CFPA SAAPPA / SASPA / SAT DFTS Winetech Canning Fruit Producers’ Assoc. Fruitgro Science Dried Fruit Technical Services Submit to: Submit to: Submit to: Submit to: Wiehahn Victor Louise Liebenberg Dappie Smit Jan Booysen Tel: +27 (0)21 872 1501 Tel: +27 (0)21 882 8470/1 Tel: +27 (0)21 870 2900 Tel: +27 (0)21 807 3324 [email protected] [email protected] [email protected] [email protected]
X Indicate (X) client(s) to whom this final report is submitted. Replace any of these with other relevant clients if required.
FINAL REPORT FOR 2011
PROGRAMME & PROJECT LEADER INFORMATION Programme leader Project leader
Title, initials, surname Dr K. Krüger Present position Senior Lecturer Dept. of Zoology and Address Entomology, University of Pretoria, Pretoria, 0002 Tel. / Cell no. (012) 420 2539 Fax (012) 362 5242 E-mail [email protected]
PROJECT INFORMATION
Project number WW 07/14 and AD936 Spread of Grapevine leafroll-associated virus 3 (GLRaV-3) by scale Project title insects Mealybugs, soft scale insects, Planococcus ficus, Pseudococcus Project Keywords longispinus, grapevine leafroll disease
Industry CFPA programme Deciduous DFTS Winetech X Other
Fruit kind(s) Grapevine
Start date (dd/mm/yyyy) 01/04/2001
End date (dd/mm/yyyy) 31/03/2010
AD936 /K. Krüger / University of Pretoria
Final report 2
FINAL REPORT
1. Executive summary Give an executive summary of the total project in no more than 250 words
A comparison of transmission efficiency of the vine mealybug Planococcus ficus and the longtailed mealybug Pseudococcus longispinus has shown that both are equally efficient vectors of Grapevine leafroll-associated virus 3 (GLRaV-3). In addition, a single first-instar nymph of either species is capable of transmitting GLRaV-3. The study demonstrated that short acquisition and inoculation access periods of 15 min, respectively, are sufficient to acquire and transmit the virus, which can persist in viruliferous nymphs of Pl. ficus for up to 8 days when feeding on a non-host or grapevine and then transmit it to a healthy grapevine plant. The study further identified three soft scale species, Coccus longulus, Parasaissetia nigra, and Saissetia sp., as vectors of GLRaV-3. Scale insects (Coccoidea) occurring on grapevine were identified through surveys of the literature and collection records at ARC-Plant Protection Research Institute, and field surveys conducted in the Western Cape from 2001 to 2006. According to the surveys, 7 mealybug, 5 soft scale and 5 armoured scale insect species occur on grapevines in South Africa. To facilitate identification of mealybug species a multiplex PCR for rapid, simple, sensitive, accurate and reliable identification of three mealybug species associated with grapevine in South Africa was developed. In addition, RAPD markers associated with Pl. ficus were identified which can potentially be used to distinguish populations within and among vineyards. To examine the relationship between the amount of GLRaV-3 uptake and transmission to grapevine by Pl. ficus a real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was developed. Results suggest that the amount of GLRaV-3 uptake by first- instar nymphs of Pl. ficus does not seem to be directly linked to feeding time (30 min to 24 hours acquisition access feeding) but is rather positively linked to the amount of virus available in virus source plants.
2. Problem identification and objectives State the problem being addressed and the ultimate aim of the project.
Insect-transmitted viruses constitute one of the major problems in plant production. Most plant virus vectors are sap-sucking insects of the order Hemiptera. In order to develop strategies for managing insect-transmitted plant viruses it is important to understand the biological and ecological factors involved in the complex plant-virus-insect interactions. The overall objective of the project is to examine the epidemiology and to contribute towards managing the spread of grapevine leafroll disease in grapevine in South Africa. Grapevine leafroll disease, which is associated with a number of viruses, has been reported to occur in all major grapevine-growing areas worldwide and constitutes one of the most serious viral diseases of grapevine, causing up to 30-40% yield losses (Cabaleiro & Segura, 1997; Golino et al., 2002). Grapevine leafroll disease affects the quality of grapevines by delaying the ripening of grapes and decreasing sugar content (Goheen & Cook, 1959; Cabaleiro et al., 1999). As in other countries, the spread of the disease is of considerable concern to the South African grapevine industry. Direct damage due to grapvevine leafroll disease has been estimated to reach several million Rands annually (Burger, 1999). Of the viruses associated with the disease, Grapevine leafroll-associated virus 3 (GLRaV-3) is one of the most widespread. Planting material from which viruses have been eliminated still remains susceptible and, when planted in vineyards, often becomes infected again. Grapevine leafroll- associated viruses (family Closteroviridae) have been shown to be transmitted by mealybugs (Hemiptera: Pseudococcidae) and scale insects (Hemiptera: Coccoidea). Several mealybug and soft scale species have been identified as vectors of GLRaV-3 worldwide. The only previously identified vector in South Africa prior to this study was the vine mealybug Pl. ficus. This species is a pest on grapevine and appears to be the most abundant scale insect (Hemiptera: Coccoidea) in South African vineyards. However, the epidemiology of grapevine leafroll disease needs clarifying by determining vectors and GLRaV-3 transmission characteristics, vector biology, alternate hosts and secondary spread through insect vectors to target the most important sources of infection and means of spread for the development and evaluation of management strategies. Another important aspect in the spread AD936 /K. Krüger / University of Pretoria
Final report 3 of grapevine leafroll is the relationship between the amount of virus uptake and the infectivity of mealybugs, i.e. whether insects feeding on plants with different virus loads are equally infective.
Objectives. 1. Establish a culture of Planococcus ficus 2. Develop a protocol for scale insect transmission of GLRaV-3 using the vine mealybug Planococcus ficus. This protocol is required as support technology for the development of virus resistant grapevines 3. Identify scale insects (Coccoidea) developing on grapevine and weeds in the vicinity of vineyards. 4. Identify vectors of GLRaV-3 in South Africa other than Planococcus ficus 5. Determine transmission characteristics and life-cycle(s) of vector(s) 6. Examine the role of GLRaV-3 and grapevine virus A (GVA) in the transmission of the disease. 7. Investigate secondary spread of GLRaV-3 through Pl. ficus in vineyards 8. Determine the relationship between the amount of GLRaV-3 uptake and transmission to grapevine by Planococcus ficus
3. Workplan (materials & methods) List trial sites, treatments, experimental layout and statistical detail, sampling detail, cold storage and examination stages and parameters.
3.1. Culture of Planococcus ficus
Aim
Establish a culture of Pl. ficus.
Methods
Nymphs of Pl. ficus were obtained from a culture at ARC-Infruitec (V. Walton) and established on butternut (Cucurbita moschata Duchesne (Cucurbitaceae)) Sub-samples were sent to I. Millar (ARC-PPRI, Biosystematics Division) to confirm identification
3.2. Protocol for transmission of GLRaV-3 by Planococcus ficus
Aim
The transmission characteristics of Pl. ficus, e.g. acquisition and inoculation access periods, were examined in order to develop a transmission protocol as support technology for the development of virus-resistant grapevines.
Materials and Methods
Insects: Specimens from a laboratory culture of Planococcus ficus maintained on butternut for several generations were used for transmission experiments. In order to ensure that mealybugs were virus-free, sub-samples of Pl. ficus nymphs and adults were tested for GLRaV-3 and grapevine virus A (GVA) using nested reverse transcription polymerase chain reaction (nested RT-PCR) for GLRaV-3 and reverse-transcription-polymerase chain reaction (RT-PCR) for GVA (MacKenzie (1997). The sub-samples of Pl. ficus from the culture tested negative for both viruses. Specimens were tested for both GLRaV-3 and GVA because the presence of GVA may influence the transmission of GLRaV-3.
AD936 /K. Krüger / University of Pretoria
Final report 4
Plants and virus source: Plants propagated from stem cuttings of LN33 1/5/2 (ARC Infruitec- Nietvoorbij) served as GLRaV-3 source. Plants propagated from stem cuttings from GLRaV-3 free Cabernet franc vines (mixed clones) obtained from KWV (Vititec) were used as recipient vines. Both source and recipient plants were examined for the presence of GLRaV-3 using nested RT- PCR and for the presence of GLRaV-3 and GVA with immunosorbent electron microscopy (ISEM). GLRaV-3 was detected in all virus source plants (LN33). However, GVA was also detected in one of the four plant samples. Only plants that tested positive for GLRaV-3 but not for GVA were used for transmission experiments. All recipient plants (Cabernet franc) tested negative for GLRaV-3 and GVA before the start of the transmission experiments. Transmission experiments: Experiments were undertaken in an insect rearing room at approximately 25ºC, 65% humidity and 14h photoperiod. To determine the acquisition access feeding period (AAP), first- and second-instar nymphs of Pl. ficus were subjected to acquisition feeding periods ranging from 1 to 7 days on virus source plants (LN33) and then transferred to healthy recipient plants (Cabernet franc) for a 7-day inoculation access feeding period (IAP). An AAP of one day was chosen when the study was done in 2002 as a minimum based on a study by Cabaleiro & Segura (1997), who showed that this period was not sufficient for Pl. ficus to acquire the virus, and a maximum of 7 days’ AAP was chosen because this period was found in the same study to be sufficient for this species to acquire the virus. The IAP was determined by providing first-instar nymphs with a 7-day acquisition feeding period on virus source plants, and inoculation feeding periods of 1 to 7 days on healthy plants. To transfer mealybugs from virus source to recipient plants, small leaf cuttings with 50 first- to second-instar nymphs of Pl. ficus were placed on each of 6 recipient plants, and 50 virus-free mealybugs were placed on a further healthy plant as a control for each of the feeding periods. Thus a total of 98 plants were used to determine AAP and IAP periods to infest plants with GLRaV-3. To transfer mealybugs from virus source to recipient plants small leaf cuttings were used (Engelbrecht & Kasdorf, 1990) to avoid breaking their fragile stylets, which would render them unable to feed and to transmit the virus. As the leaf cuttings desiccated, mealybugs moved from the cuttings to the plant. Plants were treated with chlorpyrifos (Chlorpyrifos®) and imidacloprid (Confidor®) to remove insects and to prevent re-infestation after transmission experiments. Thereafter the plants were transferred to glasshouses where they were kept at approximately 25ºC and natural humidity and photoperiod. Experiments for both AAPs and IAPs were run in parallel in the same insectary room and plants were kept in the plant growth rooms afterwards. GLRaV-3 detection: Plants were tested for GLRaV-3 with nested RT-PCR using the spot extraction method described by La Notte et al. (1997), the primer sets designed by Ling et al. (2001) and the nested RT-PCR protocol developed by M. van der Merwe (ARC-Plant Protection Research Institute (ARC-PPRI)).
3.3. Identify scale insects (Coccoidea) developing on grapevine and weeds in the vicinity of vineyards
Aim
To identify species that occur on grapevine and weeds in the vicinity of vineyards to identify possible vectors in South African vineyards other than Pl. ficus and alternate hosts of vectors.
Materials and Methods
Field surveys were undertaken in different vine-growing regions in South Africa. From 2001 to 2006, field surveys were undertaken from November to April, but mostly during the height of the summer period in January and February. Grapevine plants were sampled for mealybugs, scale insects and other Coccoidea on leaves, fruits, on and beneath bark, and on roots. In addition, cultivated crops, weeds and indigenous vegetation in and around vineyards were sampled and examined for scale insects in the same fashion as the grapevine plants to determine alternate hosts. AD936 /K. Krüger / University of Pretoria
Final report 5
Adult females, and in some instances nymphs, were collected and stored in absolute ethanol for species identification. Insects were identified by I. Millar of the National Collection of Insects (NCI), Biosystematics Division, ARC-Plant Protection Research Institute (ACR-PPRI), South Africa. Voucher specimens were deposited in NCI. In addition, parts of the samples were identified by polymerase chain reaction (PCR) (Saccaggi et al., 2008). Sub-samples of mealybug species identified using PCR were sent to I. Millar for confirmation of species identification. Plants were identified by Dr P. Fourie (ARC- Infruitec/Nietvoorbij) and Dr S. Neser (ARC-PPRI). In addition to the field surveys, a literature survey was undertaken and species records maintained by NCI were examined.
3.4. Identify vectors of GLRaV-3 in South Africa other than Planococcus ficus
Aim
To determine whether the three soft scale insects Coccus longulus, Parasaissetia nigra and Saissetia sp. are able to transmit GLRaV-3. Saissetia sp. could not be identified further because the genus is in need of revision (I. Millar, pers. comm.).
Materials and Methods
Soft scale insects: Coccus longulus (source: grapevine), Parasaissetia nigra (source: Nepenthes sp. (Nepenthaceae) and Zantedeschia sp. (Araceae)) and Saissetia sp. (source: LN33) Grapevines (Vitis vinifera L. (Vitaceae)): . Virus source: Hybrid LN33 (1/5/2, ARC Infruitec-Nietvoorbij) . Recipient plants: cv. Cabernet franc GLRaV-3 detection: Nested RT-PCR using the spot extraction method described by La Notte et al. (1997), the primer sets designed by Ling et al. (2001) and the nested RT-PCR protocol developed by M. van der Merwe (ARC-PPRI). Virus-source plants were tested for the presence of GLRaV-3; recipient plants (cv. Cabernet franc) were tested for virus-free status. Transmission: First- to second-instar nymphs obtained from rooted stem cuttings of LN33 infected with GLRaV-3 were transferred to rooted stem cuttings of healthy Cabernet franc plants for inoculation access periods (IAPs) of at least 7 days. . Five replicates were used. Prevention of insect infestation: Plants were treated in regular time intervals with chlorpyrifos (Chlorpyrifos®) and imidacloprid (Confidor®) to remove insects after transmission experiments and to prevent reinfestation. Recipient plants were tested at various time intervals after transmission for the presence of GLRaV-3 using nested RT-PCR.
3.5. Determine transmission characteristics and life-cycle(s) of vector(s). a. Determine transmission characteristics of vector(s). The vine mealybug Pl. ficus is the most abundant mealybug in vineyards in the Western Cape and is considered the most important vector of GLRaV-3 in South Africa. However, the less abundant longtailed mealybug Ps. longispinus has also been shown to transmit GLRaV-3 (Petersen & Charles, 1997).
Aims
Determine whether the longtailed mealybug Ps. longispinus is a vector of GLRaV-3 in South Africa, and, if so
AD936 /K. Krüger / University of Pretoria
Final report 6
acquisition and inoculation access periods (AAP & IAP) of GLRaV-3 by Pl. ficus and Ps. longispinus, the effects of time, post-acquisition starving and post-acquisition feeding on the persistence of GLRaV-3 in the insect vectors, and GLRaV-3 transmission efficiency of Pl. ficus and Ps. longispinus by examining the relationship between the number of first- to second-instar nymphs per plant of each species and the infection rate of healthy grapevine plants.
Materials and methods
Vector status and transmission characteristics Mealybugs. First- and second-instar nymphs of Pl. ficus reared on butternut and Ps. longispinus of all instars reared at 25°C on Alocasia macrorrhizos L. (Araceae) were used in the experiments. Grapevines (Vitis vinifera L. (Vitaceae)). Virus source: LN33 (1/5/2, Nietvoorbji); recipient vines: Cabernet franc (mixed clones). Plants were tested for GLRaV-3 before transmission (ISEM, Nested RT-PCR). GLRaV-3 detection: . Nested RT-PCR using the spot extraction method described by La Notte et al. (1997), the primer sets designed by Ling et al. (2001) and the nested RT-PCR protocol developed by M. van der Merwe (ARC-PPRI) . Enzyme-linked immunosorbent assay (ELISA) AAP. Mealybugs were allowed to feed on virus source vines for periods ranging from 15 min – 7 days and were then transferred in groups of 15 to 50 each to recipient vines for 2 – 5 days. IAP. Mealybugs were allowed to feed on virus source vines for 2 - 5 days, and were then transferred in groups of 15 each to recipient vines for periods ranging from 15 min – 7 days. Five plants were tested per AAP and IAP. Persistence - Ps. longispinus. Groups of 10 viruliferous nymphs each were allowed to feed on healthy vines or starved in Eppendorf tubes for periods ranging from 30 min – 72 hours and were then killed by freezing. The mealybugs were subsequently tested for GLRaV-3. Mealybugs removed directly from the virus source plants and A. macrorrhizos plants on which they were reared served as positive and negative controls, respectively. Persistence - Pl. ficus. . Groups of 10, 20 or 50 viruliferous nymphs each were either transferred to Eppendorf tubes for starving for periods ranging from 6 hours – 4 days or to freshly picked Ficus benjamini (Moraceae) leaves kept in glass tubes for feeding on a non-host for periods of 2–8 days. The leaves were replaced every two days for mealybugs feeding for more than 2 days on a non- host. . After post-acquisition starving and feeding periods groups that comprised 10 or 20 mealybugs were removed from the non-host sources and placed in Eppendorf tubes, and together with those starved in Eppendorf tubes were frozen at the various time intervals for later analysis by PCR. Groups that comprised 50 mealybugs were transferred to healthy Cabernet franc plants. . Mealybugs removed directly from the virus source plants and butternut on which they were reared served as positive and negative controls, respectively. Each experiment was replicated at least twice.
Transmission efficiency Mealybugs: first- and second-instar nymphs of Pl. ficus and Ps. longispinus reared at 25°C on butternut and Alocasia macrorrhizos L. (Araceae), respectively Grapevines: . Virus source: Hybrid LN33 . Recipient plants: cv. Cabernet franc AAP: Mealybugs were allowed acquisition access periods (AAPs) on virus source plants for 5 days and then groups of 1, 5, 10, 20 and 40 nymphs of each mealybug species were transferred to separate recipient plants. IAP: Mealybugs were given an inoculation access period (IAP) of 5 days on the recipient plants (n = 10 per group).
AD936 /K. Krüger / University of Pretoria
Final report 7
After completion of the transmission trials, sub-samples of each mealybug species were tested (n = 7 - 38) for GLRaV-3 and the recipient plants were tested from 8 weeks after transmission for GLRaV-3. GLRaV-3 detection: Plants were tested for GLRaV-3 with nested RT-PCR using the spot extraction method described by La Notte et al. (1997), the primer sets designed by Ling et al. (2001) and the nested RT-PCR protocol developed by M. van der Merwe (ARC-PPRI). Data analysis: Chi-square (Χ2) tests, Bonferroni adjustment
b. Determine life cycle/biology of vector(s) other than Planococcus ficus in controlled laboratory trials.
Aims
The objective of the study was to examine the effect of temperature on the development and survival of Ps. longispinus to determine lower developmental threshold and thermal limit (upper developmental threshold) on grapevine at different constant temperatures. In addition, trials were undertaken with the soft scales C. longulus and P. nigra. During the transmission experiments it was observed that only a few individuals of the species survived on grapevine. It was therefore decided to examine the survival of the two soft scale species on grapevine in controlled temperature experiments in order to determine whether this could in part explain the low abundance of soft scale insects in South African vineyards.
Materials and methods
Insects: Pseudococcus longispinus: crawlers from a laboratory culture maintained on Alocasia macrorrhizos L. (Araceae) were used in the experiments. Crawlers were used because Ps. longispinus is oviviparous, i.e. eggs hatch within 15 minutes of oviposition. Coccus longulus: crawlers from a laboratory culture maintained on V. vinifera (cv. Merlot) were used. Parasaissetia nigra: crawlers collected from a pitcher plant kept in a greenhouse at the University of Pretoria. Grapevines (Vitis vinifera L. (Vitaceae)): Potted plants propagated from stem cuttings from GLRaV-3-free Cabernet franc vines. Plants were tested for GLRaV-3 before use in experiments (ISEM, nested RT-PCR). Ps. longispinus: development on grapevine was examined in incubators at constant temperatures of 18, 21, 25, 30 and 35ºC at natural humidity and 16L: 8D photoperiod. Soft scale insects: development on grapevine of C. longulus and P. nigra was examined in incubators at constant temperatures of 18, 21, 27 and 30 ºC, and 25 and 30 ºC, respectively, at natural humidity and 16L:8D photoperiod. . Thirty or 50 one-day old crawlers (first-instar nymphs) were transferred per plant and temperature. . Survival and developmental stage of nymphs were examined and recorded daily to determine the duration of each instar. . Each experiment was replicated twice Data analysis: Analysis of variance and regression analysis.
3.6. Role of GLRaV-3 and GVA in leafroll disease transmission
Aim
A pilot study was carried out to determine transmission of GLRaV-3 in the presence and absence of GVA.
AD936 /K. Krüger / University of Pretoria
Final report 8
Materials and Methods
Transmission of GLRaV-3 in the presence and absence of GVA Mealybugs: first- and second-instar nymphs of Pl. ficus and Ps. longispinus reared at 25°C on butternut and A. macrorrhizos, respectively Grapevines: . Virus source: Rootstock hybrid LN33 or cv. Cabernet franc infected with either GLRaV-3 or a combination of GLRaV-3 and GVA . Recipient plants: cv. Cabernet franc GLRaV-3 detection: Nested RT-PCR using the spot extraction method described by La Notte et al. (1997), the primers from Ling et al. (2001) and the nested RT-PCR protocol developed by M. van der Merwe (ARC-PPRI). GVA testing: RT-PCR adapted by ARC-PPRI from MacKenzie (1997) Plants and mealybugs were tested for viruses prior to use in transmission experiments to confirm virus-free status. Virus transmission: first- and second-instar nymphs of Pl. ficus and Ps. longispinus exposed to donor plants for AAPs ranging from 15 min to 7 days and then transferred to recipient plants for IAPs ranging from 15 min to 7 days. Recipient plants using petioles were tested at various time intervals after transmission for the presence of GLRaV-3 and GVA.
3.7. Secondary spread of GLRaV-3 through the vine mealybug Planococcus ficus
Mealybugs can spread rapidly throughout grapevine-growing areas through e.g. human contact, nursery stock, farming equipment, birds, and insects. By understanding how they disperse, specific control strategies can be implemented. This aspect is likely to be vital in developing a management plan for the control of the virus. It was added to the project in 2004 based on results obtained by Prof. G. Pietersen (ARC-PPRI, University of Pretoria) on the spread of the leafroll disease in vineyards. The ultimate aim is to develop tools to examine the mechanisms of the secondary spread of GLRaV-3, i.e. disease incidence after planting healthy grapevines in the field, through Pl. ficus by monitoring the movement of this species in vineyards. This requires reliable identification of different populations of Pl. ficus. The use of nucleic acid sequences provides a useful tool in identifying members of a population. At the time of the study there were no sequences available for Pl. ficus. The study therefore entailed developing a PCR technique for identification of Pl. ficus, and, should this be successful, to include the use of PCR to differentiate between biotypes/populations. It was subsequently decided to use randomly amplified polymorphic DNA (RAPD) markers, which have been shown to be useful in population genetic studies (Williams et al., 1990) and which do not require prior sequence information (Welsh & McClelland, 1990). Therefore, arbitrary nucleotide 10-mer primers were used to generate fingerprinting patterns for individual mealybugs. However, because molecular markers based on PCR technology are more efficient, reproducible and less time consuming, RAPD markers can be converted into sequence characterized amplified regions (SCARs; Paran & Michelmore, 1993). This is done by designing specific polymerase chain reaction (PCR) primers or SCAR markers following sequence analysis of RAPD markers. The SCAR markers can be used to deduce possible dispersal patterns within South Africa.
Aims a. PCR to identify Planococcus ficus (i) Develop an accurate, fast and reliable molecular technique for identification of Pl. ficus. b. RAPD markers (i) Compare DNA yield of three DNA extraction methods for eggs, 1st- to 3rd-instar nymphs and adult females of Pl. ficus. (ii) Compare DNA fingerprinting profiles generated by five commercial brands of Taq DNA polymerase
AD936 /K. Krüger / University of Pretoria
Final report 9
(iii) Develop a RAPD-PCR protocol and identify RAPD markers that can be used to distinguish among individual vine mealybugs from different localities (iv) Pilot study: Determine the presence/absence of RAPD markers (v) Develop SCAR markers to determine genetic variation among vine mealybugs within and between localities
Materials and Methods
PCR to identify Planococcus ficus Mealybugs: three mealybug species were chosen because of their association with grapevine. These were the vine mealybug Pl. ficus, the citrus mealybug Planococcus citri and the longtailed mealybug Ps. longispinus. Although Pl. citri has not been recorded on grapevine in South Africa, it has been found on grapevine elsewhere and so was included in the present study. In addition, this species is very similar morphologically to Pl. ficus and therefore difficult to identify. DNA extraction technique: although various DNA extraction techniques exist, it is important to select a technique that is suitable for a particular study. Therefore, a number of extraction methods for mealybug DNA were tested and adapted. The different techniques were used in different aspects of this study. Genetic region: cytochrome oxidase c subunit I (CO I) gene of the mitochondrial DNA (mtDNA). Primers: two sets of universal primers to amplify and sequence approximately 1200 base pairs (2400 individual bases) of the CO I gene. Sequence comparison: sequences within and between species to determine levels of variation were analysed using computer software. Multiplex PCR: based on the sequence variation, species-specific forward primers were designed and matched with a common reverse primer. These were all used in the same PCR reaction mix, a so-called multiplex PCR. The forward primers were designed in such a way that each would yield an amplification product of a different length. b. RAPD markers Insects Pl. ficus were collected from six localities in the Western Cape Province (Franschhoek, Paarl, Stellenbosch (2 farms), Wellington, Worcester) from January to February 2007. Mealybugs collected from grapevine were preserved in 96% EtOH and stored at -20°C until DNA extraction. (i) DNA yield DNA extractions . Three DNA extraction methods to extract total genomic DNA were tested: (a) spot PCR using a positively charged nylon membrane (La Notte et al., 1997); (b) STE buffer; and (c) High Pure PCR Product Purification kit (Roche Diagnostics Corporation, Indianapolis, USA). . DNA was extracted from 10 parasitoid-free mealybugs of each of the following life stages: (a) eggs, (b) 1st-instar (crawlers), (c) 2nd – 3rd instar nymphs, (d) small adult females and (e) large adult females. . DNA concentration was quantified spectrophotometrically. DNA quality was examined by electrophoresis with a 0.8% agarose gel stained with Goldview stain (5 µl/100 ml) in 1x TAE buffer with visualization using a UV transilluminator. . RAPD primers . Twenty-seven 10-mer primers were randomly selected from UBC RAPD Primer sets #1-8 (University of British Columbia, Canada) and synthesized by Whitehead Scientific (South Africa). (ii) Comparison of commercial sources of Taq polymerase Genomic DNA was extracted from two large adult females from the culture maintained at the University of Pretoria, using the Roche kit. Five commercial sources of Taq polymerase were tested by comparing the fingerprinting profiles of the two individuals. Amplification was performed in reaction mixtures with different final concentrations of MgCl2, Taq polymerase, primer and DNA template using three primers. The sources of Taq polymerase were: (a) BIOTAQTM DNA polymerase (Bioline, USA), (b) Biotools (Biotools B&M labs, S.A.), (c) GoTaq® Flexi DNA polymerase (Promega, USA), (d)
AD936 /K. Krüger / University of Pretoria
Final report 10
KapaTaq DNA polymerase (Kapa Biosystems, South Africa) and (e) TaKaRa ExTaqTM (Takara, Japan). PCR reactions were performed using standard RAPD cycling conditions. Negative controls containing no template DNA were included for each primer. One brand of Taq polymerase will be selected for the RAPD PCR optimization study based on cost effectiveness and the intensity and number of bands of the fingerprinting profiles. Gel electrophoresis Amplification products were resolved by gel electrophoresis in 2% agarose gels and post stained with Goldview stain. RAPD PCR optimization Genomic DNA extracted from two large adult female mealybugs from the culture maintained at the University of Pretoria was used. Three primers were used to optimize the PCR. Amplification was performed in reaction mixtures with different final concentrations of MgCl2, Taq polymerase, primer and DNA template to determine their optimal concentrations. Reactions containing no DNA template were included in each PCR for each primer as negative controls. Preliminary determination of primer polymorphism Pl. ficus were collected from six localities in the Western Cape Province (Stellenbosch (2 farms), Worcester, Wellington, Franschhoek, Paarl) from January to February 2007. Mealybugs collected on a vine were preserved in 96% EtOH and stored at –20°C until DNA extraction. DNA was extracted from five parasitoid-free Pl. ficus individuals from five localities and two from one Stellenbosch locality. The Roche kit was used for DNA extraction. Standard RAPD PCR cycling conditions were used. Final concentrations of PCR reagents were determined by the RAPD PCR optimization study. Three 10-mer primers were selected for a preliminary study to determine primer polymorphism among and within localities by comparing fingerprinting patterns of the mealybugs for each primer. Determination of primer polymorphism using pooled DNA DNA extraction DNA was extracted from five parasitoid-free Pl. ficus individuals from five localities and two from one Stellenbosch locality, using the Roche kit. DNA concentration was quantified spectrophotometrically. DNA quality was examined by electrophoresis with a 0.8% agarose gel stained with Goldview stain (5 µl/100 ml) in 1x TAE buffer with visualization using a UV transilluminator. RAPD PCR Extracted DNA was pooled for each locality. Standard RAPD PCR cycling conditions were used. Final concentrations of PCR reagents were determined in the RAPD PCR optimization study. Twenty-seven 10-mer primers were selected to determine primer polymorphism among localities by comparing fingerprinting patterns of the pooled samples for each primer. Negative controls containing no template DNA were included for each primer. Gel electrophoresis Amplification products were resolved by gel electrophoresis in 1.8% agarose gels and post stained with Goldview stain (5 µl/100 ml 1x TAE buffer) with visualization using a UV transilluminator. Additional RAPD PCR optimization If a selected RAPD marker appeared faint, additional RAPD PCR optimizations were performed by varying the final concentrations of the primer and MgCl2 PCR reagents. (iii) Development of the RAPD-PCR protocol RAPD-PCR Standard RAPD-PCR cycling conditions were used. Final concentrations of PCR reagents were determined by varying the final concentrations of those reagents. Twenty-seven UBC primers were selected to determine primer polymorphism. Gel electrophoresis Amplification products were resolved by gel electrophoresis in 1.8% agarose gels. The running time for amplification products ranged between 30 – 50 min at 100V, depending on the RAPD marker. Gels were post stained with Goldview stain (5 µl/100 ml 1x TAE buffer) for 45 min with shaking and visualized with a UV transilluminator.
AD936 /K. Krüger / University of Pretoria
Final report 11
(iv) Pilot study: Determining the presence/absence of the RAPD markers RAPD markers Five RAPD markers were selected to determine presence absence data in a pilot study for 65 individuals from six farms. DNA extractions, RAPD PCR cycling conditions and gel electrophoresis DNA was extracted from parasitoid-free Pl. ficus individuals. PCR and gel electrophoresis conditions were the same as described above. PCR’s were repeated two or three times for each individual for each primer. The amplification products were screened to determine the presence or absence of the RAPD markers (v) Development of a SCAR marker for Pl. ficus DNA extraction Extracted DNA from P. ficus individuals as described above was used. RAPD PCR Three RAPD primers were selected to be converted into possible SCAR markers. Standard RAPD-PCR cycling conditions were used (Winetech report 2009/2010). Six reactions were performed for each RAPD primer, including negative controls. Gel electrophoresis Amplification products were resolved by gel electrophoresis in 1.8% agarose gels. The running time for the amplification products was 180 min at 140V. Gels were post stained with Goldview stain (5 µl/100 ml 1x TAE buffer) for 60 min with shaking at 25rpm and visualized with a UV transilluminator. Cloning Purification: The three markers were subjected to DNA purification using the Wizard SV Gel and PCR Clean-Up system kit (Promega, Madison, USA). The DNA fragments were excised from the gels and the protocol was followed as described in the kit. Three gel slices were combined in one tube for each primer respectively. The contents of both tubes were combined after the gels were dissolved. Minor modifications were made. DNA concentration: DNA concentration of the purified DNA was determined using the Nanodrop. Subsequently the amount of DNA needed for each ligation reaction was determined. Ligation: The pGEM®-T and pGEM®-T Easy Vector Systems kit (Promega, Madison, USA) was used for cloning with minor modifications made to the protocols. It was decided to include ratios of 6:1 and 3:1 insert DNA:Vector molar due to problems experienced with previous cloning attempts. Transformation of competent cells: LB/amp/IPTG/X-gal plates were prepared. JM109 competent cells were used and the cultures were plated on the plates and incubated overnight. Ten plates were used for each marker. Experimental controls including positive controls (two plates), background controls (two plates) and transformation efficiency controls (two plates) were also included. The transformation efficiency was calculated as (‘mean number colonies on two plates‘cfu / 0.001ng DNA or cfu/ug DNA). Selection of colonies: When possible, 10 white distinct colonies were selected for each clone. Care was taken to select colonies close to blue colonies. Each colony was cultured overnight in SOC medium and 50ug/ml ampicillin in a shaking incubator at 200rpm. A test tube containing only culture medium served as a blank. Any growth in this tube would suggest that contamination has occurred and all samples should be discarded off. Precipitation: Each clone was subjected to ammonium acetate precipitation in order to remove E. coli strains. Each dried down DNA pellet was resuspend in TE buffer. PCR: PCR cycling conditions were as follows: 92 °C for two min; 35 cycles of 92 °C for 30 s, 55 °C for 45 s, 72 °C for 1 min; 72 °C for 10 min; hold at 4 °C. The final concentrations of the PCR reagents in a 50 ul reaction were as follows: 12.5 mM NH4 buffer, 2.5 mM MgCl2, 0.14 mM each dNTP, 1 uM forward promoter primer T7 (3’ ATTATGCTGAGTGATATCCC 5’ ), 1 uM reverse promoter primer SP6 (3’ AAGATATCACAGTGGATTTA 5’), 2.5 U Taq polymerase (Bioline), 1 ul plasmid DNA and 29 ul water. A negative control containing no DNA was included. The expected amplification product size for each primer is calculated as the size of the cloned primer-insert added to 144 (regions flanking the forward and reverse primers). Therefore, the amplification products’ sizes should be: UBC primer 4 = 994, UBC primer 3 = 494 and UBC primer 2= 1094. Gel electrophoresis: Amplification products were resolved by gel electrophoresis in 1.8% agarose gels. The running time was 150 min at 100V. Gels were post stained with Goldview
AD936 /K. Krüger / University of Pretoria
Final report 12
stain (5 µl/100 ml 1x TAE buffer) for 60 min with shaking at 25rpm and visualized with a UV transilluminator. Purification of the clones After successfully cloning the product of UBC primer 3, two clones were selected for sequencing. Each clone was subjected to a different purification protocol. Clone 4: Roche High Pure PCR purification kit was used, following the manufacturer’s specifications, with minor modifications. Clone 5: A mixture comprising 19 ul of PCR product, and final concentrations of 10 U Exonuclease 1 and 2 U FastAP™ (thermosensitive alkaline phosphatase) was incubated at 37°C for 15 min and then 85°C for 15 min. Gel electrophoresis: Both purified products were resolved by gel electrophoresis in 1.8% agarose gels, stained with Goldview stain (5 ul / 100 ml 1x TAE buffer). The running time was 20 min at 50 V. Gels were visualized with a UV transilluminator. The brightness of the bands was used as an indication of the amount of purified product to be used in the cycle sequencing reaction. Cycle sequencing Clone 4: Two quarter reactions were prepared, using only the forward promoter primer T7. The cycling conditions were as follows: 96°C for 0 s; 25 cycles of 96°C for 10 s, 55°C for 5 s, 60°C for 4 min; hold at 4°C. Each 10 ul reaction contained 2ul Big Dye v3.1, 1ul purified product, 5 ul molecular grade water and final concentrations of 0.32 uM forward primer (3’ ATTATGCTGAGTGATATCCC 5’) and 0.5X sequencing buffer. Clone 5: Two eighth reactions were prepared, using only the forward promoter primer T7. The cycling conditions were as follows: 94°C for 1 min; 30 cycles of 94°C for 10 s, 50°C for 5 s, 60°C for 4 min; hold at 4°C. Each 10 ul reaction contained 1ul Big Dye v3.1, 1ul purified product, 5 ul molecular grade water and final concentrations of 0.14 uM forward primer (3’ ATTATGCTGAGTGATATCCC 5’) and 1.15X sequencing buffer. Precipitation Clone 4: A mastermix was prepared containing 60 ul ice cold absolute ethanol, 11 ul molecular grade water, and 2ul of 3 M sodium acetate. The cycling sequencing product was added to 65 ul of the mastermix in a new 0.5 ml Eppendorf tube and vortexed well, then centrifuged for 15 min at 12 000 rpm and the supernatant pipetted off. 190 ul of freshly prepared 71 % ethanol was added to the tube, followed by centrifuging for 10 min at 12 000rpm. The supernatant was pipetted off and 190 ul of freshly prepared 71 % ethanol added to the tube, followed by centrifuging for 10 min at 12 000 rpm and pipetting of the supernatant off. The pellet was dried on a heat block for 3 min at 80°C. Clone 5: 1 ul of 125 mM EDTA, 1 ul of 3 M sodium acetate, 25 ul of absolute ethanol and the cycle sequencing product were added together, vortexed and incubated at room temperature for 15 min, centrifuged for 30 min at 14 000rpm and 4°C. The supernatant was pipette off and 100 ul of freshly prepared 70 % ethanol was added, followed by centrifuging for 15 min at 14 000 rpm and 4°C. and pipette the supernatant off. The pellet was dried on a heat block for 1 min at 94°C. Sequencing Two reactions for each of the two clones were sequenced on the ABI3130 sequencer at the sequencing facility at the University of Pretoria. The CLC Bio v.6 software program was used for visualising the chromatograms and alignment and editing of the sequences. NCBI/Blast The sequence was paired against the nucleotide collection in the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome). This was done to determine similarities between other sequences of organisms for which sequence information has been entered into the database. SCAR marker primer design The NCBI/Primer-Blast software program was used to design primers. Two primer pairs were synthesized by Inqaba Biotechnical Industries (Pty) Ltd. PCR cycling conditions A PCR program was designed using the characteristics of the primers, information available from the band size and the recommendations for using Biotaq. The initial PCR cycling conditions were as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 52°C for 1 min, 72°C for 1 min; 72°C for 10 min; hold at 4°C. The final concentrations of the PCR reagents in a 25 ul reaction were as follows: 2 mM MgCl2, 1X NH4 buffer, 200uM each dNTP, 1 uM forward AD936 /K. Krüger / University of Pretoria
Final report 13
primer, 1uM reverse primer, 1U Biotaq DNA polymerase. In addition, 1 ul DNA and 14.50 ul water was added. Gel electrophoresis: Amplification products were resolved by gel electrophoresis in 1.8% agarose. Gels were post stained with Goldview stain (5 ul / 100 ml 1X TAE buffer) for 60 min with shaking at 25rpm and visualized with a UV transilluminator.
3.8. Determine the relationship between the amount of GLRaV-3 uptake and transmission to grapevine by Planococcus ficus
To date, the connection between foraging ecology of the vector Pl. ficus, GLRaV-3 concentration in plants and its transmission is poorly understood. Real-time quantitative RT-PCR (real-time qRT-PCR) can assist in elucidating this relationship and should lead to a better understanding of GLRaV-3 transmission by mealybugs. The aim of this study was to develop a real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assay to determine the relationship between the virus concentration in GLRaV-3 source plants, the amount of virus uptake by Planococcus ficus nymphs and GLRaV-3 transmission by nymphs to virus-free recipient grapevine plants. Hitherto, the amount of virus uptake in relation to feeding time and the initial amount of virus in the tissue of the source plant could not be quantified. Using immunosorbent electron microscopy (ISEM) GLRaV-3 particles could only be detected in first-instar mealybug nymphs that had been starved for 8 hours. With nested RT-PCR virus quantities could be detected in nymphs that had been starved for up to 4 days (first-instar nymphs die after a four-day starvation period). Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) is an increasingly used technique and can overcome the limitations of ISEM as very small virus amounts can be detected and quantified. A further aim was to use the assay developed to compare GLRaV-3 concentrations in mealybug nymphs exposed for different feeding periods on a virus-infected plant and to relate it to the transmission rates of GLRaV-3 to healthy grapevine plants.
Materials and Methods
Comparison of GLRaV-3 extraction methods The integrity of purified RNA is critical for reliable diagnostic use in real-time qRT-PCR. Sampling, storage and extraction method affect the integrity and purity of extracted RNA. The most important steps in total RNA isolation include: cell lysis, RNase activity inhibition, unwanted protein removal and recovery of intact RNA. Often, the most successful extraction techniques involve the use of chemicals such as phenol-chloroform (PC), mercaptoethanol (ME), polyvinylpyrolydone (PVP) and quanidine thiocyanate (GTC). These chemicals assist in removing PCR inhibitors such as phenolic compounds and polysaccharides present in plants. Mealybugs: first- and second-instar nymphs of Pl. ficus, reared at 25°C on butternut Grapevines (Vitis vinifera L. (Vitaceae)): virus source: cv. Cabernet franc Extraction methods: Phenol-chloroform method, Gentra Purescript® RNA Isolation Kit, Qiagen QIAzol™ method, adjusted QIAzol method (QIAzol-adj) and Qiagen RNeasy® Plant Mini kit
AD936 /K. Krüger / University of Pretoria
Final report 14
Sampling: Fig. 1a,b
Fig. 1. a) Single leaf punch (LP) and single mealybug (MB) sampling for testing Phenol- chloroform, Gentra, QIAzol and QIAzol-adj extraction methods (n = 25 LP and n = 25 MB per extraction method); b). Extraction efficiency comparisons of 1) Phenol-chloroform, Gentra and QIAzol-adj and 2) Phenol-chloroform, QIAzol-adj and Qiagen, (n = 6 LP and n = 6 MB per extraction method; 6 replicates each, Gentra only 3 replicates).
AAP: mealybugs given acquisition access periods (AAPs) on virus source plants between 1 to 4 days Extraction method testing: nested RT-PCR, repeated 3 times for each extracted sample Extraction efficiency comparisons: real-time RT-PCR adapted from Osman & Rowhani (2006) using LightCycler® TaqMan® Master kit and technology
Real-time RT-PCR for detection and quantification of GLRaV-3 in grapevine and Planococcus ficus Plants: GLRaV-3 infected leaf punches from virus source cv. Cabernet franc plants. Mealybugs: GLRaV-3 infected first- and second-instar nymphs of Pl. ficus. RNA extraction: Phenol-chloroform total RNA extraction protocol (Smit, 2008). DNA standard: Purified real-time RT-PCR specific product. cRNA standard: In vitro transcription using real-time RT-PCR products (forward primer, modified by incorporating a T7 promoter sequence at the 5’ end) as template was performed in order to generate nucleotide-specific RNA (Fronhoffs et al., 2002; Vijgen et al., 2005). Standard curve design: The DNA and cRNA standards were quantified with a Nanodrop ND-1000 spectrophotometer. Serial 10-fold dilutions of each standard were made in nuclease-free water to obtain a DNA and cRNA standard range, respectively. The DNA and cRNA standard curves were generated using LightCycler® assisted real-time PCR and RT-PCR, respectively. Standard curve sensitivity and reproducibility: Intra- and inter-assay reproducibility of both standards were analyzed in five replicates per run and five different PCR assays, respectively. Quantification: Quantification of GLRaV-3 in grapevines and Pl. ficus was performed using the DNA and cRNA standard curves.
GLRaV-3 transmission by Planoccus ficus Vector: Specimens from a laboratory culture of Pl. ficus, maintained on butternut for several generations, were used for transmission experiments. Sub-samples of Pl. ficus nymphs were tested for GLRaV-3 using nested RT-PCR to confirm their virus-free status. Virus source leaf and recipient plants: Leaves from one GLRaV-3 (621 isolate, belonging to Group 1 of GLRaV-3; Jooste et al., 2010) positive plant (roostock hybrid LN 33) served as virus source and were kept at the ARC-Plant Protection Research Institute (provided by Ms A. E. C. Jooste). The recipient plants were propagated from stem cuttings from GLRaV-3 free grapevine (cv. Cabernet franc) by Vititec. Both virus source leaves and recipient plants were tested for the presence of GLRaV-3 using nested RT-PCR. Transmission experiments: First-instar nymphs of Pl. ficus were given acquisition access periods (AAPs) of 0 (negative controls), 15 and 30 min, and 1, 2, 4, 8, 16 and 24 hours on leaves of the AD936 /K. Krüger / University of Pretoria
Final report 15
virus source plant. One virus-infected leaf was used for each acquisition access period on a given day. Fifty percent of the nymphs were then transferred to GLRaV-3-free recipient plants for a 5- day inoculation access period (IAP). The other 50 % of the nymphs were collected and frozen at - 80°C directly after completion of the different AAPs and served as positive controls. Plants exposed to nymphs collected directly from the butternut (AAP = 0 h), and plants not exposed to mealybug nymphs but otherwise treated in the same manner as the recipient plants served as negative controls. The duration of AAPs (period on the virus source leaf) and IAPs (period on the recipient plant) was chosen based on previous studies (Krüger et al., 2006, Douglas & Krüger, 2008). The experiment has been replicated six times. Phenol-Chloroform extraction: RNA was purified from the leaf punches and single mealybug nymphs using the phenol-chloroform extraction method followed by ethanol precipitation as described by Smit (2008). RNA was quantified with a Nanodrop ND-1000 spectrophotometer. Samples were diluted with DEPC so that the final concentration was 25 ng/µl RNA and samples were then stored at -80°C. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR): The real-time qRT-PCR was performed using the LightCycler® instrument (Roche Applied Science); the protocol adapted from Osman & Rowhani (2006) and Osman et al. (2007) as described by Smit (2008) was used. A serial 4-fold dilution of a known GLRaV-3 standard solution was included in each PCR run. The crossing point (number of cycles) of each standard dilution was plotted against the standard concentration. The interassay variation (between runs) of the standard curves is shown in Figure 2. For each standard concentration the average crossing point value (+ standard deviation) was indicated for eight PCR runs (Fig. 2). As the interassay variation in standard curves was so small, values between PCR runs could be compared. The concentration of the samples was calculated using the internal standard curve in each PCR run. The slope (efficiency) of the standard curves varies from 1.75 to 2.07. If the slope efficiency of the standard curve of a run was below 1.75 an external standard curve of an equivalent run was imported and used for the calculations. In each PCR run two no template controls were included, as well as a negative leaf and a negative nymph sample. For each virus source leaf sample, the corresponding nymph sample collected after completion of the AAP was analyzed in the same PCR run. Nymphs collected after completion of the IAP were analyzed in the same PCR run as the leaf samples of the virus source they fed on and the recipient plant where they were collected after completion of inoculation feeding.
35
30 y = -3.5738x + 19.474 R2 = 0.9996 25
20
15
Number of cycles of Number 10
5
0 -3 -2 -1 0 1 2 Log (GLRaV-3 Concentration (ng/µl))
Fig. 2. Average crossing point value (with standard deviation), i.e. number of cycles, for each of the fourfold serial dilutions of eight standard curves that were used to calculate Grapevine leafroll-associated virus 3 (GLRaV-3) concentrations in samples.
AD936 /K. Krüger / University of Pretoria
Final report 16
4. Results and discussion State results obtained and list any benefits to the industry. Include a short discussion if applicable to your results. This final discussion must cover ALL accumulated results from the start of the project, but please limit it to essential information.
Milestone Achievement
1. Establish and maintain a culture of A culture was established on butternut and is still Planococcus ficus being maintained at the University of Pretoria 2. Develop an assay for scale insect Submitted in 2003 to Winetech transmission of GLRaV-3 using Pl. ficus 3. Identify scale insects developing on Published in part in Walton et al., 2009 grapevine 4. Identify vectors of GLRaV-3 in South Africa Pseudococcus longispinus (Krüger et al., 2006; other than Pl. ficus Douglas & Krüger, 2008) and three soft scale species (Krüger & Douglas, 2009) were identified as vectors 5. Determine life cycle/biology of vector(s) Biology of Ps. longispnus on grapevine at other than Pl. ficus in controlled laboratory different temperatures determined (MInstAgrar trials and literature surveys thesis: Mawela, 2005); notes on biology of two soft scale species published (Krüger & Douglas, 2009) 6. Determine transmission characteristics of Published as Krüger et al. (2006) and Douglas & vector(s) Krüger (2008) 7. Identify alternate hosts of vector(s) A number of weed species occurring in vineyards have been identified as alternate hosts (Krüger, Walton, Carstens, Millar (in prep.); lists were submitted to Winetech and the Vine Improvement Association (VIA) 8. Determine the role of GLRaV-3 and GVA in Results were inconsistent but suggest that GVA leafroll disease transmission occurs together with GLRaV-3 9. Determine movement/spread of Pl. ficus in Multiplex PCR to identify three mealybug species vineyards associated with grapevine in South Africa was developed (Saccaggi et al., 2008); markers associated with populations of Pl. ficus have been identified 10. Examine the relationship between the Real-time quantitative reverse transcription amount of GLRaV-3 uptake and infectivity polymerase chain reaction (qRT-PCR) developed Pl. ficus (Smit, 2008; Douglas et al., 2009); relationship between amount of GLRaV-3 uptake and transmission by Pl. ficus to healthy grapevine plants examined
4.1. Culture of Planococcus ficus
A culture of Pl. ficus was established on butternut at the University of Pretoria and has been maintained for GLRaV-3 transmission experiments throughout the project.
AD936 /K. Krüger / University of Pretoria
Final report 17
4.2. Protocol for transmission of GLRaV-3 by Planococcus ficus
A transmission protocol to inoculate healthy grapevine plants with GLRaV-3 using Pl. ficus has been developed based on the transmission characteristics, e.g. acquisition and inoculation access periods. The protocol is required as support technology for the development of virus-resistant grapevines and has been submitted to Winetech.
4.3. Identify scale insects (Coccoidea) developing on grapevine and weeds in the vicinity of vineyards
Mealybugs (Pseudococcidae), soft scale insects (Coccidae) and armoured scales (Diaspidae) occurring in vineyards in South Africa were identified through field and literature surveys and collection records. In addition, alternate hosts of insects were identified. The most common species encountered were the mealybugs Pl. ficus and, to a lesser extent, Ps. longispinus. The most frequently collected soft scale insects were Coccus hesperidum, Coccus longulus and Parasaissetia nigra. Hemiberlesia lantaniae was the most common armoured scale insect (Walton et al., 2009). Both mealybug species, as well as P. nigra and C. longulus, are vectors of GLRaV-3 in South Africa (Engelbrecht & Kasdorf, 1990; Krüger et al., 2006; Krüger & Douglas, 2009). Many of the species that were collected on grapevine are polyphagous and have a wide host range, with the exception of Pl. ficus, which in South Africa has only been collected from Vitis vinifera and a Ficus sp. Very little is known about weeds as host plants. Planococcus viburni, which has not been recorded on vines since 1976 but has been included because it is a potential vector, was collected on six different weed species in vineyards. Other species were collected on one or two species of weeds. A list of soft scale insects and mealybugs occurring on weeds in and around vineyards has been submitted to Winetech and the Vine Improvement Association (VIA) in order to incorporate the findings in protocols for the control of leafroll in nurseries and vineyards.
4.4. Identify vectors of GLRaV-3 in South Africa other than Planococcus ficus
The current study showed that the longtailed mealybug Pseudococcus longispinus is a vector of GLRaV-3 in addition to Pl. ficus in South Africa (Krüger et al., 2006; Douglas & Krüger, 2008). Furthermore, results of the current study show for the first time that Coccus longulus, Parasaissetia nigra, and Saissetia sp. are vectors of GLRaV-3 (Krüger & Douglas, 2009). With the exception of one incidence concerning C. longulus, soft scale insects only occur in relatively low numbers and their distribution in vineyards is rather patchy in South Africa. It seems therefore that they are less important as vectors compared to Pl. ficus and Ps. longispinus. However, data from this and the studies by Belli et al. (1994) and Mahfoudhi et al. (2009) indicate that more species than previously thought are vectors of GLRaV-3, suggesting that scale insect species should be treated as potential vectors when implementing management strategies to control GLRaV-3.
4.5. Determine transmission characteristics, life-cycle(s) and alternative hosts of vector(s) a. Determine transmission characteristics of vector(s). The current study has shown that Pl. ficus and Ps. longispinus can acquire and transmit the virus within short time periods. For Pl. ficus an AAP or IAP of 15 min was sufficient to acquire GLRaV-3 or to transmit the virus, respectively. Nymphs of Pl. ficus retained the virus for at least 8 days when feeding on a non-virus host and grapevine, and for at least 2 days when starving, and were then capable of transmitting it successfully to healthy grapevine plants. Nymphs of Ps. longispinus were able to transmit the virus after an AAP of 30 min but not with an IAP of 30 min (Krüger et al., 2006). They retained the virus for at least 72 h when feeding on GLRaV-3 free vines or starving. A comparison of transmission efficiency of Pl. ficus and Ps. longispinus has shown that Ps. longispinus is as efficient a vector of GLRaV-3 as Pl. ficus. In addition, a single first-instar nymph of either Pl. ficus or Ps. longispinus is capable of transmitting GLRaV-3 (Douglas & Krüger, 2008).
AD936 /K. Krüger / University of Pretoria
Final report 18 b. Determine life cycle/biology of vector(s) other than Pl. ficus in controlled laboratory trials. Studies on the biology of the mealybug Ps. longispinus as well as the soft scale C. longulus and P. nigra indicate that the three species are less well adapted to grapevine than Pl. ficus, which could affect the transmission of the virus. A study was carried out to determine the temperature requirements of Pl. longispinus, e.g. lower and upper developmental temperature thresholds, optimal temperature for development and development rate at five different constant temperatures. The lower and upper developmental thresholds were estimated at 15.6 and 29.7°C, respectively. The optimal temperature for development was estimated at 22.7°C (Mawela, 2005). The biology of C. longulus and P. nigra on grapevine was examined at different constant temperatures ranging between 18 and 35ºC, and at 25 and 30ºC, respectively. None of the nymphs survived past the second-instar stage except for one C. longulus female at 30°C, which produced 117 offspring (Krüger & Douglas, 2009). The low survival rate could explain the low abundance and patchy distribution of soft scales in South African vineyards. However, outbreaks of soft scales have been reported in European vineyards and this study shows that more soft scale insect species than hitherto thought are able to transmit the virus.
4.6. Role of GLRaV-3 and GVA in leafroll disease transmission
Transmission experiments using plants with combined infections of GLRaV-3 and grapevine virus A (GVA) were done using Pl. ficus and Ps. longispinus as vectors. Plants that tested positive for virus tested positive for either GLRaV-3, GLRaV-3 and GVA, or GVA. However, in plants that tested positive for GVA or GLRaV-3 only, GLRaV-3 or GVA, respectively, may have been below detection levels. For example, in some instances plants tested positive for GLRaV-3 and negative for GVA but if re-tested tested positive for GVA. The inconsistent results for GLRaV-3 and GVA observed for positive plants could be due to the uneven distribution of the virus or changes in viral load within a plant over time. However, results suggest, in line with Pietersen & Kasdorf (pers. comm.), that GVA occurs in combination with GLRaV-3.
4.7. Secondary spread of GLRaV-3 through the vine mealybug Planococcus ficus
a. PCR to identify Planococcus ficus
Mealybug DNA from the mitochondrial cytochrome c oxidase subunit 1 (CO I) gene was amplified and sequenced. These data were deposited in Genbank (Pl. ficus accession number DQ238220; Pl. citri accession number DQ238221; and Ps. longispinus accession number DQ238222). Based on the 3’- segment of the CO I gene, three species-specific forward primers were designed to be used in conjunction with a universal reverse primer (TL2-N-3014; Simon et al., 1994), such that each combination yielded DNA products of a different length. These primers were then used in a multiplex PCR reaction to differentially amplify DNA from each of the three mealybug species. Amplified DNA products from each species were of a different length, and could therefore easily be separated by electrophoresis on an agarose gel, allowing clear identification of the species present (Saccaggi et al., 2008). The multiplex PCR was tested on a closely related mealybug species (Pseudococcus viburni (Signoret)), unknown specimens in blind trials (n=30), and field-collected mealybugs from grapevine (n=143). In all cases, the multiplex PCR was sensitive, accurate and reliable. DNA could be extracted and amplified from 84% of small, damaged and degraded specimens and from all fresh specimens. In all amplified specimens, a correct identification was made. The procedure can be completed in approximately four hours (including extraction, amplification and gel elecrophoresis). Thus the identification protocol is rapid, simple, sensitive, accurate and reliable. It can easily be implemented as a large-scale diagnostic procedure in any molecular laboratory. This technique represents a substantial improvement over morphological identification, and will aid in rapid and accurate identification of mealybugs occurring in South African vineyards.
AD936 /K. Krüger / University of Pretoria
Final report 19 b. RAPD markers
(i) Compare DNA yield of three DNA extraction methods for eggs, 1st- to 3rd-instar nymphs and adult females of Planococcus ficus DNA was successfully extracted from 180 individuals from a laboratory culture. The nylon membrane method yielded significantly higher DNA concentrations than the STE buffer and Roche kit methods (F5,162 = 1608.59, p < 0.001). Adults and late-instar nymphs had higher DNA concentrations than younger individuals (F2,162 = 76.83, p < 0.001). However, the Roche kit yielded higher molecular weight (HMW) DNA (a fragment of 10kb) compared to the smaller fragments of 1500bp and less of the STE buffer and nylon membrane methods. In conclusion, the nylon membrane method will be used to extract DNA from eggs and first-instar nymphs, while the Roche kit will be used for extracting DNA from second-instar nymphs to adults.
(ii) Compare DNA fingerprinting profiles generated by five commercial brands of Taq DNA polymerase A total of 140 PCR reactions were performed to select an appropriate Taq polymerase. Fingerprinting profiles differed in intensity and number of bands generated among five commercial sources of Taq polymerase. Taq polymerase from Takara generated larger and more intense bands compared to Kapa Biosystems’ and Promega’s product. The Taq polymerase from Bioline had the smallest amount of amplification product in the negative controls, generated intense bands and is cost effective, and it was therefore decided to use Taq polymerase from Bioline in the RAPD study.
(iii) Develop a RAPD-PCR protocol and identify RAPD markers that can be used to distinguish among individual Planococcus ficus from different localities RAPD PCR optimization: Fingerprinting patterns generated by three primers for two cultured Pl. ficus individuals differed in intensity, band size and number of bands, depending on the amount or concentration of PCR reagent that was used. A total of 216 PCR reactions were performed in the PCR optimization study. The optimal concentration for each PCR reagent was selected based on the results of the PCR performed for each PCR reagent. . Taq polymerase: Although smaller amounts of Taq polymerase generated intense bands, the smaller bands observed when using larger amounts of Taq polymerase were absent. Larger amounts of Taq polymerase generated fingerprinting profiles with smears. . MgCl2 concentration: Fewer bands with low intensities were observed in the fingerprinting profiles when low concentrations of MgCl2 were used. Higher concentrations of MgCl2 generated similar fingerprinting patterns. . Primer concentration: Lower primer concentrations generated fingerprinting patterns with fewer bands compared to higher primer concentrations. The fingerprinting profiles generated by high primer concentrations were comparable to each other. . DNA concentration: Fingerprinting patterns generated by the lower DNA concentrations were comparable to those of higher DNA concentrations Preliminary determination of primer polymorphism DNA was successfully extracted from 27 2nd- and 3rd-instar Pl. ficus nymphs from six localities. A total of 72 PCR reactions were performed and DNA was successfully amplified with three 10-mer primers. Four individuals were excluded from this PCR due their low DNA concentrations. This specific PCR has to be repeated two more times in order to determine the reproducibility of the PCR and to exclude any false-negative or false-positive bands in the fingerprinting profiles. No primer polymorphism was observed for any of the three primers either among localities or within localities. However, more RAPD primers and more individuals will be included in this study to find polymorphic primers.
AD936 /K. Krüger / University of Pretoria
Final report 20
Determination of primer polymorphism using pooled DNA: a b 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Fig. 3. RAPD fingerprinting patterns of two monomorphic and two polymorphic 10-mer UBC primers for pooled DNA from P. ficus individuals from six localities in the Western Cape, indicating three potential RAPD markers (encircled). (a) monomorphic primer 1: lanes 1-6, polymorphic primer 1: lanes 8-13, (b) polymorphic primer 2: lanes 1-6, monomorphic primer 2: lanes 8-13. (a) – (b): lanes 1 & 8: Stellenbosch farm 1, lanes 2 & 9: Stellenbosch farm 2, lanes 3 & 10: Worcester, lanes 4 & 11: Franschhoek, lanes 5 & 12: Paarl, lanes 6 & 13: Wellington, lanes 7 & 14: negative controls, lane 16: molecular marker.
Approximately 200 PCR reactions were performed to select potential RAPD markers. Two of the three primers were found to be polymorphic when earlier optimization studies were performed and three potential RAPD markers were identified. PCR reactions containing pooled DNA were performed for 24 primers and four of these were polymorphic. Five potential RAPD markers were identified. In conclusion, eight potential RAPD markers were identified that could be used to distinguish among Pl. ficus individuals from different localities (e.g. Fig. 3). Following this, 50 PCR reactions were performed to determine optimal final primer and MgCl2 concentrations for the RAPD markers. Determination of primer polymorphism using individual Pl. ficus: 1000 PCR reactions were performed for five RAPD markers for 65 Pl. ficus individuals from six localities in the Western Cape (Franschhoek: n = 15, Paarl: n = 15, Stellenbosch farm 1: n = 2, Stellenbosch farm 2: n = 5, Wellington: n = 13, Worcester n = 15). RAPD markers could successfully distinguish among Pl. ficus individuals either within localities (Fig. 4a) or among localities (Fig. 4b).
(iv) Pilot study: Determine the presence/absence of RAPD markers Gel images of 1000 PCR reactions (five RAPD markers; n = 65) were screened for the presence of RAPD markers. Four of the five markers could potentially be used in population genetic studies (Table 1). Marker 4 was present in all of the mealybugs that were screened, indicating that this is probably not a potential marker. RAPD markers 1, 2 and 5 were present in 79 %, 85 % and 52% of the individuals respectively. On the other hand, RAPD marker 3 was present in only 6 % of the individuals. To conclude, RAPD markers 1, 2, 4 and 5 could potentially be used to differentiate not only between individuals from different farms, but also between individuals within a farm.
AD936 /K. Krüger / University of Pretoria
Final report 21
a b 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Fig. 4. RAPD fingerprinting patterns indicating differences among individuals from Worcester (a) and among localities (b) for two RAPD markers. (a) Fingerprinting patterns for three PCR reactions repeated for five individuals. lanes 1-3: individual 1, lanes 4-6: individual 2, lanes 7-9: individual 3, lanes 10-12: individual 4, lanes 13-15: individual 5, lane 17: molecular marker, (b) lane 1: Stellenbosch Farm (SF) 1 individual 1, lane 2: SF 1 individual 2, lane 3: Wellington individual 1, lane 4: Wellington individual 2, lane 5: Wellington individual 3, lane 6: SF 2 individual 1, lane 7: SF 2 individual 2, lane 8: SF 2 individual 3, lane 9: SF 2 individual 4, lane 10: SF 2 individual 5, lane 11: Worcester individual 1, lane 12: Worcester individual 2, lane 13: Worcester individual 3, lane 14: Worcester individual 4, lane 15: Worcester individual 5, lane 17: molecular marker. SF = Stellenbosch. Arrows indicate RAPD markers.
Table 1. Percentage presence (P) / absence (A) data of potential RAPD makers for Planococcus ficus individuals from six farms. n = sample size; I = Inconclusive.
Farm n RAPD marker 1 2 3 4 5 % P % A % I % P % A % P % A % P % A % P % A Bonfoi 2 100 50 50 100 100 100 Freedom hill 15 87 13 80 20 7 93 100 27 73 Nederburg 15 53 27 20 87 13 7 93 100 33 67 Olifantskop 13 85 15 100 100 100 23 77 Overgaauw 5 60 40 100 20 80 100 100 Chavoness 15 90 10 93 7 100 100 27 73
A RAPD-PCR protocol was established that can be successfully used to distinguish among Pl. ficus individuals among different and within localities (Fig. 5). At least five of eight RAPD markers (UBC primer sets #1-8) can be used for this analysis. The RAPD-PCR protocol developed during this study is fully optimized, reproducible and easy to perform. However, it is very time consuming to use RAPDs for the following reasons: a) each RAPD-PCR has to be repeated at least twice, b) gel electrophoresis takes 35 min to 120 min, depending on the marker used, and c) digital and hard copies of the gel photos have to be screened for the presence of RAPD markers. It was therefore decided to convert the RAPD markers into SCAR markers (see below). SCAR markers are also used in a PCR reaction, but the amplification product comprises a single band. Each PCR has to be performed only once. In addition, the amplification products can be sequenced to determine nucleotide variation.
AD936 /K. Krüger / University of Pretoria
Final report 22
a b
B1 B2 Ol1 Ol2 Ol3 N1 N2 N3 N4 N5
Fig. 5. Fingerprinting profiles of a 10-mer UBC primer for Planococcus. ficus individuals indicating differences (a) among and (b) within localities. B – Bonfoi, Ol – Olifantskop, N – Nederburg
(v) Develop SCAR markers for Planococcus ficus Cloning: RAPD-PCR: Distinct RAPD marker bands were obtained, and subsequently excised from the agarose gels for purification. Although amplification can be observed in the negative controls, it is not a case of concern, since none of the bands are the same size as the required marker. Purification: The purified DNA of each primer had concentrations of 33.8 ng/ul (UBC primer 4), 31.9 ng/ul (UBC primer 3) and 114.9 ng/ul (UBC primer 2). Ligation: For the 6:1 DNA:Vector ratio, 2.5 ul (UBC primer 4), 1.10 ul (UBC primer 3) and 0.8 ul (UBC primer 2) of each primer was added to the ligation reaction. For the 3:1 DNA:Vector ratio, 1.3 ul (UBC primer 4), 0.6 ul (UBC primer 3) and 0.4 ul (UBC primer 2) of each primer was added to the ligation reaction. All ligation steps were completed successfully. Transformation, DNA precipitation and PCR: Distinct white and blue colonies were visible for all the primers for both the 3:1 and 6:1 ratio ligation reactions on the LB/amp/IPTG/X-gal plates. At most 10 white colonies close to a blue colony were selected for each primer and cultured overnight. However, no growth was observed the following day in the test tubes. New white colonies were selected and the procedure was repeated several times. Once when growth was observed for all three primers, the clones were precipitated and a PCR performed. However, there was no PCR product visible in 11 samples (UBC primer 4, n = 2; UBC primer 3, n = 3; UBC primer 2, n = 7), while the one PCR product of UBC primer 2 consisted of two bands of the incorrect size. Various measures were undertaken to exclude the possibility of experimental error, e.g. fresh LB broth, LB agar, SOC medium, AMP solution and agar plates were prepared all the time. In addition, 6:1 ratio ligation reactions were prepared again. Only limited growth of white colonies was observed on the LB/amp/IPTG/X-gal plates and those that were selected for overnight culturing did not grow, adding to the problems experienced above. As a final precautionary measure new ampicillin was ordered. It was decided to use 3:1 ligation reactions. However, no white colonies and only a few blue colonies were observed on the LB/amp/IPTG/X-gal plates after transformation. IPTG was freshly made up and new X- Gal was used. Transformation was repeated and background, positive and transformation efficiency controls were included. The positive control plates yielded 96% white colonies and 4% blue colonies (average of two plates), suggesting effective ligation has taken place. The background plates yielded 13 and two blue colonies respectively, suggesting a transformation efficiency of the competent cells of 1 x 107 – 1 x 108 cfu/ug DNA which is in line with the recommendations of the kit. The transformation efficiency plates yielded 11 and nine white colonies respectively. This amounts to a total of 1 x 107 cfu/ug DNA. This suggests that the cloning procedure is effective. Only transformations from UBC primer 2 yielded white colonies. All previously transformed LB/amp/IPTG/X-gal plates were stored in the fridge and white colonies for UBC primer 3 and 4 were selected from these plates. The colonies were cultured overnight and 53% of them grew in the culture medium. No growth was observed in the test tube that served as a blank. Thereafter, each clone was successfully precipitated. The PCR’s were successfully performed with amplification products being observed for all the clones. AD936 /K. Krüger / University of Pretoria
Final report 23
However, the product sizes were too small for UBC primers 2 (200bp instead of 994bp) and 4 (200 instead of 1094bp). In addition UBC primer 2 had two amplification products. However, the product size of UBC primer 3 is approximately 500bp, suggesting the marker has been successfully cloned. Purification, cycle sequencing, precipitation, sequencing and primer design Two clones from UBC primer 3 were purified successfully (Fig. 6). A clear band was produced by the Roche kit (clone 4) compared to the band from the other purification method (clone 5).
a 1 2 b 1 2
Figure 6. Purified products of two clones for UBC primer 3. a) lane 1: Molecular marker, lane 2: clone 4; b) lane 1: molecular marker, lane 2: clone 5.
Two forward reactions were successfully sequenced for both clones (Fig. 7). Although only the forward primers were used, the sequences extended into the promoter SP6 region, thereby confirming that the entire purified product was sequenced. The sequences were edited and aligned. No variation was found between the four sequences, thereby confirming that the clones were identical. The NCBI/Blast results were inconclusive and could not find any similarities with any of the existing sequences for Planococcus or closely related species. The 292 bp sequence was most similar to four species of bacteria (87-93%), the pig (92%) and the Bilharzia worm, Schistosoma mansoni (88%). The four bacterial species were 1) Sanguibacter keddieii (Actinobacterium, first isolated from blood of cows in Spain), 2) Thermotoga lettingae (thermophilic methanol-oxidizing bacterium), 3) Azorhizobium caulinodans (nitrogen-fixing bacterium in plants), and 4) Burkholderia thailandensis (Gram negative bacillus that occurs naturally in soil, stagnant water and rice paddies in parts of Thailand). Two primer pairs were designed, producing product lengths of 227 bp and 223 bp, respectively.
a b
Figure 7. Extracts from the chromatograms of two clones from the product of UBC primer 3. a) Clone 4, b) Clone 5.
SCAR marker PCR - Both of the primer pairs produced PCR products of the expected band size (Fig. 8). Optimization of the PCR cycling conditions was needed to obtain a single band (Figs. 9, 10). By either reducing the extension time or increasing the annealing temperature, a single band for most of the amplification products for primer pair 2 were obtained, but not for primer pair 1. AD936 /K. Krüger / University of Pretoria
Final report 24
Further optimization is, therefore, needed, for primer pair 1 and small changes need to be made to the final concentrations of the PCR reactions for primer pair 2. The amplicon was present in individuals from the Freedom Hill, Nederburg, and Overgaauw farms (Figs. 8, 10). It was also present in two individuals from the Freedom Hill farm (Fig. 9). Thereby suggesting both primer pairs were able to distinguish between individuals from different farms as well as between individuals within a farm.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
- - - + ++ - - - +++
Figure 8. Encircled areas indicate negative (-) and positive (+) samples for the SCAR marker developed from sequencing Pl. ficus using UBC primer 3. Amplification products from primer pair 1. Lanes 2-4: negative samples: Fre individual 1, Ned individual 1, Ove individual 1; lanes 5-7: positive samples: Fre individual 2, Ned individual 2, Ove individual 2; amplification products from primer pair 2. Lanes 9-11: negative samples: Fre individual 1, Ned individual 1, Ove individual 1; lanes 12-14: positive samples: Fre individual 2, Ned individual 2, Ove individual 2. Lanes 1 and 16: molecular markers; lanes 8 and 15 negative controls. (Fre: Freedom Hill; Ned: Nederburg; Ove: Overgaauw).
PP2 PP1 PP2 PP1 1 2 3 4 5 6 7 8 9 10 11 12 13
Figure 9. Optimization of the PCR+ cycling conditions for the SCAR markers of UBC primer 3. Lanes 2-7 show the effect of reduced extension time, while lanes 8-13 shows the effect of an increased annealing temperature. Lane 2: Negative sample: Fre individual 1, lane 3: Positive sample: Fre individual 2; Lane 5: Negative sample: Fre individual 1; lane 6: Positive sample: Fre individual 2. Lane 8: Negative sample: Fre individual 1, lane 9: Positive sample: Fre individual 21; Lane 11: Negative sample: Fre individual 1; lane 12: Positive sample: Fre individual 2. Lane 1: Molecular marker; lanes 4, 7, 10, 13 negative controls. (Fre: Freedom Hill; Ned: Nederburg; Ove: Overgaauw; PP1: Primer pair 1; PP2: Primer pair 2; +: Positive samples). AD936 /K. Krüger / University of Pretoria
Final report 25
1 2 3 4 5 6 7 8
+ + +
Figure 10. Amplification products from the SCAR marker (primer pair 2) developed from UBC primer 3, showing differences between localities as well as within a locality. Lanes 2-4: Negative samples: Fre individual 1, Ned individual 1, Ove individual 1, lanes 4-6: Positive samples: Fre individual 2, Ned individual 2, Ove individual 2, Lane 8: negative control. (Fre: Freedom Hill; Ned: Nederburg; Ove: Overgaauw; +: Positive samples).
In conclusion, RAPD markers can potentially be used to distinguish between Pl. ficus individuals from different vineyards and within a vineyard. However, since the Blast search could not match the sequencing information obtained from this study to any of the other Planococcus sequences or closely related species in the database, it is not with absolute certainty that amplicons from Pl. ficus were sequenced rather than any organisms associated with it. Due to several difficulties experienced with the cloning procedures, only one RAPD marker was converted into a potential SCAR marker. This SCAR marker associated with Pl. ficus could successfully distinguish between individuals from different vineyards, as well as within a vineyard. At the onset of this project, whole genome sequencing was very expensive and RAPD markers were chosen as an alternative. However, whole genome sequencing has become an affordable alternative. Instead of sequencing only part of the DNA of an individual, its whole genome can be sequenced allowing for faster identification of molecular markers.
4.8. Determine the relationship between the amount of GLRaV-3 uptake and transmission to grapevine by Planococcus ficus
Comparison of GLRaV-3 extraction methods
Initially, the Phenol-chloroform and Gentra methods proved to be the most reliable as the samples tested positive for all three PCRs. Unfortunately, the Gentra kit was withdrawn from the market after tests were completed. Due to costs of alternative kits it was decided to modify the QIAzol method by adding a combination of 2.5 % (wt/vol) PVP-40 with 1 % (vol/vol) β-ME to the QIAzol reagent before proceeding with the extraction method. Even though this improved the number of positive samples considerably, results remained unreliable as many of the samples tested only strongly positive once and rarely twice. The Phenol-chloroform method was therefore considered the optimal method (Smit, 2008) Comparing extraction efficiencies with real-time RT-PCR confirmed that the Phenol-chloroform method was more efficient in RNA extraction from both grapevine and Pl. ficus than the Gentra, QIAzol-adj and Qiagen methods (Fig. 11). The Phenol-chloroform method produced RNA in high concentrations with high PCR efficiencies. The QIAzol-adj method only appears to be reliable in extracting RNA from larger samples (six leaf punches or mealyugs) than smaller samples (single leaf punchers or mealybugs).
AD936 /K. Krüger / University of Pretoria
Final report 26
The current study confirms that the extraction method affects the integrity and purity of extracted RNA from grapevine and mealybugs. Extraction methods should, therefore, be carefully selected for reliable and diagnostic use in real-time RT-PCR. a b Phenol-chloroform Phenol-chloroform QIAzol-adjusted QIAzol-adjusted Gentra Qiagen Positive control Positive control Negative control Negative control
c d Phenol-chloroform Phenol-chloroform QIAzol-adjusted QIAzol-adjusted Gentra Qiagen Positive control Positive control Negative control Negative control
Fig. 11. Extraction efficiency from leaf (a, b) and mealybug samples (c, d)
Real-time RT-PCR for detection and quantification of GLRaV-3 in grapevine and Planococcus ficus
DNA and cRNA external standards were successfully obtained from purified RT-PCR product and in vitro transcription of RT-PCR products, respectively (Fig. 11). Intra- and inter-assay variation were used to evaluate the quantitative sensitivity and precision of the standard curves (Fig. 12, Table 2). An estimate of standard curve reproducibility can be determined by analyzing the standard deviation (SD) of the CP values produced from replicated runs. Intra- and inter- assay variability is generally higher in standards with a lower starting template concentration (Wong & Medrano, 2005), as was also found in the present study, where an increased albeit small variability in the standard samples with lower template concentration per reaction could be detected (Table 3). The DNA standards had a wider detection and amplification range and were more sensitive than the cRNA standards (Table 2). A limitation of DNA standard curve methods is that they are not subjected to the reverse transcription (RT) step. However, the cRNA standard is subjected to the RT step together with the experimental samples. Therefore, the cRNA standard provides information on the input RNA concentration prior to the RT step and can account for differences in efficiencies of cDNA synthesis.
AD936 /K. Krüger / University of Pretoria
Final report 27
Fig. 12. Construction of DNA and cRNA standard curves. LightCycler™-assisted real-time PCR of purified RT-PCR and in vitro transcribed RT-PCR products, respectively a,c) serially diluted DNA and cRNA external standards ranging from approximately 1.77 x 109 to 1.77 and 5.822 x 109 to 5.822 x 103 GLRaV-3 copies/µl, respectively. Plotting fluorescence against cycle number the crossing points (CP) were determined by the automated method provided by LightCycler™ software 4.0 and b,d) the CP values were plotted against the logarithm of the starting template concentration, showing a linear relationship.
Fig. 13. Intra-assay reproducibility test of a) DNA and b) cRNA external standard models
AD936 /K. Krüger / University of Pretoria
Final report 28
Table 2. Mean, standard deviation (SD) and coefficient of variance values for a) intra-assay and b) inter-assay variation of DNA and cRNA standards. An increase in variation is shown in DNA and cRNA standards with low template concentration.
CP Coefficient of variance Mean SD Samples copies/µl -95.00% 95.00% DNA standard 1.78 x 10 9 7.46600 0.126214 7.30928 7.62272 1.78 x 10 8 11.61600 0.102372 11.48889 11.74311 1.78 x 10 7 16.95800 0.300033 16.58546 17.33054 1.78 x 10 6 22.02800 0.169470 21.81758 22.23842 1.78 x 10 5 27.24200 0.413243 26.72889 27.75511
cRNA standard 5.822 x 10 10 14.08400 0.121778 13.93279 14.23521 5.822 x 10 9 17.39800 0.216264 17.12947 17.66653 5.822 x 10 8 21.97800 0.594365 21.24000 22.71600 5.822 x 10 7 26.33000 0.322723 25.92929 26.73071 5.822 x 10 6 30.89400 0.443712 30.34306 31.44494
Quantification experiments in the present study showed the DNA and cRNA standard models to be highly sensitive, enabling quantification of GLRaV-3 in Pl. ficus nymphs (Table 3). Both standards can be used for quantifying GLRaV-3 in grapevines and mealybugs (Smit, 2008). However, the purpose of the study and the accuracy required determine the choice of standard curve.
Table 3. CP and GLRaV-3 concentration values of grapevine (L) and corresponding mealybug (M) samples from qPCR and qRT-PCR using the DNA standard curve and cRNA standard curve models, respectively.
DNA Standard curve cRNA standard curve Measured GLRaV-3 Measured GLRaV-3 Sample CP value concentration CP value concentration
L1 25.79 1.38E-04 27.57 4.32E-03 M1 31.11 2.98E-06 31.22 2.93E-04 L2 28.84 1.58E-05 29.76 8.77E-04 M2 34.3 2.64E-07 35.31 1.20E-05 L3 27.06 5.64E-05 28.69 1.92E-03 M3 33.01 7.12E-07 35.54 9.94E-06
In conclusion, the standards developed in the current study can be used for comparing GLRaV-3 concentration in plants and in mealybugs exposed to different feeding times. The DNA standard model is best applied as a quantification method where initial RNA concentration is not relevant.
GLRaV-3 transmission by Planococcus ficus
GLRaV-3 acquisition from virus-source leaves by first-instar mealybug nymphs All of the 67 virus-source leaf punches sampled tested positive for GLRaV-3. Of the 37 nymphs tested after completion of various AAPs, nine (24%) tested positive for the virus. This is higher compared to Douglas & Krüger (2008) where the number of positive nymphs ranged between 14 % and 16 %. To determine the relationship between feeding time and amount of virus uptake AAPs ranging from 30 min to 24 hours were tested. The number of GLRaV-3 positive nymphs was lower after short AAPs
AD936 /K. Krüger / University of Pretoria
Final report 29
(e.g. 15 min AAP: 33 %) compared to AAPs of 24 hours (86%), the longest time tested. Initial results suggest that the quantity of GLRaV-3 in first-instar nymphs exposed to GLRaV-3 infected plants is not necessarily related to the time nymphs had access to the virus source (Fig.14). However, there seems to be a positive relationship between the quantity of GLRaV-3 available in a given virus source leaf and virus quantity in first-instar nymphs (Fig. 15).
40 35 30 25 20
in leaf (%) 15 10 5 GLRaV-3 in nymph/GLRaV-3 nymph/GLRaV-3 in GLRaV-3 0 0 5 10 15 20 25 Acquisition access period (hours) Fig. 14. The quantity of Grapevine leafroll associated virus 3 (GLRaV-3) in first-instar nymphs of Planococcus ficus expressed as a percentage of the quantity of GLRaV-3 in the virus source leaf and plotted against the acquisition access period.
0.45 0.4 0.35 0.3 0.25 0.2 0.15 first-instar nymphs first-instar 0.1 Amount of GLRaV-3 (ng) (ng) in GLRaV-3 of Amount 0.05 0 0 20406080100 Amount of GLRaV-3 (ng) in leaf punches from virus source leaves Fig. 15. Relationship between Grapevine leafroll associated virus 3 (GLRaV-3) quantity in leaf punches of virus source leaves and first-instar nymphs of Planococcus ficus after an acquisition access period of 24 h.
AD936 /K. Krüger / University of Pretoria
Final report 30
Transmission of GLRaV-3 by first-instar nymphs to virus-free recipient plants Of the 39 recipient plant samples analysed, eight (21%) leaf punches tested positive for GLRaV-3 so far. At AAPs of 24 hours the infection rate (number of GLRaV-3 positive leaf punch samples) using single first-instar nymphs for GLRaV-3 transmission was 17%. There was no discernible pattern between the period the nymphs had access to the virus source leaf and the number of GLRaV-3- infected leaf punches of recipient plants. The amount of GLRaV-3 in first-instar nymphs after completion of inoculation access feeding was zero or lower compared to nymphs collected directly after completion of acquisition feeding, a possible reason being loss of infectivity. Cid et al. (2007) found that the virus was not confined to the gut of the mealybug nymph, but also occurred in the salivary glands, the malpighian tubules (excretory organs) and probably the haemolymph of Pl. citri. The same authors suggested that the virus is transported in the haemolymph between the salivary glands and the gut of the mealybug and that endosymbionts may attack the virus in the haemolymph so that infectivity in the nymph can become reduced over time Krüger et al. (2006) on the other hand found that Pl. ficus nymphs can retain GLRaV-3 for eight days when feeding on a virus non-host plant after acquiring the virus. Interestingly, the amount of GLRaV-3 in the recipient plant (corresponding leaf punch where nymph was removed after a 5-day IAP) was in some cases several times higher than quantity of GLRaV-3 in the corresponding virus source leaf (Fig. 16), independent of the AAP. The leaf punches were taken at the actual sites where the mealybug nymphs were collected after a 5-day IAP. Thus, initial results suggest that the amount in GLRaV-3-positive leaf punches of recipient grapevine plants is independent of feeding time of first-instar nymphs of Pl. ficus and the amount of GLRaV-3 in the source plant.
1.4
1.2 30 min AAP 1
0.8
0.6 24 h AAP 0.4
0.2 Amount of GLRaV-3 (ng) (ng) in GLRaV-3 of Amount leaf punches of reipient plant punches reipient of leaf 0 0 5 10 15 Amount of GLRaV-3 (ng) in leaf punches of virus source plant
Fig. 16. Relationship between the amount of Grapevine leafroll-associated virus-3 (GLRaV-3) in leaf punches of virus source plants (collected after completion of acquisition access feeding by first-instar nymphs) and leaf punches of recipient plants (collected after completion of inoculation access feeding).
References Belli, G., Fortusini, A., Casati, P., Belli, L., Bianco, P. A., Prati, S. (1994). Transmission of a grapevine leafroll associated closterovirus by the scale insect Pulvinaria vitis L. Rivista di Patologia Vegetale 4: 105–108. Burger, J. (1999) Grapevine leafroll disease: a new control strategy? WineLand, December. Cabaleiro, C., Segura, A. (1997) Field transmission of Grapevine leafroll associated virus 3 (GLRaV-3) by the mealybug Planococcus citri. Plant Disease 8: 283-287.
AD936 /K. Krüger / University of Pretoria
Final report 31
Cabaleiro, C., Segura, A., García-Berrios, J.J. (1999) Effects of Grapevine leafroll-associated virus 3 on the physiology and must of Vitis vinifera L. cv. Albariño following contamination in the field. American Journal of Enology and Viticulture 50: 40-44. Cid, M., Pereira, S., Cabaleiro C., Faoro, F. & Segura, A. (2007) Presence of Grapevine leafroll-associated virus 3 in primary salivary glands of the mealybug vector Planococcus citri suggests a circulative transmission mechanism. European Journal of Plant Pathology 118: 23-30. Douglas, N. & Krüger, K. (2008) Transmission efficiency of Grapevine leafroll-associated virus 3 (GLRaV-3) by the mealybugs Planococcus ficus and Pseudococcus longispinus (Hemiptera: Pseudococcidae). European Journal of Plant Pathology 122: 207–212. Douglas, N., Pietersen, G., Krüger, K. (2009) A real-time RT-PCR assay for the detection and quantification of Grapevine leafroll-associated virus 3 (GLRaV-3) in Vitis vinifera L. (Vitaceae) and Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae). 16th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Dijon, France, August/September 2009. pp. 292-293. Engelbrecht, D.J. , Kasdorf, G.G.F. (1990) Transmission of grapevine leafroll disease and associated closteroviruses by the vine mealybug, Planococcus ficus. Phytophylactica 22: 341-346. Fronhoffs, S., Totzke, G., Stier, S., Wernert, N., Rothe, M., Brüning, T., Koch, B., Sachinidis, A., Vetter, H., Ko, Y. 2002. A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Molecular and Cellular Probes 16: 99-110. Goheen, A.C. & Cook, J.A. (1959) Leafroll (red-leaf or rougeau) and its effect on vine growth, fruit quality, and yields. American Journal for Enology and Viticulture 10: 173-181. Golino, D.A., Sim, S.T., Gill, R. & Rowhani, A. (2002) California mealybugs can spread grapevine leafroll disease. California Agriculture 56: 196-201. Jooste, A.E.C., Maree, H.J., Bellstedt, D.U., Goszczynski, D.E., Pietersen, G., Burger, J.T. (2010) Three genetic Grapevine leafroll-associated virus 3 variants identified from South African vineyards show high variability in their 5’UTR. Archives of Virology. DOI 10.1007/s00705-010-0793-y Krüger, K., Douglas, N. (2009) Transmission of Grapevine leafroll-associated virus 3 (GLRaV-3) by three soft scale insect species (Hemiptera: Coccidae) and notes on their developmental biology on grapevine. 16th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Dijon, France, August/September 2009. pp. 281-282. Krüger, K., Saccaggi, D. & Douglas, N. (2006) Grapevine leafroll-associated virus 3 - vector interactions: transmission by the mealybugs Planococcus ficus and Pseudococcus longispinus (Hemiptera: Pseudococcidae). 15th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Stellenbosch, South Africa, April 2006. pp. 130-131. MacKenzie, D.J. (1997). A standard protocol for the detection of viruses and viroids using a reverse transcription- polymerase chain reaction technique. Document CPHBT-RT-PCR1.00, The Canadian Food Inspection Agency. La Notte, P., Minafra, A., Saldarelli, P. (1997) A spot-PCR technique for the detection of phloem-limited grapevine viruses. Journal of Virological Methods 66: 103–108. Ling, K. -S., Zhu, H. -Y., Petrovic, N., Gonsalves, D. (2001) Comparative effectiveness of ELISA and RT-PCR for detecting Grapevine leafroll-associated closeterovirus-3 in field samples. American Journal of Enology and Viticulture 52: 21–27. Mahfoudhi, N., Digiaro, M., and Dhouibi, M. H. 2009. Transmission of grapevine leafroll viruses by Planococcus ficus (Hemiptera: Pseudococcidae) and Ceroplastes rusci (Hemiptera: Coccidae). Plant Disease 93: 999- 1002. Mawela, K.V. (2005) Temperature requirements of the longtailed mealybug Pseudococcus longispinus (Targioni Tozzetti) (Hemiptera: Pseudococcidae) on grapevine. MInstAgrar Thesis, University of Pretoria, Pretoria. Osman, F. & Rowhani, A. (2006) Application of a spotting sample preparation technique for the detection of pathogens in woody plants by RT-PCR and real-time PCR (Taqman). Journal of Virological Methods 133: 130-136. Osman, F., Leutenegger, C., Golino, D. & Rowhani, A. (2007) Real-time RT-PCR (TaqMan) assays for the detection of Grapevine leafroll associated viruses 1-5. Journal of Virological Methods 141: 22-29. Paran, I, Michelmore, RW. 1993. Development of reliable PCR-based markers linked to downy resistance genes in lettuce. Theoretical and Applied Genetics 85: 985-993. Petersen, C. L., Charles, J. G. (1997). Transmission of grapevine leafroll-associated closteroviruses by Pseudococcus longispinus and P. calceolariae. Plant Pathology 46: 509–515. Saccaggi, D.L., Krüger, K. & Pietersen, G. (2008) A multiplex PCR assay for the simultaneous identification of three mealybug species (Hemiptera: Pseudococcidae). Bulletin of Entomological Research 98: 27-33. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a complication of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651–701. Smit, N. (2008) A real time RT-PCR assay for the detection and quantification of Grapevine leafroll-associated virus 3 in Vitis vinifera (Vitaceae) and Planococcus ficus (Signoret)(Hemiptera: Pseudococcidae). MSc (Entomology), University of Pretoria, Pretoria. Vijgen, L., Keyaerts, E., Moës, E., Maes, P., Duson, G. & Van Ranst, M. 2005. Development of one-step, real- time, quantitative reverse transcriptase PCR assays for absolute quantitation of human coronaviruses OC43 and 229E. Journal of Clinical Microbiology 43: 5452-5456.
AD936 /K. Krüger / University of Pretoria
Final report 32
Walton, V.M., Krüger, K., Saccaggi D.L. & Millar, I.M. (2009) A survey of scale insects (Sternorryncha: Coccoidea) occurring on table grapes in South Africa. Journal of Insect Science 9 (Article 47): 1-6. Welsh, J. & McClelland M. 1990. fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18: 7213-7218. Williams, J. G. K, Kubelik, A. R., Livak, K. J., Rafalski, J. A., Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18: 6531-6535. Wong, M.L. & Medrano, J.F. 2005. Real-time PCR for mRNA quantitation. BioTechniques 39: 1-11.
5. Accumulated outputs List ALL the outputs from the start of the project. The year of each output must also be indicated.
Technology development, products and patents Indicate the commercial potential of this project (intellectual property rights or a commercial product(s)).
2002/2003 Assay/protocol for transmission of GLRaV-3 using Planococcus ficus Development of PCR technique to detect GLRaV-3 in single first-instar nymphs of Planococcus ficus
2004/2005 Multiplex PCR for the identification of Planococcus ficus, Planococcus citri and Pseudococcus longispinus
2008/2009 Development of real-time PCR technique to quantify GLRaV-3 in grapevine and mealybug vectors Development of RAPD-PCR protocol to identify markers associated with Planococcus ficus individuals from different populations
Human resources development/training Indicate the number and level (e.g. MSc, PhD, post doc) of students/support personnel that were trained as well as their cost to industry through this project. Add in more lines if necessary.
Student level (BSc, MSc, PhD, Post doc) Cost to project (R) 1. Saccaggi, Davina (BSc(Hons), 2003) R 14,000 2. Saccaggi, Davina (MSc, 2005) R 54,000 3. Mawela, K.V. (MInstAgrar, 2005) R 16,000 4. Douglas, N. (BSc(Hons), 2005) R 14,000 5. Douglas-Smit, N. (MSc, 2008) R 60,000 6. Ferreira, M. (PhD, in progress) R 105,000
Publications (popular, press releases, semi-scientific, scientific)
Scientific publications
AD936 /K. Krüger / University of Pretoria
Final report 33
Saccaggi, D.L., Krüger, K. & Pietersen, G. (2008) A multiplex PCR assay for the simultaneous identification of three mealybug species (Hemiptera: Pseudococcidae). Bulletin of Entomological Research 98: 27-33.
Douglas, N. & Krüger, K. (2008) Transmission efficiency of Grapevine leafroll-associated virus 3 (GLRaV-3) by the mealybugs Planococcus ficus and Pseudococcus longispinus (Hemiptera: Pseudococcidae). European Journal of Plant Pathology 122: 207–212.
Walton, V.M., Krüger, K., Saccaggi D.L. & Millar, I.M. (2009) A survey of scale insects (Sternorryncha: Coccoidea) occurring on table grapes in South Africa. Journal of Insect Science 9 (Article 47): 1-6.
Krüger, K., Douglas, N.. (under review). Grapevine leafroll-associated virus 3 (GLRaV-3) transmission by three soft scale insect species (Hemiptera: Coccidae) with notes on their biology. African Entomology.
Thesis Saccaggi, Davina. (2003) Transmission of grapevine leafroll-associated virus 3 by the longtailed mealybug Pseudococcus longispinus (Targioni-Tozzetti) (Hemiptera: Pseudococcidae). BSc(Hons) Thesis, University of Pretoria, Pretoria. (with distinction) Saccaggi, Davina. (2005) Development of molecular techniques to identify mealybugs (Hemiptera: Pseudococcidae) of importance on grapevine in South Africa. MSc Thesis, University of Pretoria, Pretoria. (with distinction) Mawela, Khethani V. (2005) Temperature requirements of the longtailed mealybug Pseudococcus longispinus (Targioni Tozzetti) (Hemiptera: Pseudococcidae) on grapevine. MInstAgrar Thesis, University of Pretoria. Douglas, Nicoleen. (2005) Efficiency of grapevine leafroll-associated virus 3 (GLRaV-3) transmission by mealybugs (Hemiptera: Pseudococcidae). BSc(Hons) Thesis, University of Pretoria, Pretoria. (with distinction) Smit, Nicoleen. (2008) A real-time RT-PCR assay for the detection and quantification of grapevine leafroll-associated virus 3 (GLRaV-3) in Vitis vinifera (Vitaceae) and Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae). MSc Thesis, University of Pretoria, Pretoria.
Popular van Wyk, S. 2006. Winning the wine war. Mail & Guardian, 6-12 October 2006 (Supplement).
THRIP (2006) Control of grapevine leafroll disease. THRIP 2006 annual report.
Presentations/papers delivered
Conferences
Krüger, K. Transmission of grapevine leafroll-associated virus 3 (GLRaV-3) by Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae). 14th Congress of the Entomological Society of Southern Africa. Pretoria, South Africa, July 2003. pp. 46-47.
N. Douglas & K. Krüger Persistence of grapevine leafroll-associated virus 3 (GLRaV-3) in Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae). 15th Congress of the Entomological Society of Southern Africa. Grahamstown, South Africa, July 2005. p. 19.
AD936 /K. Krüger / University of Pretoria
Final report 34
D.L. Saccaggi, K. Krüger, G. Pietersen & C. MacDonald. A PCR-based method for identification of three mealybug species (Hemiptera: Pseudococcidae). 15th Congress of the Entomological Society of Southern Africa. Grahamstown, South Africa, July 2005. p. 51.
K.V. Mawela, N. Douglas, J. van der Merwe & K. Krüger. Temperature-dependent development of the longtailed mealybug Pseudococcus longispinus Targioni-Tozzetti (Hemiptera: Pseudococcidae) on grapevine. 15th Congress of the Entomological Society of Southern Africa. Grahamstown, South Africa, July 2005. p. 73.
N. Douglas & K. Krüger. Grapevine leafroll-associated virus 3 transmission efficiency of Planococcus ficus and Pseudococcus longispinus (Hemiptera: Pseudoccidae). 15th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Stellenbosch, South Africa, April 2006. pp. 191-192.
K. Krüger, N. Douglas & D. Saccaggi. Grapevine leafroll-associated virus 3 - vector interactions: transmission by the mealybugs Planococcus ficus and Pseudococcus longispinus (Hemiptera: Pseudococcidae). 15th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Stellenbosch, South Africa, April 2006. pp. 130-131
D.L. Saccaggi, K. Krüger & G. Pietersen. Rapid identification of three mealybug species by multiplex PCR. 15th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Stellenbosch, South Africa, April 2006. pp. 124-125.
N. Douglas, G.P. Malherbe & K. Krüger. Grapevine leafroll-associated virus-3 (GLRaV-3) extraction from grapevines and mealybugs (Hemiptera: Pseudococcidae) for quantitative real-time PCR. XXIII International Congress of Entomology, Durban, South Africa, July 2008.
M. Ferreira, G. Pietersen, E. Barros & K. Krüger. Determining dispersal patterns of Planococcus ficus (Hemiptera: Pseudococcidae) among South African vineyards using RAPD markers. XXIII International Congress of Entomology, Durban, South Africa, July 2008.
M. Ferreira, G. Pietersen, E. Barros & K. Krüger. Development of a RAPD protocol to determine dispersal patterns of Planococcus ficus (Hemiptera: Pseudococcidae) among South African vineyards using RAPD markers. Bioinformatics and Genomics approaches for functional gene expression in vector-virus-host interactions. Joint symposium: University of the Witwatersrand and University of Arizona, Johannesburg, South Africa, March 2009.
K. Krüger, N. Douglas. Transmission of Grapevine leafroll-associated virus 3 (GLRaV-3) by three soft scale insect species (Hemiptera: Coccidae) and notes on their developmental biology on grapevine. 16th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Dijon, France, August/September 2009. pp. 181-182
N. Douglas, G. Pietersen & K. Krüger. A real-time RT-PCR assay for the detection and quantification of Grapevine leafroll-associated virus 3 (GLRaV-3) in Vitis vinifera L. (Vitaceae) and Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae). 16th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG). Dijon, France, August/September 2009.
Workshops
Krüger, K. Spread of Grapevine leafroll-associated virus 3 (GLRaV-3) by scale insects. Grapevine Virus Workshop I, Winetech. Plaisir de Merle wine estate, South Africa, May, 2001.
Krüger, K. Spread of Grapevine leafroll-associated virus 3 (GLRaV-3) by scale insects. Grapevine Virus Workshop II, Winetech. Plaisir de Merle wine estate, South Africa, May, 2002.
Krüger, K. Spread of Grapevine leafroll-associated virus 3 (GLRaV-3) by scale insects (Hemiptera: Coccoidea Grapevine Virus Workshop III, Winetech. Stellenbosch, South Africa, May, 2003.
AD936 /K. Krüger / University of Pretoria
Final report 35
Krüger, K. The role of insect vectors in the transmission of grapevine leafroll disease. Grapevine Virus Workshop IV, Winetech. Stellenbosch, South Africa, May, 2004.
Krüger, K. The role of insect vectors in the transmission of grapevine leafroll disease. Grapevine Virus Workshop V, Winetech. Stellenbosch, South Africa, May, 2005.
Krüger, K. Spread of GLRaV-3 by scale insects (Coccoidea). Grapevine Virus Workshop VI, Winetech. Stellenbosch, South Africa, May, 2006.
Krüger, K., Douglas, N. & Ferreira, M. Grapevine leafroll disease, mealybugs and vineyards. Grapevine Virus Workshop VII, Winetech. Stellenbosch, South Africa, May 2007.
Krüger, K., Douglas, N. Grapevine leafroll virus extraction from grapevines and mealybugs for quantitative real-time PCR Grapevine Virus Workshop VII, Winetech. Stellenbosch, South Africa, August 2008.
Ferreira, M., Barros, E., Pietersen, G., Krüger, K. Secondary spread of GLRaV-3 through the vine mealybug Planococcus ficus. Grapevine Virus Workshop VII, Winetech. Stellenbosch, South Africa, September 2008.
Ferreira, M., Barros, E., Pietersen, G., Krüger, K. Determining dispersal patterns of Planococcus ficus (Hemiptera: Pseudococcidae) among South African vineyards using RAPD markers. Grapevine Virus Workshop IX, Winetech. Stellenbosch, South Africa, September 2009.
Krüger, K. Control of leafroll disease through vector control. 4th International SASEV Conference on Enology & Viticulture – Beyond 2010; Workshop: Who’s afraid of the big, bad leafroll. Cape Town, South Africa, July 2009.
AD936 /K. Krüger / University of Pretoria
Final report 36
4. Total cost summary of project
Year CFPA Deciduous DFTS Winetech THRIP Other TOTAL Total cost in real terms for year
1 Total cost in real terms for year 2002/2003 255,139.00 - 109,345.00 364,484.00 2 Total cost in real terms for year 2003/2004 183,479.55 171,856.00 119,485.10 474,820.65 3 Total cost in real terms for year 2004/2005 173,397.00 212,109.00 135,638.00 521,144.00 4 Total cost in real terms for year 2005/2006 167,372.00 147,054.00 82,000.00 396,426.00 5 Total cost in real terms for year 154,485.00 2006/2007 144,485.00 87,800.00 386,770.00 6 Total cost in real terms for year 128,000.00 2007/2008 128,000.00 87,800.00 343,800.00 7 Total cost in real terms for year 102,837.00 2008/2009 176,500.00 73,000.00 352,337.00 8 TOTAL 1,228,373.00 916,341.00 695,068.10
AD936 /K. Krüger / University of Pretoria