Ndrg4 Is Required for Normal Myocyte Proliferation During Early Cardiac Development in Zebraﬁsh

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Developmental Biology 317 (2008) 486–496

Contents lists available at ScienceDirect

Developmental Biology

journal homepage: www.elsevier.com/developmentalbiology

ndrg4 is required for normal myocyte proliferation during early cardiac development in zebraﬁsh

Xianghu Qu a,b, Haibo Jia b,c, Deborah M. Garrity d, Kevin Tompkins a, Lorene Batts a, Bruce Appel b,e, Tao P. Zhong b,c,⁎, H. Scott Baldwin a,b,⁎

a Department of Pediatric Cardiology, Vanderbilt University Medical Center, Nashville, TN 37232, USA b Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232, USA c Department of Cardiovascular Medicine, Vanderbilt University Medical Center, Nashville, TN 37232, USA d Department of Biology, Colorado State University, Fort Collins, CO 80523, USA e Department of Biological Sciences, Vanderbilt University Medical Center, Nashville, TN 37232, USA

article info abstract

Article history: NDRG4 is a novel member of the NDRG family (N-myc downstream-regulated gene). The roles of NDRG4 in Received for publication 29 March 2007 development have not previously been evaluated. We show that, during zebrafish embryonic development, Received 1 February 2008 ndrg4 is expressed exclusively in the embryonic heart, the central nervous system (CNS) and the sensory Accepted 20 February 2008 system. Ndrg4 knockdown in zebrafish embryos causes a marked reduction in proliferative myocytes and Available online 6 March 2008 results in hypoplastic hearts. This growth defect is associated with cardiac phenotypes in morphogenesis and function, including abnormal heart looping, inefficient circulation and weak contractility. We reveal that Keywords: ndrg4 is required for restricting the expression of versican and bmp4 to the developing atrioventricular Zebrafish canal. This constellation of ndrg4 cardiac defects phenocopies those seen in mutant hearts of heartstrings (hst), ndrg4 fi fi Cardiogenesis the tbx5 loss-of-function mutants in zebra sh. We further show that ndrg4 expression is signi cantly Myocardium decreased in hearts with reduced tbx5 activities. Conversely, increased expression of tbx5 that is due to tbx20 tbx5 knockdown leads to an increase in ndrg4 expression. Together, our studies reveal an essential role of ndrg4 in tbx20 regulating proliferation and growth of cardiomyocytes, suggesting that ndrg4 may function downstream of tbx5 during heart development and growth. © 2008 Elsevier Inc. All rights reserved.

Introduction The existence of a gene family and its conservation through evolution often implies the important functions of its members. To date, NDRG4 belongs to the differentiation-related NDRG family, which studies of biological function have focused mainly on NDRG1 (also includes four related members: NDRG1–4 (Qu et al., 2002; Zhou et al., known as ndr1, drg1, RTP/rit42, GRP78/BiP, Cap43, Proxy-1). Accumu- 2001). NDRG1 was ﬁrst isolated as a gene up-regulated in N-myc lated data suggest that NDRG1 has at least two biological roles: it mutant mouse embryos and repressed by N-myc and C-myc (Shimono attenuates cell proliferation and promotes differentiation and is et al., 1999), although NDRG2 and NDRG3 expression is not under the activated in response to various types of cell stress (Kokame et al., control of N-myc or c-myc (Boulkroun et al., 2002; Okuda and Kondoh, 1996; Nishimoto et al., 2003; Zhou et al., 1998; rev in Kovacevic and 1999). The encoded proteins of this family are highly conserved in Richardson, 2006). Interestingly, a nonsense mutation in the human evolution. At the amino acid level, the four human NDRG4 members NDRG1 gene is associated with hereditary motor and sensory neuro- share 53–65% identity. While primarily found in the cytoplasm, the pathy-Lom (HMSNL) (Kalaydjieva et al., 2000). HMSNL is a severe function of these proteins remains obscure with no obvious function peripheral neuropathy characterized by Schwann cell dysfunction and predicted from protein structure. Each member contains an α/β progressive axonal loss in the peripheral nervous system (Kyuno et al., hydrolase fold, which is common to a number of hydrolytic enzymes of 2003). The importance of this nonsense mutation in disease causation widely differing phylogenetic origin and catalytic function (Qu et al., is underscored by the Schwann cell dysfunction phenotypes in Ndrg1 2002). However, no hydrolytic catalytic site has been identiﬁed in this knockout mice, which suggest that NDRG1 is essential for maintenance family (Shaw et al., 2002). of myelin sheaths in peripheral nerves (Okuda et al., 2004). Over- expression of Ndrg1 in Xenopus laevis led to disrupted formation of the pronephric ducts and reduced size of pronephric tubules and somite ⁎ Corresponding author. T.P. Zhong is to be contacted at 383 PRB/VUMC, Nashville, TN disorganization, whereas Ndrg1 reduction by morpholino resulted in a 37232-6300, USA. Fax: +1 615 936 1872. H.S. Baldwin, 9435-A MRB IV/VUMC, Nashville, failure of pronephric morphogenesis (Kyuno et al., 2003). TN 37232 0493, USA. Fax: +1 615 322 6541. E-mail addresses: [email protected] (T.P. Zhong), Much less is known about the functions of NDRG4 (also known as [email protected] (H.S. Baldwin). smap8, Bdm1) and no previous studies have investigated its role in

0012-1606/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2008.02.044 X. Qu et al. / Developmental Biology 317 (2008) 486–496 487 cardiac development. All studies to date have utilized in vitro cell Clontech). The cmlc2–Ndrg4–EGYP DNA fragment was inserted into the pWhere fl culture assays. NDRG4 protein has been shown to modulate activating plasmid (InvivoGen) at the XhoI/NheI sites. Thus, H19 insulators anked this entire fusion DNA fragment.15 pg of the linearized DNA was injected into wild-type embryos at protein-1 (AP-1) activity and may regulate neurite outgrowth in NGF- 1-cell stage with presence of ndrg4-MO1 or standard control MO. treated PC12 cells (Ohki et al., 2002). Most recently NDRG4 has been For mRNA injection experiments, a 1029 bp PCR product (including initial codon reported to enhance NGF-induced ERK signaling components and ATG and stop codon TGA) from adult zebrafish heart cDNA with primers P1 and 5′- attenuates NGF-induced Elk-1 activation for transcription in PC12 CGCAAGGGTTCAGCAGGACACT-3′ was cloned into pCRII-TOPO (named pCRII-zNDRG4) and then the ndrg4 insert was subcloned into pcGlobin2 (Ro et al., 2004)atEcoRI site. cells, suggesting a possible role in neuronal differentiation (Hongo To generate capped mRNA, plasmid was linearized by ClaI and transcribed with T7 RNA fi et al., 2006). Others have suggested a role for NDRG4 in ampli cation polymerase using the mMESSAGE mMACHINE T7 in vitro transcription kit (Ambion) of the PDGF induced mitogenic response of aortic smooth muscle via according to the manufacturer’s instructions. the ERK signaling pathway in vitro (Nishimoto et al., 2003). However, the in vivo function of NDRG4 has not been previously evaluated. In situ hybridization

To investigate the developmental role of Ndrg4, we cloned ndrg4 At 24 hpf, 0.2 mM 1-phenyl-2-thio-urea (Sigma, St Louis, MO) was added to embryo from zebrafish. We demonstrate that zebrafish ndrg4 shows a highly media to prevent pigment formation. Embryos were collected at the appropriate stages restricted pattern of expression in CNS and the developing heart from and fixed in 4% paraformaldehyde (PFA), pH 7.0, in phosphate-buffered saline (PBS), 24 h post-fertilization (hpf). We find that reduction of ndrg4 by mor- overnight at 4 °C. Fixed embryos were dechorionated, washed three times with PBS and stored in methanol at −20 °C. Whole-mount in situ hybridization was performed using pholino antisense oligonucleotides attenuates myocardial prolifera- digoxigenin labeled antisense RNA probe and visualized using anti-digoxigenin Fab frag- fi tion and growth, and ultimately, limits heart function. Speci cally, we ments conjugated with alkaline phosphatase (Roche Molecular Biochemicals). Ribop- show that the loss of Ndrg4 function led to a significant reduction of robes were made from DNA templates, which were linearized and transcribed with either myocardial cell number in both heart chambers due to lower cell SP6, T3 or T7 RNA polymerase. Embryos were processed and hybridized as described proliferation. In addition, we find that Ndrg4 is required for regulating (Thisse et al., 1993). The antisense RNA probes used in this study were tbx5 (Begemann and Ingham, 2000), cardiac-myosin light chain-2 (cmlc2), ventricular myosin heavy chain versican and bmp4 expression levels correctly during the stages of (vmhc)(Yelon et al., 1999), atrial myosin heavy chain (amhc), nppa (anf)(Berdougo et al., chamber formation. Interestingly, the heart defects in ndrg4 morphant 2003), versican (Walsh and Stainier, 2001), bmp4, gata4, Nkx2.5, hand2 (Yelon et al., embryos are similar to that of the tbx5 mutants (hst), including 2000), and ndrg4. To synthesize an ndrg4 antisense riboprobe, linearized pCRII-zNdrg4 dysregulated versican and bmp4 expression in the developing atrio- (containing a 1029 bp fragment of zebrafish ndrg4 cDNA) was used as a template. ventricular canal of the heart (Garrity et al., 2002). Consistent with this Imaging, histology and morphometric analyses observation, we find that ndrg4 expression in the developing heart is attenuated by hst mutants and tbx5 morphants. Further, we observed For histology, embryos were fixed overnight in 4% PFA in PBS at 4 °C and embedded that tbx5 overexpression by tbx20 knock-down results in increased in JB-4 resin (Polysciences, Warrington, PA) according to manufacturer’s instructions μ expression of ndrg4 in the heart, suggesting that ndrg4 may be and sectioned at 5 m, using an ultramicrotome. Serial sections were cut in transverse – fi fi orientation and stained with hematoxylin eosin. For photography, living zebra sh downstream of tbx5 activation. This study provides the rst demon- embryos, plastic tissue sections and whole-mount in situ hybridized embryos were stration of the crucial role for Ndrg4 in heart development and may photographed on an Axioplan microscope (Zeiss) using a digital camera (Dage). shed new insight into the molecular mechanisms and genetic etiology Cardiomyocyte number and cell size in ndrg4-MO2 injected and control transgenic of Holt–Oram syndrome (Bruneau et al., 2001). embryos were measured as described (Mably et al., 2003; Jia et al., 2007). One Tg(cmlc2: DsRed2-nuc) line (expressing RFP in cardiomyocyte nuclei) was used to measure myocardial cell number at 48 hpf. The second Tg(cmlc2:gfp) line (expressing GFP Materials and methods throughout the cardiomyocyte) was used to determine myocardial cell size at 48 hpf and myocyte number at 24 hpf. The Tg(cmlc2:DsRed2-nuc) line was not used for quantifying Cloning of zebrafish ndrg4 myocyte number at 24 hpf because RFP positive cells are hardly detectable at the heart tube stage (Mably et al., 2003). Briefly, myocyte number in the atrium and ventricle was We first predicted ndrg4 cDNA sequence according to mouse Ndrg4 cDNA, zebrafish determined by quantifying nuclei in 5 embryos from each group of ndrg4 morphants and htg data (AL772241 166073 bp DNA HTG 26-SEP-2003 Danio rerio clone CH211-194M7, control embryos. For clearly visualizing the margin of individual cell surface, embryos WORKING DRAFT SEQUENCE, 4 unordered pieces) and EST database using Blast and were flat mounted between two micro cover glasses and were subjected to confocal gene prediction tools (Gene finder, Genscan, GenomeScan, FGENESH). Following reverse imaging using 40× planapochromat of Zeiss LSM 510 confocal microscope system. Cell transcriptase PCR (RT-PCT) with the specific primers (5′-TTGCTTTCCTGCATCCGATTG- sizes of 150 individual cardiomyocytes from each group of ndrg4 morphants and control CAA-3′ and 5′-GAGGTGAAGGCTAGAGGCAGCAAG-3′), we cloned the 1800 bp fragment embryos were measured using Image J. Numbers of cardiomyocytes from flat-mounted into pCRII-TOPO vector (Invitrogen). Sequencing of three individual clones revealed embryos at 24 hpf were counted in each confocal section using Pickpointer embedded in identical, full-length cDNA sequence of zebrafish ndrg4, which has been deposited in the Image J. Pickpointer permits a single user-defined mark to appear through z stacks of GenBank with the accession number DQ649010. images, allowing the tracking of a single cell in overlapped z sections to avoid double counting. Zebrafish and microinjection Analysis of cell proliferation All zebrafish and embryos were maintained at 28.5 °C and staged as previously described (Kimmel et al., 1995). The tbx5 mutant hst was maintained by outcrossing to Cell proliferation in the zebrafish heart was analyzed as previously described standard wild-type lines (Garrity et al., 2002). Wild-type, transgenic Tg(cmlc2:gfp) (Shin et (Ribeiro et al., 2007). Briefly, the ndrg4-MO2 injected or control Tg(cmlc2:gfp) embryos al., 2005) or transgenic Tg(cmlc2:DsRed2-nuc) embryos (Mably et al., 2003) primarily at the at 31 hpf or 48 hpf were injected with 2 nl 100 mM BrdU in the pericardiac cavity region 1-cell stage with chorion intact were injected with approximately 2 nl volume of mor- of tricaine anesthetized embryos. These embryos were fixed after 1 h incubation in pholino oligonucleotide, mRNA or DNA in Danieau buffer (Nasevicius and Ekker, 2000). medium containing BrdU at 28.5 °C. The embryos were then treated with acetone for Morpholino antisense oligonucleotides were purchased from Gene-Tools (Corvallis, 10 min and digested in 0.25% trypsin in PBS without Mg2+ and Ca2+. Hydrochloric acid OR). ndrg4-MO1 (5′-CCAGCACTCCGGCATGGTAGCTTAG-3′) was designed against the (HCl) was used to treat the embryos for 1 h at room temperature. After extensive ndrg4 translational start site. ndrg4-MO2 (TGCATTCATCTTACCCTTGAGGCAT) is a splice- washing, double whole-mount immunofluorescence was performed using anti-BrdU blocking MO, which targets the exon 3 and intron 3 splice junction of ndrg4 pre-mRNA. antibody (1:400, Invitrogen) and anti-GFP antibody (1:400, Invitrogen) as primary We used two sets of control MOs: 1) Standard control MO (5′-CCTCTTACCTCAGTTA- antibodies, and goat anti-mouse Cy3 antibody (1:200, Invitrogen) and Alexa 488 CAATTTATA-3′) and 5mis control MO, which is a 5 bp mismatch of ndrg4-MO2 (5′- donkey anti-rabbit antibody (1:200, Invitrogen) as secondary antibodies. The BrdU TGgATTgATCTTAgCCTTcAGGgAT-3′, lower case letters indicate altered bases). To test the labeled embryos were then stripped of their head, oriented in solidifying 0.5% agarose efficiency of the ndrg4-MO2, RT-PCR was performed using whole-embryo RNA from and the heart region was confocal imaged using a Zeiss LSM510 microscope system. ∼30 embryos at 48 hpf, using the primers, P1 (5′-ATGCCGGAGTGCTGGGATGG-3′ and P2 (5′-AGCCCCAACTCCAATTCCGAC-3′) to detect the end ndrg4 mRNA transcripts from MO treatment. The tbx5-MO 5′-GAAAGGTGTCTTCACTGTCCGCCAT-3′ (Garrity et al., 2002) Results and the tbx20-MO 5′-CTCATGTGGAGAAGGGGTTTTGGAG-3′ (Szeto et al., 2002)have been previously described. Cloning and sequence analysis of zebrafish ndrg4 To test the efficiency of the ndrg4-MO1, a transgenic construct driving expression of an Ndrg4–EGYP fusion protein by the cmlc2 promoter was made (details available on fi request). Briefly, the cmlc2 minimal promoter (244 bp) was cut from pGEM-210/34 In order to investigate the potential function of Ndrg4 in zebra sh (Huang et al., 2003) and the EYFP fragment was isolated from pEYFP-N1 (BD Biosciences heart development, we cloned a single full-length cDNA of ndrg4 from 488 X. Qu et al. / Developmental Biology 317 (2008) 486–496 adult zebrafish heart. Zebrafish ndrg4 contains an open reading frame 21-somite stage (Fig. 1C). At these stages, ndrg4 expression is marked capable of encoding a 339 amino acid polypeptide, a 101-bp 5′-UTR, in the CNS but is almost undetectable in cardiac tissues (Figs. 1B, D). and a 679-bp 3′-UTR. Sequence analysis revealed that the amino acid However, by 24 hpf, ndrg4 expression resembles cmlc2 in occurring sequence of zebrafish Ndrg4 protein shows a high degree of conserv- uniformly throughout the heart tube (Figs. 1E, F). Subsequently, as the ation (identities: 87%, positives: 94%) with mouse Ndrg4 (see Supple- heart tube undergoes looping morphogenesis, robust ndrg4 expression mental data). There is a typical α/β hydrolase fold as in other NDRG continues throughout the heart with strong expression detected in the proteins (Qu et al., 2002). Homology searches with the current zebra- ventricle (Figs. 1G–L). The expression of ndrg4 persisted in the heart at fish genomic database with the entire ndrg4 cDNA revealed one iden- 72 hpf (Fig. 1M), the later embryonic period and the adult heart (RT- tical match on chromosome 25 (NC_007136.1) (data not shown), while PCR, data not shown). Thus, the temporally-regulated cardiac expres- no other significant alignment was observed with any other zebrafish sion pattern suggests Ndrg4 is not required for early specification of genomic sequence. The zebrafish ndrg4 gene includes 12 exons and cardiac progenitors, but may play a later role in chamber formation, spans 26 kb. organ growth and remodeling. Initially, ndrg4 was expressed throughout CNS, from the 10-somite Expression profile of ndrg4 in early zebrafish development through 14-somite stages (Figs. 1B and 2A). By the 21-somite stage, its expression in CNS was restricted to the telencephalon, ventral dien- Whole mount in situ hybridization indicated an unexpected ex- cephalons and spinal chord (Fig. 2B). Subsequently (at 22–72 hpf), pression of ndrg4 in the developing zebrafish heart. For comparison, expression was accentuated in cranial ganglia (trigeminal ganglion, we used the pan-cardiac marker cmlc2 to identify cardiac tissues at anterior lateral line ganglion and posterior lateral line ganglion), various stages. As we and others (Yelon et al., 1999; Yelon, 2001) hindbrain neuron cells, tegmentum and cerebellum (Figs. 2C–I). By 33– observed, cmlc2 is significantly expressed in the bilateral cardiac pri- 72 hpf, prominent expression occurs in the retina but no expression mordia at the 14-somite stage (Fig. 1A) and in the cardiac cone at the within the retinal proliferative zone (Fig. 2H).

Ndrg4 inhibition causes heart defects

To determine the role of Ndrg4 in zebrafish development, we designed two morpholino antisense oligonucleotides: 1) one to block the translation of ndrg4 (ndrg4-MO1) and another to knockdown Ndrg4 function by blocking RNA splicing (ndrg4-MO2). To test the efficacy of ndrg4-MO1, we developed a transgenic construct driving expression of an Ndrg4–EYFP fusion protein under control of the cmlc2 promoter (Huang et al., 2003), which includes the hybridization homology region targeted by ndrg4-MO1. After injection of this linearized DNA with 6.4 ng of control MO into 1-cell stage fish embryos, green fluorescent signal due to Ndrg4–EYFP expression in cardiomyocytes was observed in 7.9% of injected embryos (n=108) at 48 hpf. By contrast, injection of the Ndrg4–EYFP DNA in the presence of 6.4 ng of ndrg4-MO1 resulted in the absence of EYFP expression in all injected fish (n=155) (see Supplemental data). These experiments demonstrate that ndrg4-MO1 is able to specifically block the translation of the ndrg4 gene. To further demonstrate that the morphant phenotypes were the result of specific loss of the ndrg4 gene function, we tested ndrg4-MO2, which binds to the exon 3/intron 3 splice junction (Fig. 3A). Because ndrg4-MO2 could result in either exon deletion or intron insertion in ndrg4 mRNA, we harvested embryos injected with sequential concentrations of morpholino and checked mRNA by RT-PCR with specific primers as noted. As seen in Fig. 3B, gradual increase in MO2 resulted in a progressive loss of exon 3 (121 bp). The 224 bp band was confirmed by sequencing to directly join exon 2 and exon 4 (Fig. 3C). Injection of 6.4 ng of MO2 resulted in complete exclusion of exon 3 from the ndrg4 mRNA in the injected embryos, resulting in a shift of the reading frame and creation of an early stop codon. However, there was no inhibition of ndrg4 splicing in embryos injected with 6.4 ng of a 5 bp mismatch control ndrg4-MO. Thus, ndrg4-MO2 blocked the splicing of zebrafish ndrg4 in a dose-dependent and highly specific manner. In our initial injection experiments, both morpholino oligonucleotides caused the same phenotype at a range of 3.2 to 6.4 ng with Fig. 1. Whole mount zebrafish embryos processed for in situ hybridization using cmlc2 nonspecific effects observed at higher doses (data not shown). Since at – fi (A, C, E) or ndrg4 (B, D, F M) speci c anti-sense RNA probes. cmlc2 is expressed in the the same high concentration (N6.4 ng), MO2 was less toxic than MO1, bilateral cardiac primordia at the 14-somite stage (A), in the cardiac cone at the 21- somite stage (C) and in the heart tube at the 24 hpf (E). The first significant indication of we used MO2 in the following experiments. At 6.4 ng/embryo of ndrg4- ndrg4 cardiac expression occurs in the heart tube (arrow) at 24 hpf (F) and at 33 hpf (G). MO2, we consistently obtained morphants that had defects in the ndrg4 is robustly expressed in both atrium and ventricle at 36 hpf (H), 48 hpf (I–L) and hearts and heads (89%, n=180) but overall normal development. 72 hpf (M) with stronger signal in the ventricle. (J) Transverse section showing strong Although the morphology of the initial heart tube of ndrg4 morphants expression of ndrg4 in the ventricle at 48 hpf. (L) Higher magnification of the indicated at 24–33 hpf is indistinguishable from wild type, abnormal cardiac heart region in panel K. (A–D) Dorsal views with anterior towards the top; (E–G, K, L) fi lateral views; (H, I, M) frontal views with anterior towards the top. a, atrium; v, development was visible in ndrg4-MO2 injected zebra sh embryos ventricle. Arrow indicates heart or heart region. after 36-h development (data not shown). By 48 hpf and 3 days post- X. Qu et al. / Developmental Biology 317 (2008) 486–496 489

Fig. 2. Expression of ndrg4 during zebrafish nervous system development by whole mount in situ hybridization. (A) ndrg4 was observed for the first time in the CNS at the 10-somite stage. (B) By 21-somites, ndrg4 is expressed in telencephalon, ventral diencephalon and spinal chord. (C–E) similar expression patterns of ndrg4 in CNS and sensory system at 22– 27 hpf. Expression of ndrg4 in nervous system is increased at 33 hpf (F), 48 hpf (G) and 72 hpf (I). (H) Transverse section at 48 hpf showing the strong signal in the retina of the eyes with restriction of expression from the retina proliferative zone (rpz). (A, C–E,G) Dorsal views with anterior towards the left; (B, F, H), lateral views. allg, anterior lateral line ganglion; ce, cerebellum; di, diencephalons; pllg, posterior lateral line ganglion; rm, rhombomeres; teg, tegmentum; tel, telencephalon; trg, trigeminal ganglion. fertilization (dpf), the hearts of ndrg4 morphants showed pericardial pical defects seen in ndrg4 moprhants in less than 5% of the standard edema, dilated atrium, looping defects, reduced circulation, and slower control and 8% of the mismatch control embryos. heart rate with weaker contraction compared to their control siblings Another important criteria in determining the specificity of any (Figs. 4A–D; also see Movies 1 and 2 in Supplemental data). The heart antisense approach is rescue of observed defects by expression of gene rate of ndrg4 morphant embryos (101±38 beats/min, n=8) at 48 hpf is specific RNA. Therefore, we simultaneously injected capped ndrg4 75.1% of the control (135±27 beats/min, n=6). In addition, ndrg4 mor- mRNA along with ndrg4-MO2. In rescue experiments, when 100 pg/ phants also displayed defects in the development of their heads in- embryo of ndrg4 mRNA was injected with 6.4 ng ndrg4-MO2 into 1- cluding small eyes and prominent edema in the hindbrain. Thus, the cell zebrafish embryos, about 50% (78/156) of the injected embryos defects in the morphants are consistent with the expression pattern of displayed no or less severe cardiac defects at 48 hpf (Fig. 4E) compared ndrg4. To demonstrate that these results were not due to an injection to that for ndrg4-MO2 only, in which 92% (228/248) of injected em- artifact, we injected 1-cell embryos with a standard control MO or a 5 bryos showed the typical cardiac phenotype described above. Injection base-pair mismatch control MO of ndrg4 at a concentrations 10 ng/ of ndrg4 mRNA (100 pg) alone did not induce heart defects. Thus, the embryo. This caused non-specific abnormalities distinct from the ty- cardiac phenotype in ndrg4 morphants could be ameliorated in about

Fig. 3. Validation of ndrg4-MO2 (knockdown by splice-blocking). (A) Schematic of the strategy to target the exon3–intron3 boundary with ndrg4-MO2. Arrows represent primers used in the RT-PCR to test the efﬁciency of ndrg4 splice-blocking MO2 and the orange bar represents the ndrg4-MO2. (B) The RT-PCR was performed on wild-type embryos and embryos injected with 3.2–12.0 ng of the ndrg4-MO2. The ndrg4-MO2 efﬁciently blocks ndrg4 mRNA splicing by exon3 deletion in a dose-dependent manner. Bands of 345 bp and 224 bp represent wildtype and exon3-deleted ndrg4 mRNA, respectively. (C) Sequencing of the 224 bp band reveals direct connection of exon 2 and exon 4. 490 X. Qu et al. / Developmental Biology 317 (2008) 486–496

Fig. 4. ndrg4 morphant phenotypes. Lateral views at 48 hpf. (A, B) The overall morphology of an uninjected (A) and ndrg4-MO2-injected (B) embryos. Compared to its sibling (C), ndrg4-MO2 injected embryo (D) displays pericardial edema, dilated atrium, unlooped, stretched heart and head defects (smaller eyes and prominent edema in the hindbrain). (E) Co- injection of ndrg4 mRNA with ndrg4-MO2 signiﬁcantly rescued the cardiac, eye and brain phenotype induced by ndrg4 inhibition.

45.5% of the co-injected embryos. The eye size and head defects in MO define abnormalities in looping of the heart, we injected transgenic Tg injected embryos was also partially rescued by mRNA injection (Fig. (cmlc2:gfp) embryos with ndrg4-MO2 and evaluated heart looping at 4E). Therefore, we conclude that the specific morphant phenotypes sequential stages of development. At 36 hpf, the heart tube of control produced by ndrg4-MO2 result primarily from the selective inhibition zebrafish embryos loops to the right, whereas the heart tube in ndrg4 of Ndrg4. morphants remains central and linear in a tubular structure (data not shown). By 48 hpf and 3 dpf, there was no obvious perturbation in Defective cardiac looping in ndrg4 morphants cmlc2-driven GFP expression in ndrg4 morphants when compared to the control, but there was an obvious defect in looping as the heart As described above, one of the prominent morphological defects in continued to retain its linear configuration, midline orientation, and the ndrg4 morphant heart is failure to complete looping. To further circulation was depressed (Fig. 5). In histological sections of ndrg4-

Fig. 5. Attenuation of Ndrg4 results in early looping abnormalities. The cmlc2-driven GFP is expressed in cardiomyocytes of transgenic Tg(cmlc2:gfp) embryos. At 2 dpf (A–D) and 3 dpf (E–H), compared to the clearly looped heart of uninjected Tg(cmlc2:gfp) embryos (A, C, E, G), the heart of ndrg4 morphant (B, D, F, H) remained central and linear in a tubular structure. (A, B, E, F), Lateral views with anterior towards the left; (C, D, G, H), frontal views with anterior towards the top. a, atrium; v, ventricle. X. Qu et al. / Developmental Biology 317 (2008) 486–496 491

MO2 injected embryos, we found that at 2 dpf (data not shown) and at embryos with ndrg4-MO2. We decided to quantify cell number at 3 dpf, the overall size of ventricle and atrium was markedly smaller 48 hpf, the earliest stage in which cardiac morphology was overtly than age-matched controls (Figs. 6A, B). In addition, sections showed different from wild-type. As shown in Figs. 6C–E, ndrg4-MO2 injected that regions of local cell proliferation around the outflow tract and Tg(cmlc2:gfp) embryos at 2 dpf showed a significant reduction in the atrioventricular (AV) junction were less extensive in morphants than number of cardiomyocytes in both chambers (atria and ventricle) wild-type. The extracellular matrix between myocardium and endo- when compared to controls: myocyte number in atrium and ventricle cardium in the atrium was enlarged compared to age-matched wild- of injected fish was reduced by 36.1% (97±11 vs. 62±6) and 18.5% type embryos. (173±11 vs. 141±14) respectively (Fig. 6E). To determine the potential effect of Ndrg4 inhibition on myocyte size, we treated Tg(cmlc2:gfp) Attenuation of Ndrg4 results in reduced myocyte number and cell size embryos with ndrg4-MO2 and measured their cell size at 48 hpf with confocal imaging. We found only a slight reduction (10.3%) in myocyte The smaller overall size of the cardiac chambers in ndrg4 morõ- size (area) in ndrg4 morphants in comparison with control (193.2± phants suggests a possible primary defect in proliferation and/or size 8.5 μM2 vs. 215.3±4.5 μM2, PN 0.05) (Figs. 6F–H). of cardiomyocytes. To address this question directly, we determined We questioned whether the number of cardiomyocytes in ndrg4 myocyte cell number and size using confocal microscopic analysis after morphants was decreased at even earlier stages and thus reduction in injection of the transgenic Tg(cmlc2:DsRed2-nuc) and Tg(cmlc2:gfp) the myocyte number at 48 hpf might reflect a decrease in initial myo-

Fig. 6. Attenuation of Ndrg4 results in smaller cardiac chambers and a reduction in the number of cardiomyocytes. Transverse sections of 3 dpf wild-type (A) and ndrg4 morphant (B) heart. Outflow tract (blue arrows), AV junction (black arrows) and the enlarged space (arrowheads) between myocardium and endocardium in the dilated atrium are indicated. Note only a few blood cells in the MO treated heart. Confocal images of the heart of control (C) and ndrg4-MO2 injected (D) Tg(cmlc2:DsRed2-nuc) embryos at 2 dpf. (E) Comparison of the numbers of cardiomyocytes in un-injected and ndrg4-MO2 injected embryos at 2 dpf (Data are from 5 control and 5 injected embryos and are expressed as means±S.D. *Pb0.05). Confocal images of the heart of control (F) and ndrg4-MO2 injected (G) Tg(cmlc2:gfp) embryos at 2 dpf. (H) Comparison of the size of cardiomyocytes in control and ndrg4-MO2 injected embryos at 2 dpf. There was no change in myocardial cell number between control (I) and ndrg4-MO2 (J) injected Tg(cmlc2:gfp) embryos at 24 hpf based on the number of GFP positive cells in the heart: 182±16 vs. 177±12, respectively (Data are from 5 embryos for each group and are expressed as means±S.D.) a, atrium; v, ventricle; control, mismatch-MO. 492 X. Qu et al. / Developmental Biology 317 (2008) 486–496 cyte differentiation. Therefore, we injected Tg(cmlc2:gfp) embryos with 24 hpf, expression of cmlc2, nkx2.5, hand2 and gata4 in the developing ndrg4-MO2 and measured myocyte number in control and morphant heart tube of ndrg4-MO2 injected embryos was indistinguishable from embryos at 24 hpf. We found no attenuation in myocardial cell number un-injected embryos (Figs. 8A, B and data not shown). By 33 hpf, ndrg4 between control (182±16; n=5;Fig. 6I) and ndrg4-MO2 (177±12; n=5; morphants also showed normal expression of tbx5, nppa and cmlc2 Fig. 6J) injected Tg(cmlc2:gfp) embryos based on the number of GFP (Figs. 8C–H), indicating that myocardial differentiation proceeded positive cells in the heart tube. Thus, we conclude that attenuation of normally in ndrg4-morphant embryos. To examine cardiac chamber Ndrg4 did not result in a decrease in early myocyte differentiation. formation in ndrg4 morphants, we analyzed the expression of two pan- cardiac markers cmlc2 and nppa, as well as the ventricular marker Ndrg4 reduction attenuates cardiomyocyte cell proliferation vmhc (Yelon et al., 1999), and the atrial marker amhc (Berdougo et al., 2003). We detected no abnormalities in the expression levels of these The reduced myocyte number in ndrg4 morphants prompted us to chamber specific molecular in the ndrg4 MO knockdown embryos (Fig. investigate myocyte cell proliferation and apoptosis during 1–2 dpf. At 8). These data suggest that atrial and ventricular specification occurred 33 hpf or 48 hpf, there was not a significant number of apoptotic cells normally in ndrg4-MO2 injected embryos. observed in the heart of control or ndrg4-MO2 treated embryos by To investigate whether cardiomyocytes are properly differentiated, TUNEL assay, although there was a clear increase in apoptosis within we analyzed two genes (versican and bmp4) which are initially ex- the developing CNS in ndrg4-MO2 treated embryos at 48 hpf (data not pressed broadly in the wild-type ventricle but later (by 48 hpf) become shown). To determine myocyte proliferation in the early developing highly restricted to the AV junction (Walsh and Stainier, 2001). In heart we gave a one-hour pulse of BrdU by injecting a BrdU solution in contrast to wild-type (Fig. 8O), ndrg4-MO2 injected embryos (41 of 46 the pericardiac cavity (Ribeiro et al., 2007). As shown in Fig. 7, at 31 hpf morphants examined at 48 hfp) showed dispersed expression of ver- the number of BrdU positive cells in ndrg4-MO2 treated embryonic sican throughout the ventricle, similar to what is ordinarily observed in heart (21.0±3.0; n=5) is comparable to control (23.1±3.5; n=5). This 33 hpf wild-type hearts (Fig. 8P). In contrast, the punctate expression result is consistent with the normal heart development of ndrg4 mor- of versican in the otoliths is characteristic of embryos at 48 hpf (Garrity phants at this stage. However, at 48 hpf ndrg4-MO2 injected embryos et al., 2002), and indicates that morphants are not subject to a general (15.8±2.9; n=5) display lower number of proliferating cells than developmental delay. Similarly, bmp4 marked the developing AV canal control (35.1±5.3; n=5) in the developing heart. Because, the total in 48 hpf wild-type zebrafish embryos (Fig. 8S), whereas ndrg4-MO2 number of cardiomyocytes (Fig. 6)inndrg4 morphants (203±9) at treated embryos (Fig. 8T) showed diffusely distributed bmp4 in the AV 48 hpf is lower than control (260±11), we calculated the proliferation canal and ventricular regions. Thus, ndrg4 appears to be required for index (the average of the total number of BrdU positive cells per 100 molecular patterning of the atrio-ventricular canal. cardiomyocytes). Hearts of ndrg4 morphants at 48 hpf had a significantly lower proliferative index than control embryos (7.8±2.1 vs. Regulation of ndrg4 by Tbx5 13.5±3.9; Pb0.01). Therefore, attenuation of Ndrg4 resulted in a decrease in both myocyte proliferation and myocyte cell number at The phenotype of our ndrg4 morphants was remarkably similar to 48 hpf that was not detected during early cardiac development at that described for the hst mutants (normal myocyte specification, ab- 24 hpf. Taken together, these data indicate an essential requirement normal looping, weak contractility, abnormal restriction of versican for Ndrg4 in regulation of myocardial proliferation and cardiac growth and bmp4 expression) which lacks functional Tbx5 (Garrity et al., during early cardiogenesis suggesting that cell growth and cell 2002). In addition, expression of tbx5 (Begemann and Ingham, 2000) division are tightly coupled in the embryonic heart. precedes the expression of ndrg4 in the heart field. Because tbx5 is a key transcription factor that regulates cardiac morphogenesis and Normal cardiac chamber formation but abnormal AV canal gene expression within the developing heart (Basson et al., 1999; Horb differentiation in ndrg4 morphants and Thomsen, 1999; Bruneau et al., 2001; Garrity et al., 2002), we wished to determine the relationship between ndrg4 and tbx5 in re- ndrg4 morphants formed an overtly normal heart tube, despite gulation of versican and bmp4 in heart. We first injected wild type 1- expression of ndrg4 in the heart already at this stage. Moreover, at cell embryos with tbx5-MO and checked ndrg4 expression with whole

Fig. 7. Attenuation of Ndrg4 induces a reduction in cell proliferation of the cardiomyocytes. Although no signiﬁcant difference in the number of BrdU positive cells between control (A) and ndrg4-MO2 treated (B) embryonic hearts at 31 hpf has been detected, ndrg4-MO2 injected embryos (D) display lower number of proliferating cells than control (C) in the heart at 48 hpf. All images represent reconstructions of confocal Z-stack sections imaged on whole hearts. Green, anti-GFP antibody; Red, anti-BrdU antibody. (E) Histogram showing proliferation index (the average of the total number of BrdU positive cells in per 100 cardiomyocytes) in the heart of 48 hpf embryos: control,13.5±3.9; ndrg4-MO2, 7.8±2.1 (*Pb0.01). X. Qu et al. / Developmental Biology 317 (2008) 486–496 493

Fig. 8. Effect of ndrg4 knock-down on cardiac gene expression. At 24 hpf and at 33 hpf heart tube, no alternation was detected in cmlc2 (A, B, E, F), tbx5 (C, D) or nppa (G, H) expression level between wild-type (A, C, E, G) and ndrg4 morphants (B, D, F, H) with whole mount in situ hybridization. Note normal jogging out in the heart of morphants. At 48 hpf heart, no change was observed in vmhc (I, J), cmlc2 (M, N), amhc (Q, R) and nppa (K, L) expression level between wild-type (I, K, M, O, Q, S) and ndrg4 morphant (J, L, N, P, R, T). nppa and cmlc2 are expressed throughout the heart, vmhc is expressed in the ventricle and amhc is expressed in the atrium. Note the unlooped heart of ndrg4 morphant (N). At 48 hpf, versican is expressed at the boundary of the atrium and the ventricle (arrow) in wild type embryos (O), but is expressed throughout ndrg4 morphrant hearts (P). bmp4 expression is also prominent in the myocardial region of AV junction (between the arrows) in 48 hpf wild type zebrafish embryos (S), whereas ndrg4-MO2 injection resulted in strong ectopic expression of bmp4, especially in the ventricular region (T, arrowhead). (A, B) Dorsal views with head towards the top; (C–H), Lateral views with anterior towards the left; (I–T), frontal views with anterior towards the top. mount in situ hybridization. In tbx5 morphants at 35 hpf and 48 hpf, significantly higher than control. As we expected, compared to control we observed that ndrg4 expression in the embryonic heart was embryos, ndrg4 expression in tbx20 morphants is correspondingly significantly decreased (Figs. 9B, E), with no change in ndrg4 increased at 33 hpf or at 48 hpf. These data are consistent with the expression in the CNS and sensory system where ndrg4, but not hypothesis that Tbx5 acts to regulate the levels of ndrg4 expression tbx5, is expressed (data not shown). We then examined ndrg4 expres- during heart development and suggest that ndrg4 may be a down- sion in hst embryos to confirm this effect of loss of Tbx5 function. As stream target of tbx5 activation. can be seen in Fig. 9, at 35 hpf and 48 hpf, there appears to be a marked attenuation of ndrg4 expression in the heart of hst mutant embryos. Discussion Since tbx5 expression is down regulated by Tbx20 in early development of the zebrafish heart (Szeto et al., 2002), we injected wild- ndrg4 is conserved and expressed during cardiac development type embryos with tbx20-MO to induce tbx5 overexpression. As shown in Fig. 10, consistent with the previous report (Szeto et al., 2002), tbx5 We have cloned and characterized ndrg4, a novel member of the expression in tbx20-MO injected embryos at 33 hpf or at 48 hpf is ndrg family from zebrafish. Homology analysis reveals that the NDRG4 494 X. Qu et al. / Developmental Biology 317 (2008) 486–496

cardium of the developing heart and CNS with increased expression in the postnatal period and the adult (Okuda and Kondoh, 1999; Qu et al., 2002; and data not shown). The conservation of ndrg4 gene expression in the developing hearts may suggest an evolutionarily conserved function as well.

Abnormal cardiac defects in ndrg4 morphants

Prior to the onset of cardiac looping, cardiogenesis progresses normally in ndrg4 morphants, indicating that there is no essential requirement for Ndrg4 function in the very early stages of heart development. Although the dysmorphic hearts in the ndrg4 morphants appeared to form two distinct chambers, the heart remained as a linear tube and did not form the characteristically looped structure, resulting in a weakly contractile heart with a slower rhythm. Reduction of Ndrg4 results in a significant decreased number of cardiomyocytes by 48 hpf. Because ndrg4 is not expressed during early myocardial differentiation from the mesoderm, the reduction in myocyte number is unlikely to result from a defect in cardiomyocyte commitment. The normal expression of cardiac markers cmlc2, nppa – – Fig. 9. ndrg4 is down regulated by Tbx5 attenuation. At 35 hpf (A C) and 48 hpf (D F), and tbx5 at 33–48 hpf indicates that a degree of myocardial differ- compared with uninjected (A, D) embryos, ndrg4 expression (whole mount in situ hybridization) in tbx5-MO injected (B, E) or hst mutant (C, F) embryos was dramatically entiation and chamber maturation does occur in ndrg4 morphants, decreased. Arrow indicates heart region. a, atrium; v, ventricle. All are frontal views although continued differentiation is compromised and heart function with anterior towards the top. deteriorates with time. While we found no significant changes in apoptosis at these early protein is highly conserved across vertebrates. During development, stages of myocardial development, we were able to detect a decrease in spatial and temporal regulation confines the ndrg4 expression to the myocardial cell number at 48 hpf. In addition, we documented that at forming heart and nervous system. Specifically, ndrg4 is expressed in 48 hpf ndrg4-MO2 injected embryos display significantly lower num- the developing heart from 24 hpf with increased expression in the ber of proliferating cells than control in the heart, although the number later period and in the adult heart (XQu and HSB, unpublished). Once of BrdU positive cells in ndrg4-MO2 treated embryonic heart at 31 hpf the heart tube is formed, several key cardiogenic events occur in rapid is indistinguishable from control. Consistently, ndrg4 expression in succession (Stainier et al., 1993; Stainier, 2001), including looping zebrafish heart is not significant before 24 hpf and abnormal cardiac morphogenesis by 30 hpf, delineation of visibly distinct atrial and development in ndrg4-MO2 injected zebrafish embryos was only ventricular chambers by approximately 36 hpf, formation of the visible after 36 hpf. Therefore, the decrease in myocyte number in cardiac cushions, or AV valve analogue at approximately 48 hpf, and ndrg4 morphants is primarily due to the reduced myocyte proliferation myocardial proliferative growth from 48 hpf. Thus, ndrg4 is expressed suggesting that Ndrg4 is required for maintenance of normal cell during the later critical stages of cardiac morphogenesis and proli- proliferation after formation of the heart tube. ferative growth (Srivastava and Olson, 2000; Yelon et al., 1999; Of note, expression of NDRG2, which is most closely related to Stainier, 2001). Interestingly, in mouse, unlike the rather ubiquitous NDRG4, as well as NDRG1, has been documented to reduce cell growth expression of Ndrg1–3, Ndrg4 is expressed predominantly in the myo- in vitro (Kurdistani et al., 1998; Guan et al., 2000; Deng et al., 2003).

Fig. 10. ndrg4 is up regulated by Tbx5 augmentation via tbx20-MO. Compared to uninjected embryos, tbx5 and ndrg4 expression in tbx20-MO injected embryos at 33 hpf (A–D; lateral views with anterior towards the left) and 48 hpf (E–H; frontal views with anterior towards the top) was signiﬁcantly increased. Arrow indicates heart and arrowhead indicates ventricle of heart. X. Qu et al. / Developmental Biology 317 (2008) 486–496 495

Recently, NDRG1/Rit42 protein was shown to associate with the rafish heart (Szeto et al., 2002), therefore we investigated if tbx5 over- microtubules in centrosomes and to participate in the spindle check- expression in heart by Tbx20 reduction could induce ndrg4 expres- point (Kim et al., 2004). Interestingly, NDRG4 may regulate neural cell sion. Indeed, we observed that ndrg4 expression in tbx20 morphant proliferation and differentiation via the Ras-ERK pathway (Ohki et al., heart is increased at 33 hpf or at 48 hpf. These data further suggest 2002; Hongo et al., 2006). The human NDRG4 (smap8) was suggested that Tbx5 acts to regulate the level of ndrg4 expression during the to play a role in PDGF-induced mitogenesis of a rat aortic smooth heart development, and that ndrg4 is potentially a novel downstream muscle cell line by amplification of the ERK (extracellular signal- target of tbx5 activation and may be at least partially responsible for regulated kinase) signal (Nishimoto et al., 2003). Therefore, these data the defects observed in hearts of tbx5 null mutant animals. Since Tbx5 from cell culture assays are consistent with our in vivo data suggesting is not expressed in the CNS, ndrg4 regulation in neural tissues pre- a potential role of Ndrg4 in proliferation. It is noteworthy that ver- sumably occurs by alternative mechanisms. tebrate NDRG4 shows high of amino acid sequence conservation (56%) To date, only a few cardiac specific genes have been identified as to Drosophila MESK2 (misexpression suppressor of dominant-negative Tbx5 target genes (Plageman and Yutzey, 2005; Stennard and Harvey, KSR, kinase suppressor of Ras), a gene product which may represent a 2005) while a myriad of genes have been recently identified by micro- new component of the Ras pathway or of other signaling pathways array analysis to be affected by alteration in Tbx5 dosage (Mori et al., that can modulate signaling by Ras (Huang and Rubin, 2000). The 2006; Plageman and Yutzey, 2006). Interestingly, Ndrg4 has not been involvement of the Ras pathway in heart development has been well identified as a downstream target in any of these previous studies. As documented. Ras is implicated in hypertrophic growth of the myo- the mechanism by which TBX5 haploinsufficiency causes cardiac cardium (Clerk and Sugden, 2000; Sugden, 2003) and in valve form- abnormalities seen in Holt–Oram syndrome is still not well under- ation (Lakkis and Epstein, 1998; rev in Yutzey et al., 2005). Thus, it is stood, it will be of great interest to determine if there is a genetic link tempting to speculate that Ndrg4 might regulate heart development between NDRG4 gene and congenital heart disease. The observation via Ras pathway but clearly further investigation is warranted. that NDRG4 expression is induced by homocysteine (Nishimoto et al., 2003) leads to further speculation that it might be involved in the ndrg4 is downstream of tbx5 increased incidence of congenital heart disease in offspring of mothers with defects in homcysteine metabolism (Boot et al., 2003; Hobbs et al., The T-box transcription factor tbx5 has emerged as a key gene 2005). regulating heart development from amphibians to mammals (Horb In summary, this study is the first to demonstrate a role for ndrg4 in and Thomsen, 1999; Liberatore et al., 2000; Bruneau et al., 2001). cardiac development and provides the first functional study of Ndrg4 Mutations in human TBX5 are the cause of Holt–Oram syndrome, a in a vertebrate animal species. While not required for myocardial spe- haploinsufficient syndrome characterized by heart and forelimb cification and early differentiation, ndrg4 appears to play an important defects (Basson et al., 1999; Li et al., 1997), and dominant negative role in regulating myocyte cell proliferation and is required for normal interference of Xenopus tbx5 leads to near-total absence of differ- cardiac development in the fish. Further delineation of its potential entiated heart tissue and early cardiac markers (Horb and Thomsen, role in downstream mediation of Tbx5 signal transduction and its role 1999). Similar defects have been found in mice lacking one copy of the in atrioventricular canal morphogenesis will be the subject of con- Tbx5 gene (Bruneau et al., 2001). Mice lacking both copies of Tbx5 have tinuing investigation. more severe defects, including an absence of heart looping and alterations in a subset of cardiac-specific genes, although the early Acknowledgments steps in cardiac development appear normal (Bruneau et al., 2001). We were impressed that loss-of-function of Ndrg4 by MO knock- We thank Huai-Jen Tsai for the pGEM-210/34 plasmid; and Hae down in zebrafish closely phenocopies the cardiac defects in hst Chul Park, Karen McFarland and Jennifer Miller for help and advice mutant embryos (tbx5 mutants). Although tbx5 is expressed in the during this project. X. Q. was supported by an AHA post-doctoral developing heart earlier (Begemann and Ingham, 2000) than ndrg4, fellowship (0425408B). This research has been supported in part by a the heart of hst mutant embryos appears to form and function nor- zebrafish initiative funded by the Vanderbilt University Academic mally through the early heart tube stage, manifesting only a slight Venture Capital Fund. bradycardia compared with wild-type siblings (Garrity et al., 2002). The predominant cardiac defects of hst mutant embryos become evi- Appendix A. Supplementary data dent well after the development of discrete morphological chambers and after the onset of circulation. The heart fails to loop and then Supplementary data associated with this article can be found, in progressively deteriorates, a process affecting the ventricle as well as the online version, at doi:10.1016/j.ydbio.2008.02.044. the atrium. An intriguing observation in this study is that ndrg4 expression is References specifically reduced in the hearts of tbx5 mutants or morphants while Begemann, G., Ingham, P., 2000. Developmental regulation of Tbx5 in zebrafish ndrg4 expression in other regions of mutant embryos are unaffected. It embryogenesis. Mech. Dev. 90, 299–304. has been reported that other cardiac markers (nkx2.5, hand2, bmp4, Basson, C.T., Huang, T., Lin, R.C., Bachinsky, D.R., Weremowicz, S., Vaglio, A., Bruzzone, R., cmlc2 and vhmc) are normal in hst mutant embryos at the 15-somite Quadrelli, R., Lerone, M., Romeo, G., et al., 1999. Different Tbx5 interactions in heart and limb defined by Holt–Oram syndrome mutations. Proc. Natl. Acad. Sci. U. S. A. stage. Both vmhc and amhc are expressed normally in the heart in hst 96, 2919–2924. mutant embryos at 26 and 48 hpf (before and after overt chamber Berdougo, E., Coleman, H., Lee, D.H., Stainier, D.Y., Yelon, D., 2003. Mutation of weak formation). These data suggest that atrial and ventricular fates are atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular fi – assigned properly in hst mutant embryos (Garrity et al., 2002). There- morphogenesis in zebra sh. Development 130, 6121 6129. Boot, M.J., Steegers-Theunissen, R.P.M., Poelmann, R.E., Van Iperen, L., Gittenberger-de fore, reduction of ndrg4 expression in tbx5 mutant hearts is not just Groot, A.C., 2003. Cardiac outflow tract malformatins I chick embryos exposed to due to a general myocardial differentiation defect in tbx5 mutant homcysteine. Cardiovasc. Res. 64, 365–373. myocardium. Moreover, attenuation of either Tbx5 or Ndrg4 resulted Boulkroun, S., Fay, M., Zennaro, M.C., Escoubet, B., Jaisser, F., Blot-Chabaud, M., Farman, fi N., Courtois-Coutry, N., 2002. Characterization of rat NDRG2 (N-Myc downstream in abnormal upregulation of versican and bmp4 in zebra sh heart at regulated Gene 2), a novel early mineralocorticoid-specific induced gene. J. Biol. 2 dpf. Unfortunately, multiple attempts at tbx5 mRNA injection Chem. 277, 31506–31515. resulted in severe embryonic toxicity or lethality preventing analysis Bruneau, B.G., Schmitt, J.P., Charron, F., Robitaille, L., Caron, S., Conner, D.A., Gessler, M., Nemer, M., Seidman, C.E., Seidman, J.G., 2001. A murine model of Holt–Oram of subsequent alterations in the expression of Ndrg4. However, tbx5 syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and expression is down-regulated by Tbx20 in early development zeb- disease. Cell 106, 709–721. 496 X. Qu et al. / Developmental Biology 317 (2008) 486–496

Clerk, A., Sugden, P.H., 2000. Small guanine nucleotide-binding proteins and myocardial Nishimoto, S., Tawara, J., Toyoda, H., Kitamura, K., Komurasaki, T., 2003. A novel homo- hypertrophy. Circ. Res. 86, 1019–1023. cysteine-responsive gene, smap8, modulates mitogenesis in rat vascular smooth Deng, Y., Yao, L., Chau, L., Ng, S.S., Peng, Y., Liu, X., Au, W.S., Wang, J., Li, F., Ji, S., Han, H., muscle cells. Eur. J. Biochem. 270, 2521–2531. Nie, X., Li, Q., Kung, H., Leung, S.Y., Lin, M., 2003. N-Myc downstream-regulated Ohki, T., Hongo, S., Nakada, N., Maeda, A., Takeda, M., 2002. Inhibition of neurite gene 2 (NDRG2) inhibits glioblastoma cell proliferation. Int. J. Cancer 106, outgrowth by reduced level of NDRG4 protein in antisense transfected PC12 cells. 342–347. Brain Res. Dev. Brain Res. 135, 55–63. Garrity, D.M., Childs, S., Fishman, M.C., 2002. The heartstrings mutation in zebrafish Okuda, T., Kondoh, H.,1999. Identification of new genes ndr2 and ndr3 which are related causes heart/fin Tbx5 deiciency syndrome. Development 129, 4635–4645. to Ndr1/RTP/Drg1 but show distinct tissue specificity and response to N-myc. Guan, R., Ford, H.L., Fu, Y., Li, Y., Shaw, L.M., Pardee, A.B., 2000. Drg-1 as a differentiation- Biochem. Biophys. Res. Commun. 266, 208–215. related, putative metastatic suppressor gene in human colon cancer. Cancer Res. 60, Okuda, T., Higashi, Y., Kokame, K., Tanaka, C., Kondoh, H., Miyata, T., 2004. Ndrg1- 749–755. deficient mice exhibit a progressive demyelinating disorder of peripheral nerves. Hobbs, C.A., Cleves, M.A., Melnyk, S., Zao, W., James, S.J., 2005. Congenital heart defects Mol. Cell. Biol. 24, 3949–3956. and abnormal maternal biomarkers of methionine and homocysteine metabolism. Plageman Jr., T.F., Yutzey, K.E., 2005. T-box genes and heart development: putting the Am. J. Clin. Nutr. 81, 147–153. “T” in heart. Dev. Dyn. 232, 11–20. Hongo, S., Watanabe, T., Takahashi, K., Miyazaki, A., 2006. Ndrg4 enhances NGF-induced Plageman Jr., T.F., Yutzey, K.E., 2006. Microarray analysis of Tbx5-induced genes ERK activation uncoupled with Elk-1 activation. J. Cell. Biochem. 98, 185–193. expressed in the developing heart. Dev. Dyn. 235, 2868–2880. Horb, M.E., Thomsen, G.H., 1999. Tbx5 is essential for heart development. Development Qu, X., Zhai, Y., Wei, H., Zhang, C., Xing, G., Yu, Y., He, F., 2002. Characterization and 126, 1739–1751. expression of three novel differentiation-related genes belong to the human NDRG Huang, A.M., Rubin, G.M., 2000. A misexpression screen identifies genes that can gene family. Mol. Cell. Biochem. 229, 35–44. modulate RAS1 pathway signaling in Drosophila melanogaster. Genetics 156, Ribeiro, I., Kawakami, Y., Büscher, D., Raya, A., Rodríguez-León, J., Morita, M., Esteban, 1219–1230. C.R., Belmonte, J.C.I., 2007. Tbx2 and Tbx3 regulate the dynamics of cell proliferation Huang, C., Tu, C., Hsiao, C., Hsieh, F., Tsai, H., 2003. Germ-line transmission of a during heart remodeling. PLoS ONE 2 (4), e398. myocardium-specific GFP transgene reveals critical regulatory elements in the Ro, H., Soun, K., Kim, E.J., Rhee, M., 2004. Novel vector systems optimized for injecting in cardiac myosin light chain 2 promoter of zebrafish. Dev. Dyn. 228, 30–40. vitro-synthesized mRNA into zebrafish embryos. Mol. Cells 17, 373–376. Jia, H., King, I.N., Chopra, S., Wan, H., Jiang, C., Guan, X., Ni, T.T., Well, S., Srivastava, D., Shaw, E., McCue, L.A., Lawrence, C.E., Dordick, J.S., 2002. Identification of a novel class in Zhong, T.P., 2007. The GRIDLOCK and GATA5 transcription factors function anta- the alpha/beta hydrolase fold superfamily: the N-myc differentiation-related gonistically to regulate heart growth in the zebrafish embryo. Proc. Natl. Acad. Sci. proteins. Proteins 47, 163–168. U. S. A. 104, 14008–14013. Shimono, A., Okuda, T., Kondoh, H., 1999. N-myc-dependent repression of ndr1, a gene Kalaydjieva, L., Gresham, D., Gooding, R., Heather, L., Baas, F., de Jonge, R., Blechschmidt, identified by direct subtraction of whole mouse embryo cDNAs between wild type K., Angelicheva, D., Chandler, D., Worsley, P., Rosenthal, A., King, R.H., Thomas, P.K., and N-myc mutant. Mech. Dev. 83, 39–52. 2000. N-myc downstream-regulated gene 1 is mutated in hereditary motor and Shin, J.T., Priest, J.R., Ovcharenko, I., Ronco, A., Moore, R.K., Burns, C.G., MacRae, C.A., sensory neuropathy-Lom. Am. J. Hum. Genet. 67, 47–58. 2005. Human–zebrafish non-coding conserved elements act in vivo to regulate Kim, K.T., Ongusaha, P.P., Hong, Y.K., Kurdistani, S.K., Nakamura, M., Lu, K.P., Lee, S.W., transcription. Nucleic Acids Res. 33, 5437–5445. 2004. Function of Drg/Rit42 in p53-dependent mitotic spindle checkpoint. J. Biol. Srivastava, D., Olson, E.N., 2000. A genetic blueprint for cardiac development. Nature Chem. 279, 38597–38602. 407, 221–226. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of Stainier, D.Y., 2001. Zebrafish genetics and vertebrate heart formation. Nat. Rev., Genet. embryonic development of the zebrafish. Dev. Dyn. 203, 253–310. 2, 39–47. Kokame, K., Kato, H., Miyata, T., 1996. Homocysteine-respondent genes in vascular Stainier, D.Y., Lee, R.K., Fishman, M.C.,1993. Cardiovascular development in the zebrafish. endothelial cells identified by differential display analysis. GRP78/BiP and novel I. Myocardial fate map and heart tube formation. Development 119, 31–40. genes. J. Biol. Chem. 271, 29659–29665. Stennard, F.A., Harvey, R.P., 2005. T-box transcription factors and their roles in Kovacevic, Z., Richardson, D.R., 2006. The metastasis suppressor, Ndrg-1: a new ally in regulatory hierarchies in the developing heart. Development 132, 4897–4910. the fight against cancer. Carcinogenesis 27, 2355–2366. Sugden, P.H., 2003. Ras, Akt, and mechanotransduction in the cardiac myocyte. Circ. Res. Kurdistani, S.K., Arizti, P., Reimer, C.L., Sugrue, M.M., Aaronson, S.A., Lee, S.W., 1998. 93, 1179–1192. Inhibition of tumor cell growth by RTP/rit42 and its responsiveness to p53 and DNA Szeto, D.P., Griffin, K.J., Kimelman, D., 2002. HrT is required for cardiovascular damage. Cancer Res. 58, 4439–4444. development in zebrafish. Development 129, 5093–5101. Kyuno, J., Fukui, A., Michiue, T., Asashima, M., 2003. Identification and characterization Thisse, C., Thisse, B., Schilling, T.F., Postlethwait, J.H., 1993. Structure of the zebrafish of Xenopus NDRG1. Biochem. Biophys. Res. Commun. 309, 52–57. snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Lakkis, M.M., Epstein, J.A., 1998. Neurofibromin modulation of ras activity is required for Development 119, 1203–1215. normal endocardial–mesenchymal transformation in the developing heart. Devel- Walsh, E.C., Stainier, D.Y., 2001. UDP-glucose dehydrogenase required for cardiac valve opment 125, 4359–4367. formation in zebrafish. Science 293, 1670–1673. Li, Q.Y., Newbury-Ecob, R.A., Terrett, J.A., Wilson, D.I., Curtis, A.R., Yi, C.H., Gebuhr, T., Yelon, D., 2001. Cardiac patterning and morphogenesis in zebrafish. Dev. Dyn. 222, Bullen, P.J., Robson, S.C., Strachan, T., 1997. Holt–Oram syndrome is caused by 552–563. mutations in TBX5, a member of the Brachyury (T) gene family. Nat. Genet. 15, Yelon, D., Horne, S.A., Stainier, D.Y.R., 1999. Restricted expression of cardiac myosin 21–29. genes reveals regulated aspects of heart tube assembly in zebrafish. Dev. Biol. 214, Liberatore, C.M., Searcy-Schrick, R.D., Yutzey, K.E., 2000. Ventricular expression of tbx5 23–37. inhibits normal heart chamber development. Dev. Biol. 223, 169–180. Yelon, D., Ticho, B., Halpern, M.E., Ruvinsky, I., Ho, R.K., Silver, L.M., Stainier, D.Y.R., 2000. Mably, J.D., Mohideen, M.A., Burns, C.G., Chen, J.N., Fishman, M.C., 2003. heart of glass The bHLH transcription factor Hand2 plays parallel roles in zebrafish heart and regulates the concentric growth of the heart in zebrafish. Curr. Biol. 13, pectoral fin development. Development 127, 2573–2582. 2138–2147. Yutzey, K.E., Colbert, M., Robbins, J., 2005. Ras-related signaling pathways in valve Mori, A.D., Zu, Y., Vahora, I., Nieman, B., Koshiba-takeuchio, K., Davidson, L., Pizard, A., development: ebb and flow. Physiology 20, 390–397. Seidman, J.G., Seidman, C.E., Chen, X.J., Henkelman, R.M., Bruneau, B.G., 2006. Tbx5- Zhou, D., Salnikow, K., Costa, M., 1998. Cap43, a novel gene specifically induced by Ni2 dependent rheostatic control of cardiac gene expression an morphogenesis. Dev. compounds. Cancer Res. 58, 2182–2189. Biol. 297, 566–586. Zhou, R.H., Kokame, K., Tsukamoto, Y., Yutani, C., Kato, H., Miyata, T., 2001. Cha- Nasevicius, A., Ekker, S.C., 2000. Effective targeted gene ‘knockdown’ in zebrafish. Nat. racterization of the human NDRG gene family: a newly identified member, ndrg4, is Genet. 26, 216–220. specifically expressed in brain and heart. Genomics 73, 86–97.