US008993.526B2

(12) United States Patent (10) Patent No.: US 8,993,526 B2 Chatelain et al. (45) Date of Patent: *Mar. 31, 2015

(54) METHOD FOR COUNTERACTING THE USPC ...... 514/20.6; 435/7.1; 435/7.2 PERCEPTION OF SWEAT MALODOUR BY (58) Field of Classification Search DECREASING THE FUNCTION OF CPC ..... G01N33/52: G01N 33/58; G01N 33/566; CARBOXYLIC ACID-BINDING OLFACTORY G01N 2333/705; G01N 2500/04; A61K 31/00 RECEPTORS See application file for complete search history. (71) Applicant: ChemCom S.A., Brussels (BE) (56) References Cited (72) Inventors: Pierre Chatelain, Brussels (BE); Alex U.S. PATENT DOCUMENTS Veithen, Genappe (BE) 8,008,023 B2 * 8/2011 Sallman et al...... 435/71 2003/0207337 A1* 11/2003 Han et al...... 435/72 (73) Assignee: ChemCom S.A., Brussels (BE) 2008, 0299586 A1 12/2008 Han et al. (*) Notice: Subject to any disclaimer, the term of this FOREIGN PATENT DOCUMENTS patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days. WO 2012/O29922 3, 2012 This patent is Subject to a terminal dis OTHER PUBLICATIONS claimer. Lasaka, M., et al., “Olfactory Sensitivity for Carboxylic Acids in Spider Monkeys and Pigtail Macaques' Chemical Senses, col. 29. (21) Appl. No.: 13/916,282 No. 2, p. 101-109, 2004. Krautwurst D, “Human Olfactory Receptor Families and their Odor (22) Filed: Jun. 12, 2013 ants', Chemistry and Biodiversity, vol. 5 p. 842-852, 2008. Idan, Menasheet al., “Genetic Elucidation of Human Hyperosmia to (65) Prior Publication Data Isovaleric Acid'. PloS Biology, vol. 5, Issue 11, p. 2462, 2007. US 2013/033691.0 A1 Dec. 19, 2013 * cited by examiner Related U.S. Application Data Primary Examiner — Robert Landsman (62) Division of application No. 13/024.325, filed on Feb. (74) Attorney, Agent, or Firm — Locke Lord LLP. Ralph A. 9, 2011, now Pat. No. 8,637,259. Loren (51) Int. Cl. (57) ABSTRACT A6 IK38/00 (2006.01) The invention relates to the identification of carboxylic acids, C07K I4/72 (2006.01) present in human Sweat, as natural ligands of a specific Sub C07K 4/705 (2006.01) group of seven olfactory receptor (OR) belonging to class 1 GOIN33/53 (2006.01) within the OR classification. The invention encompasses the GOIN33/567 (2006.01) use of the interaction of OR polypeptides and carboxylic GOIN33/566 (2006.01) acids as the basis of Screening assays for agents that specifi (52) U.S. Cl. cally modulate the activity of the seven ORs of the invention. CPC ...... G0IN33/566 (2013.01); G0IN 2500/04 (2013.01) 29 Claims, 13 Drawing Sheets

U.S. Patent Mar. 31, 2015 Sheet 4 of 13 US 8,993,526 B2

Figure 2A: concentration dependent activation of OR52L1, measured with luciferase assay

1S O a C O O logEC50 = -3.05 CD > R CO O O v O 8 CD CD C CD O CO . E C -

Log Pentanoic acid (M) U.S. Patent Mar. 31, 2015 Sheet 5 of 13 US 8,993,526 B2

Figure 2B: concentration dependent activation of OR52E8, measured with luciferase assay

s O S - C O d logEC50 at -3,98 CD > c O O m O S& CD d C CD d f CD C S s - -3 -1 Log 3-hydroxy-3-methylhexanoic acid) (M) U.S. Patent Mar. 31, 2015 Sheet 6 of 13 US 8,993,526 B2

Figure2C: Concentration dependent activation of OR52E1, measured with luciferase assay

9 2 O H c O C CD logEC50 = -4.43 > c O O H O SS YY CD C C CD C c CD 8 s -

Log butanoic acid (M) U.S. Patent Mar. 31, 2015 Sheet 7 of 13 US 8,993,526 B2

Figure 2D; concentration dependent activation of OR52A5, measured with luciferase assay

C S H' C C CD logEC50: -4,52 s c C O - O SS C c c c c C 1 O . 8 -

Log4-ethyloctanoic acid) (M) U.S. Patent Mar. 31, 2015 Sheet 8 of 13 US 8,993,526 B2

Figure 2E: Concentration dependent activation of OR512, measured with luciferase assay

90 8O logEC50=-3.61 70 60 50 40 3O 2O 10

Log butanoic acid (M) Logisovaleric acid (M)

120 s 9 O 100 logEC50 : -3.73 () logEC50 at 3.41 2 8O t O O 60 O &Sd 40 O

()

E -

Log 2-methylhexanoic acid (M)

logEC50 = -4.42 logEC50= -4,33

-9 -7 -5 -3 -1 Log trans-3-methyl-2hexenoic ac) (M) Logbenzoic acid) (M) U.S. Patent Mar. 31, 2015 Sheet 9 of 13 US 8,993,526 B2

Figure2F: concentration dependent activation of OR512, measured with luciferase assay

logEC50= -4.07 s 100

80

60

40

20

-9 -7 -5 -3 -1 Log (pentanoic acid) (M)

Log (3-methylhexanoic ac) (M) U.S. Patent Mar. 31, 2015 Sheet 10 of 13 US 8,993,526 B2

Figure 2G: Concentration dependent activation of OR52B2, measured with luciferase assay

s 6 s O logEC50 : -3.83 as logEC50 - 4.56 8 5 i g 2 8. 4 3.c o 3 s S. -- 8 2 S.

cy i 8 i C E O - - -7 -5 -3 -9 -7 -5 3 Log heptanoic acid (M)

logEC50s -4.08 logEC50 = -4.28

8

-9 -7 -5 -3 -1 Lognonanoic acid (M) Log decanoic acid (M) U.S. Patent Mar. 31, 2015 Sheet 11 of 13 US 8,993,526 B2

Figure2H: concentration dependent activation of OR52B2, measured with luciferase assay

togec50 - -3.83

-7 -5 -3 Logoctanoic acid (M)

9 C o iog ECSO: -4.4? c e i O O V O S. C C CD i c C S - -7 -3 Log undecanoic acid (M) U.S. Patent Mar. 31, 2015 Sheet 12 of 13 US 8,993,526 B2

Figure 2: concentration dependent activation of OR56A5, measured with luciferase assay

30 T...... r 12 age CSO as -2.83 logEC50 = -3.24

8

Log heptanoic acid (M)

og EC50 a -4.4 / t

Lognonanoic acid (M) Log decanoic acid) (M)

50 iogEC50s -3.12

Log 2-methylheptanoic acid (M) U.S. Patent Mar. 31, 2015 Sheet 13 of 13 US 8,993,526 B2

Figure 2J: concentration dependent activation of OR56A5, measured with luciferase assay

70 y

60 log EC50s -4.1 ears 50 MY 40 30 20 O

Logoctanoic acid (M)

50 yxxyyxxyyxxxyyyyyyyyyyyyyyyyyyyyyyyyyyy m logEC50 = -3.97 40

3O

1 O

-9 -7 -5 -3 -1 Log undecanoic acid (M) US 8,993,526 B2 1. 2 METHOD FOR COUNTERACTING THE homogenous group that is more closely related to ORS found PERCEPTION OF SWEAT MALODOUR BY in fish and are therefore assumed to represent a conserved DECREASING THE FUNCTION OF relic maintained throughout the evolution of the vertebrates. CARBOXYLIC ACID-BINDING OLFACTORY The persistence of this group of ancestral ORS Suggests that RECEPTORS they play an important role in mammalian chemical percep tion. In humans, class 1 ORs encompass 68 non-pseudogenic RELATED APPLICATIONS sequences that correspond to potential functional proteins. These receptors share several characteristic domains in their This application is a divisional application of U.S. appli sequence that allows their classification as “class 1 ORs. It is cation Ser. No. 13/024.325, filed Feb. 9, 2011 (now U.S. Pat. 10 also to be noted that some amino acids located in the trans No. 8,637.259), the contents of which are incorporated herein membrane domains are highly conserved within the members by reference in their entirety. of the fish-like ORs. In contrast to the fish-like ORs, class 2 ORs first appeared in tetrapode vertebrates and expanded to SEQUENCE LISTING form the majority of the OR repertoire presently known in 15 humans. Class 2 ORs probably represent an adaptation to the The instant application contains a Sequence Listing which terrestrial life where the detection of airborne odorants is has been submitted in ASCII format via EFS-Web and is required. hereby incorporated by reference in its entirety. Said ASCII Mechanisms of Odor Perception. copy, created on Jul. 23, 2013, is named 88055 DIV Each OR is able to interact with different molecules, and (309802) SL.txt and is 30.239 bytes in size. each odorant molecule can activate more than one OR. Thus, odor perception does not rely on the simple activation of a FIELD OF THE INVENTION single OR, but rather on multiple activations of several ORs. An odor (which can be a single molecule or a mixture) is The present invention relates to the characterization of paired with a unique set of activated ORs that are sufficient for olfactory receptors. In particular, the present invention relates 25 its discrimination and characterization. Odorant concentra to seven class 1 olfactory receptors and the identification of tion can dramatically affect the profile of an odor as some their natural ligands corresponding to carboxylic acids additional ORS may be recruited (high concentration) or not present in human Sweat. The present invention provides activated (low concentration). Therefore, the set of activated assays and methods of screening for compounds, particularly ORs will differ for different odor concentrations, leading to antagonists or blockers, modulating the interaction between 30 varying odor perceptions. With a pool of 380 ORs, the num olfactory receptors and their respective natural ligands. The ber of possible combinations is almost infinite, thus explain present invention further provides compositions and methods ing the outstanding discrimination properties of the olfactory comprising the above-mentioned compounds to counteract system. Odorant receptors are expressed in specialized olfac Sweat malodors. tory sensory neurons (OSNs) located at the top of the nasal 35 cavity in a small area that constitutes the olfactory epithelium. BACKGROUND OF THE INVENTION Filiform extensions at one end of these cells contain the ORS on their surface and float in the nasal mucus where the odor Olfactory Receptors ants are dissolved. At the opposite end, the OSN extends its The genes coding for olfactory receptors (ORS) represent axon across the ethmoid bone at the base of the cranium to the largest family of genes (3% of the whole genome) in the 40 connect to the olfactory bulb a small region of the brain human body dedicated to a single physiological function. dedicated to the integration of the olfactory stimuli. An out These ORs belong to the superfamily of G protein coupled standing feature of the tens of millions of OSNs scattered receptors (GPCRs). GPCRs are membrane receptors usually throughout the olfactory epithelium is that each one expresses located at the surface of many different cell types. The com only one of the about 400 OR genes available in the human mon features of these receptors consist of seven transmem 45 genome. The OSNs expressing the matching gene connect brane spans that form a barrel within the cell membrane and their axons to the same subregion of the olfactory bulb form in their capacity to interact with heterotrimeric GTPase and ing a structure called a glomerulus. It is from this organization thereby transducing a signal upon binding of their activators. of OSNs that the coding of an odor by a specific set of In the human genome, about 900 sequences containing activated ORS is translated geographically in the bulb by a characteristic signatures of olfactory receptors have been 50 corresponding pattern of activated glomeruli. This informa found. However, 60% of these appear to encode non-func tion is further transmitted to the olfactory area of the cortex tional pseudogenes, thereby leaving humans with about 380 where it is decoded and analyzed. In OSNs, triggering of the different OR proteins. ORs are characterized by 6 conserved OR promotes the activation of an olfactory-specific G protein amino acid motifs in their sequence. The first is the FILLG (Galpha-olf) that stimulates a type III adenylate cyclase to motif (SEQID No. 17) located in the extracellular N-terminal 55 produce cyclic AMP; this plays the role of a second messen end of the receptor. It corresponds to a highly conserved ger. Upon binding to a cAMP-gated cation channel, this mes phenylalanine and glycine separated by 3 variable but mostly senger induces the entry of calcium into the cell. Calcium hydrophobic amino acids. The other motifs include causes the opening of another channel that promotes the exit LHTPMY (SEQ ID No. 18) in intracellular loop 1, MAY of chloride ions, and hence triggers an action potential of the DRYVAIC (SEQ ID No. 19) at the end of transmembrane 60 neuron leading to a signal to the respective brain area. domain 3 and the beginning of intracellular loop 2, SY (SEQ Characterisation of Odorant Molecules with ORS ID No. 20) at the end of transmembrane domain5, FSTCSSH Cultured cell lines have been widely used to characterize (SEQID No. 21) in the beginning of transmembrane domain and study receptors of interest in both academic and industrial 6, and PMLNPF (SEQID No. 22) in transmembrane domain contexts. This approach involves introduction of the corre 7. 65 sponding gene into the cells, and Subsequent promotion of its The mammalian ORs are usually subdivided in two distinct stable or transient overexpression. The activity of the receptor classes. Class 1 ORs, also called fish-like receptors, form a can be monitored using a functional assay. The use of easy US 8,993,526 B2 3 4 to-culture cell lines along with easy-to perform functional Body Malodors assays facilitates several thousand measurements per day. In our modern Society, odors released by the human body, Typically, in the pharmaceutical industry, it is common to test and more precisely in the Sweat, are often considered as libraries of 1,000,000 compounds per day on non-olfactory unpleasant or even offensive. Significant efforts have been receptors. In the aftermath of OR discovery, several attempts made by the cosmetic industry to counteract the perception of were made to express ORs in the cell lines suitable for the these odors. Amongst the various categories of molecule expression of non-olfactory receptors, but they remained present in human Sweat, short chain carboxylic acids are of largely unsuccessful. The reason for Such a setback can be particular importance. Indeed, more than 50 different acids found, not in the failure of the cell to produce the receptor, but have been identified in Sweat. A series of acids is assumed to rather in its inability to send the receptor to the surface of the 10 participate in or to be important for the genesis of malodour cell. A technique aimed at improving the functional expres (Table 1). For example, 3-hydroxy-3-methylhexanoic acid or sion of ORS requires engineering a conventional cell line to (E)-3-methyl-2-hexenoic possess a pungent odorand both are make it suitable for OR expression. In fact, it had long been known to be important contributors to axillary malodor (Zeng Suspected that correct expression and targeting of the OR at 15 et al. 1991, J. Chem. Ecolog. Vol. 17 pp 1469-1492; Gautschi the cell surface requires an OSN-specific intracellular et al., 2007, Chimia, Vol. 61 pp 27–32). Isovaleric acid, machinery that is absent in a non-olfactory cell line. Thor another short chain carboxylic acid, has been identified as the ough analysis of the expression in OSNs revealed two mem major molecule responsible for the characteristic cheesy odor bers of a new family of proteins that are specific to this released by Sweating feet (Ara et al. 2006. Can. J. Microbiol. sensory cell. When co-introduced into a conventional cell line Vol. 52 pp. 357-364). Acids are not directly produced by the along with a model OR, the so-called receptor transport pro apocrine glands. They appear under the form of glutamine conjugates and are released under the action of skin bacteria teins 1 and 2 (RTP1 and RTP2) enhanced both the cell surface enzymes. The abundance of several malodorants may there expression and the response of the receptor to its cognate fore vary from one individual to another, depending on the odorants. The production of cAMP arising in the cell upon composition of his bacterial flora. activation of the OR by its odorant molecules may be detected 25 by an indirect approach that consists of the use of a reporter TABLE 1 gene, as described in (Saito et al., 2004 Cell Vol. 119, 679 691). This gene is placed under the control of a cAMP induc Carboxylic acids contributing to Sweat malodor ible promoter and is expressed only upon induction by cAMP. Different genes can be used for this purpose, but one of the 30 Molecule References Odor descriptor most popular ones encodes the light-producing protein acetic acid 1, 2, 3 sharp pungent sour vinegar propanoic acid 2, 3 pungent acidic cheesy vinegar luciferase. While cleaving its substrate, luciferin, this enzyme butanoic acid 1, 2, 3 sharp acetic cheese butter fruit releases light that is readily detected and quantified. The ISOValeric acid 2, 3 sour stinky feet Sweaty cheese intensity of light emitted reflects the amount of luciferase tropical 35 pentanoic acid 3 sickening putrid acidic Sweaty produced, which is proportional to the cAMP increase and rancid therefore directly related to the activity of the receptor. One of hexanoic acid 2, 3, 4, 5 sour fatty Sweat cheese the advantages of reporter gene assays is dependent upon the 2-methylhexanoic 4 acid, animalic, honey, civet, signal amplification between receptor activation and reporter aci Sweet 3-methylhexanoic 4 Sweaty, butyric production. This makes the assay particularly sensitive to 40 80 weak responses that can hardly be detected by other func (E)-3-methyl-2- 4, 6 acid, Sweaty, fruity, fatty, tional assays. Other functional assays have also been used to hexenoic acid labdanum, hay, Soupy 3-hydroxy-3- 6 pungent Sweaty demonstrate the activation of an OR by its odorant ligand. methylhexanoic One of these assays consists in monitoring the increase in aci cytosolic calcium that occurs upon activation of the receptor 45 Heptanoic acid 4, 5 rancid sour cheesy Sweat 2-methylheptanoic 4 Sour-fruity, Sweet, slightly intracellular calcium increase (Krautwurtz D. et al. 1998. Cell aci fatty-oily 95,917-26). Octanoic acid 2, 3, 4, 5 fatty waxy rancid oily vegetable So far, the identification of odorant activators has only been cheesy reported for few mouse odorant ORs. Example of mouse OR 4-ethyloctanoic 4, 6 costus, fatty, greasy deorphanization are given in Malnic et al., 1999, Cell 96, 50 aci nonanoic acid 4 waxy dirty cheese cultured dairy 713-23; Saito H. et al. 2009. Sci. Signal. 2, 1-14). decanoic acid 3, 4 acid, hot iron, metalic, waxy, Soapy, The identification of human OR activators has also been metal, candle reported. Examples of deorphanized human ORS are e.g. Undecanoic acid 5 waxy creamy cheese fatty coconut benzoic acid 2 Sweet; benzoin powdery given in Fujita Yet al. 2007. J. Recept. Signal. Transduct Res. phenylacetic 6 Sweet, animal-honey 27, 323-34; Keller A. et al. 2007. Nature 449, 468-72; Mat 55 arazzo V. etal. 2005. Chem. Senses 30, 195-207: Saito H. etal. 80 2009. Sci. Signal. 2, 1-14; Sanz, G. et al. 2005. Chem. Senses 1. Yamazaki et al. (2010) Anti-Aging Medicine. 7(6): 60-652. 2. Gallagher et al. (2008) Br. J. Dermatol. 159(4): 780-7913. 30, 69-80; Schmiedeberg K. et al. 2007. J. Struct. Biol. 159, 3. Ara et al. (2006) Can. J. Microbiol. 52: 357-3644. 400-12; Shirokova E. et al. 2004. J. Biol. Chem. 280, 11807 4. Zeng et al. (1991) J. Chem. Ecol. 17(7): 1469-14925. 15: Spehr M. etal. 2003. Science 299,2054-58: Wetzel, K. et 60 5. Labows et al. (1999) Antiperspirants and Deodorants, 2nd Editioned K. Laden, Cosmetic Science and Technogy Series Vol. 20 Marcel Dekker Inc, New York, 59-826. al. 1999. J. Neurosci. 19, 7426-33; Sallmann et al. PCT No. 6. Natsch et al (2006) Chem. & Biodiv, 3:1-20 WO2006/094704. For several of the receptors, more than one ligand has been Different strategies have been developed to counteract identified. Odorants activating the same OR can belong to Sweat malodors. The most conventional ones consist in over different odorant families such as alcohol, aldehyde, esters, 65 powering the malodor with a pleasant fragrance. In a more etc (Sanz, G. et al. 2005. Chem. Senses 30, 69-80; Saito H. et Sophisticated approach, the fragrance is designed to harmo al. 2009. Sci. Signal. 2, 1-14). nize well with the malodor and to shift the perception to a US 8,993,526 B2 5 6 more pleasant character. In this case, the fragrance does not b) comparing the binding of said one or more ORS to said need to be a strong odorant by itself. one or more carboxylic acid(s), or the activity of said one or An alternative way for reducing malodor consists of lim more ORs, in the presence and in the absence of said agent, iting the production of odorant molecules. This can be wherein a difference in binding or activity in the presence of achieved either by limiting the skin bacteria population with said agent, relative to the binding or activity in the absence of bacteriostatic agents or by blocking the enzymes responsible the agent, identifies the agent as an agent that modulates the for the malodorant release. The development of antagonists function of said one or more ORS in response to said one or and/or blockers that would specifically block the receptors for more carboxylic acid(s). a malodor molecule can also be considered. An ideal blocker In a preferred embodiment, said agent is tested for influ 10 encing the binding of said carboxylic acids to all 7 ORs listed would have no odor perse, would not affect the bouquet and therein, or for influencing the activation of all 7 ORs listed therefore would give a full creative freedom to perfumers. therein by said carboxylic acids. In the present invention it has surprisingly been discovered In a further embodiment, said agent is tested for influenc that seven olfactory receptors belonging to class 1 of ORS are ing the binding of pentanoic acid to OR52L1, or for influenc activated by carboxylic acids present in human Sweat. This 15 ing the activation of OR52L1 by pentanoic acid. unexpected discovery allows the identification of com In another embodiment said agent is tested for influencing pounds, which is of interest for the perfumer and flavorist the binding of 3-hydroxy-3-methylhexanoic acid to OR52E8. companies. Indeed, the identified natural ligands of these or for influencing the activation of OR52E8 by 3-hydroxy-3- seven olfactory receptors are known to be important constitu methylhexanoic acid. ents of sweat malodor. The identification and the use of block In a next embodiment, said agent is tested for influencing ers or antagonists of these olfactory receptors in a fragrance the binding of hexanoic acid, heptanoic acid, octanoic acid, composition in order to modify the perception of Sweat mal nonanoic acid, decanoic acid, or undecanoic acid to OR52B2, odor represents an original concept that can open a new or for influencing the activation of OR52B2 by hexanoic acid, possibility for deodorant development. heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, 25 or undecanoic acid. SUMMARY OF THE INVENTION In another embodiment said agent is tested for influencing the binding ofbutanoic acid, isovaleric acid, pentanoic acid, The present invention relates to the identification of seven hexanoic acid, 2-methylhexanoic acid, 3-methylhexanoic Olfactory Receptors (ORS) belonging to class 1 of ORs, acid, (E)-3-methyl-2-hexanoic acid, or benzoic acid to namely, OR52L1, OR52E8, OR52B2, OR51I2, OR52E1, 30 OR51I2, or for influencing the activation of OR51I2 by OR52A5 and OR56A5 (the ORs of the invention), as natural butanoic acid, isovaleric acid, pentanoic acid, hexanoic acid, receptors for carboxylic acids present in human Sweat. The 2-methylhexanoic acid, 3-methylhexanoic acid, (E)-3-me invention encompasses the use of the interaction of these OR thyl-2-hexanoic acid, or benzoic acid polypeptides and carboxylic acids as the basis of Screening In a further embodiment said agent is tested for influencing assays for agents that modulate the activity of the ORs of the 35 the binding ofbutanoic acid to OR52E1, or for influencing the invention. activation of OR52E1 by butanoic acid. The invention also encompasses kits for performing In yet another embodiment said agent is tested for influ screening methods based upon the interaction of the 7 ORS encing the binding of 4-ethyloctanoic acid to OR52A5, or for invention with carboxylic acids. influencing the activation of OR52A5 by 4-ethyloctanoic The invention encompasses a method of identifying an 40 acid. agent that modulates the activity of one or more of the ORs of In another embodiment, said agent is tested for influencing the invention, said method comprising: a) contacting an OR the binding of hexanoic acid, heptanoic acid, 2-methylhep polypeptide with a carboxylic acid in the presence and in the tanoic acid, octanoic acid, nonanoic acid, decanoic acid, or absence of a candidate modulator under conditions permit undecanoic acid to OR56A5, or for influencing the activation ting the binding of said carboxylic acid to said OR polypep 45 of OR56A5 by hexanoic acid, heptanoic acid, 2-methylhep tide; and b) measuring the binding of said OR polypeptide to tanoic acid, octanoic acid, nonanoic acid, decanoic acid, or said carboxylic acid, wherein a decrease in binding in the undecanoic acid. presence of said candidate modulator, relative to the binding Preferably, said one or more OR polypeptides is defined by in the absence of the candidate modulator, identifies the can the amino acid sequence of SEQID NOS. 2, 4, 6, 8, 10, 12 or didate modulator as an agent that modulates the activity of 50 14. The invention further encompasses a method of detecting OR of the invention. in a sample the presence of an agent that modulates the The invention thus provides for a method for identifying an activity of the OR of the invention in a sample, said method agent that modulates the function of one or more Olfactory comprising a) contacting an OR polypeptide with carboxylic Receptors (ORS) selected from the group consisting of acid in the presence and in the absence of said sample under OR52L1, OR52E8, OR52B2, OR51I2, OR52E1, OR52A5 55 conditions permitting the binding of said carboxylic acid to and OR56A5 comprising the steps of: said OR polypeptide; and b) measuring the binding of said a) contacting said one or more ORS with one or more OR polypeptide to said carboxylic acid, wherein a decrease in carboxylic acid(s) selected from the group of consisting of binding in the presence of the sample, relative to the binding butanoic acid, isovaleric acid, pentanoic acid, hexanoic acid, in the absence of the candidate modulator, indicates the pres 2-methylhexanoic acid, 3-methylhexanoic acid, (E)-3- 60 ence, in the sample of an agent that modulates the activity of methly-2-hexenoic acid, 3-hydroxy-3-methylhexanoic acid, an OR in said sample. heptanoic acid, 2-methylheptanoic acid, octanoic acid, The invention further encompasses a method of identifying 4-ethyloctanoic acid, nonanoic acid, decanoic acid, unde an agent that modulates the function of the OR of the inven canoic acid and benzoic acid, in the presence and in the tion said method comprising: a) contacting an OR polypep absence of said agent under conditions permitting the binding 65 tide with a carboxylic acid in the presence and in the absence of said carboxylic acid(s) to said ORS or permitting the acti of a candidate modulator, under conditions permitting acti vation of said ORs by said carboxylic acid(s), vation of said OR polypeptide by carboxylic acid; and b) US 8,993,526 B2 7 8 measuring a signaling activity of said OR polypeptide, In a preferred embodiment of either one of the preceding wherein a change in the activity in the presence of said can methods, the method is performed on a protein chip. didate modulator relative to the activity in the absence of said In another preferred embodiment of either one of the pre candidate modulator identifies said candidate modulator as an ceding methods, the measuring is performed using a method agent that modulates the function of said OR. selected from label displacement, Surface plasmon reso The invention further encompasses a method of identifying nance, fluorescence resonance energy transfer, fluorescence an agent that modulates the function of the OR of the inven quenching, and fluorescence polarization. tion, said method comprising: a) contacting an OR polypep In another embodiment of either one of the preceding tide with a candidate modulator; b) measuring a signaling methods, the agent is selected from the group consisting of a activity of said OR polypeptide in the presence of said can 10 peptide, a polypeptide, an antibody or antigen-binding frag didate modulator, and c) comparing the activity measured in ment thereof, a lipid, a carbohydrate, a nucleic acid, and a the presence of said candidate modulator to said activity Small organic molecule. measured in a sample in which said OR polypeptide is con According to the present invention, when a functional tacted with carboxylic acid at its ECs, wherein said candi 15 assay is used, the step of measuring a signaling activity of the date modulator is identified as an agent that modulates the OR of the invention may comprise detecting a change in the function of the OR when the amount of the activity measured level of a second messenger. in the presence of the candidate modulator is at least 10% of In another embodiment, the step of measuring a signaling the amount induced by said carboxylic acid present at its activity comprises measurement of guanine nucleotide bind ECso. ing/coupling or exchange, adenylate cyclase activity, cAMP The invention further encompasses a method of detecting Protein Kinase C activity, Protein Kinase A activity phos in a sample the presence of an agent that modulates the phatidylinosotol breakdown, diacylglycerol, inositol triphos function of an OR of the invention, said method comprising: phate, intracellular calcium, calcium flux, arachidonic acid, a) contacting an OR polypeptide with carboxylic acid in the MAP kinase activity, tyrosine kinase activity, melanophore presence and in the absence of said sample; b) measuring a 25 assay, receptor initialization assay, or reporter gene expres signaling activity of said OR polypeptide; and c) comparing Sion. When the G-protein binding/coupling or exchange is the amount of said activity measured in a reaction containing measured, of all Ga subunits possible preferably the behav OR and carboxylic acid without said sample to the amount of iours of GTP-binding protein G protein alpha-olf subunit said activity measured in a reaction containing OR, carboxy (olfactory), also G-olf, is studied. The sequence of the human lic acid and said sample, wherein a change in said activity in 30 G-olf subunit has been deposited previously at the Genebank the presence of said sample relative to the activity in the under accession number L10665. However, G-olf subunits of absence of said sample indicates the presence of an agent that other species may be used and studied. modulates the function of OR in said sample. In a preferred embodiment, the measuring of the signaling The invention further encompasses a method of detecting activity comprises using a fluorescence or luminescence in a sample the presence of an agent that modulates the 35 assay. Fluorescence and luminescence assays may comprise function of an OR of the invention, said method comprising: the use of Ca" sensitive fluorophores including fluo3, Fluo4 a) contacting an OR polypeptide with said sample; b) mea or Fura, (Molecular probes); Ca3-kit family (Molecular Suring a signaling activity of said OR polypeptide in the Device) and aequorin. Furthermore, said assays may apply an presence of said sample; and c) comparing said activity mea automated fluorometric or luminescent reader such as FDSS Sured in the presence of said sample to said activity measured 40 (Hammamatsu) or FLIPR (Molecular Device). in a reaction in which said OR polypeptide is contacted with The invention further encompasses a method of modulat carboxylic acid present at its ECso, wherein an agent that ing the activity of an OR of the invention in a cell, said method modulates the function of the OR is detected if the amount of comprising the step of delivering to said cell, a carboxylic the activity measured in the presence of said sample is at least acid or agent that modulates the activity of an OR polypep 10% of the amount induced by the carboxylic acid present at 45 tide, such that the activity of the OR is modulated. its ECso. In another embodiment of any one of the preceding meth According to the present invention, when using binding ods, the method is a high throughput screening method. methods the carboxylic acid may be detectably labeled. In In another embodiment of any one of the preceding meth said methods, the carboxylic acid may be detectably labeled ods, the agent is part of a chemical library or animal organ with a moiety selected from the group consisting of a radio 50 eXtractS. isotope, a fluorophore, and a quencher of fluorescence. According to the present invention, the agent identified or In one embodiment of any one of the preceding methods, detected by any of the preceeding methods, or the composi the contacting is performed in or on a cell expressing said OR tion comprising said agent, may be used to counteract Sweat polypeptide. According to the present invention, said cell may malodour. Alternatively, these may be used for the prepara be, but is not limited to, Human embryonic kidney cells 55 tion of odorant blockers or odorant antagonists. For instance (Hek293), Chinese hamster cells (CHO), Monkey cells an OR blocker or antagonist may be used as a deodorant. An (COS), primary olfactory cells, Xenopus cells, insect cells, OR blocker or antagonist may be added to a fragrance or yeast or bacteria. perfume formulation already used as a deodorant to reinforce In another embodiment of any one of the preceding meth its efficacy. ods, the contacting is performed in or on synthetic liposomes 60 The present invention also encompasses a composition (see Tajib et al., 2000, Nature Biotechnology 18: 649-654, comprising an isolated OR polypeptide and a carboxylic acid. which is incorporated herein by reference) or virus-induced In a preferred embodiment, said composition encompasses budding membranes containing an OR polypeptide (see all 7 ORs identified herein, or any combination thereof of 2,3, WO0102551, 2001, incorporated herein by reference). 4, 5, or 6 receptors. In another embodiment of any one of the preceding meth 65 The present invention further relates to the use of carboxy ods, the method is performed using a membrane fraction from lic acids for the production of a kit for Screening agents that cells expressing said OR polypeptide. modulate the signaling of OR of the invention, or in combi US 8,993,526 B2 10 nation with OR of the invention for the production of a kit to 99% or higher, including 100% nucleic acid identity, to the screen odorant blockers or odorant antagonists. sequence represented in FIG. 1A-FIG. 1C (SEQID NOs 1,3, In addition, the present invention encompasses the use of a 5, 7, 9, 11 and 13). carboxylic acid present in mammalian Sweat as a ligand for As used herein, the term “OR binding refers to specific OR of the invention. binding of an odorant molecule by an OR polypeptide. The present invention also relates to an antibody recogniz Examples of odorant molecules include, but are not limited to ing the carboxylic acid/OR of the invention complex or frag carboxylic acids, esters, alcohols and amines. ments thereof. As used herein, the term “OR signaling activity” refers to The invention further encompasses a kit comprising an the initiation or propagation of signaling by an OR polypep isolated OR polypeptide or several isolated OR polypeptides, 10 tide. OR signaling activity is monitored by measuring a a carboxylic acid and packaging materials therefore; an iso detectable step in a signaling cascade by assaying one or more lated polynucleotide encoding an OR polypeptide or several of the following: stimulation of GDP for GTP exchange on a isolated polynucleotides encoding an OR polypeptide, a car G protein and most particularly G-olf; alteration of adenylate boxylic acid, and packaging materials therefore; a kit com cyclase activity; protein kinase C modulation; protein kinase prising a cell expressing an OR polypeptide or membranes 15 A modulation; phosphatidylinositol breakdown (generating thereof or several cells expressing an OR polypeptide or second messengers diacylglycerol, and inositol triphos membranes thereof, a carboxylic acid and packaging materi phate); intracellular calcium flux; activation of MAP kinases: als therefore. Said cell may be transformed with a polynucle modulation of tyrosine kinases; internalization assay; modu otide encoding said OR. In a preferred embodiment, said kit lation of gene or reporter gene activity; or melanophore assay. encompasses all 7 ORs identified herein, or any combination A detectable step in a signaling cascade is considered initi thereof of 2, 3, 4, 5, or 6 receptors and their respective car ated or mediated if the measurable activity is altered by 10% boxylic acids. or more above or below a baseline established in the substan tial absence of a carboxylic acid relative to any of the OR BRIEF DESCRIPTION OF THE FIGURES activity assays described herein. The measurable activity can 25 be measured directly, as in, for example, measurement of FIG. 1A-FIG. 1C show the DNA and corresponding cAMP or diacylglycerol levels. Alternatively, the measurable polypeptide sequences encoding the seven Olfactory Recep activity can be measured indirectly, as in, for example, a tors (ORs) of the invention. reporter gene assay. For most of these assays, kits are com FIG. 2A-FIG. 2J correspond to a concentration-response mercially available. analysis of the seven receptors of the invention with their 30 Carboxylic acids according to the invention are carboxylic different activators that are all carboxylic acids found in acids present in mammalian Sweat, preferably human Sweat, Sweat. These analyses have been performed according to the which participate in or are important for the genesis of sweat procedure described in “Experimental procedure” malodour (cf. e.g. Table 1). A “blocker' or “blocking compound according to the DETAILED DESCRIPTION OF THE INVENTION 35 invention is a molecule that attenuates or abolishes the per ception of an odorelicited by one or more odorant molecules. Definitions A blocker may act by interacting with an OR that transduces the said odor or by interacting with the natural ligand for the As used herein, the term “Olfactory Receptor polypeptides receptor. A "blocking compound” of the invention can (ORs) in general refers to polypeptides from the G protein 40 decrease the intracellular response induced by an agonist, for coupled receptor family generated in olfactory neurons. ORS example a carboxylic acid present in human Sweat, by at least may have the ability to interact with odorant molecules and to 10%, preferably 15-25%, more preferably 25-50% and most transduce the odorant signal. The terms “Olfactory Receptors preferably, 50-100%. A “blocker can also refer to a nucle (ORs) according to the invention' or “Olfactory Receptor otide sequence encoding a blocker of the invention. A polypeptides according to the invention” refer to the group of 45 blocker, useful according to the present invention, includes, 7 olfactory receptors that have been shown in the present but is not limited to an antibody, Small molecule, aptamer, invention to be able to selectively detect carboxylic acids. photoaptamer, modified natural ligand, etc. which specifi Examples of olfactory receptors according to the invention cally binds to at least a portion of an OR which is required for include, but are not limited to polypeptides having at least signal transduction through carboxylic acids (such as the 80% amino acid identity, and preferably 90%. 95%, 96%, 50 ligand binding site), or which is capable of blocking or reduc 97%, 98%, 99% or higher, including 100% amino acid iden ing (e.g., by at least 10%) the signal transduction pathway tity, to the sequence represented in FIG. 1A-FIG.1C (SEQID which is coupled to the OR. Preferably, the blocking agent is NOs 2, 4, 6, 8, 10, 12 and 14). Said homology may relate to the preferably volatile, or can be made volatile in combination whole polypeptide or only part of the polypeptide Such as with appropriate solvents or additives. CDR domain (ligand-binding domain of the receptor). 55 As used herein, an “antagonist' is a ligand which binds to According to Pilpel and Lancet (Protein Science 8:969-977, a receptor and inhibits the intracellular response induced by a 1999) the CDR domain of a GPCR may be defined following ligand oran agonist, for example a carboxylic acid present in the indications published: TM3-#4, TM3-#8, TM3-#11, human sweat, by at least 10%, preferably 15-25%, more TM3-#12, TM3-#15, TM4-#11, TM4-#15, TM4-#19, TM4 preferably 25-50% and most preferably, 50-100%, as com #22, TM4-#23, TM4-#26, TM5-#3, TM5-#6, TM5-#7, TM5 60 pared to the intracellular response in the presence of an ago #10, TM5-#11 and TM5-il 13, wherein TMX indicates the nist and in the absence of an antagonist. The antagonist may transmembrane region of said receptor, and # indicates the be competitive i.e. it binds at the same site as the agonist or amino acid position within said region. ligand, but does not activate an intracellular response initiated As used herein, the term “OR polynucleotide' refers to a by an active form of the receptor and therefore avoids the polynucleotide that encodes the OR polypeptides as defined 65 activation by said ligand or agonist. Alternatively, the antago herein. Preferably, said polynucleotide has an identity of at nist may be non-competitive, i.e. it binds to a site other than least 80% or more, preferably 90%, 95%, 96%, 97%, 98%, the agonist or ligand binding site and blocks the receptor in an US 8,993,526 B2 11 12 inactive conformation and therefore avoids the transduction As used herein, the term “sample” refers to the source of of the olfactory signal by the agonist. molecules being tested for the presence of an agent or modu As used herein, “natural ligand” refers to a naturally occur lator compound that modulates binding to or signalling activ ring ligand which binds to a receptor in a manner that is at ity of an OR of the invention. A sample can be an environ least equivalent to a carboxylic acid present in human Sweat, mental sample, a natural extract of animal, plant, yeast or Such as the carboxylic acids as exemplified herein. A “natural bacterial cells or tissues, a clinical sample, a synthetic sample, ligand does not refer to an engineered ligand that is not found or a conditioned medium from recombinant cells or from a in nature and that is engineered to bind to a receptor, where it fermentation process. did not formerly do so in a manner different, either in degree As used herein, a “tissue’ is an aggregate of cells that 10 perform a particular function in an organism. The term “tis or kind, from that which it was engineered to do. Such an sue' as used herein refers to cellular material from aparticular engineered ligand is no longer naturally-occurring but is physiological region. The cells in a particular tissue can com “non-natural” and is derived from a naturally occurring mol prise several different cell types. A non-limiting example of ecule. this would be brain tissue that further comprises neurons and As used herein, a “modulator” refers to a compound that 15 glial cells, as well as capillary endothelial cells and blood increases or decreases the cell Surface expression of a recep cells, all contained in a given tissue section or sample. In tor of the invention, increases or decreases the binding of a addition to solid tissues, the term “tissue' is also intended to ligand to ORS of the invention, or any compound that encompass non-solid tissues, such as blood. increases or decreases the intracellular response initiated by As used herein, the term “membrane fraction” refers to a an active form of the ORs of the invention, either in the preparation of cellular lipid membranes containing an OR of presence or absence of a ligand for the receptor, for example the invention. As the term is used herein, a “membrane frac a carboxylic acid present in human Sweat. A modulator tion' is distinct from a cellular homogenate, in that at least a includes an antagonist, or blocker, as defined herein. A modu portion (i.e., at least 10%, and preferably more) of non-mem lator can be for example, a small molecule, a polypeptide, a brane-associated cellular constituents has been removed. The peptide, an antibody or antigen-binding fragment thereof, a 25 term “membrane associated’ refers to those cellular constitu lipid, a carbohydrate, a nucleic acid, an aptamer, a photo ents that are either integrated into a lipid membrane or are aptamer, or a small chemical compound or Small organic physically associated with a component that is integrated into molecule. Candidate modulators can be natural or synthetic a lipid membrane. compounds, including, for example, synthetic Small mol As used herein, the term 'second messenger assay pref ecules, compounds contained in extracts of animal, plant, 30 erably comprises the measurement of guanine nucleotide bacterial or fungal cells, as well as conditioned medium from binding or exchange, adenylate cyclase, intra-cellular cAMP such cells. intracellular inositol phosphate, intra-cellular diacylglycerol As used herein, the terms “increase' and “decrease' refer concentration, arachidonic acid concentration, MAP to a change in amount of ligand binding to the ORS of the kinase(s) or tyrosine kinase(s), protein kinase C activity, or invention and/or cell signalling through ORS of the invention 35 reporter gene expression or an aequorin-based assay accord of at least 10%. An “increase' or “decrease' in binding or ing to methods known in the art and defined herein. signalling is preferably measured in response to contacting As used herein, the term 'second messenger” refers to a ORs of the invention with a ligand in the presence of a can molecule, generated or caused to vary in concentration by the didate modulator, wherein the change in binding or signalling activation of a G-Protein Coupled Receptor that participates is relative to the binding or signalling in the absence of the 40 in the transduction of a signal from that GPCR. Non-limiting candidate modulator. examples of second messengers include cAMP, diacylglyc As used herein, the term “small molecule' refers to a erol, inositol triphosphate, arachidonic acid release, inositol compound having a molecular mass of less than 3000 Dal triphosphate and intracellular calcium. The term “change in tons, preferably less than 2000 or 1500, still more preferably the level of a second messenger refers to an increase or less than 1000, and most preferably less than 600 Daltons. A 45 decrease of at least 10% in the detected level of a given second “Small organic molecule' is a Small molecule that comprises messenger relative to the amount detected in an assay per carbon. formed in the absence of a candidate modulator. As used herein, the terms “change”, “difference'. As used herein, the term “aequorin-based assay” refers to “decrease', or “increase' as applied to e.g., binding or sig an assay for GPCR activity that measures intracellular cal nalling activity or amount of a Substance refer to an at least 50 cium flux induced by activated GPCRs, wherein intracellular 10% increase or decrease in binding, signalling activity, or for calcium flux is measured by the luminescence of aequorin example, level of mRNA, polypeptide or ligand relative to a expressed in the cell. standard in a given assay. As used herein, the term “binding refers to the physical As used herein, the term “conditions permitting the binding association of a molecule (e.g., a ligand Such as a carboxylic of carboxylic acid to an OR of the invention” refers to con 55 acid or an antibody) with a receptor (e.g., OR of this inven ditions of for example, temperature, salt concentration, pH tion). As the term is used herein, binding is “specific’ if it and protein concentration under which the OR binds a car occurs with an ECso or a Kd of 1 mM less, generally in the boxylic acid. Exact binding conditions will vary depending range of 1 mM to 10 nM For example, binding is specific if the upon the nature of the assay, for example, whether the assay ECs or Kd is 1 mM, 500 uM, 100 uM, 10uM,9.5uM, 9 uM, uses viable cells or only a membrane fraction of cells. How 60 8.5uM, 8 uM, 7.5uM,7uM, 6.5uM, 6 uM, 5.5uM,5uM, 4.5 ever, because the ORs of the invention are cell surface pro uM, 4 uM, 3.5uM, 3 M, 2.5uM, 2 uM, 1.5uM, 1 uM, 750 teins, favored conditions will generally include physiological nM, 500 nM, 250 nM or 100 nM or less. salt (90 mM) and pH (about 7.0 to 8.0). Temperatures for As used herein, the term “ECs” refers to that concentra binding can vary from 15° C. to 37°C., but will preferably be tion of a compound at which a given activity, including bind between room temperature and about 30°C. The concentra 65 ing of a carboxylic acid or other ligand and a functional tion of carboxylic acid in a binding reaction will also vary activity of a OR, is 50% of the maximum for that OR activity from about 0.5 to 2 uM, but will preferably be about 1 uM. measurable using the same assay in the absence of compound. US 8,993,526 B2 13 14 Stated differently, the “ECs” is the concentration of com said receptors with carboxylic acids. For example, the ability pound that gives 50% activation, when 100% activation is set to reconstitute OR/carboxylic acid binding either in vitro, on at the amount of activity that does not increase with the cultured cells or in vivo provides a target for identification of addition of more agonist. agents that disrupt that binding. Assays based on disruption of As used herein, the term "saturation” refers to the concen binding can identify agents, such as Small organic molecules, tration of a carboxylic acid present in human Sweat or other from libraries or collections of such molecules. Alternatively, ligand at which further increases in ligand concentration fail Such assays can identify agents in samples or extracts from to increase the binding of ligand or OR-specific signalling natural sources, including plant, fungal, or bacterial extracts activity. or even human tissue samples. Modulators of OR/carboxylic As used herein, the term “ICso is the concentration of an 10 acid binding can then be screened using a binding assay or a antagonist or blocker that reduces the maximal activation of functional assay that measures downstream signaling through an OR of the invention by 50%. the said receptor. Both binding assays and functional assays As used herein, the term “decrease in binding refers to a are validated using carboxylic acids. decrease of at least 10% in the amount of ligand binding Another approach that uses the OR/carboxylic acid inter detected in a given assay with a known or Suspected modu 15 action more directly to identify agents that modulate OR lator of OR of the invention relative to binding detected in an function measures changes in OR downstream signaling assay lacking that known or Suspected modulator. induced by candidate agents or candidate modulators. These As used herein, the term "G-Protein coupled receptor,” or functional assays can be performed in isolated cell membrane “GPCR refers to a membrane-associated polypeptide with 7 fractions or on cells expressing the receptor on their Surfaces. alpha helical transmembrane domains. Functional GPCRs The following description provides methods for both bind associate with a ligand or agonist and also associate with and ing and functional assays based upon the interaction of ORS activate G-proteins. OR polypeptides of the invention are and carboxylic acids. GPCRS. A. OR Polypeptides. As used herein, the term “antibody' is the conventional Assays using the interaction of OR polypeptides and car immunoglobulin molecule, as well as fragments thereof 25 boxylic acids require a source of OR polypeptides. The poly which are also specifically reactive with one of the subject nucleotide and polypeptide sequence of human ORS are pre polypeptides. Antibodies can be fragmented using conven sented herein in FIG. 1A-FIG. 1C. The human OR52L1, tional techniques and the fragments screened for utility in the OR52E8, OR52B2, OR51I2, OR52E1, OR52A5 and same manner as described herein below for whole antibodies. OR56A5 polynucleotide sequences are also available at Gen For example, F(ab')2 fragments can be generated by treating 30 Bank Accession Nos. NM 001005173 (SEQ ID NO.1), antibody with pepsin. The resulting F(ab')2 fragment can be NM 001005168 (SEQ ID NO3), NM 001004052 (SEQ treated to reduce disulfide bridges to produce Fab fragments. ID NO.5), NM 001004754 (SEQ ID NO.7), NG 033197 The antibody of the present invention is further intended to (SEQ ID NO.9), NM 001005160 (SEQ ID NO.11), include bispecific, single-chain, and chimeric and humanised NM 001146033 (SEQ ID NO.13), respectively. The molecules having affinity for a polypeptide conferred by at 35 polypeptide sequences are also recorded at accession Nos. least one CDR region of the antibody. In preferred embodi Q8NGH7 (SEQ ID NO.2), Q61 FG1 (SEQ ID NO.4), ments, the antibody further comprises a label attached thereto Q96RD2 (SEQID NO.6), Q9H344 (SEQID NO.8), Q8NGJ3 and able to be detected, (e.g., the label can be a radioisotope, (SEQ ID NO.10), Q9H2C5 (SEQ ID NO.12), and POC7T3 fluorescent compound, chemiluminescent compound, (SEQID NO.14) respectively in the Uniprot database. enzyme, or enzyme co-factor). The antibodies, monoclonal or 40 One skilled in the art can readily amplify an OR sequence polyclonal and their hypervariable portion thereof (FAB, from a sample containing mRNA encoding the protein FAB", etc.) as well as the hybridoma cell producing the anti through basic PCR and molecular cloning techniques using bodies are a further aspect of the present invention which find primers or probes designed from the known sequences. Also, a specific industrial application in the field of diagnostics and since OR genes are intron-less genes, a person skilled in the monitoring of specific diseases, preferably the ones hereafter 45 art can amplify an OR sequence from genomic DNA. described. Inhibitors according to the invention include but The expression of recombinant polypeptides is well known are not limited to labeled monoclonal or polyclonal antibod in the art. Those skilled in the art can readily select vectors ies or hypervariable portions of the antibodies. and expression control sequences for the expression of OR As used herein, the term “OR constitutive activity” refers polypeptides according to the invention in eukaryotic or to a measurable activity of an olfactory receptor expressed 50 prokaryotic cells. OR polypeptides are preferably associated into a cell that occurs spontaneously without addition of a with the cell membrane or synthetic liposomes in order to ligand for the said olfactory receptor. have binding or signaling function. Methods for the prepara As used herein, the term “inverse agonist” refers to a mol tion of cellular membrane fractions are well known in the art, ecule that binds to and decreases or Suppresses the constitu e.g., the method reported by Hubbard & Cohn, 1975, J. Cell tive activity of an OR. 55 Biol. 64: 461–479, which is incorporated herein by reference. The invention relates to the discovery that carboxylic acids In order to produce membranes comprising OR polypeptides, present in human Sweat are natural ligands for a specific one can e.g. apply such membrane isolation techniques to groups of olfactory receptors, the OR polypeptides as defined cells endogenously or recombinantly expressing one of the herein. The OR/carboxylic acids interaction is useful for OR polypeptides of the invention. Alternatively, OR polypep screening assays for agents that modulate such an interaction 60 tides can be integrated into membrane preparations by dilu and thus the function of the OR. This OR/carboxylic acid tion of detergent Solution of the polypeptide (see, e.g., Sala interaction also provides for the identification of modulators mon et al., 1996, Biophys. J. 71:283-294, which is which could be of interest in industry. incorporated herein by reference). Assays for the Identification of Agents that Modulate the B. Carboxylic Acids Present in Sweat. Activity of ORS 65 The structure of such carboxylic acids are well known by a Agents that modulate the activity of ORS can be identified skilled person. In addition, the person skilled in the art may in a number of ways that take advantage of the interaction of easily derive equivalent acids from said structure and may US 8,993,526 B2 15 16 easily test if said equivalents are able to bind and/or modulate 100% or more, including 2-fold, 5-fold, 10-fold or more the OR polypeptides. Carboxylic acids may be isolated from activity than the carboxylic acid. natural samples, or chemically synthesized. b) For antagonist Screening, cells expressing ORS or mem Methods which can be used to quantify said acids may be, branes isolated from them are assayed for signaling activity in but are not limited to, a) for extraction and purification: Sol the presence of a carboxylic acid with or without a candidate vent extraction, oil extraction, vapour extraction, CO2 Super compound. Antagonists will reduce the level of carboxylic critical extraction, liquid chromatography, distillation, gas acid-stimulated receptor activity by at least 10%, relative to chromatography; b) for quantifying: gas chromatography, reactions lacking the antagonist. liquid chromatography and mass spectrometry. Said methods c) For inverse agonist screening, cells expressing constitu 10 tive OR activity or membranes isolated from them are used in are well known in the art. a functional assay that measures an activity of the receptor in Carboxylic acids may be used in purified form or used as the absence of carboxylic acid ligands. Inverse agonists are compositions. The amounts of the acid necessary in a given those compounds that reduce the constitutive activity of the binding or functional assay according to the invention will OR by at least 10%. Overexpression of OR may lead to vary depending upon the assay, but will generally use 1 LM to 15 constitutive activation. OR can be overexpressed by placing it 1000 uMoflabeled and 10 uM to 10 mMofunlabeled acid per under the control of a strong constitutive promoter, e.g., the assay. If necessary for a given assay, a carboxylic acid can be CMV early promoter. Alternatively, certain mutations of con labeled by incorporation or addition of radioactive labels as served GPCR amino acids oramino acid domains tend to lead pointed out above. to constitutive activity. See for example: Kjelsberg et al., C. Assays to Identify Modulators of ORS Activity 1992, J. Biol. Chem. 267:1430; McWhinney et al., 2000. J. The discovery that carboxylic acids are ligands of seven Biol. Chem. 275:2087: Ren et al., 1993, J. Biol. Chem. 268: ORs belonging to the class 1 olfactory receptor family per 16483; Samama et al., 1993, J. Biol. Chem. 268:4625; Parma mits the development of Screening assays to identify modu et al., 1993, Nature 365:649; Parma et al., 1998, J. Pharmacol. lators of ORs activity. The screening assays will have two Exp. Ther. 286:85; and Parent et al., 1996, J. Biol. Chem. general approaches. 25 271:7949. 1) Ligand binding assays, in which cells expressing one or Ligand Binding and Displacement Assays: more ORS according to the invention, membrane extracts One can use OR polypeptides expressed in a cell, or iso from Such cells, or immobilized lipid membranes comprising lated membranes containing receptor polypeptides, along one or more ORS according to the invention are exposed to a with a carboxylic acid in order to screen for compounds that labeled carboxylic acid known to bind said one or more ORS 30 inhibit the binding of carboxylic acids to OR polypeptides. and a candidate compound. Following incubation, the reac When identified in an assay that measures binding or car tion mixture is measured for specific binding of the labeled boxylic acid displacement alone, compounds will have to be carboxylic acid to said ORs. Compounds that interfere with or subjected to functional testing to determine whether they act displace labeled carboxylic acid from the ORS can be identi as agonists, antagonists or inverse agonists. fied as modulators, preferably blockers or antagonists of OR 35 For displacement experiments, cells expressing an OR activities. Functional analysis can be performed on positive polypeptide (generally 25,000 cells per assay or 1 to 100 g of compounds to determine in which of these categories they fit. membrane extracts) are incubated in binding buffer (e.g., 50 Binding of a compound may be classified into 3 main mM Hepes pH 7.4; 1 mM CaCl2: 0.5% Bovine Serum Albu categories: competitive binding, non-competitive binding min (BSA) Fatty Acid-Free; and 0.5 mM MgCl2) for 1.5 hrs and uncompetitive binding. A competitive binding compound 40 (at, for example, 27°C.) with labeled carboxylic acid in the resembles a second (reference) compound and binds to the presence or in the absence of increasing concentrations of a same binding pocket of a target molecule (here receptor). candidate modulator. To validate and calibrate the assay, con Upon addition, the competitive binding compound displaces trol competition reactions using increasing concentrations of said second compound from said target. A non-competitive unlabeled carboxylic acid can be performed. After incuba binding compound does not bind to the same binding pocket 45 tion, cells are washed extensively, and bound, labeled car of the target molecule as a second (reference) compound but boxylic acid is measured as appropriate for the given label may interact with the effect of said second compound on said (e.g., Scintillation counting, enzyme assay, fluorescence, target molecule. The second compound is not displaced upon etc.). A decrease of at least 10% in the amount of labeled addition of the non-competitive binding compound. An carboxylic acid bound in the presence of the candidate modu uncompetitive-binding compound binds to the target mol 50 lator indicates displacement of binding by the candidate ecule when a second compound is already bound. Coopera modulator. Candidate modulators are considered to bind spe tive binding means that a compound facilitates the binding of cifically in this or other assays described herein if they dis another compound which may be a reference compound. The place 50% of the labeled carboxylic acid. cooperative effect is thus seen in the analysis of the Kd of said Alternatively, binding or displacement of binding can be other compound. 55 monitored by surface plasmon resonance (SPR). Surface 2) Functional Assays, in which a Signaling Activity of ORS plasmon resonance assays can be used as a quantitative is Measured. method to measure binding between two molecules by the a) For agonist screening, cells expressing ORS or mem change in mass near an immobilized sensor caused by the branes prepared from them are incubated with a candidate binding or loss of binding of carboxylic acid from the aqueous compound, and a signaling activity of ORS is measured. The 60 phase to a OR polypeptide immobilized in a membrane on the assays are validated using a carboxylic acid as agonist, and sensor. This change in mass is measured as resonance units the activity induced by compounds that modulate receptor versus time after injection or removal of the carboxylic acidor activity is compared to that induced by the carboxylic acid. candidate modulator and is measured using a Biacore Bio An agonist or partial agonist will have a maximal biological sensor (Biacore AB). OR polypeptides can be immobilized on activity corresponding to at least 10% of the maximal activity 65 a sensor chip (for example, research grade CM5 chip; Biacore of the carboxylic acid when the agonist or partial agonist is AB) in a thin film lipid membrane according to methods present at 100 uMorless, and preferably will have 50%, 75%, described by Salamon et al. (Salamon et al., 1996, Biophys.J. US 8,993,526 B2 17 18 71: 283-294; Salamon et al., 2001, Biophys. J. 80: 1557 Yellow Fluorescent Protein (YPF) or Green Fluorescent Pro 1567; Salamon et al., 1999, Trends Biochem. Sci. 24: 213 tein (GFP). The BRET signal is generated by the oxidation of 219, each of which is incorporated herein by reference). Sar a coelenterazine derivative substrate. Said system may apply rio et al. demonstrated that SPR can be used to detect ligand a cell-permeable and non-toxic coelenterazine derivative Sub binding to the GPCRA(1) adenosine receptor immobilized in strate Deep BleuCTM (DBC) and a mutant of the Green Fluo a lipid layer on the chip (Sarrio et al., 2000, Mol. Cell. Biol. rescent Protein (GFP) as acceptor. When the donor and accep 20:5164-5174, incorporated herein by reference). Conditions tor are in close proximity the energy resulting from the for carboxylic acid binding to an OR of the invention in an catalytic degradation of the DBC is transferred from Rluc to SPR assay can be fine-tuned by one skilled in the art using the GFP which will then emit fluorescence at its characteristic conditions reported by Sarrio et al. as a starting point. 10 wavelength. This method allows higher distance between the SPR can assay for modulators of binding in at least two two tested molecules and is fluorophore-angle independent. ways. First, a carboxylic acid can be pre-bound to immobi In addition to the surface plasmon resonance, FRET and lized OR polypeptide, followed by injection of the candidate BRET methods, fluorescence polarization measurement is modulator at approximately 10 ul/min flow rate and a con useful for quantification of carboxylic acid-receptor binding. centration ranging from 1 nM to 1000 uM, preferably about 15 The fluorescence polarization value for a fluorescently 100 uM. Displacement of the bound carboxylic acid can be tagged molecule depends on the rotational correlation time or quantified, permitting detection of modulator binding. Alter tumbling rate. Protein complexes, such as those formed by an natively, the membrane-bound carboxylic polypeptide can be OR associating with a fluorescently labeled carboxylic acid, pre-incubated with a candidate modulator and challenged have higher polarization values than uncomplexed, labeled with a carboxylic acid. A difference in carboxylic acid bind carboxylic acid. The inclusion of a candidate inhibitor of the ing to the OR exposed to the modulator relative to that on a OR/carboxylic acid interaction results in a decrease in fluo chip not pre-exposed to the modulator will demonstrate bind rescence polarization, relative to a mixture without the can ing. In either assay, a decrease of 10% or more in the amount didate inhibitor, if the candidate inhibitor disrupts or inhibits of carboxylic acid bound is in the presence of candidate the interaction of the OR with the carboxylic acid. Fluores modulator, relative to the amount of carboxylic acid bound in 25 cence polarization is well suited for the identification of small the absence of candidate modulator indicates that the candi molecules that disrupt the formation of polypeptide or protein date modulator inhibits the interaction of the OR and the complexes. A decrease of 10% or more in fluorescence polar carboxylic acid. A Biacore system can be plugged to a system ization in samples containing a candidate modulator, relative identifying candidate modulator Such as mass spectrometry, to fluorescence polarization in a sample lacking the candidate or gas chromatography. 30 modulator, indicates that the candidate modulator inhibits the Another method of measuring inhibition of binding of OR/carboxylic acid interaction. carboxylic acid to OR uses fluorescence resonance energy Another alternative for monitoring OR/carboxylic acid transfer (FRET). FRET is a quantum mechanical phenom interactions uses a biosensor assay. ICS biosensors have been enon that occurs between a fluorescence donor (D) and a described by AMBRI (Australian Membrane Biotechnology fluorescence acceptor (A) in close proximity to each other 35 Research Institute: http//www.ambri.com.au/). In this tech (usually <100 A of separation) if the emission spectrum of D nology, the association of molecules such as an OR and a overlaps with the excitation spectrum of A. The molecules to carboxylic acid, is coupled to the closing of gramacidin be tested, e.g., a carboxylic acid and an OR polypeptide, are facilitated ion channels in Suspended membrane bilayers and labeled with a complementary pair of donor and acceptor thus to a measurable change in the admittance (similar to fluorophores. While close to each other due to the OR/car 40 impedence) of the biosensor. This approach is linear over six boxylic acid interaction, fluorescence emitted upon excita orders of magnitude of admittance change and is ideally tion of the donor fluorophore will have a different wavelength Suited for large scale, high throughput screening of Small from that emitted in response to the excitation wavelength molecule combinatorial libraries. A 10% or greater change when the molecules are not bound, thus allowing quantifica (increase or decrease) in admittance in a sample containing a tion of bound versus unbound polypeptides by measurement 45 candidate modulator, relative to the admittance of a sample of emission intensity at each wavelength. Donor/acceptor lacking the candidate modulator, indicates that the candidate pairs of fluorophores with which to label the target molecules modulator inhibits the interaction of OR and carboxylic acid. are well known in the art. It is important to note that in assays of acid-protein inter A variation on FRET uses fluorescence quenching to moni action, it is possible that a modulator of the interaction need tor molecular interactions. One molecule in the interacting 50 not necessarily interact directly with the domain(s) of the pair can be labeled with a fluorophore, and the other with a proteins that physically interact. It is also possible that a molecule that quenches the fluorescence of the fluorophore modulator will interact at a location removed from the site of when brought into close apposition with it. A change in fluo acid-protein interaction and cause, for example, a conforma rescence upon excitation is indicative of a change in the tional change in the OR polypeptides. Modulators (inhibitors association of the molecules tagged with the fluorophore: 55 or agonists) that act in this manner are nonetheless of interest quencher pair. Generally, an increase in fluorescence of the as agents to modulate the activity of ORs. labeled OR polypeptide is indicative that carboxylic acid Any of the binding assays described can be used to deter bearing the quencher has been displaced. For quenching mine the presence of an agent in a sample, e.g., a tissue assays, a 10% or greater increase in the intensity of fluores sample, that binds to OR molecule, or that affects the binding cent emission in samples containing a candidate modulator, 60 of carboxylic acid to ORs. To do so, OR polypeptides are relative to samples without the candidate modulator, indicates reacted with carboxylic acid or another ligand in the presence that the candidate modulator inhibits OR/carboxylic acid or in the absence of the sample, and carboxylic acid or ligand interaction. binding is measured as appropriate for the binding assay Bioluminescence Resonance Energy Transfer (BRET) is a being used. A decrease of 10% or more in the binding of system for monitoring intermolecular interactions in vivo. 65 carboxylic acid or other ligand indicates that the sample con The assay is based on non-radiative energy transfer between tains an agent that modulates carboxylic acid or ligand bind fusion proteins containing Renilla luciferase (Rluc) and e.g. ing to OR polypeptides. US 8,993,526 B2 19 20 Proteins Chips 252: 115-126; Detheux et al., 2000, J. Exp. Med., 192 1501 The methods of the present invention may be applied on 1508; both of which are incorporated herein by reference). protein chips. Said protein chip may be, but is not limited to, Briefly, OR-expressing clones are transfected to coexpress a glass slide or a nitrocellulose membrane. Array-based meth mitochondrial or cytoplasmic apoaequorin and G-alpha-16 or ods for protein chips are well known in the art. The protein G-olf. Cells are incubated with 5 uM Coelenterazine H or arrays preferably comprise one or more OR polypeptides derivates (Molecular Probes) for 4 hours at room temperature, according to the invention or fragments thereof that are washed in DMEM-F 12 culture medium and resuspended at a responsible for the binding with carboxylic acids. The protein concentration of 0.5x106 cells/ml. Cells are then mixed with chip preferably comprises all 70R polypeptides according to test agonist peptides and light emission by the aequorin is the invention, or fragments thereofthat are responsible for the 10 recorded with aluminometer for 30 sec. Results are expressed binding with carboxylic acids. as Relative Light Units (RLU). Controls include assays using Functional Assays of Receptor Activity membranes isolated from cells not expressing C356 (mock i. GTPase/GTP Binding Assays: transfected), in order to exclude possible non-specific effects For GPCRs such as OR polypeptides, a measure of recep of the candidate compound. tor activity is the binding of GTP by cell membranes contain 15 Aequorin activity or intracellular calcium levels are ing receptors. In the method described by Traynor and “changed if light intensity increases or decreases by 10% or Nahorski, 1995, Mol. Pharmacol. 47: 848-854, incorporated more in a sample of cells, expressing an OR polypeptide and herein by reference, one essentially measures G-protein cou treated with a candidate modulator, relative to a sample of pling to membranes by measuring the binding of labeled GTP cells expressing the OR polypeptide but not treated with the to the membrane. For GTP binding assays, membranes iso candidate modulator or relative to a sample of cells not lated from cells expressing the receptor are incubated in a expressing the OR polypeptide (mock-transfected cells) but buffer containing 20 mMHEPES, pH 7.4, 100 mMNaCl, and treated with the candidate modulator. 10 mMMgCl2, 80 uM 355-GTPYS and 3 uMGDP. The assay When performed in the absence of a carboxylic acid, the mixture is incubated for 60 minutes at 30° C., after which assay can be used to identify an agonist or inverse agonist of unbound labeled GTP is removed by filtration onto GF/B 25 an OR activity. When the assay is performed in the presence filters. Bound, labeled GTP is measured by liquid scintillation of a carboxylic acid, it can be used to assay for an antagonist. counting. In order to assay for modulation of carboxylic 1) a Fluo3, 4, Fura2, and Calcium3 (Molecular Device) acid-induced OR activity, membranes prepared from cells Based-assay. expressing an OR polypeptide are mixed with a carboxylic Fluorescence-based assays take advantage of calcium acid, and the GTP binding assay is performed in the presence 30 fluxes triggered by receptor activation: either calcium and in the absence of a candidate modulator of OR activity. A entrance through CNG for instance or calcium release from decrease of 10% or more in labeled GTPbinding as measured endoplasmic reticulum. Some fluorophores including but not by Scintillation counting in an assay of this kind containing limited to Fluo3, Fluo4 and Fura2 (Molecular Probes) and the candidate modulator, relative to an assay without the Calcium3 kit series (Molecular Device) are known to bind modulator, indicates that the candidate modulator inhibits OR 35 calcium. Such fluorophore-calcium complexes emit fluores activity. cence at specific wavelengths. Thereby, upon activation of a A similar GTP-binding assay can be performed without the G-protein coupled receptor, calcium released from endoplas carboxylic acid to identify compounds that act as agonists. In mic reticulum or entered through CNG binds to fluorophore this case, the carboxylic acid-stimulated GTP binding is used leading to specific fluorescence emission. OR-overexpress as a standard. A compound is considered an agonist if it 40 ing cells are incubated for 30 to 60 minutes with a solution of induces at least 50% of the level of GTP binding induced by 1 to 8 uM fluorophore at 37°C. After thorough washing with the carboxylic acid when the compound is present at 1 mM or saline buffer, 50 ul of the same buffer is poured into each well less, and preferably will induce a level the same as or higher containing cells (6 to 1536). Tested agonists are then injected than that induced by the carboxylic acid. into such loaded cells and activation of an OR is followed by GTPase activity is measured by incubating the membranes 45 fluorescence measurement. containing an OR polypeptide with gamma-32P-GTP. Active Intracellular calcium levels are “changed if fluorescence GTPase will release the label as inorganic phosphate, which is intensity increases or decreases by 10% or more in a sample detected by separation of free inorganic phosphate in a 5% of cells, expressing an OR polypeptide and treated with a suspension of activated charcoal in 20 mM HPO, followed candidate modulator, relative to a sample of cells expressing by Scintillation counting. Controls include assays using mem 50 an OR polypeptide but not treated with the candidate modu branes isolated from cells not expressing OR (mock-trans lator or relative to a sample of cells not expressing an OR fected), in order to exclude possible non-specific effects of the polypeptide (mock-transfected cells) but treated with the can candidate compound. didate modulator. In order to assay for the effect of a candidate modulator on 2) Depolarization/Hyperpolarization Membrane Assay OR-regulated GTPase activity, membrane samples are incu 55 (DiBac Fluorophore for Instance). bated with carboxylic acid, with and without the modulator, The principle of this assay is to follow depolarization of the followed by the GTPase assay. A change (increase or cell membrane. The anionic probe DiBAC4(3) partitions decrease) of 10% or more in the level of GTP binding or between intra- and extracellular compartments in a mem GTPase activity relative to samples without modulator is brane potential-dependent manner. With increasing mem indicative of carboxylic modulation by a candidate modula 60 brane potential (depolarization), the probe further partitions tOr. into the cell resulting in an increase of fluorescence. Con ii. Downstream Pathway Activation Assays: versely, hyperpolarization leads to a decrease of fluorescence a. Calcium flux The Aequorin-Based Assay. due to dye extrusion. The aequorin assay takes advantage of the responsiveness The DiBAC4(3) probe is excited with a wavelength of 488 of mitochondrial or cytoplasmic apoaequorin to intracellular 65 nm, and emits at a wavelength of 540 nm. calcium release or calcium flux (entrance) induced by the On the day of the experiment, add the glucose to the assay activation of GPCRs (Stables et al., 1997, Anal. Biochem. buffer (saline buffer) to a final concentration of 10 mM and US 8,993,526 B2 21 22 the DiBAC4(3) probe to a final concentration of 5uM. Main with the candidate modulator or relative to a sample of cells tain the assay buffer at 37°C. Remove the cell culture medium not expressing an OR polypeptide (mock-transfected cells) and rinse twice each well containing OR-overexpressing cells but treated with the candidate modulator. Alternatively, a with 200 ul of pre-heated assay buffer. Place 180 ul of Assay decrease of activity by 10% or more by the candidate modu buffer containing DiBAC4(3) and incubate the cells for 30 lator of OR polypeptides in a sample treated with a reference min at the appropriate temperature. Cell plates will be ready compound may be tested. for assay after these 30 mins. incubation. Collect baseline for c. cAMP Assay: 2 mins. prior any addition. Add 20ll of candidate modulators Intracellular cAMP is measured using a cAMP radioim to the appropriate well and collect the data for an additional munoassay (RIA) or cAMP binding protein according to 25 mins. 10 methods widely known in the art. For example, Horton & Membrane polarization is “changed if fluorescence inten Baxendale, 1995, Methods Mol. Biol. 41: 91-105, which is sity increases or decreases by 10% or more in a sample of incorporated herein by reference, describes an RIA for cells, expressing an OR polypeptide and treated with a can cAMP didate modulator, relative to a sample of cells expressing an A number of kits for the measurement of cAMP are com OR polypeptide but not treated with the candidate modulator 15 mercially available, such as the High Efficiency Fluorescence or relative to a sample of cells not expressing an OR polypep Polarization-based homogeneous assay marketed by LJL tide (mock-transfected cells) but treated with the candidate Biosystems and NEN Life Science Products. Control reac modulator. tions should be performed using extracts of mock-transfected 3) Melanophore assay. The melanophore assay is a color cells to exclude possible non-specific effects of some candi based assay. Basically cells used for this assay are derived date modulators. from skin of the frog Xenopus Laevis. These immortalized Assays should be performed using cells or extracts of cells cells contain melanosomes, which are organelles containing expressing an OR polypeptide, treated or not treated with a dark pigment. Activation of endogenous or recombinant carboxylic acid with or without a candidate modulator. Con GPCR that trigger activation of adenylate cyclase or phos trol reactions should be performed using mock-transfected pholipase C lead to melanosome dispersion and therefore cell 25 cells, or extracts from them in order to exclude possible darkening. Alternatively, a GPCR that inhibits adenylate non-specific effects of some candidate modulators cyclase orphospholipase C leads to cell lightening. Thereby, The level of cAMP is “changed” if the level of cAMP instead of measuring concentrations of second messenger, detected in cells, expressing an OR polypeptide and treated one can easily pinpoint hit observing cell coloration change. with a candidate modulator of OR activity (or in extracts of This color change can easily be quantified on a microplate 30 such cells), using the RIA-based assay of Horton & Baxen reader measuring absorbance at 650 nM or by examination on dale, 1995, Supra, increases or decreases by at least 10% a video imaging System. relative to the cAMP level in similar cells not treated with the b. Adenylate Cyclase Assay: candidate modulator. Assays for adenylate cyclase activity are described by Ken d. Phospholipid Breakdown, DAG Production and Inositol imer & Nirenberg, 1981, Mol. Pharmacol. 20: 585-591, 35 Triphosphate Levels: incorporated herein by reference. That assay is a modification Receptors that activate the breakdown of phospholipids of the assay taught by Solomon et al., 1974, Anal. Biochem. can be monitored for changes due to the activity of known or 58: 541-548, also incorporated herein by reference. Briefly, Suspected modulators of an OR by monitoring phospholipid 100 ul reactions contain 50 mM Tris-Hcl (pH 7.5), 5 mM breakdown, and the resulting production of second messen MgCl2, 20 mM creatine phosphate (disodium salt), 10 units 40 gers DAG and/or inositol triphosphate (IP3). Methods of (71 ug of protein) of creatine phosphokinase, 1 mM C-32P measuring each of these are described in Phospholipid Sig ATP (tetrasodium salt, 2 uCi), 0.5 mM cyclic AMP, G-3H naling Protocols, edited by Ian M. Bird. Totowa, N.J., labeled cyclic AMP (approximately 10,000 cpm), 0.5 mM Humana Press, 1998, which is incorporated herein by refer Ro20-1724, 0.25% ethanol, and 50-200 ug of protein homo ence. See also Rudolph et al., 1999, J. Biol. Chem. 274: genate to be tested (i.e., homogenate from cells expressing or 45 11824-11831, incorporated herein by reference, which also not expressing an OR polypeptide, treated or not treated with describes an assay for phosphatidylinositol breakdown. carboxylic acid with or without a candidate modulator). Assays should be performed using cells or extracts of cells Reaction mixtures are generally incubated at 37° C. for 6 expressing an OR, treated or not treated with carboxylic acid minutes. Following incubation, reaction mixtures are depro with or without a candidate modulator. Control reactions teinized by the addition of 0.9 ml of cold 6% trichloroacetic 50 should be performed using mock-transfected cells, or extracts acid. Tubes are centrifuged at 1800xg for 20 minutes and each from them in order to exclude possible non-specific effects of supernatant solution is added to a Dowex AG50W-X4 col Some candidate modulators. umn. The cAMP fraction from the column is eluted with 4 ml According to the invention, phosphatidylinositol break of 0.1 mM imidazole-HCl (pH 7.5) into a counting vial. down, and diacylglycerol and/or inositol triphosphate levels Assays should be performed in triplicate. Control reactions 55 are “changed if they increase or decrease by at least 10% in should also be performed using protein homogenate from a sample from cells expressing an OR polypeptide and treated cells that do not express an OR polypeptide. with a candidate modulator in the presence or in the absence Assays should be performed using cells or extracts of cells of carboxylic acid, relative to the level observed in a sample expressing an OR, treated or not treated with a carboxylic acid from cells expressing a carboxylic polypeptide that is not with or without a candidate modulator. Control reactions 60 treated with the candidate modulator. should be performed using mock-transfected cells, or extracts e. PKC Activation Assays: from them in order to exclude possible non-specific effects of Growth factor receptor tyrosine kinases tend to signal via a Some candidate modulators pathway involving activation of Protein Kinase C(PKC). According to the invention, adenylate cyclase activity is which is a family of phospholipid- and calcium-activated “changed if it increases or decreases by 10% or more in a 65 protein kinases. PKC activation ultimately results in the tran sample taken from cells treated with a candidate modulator of Scription of an array of proto-oncogene transcription factor OR activity, relative to a similar sample of cells not treated encoding genes, including c-fos, c-myc and c-jun, proteases, US 8,993,526 B2 23 24 protease inhibitors, including collagenase type I and plasmi should be performed using mock-transfected cells, or extracts nogen activator inhibitor, and adhesion molecules, including from them in order to exclude possible non-specific effects of intracellular adhesion molecule I (ICAMI). Assays designed Some candidate modulators. to detect increases in gene products induced by PKC can be According to the invention, PKC activity is “changed by a used to monitor PKC activation and thereby receptor activity. candidate modulator when the units of PKC measured by In addition, activity of receptors that signal via PKC can be either assay described above increase or decrease by at least monitored through the use of reporter gene constructs driven 10%, in extracts from cells expressing an OR and treated with by the control sequences of genes activated by PKC activa a candidate modulator, relative to a reaction performed on a tion. This type of reporter gene-based assay is discussed in similar sample from cells not treated with a candidate modu more detail below. 10 lator. For a more direct measure of PKC activity, the method of f. PKA Activation Assays Kikkawa et al., 1982, J. Biol. Chem. 257: 13341, incorporated PKA activity can be assayed using any of several kits herein by reference, can be used. This assay measures phos available commercially, for example from molecular device phorylation of a PKC substrate peptide, which is subse 15 IMAP PKA assay kit, or from promega ProFluor PKA assay quently separated by binding to phosphocellulose paper. This kit. PKC assay system can be used to measure activity of purified Assays should be performed using cells or extracts of cells kinase, or the activity in crude cellular extracts. Protein kinase expressing an OR, treated or not treated with a carboxylic acid Csample can be diluted in 20 mM HEPES/2 mMDTT imme with or without a candidate modulator. Control reactions diately prior to assay. should be performed using mock-transfected cells, or extracts The substrate for the assay is the peptide Ac-FKKSFKL from them in order to exclude possible non-specific effects of NH. (SEQ ID NO: 15), derived from the myristoylated ala Some candidate modulators nine-rich protein kinase C substrate protein (MARCKS). The PKA activity is “changed if the level of activity is Km of the enzyme for this peptide is approximately 50 uM. increased or decreased by 10% or more in a sample from cells, Other basic, protein kinase C-selective peptides known in the 25 expressing an OR polypeptide, treated with a candidate art can also be used, at a concentration of at least 2-3 times modulator relative to PKA kinase activity in a sample from their Km. Cofactors required for the assay include calcium, similar cells not treated with the candidate modulator. magnesium, ATP phosphatidylserine and diacylglycerol. g. Kinase Assays: Depending upon the intent of the user, the assay can be MAP kinase activity can be assayed using any of several 30 kits available commercially, for example, the p38 MAP performed to determine the amount of PKC present (activat Kinase assay kit sold by New England Biolabs (Cat #9820) or ing conditions) or the amount of active PCK present (non the FlashPlateTM MAP Kinase assays sold by Perkin-Elmer activating conditions). For most purposes according to the Life Sciences. invention, non-activating conditions will be used. Such that Assays should be performed using cells or extracts of cells the PKC that is active in the sample when it is isolated is 35 expressing an OR, treated or not treated with a carboxylic acid measured, rather than measuring the PKC that can be acti with or without a candidate modulator. Control reactions vated. For non-activating conditions, calcium is omitted in the should be performed using mock-transfected cells, or extracts assay in favor of EGTA. from them in order to exclude possible non-specific effects of The assay is performed in a mixture containing 20 mM Some candidate modulators HEPES, pH 7.4, 1-2mMDTT, 5 mMMgCl2, 100 uMATP-1 40 MAP Kinase activity is “changed if the level of activity is uCi Y-32P-ATP, 100 ug/ml peptide substrate (~100 uM), 140 increased or decreased by 10% or more in a sample from cells, uM/3.8 LM phosphatidylserine/diacylglycerol membranes, expressing an OR polypeptide, treated with a candidate and 100 uM calcium (or most preferably 500 uMEGTA). 48 modulator relative to MAP kinase activity in a sample from ul of sample, diluted in 20 mM HEPES, pH 7.4, 2 mM DTT similar cells not treated with the candidate modulator. is used in a final reaction volume of 80 ul. Reactions are 45 Direct assays for tyrosine kinase activity using known syn performed at 30°C. for 5-10 minutes, followed by addition of thetic or natural tyrosine kinase Substrates and labeled phos 25 ul of a solution containing 100 mM ATP and 100 mM phate are well known, as are similar assays for other types of EDTA with a pH value of 8.0, which stops the reactions. kinases (e.g., Ser/Thr kinases). Kinase assays can be per After the reaction is stopped, a portion (85 ul) of each formed with both purified kinases and crude extracts prepared reaction is spotted onto a Whatman P81 cellulose phosphate 50 from cells expressing an OR polypeptide, treated with or filter, followed by washes: four times 500 ml of 0.4% phos without a carboxylic acid, with or without a candidate modu phoric acid, (5-10 min. per wash); and a final wash in 500 ml lator. Control reactions should be performed using mock 95% EtOH, for 2-5 min. Bound radioactivity is measured by transfected cells, or extracts from them in order to exclude Scintillation counting. Specific activity (cpm/nmol) of the possible non-specific effects of some candidate modulators. labeled ATP is determined by spotting a sample of the reac 55 Substrates can be either full length protein or synthetic pep tion onto P81 paper and counting without washing. Units of tides representing the substrate. Pinna & Ruzzene (1996, PKC activity, defined as nmol phosphate transferred permin, Biochem. Biophys. Acta 1314: 191-225, incorporated herein are calculated as follows: by reference) list a number of phosphorylation substrate sites useful for measuring kinase activities. A number of kinase The activity, in UNITS (nmol/min) is: = (cpm on 60 substrate peptides are commercially available. One that is paper)x (105ul total 85ul spotted) (assay time, particularly useful is the “Src-related peptide.” min) (specific activity of ATP cpm/nmol). (RRLIEDAEYAARG (SEQ ID NO: 16); available from An alternative assay can be performed using a Protein Sigma i A7433), which is a substrate for many receptor and Kinase C Assay Kit sold by PanVera (Cat. # P2747). nonreceptor tyrosine kinases. Because the assay described Assays are performed on extracts from cells expressing an 65 below requires binding of peptide substrates to filters, the OR polypeptide, treated or not treated with a carboxylic acid peptide Substrates should have a net positive charge to facili with or without a candidate modulator. Control reactions tate binding. Generally, peptide Substrates should have at US 8,993,526 B2 25 26 least 2 basic residues and a free amino terminus. Reactions induced, generally within minutes of contact between the generally use a peptide concentration of 0.7-1.5 mM. receptor and the effector protein or ligand. The induction of Assays are generally carried out in a 25 Jul Volume com immediate early gene transcription does not require the Syn prising 5 ul of 5x kinase buffer (5 mg/mL BSA, 150 mM thesis of new regulatory proteins. In addition to rapid respon Tris-Cl (pH 7.5), 100 mM MgCl2; depending upon the exact siveness to ligand binding, characteristics of preferred genes kinase assayed for, MnCl2 can be used in place of or in useful to make reporter constructs include: low or undetect addition to the MgCl), 5 ul of 1.0 mM ATP (0.2 mM final able expression in quiescent cells; induction that is transient concentration), gamma-32P-ATP (100-500 cpm/pmol), 3 ul and independent of new protein synthesis; Subsequent shut of 10 mM peptide substrate (1.2 mM final concentration), cell off of transcription requires new protein synthesis; and extract containing kinase to be tested (cell extracts used for 10 mRNAs transcribed from these genes have a short half-life. It kinase assays should contain a phosphatase inhibitor (e.g. is preferred, but not necessary that a transcriptional control 0.1-1 mM sodium orthovanadate)), and HO to 25 ul. Reac element have all of these properties for it to be useful. tions are performed at 30°C., and are initiated by the addition In order to assay OR activity with carboxylic acid-respon of the cell extract. sive transcriptional reporter construct, cells that stably Kinase reactions are performed for 30 seconds to about 30 15 express an OR polypeptide are stably transfected with the minutes, followed by the addition of 45 ul of ice-cold 10% reporter construct. To Screen for agonists, untreated cells are trichloroacetic acid (TCA). Samples are spun for 2 minutes in exposed to candidate modulators, or exposed to a carboxylic a microcentrifuge, and 35ul of the Supernatant is spotted onto acid, and expression of the reporter is measured. The car Whatman P81 cellulose phosphate filter circles. The filters boxylic acid-treated cultures serve as a standard for the level are washed three times with 500 ml cold 0.5% phosphoric of transcription induced by a known agonist. An increase of at acid, followed by one wash with 200 ml of acetone at room least 10% in reporter expression in the presence of a candidate temperature for 5 minutes. Filters are dried and incorporated modulator compared to reporter expression in the absence of *P is measured by scintillation counting. The specific activ any modulator indicates that the candidate is a modulator of ity of ATP in the kinase reaction (e.g., in cpm/pmol) is deter OR activity. An agonist will induce at least as much, and mined by spotting a small sample (2-5 ul) of the reaction onto 25 preferably the same amount or more reporter expression than a P81 filter circle and counting directly, without washing. the carboxylic acid. Partial agonists may activate the receptor Counts per minute obtained in the kinase reaction (minus less compared to the carboxylic acid. This approach can also blank) are then divided by the specific activity to determine be used to screen for inverse agonists where cells express an the moles of phosphate transferred in the reaction. OR polypeptide at levels such that there is an elevated basal Assays should be performed using cells or extracts of cells 30 activity of the reporter in the absence of carboxylic acid or expressing an OR, treated or not treated with a carboxylic acid other agonists. A decrease in reporter activity of 10% or more with or without a candidate modulator. Control reactions in the presence of a candidate modulator, relative to its should be performed using mock-transfected cells, or extracts absence, indicates that the compound is an inverse agonist. from them in order to exclude possible non-specific effects of To screen for antagonists, the cells expressing an OR and Some candidate modulators. 35 carrying the reporter construct are exposed to a carboxylic Tyrosine kinase activity is “changed if the level of kinase acid (or another agonist) in the presence and absence of a activity is increased or decreased by 10% or more in a sample candidate modulator. A decrease of 10% or more in reporter from cells, expressing an OR polypeptide, treated with a expression in the presence of candidate modulator, relative to candidate modulator relative to kinase activity in a sample the absence of the candidate modulator, indicates that the from similar cells not treated with the candidate modulator. 40 candidate is an antagonist of OR activity. h. Transcriptional Reporters for Downstream Pathway Controls for transcription assays include cells not express Activation: ing an OR of the invention but carrying the reporter construct, The intracellular signal initiated by binding of a modulator as well as cells with a promoter less reporter construct. Com to a receptor, e.g., an OR polypeptide of the invention, sets in pounds that are identified as modulators of OR-regulated motion a cascade of intracellular events, the ultimate conse 45 transcription should also be analyzed to determine whether quence of which is a rapid and detectable change in the they affect transcription driven by other regulatory sequences transcription and/or translation of one or more genes. The and by other receptors, in order to determine the specificity activity of the receptor can therefore be monitored by mea and spectrum of their activity. Suring the expression of a reporter gene driven by control The transcriptional reporter assay, and most cell-based sequences responsive to OR activation. 50 assays, are well Suited for Screening chemical libraries of As used herein “promoter” refers to the transcriptional chemical compounds for those that modulate OR activity. The control elements necessary for receptor-mediated regulation libraries can be, for example, libraries from natural Sources, of gene expression, including not only the basal promoter, but e.g., plants, animals, bacteria, etc. also any enhancers or transcription-factor binding sites nec Candidate Modulators Useful According to the Invention essary for receptor-regulated expression. By selecting pro 55 Candidate modulators can be screened from large libraries moters that are responsive to the intracellular signals resulting of synthetic or natural compounds. Numerous means are from agonist binding, and operatively linking the selected currently used for random and directed synthesis of various promoters to reporter genes whose transcription, translation kinds of compounds. Synthetic compound libraries are com or ultimate activity is readily detectable and measurable, the mercially available from a number of companies including, transcription based reporter assay provides a rapid indication 60 for example, Maybridge Chemical Co. (Trevillet, Cornwall, of whether a given receptor is activated. UK), Comgenex (Princeton, N.J.), Brandon Associates (Mer Reporter genes Such as luciferase, Chloramphenicol rimack, N.H.), and Microsource (New Milford, Conn.). A Acetyl Transferase (CAT), Green Fluorescent Protein (GFP), rare chemical library is available from Aldrich (Milwaukee, beta-lactamase or beta-galactosidase are well known in the Wis.). Combinatorial libraries of small organic molecules are art, as are assays for the detection of their products. 65 available and can be prepared. Alternatively, libraries of natu Genes particularly well Suited for monitoring receptor ral compounds in the form of bacterial, fungal, plant and activity are the “immediate early’ genes, which are rapidly animal extracts are available from e.g., Pan Laboratories US 8,993,526 B2 27 28 (Bothell, Wash.) or MycoSearch (NC), or are readily pro present in Sweat were included within the 148 tested odorants. duceable by methods well known in the art. Additionally, Black squares correspond to a response of a receptor to one natural and synthetically produced libraries and compounds odorant molecule. The part of the table corresponding to are readily modified through conventional chemical, physi carboxylic acids has been boxed in bold. The seven tested cal, and biochemical means. class 1 receptors have all responded specifically and exclu sively to carboxylic acids. EXAMPLES Each molecule was tested at 3 different concentrations (1 mM,316 uM, 100 uM). The different molecules of the tested The invention is further illustrated by the following non libraries were disposed at the same concentration into 96 well limiting examples. 10 plates (1 well/molecule) containing cells expressing the receptor of interest. The activity of the tested molecules was Experimental Procedure measured using the lucifierase activity as explained above. The median luciferase activity induced by the tested mol Cell Culture and Cell Line Generation ecules and the associated Standard deviation were deter Cells were maintained in minimal essential medium 15 mined. Putatively active molecules (hits) were defined as (EMEM, Lonza) containing 10% fetal bovine serum (M10). molecules inducing a luciferase activity higher or equal to the HEK293T-RTP1A1/RTP2 cells were generated by transfect median--2 standard deviations. ing HEK293T with an expression vector containing the sequences of the chaperone proteins RTP1A1 and RTP2 and Table 2 summarizes the results of this deorphanization. a resistance gene to puromycin, using Lipofectamine 2000. A Each OR-activating molecule couple is indicated by a black recombinant cell population was selected by adding 10 ug/ml square at the intersection of the column corresponding to the of puromycin into the culture medium. Monoclonal popula receptor and the row corresponding to the molecule. The tions were further obtained by limit dilution procedure. results clearly show that the seven ORs of the invention are Briefly, a cell suspension was diluted to contain 1 cell per ml activated by carboxylic acids which are present in human and this dilution was dispatched in poly-D-lysine-coated 96 SWeat. wells plates (200 ul of dilution per well). After 5 days of 25 The 7 ORs of the invention were further included in a large culture, the presence and number of cell colonies per well was screening campaign aiming to test different molecule librar checked under a phase contrast microscopic. After 5 addi ies that do not contain carboxylic acids. These screenings tional days of culture, wells containing a single colony were were performed as described above. A total of 823 molecules harvested and each collected population was amplified inde were tested on OR52L1, OR52E8, OR51I2, OR52A5 and pendently. 30 OR56A6. A total of 592 molecules were tested on OR52B2 Odorant Molecule Dilution and a total of 777 were tested on OR52E1. The complete list Odorant molecules were diluted at a concentration of 1 of the tested molecules is given in Table 3. None of the mole/liter (M) into dimethyl sulfoxide (DMSO) to generate molecules gave a hit on any of the 7 ORs of the invention. This stock solutions. result confirms the very high selectivity of the 7 ORs of the For screening experiments, stock solutions of odorant mol 35 invention to carboxylic acid ligands. ecules were diluted in EMEM disposed in 96-well plates. The 7 tested ORs from class 1 (corresponding to the ORs Plates containing the tested molecules (1 molecule? well) at a concentration of 2 mM, at a concentration of 632 uMandata of the invention, namely: OR52L1, OR52E8, OR52B2, concentration of 200 uM were prepared. OR51I2, OR52E1, OR52A5 and OR56A5) were therefore For concentration-response analysis, serial dilutions of the found to respond specifically and exclusively to carboxylic tested molecules were prepared from Stock solutions in 40 acids. EMEM plated into 96-well plates. Luciferase Assay. Example 2 For the initial deorphanisation screening and dose-re sponse analysis, a Luciferase-based gene reporter assay Dose-Response Analysis of Ligand-OR Interaction (Promega, Leiden, The Nederlands) was used as described in 45 Saito et al. (2004). Briefly, cells were platted on poly-D- The hits were validated by concentration-response analy lysine-coated 96-well plates (BDBioscience, Erembodegem sis. Semi-logarithmic serial dilutions of hit molecules, from 1 Dorp, Belgium) and transfected with a plasmid containing the mM to 316 nM, were tested on the responding ORS using the CRE-luciferase and a plasmid containing the olfactory recep luciferase assay as described above. tor. Sixteen hours after transfection, the culture medium was 50 Results are given in Table 2. Full results are given in FIG. replaced by serum-free EMEM containing the tested ligandat 2A-FIG. 2.J. a determined concentration. After four hours of incubation at We observed that each of the 7 ORS tested respond to at 37° C. degree, cells were lysed and processed for lumines least one molecule containing a carboxylic function. A care cence measurement according to the manufacturer's proto ful comparison of these activators with the known carboxylic cols. Luminescene emission was recorded on a Spectra Max 55 acids occurring in human Sweat revealed that each of the M5 reader (Molecular Devices, Sunnyvale, Calif.). Results receptors responds to at least one carboxylic acid released in were expressed as percentage of the response induced by 10 Sweat. Some of these acids, such as hexanoic acid, 3-methyl uM of the adenylate cyclase activator Forskolin. hexanoic acid, (E)-3-methyl-2-hexenoic acid, 3-hydroxy-3- methylhexanoic acid, heptanoic acid, octanoic acid, 4-ethy Example 1 loctanoic acid, (Zeng et al. 1991, J. Chem. Ecolog. Vol. 17 pp 60 1469-1492; Natsch et al. 2006 Chem. & Biodiv. Vol. 3 pp Screening of Odorant Molecule Libraries 1-20) are known to be important promoters of human Sweat malodor. Odorant molecule libraries containing carboxylic acids These 7 ORs of the invention are therefore involved in the and other types of molecules were used to identify activators perception of Sweat malodorelicited by carboxylic acids and of the seven ORs of the invention. The deorphanisation cam 65 constitute valuable candidate receptors for the identification paign was performed on the seven olfactory receptors with a of antagonists and/or blockers that would block the percep series of 148 odorant molecules. Sixteen carboxylic acids tion of malodor. US 8,993,526 B2 29 30 TABLE 2

Activation of ORS according to the invention by carboxylic acids originating from Sweat.

butanoic acid Isovaleric acid

pentanoic acid

hexanoic acid

2-methylhexanoic acid

3-methylhexanoic acid

(E)-3-methyl-2-hexenoic acid 3-hydroxy-3-methylhexanoic acid

heptanoic acid

2-methylheptanoic acid

octanoic acid

4-ethyloctanoic acid

nonanoic acid

decanoic acid

undecanoic acid

benzoic acid

(R)-(+)-Citronellal (R)-(+)-Pulegone

(S)-(-)-Citronellol 1,4-Butanedithiol 1-amino-2-phenylethane

1-Butanethiol

1-cyclohexylethanol 1-Furfurylpyrrole 1-hepten-3-ol 1-Propanol

2,6-Dimethylthiophenol 2-Butanone 2-cyclohexylethanol 2-Methylbutyl acetate

2-Methylpyridine

2-Nonanone 3,4-Dimethoxyphenyl acetone 3-Octanone 4-(4-Methoxyphenyl)-2-butanone

4-(Methylthio)butanol US 8,993,526 B2 31 TABLE 2-continued

Activation of ORS according to the invention by carboxylic acids originating from Sweat.

4-Hydroxy-3-methoxyphenylacetone 4-Hydroxybenzaldehyde 4-Propylphenol 5-Hexen-1-ol Acetophenone a-ionone Allyl cyclohexylpropionate Allyl mercaptain Allyl sulfide alpha-Methylbenzyl alcohol AMYL BENZOATE Amyl Salicylate Androstanolone Anisyl acetate a-pinene a-terpineol Benzophenone Benzyl acetate

Benzyl mercaptain

Butyraldehyde Carvacrol Caryophyllene Cinnamyl acetate

CITRAL DIMETHYLACETAL Coumarin Cyclamal

DECALACTONEDELTA DECYLACETATE dihexyl fumarate Dihydroanethole Dihydroeugenol Dimethylsulfide

Ethyl 2-mercaptopropionate US 8,993,526 B2 33 34 TABLE 2-continued

Activation of ORS according to the invention by carboxylic acids originating from Sweat.

Ethyl p-anisate Ethyl phenylacetate Ethylvanillin Eucalyptol floridile Frutonile Furfuryl butyrate Furfuryl methylsulfide Gamma-jasmolactone gamma-undecalactone Geranyl acetate Guaiacol Heptaldehyde Heptyl alcohol Hexanal Hexyl octanoate Isoamyl laurate Isobornylcyclohexanol Isobutylbenzoate

Jasmacyclene Jasmatone JASMOLACTONE

Lauryl alcohol

Lyral Menthalactone Menthol Methyl 3-nonenoate Methyl anthranilate Methylbenzoate METHYL HEPTENONE PURE Methyl laitone methyl salicylate Nectaryl US 8,993,526 B2 35 36 TABLE 2-continued Activation of ORS according to the invention by carboxylic acids originating from Sweat.

NONADIENOL-2,6 Nonanal Nonyl alcohol n-Valeraldehyde Ocimene o-cresol Octanal Octyl propionate OXYOCTALINE FORMATE Para-methoxyacetophenone p-cresyl methyl ether p-Dimethoxybenzene Phenethyl 2-furoate Phenyl acetate Phenylethanol Piperonyl acetate Piperonyl isobutyrate p-Mentha-8-thiol-3-one PRENYL BENZOATE Propenylguaethol PROPYLIDENE PHTHALIDE Pyrrole Rasberry ketone rossitol Stenone Terpinen-4-ol Tetrahydrogeraniol Tetrahydromyrcenol Thymol tridecenenitrile undecanal UNDECATRIENE Undecavertol Undecene-2-nitrile Vanillin Verdyl propionate Vetiveryl Acetate

TABLE 3 TABLE 3-continued 55 Complete list of odorant molecules tested Complete list of odorant molecules tested on the 7 ORs of the invention. on the 7 ORs of the invention. gamma Dodecalactone (natural) Acetanisole Hexyl isobutyrate 4,5-Dihydro-3(2H)thiophenone 3-Acetyl-2,5-dimethylthiophene Styrene Acetaldehyde ethyl phenylethyl acetal 60 Benzyl alcohol Methyl isoeugenol Benzaldehyde 4-Isopropylcyclohexanol Benzyl mercaptain Ethyl maltol 2-Ethylpyridine Prenylbenzoate alpha,alpha-Dimethylphenethyl alcohol 2-Methyl-3-(p-methoxyphenyl)propanal Dimethylbenzyl carbinyl butyrate (+)-Camphene 65 alpha-Methylcinnamaldehyde Ethyl acetoacetate ethylene glycol ketal Methyl phenylacetate US 8,993,526 B2 37 38 TABLE 3-continued TABLE 3-continued Complete list of odorant molecules tested Complete list of odorant molecules tested on the 7 ORs of the invention. on the 7 ORs of the invention. Phenylacetaldehyde dimethyl acetal 5 2-Heptanone Diphenyl ether Isoamyl formate alpha-Amylcinnamyl alcohol n-Valeraldehyde alpha-Hexylcinnamaldehyde Pyridine p-Tolyl phenylacetate Piperidine Sobutyl phenylacetate 6-Methyl-5-hepten-2-one Benzyl phenylacetate 10 Methyl 2-octynoate Anisyl phenylacetate Hexylamine Triacetin Hexyl alcohol 2-Methyl-4-phenyl-2-butanol Ethyl octadecanoate Methyl cinnamate Heptaldehyde Benzyl isobutyrate Hexyl octanoate Ethyl cinnamate 15 Methyl 2-nonenoate Benzyl butyrate Methyl 2-nonynoate Benzyl cinnamate Methyl 10-undecenoate Phenethyl acetate Methyl laurate Benzyl ether Myrcenyl acetate Phenethyl cinnamate 2-Undecanone Cinnamyl acetate Octyl acetate 2-Phenoxyethyl isobutyrate 2O Decyl acetate -Bromo-2-phenylethylene 2-Acetylpyridine 2,2-Dimethyl-3-(3-methylphenyl)propanol Decanal 2-Methyl-3-(p-isopropylphenyl)propionaldehyde O-Undecen-1-ol p-Tolylacetaldehyde Undecanal -Phenyl-3-methyl-3-pentanol O-Undecena Anisyl acetate 25 Dodecylaldehyde p-Propyl anisole Methyl stearate gamma-Octalactone Methyl linoleate Cinnamic alcohol Dihydrolasmone Cinnamaldehyde Linallyl acetate gamma-Nonalactone Linallyl formate 2-Cyclohexyliden-2-phenylacetonitrile 30 (2,6,6-Trimethylcyclohexa-1,3-dienyl)methanal Phenethyl formate 2(2,4-Dimethylcyclohex-3-en-1-yl)-5-methyl-5-(1-methylpropy-) gamma-Undecalactone Benzyl salicylate (-)-C-Terpineol Maltol 4-Methylanisole 2,6-Dimethylthiophenol Ethyl 6-acetoxyhexanoate 4-Butanedithiol Anisyl alcohol 35 Prenyl acetate 3-Decen-2-one 8-Octanedithiol gamma-Heptalactone 2-Furyl methyl ketone Ethyl propionate Methyl salicylate Diethyl malonate 2-Acetyl-5-methylfuran Ethylbutyrate Fenchone Acetal Benzophenone Geranyl acetate 40 Styrallyl propionate Ethylene brassylate sobutylbenzoate omega-Pentadecalactone Benzyl benzoate Butyl laurate Heliotropin 3,7-Dimethyl-1-octanol indole Citronellol Ethylvanillin (+)-Citronellal 45 Vanillin Geraniol Ammonium sulfide Nerol Ethyl 3-phenylglycidate Isoamylbutyrate Triethylamine Ethylheptanoate Methylp-anisate Ethyl octanoate 4-Methylacetophenone p-Cresol 50 Cuminaldehyde Dimethyl Succinate ,3,4,6,7,8-Hexahydro-4,6,6,7,8,8-hexamethylcyclopentag 2,6-Dimethyl-5-heptenal 2-benzopyran Solution 1-Propanethiol alpha-Amylcinnamaldehyde Hydroxycitronellal Benzylpropionate Isopentylamine Cinnamyl cinnamate Ethyl isovalerate 55 3-Phenylpropyl acetate Benzenethiol Phenylacetaldehyde 3-Methylpyridine 3-Phenyl-1-propanol 2-Methylpyridine Phenoxyethanol 2-Methylpyrazine 4-Ethylphenol Octyl isobutyrate 4-Hydroxybenzaldehyde 1,16-Hexadecalactone p-Anisaldehyde Butyl 10-undecenoate 60 4-Heptanone Butylamine Ethylnonanoate 1-Butanethiol 2,5-Dimethylpyrazine 1,3-Propanedithiol Myrcene Pyrrole Propionaldehyde Isopropyl myristate Soamyl alcohol Diethyl sebacate 65 Ethylhexanoate Methyl decanoate Allylhexanoate US 8,993,526 B2 39 40 TABLE 3-continued TABLE 3-continued Complete list of odorant molecules tested Complete list of odorant molecules tested on the 7 ORs of the invention. on the 7 ORs of the invention. Pyrrollidine 2-Isobutylthiazole Butyl acetate beta-Farnesene Isoamyl acetate trans-2-Heptenal Ethyl myristate 3-Pentyltetrahydro2H]pyranyl acetate Isobornyl acetate Hexyl trans-2-butenoate alpha-Ionone Dihexyl fumarate 3 methyl 4 (2,6,6 trimethyl 2 cyclohex-1-yl-3 buten 2 one) alpha 10 1,10-Dimethyl-9-decalol isomethyl ionone Ethyl 2-mercaptopropionate Butylated hydroxytoluene Cedryl methyl ether 9-Decen-1-ol 4 Methyl-4-mercaptopentan-2-one 2-Hexylcyclopentanone Isoamyl octanoate 2,4-Dimethyl-2-(1,1,4,4-tetramethyltetralinyl)-1,3-dioxolan trans-2-Dodecen-1-al 2,6-Dimethyl-2-heptanol 15 Isoamylbenzoate (natural) Menthalactone Amyl Salicylate Amyl 2-furoate Butyl levulinate Methyl anthranilate 4-(Methylthio)butanol Guaicwood acetate Vanillin isobutyrate 3-Carene Citronellyl 3-methylbut-2-enoate Methyl 3-nonenoate Tetrahydrolavandulyl acetate 3,5-Dimethyl-1,2-cyclopentadione 2-Pentanethiol Syringaldehyde cis-4-Decenal Methyl 3-(methylthio)propionate Cyclohexaneethyl acetate 6-Isopropylquinoline Methyl 2-methylpentanoate Furfuryl 3-methylbutanoate Methyl propyl disulfide 2-n-Heptylcyclopentanone 5-Methyl-2-phenyl-2-hexenal Cuminyl nitrile 25 2-Acetylpyrazine cis-4-(1-Methylethyl)cyclohexanemethanol (-)-Menthol ,3,3-Trimethyl-2-norbornanyl acetate D-Carvone 3,7-Dimethyl-1,3,6-octatriene 5-Methyl-3-heptanone oxime d-Limonene 2-Tridecenonitrile 2-t-Butylcyclohexyloxy-2-butanol Nerolidyl acetate Benzyl acetate 30 Geranyl isobutyrate Phenethyl isovalerate Damascenone p-Methylphenyl acetate b-Damascone 4-Allylanisole (5H)-5-Methyl-6,7-dihydrocyclopenta(b)pyrazine (-)-Menthone 2.3 or 10-Mercaptopinane Ethyl acrylate Ethyl 3-hexenoate 2,6,10-Trimethyl-9-undecenal 2,6,10-Trimethylundeca-5,9-dienal Citronellyl propionate 35 2-Methoxy-3-(1-methylpropyl)pyrazine Hydroxycitronellal dimethyl acetal 1,3-Butanedithiol Ethyl acetoacetate 2-Heptyltetrahydrofuran Allylheptanoate Dodecane nitrile Octyl propionate Hexyl propionate Hexyl acetate 2-Methylbutyl isovalerate Nonyl alcohol 40 2-Isobutyl-3-methoxypyrazine Nonyl acetate 3,7-Dimethyl-6-octenyl 2-methylcrotonate Furfuryl methylsulfide alpha-Damascone -Furfurylpyrrole Phenethyl 2-methylbutyrate Methyl 2,5,10-trimethyl-2.5.9-cyclododecatrien-1-ylketone Methyl dihydrojasmonate Linallyl propionate 4-Hexen-3-one 2-sec-Butylcyclohexanone 45 Ethyl 2-cyclohexylpropionate beta-Ionone trans,trans-2,4-Decadienal 7-Acetyl-1,1,3,4,4,6-hexamethyltetralin cis-3-Hexenyl benzoate p-Dimethoxybenzene a,3,3-Trimethylcyclohexylmethyl formate Citronellyl acetate Dihydromyrcenyl formate alpha,alpha-Dimethylphenethyl acetate Diacetin 2-Ethyl-3-methylpyrazine 50 2,5-Dimethyl-2-octen-6-one (1R)-(+)-Fenchyl alcohol 4-Phenylbutane-2-one 1,3,5-Undecatriene Hexylbutyrate Tetrahydro-4-methyl-2-(2-methyl-1-propenyl)-(2H)pyran 4-Methyl-2-phenyl-2-pentenal cis-3-Hexenylbutyrate Allyl cyclohexanepropionate 4-tert-Amylcyclohexanone 2-Methoxy-4-propylphenol 1,1-Diethoxycyclohexane trans-2,cis-6-Nonadien-1-ol Hexyltiglate 55 Acetaldehyde ethyl (Z)-3-hexenyl acetal Dihydro-beta-ionone 2-Methyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)but-2-en-1-ol Methyl undecanoate 2-Ethyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)-2-buten-1-ol 3-Propylidenephthalide 2-Methoxy-3-methylpyrazine Tricyclodecenylpropionate 2-Methyl-3-furanthiol Methyl trans-cinnamate 4,5-Dimethyl-3-hydroxy-2,5-dihydrofuran-2-one 18, 12-Bisabolatriene 60 Thiazole Bourgeonal Watermelon ketone Ethyl 2-hexylacetoacetate Androstenone Hexahydro-1,1,5,5-tetramethyl2H-2,4a-methanonaphthalen-85 Hone trans-3-Octen-2-one Phenylacetaldehyde glyceryl acetal 1,2-Dihydrolinalool 2-Acetyl-2-thiazoline Tetrahydromyrcenol 65 4(Octahydro-4,7-methano5Hinden-5-ylidene)butanal 2,6-Dimethyl-7-octen-2-ol Ethyl 2-trans-4-cis-decadienoate US 8,993,526 B2 41 42 TABLE 3-continued TABLE 3-continued Complete list of odorant molecules tested Complete list of odorant molecules tested on the 7 ORs of the invention. on the 7 ORs of the invention. 2-Methoxypyrazine 3-(Methylthio)-1-hexanol 4-(4-Hydroxy-4-Methylpentyl)-3-cyclohexene-1-carboxaldehyde 2,4,6-Trimethyl-4-phenyl-1,3-dioxane 4-t-Butylcyclohexyl acetate Ethyl (+)-2-hydroxycaproate Acetylcedrene Methyl 3,3-dimethylbicyclo[2.2.1]heptan-3-carboxylate 6,10-Dimethyl-5.9-undecadien-2-yl acetat (cis & trans) Phenylethyl n-butyl ether 3-(Methylthio)propionaldehyde trans-2-Undecenal 6-(3-Pentenyl)tetrahydro2Hpyran-2-one 10 4-Isopropylbenzyl alcohol delta-Nonalactone 3-Ethylpyridine (Z)-3-Hexenylpropionate Methylbenzyl ether Dihydro-4-methyl-5-pentylfuran-2(3H)One Ethyl valerate 6,7-Dihydro-1,1,2,3,3-pentamethyl-4(5H)indanone Amylhexanoate 6,6-Dimethyl-2-norpinenepropionaldehyde Isobutyl propionate 1-Octen-3-ol Ethyl 3-hydroxybutyrate 4-(Methylthio)-2-butanone 15 Tricyclodecenyl acetate 6-Isopropyl-21Hoctahydronaphthalenone 3-Methyl-1-cyclopentadecanone 5,6,7,8-Tetrahydroquinoxaline Hexyl phenylacetate 3,5,5-Trimethyl-1-hexanol 2-Acetyl-3,5(6)-dimethylpyrazine 19-Nonanedithiol 3,5,5-Trimethylhexanal Ethyl dehydrocyclogeranate Octahydro-2,3,8,8-tetramethyl-2-acetonaphthone 2-Isopropyl-5-methyl-2-hexenal 2-Butyl-4,4,6-trimethyl-1,3-dioxane Methyl phenethyl ether Thujone 3,3,5,5-Tetramethyl-4-(1-ethoxyethenyl)cyclohexanone roxyphenyl)-2-butanone 2,5-Dimethyl-4-hydroxy-3 (2H)-furanone Solution dodecanedioate cis-3-Hexen-1-yl acetate -5-phenyl-1-pentanol trans-3-Hexenyl acetate -5-phenyl-1-pentanal 1-Vinyl-2-(1-methylpropyl)cyclohexyl acetate 25 3-Butylidenephthalide Dodecahydrotetramethylnaphthofuran 2-Columaranone 5-Cyclohexadecen-1-one Methyl isovalerate Isohexenyltetrahydrobenzaldehyde 3-Methyl-2-buten-1-ol 2-Heptylfuran 2,6-Nonadienal (trans, cis) (E)-6,10-Dimethylundeca-5,9-dien-2-one Phenylethyl isoamyl ether 2,4-Dimethyl-5-acetylthiazole 30 4-Carvomenthenol 5-Methyl-3-butyltetrahydropyran-4-yl acetate Caryophylene acetate p-Mentha-8-thiol-3-one 2-Methyl-3-tetrahydrofuranthiol Methyl (p-tolyloxy)acetate delta-Damascone 3-Propylbicyclo-(2.2.1]hept-5-en-2-carboxyaldehyde 2,6-Xylenol Octyl 2-furoate 1-Phenyl-1,2-propanedione alpha-Furfuryl octanoate Ethyl 2-ethyl-6,6-dimethyl-2-cyclohexenecarboxylate Ethyl 2-methylpentanoate 35 Ethyl tiglate Furfurylheptanoate 3,5,5-Trimethylhexyl acetate 9-Decenal Formaldehyde cyclododecyl ethyl acetal 3,7-Dimethyl octanenitrile Terpinolene trans-Nerolidol D-(+)-Xylose 2,5-Dimethyl-4-methoxy-3 (2H)furanone Isobutyl 2-butenoate Acetaldehyde ethyl linallyl acetal 40 3-Heptanol (Z)-3-Hexenyl isobutyrate Menthanyl acetate Octahydro-7-methyl-1,4-methanonaphthalen-6-2H)-one Acetoxymethyl-isolongifolene Anetho 2,3-Dimethylpyrazine 3,7-Dimethyl-7-methoxyoctan-2-ol Ethyl 2-methyl-6-pentyl-4-oxocyclohex-2-enecarboxylate Diisopropyl disulfide Butyl formate p-Menthane-3,8-diol 45 Allyl sulfide Diacetyl Tetrahydrogeranial 2-Ethylhexanal ethylene glycol acetal d-Limonene Cinnamyl nitrile 2,3-Pentanedione 2-Phenyl-2-butenal Tributyrin Octahydrocoumarin Phenethyl alcohol 2,2'-(Dithiodimethylene)difuran 50 2-Pentylbutyrate 3,4-Hexanedione Methyl 2-furoate Farneso cis-3-Hexenyl cis-3-hexenoate NOOTKATONE L-Menthyl lactate -Fenchone Sobutyl tiglate ALPHA. CEDRENE ((-)-a-Cedrene; 1S,2R,5S)-2,6,6,8- Ethyl pyruvate Tetramethyltricyclo[5.3.1.01.5undec-8-ene) 55 3,7-Dimethyl-2,6-nonadienenitrile 4-Cineole Dihydrocarveol Methylatrarate Cyclohexyl acetate Eucalyptol Furfuryl acetate 2-Pentylcyc opentanone Furfuryl butyrate cis-Jasmone Methylbutyrate Acetovanillone Ethyl trans-2-butenoate Dihydro-alpha-terpineol 60 2-Methylbutyl acetate (C8Oile 6-Methylheptan-3-one Ethyl methylsulfide Dimethyl disulfide n-Amyl phenylacetate 3-Penten-2-one Acetoin Hexyl salicylate 3,7-Dimethyl-2,6-Octadienenitrile 65 Diethyl malate -Citronellyl nitrile Propylhexanoate US 8,993,526 B2 43 44 TABLE 3-continued TABLE 3-continued Complete list of odorant molecules tested Complete list of odorant molecules tested on the 7 ORs of the invention. on the 7 ORs of the invention. Ethyl undecanoate 5 Citral dimethyl acetal Ethyl palmitate (+)-Camphor Butyl 2-methylvalerate Cedarwood oil alcohols Isoamyl laurate Cedryl acetate 2-Isobutyl-4-hydroxy-4-methyltetrahydropyran Terpinyl isobutyrate Isopropylbutyrate 3-Methyl-3-pentanol Amyl octanoate 10 (O-6-Hexadecenlactone Phenethylamine Soamyl cinnamate Propyl isobutyrate Sobutyl acetoacetate 4-Propylphenol sobutylbenzyl carbinol L-Carvone Ethyl 3-methyl-3-phenylglycidate 5-(2,2,3-Trimethylcyclopent-3-en-1-yl)-3-methylpentan-2-ol (1S)-(-)-C-Pinene trans-4-Decenal L-Fenchone 2.5,9,10-Tetramethyl-5,6-dehydro-1-decallyl formate 15 Triethyl citrate Maltol isobutyrate Linallyl isobutyrate 2,2,5-Trimethyl-5-pentylcyclopentanone Linallyl cinnamate 4-Methyl-5-thiazoleethanol acetate Linalool Soamyl isovalerate Sobutylamine Methyl tiglate sobutyl alcohol sobutyraldehyde 4-Allyl-2,6-dimethoxyphenol 2-Butanol sopropyl 2-methylbutyrate 2-Butanone p-Isobutyl-alpha-methylhydrocinnamaldehyde Pyruvaldehyde trans-2-Hexen-1-al Methyl acetate 4-Heptenal alpha-Irone 3,5,5-Trimethylhexyl formate 25 Allyl alpha-ionone 3,3,5-Trimethylcyclohexylethylether Geranium bourbon Sopropyl alcohol 1,3-Dimethylbut-3-enyl isobutyrate cis-3-Hexenyl methyl carbonate Cognac oil, green Allyl amylglycolate alpha-Terpinyl acetate para-Ethyl-alpha,alpha-dimethyldihydrocinnamaldehyde p-tert-Butyl-alpha-methyldihydrocinnamic aldehyde Hydratropaldehyde propylene glycol acetal 30 alpha-Pinene Phenethyl pivalate Ethyl octahydro-4,7-methano.3aHindene-3a-carboxylate ,1-Dimethoxy-2,2,5-trimethyl-4-hexene Musk ketone Methylsulfoxide Musk xylol Ethyl-2-t-butylcyclohexylcarbonate 4-Methyl-3-decen-5-ol 7-Formyl-5-isopropyl-2-methylbicyclo[2.2.2]oct-2-ene 2,44.7-Tetramethyl-6,8-nonadiene-3-one oxime Amylcyclohexyl acetate (mixed isomers) Acetyl diisoamylene cis-3-Hexenyl tiglate 35 3,5,6,6-Tetramethyl-4-methylene-2-heptanol Hexyl benzoate 2-Nonanone (-)-Ambroxide 2,4-Dimethyl-4-phenyltetrahydrofuran Solongifolene epoxide Skatole Phenylethyl isopropyl ether N-Methyl-N-phenyl-2-methylbutyramide 4-Methyl-4-phenyl-2-pentyl acetate Diethyl phthalate Grisalva 40 3-Methyldodecanonitrile 2-Ethoxy-9-methylene-2,6,6-trimethylbicyclo[3.3.1..nonane Isobornyl isobutyrate Methyl 1-methyl-4-isopropylbicyclo[2.2.2]oct-5-enecarboxylate 2-Methoxybiphenyl Methyl sorbate Methyl 2-methylbutyrate Cyclomugual Allyl mercaptain 2-Methyldecanonitrile Isoamyl Salicylate 6- or 7-Ethylideneoctahydro-5,8-methano.2H-1-benzopyran-2-one 45 Caryophyllene 5-Ethyl-3-hydroxy-4-methyl-2(5H) furanone p-Methoxybenzonitrile delta-Decalactone Tetrahydrolinalool gamma-Decalactone Diethyl L-tartrate 1-(2,2,6-Trimethylcyclohexyl)-3-hexanol o-t-Butylcyclohexyl acetate 2-methoxyphenol reaction products with hydrogenated 2,2-dimethyl-3- 2-Isopropylphenol methylenebicyclo2.2.1]heptane 50 Isopulegyl acetate delta-Undecalactone (-)-Isopulegol 1-p-Menthene-8-thiol Menthone 1-Propanol Thymol delta-Dodecalactone Salicylaldehyde Phenethyl 2-furoate 1-Methylnaphthalene 2.5,5-Trimethyloctahydro-2-naphthol Trichloromethyl phenyl carbinyl acetate 2-Methyl-4-(2,6,6-trimethyl-2-cyclohexenyl)butanal 55 2-Methylpentyl 2-methylpentanoate Methyl trans-2-octenoate 2-Phenylpropionaldehyde dimethyl acetal 2.2,6-Trimethyl-6-vinyltetrahydropyran Naphthalene 2,2-Dimethyl-5-(1-methylpropen-1-yl)tetrahydrofuran 2-Naphthalenethiol Ethyl 2-methylbutyrate Coumarin Citronellyloxyacetaldehyde trans-Isoeugenylbenzyl ether Butylbutyryllactate 60 trans-2-Hexen-1-ol Acetaldehyde phenethylpropyl acetal cis-3-Hexen-1-ol Allyl phenoxyacetate Methyl beta-naphthyl ketone Ethylamine 4-Allyl-1,2-dimethoxybenzene Acetaldehyde beta-Naphthyl ethyl ether Ethanethiol 2-Phenylpropionaldehyde 1,5-Dimethyl bicyclo(3.2.1)octan-8-one oxime 65 Methylbenzoate Dimethylsulfide Methyl nicotinate US 8,993,526 B2 45 46 TABLE 3-continued TABLE 3-continued Complete list of odorant molecules tested Complete list of odorant molecules tested on the 7 ORs of the invention. on the 7 ORs of the invention. Ethylbenzoate methyl 1,4-dimethylcyclohexane-1-carboxylate alpha-Methylbenzyl acetate undec-10-enenitrile 1-Ethylhexyl tiglate (9Z)-undec-9-enenitrile Ethyl p-anisate (9E)-undec-9-enenitrile Isoamylbenzoate 1-spiro[4.5 dec-7-en-7-ylpent-4-en-1-one Geranyl benzoate 1-spiro[4.5 dec-7-en-7-ylpent-4-en-1-one Piperine 10 tricyclo decenylacetate Propenylguaethol Tricyclodecenylpropionate 2-Hexyl-2-cyclopenten-1-one 2 ethyl 3.5 dimethyl pyrazine o-Cresol 2 ethyl 3,6 dimethyl pyrazine 2.5-Xylenol Tetrahydro-4-methyl-2-(2-methyl-1-propenyl)-(2H)pyran 2-(2-(4-Methyl-3-cyclohexen-1-yl)propyl)cyclopentanone Helioma 2,3-Heptanedione 15 6-ethyl-3-methyl-Oct-5-en-1-ol Eugenol Galaxolide Isoeugenol Ambrettolide Ethyl isobutyrate Habanolide Isobutyl isobutyrate Muscenone Citronellyl isobutyrate Traseolide Tetrahydrofurfuryl alcohol Moxalone alpha-Terpineol Florhydral alpha-Methylbenzyl alcohol Furnisa alpha-Phellandrene Polysantol gamma-Terpinene Ebanol alpha-Terpinene Javanol p-Cymene Mareni Composé Inconnu 25 Indoclear Forskolin Pivacyclene Sodium Sulfide hydrate Neocaspirene Sodium methanethiolate Herbanate 3-mercapto-1-pentanol Methyl laitone 3-mercapto-2-methyl-1-butanol Ethyl laitone 3-Mercapto-3-methyl-1-hexanol 30 Amber ketal trimethylamine HCL Ambermax (compose 1) putrescine Ambermax (composé 2) cadaverine Ambrocenide morpholine Metambrate 4-methylmorpholine Spirambrene Urea 35 1-(3,3-dimethylcyclohex-1-en-1-yl)pent-4-en-1-one Androstadienol 1-(5,5-dimethylcyclohex-1-en-1-yl)pent-4-en-1-one geovertol Reseda Body methylgeosmin Ligustral 1,3,5-trichloro-2-methoxybenzene Verdoracine N-ethyl pyrrol Vethymine 2,3,5-trimethyl pyridine Alicate ammonium hydroxyde 40 Undecene-2-nitrile 1-cyclohexylethanol Methyldiantilis 1-cyclohexylethyl acetate Toscanol 1-cyclohexylethylbutyrate Safraleine 1-cyclohexylethyl propionate Lewistamel Agarbois Dihydroisojasmonate Anapear 45 Carvacrol Anjeruk Violet nitrile AZurone 4-methylidene-2-phenyloxane Belambre 4-methyl-2-phenyl-3,6-dihydro-2H-pyran Camonal Pelargene cis-3-hexenyl salicylate Dispirone COSOile 50 Gyrane Dihydrofarnesal Glycolierral Dihydromyrcenyl acetate Gardocyclene Ethylene Glycol Monophenoxyacetate Felvinone Florymoss Azarbre Georgywood PTBCHA high cis Heliotropin 55 Sobutylquinolene nirvanolide Tetrahydronaphthol opalal Methyl epijasmonate paradisamide (R)-2(S) Methyl epijasmonate Pepperwood 4-cyclohexyl-2-methylbutan-2-ol Pharaone methyl 2-(methylamino)benzoate rossitol 2-2-(3,3,5-trimethylcyclohexyl)acetylcyclopentan-1-one serenolide 60 4-(4-methylpent-3-en-1-yl)cyclohex-3-en-1-yl)methyl acetate (E)-6-ethyl-3-methyl-oct-6-en-1-ol NEROLIONE Tanaisone -10,10-dimethyl-2,6-dimethylidenebicyclo[7.2.0]undecan-5-yl)ethan tonkarose -Oile ultravanil -(4-tert-butylphenyl)-3-(4-methoxyphenyl)propane-1,3-dione undecanol methyl 2-(E)-(7-hydroxy-3,7-dimethyloctylidene)aminobenzoate yarayara 65 2-(2-methylphenyl)ethan-1-ol methyl 1,3-dimethylcyclohexane-1-carboxylate 2-phenylethyl 2-hydroxybenzoate

US 8,993,526 B2 49 - Continued

<4 OOs, SEQUENCE: 2 Met Thr Lieu Val Ser Phe Phe Ser Phe Leu Ser Lys Pro Leu. Ile Met 1. 5 1O 15 Lieu. Lieu. Ser Asn. Ser Ser Trp Arg Lieu. Ser Glin Pro Ser Phe Lieu. Lieu. 2O 25 3O Val Gly Ile Pro Gly Lieu. Glu Glu Ser Gln His Trp Ile Ala Leu Pro 35 4 O 45 Lieu. Gly Ile Lieu. Tyr Lieu. Lieu Ala Lieu Val Gly Asn Val Thir Ile Lieu. SO 55 6 O Phe Ile Ile Trp Met Asp Pro Ser Lieu. His Glin Ser Met Tyr Lieu Phe 65 70 7s 8O Lieu. Ser Met Lieu Ala Ala Ile Asp Lieu Val Lieu Ala Ser Ser Thr Ala 85 90 95 Pro Lys Ala Lieu Ala Val Lieu. Lieu Val His Ala His Glu Ile Gly Tyr 1OO 105 11 O Ile Val Cys Lieu. Ile Gln Met Phe Phe Ile His Ala Phe Ser Ser Met 115 12 O 125 Glu Lieu. Gly Val Lieu Val Ala Met Ala Lieu. Asp Cys Tyr Val Ala Ile 13 O 135 14 O Cys His Pro Leu. His His Ser Thr Ile Lieu. His Pro Gly Val Ile Gly 145 150 155 160 Arg Ile Gly Met Val Val Lieu Val Arg Gly Lieu Lleu Lleu Lieu. Ile Pro 1.65 17O 17s Phe Pro Ile Lieu Lieu. Gly. Thir Lieu. Ile Phe Cys Glin Ala Thir Ile Ile 18O 185 19 O Gly His Ala Tyr Cys Glu. His Met Ala Val Val Llys Lieu Ala Cys Ser 195 2OO 2O5 Glu Thir Thr Val Asn Arg Ala Tyr Gly Lieu. Thir Met Ala Lieu. Lieu Val 21 O 215 22O Ile Gly Lieu. Asp Val Lieu Ala Ile Gly Val Ser Tyr Ala His Ile Lieu. 225 23 O 235 24 O Glin Ala Val Lieu Lys Val Pro Gly Ser Glu Ala Arg Lieu Lys Ala Phe 245 250 255 Ser Thr Cys Gly Ser His Ile Cys Val Ile Leu Val Phe Tyr Val Pro 26 O 265 27 O Gly Ile Phe Ser Phe Lieu. Thir His Arg Phe Gly His His Val Pro His 27s 28O 285 His Val His Val Lieu. Leu Ala Thr Arg Tyr Lieu Lleu Met Pro Pro Ala 29 O 295 3 OO Lieu. Asn Pro Lieu Val Tyr Gly Wall Lys Thr Glin Glin Ile Arg Glin Arg 3. OS 310 315 32O Val Lieu. Arg Val Phe Thr Glin Lys Asp 3.25

<210s, SEQ ID NO 3 &211s LENGTH: 954 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 3 atggcaggaa gaatgtctac gttctaatcac acccagttcc atcct tcttic attcc tactg 6 O

Ctgggt at CC Cagggctaga agatgtgcac atttggattg gtgtc. ccttt ttt Ctttgtg 12 O tat cittgttg cacticcitggg aaacactgct citcttgtttgttgatccagac tdagcagagt 18O US 8,993,526 B2 51 52 - Continued citccatgagc ctato tacta citt cotggcc atgttggatt c cattgacct gggcttgtct 24 O acagccacca to CCCaaaat gttgggcatc ttctggttca ataccaaaga aat at Cttitt 3OO ggaggctgcc titt cit cacat gttctt catc catttgttca Ctgctatgga gag cattgttg 360 ttggtggc.ca tggcct ttga cc.gctacatt gcc atttgca aac ct ctitcg gtacaccatg atcCtcacca gcaaaatcat cagcct catt gCagg cattg Ctgtc.ctgag gag cctgtac atggttgttc Cactggtgtt totccttctg aggctg.ccct tctgtgggca tcqtat catc 54 O c ct catact t attgtgagca Catgggcatt catcaaagtic aacattaggit ttggccttgg caa.catat ct citc.ttgttac tggatgttat cott attatt 660 citct cotatg t caggat.cct gtatgctgtc. ttctgcc togc Cct Cotggga agct cqactic 72 O aaagct ct ca acacctgtgg ttct catatt ggtgttatct tagcc tttitt tacaccagoa titt t t t t cat t cittgacaca tcqttittggc CataatlatcC cacagtatat acat attata 84 O ttagccaacc tgtatgtggit tgtc.ccacca gcc ct caatc ctgtaatcta tggagtic agg 9 OO acaaag caga titcgagagag agtgctgagg at t t t t ct ca. agaccaatca Ctaa 954

<210s, SEQ ID NO 4 &211s LENGTH: 317 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 4

Met Ala Gly Arg Met Ser Thr Ser Asn His Thr Glin Phe His Pro Ser 1. 1O 15

Ser Phe Luell Lieu. Lieu. Gly Ile Pro Gly Lieu. Glu Asp Wall His Ile Trp 25

Ile Gly Wall Pro Phe Phe Phe Wall Tyr Lieu Val Ala Lell Luell Gly Asn 35 4 O 45

Thir Ala Luell Lieu. Phe Wall Ile Glin Thr Glu Glin Ser Lell His Glu Pro SO 55 6 O

Met Phe Lieu. Ala Met Lieu. Asp Ser Ile Asp Lell Gly Luell Ser 65 70 7s 8O

Thir Ala Thir Ile Pro Llys Met Leu Gly Ile Phe Trp Phe Asn Thr Lys 85 90 95

Glu Ile Ser Phe Gly Gly Cys Lieu Ser His Met Phe Phe Ile His Phe 105 11 O

Phe Thir Ala Met Glu Ser Ile Wall Lieu Wall Ala Met Ala Phe Asp Arg 115 12 O 125

Ile Ala Ile Cys Llys Pro Lieu. Arg Tyr Thr Met Ile Luell Thir Ser 13 O 135 14 O

Lys Ile Ile Ser Lieu. Ile Ala Gly Ile Ala Wall Lell Arg Ser Leu Tyr 145 150 155 160

Met Wall Wall Pro Leu Wall Phe Lieu. Lieu. Lieu. Arg Lell Pro Phe Cys Gly 1.65 17O 17s

His Arg Ile Ile Pro His Thr Tyr Cys Glu. His Met Gly Ile Ala Arg 18O 185 19 O

Lell Ala Cys Ala Ser Ile Llys Val Asn. Ile Arg Phe Gly Luell Gly Asn 195

Ile Ser Luell Lieu Lleu Lieu. Asp Wall Ile Lieu. Ile Ile Lell Ser Tyr Val 21 O 215

Arg Ile Luell Tyr Ala Val Phe Cys Leul Pro Ser Trp Glu Ala Arg Lieu. 225 23 O 235 24 O US 8,993,526 B2 53 54 - Continued

Lys Ala Lieu. Asn. Thir Cys Gly Ser His Ile Gly Wall Ile Luell Ala Phe 245 250 255

Phe Thr Pro Ala Phe Phe Ser Phe Lieu. Thir His Arg Phe Gly His Asn 26 O 265 27 O

Ile Pro Glin Tyr Ile His Ile Ile Leu Ala Asn Lell Tyr Wall Wall Wall 27s 28O 285

Pro Pro Ala Lieu. Asn Pro Val Ile Tyr Gly Val Arg Thir Glin Ile 29 O 295 3 OO

Arg Glu Arg Val Lieu. Arg Ile Phe Lieu Lys Thr Asn His 3. OS 310 315

<210s, SEQ ID NO 5 &211s LENGTH: 972 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 5 atgagt caca ccaatgttac catct tccat cotgcagttt ttgtcct tcc tggcatc cct 6 O gggttggagg ctitat cacat ttggctgtca atacct ctitt gcct cattta cat cactgca 12 O gtcCtgggaa acagcatcct gat agtggitt attgt catgg aacgtaacct t catgtgcc c 18O atgt atttct tcc tot caat gctggcc.gtc atgga catcc tgctgtctac caccactgtg 24 O cc caaggc cc tagc.catctt ttggcttcaa goa catalaca ttgcttittga tgcctgtgtc. 3OO acccaaggct tctttgtc.ca tatgatgttt gtgggggagt cagctat cot gttagc.catg 360 gCCtttgatc gCtttgttggc catttgttgcc CCaCtgagat atacaac agt gctaa Catgg

Cctgttgttgg ggaggattgc tictggc.cgt.c at Caccc.gaa gctitctgcat Catct tcc.ca gtcatatt ct togctgaag.cg gctg.ccct tc togcct aacca acattgttcc to act CCtac 54 O tgtgagcata ttggagtggc ticgtttagcc ttgctgaca t cactgttaa catttggitat ggcttct cag tdcc.cattgt catggtcatc ttggatgtta t cct catcgc tgttgtc.ttac 660 t cactgat co toccagoagt gtttcqtttg ccctic cc agg atgct cqgca caaggcc ct c 72 O agcacttgttg gct cocacct ctdtgtcatc ctitatgttitt atgttccatc citt citt tacic ttattgaccc at cattttgg gcgtaatatt cotcaacatg to catat citt gctggccaat 84 O ctittatgtgg cagtgccacc aatgctgaac cccattgtct atggtgtgaa gactalagcag 9 OO atacgtgagg gtgtagcc.ca ccggttctitt gaCat Calaga Cttggtgctg tacct cocct 96.O

Ctgggct cat aa 972

<210s, SEQ ID NO 6 &211s LENGTH: 323 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 6

Met Ser His Thir ASn Wall Thir Ile Phe His Pro Ala Wall Phe Wall Lieu 1. 5 1O 15

Pro Gly Ile Pro Gly Lieu. Glu Ala Tyr His Ile Trp Lell Ser Ile Pro 2O 25

Lieu. Cys Lieu. Ile Tyr Ile Thr Ala Val Lieu. Gly Asn Ser Ile Lieu. Ile 35 4 O 45

Val Val Ile Val Met Glu Arg Asn Lieu. His Val Pro Met Phe Phe SO 55 6 O

Lieu. Ser Met Lieu Ala Val Met Asp Ile Lieu. Lieu. Ser Thir Thir Thir Wall US 8,993,526 B2 55 56 - Continued

65 70

Pro Ala Lieu Ala Ile Phe Trp Lieu. Glin Ala His Asn Ile Ala Phe 85 90 95

Asp Ala Val Thr Glin Gly Phe Phe Wal His Met Met Phe Val Gly 105 11 O

Glu Ser Ala Ile Lieu. Lieu. Ala Met Ala Phe Asp Arg Phe Wall Ala Ile 115 12 O 125

Ala Pro Lieu. Arg Tyr Thr Thr Wall Lieu. Thir Trp Pro Wall Val Gly 13 O 135 14 O

Arg Ile Ala Lieu Ala Wall Ile Thr Arg Ser Phe Ile Ile Phe Pro 145 150 155 160

Wall Ile Phe Lieu Lleu Lys Arg Lieu Pro Phe Cys Lell Thir Asn Ile Wall 1.65 17O 17s

Pro His Ser Tyr Cys Glu. His Ile Gly Val Ala Arg Lell Ala Cys Ala 185 19 O

Asp Ile Thir Val Asn Ile Trp Tyr Gly Phe Ser Wall Pro Ile Wal Met 195

Wall Ile Luell Asp Val Ile Lieu. Ile Ala Wal Ser Tyr Ser Luell Ile Lieu. 21 O 215 22O

Arg Ala Wall Phe Arg Lieu Pro Ser Glin Asp Ala Arg His Ala Lieu 225 23 O 235 24 O

Ser Thir Gly Ser His Lieu. Cys Wall Ile Lieu. Met Phe Wall Pro 245 250 255

Ser Phe Phe Thir Lieu Lleu. Thir His His Phe Gly Arg Asn Ile Pro Glin 26 O 265 27 O

His Wall His Ile Lieu. Lieu. Ala Asn Leu Tyr Val Ala Wall Pro Pro Met 27s 285

Lell Asn Pro Ile Val Tyr Gly Val Llys Thir Lys Glin Ile Arg Glu Gly 29 O 295 3 OO

Wall Ala His Arg Phe Phe Asp Ile Lys. Thir Trp Thir Ser Pro 3. OS 310 315 32O

Lell Gly Ser

SEO ID NO 7 LENGTH: 939 TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 7 atggggttgt tdaatgtcac t caccctgca ttct tcc toc tgactggitat CCCtggtctg 6 O gaga.gctict c act cotggct gtcagggc cc Ctctg.cgtga tgtatgctgt ggCCCttggg 12 O ggaaatacag tgatcc tigca gtggagcc.ca gcc to catga gcc catgitac 18O tact tcctgt c catgttgtc citt cagtgat gtggc catat c catggccac actg.cccact 24 O gtact.ccgaa cct tctgcct caatgcc.cgc aaCat Cactt ttgatgcctg tctaatt cag 3OO atgttt citta tt cact tott ctic catgatg gaat Caggta ttctgctggc catgagttitt 360 gaccgctatg tggc.catttg tgacc ccttg cgctatgcag ctgtgct cac cactgaagtic attgctgcaa tgggitt tagg tgcagctgct cgaagct tca t caccottt t coctott coc 48O tt tott atta agaggctgcc tat ctdcaga tccaatgttc titt cit cactic c tact gcctg 54 O cacccagaca tgatgaggct gatat cagta t caacagcat ctatogactic tttgttcttg tat coacct it tgg catggac citgttttitta tott cotctic ctatotgctic 660 US 8,993,526 B2 57 - Continued attctg.cgitt Ctgtcatggc cactgct tcc cgtgaggaac gcct caaagc tict caacaca 72 O tgtgttgtcac at atcc tiggc tgtacttgca titt tatgtgc Caatgattgg ggt ct coaca gtgcaccgct ttgggaagca tgtcc catgc tacatacatg t cct catgtc. aaatgtgtac 84 O ctatttgtgc ctic ctdtgct Calacc Ctectic atttatagog ccalagacaaa ggaaatc.cgc 9 OO cgagccattt tcc.gcatgtt to accacatc. aaaatatga 939

<210s, SEQ ID NO 8 &211s LENGTH: 312 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 8 Met Gly Lieu Phe Asn Val Thr His Pro Ala Phe Phe Leu Lieu. Thr Gly 1. 1O 15

Ile Pro Gly Lieu. Glu Ser Ser His Ser Trp Lieu. Ser Gly Pro Leu. Cys 25 3O

Wall Met Tyr Ala Val Ala Lieu. Gly Gly Asn Thr Wall Ile Lieu. Glin Ala 35 4 O 45

Wall Arg Wall Glu Pro Ser Lieu. His Glu Pro Met Tyr Tyr Phe Leu Ser SO 55 6 O

Met Luell Ser Phe Ser Asp Wall Ala Ile Ser Met Ala Thir Lieu. Pro Thr 65 70 7s 8O

Wall Luell Arg Thr Phe Cys Lieu. Asn Ala Arg Asn Ile Thr Phe Asp Ala 85 90 95

Lieu Ile Gln Met Phe Lieu. Ile His Phe Phe Ser Met Met Gil Ser 105 11 O

Gly Ile Luell Lieu Ala Met Ser Phe Asp Arg Tyr Val Ala Ile Cys Asp 115 12 O 125

Pro Luell Arg Tyr Ala Ala Val Lieu Thir Thr Gul Wall Ile Ala Ala Met 13 O 135 14 O

Gly Luell Gly Ala Ala Ala Arg Ser Phe Ile Thr Leul Phe Pro Leu Pro 145 150 155 160

Phe Luell Ile Lys Arg Lieu Pro Ile Cys Arg Ser Asn. Wall Lieu. Ser His 1.65 17O 17s

Ser Lieu. His Pro Asp Met Met Arg Lieu. Ala Cys Ala Asp Ile 185 19 O

Ser Ile Asn Ser Ile Tyr Gly Lieu Phe Wall Lieu. Val Ser Thr Phe Gly 195 2O5

Met Asp Luell Phe Phe Ile Phe Lieu. Ser Tyr Val Lieu. Ile Lieu. Arg Ser 21 O 215 22O

Wall Met Ala Thir Ala Ser Arg Glu Glu Arg Lieu. Lys Ala Lieu. Asn Thr 225 23 O 235 24 O

Wall Ser His Ile Lieu Ala Val Lieu Ala Phe Tyr Val Pro Met Ile 245 250 255

Gly Wall Ser Thr Val His Arg Phe Gly Llys His Val Pro Cys Tyr Ile 26 O 265 27 O

His Wall Luell Met Ser Asn Val Tyr Lieu. Phe Wall Pro Pro Wall Lieu. Asn 28O 285

Pro Luell Ile Tyr Ser Ala Lys Thr Lys Glu Ile Arg Arg Ala Ile Phe 29 O 295 3 OO

Arg Met Phe His His Ile Lys Ile 3. OS 310 US 8,993,526 B2 59 - Continued

SEO ID NO 9 LENGTH: 927 TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 9 atgaatacca citctatttica t cott act ct ttcottct to tgggaattic C tgggctggala 6 O agtatgcatc tctgggttgg ttt toott to tittgctgtgt tcc tigacagc tgtcCttggg 12 O aatlatcacca toctittttgt gattcagact gacagtagt c to CatcatCC catgttctac 18O titcc toggc.ca ttctgtcatc tattgaccc.g ggcctgtcta Cat CCaC cat c cctaaaatg 24 O cittggcacct tctggtttac Cctgagagaa atctoctittg aaggatgcct tacccagatg 3OO t tott catcc. acctgtgcac tgg catggaa t cagctgtgc ttgttggc cat ggcct atgat 360 tgctatgtgg c catctgtga ccctcitttgc tacacgttgg tgctgacaaa Caaggtggtg t cagtt atgg cactggcc at Ctttctgaga c cct tagt ct ttgtcat acc Ctttgttcta tittatcCtaa ggct tccatt ttgttggacac Calaattatto Ctcat actta cggtgagcac 54 O atgggcattg ccc.gc.ctgtc ttgttgc.ca.gc at Cagggitta a catcatCta tggct tatgt gccatctota tcc tiggtc.tt tgacat cata gcaattgtca titt cotatgt acagatccitt 660 tgtgctgt at t to tactic to ttcacatgat gcacgactica aggcatt cag Cacctgtggc 72 O t ct catgtgt gtgtcatgtt gactittctat atgcctgcat tgttct catt catgacc cat aggtttggtc ggaatatacc t cact titatic cacattct to tggctaattit Ctgtgtagt c 84 O attic cacctg Ctect caactic tgtaattitat ggtgtcagaa c caaacagat tagagcacala 9 OO gtgctgaaaa tgtttittcaa taaataa. 927

<210s, SEQ ID NO 10 &211s LENGTH: 3O8 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 10

Met Asn. Thir Thir Lieu. Phe His Pro Tyr Ser Phe Lell Lell Luell Gly Ile 1. 5 1O 15

Pro Gly Luell Glu Ser Met His Lieu. Trp Val Gly Phe Pro Phe Phe Ala 25

Wall Phe Luell Thir Ala Val Lieu. Gly Asn. Ile Thr Ile Lell Phe Wall Ile 35 4 O 45

Glin Thir Asp Ser Ser Lieu. His His Pro Met Phe Tyr Phe Luell Ala Ile SO 55 6 O

Lell Ser Ser Ile Asp Pro Gly Lieu. Ser Thir Ser Thir Ile Pro Lys Met 65 70 7s 8O

Lell Gly Thir Phe Trp Phe Thr Lieu Arg Glu Ile Ser Phe Glu Gly Cys 85 90 95

Lell Thir Glin Met Phe Phe Ile His Lieu. Cys Thr Gly Met Glu Ser Ala 105 11 O

Wall Luell Wall Ala Met Ala Tyr Asp Cys Tyr Val Ala Ile Asp Pro 115 12 O 125

Lell Cys Thir Lieu. Wall Lieu. Thir Asn Llys Val Wall Ser Wall Met Ala 13 O 135 14 O

Lell Ala Ile Phe Lieu. Arg Pro Lieu Wall Phe Wall Ile Pro Phe Wall Lieu 145 150 155 160

Phe Ile Luell Arg Lieu Pro Phe Cys Gly His Glin Ile Ile Pro His Thr 1.65 17O 17s US 8,993,526 B2 61 62 - Continued

Gly Glu His Met Gly Ile Ala Arg Lieu. Ser Cys Ala Ser Ile Arg 18O 185 19 O

Wall Asn Ile Ile Tyr Gly Lieu. Cys Ala Ile Ser Ile Lell Wall Phe Asp 195

Ile Ile Ala Ile Val Ile Ser Tyr Wall Glin Ile Lell Ala Wall Phe 21 O 215

Lell Luell Ser Ser His Asp Ala Arg Lieu Lys Ala Phe Ser Thir 225 23 O 235 24 O

Ser His Wall Cys Val Met Lieu. Thr Phe Tyr Met Pro Ala Luell Phe Ser 245 250 255

Phe Met Thir His Arg Phe Gly Arg Asn. Ile Pro His Phe Ile His Ile 26 O 265 27 O

Lell Luell Ala Asin Phe Cys Val Val Ile Pro Pro Ala Lell Asn Ser Wall 285

Ile Tyr Gly Val Arg Thr Lys Glin Ile Arg Ala Glin Wall Luell Lys Met 29 O 295 3 OO

Phe Phe Asn 3. OS

SEQ ID NO 11 LENGTH: 945 TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 11 atgc.cgaCat it caatggctic agt Ctt Catg CCCtctg.cgt. ttatactaat tgggatt CCt 60 ggtctggagt Cagtgcagtg ttggattggg att cott tot ctgccatgta t cittattggit 12 O gtgattggaa att CCCtaat tittagittata atcaaatatg aaaacagcct CCatataccC 18O atgtacattt ttittggcc at gttggcagcc acaga cattg CaCttalacac ctgcatt citt 24 O cc caaaatgt taggcatctt ctggttt cat ttgc.ca.gaga tttcttittga tgcctgtc.tt 3OO tittcaaatgt ggct tatt ca ct cattccag gcaattgaat cgggt at CCt tctggcaatg 360 gccCtggatc gctatgtggc catctgtatic c ccttgagac atgccaccat cittitt cocag cagttcttaa ct catattgg acttggggtg acact caggg ctgcc attct tataatacct t cct tagggc t catcaaatg ctgtctgaaa cactatogaa ctacagt cat citct cact ct 54 O tact.gtgagc acatggcc at cgtgaagctg gct actgaag at atc.cgagt caacaagata tatggccitat ttgttgccitt tgcaatcc ta gggtttgaca taatlattitat aac Cttgtc.c 660 tatgtc.caaa titt titat cac tgtctitt cag ctgc.cccaga aggaggcacg attcaaggcc 72 O tittaataCat gcattgcc.ca catttgttgtc titcct acagt to tacct tot tgcctitcttic tott tott ca. cacacaggitt tggttcacac attaccaccat a tatt Catat cct cittgtca 84 O aatctttacC tgttagt ccc acct t t t c to aac cc tattg tctatggagt gaagaccalag 9 OO caaatt cqtg accatattgt gaaagttgttt ttcttcaaaa. agtaa 945

<210s, SEQ ID NO 12 &211s LENGTH: 314 212. TYPE : PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 12 Met Pro Thr Phe Asn Gly Ser Val Phe Met Pro Ser Ala Phe Ile Leu 1. 5 15 US 8,993,526 B2 63 64 - Continued

Ile Gly Ile Pro Gly Lieu. Glu Ser Val Glin Cys Trp Ile Gly Ile Pro 25 3O

Phe Ser Ala Met Tyr Lieu. Ile Gly Val Ile Gly Asn Ser Luell Ile Lieu. 35 4 O 45

Wall Ile Ile Llys Tyr Glu Asn. Ser Lieu. His Ile Pro Met Ile Phe SO 55 6 O

Lell Ala Met Lieu Ala Ala Thr Asp Ile Ala Lieu. Asn Thir Ile Lieu. 65 70 7s 8O

Pro Met Leu Gly Ile Phe Trp Phe His Lieu. Pro Glu Ile Ser Phe 85 90 95

Asp Ala Leu Phe Gln Met Trp Lieu. Ile His Ser Phe Glin Ala Ile 105 11 O

Glu Ser Gly Ile Lieu. Lieu. Ala Met Ala Lieu. Asp Arg Tyr Wall Ala Ile 115 12 O 125

Ile Pro Lieu. Arg His Ala Thr Ile Phe Ser Glin Glin Phe Lieu. Thir 13 O 135 14 O

His Ile Gly Lieu. Gly Val Thr Lieu Arg Ala Ala Ile Lell Ile Ile Pro 145 150 155 160

Ser Luell Gly Lieu. Ile Llys Cys Cys Lieu Lys His Arg Thir Thir Wall 1.65 17O 17s

Ile Ser His Ser Tyr Cys Glu. His Met Ala Ile Wall Luell Ala Thr 18O 185 19 O

Glu Asp Ile Arg Val Asn Lys Ile Tyr Gly Lieu. Phe Wall Ala Phe Ala 195

Ile Lieu Gly Phe Asp Ile Ile Phe Ile Thr Lieu. Ser Wall Glin Ile 21 O 215 22O

Phe Ile Thir Wall Phe Glin Leu Pro Gln Lys Glu Ala Arg Phe 225 23 O 235 24 O

Phe Asn Thir Cys Ile Ala His Ile Cys Val Phe Lell Glin Phe Tyr Lieu. 245 250 255

Lel Ala Phe Phe Ser Phe Phe Thr His Arg Phe Gly Ser His Ile Pro 26 O 265 27 O

Ile His Ile Lieu Lleu Ser Asn Lieu. Tyr Lell Lell Wall Pro Pro 28O 285

Phe Luell Asn Pro Ile Val Tyr Gly Val Lys Thr Lys Glin Ile Arg Asp 29 O 295 3 OO

His Ile Wall Llys Val Phe Phe Phe 3. OS 310

SEQ ID NO 13 LENGTH: 942 TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 13 atgacattac cca.gcaacaa citc. cact tcc. c cagt ctittg aat tott cott catttgttt c 6 O cc.cagttt co agagctggca gCactggctg totctg.cccc t cago: ct cot citt cotcctg 12 O gccatggggg c caatgccac c ctitctgatc acCatctato tggaa.gc.ctic tctgcaccag 18O cc cctd tact acctgcticag c ct cost ct co Ctgctggaca tcqtact citg cct caccgt.c 24 O atc.cccaagg tcc tiggcc at cittctggttt gacct cagat caatcagctt c cctdcctgc 3OO titcc titcaga tgttcatcat gaacagttitt Ctgactatgg agt cctdcac att catgat c 360 atggcc tatg accoctatgt ggc catctgc aagcc cctac agtact catc CatCatcact US 8,993,526 B2 65 - Continued gatcaatttg ttgctagggc tigc catctitt gttgttggc.ca ggaatggcct tct tact atg

CCtatic Coca tactitt ctitc. tcgacticaga tactgtgcag gacacat cat Caagaactgc 54 O atctgtacta acgtgtctgt gtctaaactic tcttgttgatg a catcaccitt gaatcagagc taccagtttg ttataggttg gaccctgctg ggctctgacc t cat cott at tgttctotct 660 tact t t t t ta. tcttgaaaac ttgctaagg attalagggtg agggagatat ggccaaagct 72 O c tagg tactt gtggttcc.ca citt catcc to at cost cit tot t caccacagt Cctgctggitt ctgg to atca Cta acctggC Caggalagaga att cotc.cgg atgtc.cc cat cctgct caac 84 O atcc tdcacc acct tatt co cccagctctg aac cc cattg tittatggtgt gagaac Caag 9 OO gagatcaa.gc agggaatcca galacctgctg aagaggttgt a.a. 942

SEQ ID NO 14 LENGTH: 313 TYPE : PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 14

Met Thir Lieu. Pro Ser Asn. Asn. Ser Thir Ser Pro Wall Phe Glu Phe Phe 1. 5 1O 15

Lell Ile Cys Phe Pro Ser Phe Glin Ser Trp Gln His Trp Luell Ser Luell 2O 25

Pro Luell Ser Lieu. Luell Phe Lieu. Lieu. Ala Met Gly Ala Asn Ala Thir Lieu. 35 4 O 45

Lell Ile Thir Ile Tyr Lieu. Glu Ala Ser Lieu. His Glin Pro Luell Tyr Tyr 50 55 60

Lell Luell Ser Lieu. Luell Ser Lieu. Luell Asp Ile Val Lell Luell Thir Wall 65 70 7s 8O

Ile Pro Wall Lieu. Ala Ile Phe Trp Phe Asp Lell Arg Ser Ile Ser 85 90 95

Phe Pro Ala Cys Phe Leul Glin Met Phe Ile Met Asn Ser Phe Lieu. Thir 1OO 105 11 O

Met Glu Ser Cys Thr Phe Met Ile Met Ala Tyr Asp Arg Wall Ala 115 12 O 125

Ile Cys Pro Leu. Gln Tyr Ser Ser Ile Ile Thir Asp Glin Phe Wall 13 O 135 14 O

Ala Arg Ala Ala Ile Phe Wal Wall Ala Arg Asn Gly Lell Luell Thir Met 145 150 155 160

Pro Ile Pro Ile Lieu. Ser Ser Arg Lieu. Arg Tyr Ala Gly His Ile 1.65 17O 17s

Ile Asn Cys Ile Cys Thr Asn Wall Ser Wall Ser Luell Ser Cys 18O 185 19 O

Asp Asp Ile Thir Lieu. ASn Glin Ser Tyr Glin Phe Wall Ile Gly Trp Thr 195 2OO 2O5

Lell Luell Gly Ser Asp Lieu. Ile Lieu. Ile Wall Lieu. Ser Phe Phe Ile 21 O 215 22O

Lell Thir Wall Lieu. Arg Ile Llys Gly Glu Gly Asp Met Ala Lys Ala 225 23 O 235 24 O

Lell Gly Thir Ser His Phe Ile Lieu. Ile Lell Phe Phe Th Thr 245 250 255

Wall Luell Luell Wall Lieu. Wall Ile Thr Asn Lieu Ala Arg Arg Ile Pro 26 O 265 27 O

Pro Asp Wall Pro Ile Lieu. Luell Asn Ile Lieu. His His Lell Ile Pro Pro 27s 28O 285 US 8,993,526 B2 67 68 - Continued

Ala Lieu. Asn. Pro Ile Val Tyr Gly Val Arg Thr Lys Glu Ile Lys Glin 29 O 295 3 OO Gly Ile Glin Asn Lieu Lleu Lys Arg Lieu. 3. OS 310

SEO ID NO 15 LENGTH: 7 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide FEATURE: OTHER INFORMATION: N-term Act FEATURE: OTHER INFORMATION: C-term NH2

SEQUENCE: 15 Phe Llys Llys Ser Phe Llys Lieu. 1. 5

SEQ ID NO 16 LENGTH: 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

SEQUENCE: 16 Arg Arg Lieu. Ile Glu Asp Ala Glu Tyr Ala Ala Arg Gly 1. 5

SEO ID NO 17 LENGTH: 5 TYPE PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 17 Phe Ile Lieu. Lieu. Gly 1. 5

SEQ ID NO 18 LENGTH: 6 TYPE PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 18 Lieu. His Thr Pro Met Tyr 1. 5

SEQ ID NO 19 LENGTH: 10 TYPE PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 19 Met Ala Tyr Asp Arg Tyr Val Ala Ile Cys 1. 5

SEQ ID NO 2 O LENGTH: 2 TYPE PRT ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 2O US 8,993,526 B2 69 70 - Continued

Ser Tyr

SEQ ID NO 21 LENGTH: 7 TYPE PRT ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 21 Phe Ser Thr Cys Ser Ser His 1. 5

<210s, SEQ ID NO 22 &211s LENGTH: 6 212. TYPE: PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 22

Pro Met Lieu. Asn. Pro Phe 1. 5

The invention claimed is: 25 4. The method according to claim 1, wherein said agent is 1. A method for counteracting the perception of Sweat tested for decreasing the binding of pentanoic acid to malodour in a Subject, comprising identifying an agent that OR52L1, or for decreasing the activation of OR52L1 by decreases the function of one or more Olfactory Receptor pentanoic acid. polypeptide(s) (ORS) selected from the group consisting of 30 5. The method according to claim 1, wherein said agent is OR52L1, OR52E8, OR52B2, OR51I2, OR52E1, OR52A5 tested for decreasing the binding of 3-hydroxy-3-methylhex and OR56A5 comprising the steps of anoic acid to OR52E8, or for decreasing the activation of a) contacting said one or more ORS with one or more OR52E8 by 3-hydroxy-3-methylhexanoic acid. carboxylic acid(s) selected from the group of consisting 6. The method according to claim 1, wherein said agent is of butanoic acid, isovaleric acid, pentanoic acid, hex 35 tested for decreasing the binding of hexanoic acid, heptanoic anoic acid, 2-methylhexanoic acid, 3-methylhexanoic acid, octanoic acid, nonanoic acid, decanoic acid, or unde acid, (E)-3-methly-2-hexenoic acid, 3-hydroxy-3-meth canoic acid to OR52B2, or for decreasing the activation of ylhexanoic acid, heptanoic acid, 2-methylheptanoic OR52B2 by hexanoic acid, heptanoic acid, octanoic acid, acid, octanoic acid, 4-ethyloctanoic acid, nonanoic acid, nonanoic acid, decanoic acid, or undecanoic acid. decanoic acid, undecanoic acid and benzoic acid, in the 40 7. The method according to claim 1, wherein said agent is presence and in the absence of said agent under condi tested for decreasing the binding ofbutanoic acid, isovaleric tions permitting the binding of said carboxylic acid(s) to acid, pentanoic acid, hexanoic acid, 2-methylhexanoic acid, said ORS or permitting the activation of said ORs by said 3-methylhexanoic acid, (E)-3-methyl-2-hexanoic acid, or carboxylic acid(s), benzoic acid to OR51I2, or for decreasing the activation of b) comparing the binding of said one or more ORS to said 45 OR51I2 by butanoic acid, isovaleric acid, pentanoic acid, one or more carboxylic acid(s), or the activity of said one hexanoic acid, 2-methylhexanoic acid, 3-methylhexanoic or more ORs, in the presence and in the absence of said acid, (E)-3-methyl-2-hexanoic acid, or benzoic acid. agent, wherein a decrease in binding or activity in the 8. The method according to claim 1, wherein said agent is presence of said agent, relative to the binding or activity tested for decreasing the binding ofbutanoic acid to OR52E1, in the absence of the agent, identifies the agent as an 50 or for decreasing the activation of OR52E1 by butanoic acid. agent that modulates the function of said one or more 9. The method according to claim 1, wherein said agent is ORS in response to said one or more carboxylic acid(s): tested for decreasing the binding of 4-ethyloctanoic acid to and OR52A5, or for decreasing the activation of OR52A5 by administering the agent to the Subject, thereby reducing the 55 4-ethyloctanoic acid. function of said one or more ORS and counteracting the 10. The method according to claim 1, wherein said agent is perception of Sweat malodour. tested for decreasing the binding of hexanoic acid, heptanoic 2. The method according to claim 1, wherein said agent is acid, 2-methylheptanoic acid, octanoic acid, nonanoic acid, tested for decreasing the binding of said carboxylic acids to decanoic acid, or undecanoic acid to OR56A5, or for decreas all 7 ORs listed therein, or for decreasing the activation of all 60 ing the activation of OR56A5 by hexanoic acid, heptanoic 7 ORs listed therein by said carboxylic acids. acid, 2-methylheptanoic acid, octanoic acid, nonanoic acid, 3. The method according to claim 1, wherein said agent is decanoic acid, or undecanoic acid. tested for decreasing the binding of said carboxylic acids to 11. The method according to claim 1, wherein said one or all members of the group of 6 ORS consisting of: OR52L1, more OR polypeptides is defined by the amino acid sequence OR52E8, OR52B2, OR52E1, OR52A5 and OR56A5, or for 65 of SEQID NOS. 2, 4, 6, 8, 10, 12 or 14. decreasing the activation of all 6 ORs of said group by said 12. The method according to claim 1, wherein said one or carboxylic acids. more carboxylic acid(s) may be detectably labeled with a US 8,993,526 B2 71 72 moiety selected from the group comprising: a radioisotope, a 22. The method according to claim 1, wherein said agentis fluorophore, and a quencher of fluorescence. selected from the group consisting of a peptide, a polypep 13. The method according to claim 1, wherein said agent is tide, an antibody orantigen-binding fragment thereof, a lipid, present in a sample. a carbohydrate, a nucleic acid, and a small organic molecule. 14. The method according to claim 1, in which said one or 23. The method according to claim 1, wherein said step of more OR polypeptide(s) is contacted with said one or more comparing an activity of the OR(S) comprises detecting a carboxylic acid(s) at their ECso concentration. change in the level of a second messenger. 15. The method according to claim 1, wherein said agent is 24. The method according to claim 1, wherein said step of identified as an agent that modulates the function of ORS comparing an activity of the ORS comprises measurement of according to the invention, when said agent decreases the 10 intracellular response induced by said carboxylic acid(s), by guanine nucleotide binding/coupling or exchange, adenylate at least 10%. cyclase activity, cAMP, Protein Kinase C activity, Protein 16. The method according to claim 1, wherein the contact Kinase A activity phosphatidylinosotol breakdown, diacylg ing is performed in or on a cell expressing said OR polypep lycerol, inositol triphosphate, intracellular calcium, calcium tide. 15 flux, arachidonic acid, MAP kinase activity, tyrosine kinase 17. The method according to claim 1, wherein said cell may activity, melanophore assay, receptor initialization assay, or be selected from: Human embryonic kidney cells (Hek293), reporter gene expression. Chinese hamster cells (CHO), Monkey cells (COS), primary 25. The method according to claim 1, wherein said step of olfactory cells, Xenopus cells, insect cells, yeast or bacteria. comparing the activity of the ORS comprises using a fluores 18. The method according to claim 1, wherein said con cence or luminescence assay. tacting is performed in or on synthetic liposomes or virus 26. The method according to claim 25, wherein said fluo induced budding membranes containing an OR polypeptide. rescence and luminescence assays comprise the use of Ca"- 19. The method according to claim 1, wherein said method sensitive fluorophores including Fluo3, Fluo4 or Fura: Ca3 is performed using a membrane fraction from cells express kit family or aequorin. ing said OR polypeptide. 25 27. The method according to claim 25 or 26, wherein said 20. The method according to claim 1, wherein said method assays may apply an automated fluorometric or luminescent is performed on a protein chip. reader Such as FUSS or FLIPR. 21. The method according to claim 1, wherein said mea 28. The method according to claim 1, which is a high Suring is performed using a method selected from label dis throughput Screening method. placement, Surface plasmon resonance, fluorescence reso 30 29. The method according to claim 1, wherein the agent is nance energy transfer, fluorescence quenching, and part of a chemical library or animal organ extracts. fluorescence polarization. k . . . . UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 8,993,526 B2 Page 1 of 1 APPLICATIONNO. : 13/916282 DATED : March 31, 2015 INVENTOR(S) : Pierre Chatelain et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

In the Claims

Col. 72, line 26, replace the term “FUSS' with the term — FDSS — so as to read - reader Such as FDSS or FLIPR.

Signed and Sealed this Seventeenth Day of November, 2015 74-4-04- 2% 4 Michelle K. Lee Director of the United States Patent and Trademark Office