians. [27] Kambacheld, M., Augustin, S., Tatsuta, T., Muller, S. and Diabetes 47, 840–842. Langer, T. (2005) Role of the novel metallopeptidase Mop112 and [17] Mills, E.M., Xu, D., Fergusson, M.M., Combs, C.A., Xu, Y. and saccharolysin for the complete degradation of proteins residing in Finkel, T. (2002) Regulation of cellular oncosis by uncoupling different subcompartments of mitochondria. J. Biol. Chem. 280, protein 2. J. Biol. Chem. 277, 27385–27392. 20132–20139. [18] Cullin, C. and Pompon, D. (1988) Synthesis of functional mouse [28] Blanc, J., Alves-Guerra, M.C., Esposito, B., Rousset, S., Gourdy, cytochromes P-450 P1 and chimeric P-450 P3-1 in the yeast P., Ricquier, D., Tedgui, A., Miroux, B. and Mallat, Z. (2003) Saccharomyces cerevisiae. Gene 65, 203–217. Protective role of uncoupling protein 2 in atherosclerosis. [19] Arechaga, I., Raimbault, S., Prieto, S., Levi-Meyrueis, C., Circulation 107, 388–390. Zaragoza, P., Miroux, B., Ricquier, D., Bouillaud, F. and Rial, [29] Granot, Z., Geiss-Friedlander, R., Melamed-Book, N., Eimerl, S., E. (1993) Cysteine residues are not essential for uncoupling Timberg, R., Weiss, A.M., Hales, K.H., Hales, D.B., Stocco, protein function. Biochem. J. 296 (Pt 3), 693–700. D.M. and Orly, J. (2003) Proteolysis of normal and mutated [20] Casteilla, L., Blondel, O., Klaus, S., Raimbault, S., Diolez, P., steroidogenic acute regulatory proteins in the mitochondria: the Moreau, F., Bouillaud, F. and Ricquier, D. (1990) Stable expres- fate of unwanted proteins. Mol. Endocrinol. 17, 2461–2476. sion of functional mitochondrial uncoupling protein in Chinese [30] Vogler, S., Pahnke, J., Rousset, S., Ricquier, D., Moch, H., hamster ovary cells. Proc. Natl. Acad. Sci. USA 87, 5124–5128. Miroux, B. and Ibrahim, S.M. (2006) Uncoupling protein 2 has [21] Ricquier, D., Barlet, J.P., Garel, J.M., Combes-George, M. and protective function during experimental autoimmune encephalo- Dubois, M.P. (1983) An immunological study of the uncoupling myelitis. Am. J. Pathol. 168, 1570–1575. protein of brown adipose tissue mitochondria. Biochem. J. 210, [31] Horimoto, M., Resnick, M.B., Konkin, T.A., Routhier, J., 859–866. Wands, J.R. and Baffy, G. (2004) Expression of uncoupling [22] Rial, E., Gonzalez-Barroso, M., Fleury, C., Iturrizaga, S., Sanchis, protein-2 in human colon cancer. Clin. Cancer Res. 10, 6203– D., Jimenez-Jimenez, J., Ricquier, D., Goubern, M. and Bouil- 6207. laud, F. (1999) Retinoids activate proton transport by the uncoupling proteins UCP1 and UCP2. EMBO J. 18, 5827–5833.