Intraflagellar Transport Proteins Cycle Between the Flagellum and Its Base

Intraflagellar transport proteins cycle between the flagellum and its base Johanna Buisson, Nicolas Chenouard, Thibault Lagache, Thierry Blisnick, Jean-Christophe Olivo-Marin, Philippe Bastin

To cite this version:

Johanna Buisson, Nicolas Chenouard, Thibault Lagache, Thierry Blisnick, Jean-Christophe Olivo- Marin, et al.. Intraflagellar transport proteins cycle between the flagellum and its base. Journalof Cell Science, Company of Biologists, 2013, 126 (1), pp.327-338. 10.1242/jcs.117069. hal-03246304

HAL Id: hal-03246304 https://hal.archives-ouvertes.fr/hal-03246304 Submitted on 23 Jun 2021

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Journal of Cell Science s slkl ofs ihi ahrta ooetk t mligta hs ristae narsrce e fmcouue.Using microtubules. of set restricted but a base, flagellum on the velocities. at IFT travel proteins and IFT length trains flagellum of IFT. on pools these in dependent two at is that engaged of present recycling existence actively those This implying the with twice is flagellum. mixed reveals almost the it, one are actually in is flagellum only parameters cycle it overtake the IFT all one, from full integrating to slow back a modelling coming a reiterate proteins than Mathematical with can IFT up and that rather catches base time train first flagellum it anterograde the the for fast with show a we When fuse experiments, trains. photobleaching retrograde to to likely converted and as three into split are trains n hlpeBastin Philippe and Buisson Johanna base its the and between flagellum cycle proteins transport Intraflagellar Article Research nrfaelrtasot(F) rcs htwsdsoee nthe in called discovered trains) was alga that green or process particles bi-directional a (IFT), the (IFT transport complexes on intraflagellar relies protein flagella of and movement cilia of construction The Introduction words: Key a by in analysis (5 investigated Tracking IFT the was retrograde DHC2.1. of for chain IFT speed base heavy Here, uniform dynein the a proteins. IFT demonstrated at of transport the concentrated return pool or are and IFT52 this forward proteins with of of IFT fusions separation role automated GFP flagella. allowing actual using and method studies, the curvelet cilia flagellum about of for known construction model is the attractive little for but necessary is flagellum (IFT) transport Intraflagellar Summary 10.1242/jcs.117069 doi: 327–338 126, ß Science Cell of Journal 2012 August 30 Accepted ( correspondence for *Author 2 1 Kzisie l,19;Aslne l,20;Pgn ta. 2009). al., from et Pigino purified 2008; microtubules were al., et They peripheral Absalon 1995; axoneme the al., the et between (Kozminski and positioned membrane granules electron flagellum a transmission electron-dense by by visualised as and are microscopy particles 1995) IFT 2007). al., al., et et (Rompolas (Kozminski orientation retrograde anterograde the tip) in the complex dynein in to specialised family base II kinesin (from the of direction motors by driven is IFT ye Fli ta. 06 bao ta. 08 rne l,2008) al., for et available Tran only 2008; is al., investigation in et cell Absalon detailed few of 2006; to and al., limited (only et are movement (Follit observations these types However, membrane (Orozco the 1999). protein al., fluorescent a et as to flagellum fused components IFT cells individual the live Chlamydomonas deforming in particles microscopy to 2003). al., contrast et protists Kohl 2003; from al., et Huangfu far, 2000; al., al., et so et Signor Pazour 1999; al., 1999; investigated et Brown 1995; species al., the et (Kozminski most mammals all of construction in perturbs in components conserved particle organelle or are motor inhibition IFT and proteins 2009) of Scholey, IFT and (Hao or species eukaryotic 1998). ciliated motors al., et (Cole encoding B and Genes A termed complexes protein two contain uniaieIaeAayi nt ntttPseradCR R28,2 u uDcerRu,705Prs France Paris, 75015 Roux, France Docteur Paris, du 75015 rue Roux, 25 Docteur URA2582, du CNRS rue and 25 Pasteur URA2581, Institut CNRS Unit, and Analysis Pasteur Image Institut Quantitative Unit, Biology Cell Trypanosome 2 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. ofr F a endmntae ydfeeta interfering differential by demonstrated been has IFT far, So 1 u w itntppltosfratrgaemvmn htaesniiet eprtr.We hyrahtedsa i,anterograde tip, distal the reach they When temperature. to sensitive are that movement anterograde for populations distinct two but ) hayooa reinhardtii Chlamydomonas nrfaelrtasot ii n lgla Trypanosome flagella, and Cilia transport, Intraflagellar Kzisie l,19)o ymonitoring by or 1993) al., et (Kozminski ) [email protected] 1 ioa Chenouard Nicolas , 1, Chlamydomonas * Kzisie l,1993). al., et (Kozminski ) lglaadsonto shown and flagella 2 Chlamydomonas hbutLagache Thibault , F si osse ogfaelm(20 flagellum long a possesses it as IFT eakby uineet eeams wc oelkl to likely more twice almost were events flagellum. the fusion of portion populations Remarkably, same anterograde the distinct in the speed two different least with of show travelling at We selection travel. of existence to to the going the example are here possibility trains for mechanistic which the on as IFT microtubule such in doublet up aspects unsolved, opened key remain multiple that This the of 2010). some investigate al., and et anterograde ratio (Chenouard signal-to-noise of the improving discrimination significantly traffic, easy retrograde appropriate semi- and allowing up detect analysis, analysis to kymograph set automatic software upon now particles a IFT developed have track have and and We to IFT monitoring fused 2008). image complex) to by al., IFT-B conditions trypanosomes et the of (Absalon in member GFP (a IFT IFT52 of of movement visualisation first the genetics. reverse all of potent almost conservation the to demonstrated analysis amenable functional and is Genomic and structure axonemal further for importance contexts. the cellular IFT distinct highlight of in nature and investigation the revealed in studies motors and (Follit These rates cells anterograde IFT 2009). in al., cultured differences the et significant IMCD for quite Besschetnova and reported 2006; been al., LLC-PK1 mammals only et of in have IFT cilium data Imaging and primary 2011). challenging Barr, been and has Morsci in 2004; neurons al., ciliated et of types different elegans for and 2005) (Dentler, h protist The 2 her Blisnick Thierry , hr nxetddfeecshv enrpre (Snow reported been have differences unexpected where IFT rpnsm brucei Trypanosoma ee JlosaadBsi,20) ereported We 2009). Bastin, and (Julkowska genes 1 enCrsoh Olivo-Marin Jean-Christophe , sa trciemdlt study to model attractive an is rpnsm brucei Trypanosoma m )wt typical a with m) 327 ,an m C. m 2 Journal of Cell Science Results IFT. aeat eetITtan ntefaelm 5 sexposure allowing events ms CCD anterograde 150 of a side, A detection z- with flagellum. unambiguous single the and recording the in clear a digital trains provided in IFT used on detect organelle we to Second, the camera lying acquisition 1). of (Fig. flagellum segments and glass plane long to their of stick viewing frequently visualisation with cells improved that the noticed slides to we therefore in difficult First, extremely conditions. ratio We events retrograde signal-to-noise and detect. using the low matrix was However, Images agarose flagellum 1). an (Fig. recording. in nucleus immobilisation the movie 2008). of upon exception acquired al., flagellum the in were uniformly with et the present body and at cell flagellum (Absalon the the concentration in GFP spots high elongated as in to base, found fused was complex that IFT IFT52 GFP::IFT52 the (those expressing component trypanosomes midgut) fly B procyclic the live in develop in normally visualised particles was IFT fluorescent IFT of tracking and Detection modelling mathematical the and from returning base proteins only flagellum IFT that revealed the of recycling to the flagellum time first (Pigino for demonstrate studies the experiments photobleaching other Finally, 2009). from al., et transport retrograde of the frequency and reach and size they anterograde train once between conundrum three a in solving tip, split distal are also trains We anterograde doublets. microtubule that of show number limited a on anterograde travel that trains view the supporting cases, overtaking than happen 328 ora fCl cec 2 (1) 126 Science Cell of Journal , 5 ftebslpo satvl nae in engaged actively is pool basal the of 45% fteotrdni r rPR,oeo h ancmoet of components main the of one PFR2, or arm to dynein chain fused outer intermediate was the the an GFP DNAI1, of when as of such observed proteins not subunits unpublished flagellar was structural our three IFT FAP133, contrast, and and In (two data). XBX1 IFT27- machinery DHC2.2, IFT and complex for the dynein -IFT22 as of observed components 4), proteins distinct Movie were IFTB five for material events as supplementary well IFT 1D; (Fig. retrograde GFP::DHC2.1 transport. and retrograde for chain motor fusion Anterograde heavy the dynein a DHC1b), IFT called constructed the also we and (DHC2.1, GFP IFT52, encoding to genes ensure the restricted To between 1B,C). not Fig. were both at the these images of that and length still defined whole on ms the as arrows along 100 (colour appeared followed flagellum be to then could path time particles whose spots exposure retrograde This 3). and the 2, anterograde of Movies reduction material supplementary allowed EMCCD disk 1B,C; amplified (Fig. spinning an with the camera acquired using were images illumination and laser technology under observed weak were of accurately. detect. traces tracked elongated to be not very difficult could as that remained appeared intensity events they visible, retrograde material When but supplementary 1A; 1), (Fig. traces Movie elongated as appear that 0sweetepsto ftepril smre nthe on marked is particle the the of position alongside the where s found 30 structure large data). a unpublished (our rod, axoneme paraflagellar the aeilMve5.Hwvr idrcinlITyed many yields IFT bi-directional However, the 5). on Movie projected material is time oipoesniiiy F:IT2epesn trypanosomes expressing GFP::IFT52 sensitivity, improve To yorp nlsswsnx are u nclsfle for filmed cells on out carried next was analysis Kymograph seFg n et.()ITmvmn of movement 5 IFT bars: (D) Scale text). GFP::DHC2.1. and visible 5 are Fig. trains (see retrograde of only tip flagellum, the the the reached all trains Once anterograde trains. fluorescent fluorescent new prevent of to entry photo-bleached was the base particles, flagellum anterograde larger regularly by are masked that To trains (C) retrograde trains. visualise anterograde camera. of EMCCD Movement an (B) a using with exposure acquired ms images 100 and disk spinning equipped a microscope a with using laser was a Fluorescence with (B–D) excited exposure camera. ms CCD 150 a a using with acquired were images and a microscope on epifluorescence the illuminated conventional of were end Cells distal (A) the flagellum. and marks base arrow star flagellum white white the the the of left, position the the on indicates image first arrowheads. the coloured On by indicated is on image trains each (C) retrograde and of (A,B,D) position anterograde successive The indicated. as 4) Movie ( GFP::DHC2.1 GFP::IFT52 expressing ( cells of movies from EGFP::DHC2.1. and EGFP::IFT52 of movement retrograde intraflagellar and Anterograde 1. Fig. A–C upeetr aeilMve –)or 1–3) Movies material supplementary , y ai Fg AB supplementary 2A,B; (Fig. -axis D upeetr material supplementary , ahrwsossilimages still shows row Each m m. x ai and -axis Journal of Cell Science s s whereas nmn ois hyrpeet47 ftettlnme of number a total ( GFP::DHC2.1 the in ( of of GFP::IFT52 detected case 4.7% for be represent trains to They anterograde movies. detected low consistently many were too (stars, on they speed but was analysis slow proportion statistical very significant Their at travelling 2D). trains Fig. of population minor lglu eeldta risdslydfs rso oin as motions slow or fast displayed trains that revealed flagellum and GFP::IFT52 the both of 67% for About (2.40 bars). films) motility grey fast showed 41 dark trains individual 3A,B, most of (Fig. The in GFP::DHC2.1 trains (71% peaks. anterograde criterion two of showed sequences that information distribution Methods) least bimodal and Bayesian Materials a at a (see 1978) using of (Schwarz, (BIC) tested existence train was of the Examination hypothesis 3). suggested 2, (Figs an dissimilar flagellum speed same demonstrated highly the exhibiting within events trains rates with anterograde complexity, of unexpected analysis frequency and Kymograph speed IFT of Quantification trypanosome the in events retrograde flagellum. and automatic of anterograde the analysis IFT reproducible and and material both robust conditions (supplementary allow acquisition kymographs hour of the an a analysis Overall, to over up S1). unaltered of Fig. were acquisition parameters of these period retrograde that and anterograde showed slide both same velocities of the Measurement of on acquired. movies medium were successive in analysis, maintained for trypanosomes amenable separate cells increase of To and below). number see larger the 2C,D, the improves by (Fig. particles masked greatly anterograde usually which brighter trains and retrograde present, of bi- longer analysis between anterograde no the points crossing are images result, of trails a sub-kymograph directional As distinct 2010). separation al., two et in the (Chenouard particles curvelet IFT permits a retrograde on that based technique a transform analysis therefore using kymograph We prevents a quantification. IFT which developed for image, procedure automatic kymograph simple the in cross-points 2 2 xmnto fcmlt rcsfo h aet h i fthe of tip the to base the from traces complete of Examination 1 1 n 0.52 and , , n 5 7,Tbe1.Mroe,w oie h rsneo a of presence the noticed we Moreover, 1). Table 271, , 3 fte ipae lwrmto (1.53 motion slower displayed them of 33% 6 0.30 m ms n 5 2 4) ihasedo 0.55 of speed a with 442), 1 respectively. , 6 0.31 n 5 m ,2)ad59 nthe in 5.9% and 1,223) ms 2 1 , n 5 5,Tbe1) Table 551, 6 6 0.30 0.24 m m m m aesedfrtecmlt neord ore,so trains slow the journey, maintained compartment anterograde complete trains flagellar the fast the for in most speed detected whereas same be However, could 2D). (Fig. they as soon h ats F oinrpre ofr 5.64 far: so reported best the motion was IFT uncovering model movie, fastest Gaussian every in single the transport retrograde a for Accordingly, that model 3A–C). fitting Fig. indicated 2E, more BIC (Fig. other the appeared were each traces to transport where trains parallel kymographs mostly retrograde the slow on contrast, evidenced and as homogenous, In events Fast complex below). more arrows). to leading (see flagellum, 2D, the (Fig. in trip interact flagellum actually their during the motion their along of modification showed frequently n ail.Icesn h bevto eprtr o37 to accurately temperature controlled observation be the Increasing could rapidly. temperature and where chamber a in ceeae F pe o l ri aeois iha1.4-fold in a 3C; (Fig. with resulted categories, analysis it train for BIC all However, for velocities the 8). speed by IFT distinct a Movie accelerated transport, supported two material retrograde was for supplementary of one that only occurrence feature and the transport anterograde affect not odfeetain(nslradBsat 04.Procyclic 2004). Boshart, 27 and contributor at grown main as (Engstler were they a such trypanosomes infection, differentiation where conditions, fly hosts, to during environmental different temperatures different varying two very in the encounter develop and temperature trains Trypanosomes to sensitive the is IFT of speed the the microscopy. by light imposed ms), of (100 be resolution limitations to the time have given acquisition These approximations analysis). as nm kymograph 250 taken using was movies train separate 393 retrograde that whereas was the the analysis) kymograph train of of using anterograde movies length separate the 10 The from by counterparts. left retrograde that average traces showed their on and than intensity path carry to material visible train trains compared entire IFT their anterograde of events along Calculation performed retrograde 2). was (Table of almost ones an abundance anterograde revealing flagellum, higher the of 3-fold end distal the and proximal ( n 5 h rqec fvsbeITtan a acltda ohthe both at calculated was trains IFT visible of frequency The ,2)(i.3,,lgtgrey). light 3A,B, (Fig. 1,223) rista hne pe uigterti ntefaelmand flagellum trains. the slow in very trip at their point slow during stars some speed indicate changed Arrows that C). trains as straightforward magnification for (same allowing analysis and background reducing hence neord ( 5 Anterograde bar, scale (horizontal flagellum the m axis of X length the the where to 5 corresponds Movie material supplementary highlighted from is extracted analysis 5 for bar: used Scale flagellum (arrowheads). the of portion visible oi rmwihtekmgahwsetatd ( extracted. was kymograph the which from 5 Movie anterograde of traces. separation retrograde and and generation Kymograph 2. Fig. yaiso nrfaelrtasot329 transport intraflagellar of Dynamics )adteYai oteeasdtm vria cl a:5s). 5 bar: scale (vertical time elapsed the to axis Y the and m) D n ergae( retrograde and ) ( A tl mg fsplmnaymaterial supplementary of image Still ) ˚ m suuladte incubated then and usual as C o ohiae.( images. both for m 6 E 1n ( nm 51 rcshv enseparated been have traces ) , .-odmr IFT52 more 4.1-fold 6 n 1n ( nm 51 5 6 3,fo 10 from 539, 1.01 C Kymograph ) B m The ) n ms 5 ˚ did C 505, 2 1 Journal of Cell Science atrwe el r nuae t37 travel at populations incubated All are lines. cells blue when each as faster for represented be Gaussians are can obtained population one The anterograde only transport. whereas retrograde separate transport for two anterograde identified detected for analysis trains BIC of 8). populations Movie material supplementary from ris l yorpsaesona h aemgiiain cl bars: Scale magnification. same the at 5 shown horizontal, are kymographs All trains. tr.Fnly iia .7fl nraewsntcdfor noticed of was velocity average increase spectacular 1.37-fold a 7.42 reaching similar transport a retrograde Finally, star). upeetr aeilMve n ,rsetvl)o 37 or respectively) 7, and 6 Movies material supplementary Tbe2.I otat euigtetmeauet 20 to events temperature retrograde the reducing for of contrast, pronounced frequency In more the 2). slightly in (Table was increase that an by trains accompanied was velocities nsmlrpooto hna 27 n for at detected increase than still were proportion 1.3-fold velocity similar slower in a displaying and Trains ones. trains fast the anterograde slow for increase 27 to exposed lines cell indicated temperature. the to in sensitivity and IFT retrograde ( and Anterograde 3. Fig. 330 u nweg,ti stefrtdmntaino nefc of effect an of demonstration first To shown). the not is (data this speed IFT knowledge, of our modifications visible to lead A–C 5 0)bthdafse eoiya 1.07 at velocity faster a had but 707) 6 .Sedo neord dr ry n ergae(ih ry F trains IFT grey) (light retrograde and grey) (dark anterograde of Speed ). 1.64 ora fCl cec 2 (1) 126 Science Cell of Journal m m ;vria,5s. 5 vertical, m; ms 2 1 ( n 5 4)(al ) hsaclrto fIFT of acceleration This 1). (Table 742) ˚ ˚ 56 fteatrgaetrains, anterograde the of (5.6% C C.Saspita oevr slow very some at point Stars (C). C ˚ AB tl mgsfrom images still (A,B; C 6 0.23 m ms ˚ C tl image still (C; C 2 1 ˚ i not did C Fg 3C, (Fig. ai) ncnrs,tefeunyo ergaetasotwas transport higher or retrograde fusion detectable the of of events. absence (1.2:1 fission with the frequency events with agreement agreement the fission the in train the unchanged, contrast, in to in of In relative therefore end, decrease ends events ratio). slight we distal fusion distal of a the and proportion and revealed at flagellum proximal This frequency the could 2). the (Table to frequency between flagellum train trip it that the compared interact imply actively during They trains change fast flagellum. 4D). and the Fig. slow on colour within that pink indicate events, 92 results of out These (77 situation first the of lwoebhn Fg C,o lentvl hnaso ri let 4C train slow (Fig. a ‘escape’ when one alternatively or fast 4C), a (Fig. behind one slow a 1.4-fold was events particles microtubules. trains overtaking doublet both the pink fast positioned to that higher. 117, closely relative imply of or of proportion events same Their out fusion the predominance Such events on 4D). travel (102 Fig. clear speed on colour initial a their with maintaining 4D), (Fig. ri agtu lwoeadaprnl ue ihi,leading it, with fast fused a apparently when and microtubule one observed trains slow was separate a situation these up of caught on that type train suggests second presumably visible A This traces doublets. a 4A). anterograde independently, (Fig. the passing by of the travel kymograph at continuity accompanied the train the fast by on not the confirmed of as was arrest point, or This deceleration temporary 4D). (Fig. trains i.4)o eue pe teso n sosdw’tefast the down’ ‘slows one, one slow slow the 4B (the Fig. ‘pushes’ speed one one, reduced fast or (the 4B) speed Fig. unchanged either to infcn osqecsfrclae el xoe ovariable have to could exposed that cells phenomenon ciliated temperatures. a for consequences velocity, significant IFT on temperature h aeo lwITtanta a vrae yoeo two or 4A one (Fig. by 3 by overtaken occasions was few that a train on IFT and being slow could trains, situation a fast common train of most frequently the case were with fast the events movies, Such most a 4A in speed. (Fig. detected initial all First, more their were or of that 4). 4A) modification (Fig. events (Fig. of one kymographs types overtake three microtubule in whether to distinct evaluate on rise detected to or gives same way This the a doublets. on providing should travel particles ones, trains fast slow anterograde that anterograde with implies up different flagellum catch same displaying the populations in motions of flagellum existence same the The within interact trains Anterograde eursa10m xoueta sal eut nstrto of saturation in flagellum results the usually that in exposure trains ms IFT 100 a of signal requires detection local challenging really non-ambiguous in is This differences since Methods). high and Materials the (see fluorescent account intensities quantify overall into to for taking and Next, data exposure signals, shown). normalise laser to to not due up (data photobleaching set cells bleaching were conditions after non-exposed the appropriate rates to Indeed, IFT IFT. equivalent retrograde affect were not and did was anterograde it exposure measured First, an unknown. performed. such is was that flagellum analysis confirmed the FRAP the pool, in at this place concentrated address taking proteins To IFT IFT to of base pool flagellum the of contribution The compartment base flagellum flagellum the the and between exchange actively proteins IFT ial,fsineet eeas bevdwe attanleft train fast a when observed also were events fission Finally, 9 .Fso vnstre u ob eyfrequent very be to out turned events Fusion ). 9 .Teewsasrn isi favour in bias strong a was There ). 9 lwtan without trains slow ) 9 )ormorefast Journal of Cell Science F5 37 27 IFT52 DHC2.1 F5 27 T IFT52 Strain 37 27 T reduced with although trains, pattern 5Ai). (Fig. IFT retrograde intensity typical cells and the were to unbleached anterograde they leading tip, with as trains, distal the retrograde particles reached to slow particles converted these and Once 5Aa). fast the (Fig. displayed of they intensity but diversity trains Their original anterograde same 5Ah). the where to (Fig. compared later visible weaker was again s detected 4 were until trains were fluorescent 5Ag) particles Fig. moment fluorescent arrowheads, that (violet From retrograde 5Af). of exclusively Fig. tip distal arrowheads, on, the (green reached flagellum particle the fluorescent anterograde 5Ad). last (Fig. the for and GFP::IFT52 area anterograde trains of of cytoplasmic mixture retrograde a pool contained the flagellum cytoplasmic the when Meanwhile, the rapid later indicating of replenished, s was dynamics on 1 recovery base of flagellum than kept sign the first surrounding less and The 5Ad). observed intensity (Fig. rates was usual fluorescence their at their before moving flagellum base new the retained fluorescent in of flagellum both present bleaching loss contrast, trains the By retrograde the immediate flagellum. and almost the anterograde of of in the trains in vicinity anterograde disappearance resulted fluorescent close This to 5Ac). in (Fig. signal also laser single base a cytoplasmic reliable by flagellum leading achieved was permitting the bleaching pulse, cases, at non-saturating, both In intensity 5B). but (Fig. fluorescence the weaker of in is quantification trains where 10 IFT signal Movie material different supplementary the the and base 5A) of flagellum (Fig. visualisation the the flagellum easy at allows saturating in is but intensity trains fluorescence where fluorescent monitor by to base, performing flagellum. flagellum by analysis was and the recovery distribution kymograph at fluorescence and intensity overall bleached examining quantifying selectively flagellum the was by at cells evaluated fluorescence such GFP of were flagellum. trains base the the where a in base conditions flagellum of acquisition detectable the in identification at the saturated signal the screening not GFP::IFT52 allowed the was of which cells in Nevertheless, them of quantification of number few large impossible. rendering a through signal, recovery base fluorescence flagellum the ae r ie in given are Rates rqece r ie snme ftan e second. per trains of number as given are Frequencies ˚ ˚ w oisaepeetd upeetr aeilMve9, Movie material supplementary presented: are movies Two .209 .133 .43.37 2.87 3.24 2.78 3.30 2.47 3.31 2.48 0.98 0.86 1.02 0.89 C C m ms , 2 rxmlDsa rxmlDsa rxmlDistal Proximal Distal Proximal Distal Proximal 01 fe lahn Fg A)until 5Ae) (Fig. bleaching after s 10–15 1 lwadfs neord riswr eaae yteBIC. the by separated were trains anterograde fast and Slow . ˚ ˚ ˚ 2 2.22 1.34 1.53 528 191 822 C C C neord A ergae()RtoR:A Ratio (R) Retrograde (A) Anterograde al .Feunyo F risi h F:IT2epesn strain expressing GFP::IFT52 the in trains IFT of Frequency 2. Table al .ITvlcte fatrgaeadrtord trains retrograde and anterograde of velocities IFT 1. Table n lwsedFs speed Fast speed Slow 6 6 6 .73.21 2.25 2.40 0.37 0.20 0.30 neord risRtord trains Retrograde trains Anterograde ae n pesaeicesdwe el r ananda 37 at maintained time are cells IFT the that when above and increased seen are have base speeds We flagellum and flagellum. flagellum the rates the in trains the at IFT by time spent from recovery the back to between due coming is trains bleaching margin IFT after compartment. this base of flagellum within material recycling the fluorescent exactly the replenishes of plateau majority that the that a suggesting 5B), reaches (Fig. Remarkably, train). rate anterograde the of recovery rate initial the to according n ergaetan (5.6 trains retrograde and i+0o h ergaelg n ulfaelmcceis cycle flagellum full a and is for leg) flagellum last a retrograde to within expected the units on of or tip+10 trains number at anterograde be total to 3–4 estimated the of Hence equivalent the units. is for and reported s 2007)) ones, 2.5 retrograde the to to comparable trains anterograde distal takes the of which at conversion spent time during the include tip not does This any and flagellum. at single units) that 27 deduce can of we total second, per units) time, 2.7 given (or trains 0.9 of n h RPeprmnswr erdcdi hs conditions. these in reproduced were experiments FRAP the and n a hrfr eie stebscui genrectangles, (green unit basic This the one. as IFT retrograde defined a 5C). all therefore (Fig. than train the material was anterograde model integrating more an one from that times transport by know three back a we contains analysis, calculated coming in frequency the be above material From described to can the parameters at due this proteins is fluorescent flagellum, of base recovery was the This flagellum that 5B). considers at (Fig. 46 one reached reached If presented and s is are 20–24 plateau after achieved and after a immediately observed films until is recovery photobleaching separate steady and Rapid 10 5B. Fig. from averaged were ytkn nocnieaintelnt fteflagellum the of cycle length full (0.66*2.4+0.33*1.5 anterograde a the of for the velocity consideration in spent present into time (22.3 units the taking IFT measured of by first number we the calculate flagellum, To 5B). Fig. fti supinwr orc,oewudepc correlation a expect would one correct, were assumption this If eoeydt fteGP:F5 inla h lglu base flagellum the at signal GFP::IFT52 the of data Recovery m )(oisne l,19)dvddb h average the by divided 1995) al., et (Robinson m) yaiso nrfaelrtasot331 transport intraflagellar of Dynamics 6 6 6 , , .6727.42 4.99 5.64 742 210 1223 0.46 0.14 0.31 neord ris(i atadtreso ones, slow three and fast (six trains anterograde 9 .– Fg A upeetr aeilMve9, Movie material supplementary 5A; (Fig. s 3.5–4 , 7(7atrgaeuis1 rniiga the at transiting units+10 anterograde (27 47 , , 8so vrg bten1 o2 s 22 to 16 (between average on s 18 0rtord risaetafcigi a in trafficking are trains retrograde 10 m ms 2 n 1 ,so Chlamydomonas 6 , %o h rgnlvalue. original the of 8% . ) ihafrequency a With s). 3.5 m ms Speed 2 6 6 6 1 ,so 1.64 0.89 1.01 Qne al., et (Qin , 1s) 11 , 10 ˚ C Journal of Cell Science e lglu fvroslntsrvaigacertendency clear a shorter a with revealing a cells in lengths on from on various and of reproduced based coming flagellum was flagellum recovery new proteins experiment of full-length This fluorescent time flagellum. a of calculated with the recycling with cells cells. was agreement uni-flagellated to elapsed for observed time compared as the fluorescent range to 40 same However, reached the new base recovers in flagellum the 50%, Movie of progressively at material recovery supplementary Fluorescence emergence that 12). 5E; (Fig. base and particles anterograde the material of to return fluorescent bleaching, trains before a flagellum retrograde with the trains, retrograde within cells anterograde and present anterograde for fluorescent trains fluorescent the the observed new in of motion was of resulted for continued loss that flagellum whose flagellum: events new positive single the of flagellum of both cascade new 5E; base same has (Fig. the are a at cell presented that exclusively constructing reached the has is bodies are length where and basal examples 12), GFP::IFT52 its Two Movie duplicated material 1995). (Robinson cycle whose supplementary cell al., flagellum the new of stage a et the assembling This to according length. cells varies flagellum in length the addressed with be exist can also base, should flagellum s, the correlation 12 at a at recovery fluorescence peak dictates a flagellum reaching faster margin. was predicted the recovery within of exactly speed the but frcvr a 5,smlrt hthdbe bevda 27 at supplementary observed been (see had rate what The to 5D cell). similar individual Fig. 45%, the an was of and at recovery example analysed of to an be s for presented 11 could 14 Movie to cells are material 11 22 to data of leading total s, averaged A 1 the only cycle. was that a end showed complete distal analysis the FRAP at the time journey. during dwell velocity the for slow of s the 13 and part and fast anterograde 10 the between at be travelled to having expected trains now is time running Total flagellum. same the in interact trains Anterograde 4. Fig. 332 hr attan r hw npn n lwtan r hw nbu.We attancthsu lwoe he iutosaeosre.Quantificat observed. are situations three one, slow a up catches train fast a When blue. in shown are in trains shown slow and is pink scenario in shown are trains fast where ) aawr opldfo 6mve nldn oa f75tan.Alkmgah r hw ttesm anfcto.Saebr:hrzna,5 horizontal, bars: Scale magnification. same tra the slow and at fast shown a (B are into rate splitting kymographs slow train All the slow at trains. a or to 715 D) or of in D), pink in total (light (pink a (B) (C) rate including train fast slow movies s. the a 16 at 5 and either fast from vertical, continues a compiled couple into were splitting the train and Data fast it D). a with to fuses correspond one, events slow fission a Third, up catches train fast a Second, ofrhrspotteve httetm pn nthe in spent time the that view the support further To ora fCl cec 2 (1) 126 Science Cell of Journal D is,afs ri vrae n A ‘’i )o oe(A more or D) in (‘1’ (A) one overtakes train fast a First, . , 8 m .Becigtefursetsignal fluorescent the Bleaching m. , –0s ..mc faster much i.e. s, 8–10 ( A–C yorps(etpnl)adshmtcrpeetto ftae fitrs rgtpanels) (right interest of traces of representation schematic and panels) (left Kymographs ) ˚ C, 9 ttefaelmbs 8 t37 units at 90 of (85 presence base The the flagellum 5F). requires (Fig. model the flagellum this at the for in obtained IFT base fit flagellum to best the participate pool, at to model found base simplest mobilised stock protein The is flagellum IFT pool. the the body all cell in that the proposes present of trains contribution proteins IFT a returning the without of with content mixed the where is concept based modelling recycling mathematical a by on analysed be can base a flagellum velocity. with IFT trypanosomes, and in length flagellum compartment on flagellar flagellum dependence the the Overall, between and protein lengths. base GFP::IFT52 of different di exchange three displayed active in obtained flagella not since results here (data new these produced flagella be these cannot shorter all analysis in averaging times An shown). recovery shorter towards oa ubro risa h lglu aei e o4 o 0at 30 (or 45 to set the is when base reached is flagellum model the this at 37 for trains the fit of contribute best number at and The total flagellum present 5G). a the (Fig. normally only penetrate IFT to that proteins to able considers IFT are one base the if flagellum of explained base fraction be the flagellum can restricted of the of This that recovery replenishment place. match the faster takes not of a shape does that The 5B,D) indicates 5B,D). Fig. curve Fig. (red, (black, fit data a experimental such of curve lahdadubece F rtistkspaea the at the place than takes higher proteins times IFT three unbleached than more and is of bleached value which be predicted should experimental s, model the this 33 However, to in base close model. or flagellum quite first the is at the This time by units. dwell 102 predicted of value number initial the the maximum are of a 46% that before so represent base pool, units would flagellum they fluorescent the flagellum, at the 47 accumulate re-entering the flagellum the where In from curves). system back blue queuing 5B,C, pure (Fig. trains a anterograde new to contribute o2 1 t37 at (13 20 to ‘’o ‘ or (‘2’ ) ihalteedt nhn,tert frcvr tthe at recovery of rate the hand, in data these all With ˚ )adwe ny4%(2 t37 at (42% 45% only when and C) § ’i )so ris eutn ncosnso h kymographs. the on crossings in resulting trains, slow D) in 3’ ˚ ) r cieyrcce otefaelmto flagellum the to recycled actively are C), , .Ee fsm iigbetween mixing some if Even s. 9 ˚ ) oee,tesaeo the of shape the However, C). frn iutosdemonstrate situations fferent ˚ )o hm corresponding them, of C) 9 dr lei D). in blue (dark ) n(C in o feach of ion 9 , bu on (blue ) 90/2.7 m m; Journal of Cell Science i.5. Fig. e etpg o legend. for page next See yaiso nrfaelrtasot333 transport intraflagellar of Dynamics Journal of Cell Science rtisi F Mdl1 e)o fol iie ol(oe ,blue). 2, (Model pool limited a only all of of or involvement red) with 1, base, (Model flagellum IFT the in at proteins dynamics IFT for models ihclsmitie t37 at maintained cells with MD60406n 65(rne l,2008) al., et (Tran 2004) al., et (Snow 2006) al., et (Follit 26.5 10.0 nd nd nd 0.6 0.7 1.1 0.4 0.6 1.3 6 2.5 3 IMCD LLC-PK1 (distal) .brucei T. rsne.Rcvr sfse hntefaelmi hre.( shorter. is flagellum the when was are flagellum faster cells new is distinct the two Recovery for of presented. Results base 11). the Movie only material (supplementary where bleached flagella, two possess that cells iso vnsaentsonfrtesk fcaiy ( clarity. of sake the for shown not movies. are separate events 10 fission from averaged base were flagellum data the ( at Recovery intensity saturated. fluorescence not the is where cells in bleaching after ( nFg ,3.Saebri 5 is bar presented Scale kymographs these 3). with of 2, compare intensity (a, Figs fluorescent kymograph in the reduced reaching on the are visible Notice trains also flagellum. anterograde trains, the new have and of trains area tip base fluorescent the flagellum retrograde the the Most to at (i) back appear flagellum. gone trains the retrograde fluorescent of Only anterograde part (g) New proximal tip. (h) distal detected. the and the are more reach trains any progressively detected present not the already are in trains ones anterograde detected New are (f) trains (b–e). cytoplasmic arrowhead) flagellum flanking (d (violet the recovered retrograde at rapidly and also is arrowheads) but that base pool no flagellum a bleaching, the region, after at its Immediately and detected flagellum (c) is the the photo-bleaching. signal between by before events obscured of Image is timing (b) in it base. shift since the a analysed cell, in be resulting this cannot body, in cell flagellum that images the note still of of Please part analysis 9). proximal by Movie cell material whole flagellum supplementary the the in (b–i, visible and in clearly (a) monitored analysis are were kymograph flagellum Events using the 9). in Movie flagellum trains the material at IFT (supplementary intensity but signal to saturated The restricted b. is pulse panel base laser in brief indicated interest a of by flagellum. region bleached the the was in flagellum and single base a possessing flagellum the at IFT ( of the Dynamics 5. Fig. in IFT It organisms. of any in IFT report of study quantify the quantitative to for useful method be first robust should that a IFT developed the We model. is trypanosome study flagellum This trypanosome the in IFT Discussion this quite for matching support is further providing proteins model. data, the IFT experimental recycling model the resident explain the closely 20 by and to produced of units) cycling distant base prediction flagellum implying 45 too the the of way contrast, (45% units is In data. value experimental this base, flagellum ( A Length Species IT0:F)1 . . d1. Lcteke l,2009) 2009) al., al., et et (Lechtreck (Engel 10.5 nd nd nd 2.5 nd 2.1 2.3 12 12 elegans C. (IFT20::GFP) (IFT27::GFP) reinhardtii C. 334 (37 C B A uniiaino h loecn inla h lglu aebfr and before base flagellum the at signal fluorescent the of Quantification ) ,atrgaetasot d o oe ,rtord rnpr;*ubr nprnhssrpeetso trains. slow represent parentheses in *numbers transport; retrograde R, done; not nd, transport; anterograde A, a oe hwn h itiuino F risi h lglu.Fso and Fusion flagellum. the in trains IFT of distribution the showing Model ) h loecn F:IT2sga ttefaelmbs fcells of base flagellum the at signal GFP::IFT52 fluorescent The ) yl acltda h u ftetm pn ntemdl n itlsegments. distal and middle the in spent time the of sum the as calculated cycle ˚ )2. . 22*7433 . 1.) hswork This (13.0)* 9.9 3.37 7.4 (2.2)* 3.2 22.3 C) (27 mdl)40712n 13.0 nd 1.2 0.7 4 (middle) ora fCl cec 2 (1) 126 Science Cell of Journal ˚ )2. . 15*5628 32(84*Ti work This (18.4)* 13.2 2.87 5.6 (1.5)* 2.4 22.3 C) DC 2183112 05(oiie l,2001) al., et (Iomini 10.5 1.25 3.1 1.8 12 (DIC) ˚ C( m n iesaefrtekmgahi s. 5 is kymograph the for scale time and m n 5 2192810 06(ete,2005) (Dentler, 10.6 1.07 2.8 1.9 12 2cls.( cells). 22 . . d3. Bscenv ta. 2009) al., et (Besschetnova 30.0 nd 0.6 0.3 6 –e .Bt neord (green anterograde Both ). E RPeprmn t27 at experiment FRAP ) m )R( R m) al .ITprmtr nvroscl types cell various in parameters IFT 3. Table D RPexperiment FRAP ) m F ms , G Two ) 2 1 : ( R:A ) ˚ Cin m ms F nIC el nuae ihcmonsta trigger that compounds during with 2005) incubated Dentler, cells 2009; IMCD progressive al., the in by et IFT supported (Engel in is regeneration IFT flagellar that from longer fact in in data IFT a increase faster IFT 3), for (Table tendency comparing for a flagella especially noticed By we far, 3). systems, so multiple (Table reported transport speed IFT retrograde fastest the unravelled nti aertord rissol ebihe,wihi o the not is which in brighter, nor trypanosomes be in but should neither complexes trains case tighter retrograde in case proteins hypothesis this more IFT alternate in of An appears compaction size. the smaller This be al., their could et tip. to (Engel trains due retrograde distal possibly DIC IFT 2009), the the the all that detect suggests not at and does approach analysis three anterograde structural our the that in by with species, compatible split solved different be a are in might ones trains albeit conundrum anterograde reveal, This that shorter to 2009). results compared 3-fold al., trains et a electron retrograde (Pigino with showed IFT agreement that for in length not studies are tomography data between microscopy These 1:1 Dentler, 3). to 2001; (Table al., close et 2005) ratio for (Iomini transport a reported retrograde suggested and been anterograde and only approach DIC far using so had to trafficking anterograde of conversion during cells tip dwelling the distal IMCD trains. account retrograde the in into at take cilia spent not primary does time this s), of However, (10–13 complete 3). exception far a (Table so noticeable reported for systems the time all in elapsed with similar It predicted quite 2009). is the cycle al., that IFT et noted (Besschetnova be cilium should primary the of elongation inlncsayfrdfeetain(ene l,20) The sensing a 2009). as al., work to et proposed (Dean other been the has differentiation entry, flagellum for cis-aconitate the trypanosome in triggers necessary involved that transporter signal surface signals a the key redistributionof in in the stage in resulting drop two 2004), procyclic Boshart, and (Engstler the a fly the tsetse to Indeed, bloodstream of the cycle. from differentiation life one trypanosome is the temperature for significant be to due velocity. undetected faster be and to size likely smaller their more are underestimated is trains probably trains retrograde is anterograde because value for the This trains. by flagellum, to retrograde carried close in the signal present that of fluorescent found the tip we of distal However, 80% digestion. the protease at by destroyed example is some that material imagine could IFT one Finally, 2009). al., et Lechtreck 2009; 2 1 h rqec fbt neord n ergaeIFT retrograde and anterograde both of frequency The h nlec ftmeaueo F pe n rqec could frequency and speed IFT on temperature of influence The F yl (s cycle IFT ) a 2 1 References ) Chlamydomonas So ta. 2004) al., et (Snow Chlamydomonas rb atranterograde faster by or Chlamydomonas Egle al., et (Engel Journal of Cell Science h icvr ftodsic oiiisfratrgaeITi the in the IFT from different anterograde is for flagellum motilities same flagellum distinct two the of within discovery trains The anterograde IFT 37 of Interaction at IFT in Anderson, and increase (Scholey for cilium The suggested primary been 2006). the has at what function modified to cell hedgehog in and comparable IFT flagellum involved compartments, of the be body between reduction could molecules possible drop signalling temperature of a exchange the and to 2009) due al., speed et (Rotureau element oiiain nmmrn liiyado oo processivity. motor and/or fluidity membrane in modifications tutrlyietfe BisnadWih,20)adtherefore and 2003) the be Wright, from can triplet and derived each (Beisson be protists, identified some could in structurally identity least molecular at This One where, own trains. base flagellum its IFT microtubules. molecular of of has type or specific these doublet motor a for each ground select optimal that providing identity trains be the raises could also how It hypothesis available. freely about are 9 question and 2 7–8 and 1, 3–4 doublets doublets whereas at encountered doublets. of only available level are of particles the number IFT the at Indeed, restricting axoneme hence 7, the to after the to 4 of connected doublets presence observed is the to that due as rod simply not paraflagellar microtubules, is This analysis 2008). of microscopy al., et electron (Absalon set transmission and restricted fixation chemical a are trains on IFT that doublets view found nine the the supports if This events stochastically. expected overtaking used be were would versus than fusion higher doublet much of same is ratio the (1.2:1) the to However, restricted 6A). be (Fig. can or independently and trains travel that overtaking indicates can observed both are formally limit) that shown resolution current be fact the not given could The this 2004). (although events al., fusion apparent et (Snow of segments cilia separate the on but reported been have velocities different .elegans C. ˚ ol eepandby explained be could C iuto hr two where situation niaeawa otiuino F rtisfo the from proteins kinetic slow IFT a with but of base experiments flagellum contribution the RNAi to weak of pool cytoplasmic number preliminary a minimum a indicate Nevertheless, using flagellum flagellum the parameters. the from material by at back explained signal fully coming be fluorescent can photobleaching of following recovery base the the However, that rather reveals ones. model. original is fluorescent the mixing new than but these bright a because less model either are or valid trains recycling not bleaching queuing is trains direct model following the a queuing s the anterograde in of 9 support spent least indicative fluorescent at trains not for of IFT does the flagellum time absence the of the penetrating recovery The of that independent experiments flagellum. FRAP imply our be in they base should flagellum the because models at two signal first discarded fluorescent The trains. be new Fourth, flagellum make the can to trains. with recruited mixed and anterograde be pool could base to trains base, returning conversion flagellum to from the proteins before have at example could present already trains for proteins returning the behind Third, the queue material. with directly exchange be base without could compartment flagellum trains flagellar Second, the to proteins. and recycled IFT exit the flagellum fresh in upon by destroyed trip replaced be their could completed they to have First, happens they flagellum. what once flagellum explain components the to train in suggested IFT trip be their can after hypotheses trains Several IFT of fate The h ee ftefaelmbs ihu eurn specific a requiring without base the level. flagellum axoneme to the the at transmitted identity molecular of be level to at made be the identity could selection the molecular simply, More microtubule. axoneme the define could u ahmtclaayi nertn l xeietldata experimental all integrating analysis mathematical Our ( lglu aea 27 at base flagellum nuae t37 at incubated hi xetdpstosaeidctdatr1ad2s h scale the s, and 2 ( one and of slow 1 number a after the to indicated indicates the up are indicates catching positions s train expected 0 fast their marked a can box with ones The situation fast (right). initial doublet, ones same the slow on with travel fuse they overtake If can (left). ones ones fast slow doublets, for microtubule and axonemal flagellum base. separate the flagellum in the trafficking at IFT recycling for Models 6. Fig. ie)o i.6 dte lelns.( lines). blue (dotted 6B Fig. or lines) yaiso nrfaelrtasot335 transport intraflagellar of Dynamics C B lseigmdlfrITrcciga h lglu base. flagellum the at recycling IFT for model Clustering ) niiulsqec ffursec eoeya the at recovery fluorescence of sequence Individual ) ˚ C. ˚ ihmdl hw nFg G(oi blue (solid 5G Fig. in shown models with C m a ln h doublets. the along ran m ( A ftotan rvlon travel trains two If ) D aea u o cell a for but C as Same ) Journal of Cell Science xmnto feet attepaeuosre t2 (27 s 22 at observed plateau the past events of examination htpoie nee oepeiefto h xeietldata experimental the of fit curves). precise dotted and 6B,C, more 6D) (Fig. even Fig. train, an three anterograde least provided an at that constitute (since to model kinesin as required the the are in such units to steps association two steps, motor, considered and dynein We several train motor. the anterograde require of the release of could train, formation retrograde This the cycle. the of disassembly by next refined the trains be anterograde to for still trains the retrograde account can IFT into model of take conversion to necessary The order in curve. condition, clustering the a of inclusion of part this in owr rmradCTAATCG and primer forward QIaig.Iae eeaaye sn h Pa pcrm39software camera 3.9 Retiga-SRV Spectrum a IPLab with the were ms 150–400 using Images of analysed excitation. time were for exposure Images bulb an (Q-Imaging). mercury a with with using directly observed captured microscope first was Leica GFP::DHC2.1 or DMI4000 GFP::IFT52 of expression The analysis microscopy Life Phusion genomic enzyme from described proof-reading PCR been by the sequence amplified with has the was template GFP::DHC2.1, (1–777) GFP::IFT52 as of nucleotides DNA expressing expression 777 For first lines 10% the 2008). and encoding cell al., hemin et The with (Absalon supplemented elsewhere serum. of medium SDM79 derivatives calf in were foetal cultured work were this and for stage) used cells cultures All and lines cell Trypanosome Methods and Materials at (6/10 films individual a multiple Indeed, on 5A). detected 27 (Fig. is bleach decrease the penetrated clear after that immediately trains non-fluorescent flagellum the the 2008; of return peak the al., the reached of having because after et decrease should base flagellum (Absalon the at base small flagellum a 2009). the al., et fraction However, at Adhiambo with cytoskeletal localised the agreement movement. in IFT in and detected the consistently fraction, rapid was soluble of proportion undergoing the most in that of proteins found mitotic Treatment revealed are the 2011). of al., detergent proteins et positioning with Delaval the 2007; to trypanosomes al., or to et cycle participate (Robert cell to spindle the shown of been in control These has suggested the dynamics. IFT88 as where slower functions, cells other much play mammalian or may no proteins has IFT ‘resident’ one flagellum the in other from engaged the are back actively coming whereas proteins is material them IFT with of exchanges of One and IFT pools base. The flagellum two minutes. the few where at a present model to This a sec data). supports 30 lasted unpublished analysis incubations (our where conditions experimental here hours the used 8 in negligible to probably is 6 contribution lasting exchange of 336 r1 (37 s 12 or ae tete 27 films individual either two on the the at 5B,D) of ran Fig. therefore part on taken We curve later (blue 5B,D). the model (Fig. dim mixing analysis to the tended restricting sequences curve, the all averaging ieudrie)a ees rmr h C rdc a lndi frame in cloned was product PCR The primer. reverse the of as downstream underlined) site GCATCA euneo H21fsdt F.Ti eobndgn sfakdb h 5 the by flanked is gene recombined This homologous coding GFP. length the by full to of the region integration fused of untranslated to expression DHC2.1 to leading of and locus trypanosomes, sequence endogenous wild-type the in in recombination 2007) linearised al., was et construct The Express). the (Genome within sequencing by verified and 2009) xrsino h uino prpit iewscnimdb etr blotting western by confirmed was shown). (not size antibody appropriate anti-GFP of an fusion with the of Expression h iigmdlpeit httettlaon ffluorescence of amount total the that predicts model mixing The ˚ n 13 t37 at 21/30 and C CACTGTCGAAAG Ne ieudrie)as underlined) site (NheI GCTAGCATGGTTTCGGCAGAGAAGG DHC2.1 ora fCl cec 2 (1) 126 Science Cell of Journal ˚ )ucvrdcoeftigo h xeietldt also data experimental the of fitting close uncovered C) GFP eunewt h nyeMe n uloetd(Burkard nucleofected and MfeI enzyme the with sequence eei h PPRepeso etr(dimoe al., et (Adhiambo vector expression pPCPFR the in gene PFR2 ˚ Fg B r37 or 6B) (Fig. C ˚ )bta lgtysitdtms However, times. shifted slightly at but C) eeadb h 3 the by and gene GTCTCCCAATGG( GGATCCCTACTCGCTAGATTGGAG 9 .brucei T. nrnltdrgo of region untranslated ˚ Fg C.Careful 6C). (Fig. C TM tan47(procyclic 427 strain Fnzm) using (Finnzyme), DHC2.1 Bam ˚ C) HI 9 . nsraigmd.Asml fcl a100 (a acquired cell of were operating sample Hamamatsu) Images A (C-9100, Yokogawa). mode. camera streaming (CSU22, EMCCD in an head with software confocal Volocity disk using equipped spinning 200) (Axiovert a for (magnification microscope and objective and inverted immersion time oil Zeiss acquisition an a reduced with used For we ImageJ. quantification or IFT Biosciences) BD & (Scanalytics iwhsbe etitdt el fitrs ntepeetdmovie. of presented field the GFP the in correct size, interest file to of large cells allows the to This of restricted that image. been Because cell individual has exposure. a view laser each in to pool for due protein another bleached) photobleaching fluorescent using was been base normalised flagellum background not was (a data, had GFP time normalise of over source To photo-bleaching equivalent base). overall flagellum and the subtracted example (for 1 was software (binning s frames two 0.116 between and time actual s time the (no 0.111 and frame acquisition around per of was ms speed independent 100 maximum was seven time at Exposure in lapse). taken acquired new were the were Movies of sequences experiments. base image the FRAP only 30 where photo-bleached, and was flagella two one presenting cells on experiments the utr rw t6t 8 to 6 at grown culture 0mnts 4 oiso F:IT2clsa 27 at cells GFP::IFT52 of movies 345 minutes. 30 ewe w rmswsaon .1 n .1 bnigws1 was (binning s 0.116 and time s actual of the 0.111 and speed around frame was per maximum ms frames at two 100 was between taken time Exposure were lapse). single time Movies (no the acquisition experiments. a in For acquired FRAP construction). were just sequences in independent image new possessing 96 eight flagellum, a one (cells and presenting flagellum cells experiments old on experiments an both presenting and cells for and presented coverslip flagellum The representative photo-bleaching. and after are recovery slide signal sequences movies Time-lapse GFP between analyse before. to described mounted acquired as were conditions were imaging same cells with observed experiments, FRAP analysis (FRAP) For photobleaching after recovery Fluorescent vnulycmae n vrgdoe utpeprilsadidvdas The individuals. and particles multiple and over pipeline collected averaged are semi-automatic measures and These events. compared these these of eventually crossing frequency particles the of number estimate also the and We count velocity. gates, flagellum, extract its the and on points area, automatically particle control some the trajectories: We set over of averaged set intensity the extremities. its from length, while time identified train of the function image, a the as indicators kymograph between particle individual several the automatically trails that algorithm in the path shortest trails follows a with particle to estimated only frames are performed missing trajectories operator complete then multiple the of as is semi-automated extremities over correction is tracking indicates and correction modelling statistical Track inspection accuracy. motion for a Human optimal 2009). achieve compensates particle to al., thanks and to et time detections (Chenouard thanks through wrong detections linked discards missing are automatically positions which of accuracy, algorithm sub-pixel set a achieve method the of to tracking set analysed a (2) automatic are detecting which The by maxima positions sets. intensity particle putative local data identify relevant large we (1) of stages: analysis two of the automated consists an respectively. allow in particles to built IFT are as particles retrograde IFT manner or of directionality trajectories anterograde kymograph, different separated select each two to For coming and as fluorescence for, chosen compensated (e.g. are are artefacts setups practice, body) that select In trypanosome such and 2010). the adjusted al., from characteristics are et trains parameters Chenouard filtering in the available the to details (specific adapt features of automatically oriented the separation of to analysis the curvelet image the allows exploits kymograph method that filtering The method the directions. novel opposite filtering a of to on trails band-pass based corresponds very is directional technique a kymograph Our providing and time. flagellum, the of adaptive the period in extended of trip an kymograph its over line during summary the concise train Each used given a we 1998). of time intensities al., observed through et trajectories particle (Piperno IFT analysis identify to order In analysis and extraction Kymograph ndphaayi eetknoto i needn xeiet o F5 t27 at IFT52 for experiments independent six of out taken were analysis in-depth hs a esrd asswr aeyosre u eyso rcswere tracks slow very but observed of speed rarely individual the were and Pauses lines straight measured. as the was split and during were train speed these set tracks changed as that leg, data trains such of anterograde large case information the the of extract In length. we analysis and intensity Indeed, velocity, the within density, statistics. possible frames significant hundred making of several hence computation of minutes, comprised few sequence only image an from trajectories ai hne ntmeaue.Ti eiealw aito ftesample the of variation allows device 38 This and 4 temperatures. between allowing in temperature controller temperature changes mini-stage response rapid fast a and chamber controlled h ape eekp t27 at kept were samples The 07;Gorja 2007a; eprtr tblt within stability temperature 4 ois,toa 37 at two movies), (40 needn xeiet,10mve ntreeprmnsa 37 at experiments three in movies 100 experiments, independent t27 at loecneitniywsmaue ntergo fitrs sn ImageJ using interest of region the in measured was intensity Fluorescence ˚ nfu needn xeiet o GP:H21cls oisfor Movies cells. EGFP::DHC2.1 for experiments independent four in C ´ na ´ ze l,20b.Tesmlswr sdn ogrthan longer no used were samples The 2007b). al., et cz 6 ˚ 2 ois n he o H21(0movies). (10 DHC2.1 for three and movies) (20 C 1 10 losteacrt xrcino ag ubrof number large a of extraction accurate the allows 6 ˚ 6 Cor37 el mL cells 0.3 ˚ trtsof rates at C ˚ ae nPlireeet(Gorja element Peltier on based C ˚ sn w ifrn eie,atemperature a devices, different two using C 2 1 n rpe ewe ld n coverslip. and slide between trapped and m rp a ae ietyfo the from directly taken was drop) L , 6 6 1 pixels). 1 3wt . ueia aperture) numerical 1.4 a with 63 ˚ Cs 2 ˚ eeaqie neight in acquired were C 1 n rvdslong-term provides and , ˚ n 2 movies 129 and C 6 ies.For pixels). 1 ´ na ´ ze al., et cz ˚ C Journal of Cell Science nt e eoda 27 at second per units rtiscneunl oe akt h lglu aea h aetm.Uigthe Using time. same ( the at their anterograde base during flagellum the mean unchanged to back remained time comes mean trains consequently a proteins lasts IFT which flagellum, of the inside fluorescence journey the that considered pia aaee bandfrcl k. cell for obtained parameter optimal ast u ntemdladt vi vritn,b nrdcn eat emfor of term number penalty a right introducing the by select overfitting, avoid to to permits and BIC model the the in laws, put anterograde Gaussian to and laws of retrograde both sum (Schwarz, in weighted distribution BIC modes empirical cell, a the of each modelling number in Indeed, the velocities. velocities uncover IFT IFT to of used variability is (BIC) intrinsic 1978) criterion large information the Bayesian to the Due analysis: statistical analysis. rate BIC IFT the in detected not low are their trains to Due slow category. very separate these a proportion, as manually grouped and detected consistently h lglu.I atclrITfursetuisetrtefaelmwt effective with flagellum fluorescence the enter the units fluorescent that frequency IFT particular considered In flagellum. we the experiments, base t, time flagellum at photobleaching recovery the at analyse proteins IFT To of recycling the Modelling representing precisely, More model. model fitting mixture the Gaussian in a with parameters of number the neord F ae a optdb iiiigteBIC the minimising by computed was rates IFT anterograde niiulcl and cell individual parameters xeietly(al ) h length time the 1), (Table experimentally osqety h loecnercvr rate recovery fluorescence the Consequently, and h duration the where m oe odt.Te,teotmlnme fmodes of number optimal the Then, data. to model pligti nlsst h esrdITrts efudta h neord IFT anterograde the that found we ( rates, bimodal IFT measured was the to analysis this Applying 21 GP:F5 el t37 at cells EGFP::IFT52 12/16 nlsspoie h airtdparameters calibrated the provides analysis where equation: r umrsdi al 1. Table in summarised are GP:F5 (37 EGFP::IFT52 where h lglu.Fr0 For flagellum. the where i , s enparameters: Mean i k h orsodn enadvrac,w is erhd o fixed a for searched, first we variance, and mean corresponding the t p lag p L stenme ffe aaees( parameters free of number the is N (x p stenme fGusa asi h mixture, the in laws Gaussian of number the is L 1 * ( stettlnme fITpoen ntefaelmbs xhnigwith exchanging base flagellum the in proteins IFT of number total the is a ,x , ( a stemxmsdlklho the likelihood maximised the is 1 a ( 2 ~ t27 at s 4 (t). a 1 ,…,x t , i *, m P fteITfaelmti a eetmtdto: estimated be can trip flagellum IFT the of m k f 1 1 m * where , p , n 5 i X s k ~ *, ) ~ a m 1 n ˚ )i 9o h 1cls(1;1/8EF:IT2clsa 27 at cells EGFP::IFT52 13/18 (71%; cells 41 the of 29 in 2) L )adEF:DC.,rsetvl,ad.*( and respectively, EGFP::DHC2.1, and C) s r h bevdrtord rs.atrgae F ae nan in rates IFT anterograde) (resp. retrograde observed the are ; t setrl otoldb xhneo loecn aeilwith material fluorescent of exchange by controlled entirely is (t) # 1 h orsodn apesz.Cneunl,ti is tpo the of step first this Consequently, size. sample corresponding the p ::: ˚ i v a *) and C ~ ÈÉ a , 1 ; n ergae( retrograde and ) 1..p m ( a t ˚ f k a j ) ob ute rnpre oad h itltp We tip. distal the towards transported further be to C), , 1 p ~ BIC ), n , steatrgaetan rqec (f frequency trains anterograde the is , s htmxms h likelihood the maximise that m t 1 a 1 nypr loecn atce,ta eeit the into were that particles, fluorescent pure only , , "# p d 2 , , ~ ( m X a i s dt t37 at s 1 p ~ t p 2 ( e p ˚ ) ~ t 1 n / GP:H21cells). EGFP::DHC2.1 4/7 and C , 1 ) ~{ ( ) s ~ { x m p ~ 2 t ) , ~ 5 lag 2 ffiffiffiffiffiffi a ::: a j ~ P N p 1 1 n i 2log 3 2ad4frEF:IT2(27 EGFP::IFT52 for 4 and 12 13, L , z , X s 1 i m ˚ ~ 5 f )o F rtisa h lglu itltip, distal flagellum the at proteins IFT of C) m p "# i p Þð ðÞ L #{S} 1 1 , X exp 23 i a s ~ ~ a p ( v ( p p i t L ( 1 v r , N mxuemodel: -mixture 1 { a F eoiista eemeasured were that velocities IFT ) m m a a p 1 p ( eoe h adnlo nensemble an of cardinal the denotes i ) ftefaelmadtema lag mean the and flagellum the of m *, ( 1 { z t a z m X k , 2 ffiffiffiffiffiffi a a ) m ~ (t) m i p ( { i , p i v k x 1 s *, 1 s , r p j ::: i m a { steslto ftedynamical the of solution the is i s ) log p* exp 1 ( , i t t *) a ( m ) k n that and , p a i 1..p ( ), { conigfrrtord or retrograde for accounting L ) i ( n 2 m { h egto ahlwand law each of weight the 1 ) ftemdlt data to model the of a fitting when , 2 2 ~ ( ~ e(x) x s j i { 3 m 1 p , f. X k m { fITsed with speeds IFT of a ~ m 0.89*3 i (t ) 1 1 2 2 k m eoe the denotes ) 2 2 t p ( ) s h optimal the , k fluorescent 5 i ) p .7IFT 2.67 -mixture e(x) ˚ C), ˚ C, 1 S Þ ) he niiuluisbfr eunn notefaelm ecniee htthe contain that that considered trains we novel flagellum, into the pool cluster into base base returning flagellum flagellum before the trains units IFT to individual retrograde three back Because IFT model. of anterograde coming previous condition to are our clustering to a trains that include base retrograde further flagellum to the IFT decided at we of proteins cycle, conversion next base the necessary for flagellum the trains the for at units account IFT To of clustering the Integrating yorp rdcin n id ol hrPegOi Lotte for manuscript. Trepout Ooi, the Sylvain of Cher-Pheng and reading Rotureau Kohl, critical Brice Rosenbaum, Linda Joel initial thank and Pedersen, with also advice production, for We (UCSF) imaging. kymograph and providing Rafelski Susanne advice in and technical for assistance Engel for expert Benjamin Dynamique Roux for Pascal Machu d’Imagerie and Christophe equipment Plateforme their to the access thank We Acknowledgements a rirrl e at set arbitrarily was otiuet F,tefursec eoeyi hneult N/N to equal then is recovery fluorescence the IFT, to contribute N where ore hc lasts which journey time at flagellum epcieyeggdi igeITuis n n2 n 3-clusters. and 2- in and units, IFT single in engaged respectively ntcnbn oaohrsnl ntwt rate fluorescent with single unit a single Consequently, another equal. to are bind 2-cluster can a and unit unit single a between lglu ae hn ftetosnl F nt htbn ofr -lse are 2-cluster a form to bind that units IFT probability single a with two fluorescent, the both if Then, base. flagellum iie notresubpopulations: three into divided odtosi rvosdnmcleutos eoti h relations the obtain we equations, dynamical previous in conditions nt htaeeggdit nemdaecutr ftouisand units two of clusters intermediate into engaged are that units eetrtefaelma neord F ris h loecnerecovery fluorescence to to: The able equal trains. then thus are IFT is units anterograde 3-cluster photobleaching as These after units. flagellum three the of clusters re-enter final in engaged units where h lglu aeaddnmceuto 1 eue to: reduces (1) to equation back coming dynamic are and occurred, base base flagellum flagellum the the of photobleaching when flagellum reads igeITuista r oigbc rmteflagellum, the from back coming are that units IFT single ihrate with and igeITui sfurset ihpoaiiy2 one probability only if with While fluorescent, pool. 2-cluster is the unit into transferred IFT are single that units two by depleted oli nydpee yoeui.Bcueafursetsnl ntcnas ida bind also can equation unit dynamical single the fluorescent obtain a Because finally unit. we one 2-cluster, by depleted only is pool eoepoolahn,alteITprilso h lglu aeare base flagellum the of particles IFT the fluorescent: all photobleaching, Before N that consider we if Finally, hc eue to reduces which T 2 oevr easmdta h idn rate binding the that assumed we Moreover, 5 ffaelmbs F rtis htaeal opntaetefaelmand flagellum the penetrate to able are that proteins, IFT base flagellum of N N d 1 a 3 dt f ~ a 1 5 a 1 ( t ( 3 2N q ) k.N t ( ), ~ t f ffiffiffiffiffiffiffiffi { 1 = a yaiso nrfaelrtasot337 transport intraflagellar of Dynamics 1 a . 3 N i .N t 2 d ( 1 k ( ) t 1 a h oe sntvr estv otebnigconstant binding the to sensitive very not is model The . ) t 2 dt and ) 5 1 steefcienme ffursetpoen htetr the enters that proteins fluorescent of number effective the is 2 where /2, d d t ( 2 f t for 1 a a ) dt dt a 3 2 t ~ N k 3 t ( ( n oebc ttefaelmbs fe hi flagellum their after base flagellum the at back come and , ( t t nasm a,dnmcleuto for equation dynamical way, same a In . ~ ) ) t fITpoen htecag ihtefaelmcnbe can flagellum the with exchange that proteins IFT of a N { a ~ ~ 1 3 ( i 3 1 25 ( 5 t t N N t ) N N r h rprino loecn rtista are that proteins fluorescent of proportion the are ) ) ~ 1 1 N ,2ad3 and 3, and 2 1, f { 2 ersnsol etitdfato ftettlnumber total the of fraction restricted a only represents f 3 2 hc seuvln otesocimtycondition stoichiometry the to equivalent is which , 2 a ÀÁ a 2i h fetv ubro -lsesisd the inside 2-clusters of number effective the is /2 d kN 3 2 1 a dt k ( a ( t ( t N { 1 t 1 2 ) ) ( N a N 1 t 2 ~ t N 1 2 ) N 1 2 kN ) ( z 2 { 5 t N a ) 1 ( h olo loecn igeITuisis units IFT single fluorescent of pool the , 1 1 N a 2 2 kN ( f { 2 a 1 t ðÞ ( ) +N 2 N 1 t { kN ( 1 2 ) { t N d N ) k.N kN 2 z a 2 1 dt +N a 2 z i N ( ( a a 1 1 2 t t ) ) .N 1 2 a 1 a ÀÁ k 3 ( ( ~ 2 a 1 where , 3 t t 1 ( ( a 2 )) ewe igeITuisor units IFT single between ) ri a idt 2-cluster a to bind can it or , t t { ( .R-netn hs initial these Re-injecting 0. 1 2 )( ) { t ( N ) 1 t 2 ) 3 f { z kN and a 3 a 2 N 1 ( 2 N 1 a t a 2 ( ) 1 1 t 1 )) ( h ubro IFT of number the ( t stenme of number the is t T )( h igeunits single the , N ) 1 a 3 a { (t). h ubrof number the 2 ( a t )and 1 ( N t ) 2 ~ k a 2 that a 3 N ( ( 1 t t ) ) , Journal of Cell Science olt .A,Tf,R . oat,K .adPzu,G J. G. Pazour, and E. K. Fogarty, A., R. Tuft, A., J. Follit, nslr .adBsat M. Boshart, and M. Engstler, ’aoIed-rne ..i uddb atu Transversal Pasteur a by funded (PTR387). is from Program fellowship T.L. Research doctoral a Ile-de-France. by C’Nano funded was N.C. Pasteur-Weizmann. ne,B . uigo,W .adMrhl,W F. W. Marshall, and B. W. Ludington, D., B. Engel, ehrh E37,teFnainpu aRceceMe Recherche la pour Fondation the (ED387), Recherche ete,W. Dentler, eaa,B,Bih,A,Lwo,N .adDxe,S. Doxsey, and D. N. Lawson, and A., R. Bright, C. B., K. Delaval, J. Matthews, and Fuster, K. Kirk, L., R., P. Marchetti, S., Beech, Dean, L., A. Himelblau, R., D. Diener, G., D. C. J. Cole, Olivo-Marin, and P. Bastin, I., Bloch, J., Buisson, N., Chenouard, C. J. Olivo-Marin, and I. Bloch, N., Chenouard, V. J. Shah, and B. Roy, Y., T. Besschetnova, Dore G., Toutirais, L., Kohl, T., Blisnick, S., Absalon, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.117069/-/DC1 online available material Supplementary by funded Ministe was the (ANR-08- from recherche J.B. fellowships la de (CNRS), ANR-09-GENOPAT-R09088KS). Nationale Scientifique Agence the MIE-027; Recherche of grants la Institut two de the by by and National funded Centre is Unit the Biology Pasteur, Cell Trypanosome the in Work manuscript. Funding the J.-C.O.-M. wrote and line. BIC study T.L. conceived cell the the P.B. supervised analyses. and GFP::DHC2.1 quantification. and mathematical the recycling the supervised their and IFT generated conceived of and T.B. model events analysis. mathematical the anterograde transport of analyses. produced separation quantitative retrograde the their allowing out and software carried the and developed reported, movies N.C. experiments the biological all the all acquired performed and designed J.B. contributions Author 338 eso,J n rgt M. P. Wright, and Bastin, J. Beisson, and E. Delannoy, G., Toutirais, T., Blisnick, C., Adhiambo, ukr,G,Faoo .M n oii I. Roditi, and M. J. C. Gaertig, Fragoso, and G., R. Burkard, Kosoy, C., Marsala, M., J. Brown, rnpr rti F2 sascae ihteGlicmlxadi eurdfrcilia for required is and complex Golgi the with associated assembly. is IFT20 protein transport rfikn ovysniiaint nueso tg ifrnito nTrypanosoma in differentiation stage of inducers brucei. to sensitization convey trafficking atcesz clsivreywt lgla egh eiiigteblnepitlength balance-point the revisiting length: flagellar model. with control inversely scales size particle hayooa flagella. Chlamydomonas srqie o pnl retto nmitosis. in orientation spindle for required in is assembly signal. differentiation ciliary trypanosome for the conveys required family proteins contain particles elegans IFT Caenorhabditis (IFT): L. transport J. Rosenbaum, 2010. China, Kong, Hong Flurescence 2010, in Particles Bi-directional Images Tracking Microscopy for Kymograph of Analysis Curvelet 2009. USA, Boston, 2009, Images Microscopy in rnfraino losra om fTyaooabrucei. Trypanosoma of forms bloodstream Parasitol. of transformation normal and ciliogenesis for required Tetrahymena. is and in cilia cytokinesis assembling to targeted preferentially cilia. primary the mammalian of assembly the in Biol. 5 Cell Opin. Rab-like protein G small atypical flagellum. the trypanosome for function novel trypanosomes. in formation flagellum for P. required Bastin, and A. ee Dev. Genes ora fCl cec 2 (1) 126 Science Cell of Journal 20) nrfaelrtasot(F)drn sebyaddssebyof disassembly and assembly during (IFT) transport Intraflagellar (2005). o.Bo.Cell Biol. Mol. 153 220-223. , .Cl Biol. Cell J. 15 96-104. , 7hIE nentoa ofrneo mg rcsig ICIP Processing, Image on Conference International IEEE 17th . 20) nrfaelrtasotadfntoa nlsso genes of analysis functional and transport Intraflagellar (2008). 18 19) hayooa iei-Idpnetintraflagellar kinesin-II-dependent Chlamydomonas (1998). 2798-2811. , t EEItrainlSmoimo iIaig ISBI BioImaging, on Symposium International IEEE 6th . .Cl Sci. Cell J. esr neurons. sensory 20) aa oycnroeasml n continuity. and assembly body/centriole Basal (2003). .Cl Biol. Cell J. 17 ehd elBiol. Cell Methods 187 3781-3792. , o.Bo.Cell Biol. Mol. 20) odsokadrglto fsraeprotein surface of regulation and shock Cold (2004). 81-89. , ` ed ’negeetSupe l’Enseignement de re 122 170 834-841. , .Cl Biol. Cell J. 649-659. , 20) mgn nrfaelrtasotin transport intraflagellar Imaging (2009). 10 a.Cl Biol. Cell Nat. 93 3081-3096. , (2009). 331-346. , 20) ihyefcetstable efficient Highly (2007). o.Bo.Cell Biol. Mol. ,G,Jlosa . Tavenet, D., Julkowska, G., ´, 21) h ii rti IFT88 protein cilia The (2011). 20) nrfaelrtransport Intraflagellar (2009). 141 utpeHptei Tracking Hypothesis Multiple Nature transporter surface A (2009). 993-1008. , 20) h intraflagellar The (2006). 13 19) iei-Iis Kinesin-II (1999). 459 461-468. , 213-217. , ´ 19 iu td la de et rieur o.Biochem. Mol. 929-944. , ´ iaeand dicale 20) A (2009). (2010). Curr. ien,G,Sua . edro,S,Sgl . annn .adSsaoi M. Sassaroli, and H. Vaananen, M., Segil, S., Henderson, E., Siuda, G., Piperno, Gorja iio . emr . azvcha . acgii . atl,F,Dee,D R., D. Diener, F., Cantele, E., Paccagnini, S., Lanzavecchia, S., Geimer, G., Pigino, rzo .T,Wdmn .P,Sgo,D,Bon . oe .adShly .M. J. Scholey, and L. Rose, H., Brown, D., Signor, P., K. Wedaman, M. T., M. J. Orozco, Barr, and S. N. Morsci, aor .J,Dcet .L,Vcc,Y,See,E . oebu,J . Witman, L., J. Rosenbaum, S., E. Seeley, Y., Vucica, L., B. Dickert, J., G. Pazour, ehrc,K . ono,E . aa,T,Ccrn . alf .A,Rs,J., Rush, A., B. Ballif, D., Cochran, T., Sakai, C., E. Johnson, F., K. Lechtreck, omnk,K . ec,P .adRsnam .L. J. Rosenbaum, and L. P. Beech, L. G., J. K. Rosenbaum, Kozminski, and P. Forscher, A., K. Johnson, G., K. P. Kozminski, Bastin, and D. Robinson, L., Kohl, P. Bastin, and G. D. Piperno, Julkowska, and M. Sassaroli, V., Babaev-Khaimov, C., Iomini, oisn .R,Sewn . luio,A,Bad .H n ul K. Gull, and H. E. Byard, A., Ploubidou, T., Sherwin, R., D. Robinson, Bre E., J. J. Guidotti, G., Rosenbaum, Margall-Ducos, and A., Robert, D. Diener, Z., Wang, H., Qin, unf,D,Lu . aea,A . uca .S,Nsadr .adAnderson, and L. Niswander, S., N. Murcia, S., A. Rakeman, A., Liu, D., Huangfu, M. J. Scholey, and L. Hao, Gorja rn .V,Hyrf,C . eshtoa .Y,TreDa,A,Sotan .W., R. Stottmann, A., Turbe-Doan, Y., T. Besschetnova, J., C. Haycraft, V., P. Tran, Brust-Mascher, M., H. Zhou, R., M. Walker, L., A. Gunnarson, G., Ou, J., J. Snow, G. Schwarz, V. K. Anderson, and M. M. J. Scholey, S. Spa and King, P. Bastin, and A., S. M. Morales, R. B., Rotureau, Patel-King, B., L. Pedersen, P., Rompolas, inr . eaa,K . rzo .T,Dyr .D,Brmn,C . Rose, I., C. Bargmann, D., N. Dwyer, T., J. Orozco, P., K. Wedaman, D., Signor, 19) itntmtnso ergaeitalgla rnpr IT hr similar share (IFT) transport intraflagellar defects. retrograde molecular of and morphological mutants Distinct (1998). oebu,J .adLpti P. Lupetti, trains and particle transport L. intraflagellar J. Rosenbaum, oyytckde ies eet77 r eurdfrasml fclaadflagella. and cilia of assembly for required Biol. are Cell tg737, J. gene disease kidney polycystic 19) oeeto oo n ag ln cilia. along cargo and motor of Movement (1999). .B n oe .G. D. Cole, and B. G. rnpr nml-pcfcclaof cilia male-specific B. in transport proteins signaling G. specific of Witman, export for and required flagella. cargo M. IFT from an Ikebe, is BBSome J., reinhardtii G. Pazour, iei-iepoenFA0i novdi oiiyascae ihteflagellar the with associated motility in involved is membrane. FLA10 protein kinesin-like trypanosomes. 628-637. control. cell-cycle in involved protein G small a is 27 protein oiiyi h uaytcfaelmurltdt lgla beating. flagellar to unrelated USA flagellum Sci. eukaryotic the in motility trypanosomes. of cytokinesis and morphogenesis four of consisting cycle transport a undergo flagella phases. Chlamydomonas in particles proteins. V. K. 889-892. microscope. the on biology assembly. envelope nuclear post-mitotic in directly W. participate I. Mattaj, and P. irtbl oaiyaddnmc ntecnrlo rael positioning, organelle of control cycle. the cell trypanosome in the in dynamics cytokinesis and and segregation, polarity Microtubule cells. non-ciliated in transition G1-S regulating protein centrosomal C. Desdouets, and ern .J,Ceer,A . i,H,Shr,P . hh .V tal. et V. affects J. and Shah, transduction cilia. J., signal in P. hedgehog transport Scherz, sonic intraflagellar H., mouse retrograde Qiu, modulates L., negatively A. THM1 Chesebro, J., neurons. B. Herron, elegans C. on cilia sensory M. 1113. build J. to Scholey, cooperate and I. role sensory development? key and a signalling Trypanosomatids: parasite in in connection kinase protein mitogen-activated 1172. rnpr fITmtr n F atprilsaogcla u o edie,in dendrites, not but cilia, along particles raft IFT living and of motors neurons M. chemosensory IFT J. of Scholey, transport and S. L. signaling. the with associated chain intermediate dynein motor. a transport intraflagellar is retrograde FAP133 Chlamydomonas ńa ńa c,M,Kek,E . ay . atrla . Lo R., Santarella, V., Galy, P., E. Klerkx, M., ćz, c,M,Mta,I .adRedr,J. Rietdorf, and W. I. Mattaj, M., ćz, 20) eghgsgaln ntemuerqie nrfaelrtransport intraflagellar requires mouse the in signalling Hedgehog (2003). .Cl Biol. Cell J. Nature 90 Cell 17) siaigtedmnino model. a of dimension the Estimating (1978). .Cl Biol. Cell J. 5519-5523. , 151 .Cl Biol. Cell J. ehd elBiol. Cell Methods 125 709-718. , 426 439-442. , 20) h nrfaelrtasotcmoetIT8plrsi a is IFT88/polaris component transport intraflagellar The (2007). 83-87. , 153 (2007a). 13-24. , 131 (2000). 20) nrfaelrtasota glance. a at transport Intraflagellar (2009). 20) w neord nrfaelrtasotmotors transport intraflagellar anterograde Two (2004). 187 mgn Micro. Imaging 1517-1527. , 19) oeo ls H1 yeni retrograde in dynein DHC1b class a of Role (1999). 20) ol o nlzn nrfaelrtasotin transport intraflagellar analyzing for Tools (2009). 1117-1132. , anradtselegans Caenorhabditis anradtseeas .Cl Biol. Cell J. elegans. Caenorhabditis Chlamydomonas anradtseeas ur Biol. Curr. elegans. Caenorhabditis 21) iei- L- euae intraflagellar regulates KLP-6 Kinesin-3 (2011). 93 20) nrfaelrtasotadcilium-based and transport Intraflagellar (2006). 59-80. , nst.J elBiol. Cell J. situ. in .Cl Biol. Cell J. 20) oe oe o h lglu ncell in flagellum the for roles Novel (2003). el Microbiol. Cell. 20) lcrntmgahcaayi of analysis Electron-tomographic (2009). .Cl Sci. Cell J. a.Genet. Nat. 9 26-27. , 20b.Sm iei o:switching hot: it like Some (2007b). gre . eai . Bre C., Celati, O., ´gerie, MOJ. EMBO t,G F. G. ¨th, F8 n t os homologue, mouse its and IFT88 Nature 143 120 20) nrfaelrtransport Intraflagellar (2007). 20) h Chlamydomonas The (2009). 40 1591-1601. , 19) The (1995). A- n t iaeVRK-1 kinase its and BAF-1 3653-3665. , 403-410. , pzIlsa,C,Askjaer, C., ´pez-Iglesias, 11 n.Stat. Ann. 187 398 a.Cl Biol. Cell Nat. 710-718. , 22 .Cl Biol. Cell J. ur Biol. Curr. 20) h flagellum- The (2009). 135-148. , MOJ. EMBO 5336-5346. , 674. , rc al Acad. Natl. Proc. Chlamydomonas 6 .Cl Sci. Cell J. .Cl Sci. Cell J. 20) Protein (2001). 461-464. , 21 147 1239-1244. , 26 17 128 519-530. , 132-143. , 193-202. , 19) A (1993). co,C. ćhot, 6 1109- , 1163- , (2007). (1995). (2008). 120 122 , ,