CBP/P300-Interacting Protein CITED1 Modulates Parathyroid Hormone Regulation of Osteoblastic Differentiation

CBP/p300-Interacting Protein CITED1 Modulates Parathyroid Hormone Regulation of Osteoblastic Differentiation

Dehong Yang, Jun Guo, Paola Divieti, Toshi Shioda, and F. Richard Bringhurst Endocrine Unit (D.Y., J.G., P.D., F.R.B.), Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114; and Molecular Profiling Laboratory (T.S.), Massachusetts General Hospital Cancer Center, Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021 Charlestown, Massachusetts 02129

PTH regulates osteoblastic differentiation and activity and comparison with wild type (WT) osteoblasts. This effect was exerts different overall skeletal effects in vivo, depending on blocked by restoration of CITED1 expression via adenoviral the schedule and dose of administration. In clonal Wt9 murine gene transfer. Intermittent administration of hPTH(1–34) (10 osteoblastic cells, mRNA and protein levels of CITED1 tran- nM, for 4 h every 48 h) for 3–6 wk increased mineralization up scriptional coactivator were strongly up-regulated by human to 2-fold over basal levels in both WT and CITED1 KO mouse (h) PTH(1–34). Stimulation of CITED1 mRNA by PTH was tran- calvarial cell cultures. Whereas the cAMP-selective sient, peaking at 4 h, concentration dependent, and blocked by [G1,R19]hPTH(1–28) analog [at 100 nM, equivalent to 10 nM actinomycin D but not cycloheximide. The stimulation was hPTH(1–34)] did not stimulate mineralization in WT cultures, mimicked by forskolin, phorbol ester, and the cAMP-selective it was twice as effective as hPTH(1–34) in CITED1 KO cultures. PTH analog [G1,R19] hPTH (1–28) and inhibited completely by Thus, CITED1 negatively regulates osteoblastic differentia- the protein kinase A inhibitor, H89 and partially by phorbol tion in vitro and inhibits the cAMP-dependent stimulation of ester-induced protein kinase C depletion. Increased CITED1 differentiation by intermittent PTH. We conclude also that expression was not maintained during persistent (24 h) PTH PTH receptor signaling pathways independent of cAMP re- exposure. Cultured primary calvarial osteoblasts from neo- strain osteoblastic differentiation, an effect normally ob- natal homozygous or hemizygous CITED1-knockout (KO) scured in the presence of CITED1 but revealed in its absence. mice achieved 2-fold greater mineralized nodule formation in (Endocrinology 149: 1728–1735, 2008)

TH INCREASES BONE mass when administered inter- mone’s action on osteoblasts (6, 7). In a preliminary (unpub- P mittently at appropriate doses to animals or humans, lished) DNA microarray study in a clonal osteoblastic cell whereas continuous exposure to high concentrations of the line (Wt9), we identified CITED1 as a gene whose expression hormone accelerates bone turnover and sustains net bone was strongly up-regulated by PTH. This study was directed resorption and bone loss, especially at cortical sites (1–4). at understanding the role of CITED1 in osteoblasts and in Both of these effects of PTH on bone metabolism are believed their functional response to PTH. to be mediated by activation of PTH/PTHrP receptors The gene for CITED1, formerly melanocyte-specific gene (PTHR1) expressed in cells of the osteoblastic lineage, which 1, was mapped to the X chromosome (8) and identified as a indirectly regulate the osteoclastic response (5). More de- nuclear protein (9). Recent studies have shown that CITED1, tailed understanding of the molecular mechanisms of PTH as well as CITED2, CITED3, and CITED4, strongly activates action on bone metabolism is of intense interest, and it would transcription via the interaction of its conserved C-terminal be particularly advantageous to learn whether it is possible transcriptional activating domain (CR2 domain) with CBP/ to modulate the balance between the anabolic and catabolic p300 (10, 11). CITED1 binds CBP/p300 to form a complex, effects of the hormone in vivo. which then interacts with mothers against decapentaplegic Analysis of osteoblastic gene regulation by PTH has pro- homolog-4 to enhance transcription induced by TGF␤. The vided important clues to the molecular basis of the hor- binding affinity of CITED1 to CBP/p300 and enhancement of mothers against decapentaplegic homolog-mediated tran- First Published Online January 10, 2008 Abbreviations: Ad-CITED1, Adenovirus designed to express CIT- scription is suppressed by heat-shock cognate protein 70, ED1; Ad-Lac Z, adenovirus designed to express ␤-galactosidose as a possibly via a competition mechanism (heat-shock cognate control protein; ALP, alkaline phosphatase; CBP, CREB-binding protein; protein 70 also forms a complex with CITED1) (10, 11). CHX, cycloheximide; CITED1, CBP/p300-interacting transactivator CITED1 also selectively binds the activation function 2 do- with glutamic acid/aspartic acid-rich C-terminal domain-1; CREB, ␣ ␤ cAMP response element binding protein; FBS, fetal bovine serum; GFP, main of the liganded estrogen receptors- and - and may green fluorescent protein; hPTH, human PTH; KO, knockout; PKA, enhance estrogen-dependent gene transcription (including protein kinase A; PKC, protein kinase C; PLC, phospholipase C; PTHR1, up-regulation of TGF␣) (12). Given that TGFs and estrogen, PTH/PTHrP receptor; RAMP3, receptor activity modifying protein-3; TPA, phorbol ester; WT, wild type. like PTH, are powerful regulators of bone metabolism, our finding that CITED1 is induced by PTH in osteoblasts led us Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the to anticipate that CITED1 may play a role in controlling endocrine community. osteoblastic differentiation and its regulation by PTH.

1728 Yang et al. • CITED1, PTH, and Osteoblastic Differentiation Endocrinology, April 2008, 149(4):1728–1735 1729

Materials and Methods Public Health Commission, consistent with National Institutes of Health Peptides and other reagents guidelines. Adenovirus infection was conducted 1 d after primary osteoblasts PTH peptides used in these experiments were prepared as previously were plated into cell culture dishes. Briefly, cells were suspended by described (13). Other reagents were purchased from Sigma-Aldrich Inc. trypsin, counted, and plated into type I collagen-coated 24-well plates (St. Louis, MO) unless noted otherwise. (5 ϫ 104 cells/well, for mineralization) or six-well plates (2 ϫ 105 cells/ well, for quantitative PCR and Western blot experiments). After 24 h, the ␣ ␣ Mice cells were washed twice with MEM medium and refed with MEM supplemented with 10% FBS. Ad-CITED1 or control virus (Ad-Lac Z) Wild-type (WT) and pregnant C57BL/6J mice were purchased from was added into each well at the concentration of 100 infectious units the Jackson Laboratory (Bar Harbor, ME). CITED1 knockout (KO) mice (ifu)/cell. After 48 h, the cells were refed with mineralization medium [previously generated by ablation of the second and third exons of the (␣MEM plus 10% FBS, 10 mm ␤-glycerophosphate, and 50 ␮g/ml ascor- CITED1 gene and maintained in a mixed C57BL/6J and 129sv back- bic acid) and then refed with this medium three times a week. ground (14)] were genotyped using a Lac Z-PGK-neo cassette incorpo- rated in the targeting vector. For isolation of primary osteoblasts (see RNA isolation Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021 below), pups with the desired genotypes were produced by matings of ϫ 4 heterozygous females (neo/X) with either hemizygous (neo/Y) or WT Cells were plated into six-well plates or 10-cm dishes at 2.5 10 2 ␣ (X/Y) males. Mice, housed five or fewer per cage, were given free access cells/cm and maintained at 37 C in MEM supplemented with 10% FBS. to water and fed with a standard diet in a room maintained at 22 C with The concentration of FBS was reduced to 1% when the cells reached 90% 60–75% humidity on a 12-h light, 12-h dark cycle. Animals were main- confluence, and 24 h thereafter cells were treated with human (h) tained in facilities operated by the Center for Comparative Medicine of PTH(1–34) or other agents, for designated time intervals. Before RNA the Massachusetts General Hospital in accordance with the National extraction, cells were washed gently with cold PBS three times and total Institutes of Health Guide for the Care and Use of Laboratory Animals, RNA was isolated using an RNeasy kit (Qiagen Science, Gaithersburg, and protocols were approved by the institution’s subcommittee on re- MD). search animal care. Quantitative RT-PCR Cell culture Expression of CITED1 and other mRNAs was measured by two-step Clonal Wt9 osteoblastic cells were generated and maintained as pre- real-time PCR performed as previously described (15). The primers used viously described (15), MC3T3-E1 cells were purchased from American are shown in Table 1. Type Culture Collection (Manassas, VA) and cultured under the same conditions as previously described (15). Western blots We isolated and cultured calvarial osteoblasts from each neonatal Cells were lysed in radioimmunoprecipitation assay solution [1% mouse separately until the genotype was identified, whereupon the cells Nonidet P-40, 1% sodium deoxycholate, 0.1% (wt/vol) sodium dodecyl were combined into a CITED1-KO (NEO/NEO; NEO/Y) group or a WT sulfate, 0.15 m NaCl, 2 mm EDTA, 50 mm NaF, 0.2 mm sodium vanadate, (X/Y; X/X) group, respectively, for long-term culture. The DNA spec- and 4 ␮l/ml of protease inhibitor cocktail] by repeated passage through imens used for PCR genotyping were extracted by a genomic DNA a 22-gauge needle. Western blots of the protein samples were conducted isolation kit (Qiagen Science, Germantown, MD) from tails collected as described (15). Monoclonal antibody directed against CITED1 was during cell isolation. For WT allele amplification, forward primer (5Ј- generated as described by Yahata et al. (12). Intensity of the Western blot AACCCCCATCCTTCAACCTG-3Ј) and reverse primer (5Ј-AACA- bands were quantified densitometrically (AlphaImager 2200; Alpha In- GAATCGGTGGCTTTTT-3Ј) generated a 439-bp band, whereas for notech Corp., San Leandro, CA), normalized to the level of the same mutant allele (NEO insertion) detection, primers of 5Ј-TGGTC- protein measured in control cells (set at 1.0) and presented as fold over GAATGGGCAGGTAGC-3Ј and 5Ј-CGCTTGGGTGGAGAGGCTAT-3Ј control. produced a 366-bp fragment. For cell isolation, minced calvarial fron- toparietal bones from 2-d-old neonatal mice were subjected to sequential collagenase (type I and II; ratio 1:3) digestion. Of six fractions generated cAMP accumulation by serial 20-min digestions, fractions 3–6 were combined and the cells cAMP accumulation was measured as described previously (15). were plated at 5 ϫ 104/cm2 in a humidified atmosphere (95% air-5% ␣ CO2)in MEM supplemented with 10% fetal bovine serum (FBS) (16). Assays of cellular differentiation Adenovirus generation and infection Osteoblastic cells from WT and CITED1 gene KO mice were plated in 24-well plates coated with type I collagen (BD Bioscience, Bedford, Ј CITED1 cDNA, including a 5 Kozak sequence, was cloned by PCR MA) at the concentration of 5 ϫ 104/well, and incubated at 37 C until using high-fidelity Taq enzyme (Invitrogen, Carlsbad, CA), and its se- 90% confluent. Treatment with PTH peptide then was conducted using quence was confirmed by dual-direction DNA sequencing. Adenovi- a 4 h/48 h schedule, whereby cells were cultured in mineralization ruses designed to express either CITED1 (Ad-CITED1) or control pro- medium containing peptide or vehicle alone (0.1% trifluoroacetic acid) teins [Ad-Lac Z or adenoviruses expressing green fluorescent protein for 4 h, at which point the medium with peptide or vehicle was aspirated (GFP)] were generated using the BD Adeno-X Expression System 1 and cells were rinsed with ␣MEM twice before being refed with fresh (CLONTECH Laboratories, Inc., Mountain View, CA). In brief, CITED1 cDNA was first cloned into pShuttle plasmid by endonuclease digestion TABLE 1. Primers for quantitative RT-PCR and ligation, after which a mammalian expression cassette carrying the CITED1 cDNA was cut from the pShuttle plasmid with I-ceu/PI-Sce I Forward Reverse and subsequently inserted into linearized adenoviral DNA using T 4 CITED1 ccactagctcctctggatcg agccccttggtactggctat ligase. The viral DNA packaging and virus amplification were accom- CITED2 ctgcagaagctcaacaacca ctggtttgtcccgttcatct plished in HEK 293 cells. Purification of virus was accomplished with CITED4 gtagcacgcacctgcagtc gaagcaatcgaactcgctct a virus purification kit, using a filter system that binds virus (CLON- GAPDH tgtcgtggagtctactggtg gcattgctgacaatcttgag TECH). Viral titers were determined by infecting HEK293 cells with RANKL agccgagactacggcaagta gcgctcgaaagtacaggaac serially 10-fold diluted virus and detecting infected cells using an im- RAMP3 tgcaccttcttccactgttg aggttgcaccacttccagac munohistochemical stain for the viral hexon (Adeno-X rapid titer kit; BSP agggaactgaccagtgttgg actcaacggtgctgcttttt CLONTECH). Expression of CITED1 was detected by RT-PCR and OC aagcaggagggcaataaggt gcggtcttcaagccatactg Western blot (as described below) 2 d after addition of virus to the cells. ALP gctgatatgagatgtcctt gcactgccactgcctact The protocol was approved by the Harvard Committee on Microbio- RUNX2 cccagccacctttacctaca tatggagtgctgctggtctg logical Safety, certified by the Environmental Health Office of the Boston 1730 Endocrinology, April 2008, 149(4):1728–1735 Yang et al. • CITED1, PTH, and Osteoblastic Differentiation mineralization medium and incubated for another 44 h before the pro- A cedure was repeated. After defined intervals, alkaline phosphatase 15 CON (ALP) activity was assessed histochemically or enzymatically in cell

PTH(1-34) )

lysates using methods previously described (15). Results of enzymatic l o

r *

assays were expressed in terms of standard units of ALP activity. t n

For analysis of matrix mineralization, cells plated and treated as o 10

/ d

above were fixed in 10% neutral formalin at the designated time and the l o

presence of mineralized nodules was assessed by Alizarin Red staining. F

(

Briefly, the fixed cells were gently washed with distilled water, incu- A

N 5

bated in 0.1% Alizarin Red S/70% ethanol solution and then washed R with distilled water. Alternatively, to determine the calcium content of m ϩ ϩ the cultures, cell monolayers were washed in Ca2 - and Mg2 -free PBS and then incubated for3hin0.2mlof0.6n HCl. Extracted calcium then 0 was measured spectrophotometrically at 612 nm after reaction with CITED1 CITED2 CITED4 methylthymol blue (17). CITED GENES Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021 B Cell number and apoptosis

) 4 l CON

o * r Primary calvarial osteoblastic cells, isolated from WT and KO neo- t

n PTH(1-34) o nates, were plated in type I collagen-coated 24-well plates and incubated c

/ 3 d

at 37 C in ␣MEM ϩ10% FBS until confluence. Cells then were exposed l

o F

to cyclic intermittent 4 h/48 h treatment with PTH peptides as described (

above. At selected intervals (d 3, 14, and 28), cell number in each well A 2 N

was assessed by addition of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe- R

m nyltetrazolium and production of formazan product was measured 1 1

spectrophotometrically according to the manufacturer’s instructions D

E T (Promega Corp., Madison, WI). I For measurements of apoptosis, calvarial osteoblasts were plated in C 0 24-well plates, cultured, and treated with PTH peptides as described in CON PTH(1-34) table legends. Cells were detached enzymatically (ACCUMAX; Chemi- con, Temecula, CA), washed once with PBS, and stained with Annexin C 6 h 24 h and 7-amino-actinomycin D (Guava Nexin kit; Guava Technologies Inc., Hayward, CA) before enumeration of the percentage of early (annexin control PTH(1-34) control PTH(1-34) positive/7-amino-actinomycin negative) apoptotic cells by flow cytom- etry (Guava PCA, GTI-0300375; Guava Technologies, Inc.). CITED1 Results CITED1 is up-regulated by hPTH(1–34) in osteoblasts β-actin CITED1 was identified in preliminary cDNA microarray experiments (unpublished data) as a gene whose transcrip- D tion was strongly up-regulated by hPTH(1–34) within 4 h in * β-ACTIN

the clonal calvarial osteoblastic cell line Wt9 (15). This initial )

l 1.5 CITED1 o

microarray result was confirmed by quantitative RT-PCR, r

t n

which showed that CITED1 mRNA in Wt9 cells was in- o c creased as much as 10-fold by 4 h stimulation with f

o 1.0 d

hPTH(1–34) at 100 nm (Fig. 1A). Neither CITED2 nor l o

CITED4, other members of the mammalian CITED gene fam- F ( 0.5

ily, was regulated by PTH (Fig. 1A). To determine whether y

t i

this CITED1 response to PTH was characteristic of normal s n osteoblasts, we isolated primary calvarial osteoblasts from e D 0.0 C57BL/6 neonatal mice. As shown in Fig. 1B, CITED1 mRNA CON PTH CON PTH was increased 3-fold (up to 4-fold in some experiments) in 6 h 24 h response to treatment with hPTH(1–34) (100 nm). Similar FIG. 1. CITED1 expression in osteoblasts. A, Wt9 cells were treated with results were observed using MC3T3-E1 cells (data not 100 nM hPTH(1–34) for 4 h before extraction of RNA and subsequent mea- shown). Western blot analysis in Wt9 cells indicated that surement of CITED1, CITED2, and CITED4 mRNA expression by quan- CITED1 protein expression also was increased by6hof titative RT-PCR, as described in Materials and Methods. Results are ex- treatment with hPTH(1–34) but returned to baseline despite pressed as fold over control. B, Primary osteoblasts isolated from neonatal C57BL6 mice were treated with 100 nM hPTH(1–34) for 4 h before RNA the presumed continued presence of hPTH(1–34) (Fig. 1, C extraction and measurement of CITED1 mRNA expression, as in A. C, Wt9 and D). To determine whether CITED1 might be a PTH- cells were treated with 30 nM hPTH(1–34), or vehicle alone (control), for 6 h induced primary response gene, Wt9 cells were treated with or 24 h before simultaneous extraction of proteins in radioimmunoprecipi- cycloheximide (CHX; 5 ␮g/ml) for1htoinhibit protein tation assay buffer and assessment of CITED1 expression by Western blot ␤ synthesis before addition of hPTH(1–34) at 30 nm. The effect analysis. D, Intensities of CITED1 and -actin protein bands from five experiments performed as in C were assessed densitometrically (see Ma- on CITED1 mRNA induction was compared with that on terials and Methods) and are presented as fold over the corresponding 6 h receptor activity modifying protein-3 (RAMP3), which we control in each experiment. Data are shown as mean Ϯ SD for groups of three and others have found to be strongly induced in osteoblasts cultures (A and B). *, P Ͻ 0.01 vs. control (CON). Yang et al. • CITED1, PTH, and Osteoblastic Differentiation Endocrinology, April 2008, 149(4):1728–1735 1731

12 CON A * PTH(1-34)

a b c 10.0

) l

10 Act D o r CON

t * n

Act D + PTH o

c PTH (1-34)

/ 7.5 d CHX l *

8 o

F (

CHX + PTH

A 5.0

N R

6 m

a c 1

D 2.5

E T a I 4 C

mRNA (Fold/control) a 0.0 124824 Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021 2 Time (h)

bb B

0 7.5 )

CITED1 RAMP3 l PTH(1-34)

o r

t 1 19

n G R (1-28)

FIG. 2. CITED1 is a primary response gene transcriptionally regu- o

/ d

lated by PTH. Wt9 cells were treated with actinomycin D (ActD; 5 l 5.0 o

␮ ␮ M F

g/ml) or CHX (5 g/ml) for 1 h before addition of hPTH(1–34) (30 n ). (

After4hofPTHexposure, total RNA was extracted from the cells and A N

the expression levels of CITED1 and RAMP3 mRNA were measured R m

by quantitative RT-PCR and shown as fold over control (CON). Ex- 2.5 1

periments were performed three times with similar results. Data D

E T shown are mean Ϯ SD for groups of two cultures each. a, P Ͻ 0.01 vs. I control; b, P Ͻ 0.01 vs. PTH; c, P Ͻ 0.05 vs. CHX. C 0.0 -10 -9 -8 -7 -6 by PTH (13, 18). As shown in Fig. 2, CHX pretreatment did Peptide (M) not inhibit the increase in CITED1 mRNA induced by4hof PTH treatment, whereas CHX enhanced PTH induction of FIG. 3. PTH increases CITED1 expression in a dose- and time-de- ␮ pendent manner in osteoblasts. Wt9 cells were treated with 100 nM RAMP3 mRNA, as expected (18). Actinomycin D (5 g/ml), hPTH(1–34) for indicated times (A) or 4 h with hPTH(1–34) or an inhibitor of RNA synthesis, completely blocked PTH- G1R19(1–28) at the indicated concentrations (B). Total RNA was ex- induced expression of CITED1 (and RAMP3), indicating that tracted and the expression of CITED1 was measured by quantitative PTH increases CITED1 mRNA expression via an effect on RT-PCR and expressed as fold over control. Experiments were per- Ϯ transcription (Fig. 2). Taken together, these data are consis- formed three times with similar results. Data are shown as mean SD for groups of three cultures. *, P Ͻ 0.01 vs. control (CON). tent with the possibility that CITED1 may be a primary response gene for PTH action in osteoblastic cells. hPTH(1–34) in Wt9 cells was concentration dependent, PTH(1–34) increases CITED1 expression in a dose- and increasing between 1 nm and 100 nm, which induced the time-dependent manner in osteoblasts maximal response (Fig. 3B). To further analyze the effect of PTH on CITED1 expres- Signaling pathways mediating increased CITED1 sion, we investigated the time- and concentration-depen- expression by PTH dence of increased CITED1 mRNA expression in response to hPTH(1–34). As shown in Fig. 3A, CITED1 mRNA expres- Upon binding active ligand, the PTHR1 engages several sion in Wt9 cells increased 5-fold between 1 and 2 h after parallel signaling pathways, including cAMP/protein kinase addition of hPTH(1–34) and peaked (10-fold) at 4 h, declining A (PKA), and activation of protein kinase C (PKC) via either thereafter to baseline by 24 h in the continued presence of the phospholipase C (PLC)-dependent or PLC-independent hormone (consistent with the results of Western blot anal- mechanisms (15). To determine which PTHR1 signaling ysis, Fig. 1, C and D). Studies of PTH peptide stability in pathway(s) is involved in the up-regulation of CITED1 ex- osteoblastic cultures confirmed that 80% of hPTH(1–34) bio- pression, we first studied the responses to PKA and PKC activity could be recovered in medium after 24 h of incuba- pathway agonists or antagonists. These were compared with tion with cells (see supplemental Fig. 1, published as sup- those of RAMP3 mRNA, which is known to be regulated plemental data on The Endocrine Society’s Journals Online mainly by cAMP/PKA in osteoblasts (18). As shown in Fig. Ϫ Web site at http://endo.endojournals.org). In primary mu- 4A, forskolin (10 7 m), like hPTH(1–34), strongly induced rine calvarial osteoblasts, persistent (nonpulsatile) exposure CITED1 mRNA expression, as with RAMP3 mRNA expres- Ϫ to hPTH(1–34) (100 nm) for 8 d blocked the acute up-regu- sion. Active phorbol ester (TPA; 10 7 m) also mimicked the lation of CITED1 at 4 h; in contrast, three cycles of intermit- PTH CITED1 response but not the RAMP3 response. Pre- tent exposure (4 h every 48 h) to the same dose treatment for 1 h with the PKA inhibitor H89 (20 ␮m), entirely of hPTH(1–34) or [G1R19]hPTH(1–28) (G1R19(1–28)) did not blocked the CITED1 mRNA response to both PTH and for- prevent the acute CITED1 response to PTH rechallenge skolin (Fig. 4B). Prolonged pretreatment with TPA (1 ␮m) for (supplemental Fig. 2). The CITED1 mRNA response to 16 h to deplete PKC significantly inhibited PTH’s effect on 1732 Endocrinology, April 2008, 149(4):1728–1735 Yang et al. • CITED1, PTH, and Osteoblastic Differentiation

teoblasts from WT and CITED1 KO neonatal mice. Both cell A 2 5 a

CON populations demonstrated the same cAMP response to ) l ϭ Ϯ ϭ o 20 m

r PTH(1-34) hPTH(1–34) with the same EC50 (WT 0.83 0.14 n ,KO t

n a Ϯ

o FSK 0.86 0.21 nm; supplemental Fig. 3A). After culturing these c

/ 15 d

l a TPA calvarial osteoblasts in mineralization medium for 4 wk, we

o F

( a observed that CITED1 KO cells produced more bone nodules

A 10 a

N than WT cells and deposited roughly twice as much calcium R

m 5 in the matrix (Fig. 5A; also see Figs. 6 and 7). Expression of osteoblastic genes (bone sialoprotein, osteocalcin, runt-re- 0 CITED1 RAMP3 lated transcription factor 2, alkaline phosphatase, and receptor activator of nuclear factor-␬B ligand) was increased in KO B 15 a cells as well (supplemental Fig. 4). The increased differen-

a Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021

CON tiation demonstrated by CITED1 KO osteoblasts seemed not

) l

o to be related to altered proliferation or apoptosis (supple- r

t PTH(1-34)

n 10 o mental Tables 1 and 2).

c H89

/ d l To ascertain whether this augmented differentiation ob-

o H89+PTH(1-34) F ( a served in cultured KO calvarial osteoblasts was due to the A c FSK N 5 absence of CITED1 per se, as opposed to an alteration of the R a H89+FSK m c cell population or other secondary effects of the absence of b CITED1 in vivo, we prepared a recombinant replication-de- 0 CITED1 RAMP3 fective adenovirus encoding CITED1 (Ad-CITED1) and infected CITED1 KO cells in vitro. In preliminary experiments, C the efficiency of infection was analyzed by quantitative RT- 7.5 a

CON PCR and Western blotting, which showed that 2 wk after ) l ϭ o a r PTH(1-34) Ad-CITED1 infection (multiplicity of infection 100 ifu/

t a d n

o cell), the CITED1 gene was persistently expressed in CITED1

c Pre-TPA

/ 5.0 d l KO cells, with mRNA levels approximately 30-fold that seen

o Pre-TPA+PTH(1-34) F

( in WT cells (supplemental Fig. 5A). CITED1 expression re- A

N a b d

R 2.5 m

0.0 CITED1 RAMP3

FIG. 4. Signaling pathways mediating increased CITED1 expression by PTH(1–34). Wt9 cells were exposed to the indicated agonists for 4 h, Ϯ pretreatment with inhibitors for 1 h, before extraction of total RNA and measurement of CITED1 and RAMP3 mRNA expression by quantitative RT-PCR (see Materials and Methods). A, Cells were treated Ϫ with vehicle (CON), 100 nM hPTH(1–34) PTH(1–34)), 10 7 M forskolin Ϫ (FSK), or 10 7 M TPA for 4 h. B, Cells were treated with hPTH(1–34) or forskolin as in A Ϯ pretreatment with the PKA inhibitor H89 (20 ␮M). C, Cells were stimulated with hPTH(1–34) as in A with or with- Ϫ out prolonged (16 h) pretreatment with 10 6 M TPA (Pre-TPA). Ex- periments were performed three times with similar results. Data are shown as mean Ϯ SD for groups of three cultures. a, P Ͻ 0.01 vs. control; b, P Ͻ 0.01 vs. PTH; c, P Ͻ 0.05 vs. Fsk; d, P Ͻ 0.01 vs. pre-TPA. the expression of CITED1 (PTH ϭ 5.5-fold, control ϭ pre- TPA ϭ 1-fold, pre-TPAϩPTH ϭ 2-fold) but not that of RAMP3 (Fig. 4C). Finally, G1R19(1–28), a cAMP/PKA-selective PTH analog (15), also increased CITED1 expression, although to a slightly lower maximum and with 10-fold less FIG. 5. Regulation of osteoblastic mineralization by CITED1. WT potency, as expected from its comparably reduced potency and CITED1 KO primary calvarial osteoblasts isolated from neonatal for stimulation of cAMP (Fig. 3B and supplemental Fig. 3). mice (A) or CITED1 KO primary calvarial osteoblasts, either unin- Collectively, these data are consistent with a role for cAMP/ fected (CON) or infected with Ad-CITED1 or Ad-Lac-Z at 100 ifu/cell (B) were cultured in mineralization medium for 4 wk. Mineralized PKA and, to a lesser extent, PKC in up-regulation of CITED1 nodules in the cultures then were assessed by staining with Alizarin expression by PTHR1s. Red S and imaged by either plate scanning (A, top panel, and B) or microscopy (A, bottom panel, at magnification ϫ40). Calcium content CITED1 is an inhibitor of osteoblastic mineralization was measured in acid extracts (see Materials and Methods). Exper- iments were performed three times with similar results. Calcium To determine whether CITED1 is involved in regulating content (milligrams per well) is expressed as mean Ϯ SD for groups of osteoblast differentiation, we isolated primary calvarial os- three cultures. *, P Ͻ 0.01 vs. WT (A) or uninfected controls (B). Yang et al. • CITED1, PTH, and Osteoblastic Differentiation Endocrinology, April 2008, 149(4):1728–1735 1733

WT KO PTH (1-34) G1R19 (1-28) PTH (1-34) G1R19 (1-28) 0 10 nM 100 nM 0 10 nM 100 nM

ALP

a 1.10 0.85 0.60 0.5 a b

0.4 c 0.3 ALP (U/well)

0.2 Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021

0.1 a b

0.0 Control PTH(1-34) G1R19(1-28) Control PTH(1-34) G1R19(1-28) WT KO

WT KO PTH (1-34) G1R19 (1-28) PTH (1-34) G1R19 (1-28) FIG. 6. Role of CITED1 in regulation of osteoblastic differentiation by 0 10 nM 100 nM 0 10 nM 100 nM intermittent PTH in 3-wk cultures. Primary osteoblastic cells from WT or CITED1 KO mice were plated in type I collagen-coated 24-well plates and cultured until 90% confluent before initiation of cyclic (4 AR-S 0 h every 48 h) PTH treatment (see Materials and Methods), using the peptides and concentrations indicated. After 3 wk, mineralization was assessed by Alizarin Red-S staining (top panel) and calcium content a was measured in acid extracts of the cultures (bottom panel). Bars 5 depict means Ϯ SE of three independent experiments. a, P Ͻ 0.01 vs. same-genotype control; b, P Ͻ 0.01 vs. G1R19(1–28) in same genotype; 4 c, P Ͻ 0.01 vs. WT control. a b 3 c a b 2 mains as high as 23-fold over controls at 4 wk after infection (supplemental Fig. 5B). Western blotting confirmed the pres- 1 ence of the expected 21-kDa CITED1 protein in the infected Calcium Content (mg/well) 0 1 19 1 19 cells (supplemental Fig. 5C). In parallel experiments, primary Control PTH(1-34) G R (1-28) Control PTH(1-34) G R (1-28) WT KO osteoblasts were infected with adenoviruses expressing GFP, after which GFP fluorescence was expressed within2dand FIG. 7. Role of CITED1 in regulation of osteoblastic differentiation by intermittent PTH in 6-wk cultures. Primary osteoblastic cells were at 2 wk was strongly expressed in virtually all cells. After 5 isolated and treated with PTH peptides as described in Fig. 6. His- wk, some GFP still was visible (supplemental Fig. 5D). tochemical staining for ALP activity (upper photograph), staining Virus-infected primary osteoblasts were cultured for 4 wk with Alizarin Red-S (lower photograph), and measurements of ALP before Alizarin Red S staining and calcium mass measure- activity (upper graph) and calcium content (lower graph) were performed after 6 wk of PTH treatment. a, P Ͻ 0.01 vs. same-genotype ment. Compared with control or Ad-Lac-Z-infected CITED1 control; b, P Ͻ 0.01 vs. G1R19(1–28) in same genotype; c, P Ͻ 0.01 vs. KO osteoblasts, those infected with active Ad-CITED1 WT control. Note interrupted ordinate scale in upper graph. showed greatly reduced mineralized nodule formation and calcium deposition, comparable with that in WT controls PKA-selective analog G1R19(1–28), applied similarly but at (Fig. 5B). 100 nm (to adjust for its reduced potency in generating cAMP) (15) (supplemental Fig. 3, B and C). Cultures were Role of CITED1 in PTH regulation of osteoblastic performed using either WT or CITED1 KO primary differentiation osteoblasts. Because PTH acutely and transiently increased CITED1 The results of a typical experiment are illustrated in Fig. 6. expression and CITED1 apparently restrains osteoblastic dif- As anticipated, after 3 wk of intermittent application, ferentiation in vitro, we sought to determine whether the hPTH(1–34) (10 nm) significantly increased bone nodule for- regulation of osteoblastic differentiation by intermittently mation and augmented calcium deposition in WT cultures by applied PTH in vitro might be modified in the absence of about 2-fold (0.569 Ϯ 0.010 vs. 0.249 Ϯ 0.007 mg/well). As CITED1. In preliminary experiments, we determined that previously observed (15), G1R19(1–28) (100 nm) did not con- intermittent treatment (4 h of 48 h) of WT primary calvarial sistently mimic this effect of hPTH(1–34) in WT cells (0.387 Ϯ osteoblasts with 10 nm hPTH(1–34) increased mineralization 0.001 mg/well). Control CITED1 KO cells again showed and calcium deposition in the cultures, as previously re- more advanced nodule formation and greater calcium dep- ported (19). To gauge the importance of the cAMP/PKA osition than did WT controls (ϳ2.5-fold: 0.602 Ϯ 005 vs. pathway in this response, we compared the effect of 10 nm 0.249 Ϯ 0.007 mg/well). Intermittent hPTH(1–34) doubled hPTH(1–34) applied intermittently with that of the cAMP/ the calcium deposition in CITED1 KO cultures (to 1.313 Ϯ 1734 Endocrinology, April 2008, 149(4):1728–1735 Yang et al. • CITED1, PTH, and Osteoblastic Differentiation

0.003 mg/well), indicating that CITED1 expression is not Nevertheless, our results, the first to link CITED1 with reg- required for the increase in osteoblastic differentiation in- ulation of bone function, strongly suggest that CITED1 reduced by intermittent PTH in vitro. Quite remarkably, how- strains the pace of osteoblastic differentiation in vitro and, ever, the absence of CITED1 uncovered striking agonism in furthermore, that it is not required for the stimulation of this assay for the cAMP/PKA-selective analog G1R19(1–28), differentiation exerted by intermittently applied PTH in the which increased calcium deposition 4-fold (to 2.565 Ϯ 0.143 murine calvarial osteoblast culture system (indeed, it pow- mg/well), a treatment effect two to three times that of erfully dampens the PTH effect, as discussed below). hPTH(1–34) itself. These differences in responsiveness to Perhaps the most surprising result of these studies was the hPTH(1–34) and G1R19(1–28) were not associated with any unexpected disproportionate augmentation, in CITED1 KO differences in apoptosis in these cultures (supplemental Ta- osteoblast cultures, of the prodifferentiating effect of inter- ble 2) or to differences in degradation of these two peptides mittently applied G1R19(1–28). G1R19(1–28) is a signal-selec- (supplemental Fig. 1). Similar results were obtained in 6-wk tive hPTH analog that lacks structural determinants needed cultures (Fig. 7), in which the augmented differentiation of for effective activation by PTHR1s of PLC (N terminal serine) Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021 control CITED1 KO cells was especially evident when as- and PLC-independent PKC (residues 29–34 of the hPTH sessed by ALP activity and the absence of any prodifferen- sequence) (21). This analog can fully activate adenylyl cy- tiation effect of G1R19(1–28) in WT cells, again contrasted clase, albeit with reduced potency (due to impaired binding dramatically with its very powerful effect, relative to caused by the C-terminal truncation). In most systems tested, hPTH(1–34), in CITED1 KO cultures. These results argue including the osteoblastic cells studied here (13) (supple- strongly that the lack of efficacy observed for G1R19(1–28) in mental Fig. 3), the potency of G1R19(1–28) is reduced ap- WT cultures is not due to its lower potency in activating proximately 10-fold relative to standard hPTH(1–34). In the cAMP/PKA and, furthermore, that the cAMP/PKA-medi- present studies, we found that intermittently applied ated differentiating effect of intermittent PTH in vitro is se- G1R19(1–28), in contrast to hPTH(1–34), did not increase os- lectively suppressed by CITED1, which, in turn, is rapidly teoblastic differentiation in WT calvarial osteoblastic cul- and transiently induced by PTH in a manner at least partly tures, even when used at a 10-fold greater molar concentra- dependent on cAMP/PKA signaling. tion (100 vs. 10 nm) needed to compensate for the impaired binding affinity and to achieve equivalent cAMP stimulation. In striking contrast, when the same experiment was per- Discussion formed with CITED1 KO cultures, intermittent G1R19(1–28) Our results indicate that expression of the transcriptional stimulated ALP and calcium deposition to a 2- to 3-fold cofactor CITED1 (mRNA and protein) is acutely and tran- greater extent than did hPTH(1–34). Several conclusions can siently increased in osteoblastic cells during brief exposure be drawn from these observations. First, the absence of a to PTH. This response is specific to CITED1 among the prodifferentiating effect of G1R19(1–28) in WT cultures is not CITED gene family members, appears to be mediated mainly due to lack of efficacy in activating PTHR1s on these cells, as via cAMP-dependent (but partly also by PKC dependent) also suggested by direct measurements of cAMP responses PTHR1 signaling, and is not inducible after persistent prior in the WT vs. KO osteoblasts (supplemental Fig. 3). Rather, exposure to the hormone. Examination of the differentiation it appears to result from a specific inhibition by CITED1 of of primary calvarial osteoblasts over several weeks in vitro the cAMP/PKA-dependent differentiation-enhancing ef- indicated that the absence of CITED1 gene expression was fect(s) of PTH. Second, although cAMP-dependent signaling associated with increased osteoblastic differentiation, as as- has been regarded as the primary basis for the anabolic effect sessed by expression of ALP and other osteoblastic genes and of PTH in vivo, it seems clear that the cAMP pathway alone formation of mineralized nodules. This augmented differ- cannot account for the effect of intermittent (4 of every 48 h) entiation was normalized upon restoration of CITED1 ex- PTHR1 activation to promote osteoblastic differentiation in pression via use of an adenoviral vector in vitro, which sug- the culture system used here. Rather, at least in the presence gests that the enhanced osteoblastic differentiation is of CITED1, cAMP-independent PTHR1 signaling, likely trig- attributable to the absence of cellular CITED1 per se and not gered by determinants in the PTH (29–34) sequence of the to other systemic influences to which the CITED1 KO cal- ligand (15), appears to play a crucial role. In contrast, the varial cells may have been exposed in vivo. This is important reversal in agonist potency between hPTH(1–34) and because CITED1-null mice obtained via matings of heterozy- G1R19(1–28) observed in this system in the absence of CITED1 gous females and hemizygous males may exhibit moderate appears to have unmasked a strong inhibitory action of some intrauterine growth retardation and lower birth weight, a form of cAMP-independent signaling as well, i.e. a response phenotype that is lost during further postnatal development that is engaged by hPTH(1–34) but not G1R19(1–28). and that has been attributed to compromised placental func- It is important to acknowledge that the effects of inter- tion (20). mittent PTH to promote differentiation of murine calvarial The conclusion that CITED1 may constitutively suppress osteoblasts in vitro bear an uncertain relation to the well- osteoblastic differentiation was unexpected, given the sup- described anabolic effects of the hormone that accompany its porting role this cofactor appears to play in other systems intermittent administration in vivo. Among other limitations, with respect to the actions of estrogen and TGF family mem- the in vitro calvarial-cell cultures may not accurately reflect bers and the fact that induction of its expression by PTH in osteoblastic responses in vivo in bones formed by endochon- vitro, like the anabolic response to PTH in vivo, is associated dral development, nor can osteoblastic responses in vitro with intermittent rather than persistent hormone exposure. predict fully the integrated response of intact bone that con- Yang et al. • CITED1, PTH, and Osteoblastic Differentiation Endocrinology, April 2008, 149(4):1728–1735 1735 tains marrow stromal cells, osteoclasts, and embedded os- 4/3 cells expressing recombinant PTH/PTHrP receptors. J Bone Miner Res 15:1766–1775 teocytes. Nevertheless, these results are useful in generating 6. Swarthout JT, D’Alonzo RC, Selvamurugan N, Partridge NC 2002 Parathy- hypotheses that can then be tested directly in vivo and likely roid hormone-dependent signaling pathways regulating genes in bone cells. reflect some actions of PTH on cells of the osteoblast lineage. Gene 282:1–17 7. Qin L, Qiu P, Wang L, Li X, Swarthout JT, Soteropoulos P, Tolias P, Partridge One such hypothesis is that CITED1 expression in bone, NC 2003 Gene expression profiles and transcription factors involved in para- transiently augmented by PTHR1 activation, may be one thyroid hormone signaling in osteoblasts revealed by microarray and bioin- component of an autoregulatory feedback loop that serves to formatics. J Biol Chem 278:19723–19731 8. Fenner MH, Parrish JE, Boyd Y, Reed V, MacDonald M, Nelson DL, Issel- restrain the extent of PTH regulation of osteoblastic function bacher KJ, Shioda T 1998 MSG1 (melanocyte-specific gene 1): mapping to (and hence its anabolic effect) and also to differentially mod- chromosome Xq13.1, genomic organization, and promoter analysis. Genomics 51:401–407 ulate the responsiveness of osteoblasts to distinct PTHR1 9. Shioda T, Fenner MH, Isselbacher KJ 1996 msg1, a novel melanocyte-specific signaling mechanisms. Our in vitro findings highlight the gene, encodes a nuclear protein and is associated with pigmentation. Proc Natl importance of further studies of skeletal responsiveness to Acad Sci USA 93:12298–12303 10. Shioda T, Lechleider RJ, Dunwoodie SL, Li H, Yahata T, de Caestecker MP, PTH in mice lacking CITED1 expression and point to CITED1 Fenner MH, Roberts AB, Isselbacher KJ 1998 Transcriptional activating ac- Downloaded from https://academic.oup.com/endo/article/149/4/1728/2455181 by guest on 02 October 2021 as a potential pharmacologic target in the treatment of bone tivity of Smad4: roles of SMAD hetero-oligomerization and enhancement by disease. an associating transactivator. Proc Natl Acad Sci USA 95:9785–9790 11. Yahata T, de Caestecker MP, Lechleider RJ, Andriole S, Roberts AB, Issel- bacher KJ, Shioda T 2000 The MSG1 non-DNA-binding transactivator binds Acknowledgments to the p300/CBP coactivators, enhancing their functional link to the Smad transcription factors. J Biol Chem 275:8825–8834 We thank Dr. Henry Kronenberg for thoughtful review of the 12. Yahata T, Shao W, Endoh H, Hur J, Coser KR, Sun H, Ueda Y, Kato S, manuscript. Isselbacher KJ, Brown M, Shioda T 2001 Selective coactivation of estrogen- dependent transcription by CITED1 CBP/p300-binding protein. Genes Dev 15:2598–2612 Received June 20, 2007. Accepted December 31, 2007. 13. Yang D, Singh R, Divieti P, Guo J, Bouxsein ML, Bringhurst FR 2007 Con- Address all correspondence and requests for reprints to: F. R. tributions of parathyroid hormone (PTH)/PTH-related peptide receptor sig- Bringhurst, M.D., Endocrine Unit, Thier 11, Massachusetts General Hos- naling pathways to the anabolic effect of PTH on bone. Bone 40:1453–1461 pital, Boston, Massachusetts 02114. E-mail: [email protected]. 14. Howlin J, McBryan J, Napoletano S, Lambe T, McArdle E, Shioda T, Martin This work was supported by National Institutes of Health Awards F 2006 CITED1 homozygous null mice display aberrant pubertal mammary DK11794 and CA082230. ductal morphogenesis. Oncogene 25:1532–1542 15. Yang D, Guo J, Divieti P, Bringhurst FR 2006 Parathyroid hormone activates Disclosure Statement: All authors have nothing to disclose. PKC-⌬ and regulates osteoblastic differentiation via a PLC-independent pathway. Bone 38:485–496 References 16. Divieti P, Lanske B, Kronenberg HM, Bringhurst FR 1998 Conditionally immortalized murine osteoblasts lacking the type 1 PTH/PTHrP receptor. 1. Mitlak BH, Williams DC, Bryant HU, Paul DC, Neer RM 1992 Intermittent J Bone Miner Res 13:1835–1845 administration of bovine PTH-(1–34) increases serum 1,25-dihydroxyvitamin 17. Gindler EM, King JD 1972 Rapid colorimetric determination of calcium in D concentrations and spinal bone density in senile (23 month) rats. J Bone biologic fluids with methylthymol blue. Am J Clin Pathol 58:376–382 Miner Res 7:479–484 18. Phelps E, Bezouglaia O, Tetradis S, Nervina JM 2005 Parathyroid hormone 2. Mazzuoli GF, D’Erasmo E, Pisani D 1998 Primary hyperparathyroidism and induces receptor activity modifying protein-3 (RAMP3) expression primarily osteoporosis. Aging (Milano) 10:225–231 via 3Ј,5Ј-cyclic adenosine monophosphate signaling in osteoblasts. Calcif Tis- 3. Bouxsein ML, Pierroz DD, Glatt V, Goddard DS, Cavat F, Rizzoli R, Ferrari sue Int 77:96–103 SL 2005 ␤-Arrestin2 regulates the differential response of cortical and trabec- 19. Ishizuya T, Yokose S, Hori M, Noda T, Suda T, Yoshiki S, Yamaguchi A 1997 ular bone to intermittent PTH in female mice. J Bone Miner Res 20:635–643 Parathyroid hormone exerts disparate effects on osteoblast differentiation 4. Iida-Klein A, Zhou H, Lu SS, Levine LR, Ducayen-Knowles M, Dempster depending on exposure time in rat osteoblastic cells. J Clin Invest 99:2961–2970 DW, Nieves J, Lindsay R 2002 Anabolic action of parathyroid hormone is 20. Rodriguez TA, Sparrow DB, Scott AN, Withington SL, Preis JI, Michalicek skeletal site specific at the tissue and cellular levels in mice. J Bone Miner Res J, Clements M, Tsang TE, Shioda T, Beddington RS, Dunwoodie SL 2004 17:808–816 Cited1 is required in trophoblasts for placental development and for embryo 5. Itoh K, Udagawa N, Matsuzaki K, Takami M, Amano H, Shinki T, Ueno Y, growth and survival. Mol Cell Biol 24:228–244 Takahashi N, Suda T 2000 Importance of membrane- or matrix-associated 21. Takasu H, Guo J, Bringhurst FR 1999 Dual signaling and ligand selectivity of forms of M-CSF and RANKL/ODF in osteoclastogenesis supported by SaOS- the human PTH/PTHrP receptor. J Bone Miner Res 14:11–20

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.