Putrescine Promotes Betulin Accumulation in Suspension Cell Cultures of Betula Platyphylla by + Regulating NO and NH4 Production

Home , Putrescine

Article Putrescine Promotes Betulin Accumulation in Suspension Cell Cultures of Betula platyphylla by + Regulating NO and NH4 Production

Guizhi Fan † , Tingting Zhang, Yingtian Liu, Yaguang Zhan † and Baojiang Zheng * Key Laboratory of Saline-Alkali Vegetation Ecology Restoration, Ministey of Education, Northeast Forestry University, Harbin 150040, China; [email protected] (G.F.); [email protected] (T.Z.); [email protected] (Y.L.); [email protected] (Y.Z.) * Correspondence: [email protected] These two authors contribute equally to this work. † Received: 6 November 2020; Accepted: 3 December 2020; Published: 16 December 2020

Abstract: Putrescine (Put) can enhance secondary metabolite production, but its intrinsic regulatory mechanism remains unclear. In this study, Put treatment promoted betulin production and gene expression of lupeol synthase (LUS), one of betulin synthetic enzymes. The maximum betulin content and gene expression level of LUS was 4.25 mg g 1 DW and 8.25 at 12 h after 1 mmol L 1 · − · − Put treatment, approximately two- and four-times that in the control, respectively. Put treatment increased the content of nitric oxide (NO) and its biosynthetic enzyme activity of nitrate reductase (NR) and NO synthase (NOS). Pretreatment of the birch suspension cells with NO-speciﬁc scavenger 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline- 1-oxyl-3-oxide (cPTIO), NR inhibitor sodium G azide (NaN3), and NOS inhibitor N -nitro-L-Arg methyl ester (L-NAME) decreased Put-triggered NO generation and blocked Put-induced betulin production. Put treatment improved the content + of NH4 and its assimilation enzyme activity of glutamate synthase and glutamate dehydrogenase. + NH4 supplementation also promoted NO and betulin production. Thus, the above data indicated + that Put-induced NO was essential for betulin production. NO derived from NR, NOS, and NH4 mediated betulin production in birch suspension cell cultures under Put treatment.

+ Keywords: Betula platyphylla; putrescine; nitric oxide; NH4 ; betulin

1. Introduction Polyamines (PAs), including putrescine (Put), spermidine (Spd), and spermine (Spm), are low-molecular-weight aliphatic polycations that are quite common in living organisms [1]. Put is the major diamine in plants and a direct substrate for the synthesis of Spd and Spm [2]. PAs have been suggested to play important roles in morphogenesis, growth, embryogenesis, organ development, leaf senescence, and abiotic and biotic stress responses [3,4]. Besides the above roles, PAs also regulate various fundamental cellular processes as signaling molecules [5]. The major links in PA signaling may be hydrogen peroxide (H2O2) and nitric oxide (NO) [6,7]. NO is considered to cause the groundbreaking bioactive signaling described in plants [8]. Like PAs, NO also participates in various cell processes such as growth and development, respiratory metabolism, senescence, and maturation, as well as plant response to abiotic and biotic stressors [8,9]. Nitric oxide synthase (NOS) and nitrate reductase (NR) are known as two major sources of NO production in plants [10]. Moreover, NO is also produced via nonenzymatic pathways, such as NO induced by the + presence of hydrogen sulﬁde, abscisic acid, PAs, and ammonium cation (NH4 )[11,12]. Recent studies have indicated that PA-induced NO biosynthesis might be a potential linking signal in many of the developmental processes and stress responses in plants. Such as, Put and Spd stimulated

Forests 2020, 11, 1336; doi:10.3390/f11121336 www.mdpi.com/journal/forests Forests 2020, 11, x FOR PEER REVIEW 2 of 10 stimulated arginine-dependent NO formation during dormancy release and germination of apple embryos [13]. NR is known as one of the major sources of NO production, and NO and NH4+ are all productForests 2020s of, 11 ,NR 1336 [14]. However, the role of NR, NO, and NH4+ induced by PAs in plants is poorly2 of 10 understood. Plant cell culture offers a good alternative to whole-plant collection for the production of arginine-dependent NO formation during dormancy release and germination of apple embryos [13]. bioactive secondary metabolites under controlled and reproducible protocols. Many strategies have NR is known as one of the major sources of NO production, and NO and NH + are all products of been used to increase the secondary metabolite production in plant cell cultures,4 e.g., elicitation, NR [14]. However, the role of NR, NO, and NH + induced by PAs in plants is poorly understood. precursor feeding, and nutritional supplement 4[15,16]. One such bioactive secondary metabolite is Plant cell culture oﬀers a good alternative to whole-plant collection for the production of bioactive botulin, which is extracted from the bark of white birch trees (Betula platyphylla); one of the pentacyclic secondary metabolites under controlled and reproducible protocols. Many strategies have been used to triterpene compounds, lupeol synthase (LUS), is mainly responsible for betulin biosynthesis through increase the secondary metabolite production in plant cell cultures, e.g., elicitation, precursor feeding, the MVA (mevalonate) pathway. Betulin is a valuable metabolite with antiviral, antibacterial, and and nutritional supplement [15,16]. One such bioactive secondary metabolite is botulin, which is antitumor properties [17]. In our previous study, betulin was detected in birch cell suspension extracted from the bark of white birch trees (Betula platyphylla); one of the pentacyclic triterpene cultures and plantlets; PAs or NO induced betulin accumulation [18,19]. However, the regulatory compounds, lupeol synthase (LUS), is mainly responsible for betulin biosynthesis through the MVA mechanism of PAs or NO in betulin biosynthesis of birch suspension cells remains elusive. The aim (mevalonate) pathway. Betulin is a valuable metabolite with antiviral, antibacterial, and antitumor of the present study is to determine the response of NO and NH4+ to Put in betulin production and properties [17]. In our previous study, betulin was detected in birch cell suspension cultures and investigate NH4+ assimilation and the sources of NO in betulin production induced by Put. plantlets; PAs or NO induced betulin accumulation [18,19]. However, the regulatory mechanism of 2.PAs Results or NO in betulin biosynthesis of birch suspension cells remains elusive. The aim of the present + + study is to determine the response of NO and NH4 to Put in betulin production and investigate NH4 2.1.assimilation Put Enhanced and Betulin the sources Production of NO in betulin production induced by Put.

2. ResultsTo improve betulin content in birch cell suspension cultures, the induced effect of 0.1, 1, and 5 mmol·L-1 Put on betulin production was used for analysis. Figure 1A shows that betulin production in2.1. birch Put Enhancedsuspension Betulin cells Productioninduced by Put is time-dependent and dose-dependent. Betulin content peakedTo at improve 12 h after betulin 0.1, 1, contentand 5 mmol·L in birch-1 Put cell treatment suspensions, which cultures, were 51.89%, the induced 139.23%, eﬀect and of 55.69% 0.1, 1, higherand 5 than mmol thoseL 1 ofPut the on control, betulin respectively. production In was addition, used for5 m analysis.mol·L−1 Put Figure treatment1A shows decreased that betulinbetulin · − contentproduction at 24 inand birch 48 h, suspensionwhich were cells15.81% induced and 20.21% by Putlower is than time-dependent those of the control, and dose-dependent. respectively. BetulinBetulin content is a lupane peaked-type at 12 triterpene h after 0.1,; one 1, of and its 5synthetic mmol L key1 Put enzyme treatments,s is lupeol which synthase were 51.89%, (LUS) · − [19]139.23%,. Figure and 1B 55.69%shows that higher the thangenethose expression of the of control, LUS ha respectively.s the same varying In addition, tendenc 5y mmol with Lbetulin1 Put · − contenttreatment in the decreased suspension betulin cell contents of birch at 24 treated and 48 with h, which Put; the were maximum 15.81% and gene 20.21% expression lower level than thoseof LUS of wasthe control,8.25 at 12 respectively. h after 1 mmol·L−1 Put treatment, approximately four times that of the control.

6 control 10 control ） 0.1mmol/L a 0.1mmol/L 1mmol/L 1mmol/L DW a

1 5mmol/L 5mmol/L

- 8 b L

• b 4 c

mg 6 c c c c c cd （ d cd d d d cd d d d d d d d 4 d d d d e d de e

2 LUS of level ef ef e e ef ef

Relative expression expression Relative 2 f f Betulin content Betulin 0 0 3 6 12 24 48 3 6 12 24 48 A B Time of treatment(h) Time of treatment(h) Figure 1. Effect of putrescine (Put) on betulin production and gene expression of lupeol synthase (LUS) Figure 1. Effect of putrescine (Put) on betulin production and gene expression of lupeol synthase1 in suspension cells of birch. Eight-day-old suspension cells were treated with 0.1, 1, and 5 mmol L− (LUS) in suspension cells of birch. Eight-day-old suspension cells were treated with 0.1, 1, and· 5 Put and harvested at the indicated time points after treatment. Suspension cells treated with the same mmol·L-1 Put and harvested at the indicated time points after treatment. Suspension cells treated with volume of distilled water were used as controls. Different letters show significant differences among the same volume of distilled water were used as controls. Different letters show significant differences means (p < 0.05, Tukey’s test); the following figures are the same. (A), betulin content in suspension among means (p < 0.05, Tukey’s test); the following figures are the same. (A), betulin content in cells of birch; (B), gene expression of LUS in suspension cells of birch. suspension cells of birch; (B), gene expression of LUS in suspension cells of birch. Betulin is a lupane-type triterpene; one of its synthetic key enzymes is lupeol synthase (LUS) [19]. Figure1B shows that the gene expression of LUS has the same varying tendency with betulin content in the suspension cells of birch treated with Put; the maximum gene expression level of LUS was 8.25 at 12 h after 1 mmol L 1 Put treatment, approximately four times that of the control. · −

Forests 2020, 11, 1336 3 of 10 Forests 2020, 11, x FOR PEER REVIEW 3 of 10

2.2.2.2. Put Put InducedInduced NONO ProductionProduction NONO production production inin birchbirch suspension cells cells was was examined examined using using the the Greiss Greiss reagent reagent assay assay kit kit and and a afluorometric fluorometric method method.. Fig Figureure 2A2A show showss the the time time course course of of NO NO generation generation in in a a medium of of birch suspension cells treated with 0.1, 1, and 5 mmol·L−1 1Put. NO content peaked at 9 h after 0.1 or 1 suspension cells treated with 0.1, 1, and 5 mmol L− Put. NO content peaked at 9 h after 0.1 or −1 −1 · 1m mmolmol·LL Put1 Put treatment, treatment, 18 18h after h after 5 m 5mol mmol·L LPut1 Puttreatment, treatment, approximately approximately 4-, 8- 4-,, and 8-, 13 and-times 13-times that · − · − thatin the in thecontrol, control, respectively. respectively. NO NO fluorescence fluorescence intensity intensity in suspension in suspension cells cells after after Put Put treatment treatment had had a asimilar similar change change tendency tendency to to NO NO content content in in medium medium of of birch birch suspension suspension cells cells (Fig (Figureure 22B)B),, and the −1 maximummaximum fluorescence fluorescenceintensity intensity waswas alsoalso atat 99 hh afterafter 11 mmolmmol·L 1PutPut treatment treatment (Fig (Figureure 22C).C). · −

14 control 0.1mmol/L 1200 control 0.1mmol/L 12 1mmol/L 5mmol/L 1mmol/L 5mmol/L a a ab a a 900 b ab 10 b bc bc 8 c

M inmedium)M c d d μ d 600 d 6 e e e h ef f ef ef ef 4 fg f f gh g intensity Fluorescence 300 f f f gh g gh gh f f f f f hgh h ggh g 2 h h h h h h h h h g g g g g g g g NO content ( contentNO 0 0 0.5h 3h 6h 9h 12h 18h 24h 48h 0.5h 3h 6h 9h 12h 18h 24h 48h Time of treatment (h) B Time of treatment (h) A

Figure 2. Effect of Put on nitric oxide (NO) generation in suspension cells of birch. (A), NO content in cultureFigure medium 2. Effect ofof birch;Put on (B nitric), NO oxide fluorescence (NO) generation intensity inin suspensionsuspension cellscells of of birch; birch (. C(A),) NO, NO fluorescence content in 1 intensity in suspension cells after 1 mmol L Put treatment (C1, Control; C2, 3 h after Put treatment; culture medium of birch; (B), NO fluorescence· − intensity in suspension cells of birch; (C), NO Cfluorescence3, 9 h after Put intensity treatment; in suspensionC4, 12 h cells after after Put treatment;1 mmol·L−1 CPut5, 24treatment h after ( PutC1, Control; treatment; C2,C 36 h, 48after h afterPut Puttrea treatment).tment; C3, 9 h after Put treatment; C4, 12 h after Put treatment; C5, 24 h after Put treatment; C6, 48 h after Put treatment). NR and NOS are the two NO-generating key enzymes in plants [10]. Figure3 shows that the enzymeNR activity and NOS of NR are and the NOStwo NO of the-generating birch suspension key enzymes cells induced in plant bys [10] Put. wasFigure also 3 time-dependentshows that the andenzyme dose-dependent. activity of NRPut treatment and NOS increased of the birch the enzyme suspension activity cells of inducedNR and NOS. by Put NR was enzyme also activity time- 1 peakeddependent at 6 andand 12dose h after-dependent. 5 and 1 mmolPut treatmentL− Put treatment,increased the which enzyme was4.4-fold activityand of NR 3.8-fold and NOS. that of NR the · 1 control, respectively (Figure3A). NOS enzyme activity peaked−1 at 3 h after 0.1 and 1 mmol L Put enzyme activity peaked at 6 and 12 h after 5 and 1 mmol·L Put treatment, which was 4.4-fold· − and treatment,3.8-fold that which of the was control, 2.3-fold respectively and 2.9-fold (Fig thature 3A). of the NOS control, enzyme respectively activity peaked (Figure at3 B).3 h Theseafter 0.1 results and had1 m themol same·L−1 Put change treatment, tendency which as was NO 2.3 content-fold and in the 2.9 medium-fold that ofof birchthe control suspension, respectively cells. (Figure 3B). These results had the same change tendency as NO content in the medium of birch suspension cells. 2.3. NO-Mediated Put Induced Betulin Accumulation

control To investigate0.4 the role of NO in Put-inducedcontrol betulin6 production, we examined the eﬀects of 0.1mmol/L 0.1mmol/L NO scavenger） cPTIO, NOS inhibitora L-NAME,1mmol/L and NR inhibitora NaN3 on Put-induced1mmol/L NO burst,

ab 5mmol/L 1 ab - 5mmol/L betulin production,0.3 and gene expression of LUS in the birch suspension cells (Figure4). As shown, protein

b mg • 1 b 4 - bc b pretreatment of the suspensionbc cells withbc cPTIO, L-NAME,U andbc NaN3 abolishedbc the Put-triggeredbc

mg bc ）（

• c bc 0.2 c c c c c c c NO generationU (Figurecd 4A) andcd blocked the Put-inducedcd betulinc productionc andc genec expression of c c c LUS (Figure4（ B,C). Thus, the data indicatedd that Put-induced2 NO was essential for betulin production, d d d protein d d d and it may have0.1 been mainly derived from NR and NOS biosynthetic pathways in birch suspension cell cultures. activityNOS NR activity NR 0 0 3 6 12 24 48 3 6 12 24 48 Time of treatment(h) Time of treatment(h) A B

Forests 2020, 11, x FOR PEER REVIEW 3 of 10

2.2. Put Induced NO Production NO production in birch suspension cells was examined using the Greiss reagent assay kit and a fluorometric method. Figure 2A shows the time course of NO generation in a medium of birch suspension cells treated with 0.1, 1, and 5 mmol·L−1 Put. NO content peaked at 9 h after 0.1 or 1 mmol·L−1 Put treatment, 18 h after 5 mmol·L−1 Put treatment, approximately 4-, 8-, and 13-times that in the control, respectively. NO fluorescence intensity in suspension cells after Put treatment had a similar change tendency to NO content in medium of birch suspension cells (Figure 2B), and the maximum fluorescence intensity was also at 9 h after 1 mmol·L−1 Put treatment (Figure 2C).

14 control 0.1mmol/L 1200 control 0.1mmol/L 12 1mmol/L 5mmol/L 1mmol/L 5mmol/L a a ab a a 900 b ab 10 b bc bc 8 c

Figure 2. Effect of Put on nitric oxide (NO) generation in suspension cells of birch. (A), NO content in culture medium of birch; (B), NO fluorescence intensity in suspension cells of birch; (C), NO fluorescence intensity in suspension cells after 1 mmol·L−1 Put treatment (C1, Control; C2, 3 h after Put treatment; C3, 9 h after Put treatment; C4, 12 h after Put treatment; C5, 24 h after Put treatment; C6, 48 h after Put treatment).

NR and NOS are the two NO-generating key enzymes in plants [10]. Figure 3 shows that the enzyme activity of NR and NOS of the birch suspension cells induced by Put was also time- dependent and dose-dependent. Put treatment increased the enzyme activity of NR and NOS. NR enzyme activity peaked at 6 and 12 h after 5 and 1 mmol·L−1 Put treatment, which was 4.4-fold and 3.8-fold that of the control, respectively (Figure 3A). NOS enzyme activity peaked at 3 h after 0.1 and 1 mmol·L−1 Put treatment, which was 2.3-fold and 2.9-fold that of the control, respectively (Figure 3B). Forests 2020, 11, 1336 4 of 10 TheseForests 20result20, 11s, xhad FOR the PEER same REVIEW change tendency as NO content in the medium of birch suspension cells.4 of 10

control Figure 3.0.4 Effect of Put on enzyme activitycontrol of nitrate reductase6 (NR) and NO synthase (NOS) in 0.1mmol/L 0.1mmol/L suspension） cells of birch. (A), NR activity in suspension cells of birch; (B), NOS activity in suspension a 1mmol/L a 1mmol/L

ab 5mmol/L 1 ab - 5mmol/L cells of birch.0.3 protein

b mg • 1 b 4 - bc b bc bc U bc bc bc

mg bc ）

2.3. NO-Mediated Put Induced Betulin Accumulation （

• c bc 0.2 c c c c c c c U cd cd cd c c c c c c c To investigate（ the role of NO in Putd -induced betulin2 production, we examined the effects of NO d d d protein d d d scavenger cPTIO,0.1 NOS inhibitor L-NAME, and NR inhibitor NaN3 on Put-induced NO burst, betulin production, and gene expression of LUS in the activityNOS birch suspension cells (Figure 4). As shown,

NR activity NR 0 0 pretreatment of the suspension cells with cPTIO, L-NAME, and NaN3 abolished the Put-triggered 3 6 12 24 48 3 6 12 24 48 NO generationA (Figure 4A)Time and of treatment(h) blocked the Put-inducedB betulin productionTime of treatment(h) and gene expression of LUS (Figure 4B,C). Thus, the data indicated that Put-induced NO was essential for betulin production, and itFigure may have 3. Eﬀ beenect of mainly Put on derived enzyme activityfrom NR of and nitrate NOS reductase biosynthetic (NR) andpathways NO synthase in birch (NOS) suspension in cell cultures.suspension cells of birch. (A), NR activity in suspension cells of birch; (B), NOS activity in suspension cells of birch.

16 6 12 a a DW) 10

1 a

12 - b 4 8 b

M inmedium)M 8 b c μ b bc bc bc 6 c c d 2 4 4 d 2

NO content ( contentNO 0 0 Betulin content(mg•g Betulin 0 Relative expression level LUS of level expression Relative A B C

Figure 4. Effect of Put and NO inhibitor on NO production, betulin content, and gene expression of Figure 4. Effect of Put and NO inhibitor on NO production, betulin content, and gene expression of1 LUS in birch suspension cells. Eight-day-old suspension cells pretreated for 0.5 h with 150 µmol L− LUS in birch suspension cells. Eight-day-old suspension cells pretreated for 0.5 h with 150 μmol·L·−1 2- 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO; a NO-specific scavenger), (4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO; a NO-specific scavenger), 0.5 mmol L 1 NR inhibitor sodium azide (NaN ), and 3 mmol L 1 NOS inhibitor NG-nitro-L-Arg −−1 3 −1 − G 0.5 mmol·L· NR inhibitor sodium azide (NaN3), and 13 mmol·L NOS· inhibitor N -nitro-L-Arg methyl methyl ester (L-NAME) were treated with 1 mmol L− for 12 h, respectively. (A), NO content in culture ester (L-NAME) were treated with 1 mmol·L−1 ·for 12 h, respectively. (A), NO content in culture medium of birch; (B), betulin content in suspension cells of birch; (C), gene expression of LUS in medium of birch; (B), betulin content in suspension cells of birch; (C), gene expression of LUS in suspension cells of birch. suspension cells of birch. + 2.4. Put Induced NH4 Production 4+ 2.4. Put Induced NH+ Production NO and NH4 are all products of NR. Put treatment significantly increased the enzyme activity + + of NRNO (Figure and NH3A);4 are the all e ff productect of Puts of treatment NR. Put treatment on NH4 significantlyproduction wasincreased unknown. the enzyme In this activity study, + + weof NR examined (Figure the3A) e; fftheect effect of Put of treatment Put treatment on NH on4 NHproduction4 production in birch was suspensionunknown. In cells. this Figurestudy, 5weA + + + showsexamined that the Put effect treatment of Putsignificantly treatment on increased NH4 production NH4 production in birch suspension except after cells. 48 Fig h. NHure 45Acontent shows peakedthat Put attreatment 3 h after significantly 0.1, 1, and 5 increased mmol L 1NHPut,4+ production approximately except 2.35-, after 2.04-, 48 h. and NH 2.72-fold4+ content thatpeaked in the at · − control,3 h after respectively. 0.1, 1, and GS, 5 mmol GOGAT,·L−1 Put, and GDH approximately are involved 2.35 in- ammonium, 2.04-, and assimilation 2.72-fold that [20 in]; thethe activities control, + ofrespectively GOGAT and. GS, GDH GOGAT had the, and same GDH change are involved tendency in as ammonium NH4 content assimilation (Figure5B,D), [20] but; the the activities activity ofof GSGOGAT was di andfferent GDH in had birch the suspension same change cells tendency under Put as treatment NH4+ content (Figure (Fig5C).ure 5B,D), but the activity of GS was different in birch suspension cells under Put treatment (Figure 5C). + 2.5. NH4 Induced NO and Betulin Production + 2.5. NH4 Induced NO and Betulin Production + To further investigate the roles of NH4 -induced NO on betulin production, we examined the + effectTo of further the NO-specific investigate scavenger the roles cPTIO of NH on4+ NH-induced4 -induced NO on betulin betulin accumulation production, in we birch examined suspension the 1 cells.effect Figureof the NO6 shows-specific that scavenger 10 mmol cPTIOL− (NH on4 )NH2SO44+-induced(NS) and betulin NH4Cl accumulation (NCL) enhanced in birch NO andsuspension betulin · + production,cells. Figure respectively.6 shows that Pretreatment 10 mmol·L−1 of(NH birch4 )2SO suspension4 (NS) andcells NH4 withCl (NCL) cPTIO enhanced reduced NHNO 4and-triggered betulin + NOproduction, generation respectively. (Figure6A) P andretreatment blocked of NH birch4 -induced suspension betulin cells production with cPTIO (Figure reduced6B). NH4+-triggered NO generation (Figure 6A) and blocked NH4+-induced betulin production (Figure 6B).

Forests 2020, 11, x FOR PEER REVIEW 5 of 10 Forests 2020, 11, 1336 5 of 10 Forests 2020, 11, x FOR PEER REVIEW 5 of 10 8 control 0.1mmol/L 0.8 control 1mmol/L 5mmol/L 0.1mmol/L 1mmol/L FW) 8 control 0.1mmol/L 0.8 control 1 - 0.1mmol/L 6 a1mmol/L 5mmol/L Protein 0.6 1 a

- 1mmol/L FW) ab 1

- b bc

a Protein mg • g • mg 6 0.6 b 1 b

) a bcc bc - bc 1

（ c - bc 4 c c ab mg • U 0.4 bc bc b c c bc ccd c mg • g • mg cd b （ cd c b cd ) bcc bc min cd c bc cd 1 cd （ c d - bc cd 4 d c d c c d d d mg • U 0.4 bc bc d content d ccd d ccd c （

+ 0.2 cd c cd 2 min c

4 cd d cd cd cd d d d d d d

content d

NH d

+ 2 0.2 4

0 activityGDH 0 NH 3 6 12 24 48 3 6 12 24 48

GDH activityGDH 0 A 0 Time of treatment(h) B Time of treatment(h) 3 6 12 24 48 3 6 12 24 48 A Time of treatment(h) B Time of treatment(h) 0.8 control 1.2 control )

1 0.1mmol/L - 0.1mmol/L 0.8 1mmol/Lcontrol 1.2 1mmol/Lcontrol ) Protein Protein 1 1 0.1mmol/L - a a 1 0.1mmol/L 0.6 1mmol/L - a 1mmol/L Protein Protein 1 a 0.8 b a a 1

ab - b Protein min Protein bc ) 0.6 •mg U

1 c bc 1

- bc bc bc a bc bc - c c a c （ 0.8 cd cd 0.4 bc bc ab bc bc 0.6 b cd b Protein min Protein bc ) min U •mg U

1 c bc 1 d - bc bc bc cd cd bc bc - d d d d c d （ cd U • mg • U c c d cd 0.4 bc bc bc bcd 0.40.6 cd min （ d 0.2 cd cd d d d d d U • mg • U d d 0.4

（ 0.2 0.2 GOGAT activityGOGAT 0.2

GS activityGS 0 0

3 6 12 24 48 activityGOGAT 3 6 12 24 48

GS activityGS 0 0 C Time of treatment(h) D Time of treatment(h) 3 6 12 24 48 3 6 12 24 48 C Time of treatment(h) D Time of treatment(h) Figure 5. Effect of Put on the content of NH4+ and its assimilation enzyme activities in suspension cells + Figure 5. Eﬀect of+ Put on the content of NH4 and its assimilation enzyme activities in suspension of birch. (A), NH4 content in culture medium of birch; (B), glutamate dehydrogenase (GDH) activity Figure 5. Effect of Put on+ the content of NH4+ and its assimilation enzyme activities in suspension cells cells of birch. (A), NH4 content in culture medium of birch; (B), glutamate dehydrogenase (GDH) in suspension cells+ of birch; (C), glutamine synthase (GS) activity in suspension cells of birch; (D), ofactivity birch.in (A suspension), NH4 content cells in of culture birch; ( Cmedium), glutamine of birch; synthase (B), glutamate (GS) activity dehydrogenase in suspension (GDH) cells ofactivity birch; glutamine-2-oxoglutarate aminotransferase (GOGAT) activity in suspension cells of birch. (inD ),suspension glutamine-2-oxoglutarate cells of birch; (C aminotransferase), glutamine synthase (GOGAT) (GS) activityactivity in in suspension suspension cells cells of of birch. birch; (D), glutamine-2-oxoglutarate aminotransferase (GOGAT) activity in suspension cells of birch. 9 4 a a 9 a DW) 1 4 a - a 6 a b a DW) 1 b - b M inmedium)M a b b μ 6 2 b b c b M inmedium)M 3 b b μ 2 3 c

NO content ( contentNO 0 0 Betulin content(mg•g Betulin

NO content ( contentNO 0 0 Betulin content(mg•g Betulin A B

A + Figure 6. Effect of NH4 on the content ofBNO and betulin in suspension cells of Figure 6. Effect of NH4+ on the content of NO and betulin in suspension cells of1 birch. Eight-day -old birch. Eight-day-old suspension cells pretreated for 0.5 h with 150 µmol L− 2-(4-carboxyphenyl)- suspension cells pretreated for 0.5 h with 150 μmol·L−1 2-(4-carboxyphenyl)· -4,4,5,5-tetramethylimi- Figure4,4,5,5-tetramethylimi-dazoline-1-oxyl-3-oxide 6. Effect of NH4+ on the content of NO and (cPTIO) betulin (NO-specific in suspension scavenger) cells of birch were. Eight treated-day with-old dazoline-1-oxyl1 -3-oxide (cPTIO) (NO-specific scavenger)1 were treated with 10 mmol·L−1 (NH4)2SO4 10suspension mmol L− cells(NH4) pretreated2SO4 (NS) for and 0.5 10 h mmolwith 150L− μmolNH4Cl·L−1 (NCL) 2-(4-carboxyphenyl) for 12 h, respectively.-4,4,5,5- (tetramethylimiA), NO content- · · (NS) and 10 mmol·L−1 NH4Cl (NCL) for 12 h, respectively. (A), NO content in culture medium of birch; dazolinein culture-1 medium-oxyl-3-oxide of birch; (cPTIO) (B), betulin(NO-specific content scavenger) in suspension were cells treated of birch. with 10 mmol·L−1 (NH4)2SO4 (B), betulin content in−1 suspension cells of birch. 3. Discussion(NS) and 10 mmol·L NH4Cl (NCL) for 12 h, respectively. (A), NO content in culture medium of birch; (B), betulin content in suspension cells of birch. 3. DiscussionPlants do not appear to have specific receptors for PAs; thus, it is particularly interesting to 3.investigate DiscussionPlants howdo not PAs appear perform to havediverse specific functions receptors in plant for cells PAs; [21 thus,]. Recently, it is particularly some experiments interesting have to shown that Put can induce the production of NO in plants, but the roles and origins of NO induced by investigatePlants how do not PAs appear perform to diverse have specific functions receptors in plant for cells PAs; [21] thus,. Recently, it is particularly some experiments interesting have to Put in plants remain poorly understood. showinvestigaten that howPut c PAsan induce perform the diverse production functions of NO in in plant plant cellss, but [21] the. Recently, roles and some origins experiments of NO induced have In our previous report, exogenous Put treatment increased the production of triterpenoids and byshow Putn inthat plant Puts cremainan induce poorly the understood.production of NO in plants, but the roles and origins of NO induced flavonoids in suspension cells of birch, and exogenous NO donor sodium nitroprussiate also enhanced by PutIn inour plant previouss remain report, poorly exogenous understood. Put treatment increased the production of triterpenoids and the accumulation of triterpenoids and the gene expression of LUS, one of the key enzymes in the flavonoidIn ours inprevious suspension report, cells exogenous of birch, Put and treatment exogenous increased NO the donor production sodium of nitroprussiate triterpenoids alsoand flavonoids in suspension cells of birch, and exogenous NO donor sodium nitroprussiate also

Forests 2020, 11, 1336 6 of 10 triterpenoid biosynthesis pathway [18,22]. Betulin is one of the main triterpenoids in the bark of birch trees. In this study, we further verified that Put treatment enhanced betulin production at the metabolic and gene expression levels and confirmed Put promoted NO production. To further clarify the function of NO-induced by Put, 8-day-old suspension cells were treated with Put and cPTIO, a specific scavenger of NO. The results showed that the Put and cPTIO treatment abolished Put-triggered NO generation and blocked Put-induced betulin production and gene expression of LUS. Thus, the above data suggest a crucial role of NO in Put-induced betulin accumulation in birch suspension cells. NO is produced from a range of enzymatic and nonenzymatic sources in plants [10]. NR and NOS have been known as major enzymatic sources of NO production, although the existence of NOS in plants remains controversial [8,9]. To understand the effect of Put on NO biosynthesis, we analyzed the role of NOS and NR in Put-induced NO biosynthesis. The results showed that Put treatment enhanced the activity of NR and NOS; NR inhibitor NaN3 or NOS inhibitor L-NAME reduced NO and betulin production in birch suspension cells induced by Put. Similar results were also reported in our previous research: NR-dependent NO and NOS-dependent NO mediated betulin production in birch suspension cells induced by a fungal elicitor or hydrogen sulfide [12,18]. Thus, our recent research suggests that NR-dependent NO and NOS-dependent NO mediate betulin production in birch suspension cells. + + NO can be induced by NH4 in plants [23], and NH4 supply enhanced secondary metabolite + biosynthesis, such as catechin and epicatechin in tea plant leaves [24,25]. NO3− and NH4 are the two primary N sources for plants, and NR is necessary for both the first step of the reduction of NO3− to + + NH4 and for the formation of NO in plants [9]. However, the role of NH4 -induced NO and Put + -induced NH4 on secondary metabolite production is unclear. Our results showed that NO scavenger + + cPTIO reduced NH4 -triggered NO generation and decreased NH4 -induced betulin production; + + Put treatment enhanced NH4 production and the activities of GOGAT and GDH, which are the NH4 assimilation enzymes. Awasthi et al. (2013) also found that Put treatment increased the activities of + + GOGAT and GDH in mice [26]. Thus, the above data first suggests that NH4 or NH4 -triggered NO participates in Put-induced betulin accumulation in birch suspension cells, and this suggestion should be further confirmed. The results of this work demonstrated that NO signaling was involved in Put-induced betulin production of birch suspension cells. However, the data also showed that Put could still stimulate betulin production in the birch suspension cells even though Put-triggered NO accumulation was abolished by cPTIO, which implied that Put-induced betulin production was not completely dependent on NO signaling. In addition to NO, many other signal molecules such as hydrogen peroxide (H2O2), jasmonic acid (JA), and salicylic acid (SA) have also been reported to play roles in secondary metabolite production [16,27,28]. Whether these signal molecules are involved in Put-induced betulin production still needs to be further investigated. The current study allowed us to conclude that Put-induced NO is essential to betulin production in birch suspension cell cultures, and it may have been derived from NR and NOS biosynthetic + pathways and nonenzymatic pathways in NH4 . This may be beneficial to further understanding of the role of Put-elicited betulin biosynthesis in plant cell cultures and in the rational manipulation of secondary metabolism.

4. Materials and Methods

4.1. Plant Cell Culture The cell line used in the study was developed from the axillary buds of a 30-year-old B. platyphylla Suk tree. Birch suspension cell cultures were cultivated on Nagata–Takebe medium supplemented with 0.1 mg L 1 6-benzyladenine, 0.01 mg L 1 thidiazuron, and 20 g L 1 sucrose [29]. The medium was · − · − · − adjusted to pH 5.6 and then sterilized by autoclaving at 121 ◦C for 20 min. The suspension culture was maintained in 250 mL Erlenmeyer flasks, with a liquid volume of 100 mL in each flask, and inoculated Forests 2020, 11, 1336 7 of 10 with 5.0 g fresh weight of 8-day-old cell suspension cultures. The Erlenmeyer flasks were incubated on a rotary shaker (110 rpm) at 25 ◦C. Illumination was regulated to give 14 h of light [12].

4.2. Chemical Reagents and Treatment The chemical reagents and their concentrations used in these experiments were as follows: 0.1, 1, and 5 mmol L 1 putrescine (Put), 10 mmol L 1 (NH ) SO , 10 mmol L 1 NH Cl, 150 µmol L 1 · − · − 4 2 4 · − 4 · − 2- (4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline- 1-oxyl-3-oxide (cPTIO; a NO-speciﬁc scavenger), 0.5 mmol L 1 NR inhibitor sodium azide (NaN ), and 3 mmol L 1 NOS inhibitor NG-nitro-L-Arg · − 3 · − methyl ester (L-NAME). Among them, cPTIO was purchased from Sigma Corporation (St Louis, MO, USA); the other chemicals were purchased from Beijing Huagong Biotechnology Institute, China. Eight-day-old suspension cells were used for the above chemical treatment. The controls were treated with the same volume of distilled water.

4.3. Betulin Estimation Betulin was extracted from birch suspension cells using a procedure reported by Fan et al. (2014) [18]. Briefly, 0.50 g powder of dried suspension cells was soaked in 20 mL hydrochloric acid:ethanol solution (2:8 by volume). The solution was refluxed for 3 h in a water bath at 90 ◦C. The filtrate was extracted three times with 15 mL of ether. The combined extracts were evaporated to dryness at 40 ◦C and redissolved in 2 mL ethanol for HPLC analysis. Betulin content was analyzed by reversed-phase HPLC with ultraviolet detection at 210 nm. The mobile phase consisted of 80:20 (v/v) acetonitrile:water. The flow rate was 1 mL min 1. The betulin standard was obtained from · − Sigma–Aldrich Chemical Corporation (St Louis, MO, USA).

4.4. Detection of NO Briefly, 2 mL suspension culture medium was used to determine the content of NO by the Greiss reagent method using an assay kit (Nanjing Jiangcheng Biotechnology Institute, China). The absorbance values were determined at the wavelength of 540 nm. The images of NO-induced fluorescence were examined with a confocal laser scanning microscope (Zeiss LSM 510, Mannheim, Germany) using standard filters and collection modalities for visualizing DAF-FM green fluorescence (excitation 495 nm; emission 515 nm) [30]. Image Pro Plus 6.0 software (Media Cybernetics, Bethesda, Rockville, MD, USA) was applied to quantify the fluorescence intensity of NO; mean density = IOD SUM/area sum.

+ 4.5. Detection of NH4 + Fresh suspension cells (2 g) were used to detect concentrations of NH4 , according to the manufacturer’s instructions of commercially available assay kits (Nanjing Jiangcheng Biotechnology + Institute, China). NH4 was extracted in double-distilled water. The absorbance values were + determined at the wavelength of 580 nm for NH4 by a spectrophotometer.

4.6. Determination of Enzyme Activities

First, 2 g of fresh suspension cells was ground with liquid N2 and then resuspended in extraction buffer containing 100 mM HEPES-KOH (pH 7.5), 1 mmol L 1 EDTA, 10% (v/v) glycerol, 5 mmol L 1 · − · − dithiothreitol, 0.1% TritonX-100, 0.5 mmol L 1 phenylmethylsulfonyl fluoride, 20 mmol L 1 FAD, · − · − 1 mmol L 1 leupeptin, 5 mmol L 1 Na MoO , and 1% polyvinylpyrrolidone. Then, after centrifugation · − · − 2 4 at 10,000 g for 20 min at 4 C, the supernatant was used to determine enzyme activity. × ◦ Enzyme activities of glutamine synthase (GS), glutamine-2-oxoglutarate aminotransferase (GOGAT), glutamate dehydrogenase (GDH), and NOS were determined using commercially available assay kits (Nanjing Jiangcheng Biotechnology Institute, Nanjing, China and Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). The absorbance values were recorded at the wavelength Forests 2020, 11, 1336 8 of 10 of 540, 340, 340, and 530 nm for GS, GOGAT, GDH, and NOS by spectrophotometer, respectively. Enzyme activity was expressed as units per mg of protein. NR activity was measured by mixing 1 volume of the extract with 5 volumes of prewarmed (25 ◦C) assay buffer (100 mmol L 1 HEPES-KOH, pH 7.5, 5 mmol L 1 KNO , and 0.25 mmol L 1 NADH). · − · − 3 · − The reaction was started by the addition of an assay buffer, incubated at 25 ◦C for 30 min, and then stopped by adding 0.1 mol L 1 zinc acetate. After 15 min, the tubes were centrifuged at 13,000 g for · − × 5 min. The nitrite produced was measured colorimetrically at 520 nm by adding 1 mL of 1% (w/v) sulfanilamide in 3 mol L 1 HCl plus 1 mL of 0.02% (v/v) N-(1-naphthyl)-ethylenediamine in distilled · − water [31]. The protein content of the supernatant was determined according to the method described by Bradford (1976). Bovine serum albumin was used as a standard [32].

4.7. RNA Isolation and Real-Time Quantitative RT-PCR Total RNA was isolated using the CTAB-based method [33]. The b-tubulin (Tu) and ubiquitin (UbQ) genes were used as references [18]. The TaqMan probes and primers are presented in Table1. PCR ampliﬁcation was performed under standard cycling conditions, namely, 94 ◦C for 30 s (initial polymerase activation), followed by 45 cycles of 94 ◦C for 12 s (denaturation), 58 ◦C for 30 s (annealing), and 72 ◦C for 40 s. Gene expression data were calculated relative to the reference gene following the ∆∆Ct 2− method [34].

Table 1. Sequences of primer pairs for quantitative real-time RT-PCR (qRT-PCR) assay.

Gene Name Accession NO. Primer Sequences (5 3 ) Tm ( C) Fragment Size (bp) 0→ 0 ◦ Forward: TTGAAGACGTGCAAGAACCTG LUS AB055511 58 195 Reverse: CATCAATGAGGGATAACAAGG Forward: TCAACCGCCTTGTCTCTCAGG TU FG067376 54 190 Reverse:TGGCTCGAATGCACTGTTGG Forward: GATTGAGGGGAGGGATGCTG UbQ FG065618 53 202 Reverse: GGAGGACAAGGTGGAGGGTG

4.8. Statistical Analysis All experiments were conducted in triplicate. Data (mean standard error) were statistically ± analyzed using SPSS version 15.0. Tukey’s test was used for multiple comparisons among means, and different letters show significant differences among means (p < 0.05).

5. Conclusions In this study, the application of Put signiﬁcantly enhanced betulin production and gene expression of LUS, one of its synthetic key enzymes in birch suspension cells. Put treatment promoted NO bursts and increased the activity of NOS and NR. However, the above positive inductive eﬀects can be blocked with NO scavenger cPTIO, NR inhibitor NaN3, and NOS inhibitor L-NAME. Put treatment improved + + the content of NH4 and its assimilation enzyme activity of GOGAT and GDH. NH4 supplementation also promoted NO and betulin production. Thus, the data indicate that Put-induced NO is essential to + betulin production, and NO may have been derived from NR, NOS, and NH4 in birch suspension cell cultures induced by Put.

Author Contributions: G.F. and Y.Z. conceived and designed the experiments. Y.L. and T.Z. performed the research. G.F., Y.Z. and B.Z. analyzed the data and wrote the paper. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by the Fundamental Research Funds for the Central Universities (2572020DY17), the Foundation of State Key Laboratory of Desert and Oasis Ecology, the Xinjiang Institute of Ecology and Geography, the Chinese Academy of Sciences (G2018-02-07), and the Heilongjiang Touyan Innovation Team Program (Tree Genetics and Breeding Innovation Team). Conﬂicts of Interest: The authors declare no conﬂict of interest. Forests 2020, 11, 1336 9 of 10

Abbreviations

Put putrescine LUS lupeol synthase NO nitric oxide NR nitrate reductase NOS NO synthase cPTIO 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline- 1-oxyl-3-oxide NaN3 sodium azide L-NAME NG-nitro-L-Arg methyl ester GOGAT glutamine-2-oxoglutarate aminotransferase GDH glutamate dehydrogenase NS (NH4)2SO4 NCL NH4Cl

References

1. Hussaina, S.S.; Ali, M.; Ahmad, M.; Siddique, K.H.M. Polyamines: Natural and engineered abiotic and biotic stress tolerance in plants. Biotechnol. Adv. 2011, 29, 300–311. [CrossRef][PubMed] 2. Silveira, V.; Santa-Catarina, C.; Tun, N.N.; Scherer, G.F.E.; Handro, W.; Guerra, M.P.; Floh, E.I.S. Polyamine effects on the endogenous polyamine contents, nitric oxide release, growth and differentiation of embryogenic suspension cultures of Araucaria angustifolia (Bert.) O. Ktze. Plant Sci. 2006, 171, 91–98. [CrossRef] 3. Handa, A.K.; Mattoo, A.K. Differential and functional interactions emphasize the multiple roles of polyamines in plants. Plant Physiol. Bioch. 2010, 48, 540–546. [CrossRef][PubMed] 4. Pál, M.; Ivanovska, B.; Oláh, T.; Tajti, J.; Hamow, K.Á.; Szalai, G.; Khalil, R.; Vanková, R.; Dobrev, P.; Misheva, S.P.; et al. Role of polyamines in plant growth regulation of Rht wheat mutants. Plant Physiol. Bioch. 2019, 137, 189–202. [CrossRef][PubMed] 5. Pál, M.; Szalai, G.; Janda, T. Speculation: Polyamines are important in abiotic stress signaling. Plant Sci. 2015, 237, 16–23. [CrossRef][PubMed] 6. Wu, J.Q.; Shu, S.; Li, C.C.; Sun, J.; Guo, S.R. Spermidine-mediated hydrogen peroxide signaling enhances the antioxidant capacity of salt-stressed cucumber roots. Plant Physiol. Bioch. 2018, 128, 152–162. [CrossRef] 7. Benk˝o,P.; Jee, S.; Kaszler, N.; Fehér, A.; Gémes, K. Polyamines treatment during pollen germination and pollen tube elongation in tobacco modulate reactive oxygen species and nitric oxide homeostasis. J. Plant Physiol. 2020, 244, 153085. [CrossRef] 8. Domingos, P.; Prado, A.M.; Wong, A.; Gehring, C.; Feijo, J.A. Nitric oxide: A multitasked signaling gas in plants. Mol. Plant 2015, 8, 506–520. [CrossRef] 9. Castello, F.D.; Nejamkin, A.; Cassia, R.; Correa-Aragunde, N.; Fernández, B.; Foresi, N.; Lombardo, C.; Ramirez, L.; Lamattina, L. The era of nitric oxide in plant biology: Twenty years tying up loose ends. Nitric Oxide 2019, 85, 17–27. [CrossRef] 10. Santolini, J.; André, F.; Jeandroz, S.; Wendehenne, D. Nitric oxide synthase in plants: Where do we stand? Nitric Oxide 2017, 63, 30–38. [CrossRef] 11. Cao, X.C.; Zhu, C.Q.; Zhong, C.; Zhang, J.H.; Wu, L.H.; Jin, Q.Y.; Ma, Q.X. Nitric oxide synthase-mediated early nitric oxide burst alleviates water stress-induced oxidative damage in ammonium-supplied rice roots. BMC Plant Biol. 2019, 19, 108. [CrossRef][PubMed]

12. Ma, K.; Jiang, Y.; Yu, Z.Y.; Huang, Y.T.; Zhan, Y.G.; Fan, G.Z. H2S-induced NO/SNO positively promotes betulin production in Betula Platyphylla. Ind. Crops Prod. 2019, 140, 111608. [CrossRef] 13. Krasuska, U.; Ciacka, K.; Gniazdowska, A. Nitric oxide-polyamines cross-talk during dormancy release and germination of apple embryos. Nitric Oxide 2017, 68, 38–50. [CrossRef][PubMed] 14. Chamizo-Ampudia, A.; Sanz-Luque, E.; Llamas, A.; Galvan, A.; Fernandez, E. Nitrate reductase regulates plant nitric oxide homeostasis. Trends Plant Sci. 2017, 22, 163–174. [CrossRef][PubMed] 15. Chandran, H.; Meena, M.; Barupal, T.; Sharma, K. Plant tissue culture as a perpetual source for production of industrially important bioactive compounds. Biotech. Rep. 2020, 26, e00450. [CrossRef][PubMed] 16. Thakur, M.; Bhattacharya, S.; Khosla, P.K.; Puri, S. Improving production of plant secondary metabolites through biotic and abiotic elicitation. J. Appl. Res. Med. Aroma. 2019, 12, 1–12. [CrossRef] Forests 2020, 11, 1336 10 of 10

17. Zhao, F.Q.; Mai, Q.Q.; Ma, J.H.; Xu, M.; Wang, X.; Cui, T.T.; Qiu, F.; Han, G. Triterpenoids from Inonotus obliquus and their antitumor activities. Fitoterapia 2015, 101, 34–40. [CrossRef] 18. Fan, G.Z.; Liu, Y.T.; Wang, X.D.; Zhan, Y.G. Cross-talk of polyamines and nitric oxide in endophytic fungus-induced betulin production in Betula platyphylla plantlets. Trees-Struct. Funct. 2014, 28, 635–641. [CrossRef] 19. Fan, G.Z.; Zhai, Q.L.; Zhan, Y.G. Gene expression of lupeol synthase and biosynthesis of nitric oxide in cell suspension cultures of Betula platyphylla in response to a Phomopsis elicitor. Plant Mol. Biol. Rep. 2013, 31, 296–302. [CrossRef] 20. Navarro-León, E.; Barrameda-Medina, Y.; Lentini, M.; Esposito, S. Comparative study of Zn deficiency in + L. sativa and B. oleracea plants NH4 assimilation and nitrogen derived protective compounds. Plant Sci. 2016, 248, 8–16. [CrossRef] 21. Yang, B.N.; Wu, J.Z.; Gao, F.M.; Wang, J.; Su, G.X. Polyamine-induced nitric oxide generation and its potential requirement for peroxide in suspension cells of soybean cotyledon node callus. Plant Physiol. Bioch. 2014, 79, 41–47. [CrossRef][PubMed] 22. Li, X.C.; Zhang, Y.G.; Wang, X.D.; Liu, Y.T.; Li, D.; Rong, L.Z.; Fan, G.Z. Effect of polyamine on growth of Betula platyphylla suspension cells and triterpenoid accumulation. Chin. Tradit. Herbal Drugs 2013, 44, 463–467. 23. Zhu, X.F.; Dong, X.Y.; Wu, Q.; Shen, R.F. Ammonium regulates Fe deficiency responses by enhancing nitric oxide signaling in Arabidopsis thaliana. Planta 2019, 250, 1089–1102. [CrossRef][PubMed] 24. Liu, M.Y.; Burgos, A.; Zhang, Q.F.; Tang, D.D.; Shi, Y.Z.; Ma, L.F.; Yi, X.Y.; Ruan, J.Y. Analyses of transcriptome + profiles and selected metabolites unravel the metabolic response to NH4 and NO3− as signaling molecules in tea plant (Camellia sinensis L.). Sci. Hortic. 2017, 218, 293–303. [CrossRef] 25. Radušiene,˙ J.; Marksa, M.; Ivanauskas, L.; Jakštas, V.; Çali¸skan,Ö.; Kurt, D.; Odaba¸s,M.S.; Çirak, C. Effect of nitrogen on herb production, secondary metabolites and antioxidant activities of Hypericum pruinatum under nitrogen application. Ind. Crops. Prod. 2019, 139, 111519. [CrossRef] 26. Awasthi, V.; Gautam, I.K.; Sengar, R.S.; Garg, S.K. Influence of putrescine on enzymes of ammonium assimilation in maize seedling. Am. J. Plant Sci. 2013, 4, 297–301. [CrossRef] 27. Zhao, J.; Davis, L.C.; Verpoorte, R. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv. 2005, 23, 283–333. [CrossRef] 28. Li, Y.Q.; Kong, D.X.; Fu, Y.; Sussman, M.R.; Wu, H. The effect of developmental and environmental factors on secondary metabolites in medicinal plants. Plant Physiol. Bioch. 2020, 148, 80–89. [CrossRef] 29. Nagata, T.; Takebe, I. Cell Wall Regeneration and Cell Division in Isolated Tobacco Mesophyll Protoplasts. Planta 1970, 92, 301–308. [CrossRef] 30. Hong, W.Y.; Yang, T.W.; Wang, C.M.; Syu, J.H.; Lin, Y.C.; Meng, H.F.; Tsai, M.J.; Cheng, H.; Zan, H.W.; Horng, S.F. Conversion of absorption to fluorescence probe in solid-state sensor for nitric oxide and nitrite. Org. Electron. 2013, 14, 1136–1141. [CrossRef] 31. Zhao, M.G.; Chen, L.; Zhang, L.L.; Zhang, W.H. Nitric reductase-dependent nitric oxide production is involved in cold acclimation and freezing tolerance in Arabidopsis. Plant Physiol. 2009, 151, 755–767. [CrossRef][PubMed] 32. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [CrossRef] 33. Zeng, F.S.; Nan, N.; Zhan, Y.G. Extraction of total RNA from mature leaves rich in polysaccharides and secondary metabolites of Betula platyphylla Suk. Plant Physiol. Commun. 2007, 43, 913–916. 34. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and ∆∆Ct the 2− method. Methods 2001, 25, 402–408. [CrossRef][PubMed]

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional aﬃliations.

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).