Chronic Carriage of Salmonella: Biofilms and Gallstones
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Robert W. Crawford, B.S., B.A.
Integrated Biomedical Science Graduate Program
The Ohio State University
2009
Dissertation Committee:
John S. Gunn, Ph.D., Adviser
Larry S. Schlesinger, M.D.
Robert S. Munson, Jr., Ph.D.
Brian M. Ahmer, Ph.D.
Abstract
Salmonella enterica serovar Typhi can establish a chronic, asymptomatic infection of the gallbladder, suggesting that this bacterium utilizes novel mechanisms to
mediate enhanced colonization and persistence in a bile-rich environment. The typhoid
carrier state is a significant risk factor for hepatobiliary carcinomas, frequently associated
with the presence of gallstones, and typically unresolved by regimens of clinically
administered antibiotics. This description led us to hypothesize that serovar Typhi biofilm formation on gallstones facilitates gallbladder carriage, and we have demonstrated
previously that salmonellae form bile-mediated biofilms on human gallstones in vitro.
To eliminate dependence on human gallstone samples and to allow gallstone
constituents to be analyzed individually for their abilities to interact with salmonellae,
siliconized Eppendorf tubes were coated with cholesterol and shown to support
Salmonella biofilm formation in a new Tube Biofilm Assay (TBA). Random transposon
mutants of S. enterica serovar Typhimurium were screened for impaired adherence to and
biofilm formation on cholesterol in the TBA, but not on glass and plastic surfaces, to
elucidate mechanisms of attachment initiating biofilm formation specifically on
cholesterol surfaces. We identified 49 mutants with this phenotype. Upon sequence
analysis of the transposon insertion sites, two unique insertions were identified in both
fimW and ompC, one in sseI, and five in various flagellar genes. Focusing on the role of
ii
flagella, subsequent analysis in the TBA suggested that the presence of the flagellar
filament and functional chemotaxis enhanced binding/biofilm formation in the presence
of bile, while flagellar motility was unimportant. Purified Salmonella flagellar proteins
used in a modified TBA ELISA showed that FliC was the critical subunit mediating
binding to cholesterol.
A serovar Typhimurium mutant deficient in biosynthesis of colanic acid and
cellulose formed a mature biofilm on gallstones and in the TBA, suggesting the presence
of an unidentified exopolysaccharide necessary for mature biofilm development. Our
experiments indicate that the Salmonella O-antigen capsule is a crucial determinant in
gallstone and cholesterol biofilms but that expression of this exopolysaccharide is not
necessary for binding to glass or plastic. Growth in bile resulted in upregulation of the O-
antigen capsule-encoding operon in an agfD-independent manner and enhanced capsule
expression in biofilms on gallstone/cholesterol-coated surfaces.
Naturally resistant 129X1/SvJ mice fed a lithogenic diet developed cholesterol
gallstones and, as a result, demonstrated enhanced colonization of gallbladder tissue and
bile. These mice also showed pronounced fecal shedding during persistent serovar
Typhimurium infection. Furthermore, cholesterol gallstones were shown to associate with
significant amounts of salmonellae that increased with time post infection. In a human
study conducted in typhoid endemic Mexico City, individuals seeking cholecystectomy due to gallstones were analyzed for asymptomatic serovar Typhi carriage. Results
iii
indicate that 5% of patients with cholelithiasis carried serovar Typhi and that bacterial
biofilms could be visualized on gallstones from 3 of 4 of these carriers. Gallstone biofilm
formation was not observed in patients positive for other bacteria, suggesting that
gallstone biofilms are a typhoid specific phenomenon.
These findings offer direct evidence that gallstone biofilms occur in humans and
mice carrying salmonellae asymptomatically in their gallbladders, which facilitates
gallbladder colonization and shedding. In addition, this work brings forward new therapeutic targets against typhoid fever transmission and a novel murine model for their evaluation.
iv
Dedication
To those reading this dissertation: You have positively influenced this journey, and I am truly grateful.
v
Acknowledgments
I thank first and foremost John S. Gunn, Ph.D., for 6 years of unparalleled professional and personal mentorship. Fellow dissertation committee members Larry S.
Schlesinger, M.D., Robert S. Munson, Jr., Ph.D., and Brian M. Ahmer, Ph.D., have similarly provided helpful scientific and life-related discourse.
The Center for Microbial Interface Biology (CMIB) permitted collaboration, friendship, and countless opportunities for growth. I am proud and honored to have been part of such a special group of individuals, and would like to specifically acknowledge
Shilpa Soni, Nrusingh Mohapatra, Ph.D., Massimo Merighi, Ph.D., and Travis McCarthy,
Ph.D., for advice and training from day one onward.
I also recognize Angela Prouty, Ph.D, Kristin Reeve, Deanna Gibson, Ph.D.,
William Kay, Ph.D., Roberto Rolases-Reyes, Ph.D., Celia Alpuche-Aranda, M.D., Krista
La Perle, D.V.M., Ph.D., Julie Moffitt, Brian Kemmenoe, for technical guidance.
This study was supported by NIH grant AI066208 (J.S.G.) and a graduate education fellowship from The Ohio State University Public Health Preparedness for
Infectious Diseases Program (R.W.C.).
vi
Vita
February 8, 1979 ...... Born – Cleveland, Ohio
1997-2002 ...... B.S., Biology The Ohio State University
1997-2002 ...... B.A., French The Ohio State University
2002-2003 ...... Visiting Research Assistant Radiation Biology Research Institute Hiroshima University Medical Campus, Hiroshima, Japan
2003-2004 ...... Research Assistant Molecular Virology, Immunology, and Medical Genetics The Ohio State University
2004-Present ...... Graduate Research Associate and Fellow Integrated Biomedical Science Graduate Program Research Emphasis: Microbial Pathogenesis The Ohio State University
Awards and Honors
2006 ...... Invited Speaker 2nd ASM Salmonella Meeting, Victoria, British Columbia, Canada
2007 ...... Travel Grant; ASM Corporate Scholars Award General Meeting, Toronto, Ontario, Canada
2007 ...... Travel Award 6th Ann. OSU Md. Ctr. Research Day The Ohio State University, Columbus, OH
2007 ...... Invited Speaker Microbiology Dept. Symposium, The Ohio State University, Columbus, OH
2008 ...... Fellowship Recipient P.H.P.I.D.,The Ohio State University Columbus, OH vii
2008 ...... Edward F. Hayes Graduate Research Forum Award Winner Interdisciplinary Competition, The Ohio State University, Columbus, OH
2008 ...... Abstract Press Release Selection ASM General Meeting, Boston, MA
Publications
1. Crawford, R.W., D.L. Gibson, W.W. Kay, and J.S. Gunn. 2008. Identification of a bile-induced exopolysaccharide required for Salmonella biofilm formation on gallstone surfaces. Infect. Immun. 76 (11): 5341-5349.
* Manuscript chosen for journal Spotlight. Infect. Immun. 76 (11): 4793-4794
* Image selected for journal cover art, with caption. Infect. Immun. 77 (1)
2. Crawford, R.W. and J.S. Gunn. 2009. The interaction of bile salts with pathogenic and non-pathogenic intestinal bacteria. In L.A. Jaykus, H.H. Wang, and L.S. Schlesinger (ed.), Foodborne Microbes: Shaping the Host Ecosystem, 1st ed.
* Illustration chosen for book cover image, with caption.
3. Crawford, R.W., K.E. Reeve, and J.S. Gunn. 2009. The Salmonella enterica serovar Typhimurium flagellum mediates attachment to and biofilm development on cholesterol coated surfaces. In Preparation.
4. Crawford, R.W., R. Rosales-Reyes, C. Alpuche-Aranda, and J.S. Gunn. 2009. Gallstones play a significant role in Salmonella spp. gallbladder colonization and carriage. In Preparation.
5. Crawford, R.W., G.J. Gonzalez, and J.S. Gunn. 2009. Salmonella biofilms: From food to human disease. In S. Porwollik, et al. (ed.), Salmonella enterica: genomics and molecular biology, 1st ed. In Preparation.
Fields of Study
Major Field: Microbial Pathogenesis
viii
Table of Contents Page Abstract...... ii Dedication…………………………………………………………………………………v Acknowledgments………………………………………………………………………..vi Vita………………………………………………………………………………………vii List of Tables……………………………………………………………………………xiii List of Figures…………………………………………………………………………...xiv
Chapters:
1. Introduction………………………………………………………………………..1
1.1 Salmonella, a pathogen of global concern…………………………………….1 1.1.1 Historical perspective and nomenclature……………………………1 1.1.2 Burdens to public health world-wide………………………………..3 1.1.3 Mechanisms of pathogenesis………………………………………..5 1.2 Bacteria and Bile, a Dynamic Duo during Disease…………………………..11 1.2.1 Bile composition and characteristics………………………………11 1.2.2 Bile and the normal flora…………………………………………..13 1.2.3 Interactions of bile with pathogenic bacteria and viruses……….....15 1.3 Chronic Carriage, Gallstones, and Carcinoma……………………………….28 1.4 Bacterial Biofilm Formation…………………………………………………31 1.5 Hypothesis and Goals………………………………………………………..38
2. The Salmonella enterica serovar Typhimurium flagellum mediates attachment to and biofilm development on cholesterol coated surfaces……………………..45
2.1 Abstract………………………………………………………………………45 2.2 Introduction…………………………………………………………………..46 2.3 Materials and Methods……………………………………………………….49 2.3.1 Bacterial strains, growth conditions, and molecular biology techniques…………………………………………………49 2.3.2 Transposon mutagenesis and screening……………………………49 2.3.3 Cholesterol, glass, and plastic surface biofilm assays……………..50 2.3.4 DNA sequencing and bioinformatics………………………………51 2.3.5 Mutant and complement construction……………………………...51 2.3.6 Adherence assay of live and dead bacteria………………………...52 2.3.7 Live and dead scaffold assay………………………………………52
ix
2.3.8 Purification of serovar Typhimurium flagellin…………………….53 2.3.9 Western blotting……………………………………………………54 2.3.10 Subunit binding ELISA…………………………………………..54 2.3.11 Statistical analysis………………………………………………...55 2.4 Results………………………………………………………………………..55 2.4.1 Identification of serovar Typhimurium mutants deficient for binding to cholesterol but not glass or plastic……………………...55 2.4.2 Sequencing of Tn10d transposon insertion sites…………………...57 2.4.3 Fimbriae production and FimW-mediated over expression of type 1 fimbriae in serovar Typhimurium play negative roles in biofilm formation on cholesterol………………………………..60 2.4.4 Flagella-mediated binding to cholesterol is necessary for biofilm development in serovar Typhimurium…………………….61 2.4.5 Serovar Typhimurium flagellar motility inhibits biofilm formation on cholesterol surfaces whereas functional chemotaxis appears important……………………………………...62 2.4.6 The number of surface-expressed serovar Typhimurium flagella is not regulated by bile…………………………………….63 2.4.7 Formalin fixed and heat killed salmonellae expressing an intact flagella bind to cholesterol…………………………………..63 2.4.8 Dead salmonellae bound to cholesterol provide a scaffold for biofilm formation of live cells………………………………….64 2.4.9 The serovar Typhimurium flagellar subunit FliC is critical for binding to cholesterol…………………………………………..66 2.5 Discussion……………………………………………………………………67
3. Identification of a Bile-Induced Exopolysaccharide Required for Salmonella Biofilm Formation on Gallstone Surfaces…………………………..83
3.1 Abstract………………………………………………………………………83 3.2 Introduction…………………………………………………………………..84 3.3 Materials and Methods……………………………………………………….87 3.3.1 Bacterial strains and growth conditions……………………………87 3.3.2 Molecular biology and genetic techniques………………………...87 3.3.3 Construction of ΔbcsE ΔwcaA, yihO, and yihP mutants…………...88 3.3.4 Gallstone tube assay………………………………………………..89 3.3.5 Tube biofilm assay (TBA)…………………………………………89 3.3.6 Plastic/glass binding assay…………………………………………90 3.3.7 Crystal violet quantification of biofilms…………………………...90
x
3.3.8 Immunofluorescence microscopy of tube biofilms………………...91 3.3.9 Tube biofilm ELISA……………………………………………….91 3.3.10 Scanning electron microscopy (SEM)……………………………92 3.3.11 Murine infections with serovar Typhimurium wild-type and yihO mutant strains…………………………………………..92 3.3.12 Statistics…………………………………………………………..93 3.4 Results………………………………………………………………………..93 3.4.1 A serovar Typhimurium colanic acid/cellulose double mutant forms mature gallstone biofilms…………………………………...93 3.4.2 S. enterica binds to and forms biofilms on cholesterol-coated Eppendorf tubes……………………………………………………94 3.4.3 The Salmonella O-ag capsule is necessary for binding to cholesterol versus binding to glass or plastic………………………95 3.4.4 The extracellular-matrix-associated O-ag capsule is a critical component of Salmonella gallstone biofilms………………………96 3.4.5 Bile increases Salmonella O-ag capsule production in biofilms…..97 3.4.6 Transcription of O-ag capsule genes is upregulated by bile in an AgfD-independent manner……………………………………...98 3.4.7 Serovar Typhimurium O-ag capsule mutants are attenuated for virulence during oral murine infections………………………..99 3.5 Discussion…………………………………………………………………..100
4. Gallstones play a significant role in Salmonella spp. Gallbladder colonization and carriage……………………………………………………….114
4.1 Abstract……………………………………………………………………..114 4.2 Introduction…………………………………………………………………115 4.3 Materials and Methods……………………………………………………...119 4.3.1 Bacterial strains and growth conditions………………………...... 119 4.3.2 Serovar Typhimurium infections in mice………………………...119 4.3.3 Sample collection from human donors…………………………...120 4.3.4 Scanning electron microscopy……………………………………121 4.3.5 Histopathology……………………………………………………121 4.3.6 MIC assays of bile resistance……………………………………..122 4.3.7 Biofilm formation assays on cholesterol………………………….122 4.3.8 Antibiotic challenge of biofilm and planktonic cells……………..123 4.3.9 Neutrophil isolation and effect on established biofilms v. planktonic cells………………………………………………...123 4.3.10 Statistical analysis……………………………………………….124
xi
4.4 Results……………………………………………………………………....124 4.4.1 Salmonella resistant mice form cholesterol gallstones…………...124 4.4.2 Cholesterol gallstones enhance Salmonella gallbladder colonization and fecal shedding during persistent murine infections…………………………………………………125 4.4.3 Serovar Typhi forms biofilms on gallstones of asymptomatic carriers from Mexico City………………………………………...128 4.4.4 Histology of infected gallbladder tissues…………………………130 4.4.5 Serovar Typhi laboratory strains and clinical isolates demonstrate the same level of bile tolerance, and this resistance is independent of Vi antigen………………………………………...131 4.4.6 Cholesterol-bound serovar Typhimurium biofilms resist antibiotics but planktonic cells are susceptible…………………...132 4.4.7 Serovar Typhimurium biofilm bacteria, but not dispersed planktonic cells, are resistant to neutrophil-mediated killing…….133 4.5 Discussion…………………………………………………………………..133
5. General Discussion…………………………………………………………………..154
List of References………………………………………………………………………170
xii
List of Tables
Table Page
2.1 Bacterial strains and relevant characteristics…………………………………….74
2.2 Transposon insertion sites, frequencies, and functions…………………………..75
2.3 Cholesterol adherence quantification assay of live and dead bacteria…………...76
2.4 Summary of biofilm formation on cholesterol or formalin fixed cells…………..77
3.1 Bacterial strains, plasmids, and relevant characteristics………………………..105
3.2 Oligonucleotide primers………………………………………………………...106
3.3 Summary of biofilm formation on cholesterol, glass, and plastic surfaces…….107
4.1 Bacterial strains and relevant characteristics…………………………………...141
4.2 Gallstone biofilm formation and bacterial burden in patient samples………….142
4.3 Bile MICs for clinical isolates and laboratory strains of serovar Typhi………..143
xiii
List of Figures
Figure Page
1.1 Karl Eberth’s typhoid bacilli, March 25, 1882…………………………………..40
1.2 Typhoid endemic areas and global incidence of multidrug-resistant strains…….41
1.3 Gastrointestinal tract and interactions of pathogenic bacteria with bile…………42
1.4 The sequential, highly ordered stages of biofilm development………………….43
1.5 S. enterica bile-induced biofilm formation on human gallstones………………..44
2.1 Schematic of Tn10d transposon insertion sites in serovar Typhimurium cholesterol-binding mutants……………………………………………………...78
2.2 Biofilm formation of serovar Typhimurium fimbriae and flagella mutant strains on cholesterol-coated tubes………………………………………………………79
2.3 Surface expression of Salmonella flagella in the presence or absence of bile…...80
2.4 Identification of salmonellae purified flagellin proteins...... 81
2.5 Adherence of purified flagella subunit proteins to cholesterol…………………..82
3.1 Effect of colonic acid and cellulose on Salmonella gallstone biofilms………...108
3.2 Tube biofilm assay of Salmonella O-antigen capsule mutants…………………109
3.3 Salmonella biofilm formation on cholesterol and bilirubin coated surfaces…...110
3.4 Mutations in the O-ag operon affect Salmonella gallstone biofilm formation…111
3.5 The effect of bile on Salmonella O-ag capsule expression……………………..112
3.6 S. enterica O-ag capsule transcription in the presence or absence of bile……...113
4.1 Lithogenic diet-induced cholesterol gallstones in mice………………………...144
xiv
4.2 Spleen and gallbladder tissue burdens at days 3, 7, and 21 post infection……..145
4.3 Bacterial enumeration from gallbladder bile and stones over time…………….146
4.4 Serovar Typhimurium is shed in fecal matter of persistently infected mice…...147
4.5 Gallstones from human typhoid carriers harbor biofilms………………………148
4.6 SEM micrographs of cholecystectomized patients from Mexico City…………149
4.7 H&E stained gallbladder tissues from human donors…………………………..150
4.8 Histology of the mouse gallbladder epithelium post infection…………………151
4.9 Antibiotic susceptibility of biofilm embedded and planktonic bacteria………..152
4.10 Interactions of purified human neutrophils with biofilm and planktonic cells…153
xv
Chapter 1
Introduction
1.1 Salmonella, a pathogen of global concern
1.1.1 Historical perspective and nomenclature
Salmonellae are rod-shaped pathogens that infect a broad array of hosts, causing
significant morbidity and mortality in impoverished and developed nations worldwide.
Members of this genus have been preeminent research models in laboratories for over a
century and belong to the family Enterobacteraciae, a large group of clinically relevant
gram-negative, facultative anaerobic commensal and invasive bacilli (Schaechter, 1987).
Salmonella has minimal nutritional requirements, does not ferment lactose, resists the
caustic nature of bile salts, and, as such, can be differentiated on selective growth media
that take advantage of these traits (2002).
The namesake of the Salmonella genus is Daniel Elmer Salmon, the first
American citizen to be granted the Doctor of Veterinary Medicine degree (Howell et al.,
2008). Dr. Salmon presided over the United States Department of Agriculture during the late nineteenth century when Salmonella was discovered, a feat attributed to the epidemiologist and pathologist Theobald Smith (Howell et al., 2008). Salmonella nomenclature has a complex, dynamic evolution and remains a topic of debate today.
1 Initially, members of the genus were differentiated based on simplified antigenic
formulae proposed by Kauffman and White. In this one serotype-one species scheme,
variations in the somatic O polysaccharides and the flagellar H proteins designated names
of new species (Brenner et al., 2000). Due in large part to DNA hybridization
experiments performed in 1973 by the laboratory of Stan Falkow that demonstrated
species level relationships amongst different serotypes and subgenera (Crosa et al., 1973),
only two species are currently referenced in Salmonella taxonomy, S. enterica and S.
bongori.
The World Health Organization (WHO) Collaborating Centre for Reference and
Research on Salmonella is charged with defining and maintaining nomenclature
standards, and new serotypes (serovars) are introduced in annual updates of the
Kauffman-White scheme (Brenner et al., 2000). The Centers for Disease Control and
Prevention (CDC) reports that S. enterica is comprised of six subspecies and over 2,400
serotypes (serovars) that are generally classified by locations of initial isolation (Popoff et
al., 2000). Over the past 25 years, the National Salmonella Surveillance System at the
Robert Koch Institute has monitored human salmonellosis and geographical trends in
specific serotypes (Brenner et al., 2000). The complete 4,857-kilobase (kb) chromosome
and 94-kb virulence plasmid of S. enterica serovar Typhimurium were sequenced and
published in 2001, revolutionizing the scientific investigation of this microorganism
(McClelland et al., 2001).
S. enterica serovar Typhi caused typhoid fever long before the discovery of etiologic causality by German bacteriologist Karl Eberth. In 1882, Eberth examined intestinal tissue from an infected individual under a microscope and made a hand drawn
2 woodcut of his observations (Coats, 1882). He noticed that bacilli existed as aggregates or isolated rods, and that there was a tropism for clumps toward lymphatic cells (Fig.
1.1). It is believed that typhoid fever ravaged societies during the Parliamentary Wars of
1642-48, and one of the first descriptions of this illness was catalogued by English physician Thomas Willis in 1684, who wrote that ‘the first assault is for the most part accompanied with a shivering or horror (Paterson, 1949). Widal and Sicard identified specific agglutinins for O and H antigens in the serum of typhoid patients in 1896, a diagnostic technique still used in clinics today (Paterson, 1949). Because other
Salmonella serovars and members of the Enterobacteraciae family share these antigens, the sensitivity, specificity, and predictive values of the Widal test are controversial (Parry et al., 2002).
1.1.2 Burdens to public health world-wide
An estimated 1.3 billion cases of disease are mediated by S. enterica serovars across the globe each year (Coburn et al., 2007). The two most common clinical manifestations are gastroenteritis and enteric (typhoid) fever, both of which result in large financial burdens to hospitals and patients. The severity and outcome of illness depend on host susceptibility, including age and immune function, and the infectious S. enterica serovar (2002). S. Typhi is exquisitely adapted to induce disease strictly in humans, while non-typhoidal serovars are ubiquitous in nature and can colonize poultry, reptiles, livestock, rodents, birds, water, and soil.
Approximately 1.4 million incidences of enterocolitis due to non-typhoidal salmonellae occur in the U.S. each year and over 200 million more outside North
3 America, estimates that lack statistical consistency due to diagnostic and reporting problems (Coburn et al., 2007). In humans, the onset of symptoms occurs between 6 and
72 hours after consumption of food or water contaminated with greater than 105 bacteria, and is typically characterized by abdominal pain, diarrhea, nausea, and vomiting (Coburn et al., 2007). Infections are commonly limited to the gastrointestinal tract and resolve between 5-7 days with oral or intravenous administration of fluids. The pathological hallmarks of salmonellosis caused by S. enterica serovars Enteritidis or Typhimurium differ from those of enteric fever and include intestinal neutrophilia, localized inflammatory diarrhea, the loss of electrolytes, serum protein and fluid, as well as sepsis- induced death in immunocompromised individuals such as patients with acquired immunodeficiency syndrome (AIDS) (Tsolis et al., 2008; Dharmana et al., 2002;
Fleisher, 1991;Santos et al., 2002). Models for examining Salmonella enteropathogenesis include inoculations of bovine ileal loops, tissue cultured epithelial cells, and, recently, pretreatment of mice with streptomycin (Barthel et al., 2003).
S. Typhi is the etiologic agent of typhoid fever, a debilitating illness characterized by interstitial inflammation, a gradual onset of symptoms, and, ultimately, bacterial dissemination to systemic sites (Tsolis et al., 2008). S. enterica serovars Paratyphi A,
Schottmuelleri, and Hirschfeldii induce a mild form of enteric fever called paratyphoid fever. The CDC estimates that at least 22 million illnesses and 600,000 deaths world- wide are attributed to typhoid fever and person-to-person spread of S. Typhi is enhanced by its low infectious dose (Butler et al., 1978; Crump et al., 2004; Parry et al., 2002).
Symptoms manifest 10 to 14 days post inoculation, vary with geography, and usually include generalized fever, myalgias, and malaise. In adults, typhoid fever can be
4 accompanied by constipation and bradycardia whereas children and immunosuppressed
patients experience intense diarrhea (Tsolis et al., 2008). Blood antibody titers are
highest during the first week, but delayed onset or absence altogether of overt symptoms
in many patients makes the clinical diagnosis of typhoid fever challenging (Parry et al.,
2002). S. Typhi is transmitted via the fecal-oral route, yet stool cultures are positive in
only 30% of symptomatic typhoid patients (Parry et al., 2002). A regimen of
fluoroquinolones such as ciprofloxacin and bed rest is used to treat most cases of enteric
fever, but the introduction of multi-drug resistant strains in endemic areas is making
management of the disease particularly problematic (Fig. 1.2). Approximately 3-5% of
patients suffering from typhoid fever develop an asymptomatic chronic carrier state
thought to account for much of the human-to-human transmission of S. Typhi (Levine et al., 1982). This disease manifestation will be discussed in detail later.
1.1.3 Mechanisms of pathogenesis
Interestingly, much of what is known about the systemic pathogenesis of S. Typhi during typhoid fever has been extrapolated from infections of inbred mouse strains lacking Nramp1 (e.g. BALB/c and C57BL/6) with non-typhoidal serovar Typhimurium.
Nramp1 is a macrophage phagosome transmembrane protein hypothesized to affect transport of cations (Skamene et al., 1998). In this model, Salmonella pathogenicity island (SPI)-1 facilitates translocation of the intestinal epithelium (bacterial mediated endocytosis) at microfold (M) cells overlying the lymphoid follicles of Peyer’s patches
(Wolf et al., 1981), and is followed by a primary bacteraemia in the blood and uncontrolled replication within macrophages of the liver, spleen, and bone marrow
5 leading to death at 7 to 10 days post infection (Jepson and Clark, 2001; Jones and
Falkow, 1996; Galan and Curtiss, 1991; Richter-Dahlfors et al., 1997; Salcedo et al.,
2001). Alternatively, salmonellae can disseminate from the gastrointestinal tract to the blood independently of SPI-1 in CD18-expressing phagocytes (Vazquez-Torres et al.,
1999).
Collectively, these results demonstrate that salmonellae express an arsenal of virulence factors that are highly regulated in space and time to enhance replication, colonization, and transmission when confronted by innate and adaptive host immune responses. SPIs are critically important to bacterial fitness during infection and may have been acquired by horizontal gene transfer. These regions are characterized by a lower content of guanine and cytosine relative to the overall genome, and are flanked by transposon insertion sites (Groisman and Ochman, 1996). Although several SPIs exist and more are currently being elucidated, the best characterized are SPI-1, a mediator of
Salmonella invasion and induction of host inflammatory pathways, and SPI-2, required for intracellular evasion of phagocytic oxidases and systemic infection in mice (Galan and Curtiss, 1989; Fass and Groisman, 2009). SPI-1 and SPI-2 regulate two distinct type
III secretion systems (TTSS) that deliver specialized effector proteins into eukaryotic host cells at specific stages of pathogenesis (McGhie et al., 2009).
Over 30 secreted effectors mediated by SPI-1 and SPI-2 TTSSs have been shown to influence the host biochemistry and cell physiology. For example, SPI-1 proteins
SipA, SipC, SopB, SopD, SopE, and SopE2 trigger bacterial internalization into
Salmonella-containing vacuoles (SCVs) of host cells by a coordinated process of actin polymerization and cytoskeletal rearrangements termed membrane ruffling (reviewed in
6 (McGhie et al., 2009)). SPI-1 effectors also induce inflammation. Specifically, SipA stimulates interleukin (IL)-8 production and neutrophil recruitment across cultured epithelial monolayers (McCormick et al., 1998; Lee et al., 2000b), SopE activates mitogen-associated protein kinases (MAPKs) and thus nuclear factor kappa-light-chain- enhancer of activated B cells (NF-κB) signaling (Hardt et al., 1998), and SipB binds to caspase-1, increasing IL-1β and IL-18-mediated proinflammatory cell death (pyroptosis)
(Lara-Tejero et al., 2006).
SPI-2 facilitates replication and survival in host cells and is positively or negatively regulated by Salmonella factors including but not limited to nucleoid- associated proteins (NAPs) IHF, Fis, SlyA, and HilD, and the two-component systems
PhoP/PhoQ and OmpR/EnvZ (Fass and Groisman, 2009). SPI-2 encodes two-component system SsrA/SsrB, whose signaling is dependant on external factors such as osmolarity and pH (Worley et al., 2000). SsrA/B are directly regulated in turn by transcription factors SlyA and OmpR (Feng et al., 2004; Lee et al., 2000a; Feng et al., 2003).
Two-component regulatory systems allow bacteria to respond to conditions in the external milieu and are comprised of a membrane-bound sensor histidine kinase and a response regulator that, when phosphorylated at a conserved aspartic acid, activates or represses gene transcription (Gunn et al., 1996). More than 4,000 two-component signal transduction systems have been identified in 145 sequenced bacterial genomes accounting for diverse response regulation including nutrient acquisition, energy metabolism and virulence (Mohapatra et al., 2007). One such pathway, required for phenotypes including antimicrobial-peptide resistance, survival within macrophages and virulence in animal models and human volunteers, is the PhoP-PhoQ (PhoPQ) two-
7 component system (TCS) (Groisman, 2001; Hohmann et al., 1996). PhoPQ post-
transcriptionally activates another TCS, PmrA-PmrB (PmrAB), via the PmrD protein
(Kato and Groisman, 2004). The PmrAB TCS has orthologs in other bacterial pathogens
(Mohapatra et al., 2007), responds directly to environmental signals including high iron
and aluminum concentrations and low pH, and modifies lipopolysaccharide (LPS) to
mediate resistance to killing by ions or innate immune factors (reviewed in (Gunn,
2008)).
Pathogen-associated molecular patterns (PAMPs) are factors recognized by
specific pattern recognition receptors (PRRs) of the innate immune system. Multiple pro-
and anti-inflammatory cytokines and chemokines synthesized by macrophages, epithelial
cells, and Dendritic cells in response to PAMPs, including interferon (IFN)-γ, IL-12,
tumor necrosis factor (TNF)-α, IL-18, transforming growth factor-β, IL-10 MCP-1,
CCL2, CCL20 and CCL3, play pivotal roles during Salmonella infections (Coburn et al.,
2007).
The Vi-capsular polysaccharide antigen of serovar Typhi is a PAMP encoded by
SPI-7, a large mosaic, genetic island that is genetically unstable, can be lost upon
laboratory passage, and is absent from the serovar Typhimurium chromosome altogether
(Nair et al., 2004). The Vi-capsule has been shown to prevent Toll-like receptor (TLR) 4
recognition (Wilson et al., 2008), and its loss in serovar Typhi isolates increased TNF-α production or IL-8 secretion production in macrophage or epithelial cell lines, respectively (Hirose et al., 1997; Sharma and Qadri, 2004). Human enterocolitis induces massive neutrophilia whereas typhoid fever is characterized by mononuclear infiltrate,
8 suggesting that different PAMPs stimulate varying responses in association with specific
PRRs (reviewed in reference (Tukel et al., 2006)).
The major components of the Salmonella outer membrane have been studied extensively and include lipopolysaccharide (LPS), enterobacterial common antigen
(ECA), porins, and flagellin, the monomeric subunits comprising peritrichous flagella.
LPS is composed of a hydrophobic lipid A membrane anchor, the distal, hydrophilic O- antigen protrusion, and a core region of polysaccharide repeat units that connect the two
(Muhlradt, 1976; Nikaido, 1987). O-antigen capsule mutants are attenuated for virulence and highly sensitive to hydrophobic chemicals including bile salts (described later), whereas strains with incomplete assembly of lipid A are conditionally lethal (Jansson et al., 1981; Nikaido, 1976). TLR4 recognition of bacterial LPS by macrophages is required for the host to generate complete inflammatory responses to invading pathogens
(MacVittie et al., 1982; Vazquez-Torres et al., 2004; Royle et al., 2003). Another LPS receptor, CD14, is not expressed by intestinal epithelial cells, suggesting that these cells may not directly generate LPS-mediated host responses (Coburn et al., 2007).
The ECA is an acidic polysaccharide containing N-acetyl-D-glucosamine, N-
acetyl-D-mannosaminuronic acid, and 4-acetamido-4,6-dideoxy-D-galactose covalently linked to the external leaflet of the outer membrane in all species of the family
Enterobacteraciae (Lugowski and Romanowska, 1991). S. Typhimurium strains carrying mutations in the ECA biosynthesis and assembly genes wecD and wecA were highly attenuated in oral infections in vivo compared to wild-type (Valtonen et al., 1976; Ramos-
Morales et al., 2003) and susceptible to bile salts in vitro (described later).
9 One of the most abundant proteins in S. enterica are the porins, which form channels that facilitate passive diffusion of hydrophilic molecules across the outer membrane (Nikaido, 1987). The three major S. Typhimurium porins vary in size and are encoded by the ompC, ompD, and ompF genes (Norioka et al., 1986). OmpR positively regulates expression of OmpC and OmpF, and is necessary for virulence in murine
models, whereas individual mutations in ompC, ompD, or ompF do not affect disease
outcome (Dorman et al., 1989). Expression of OmpS1 and OmpS2 porins occurs at low
levels, but is required for lethality in mice (Rodriguez-Morales et al., 2006).
The Salmonella flagellum is encoded by a highly ordered transcriptional hierarchy
comprised of more than 60 genes and is comprised of two antigenically distinct subunit
proteins, FliC (H:i) and FljB (H:1,2) (Frye et al., 2006). Flagellin is detected by
mammalian cells via surface-expressed TLR-5 and cytosolic Nod-like receptors (Rochon
and Romling, 2006; Simon and Samuel, 2007). Secretion of IL-1 beta and IL-18 by
mouse cell lines is activated comparably by the FliC and FljB flagellins (Simon and
Samuel, 2008), but memory CD4+-T-cells preferentially recognize FliC during adaptive
immunity and Salmonella committed to expressing only FljB is attenuated in vivo
(Bergman et al., 2005; Ikeda et al., 2001). S. Typhimurium-induced colitis in
streptomycin-pretreated mice required flagella production and recent experiments have
demonstrated that SPI-2 translocates flagellin to the basolateral surface of the intestinal
epithelium (Stecher et al., 2004; Lyons et al., 2004).
10 1.2 Bacteria and Bile, a Dynamic Duo during Disease
1.2.1 Bile composition and characteristics
Normal physiology of healthy individuals requires emulsification and
solubilization of lipids as well as elimination of substances that cannot be efficiently
excreted in urine. This is accomplished by bile, a complex digestive secretion produced
by the liver at nearly one liter per day that in general is lipid rich and protein poor
(Hofmann, 1998). Bile acids are the primary constituents of bile, act as detergents due to their surface active, amphipathic properties, and comprise 12% of the weight and approximately 50% of the organics in bile. In addition to aiding the dispersal of lipids, bile acids serve as potent antimicrobial agents. Thus, bile contributes to the harsh environment of the gastrointestinal tract that also includes variations in pH and oxygen tension, the presence of commensal bacteria, and limitations in nutrients. These and other factors combine to be a significant barrier for invading enteric pathogens (Begley et al., 2005a). Gastrointestinal commensals and pathogens, including salmonellae, have developed mechanisms to resist the deleterious effects of bile and subsequently colonize human intestines, and, as such, the manner in which microbes sense and respond to bile has been a subject of recent interest (Fig. 1.3).
Along with bile acids, other lipid-containing molecules found in bile include cholesterol and phospholipids (eg. phosphatidylcholine). One of the major protein constituents is immunoglobulin, while the pigment biliverdin provides bile its characteristic yellowish green color (Hofmann, 1999). IgA and mucus in bile contribute to making it a sterile compound by preventing bacterial growth and adhesion to the biliary and small intestine epithelium (McPhee, 1987). Synthesis of bile occurs in
11 pericentral hepatocytes of the liver and is followed by secretion into bile canaliculi and
drainage into bile ducts that merge to form hepatic ducts. The common hepatic duct
meets the cystic duct from the gallbladder, and the two channels merge into the common
bile duct to provide an exit route for bile from the liver. From there, the sphincter of
Oddi regulates the flow of bile into the duodenum (Begley et al., 2005a).
Bile is concentrated up to 10-fold by removal of water and electrolytes and can be
acidified by ion exchange. This process occurs in the gallbladder, the storage organ for
bile between meals (Hofmann, 1999; Johnson, 1998). About half the hepatic bile
produced is diverted to the gallbladder until fats stimulate the enteric hormones secretin
and cholecystokinin to induce bile secretion and flow, causing the gallbladder to contract
and the sphincter of Oddi to relax so that bile may reach the duodenum and aid digestion.
Bile acids are derived from cholesterol in the liver through a multienzyme process that includes an important oxidative step which converts the molecule from an eight carbon to a five carbon acid moiety. This mechanism permits conjugation of bile acids through a peptide linkage with either glycine or taurine in a 3:1 ratio depending on diet
(Hardison, 1978; Sjovall, 1959). Cholic acid and chenodeoxycholic acid are the primary bile salts of human bile. In their unconjugated form, bile acids are only slightly soluble at physiologically relevant pH. Therefore, amidation of bile acids is critical because it
lowers their pKa to provide solubility over a wide range of ionic strengths, calcium
concentrations and pH values (Hofmann and Roda, 1984; Hofmann and Mysels, 1992).
Additionally, conjugation of bile acids discourages passive absorption in the
biliary tract and small intestine so that bile acids are maintained between 0.2 to 2% in the
intestine and approximately 8% in the gallbladder (Hofmann, 1998). Fasting and
12 malnourishment have been shown to decrease the amount of bile in the intestine and,
consequently, leave such individuals vulnerable to bacterial pathogens (Opleta et al.,
1988; Reed et al., 1996). As mentioned above, bile acids are amphipathic and as such
self-associate in water to form polymolecular micelles that solubilize other lipids. It has
been suggested that these aggregates decrease the toxicity individual bile salts exude
upon biliary epithelial cells (Hofmann, 1999).
De novo synthesis of bile acids from cholesterol is not always required because
up to 95% of the bile acid pool is recycled on a daily basis in a process called enterohepatic circulation (Begley et al., 2005a). Absorption of conjugated and
unconjugated bile acids occurs along the entire length of the gut mucosa to facilitate transfer back to the liver for reconjucation and delivery into bile (Hofmann, 1998). The
constant flow of bile through the gastrointestinal tract is critical for bile homeostasis.
Excess intraluminal bile acids can cause diarrhea whereas suboptimal levels may result in
cholesterol supersaturated bile responsible for gallstone formation (Paumgartner and
Sauerbruch, 1991).
1.2.2 Bile and the normal flora
The resident, bile resistant microbial flora of the caecum and colon can alter the
properties of bile acids that were bypassed for enterohepatic circulation. Intestinal
microbiota, primarily anaerobes, deconjugate bile acids and stimulate mechanisms that
convert primary bile acids cholate and chenodeoxycholate into secondary bile acids
deoxycholate and lithocholate, respectively (Franklund et al., 1993). As outlined by
Bortolini et al., the categories of microbial induced biotransformations of bile acids
13 include epimerization, oxidation, hydroxylation, reduction and dehydroxylation
(Bortolini et al., 1997). Some of these natural reactions are pharmaceutically relevant,
such as ursodeoxycholic acid, the 7-hydroxy epimer of chenodeoxycholic acid that can be
synthesized industrially and prescribed as a treatment for cholestatic liver diseases (28).
Deconjugation cleaves amino acid side chains and is an important mechanism
used by bacteria to impact the properties of bile. This reaction may be carried out by intracellular bile salt hydrolases (BSHs) belonging to the choloylglycine hydrolase family of enzymes (Begley et al., 2005a). Species of the intestinal microflora expressing BSH activity include Clostridium, Bifidobacterium and Enterococcus (Coleman and Hudson,
1995; Grill et al., 2000b; Knarreborg et al., 2002). Although the physiological significance of BSH activity remains uncharacterized, key studies have advanced our
understanding of their proposed roles in enteric microorganisms. Van Eldere et al.
demonstrated that Clostridia energetics utilize taurine released from bile acids,
suggesting that deconjugation by hydrolytic strains provides nutritional sources of carbon
and nitrogen (Van Eldere et al., 1996). It has also been postulated that BSHs increase
tensile strength of bacterial membranes residing in the intestine and serve as a
detoxification system mediating bile tolerance (Boggs, 1987; Grill et al., 2000a).
The inherent cost of altering the properties of bile acids to cultivate a healthy
microflora may be at the expense of the human host. Unconjugated bile acids emulsify
dietary lipids less effectively than their conjugated counterparts, leaving lipid digestion
and fatty acid removal impaired (De Smet et al., 1998). The products of dehydroxylation
reactions are potentially toxic and have been associated with increased risk of colon
cancer (Mower et al., 1979). On the other hand, probiotic researchers encourage
14 consumption of BSH active bacteria. They suggest that subsequent limitations to
enterohepatic circulation in the presence of unconjugated bile acids causes enhanced
faecal loss of bile salts. The result may be manifested in lower serum cholesterol levels
due to an increased demand by the liver for cholesterol for de novo bile acid synthesis
(De Smet et al., 1998).
1.2.3 Interactions of bile with pathogenic bacteria and viruses
Bile affects the expression of important Salmonella proteins necessary for bile tolerance, some of which are thought to be regulated by the two-component system,
PhoPQ. Van Velkinburgh and Gunn observed that mutant strains constitutively expressing this regulon survived prolonged incubation with bile at concentrations exceeding 60%, whereas a phoP-null strain was susceptible to significantly lower bile concentrations than wild type strains. However, no PhoPQ regulated genes responsible
for bile resistance where identified (van Velkinburgh and Gunn, 1999). Therefore,
PhoPQ-mediated bile resistance may occur via genes that overlap this regulon.
As mentioned above, LPS protects cells from damaging agents like amphipathic
bile acids. Loss of the O-antigen component of LPS, which protrudes from the
membrane to serve as its main barrier, creates a rough colony phenotype resulting in
decreased resistance to bile (Kaper et al., 1995; Prouty et al., 2002b). Interestingly, LPS
modifications (aminoarabinose addition to the lipid A anchor portion of LPS and
ethanolamine changes to the core and lipid A regions) did not alter the high tolerance of
Salmonella to bile, eliminating the possibility that electrostatic interactions between bile
and S. Typhimurium contributed to resistance (van Velkinburgh and Gunn, 1999).
15 Furthermore, activation of the PmrAB system, which mediates these modifications,
actually sensitizes both E. coli and Salmonella to killing by bile salts (J. Gunn
unpublished observation), genes other than those mediating LPS alteration are likely to
be possible.
One of the most well characterized mechanisms through which bacteria exhibit
bile tolerance is efflux pump activity. In addition to mediating resistance to a variety of antibiotics and oxidative stress agents, these systems expel out of the cell bile salts that have traversed the inner membrane. Salmonellae express the bile-activated AcrAB efflux pump, which has a proton motive force-dependent drug efflux transporter, AcrB, and an element to bridge the inner and outer membranes, AcrA (Ma et al., 1994; Zgurskaya and
Nikaido, 1999). The acrAB efflux pump genes are absolutely required for growth of S.
Typhimurium in the presence of bile. Similarly, the marRAB operon of S. Typhimurium is involved in resistance to structurally unrelated antimicrobials including chloramphenicol, tetracycline and bile. DNA microarray and transcriptional assays performed by Prouty et al. showed activation of marRAB in the presence of bile.
Deoxycholate, but not other bile acids or a non-ionic detergent, interacted directly with the marRAB repressor MarR to interfere with its ability to bind to the mar operator.
Interestingly, growth in sublethal amounts of bile enhanced chloramphenicol resistance by both mar-dependent and mar-independent pathways (Prouty et al., 2004a).
Tol proteins function in the uptake of colicins and filamentous phage DNA and many gram-negative transport systems require a Tol homolog at the outer membrane to serve as a pore (Gunn, 2000). In this regard, TolC contributes to the AcrAB efflux pump system and is an essential component of bile resistance. Several bile-sensitive mutations
16 in S. Typhimurium isolated from a MudJ transposon experiment were located in the tolQRA region (Prouty et al., 2002b). Mutations in these genes compromise membrane integrity, possibly allowing an increase in bile acid traffic into the cell. The S.
Typhimurium ECA also provides bile protection. Strains carrying mutations in the ECA biosynthesis and assembly genes wecD and wecA were 40-fold more sensitive to deoxycholate in vitro and highly attenuated in oral infections in vivo compared to wild- type (Valtonen et al., 1976; Ramos-Morales et al., 2003).
As described above, the SPI-1 encoded TTSS mediates endocytosis of S.
Typhimurium into nonphagocytic eukaryotic cells. Invasion gene regulators including sirA and invF are transcriptionally repressed by bile, leading to repression of protein secretion by the SPI-1 TTSS and a dramatic reduction in epithelial cell invasion (Prouty and Gunn, 2000; Prouty et al., 2004b). The presence of bile also reduced expression of flagellar biosynthesis genes and motility. Therefore, successful host invasion may rely on temporal sensing of bile by salmonellae. High concentrations of bile encountered in the intestinal lumen may halt invasive properties until bacteria traverse the epithelial mucus layer to the underlying surface. It is there, where bile is likely in low concentration and invasion is needed for disease progression, that SPI-1 TSS repression is alleviated.
The ubiquitous, gram-negative bacterium Escherichia coli facilitate waste processing, vitamin K production and food absorption in a healthy functioning gastrointestinal microenvironment. However, it is in this same niche that commensal E. coli plays destructive roles implicated in gastroenteritis, urinary tract infections and peritonitis. Despite advances in sterilization techniques aimed at killing active bacteria,
17 E. coli also remains an important foodborne pathogen. Recent outbreaks of contaminated
beef and vegetables have caused numerous cases of severe diarrhea (Jeong et al., 2007).
Like Salmonella and other gram-negative bacteria, E. coli actively removes bile
acids that have traversed the membranes into the cytoplasm as a mechanism of bile
resistance. Thanassi et al. demonstrated that bile acids in the unconjugated, lipophilic
form entered the cell through the OmpF porin of the outer membrane and were
subsequently expelled via energy-dependent efflux (Thanassi et al., 1997). The
mdtABCD multidrug resistance cluster encodes three different transporter proteins and has been linked to enhanced resistance to deoxycholate (Baranova and Nikaido, 2002).
E. coli possesses two additional efflux systems, AcrAB and EmrAB, required for
tolerance to antibiotics such as tetracycline and chloramphenicol and toxic stressors such
as bile. As mentioned previously, the constituents of AcrAB are well characterized
whereas EmrAB is not as well described outside of its negative regulator EmrR
(Lomovskaya and Lewis, 1992). E. coli strains carrying acrA emrB double mutations
demonstrated growth inhibition in the presence of bile and intracellular accumulation of
chenodeoxycholate.
Enteropathogenic E. coli (EPEC) are significant causes of infantile diarrhea.
Virulence factors encoded by the chromosomal locus of enterocyte effacement (LEE)
region and adherence factors allow EPEC attachment to the intestinal mucosa (Trabulsi et
al., 2002). The ability of bile to mediate EPEC adhesion was demonstrated by deJesus et
al. in experiments showing that bile acids including chenodeoxycholate and deoxycholate
indeed increased adherence to HEp2 cells in tissue culture (de Jesus et al., 2005).
Although specific EPEC adhesins responsible for the bile acid stress induced adherence
18 were not elucidated, virulence factors intimin and flagella were ruled out. This question
was similarly addressed by Torres et al. using strains of atypical enteropathogenic E. coli
(aEPEC). Bile acids enhanced aEPEC adhesion to in vitro cultured HeLa cells by
regulating expression of the afimbrial locus for diffuse adherence (LDA) adhesion
(Torres et al., 2007). Other detergents tested could not achieve the same LDA induction,
suggesting a specific mechanism by which bile promotes disease manifestation by
increasing the binding of aEPEC to intestinal epithelial cells.
Shigella flexneri, closely related to enteroinvasive E. coli (EIEC), is a facultative intracellular pathogen and the etiologic agent of bacillary dysentery (Hale, 1991).
Invasion of colonic epithelial cells is mediated by a type III secretion system and triggers
a strong inflammatory response. Disease onset is characterized by diarrhea, abdominal
cramps and fever (Blocker et al., 2003). Interestingly, natural infections in humans
require only 10 to 100 organisms of S. flexneri whereas simulated infection of tissue cultured cells is relatively inefficient and needs a centrifugation step to initiate contact between bacteria and target cells. This observation led to the hypothesis that bile acids encountered in vivo act as specific environmental factors that enhance Shigella invasion and disease progression (Pope et al., 1995a).
Indeed, Pope et al. demonstrated that exposure to physiological concentrations of deoxycholate and chenodeoxycholate increased attachment and entry of Shigella species to HeLa cells in an in vitro model system (Pope et al., 1995a). Interestingly, this
phenomenon did not occur in EIEC. The presence of bile upregulates type III machinery
and invasion in Shigella but has the opposite effect in Salmonella, further suggesting a
unique mechanism contributing to bile-signaling and pathogenesis. This group also
19 observed the ability of bile acids to enhance secretion of Ipa proteins released during type
three-dependent cell entry. Olive et al. elaborated upon this finding, reporting that
deoxycholate stimulated recruitment of IpaB to the S. flexneri surface. Once there, IpaB
colocalized with IpaD at the tip of the type III secretion needle. The authors speculate
that IpaD is an environmental sensor capable of changing conformation in the presence of
bile acids to permit type III mediated secretion (Olive et al., 2007).
Since the discovery in the late 1970s that Campylobacter jejuni could induce
human illness, this gram-negative pathogen has become the leading bacterial cause of
enteritis in the United States (Slutsker et al., 1998). A small percentage of patients
develop Guillain-Barre syndrome, an autoimmune disorder of the peripheral nervous
system characterized by weak respiratory muscles, neurologic deficits or death
(Nachamkin et al., 1998). Effective control and prevention of Campylobacter infection
remains elusive as the pathogen becomes increasingly resistant to fluoroquinolone treatment and innate host defense (Tauxe, 2002). Bile salts present an important antimicrobial barrier for Campylobacter in the intestine. Accordingly, the pathogen expresses a multidrug resistance (MDR) efflux pump called CmeABC which is essential for adaptation to the harsh gastrointestinal environment (Luo et al., 2003). This resistance-nodulation-division (RND)-type multidrug efflux system is capable of mediating the bile resistant phenotype C. jejuni requires for successful host colonization
(Grkovic et al., 2002).
CmeABC is encoded by a three gene operon and is constitutively expressed at moderate levels in wild type Campylobacter strains cultured in conventional media (Lin et al., 2005b). Lin et al. showed expression of cmeABC to be controlled by the
20 transcriptional repressor CmeR which, when inactivated, leads to overexpression of the pump (Lin et al., 2005a). Researchers have also demonstrated direct interaction of bile salts with CmeR much like that described previously for Salmonella MarR (Lin et al.,
2005b). Both conjugated and unconjugated bile salts increased expression of the
CmeABC efflux pump while other antimicrobials, including chloramphenicol, ethidium bromide and erythromycin, did not affect transcription of cmeABC. Surface plasmon resonance provided evidence that bile salts were capable of inhibiting binding of CmeR to the cmeABC promoter, leading to increased pump expression and elevated bile resistance. Interestingly, the presence of bile salts in culture media enhanced resistance of Campylobacter to multiple antibiotics including cefotaxime, novobiocin and fusidic acid (Lin et al., 2005b). Mutations in cmeABC drastically reduced resistance to bile salts, as inactivation of the CmeABC pump led to impaired growth in the presence of 2 mM choleate culture media whereas wild type bacteria displayed no growth defect under the same conditions (Lin et al., 2003).
Bile salts are proposed to act as a stimulatory signal for synthesis of virulence- associated Campylobacter invasion antigens (Cia) present upon coculture with epithelial cells (Rivera-Amill et al., 2001). These invasion-related proteins were not induced by altering the pH, calcium concentration, osmolarity or temperature of the culture media, suggesting a specific effect for bile salts sodium deoxycholate, cholate and chenodeoxycholate. The flagellum of C. jejuni is another important virulence determinant whose expression is known to be enhanced by bile. Experiments done by
Allen and Griffiths showed that bile positively induced the flagellar flaA σ28 promoter
21 and that subsequent chemotaxis led to colonization of the mucus layer and pathogenesis
(Allen and Griffiths, 2001).
The presence of bile causes pleiotropic responses that affect production of virulence factors, motility and other phenotypes in pathogenic, non-invasive Vibrio cholerae. The diarrheal disease cholera is acquired following consumption of food or water contaminated with V. cholerae, and developing countries are particularly susceptible to devastating outbreaks where mortality rates may exceed 20% in affected populations (Chatterjee et al., 2007). Production of cholera toxin (CT) and toxin- coregulated pilus (TCP) are typically required for colonization of the intestinal epithelium (Kaper et al., 1995). Expression of these virulence factors, as well as others, is controlled by a cascade of regulatory proteins comprising the ToxR regulon. ToxR and
TcpP are inner membrane DNA binding proteins that activate ToxT, an important transcriptional regulator that controls a variety of factors necessary for colonization and disease in the host, including ctxAB and tcpA (Chatterjee et al., 2007).
As evidenced by several pieces of conflicting data, the relationship between
Vibrio and bile is quite complex. It was initially reported that the production of CT and
TCP is dramatically diminished when V. cholerae is grown in the presence of crude ox bile extract (Gupta and Chowdhury, 1997). This finding was extended by Schumacher and Klose who used a plasmid-based heterologous Plac promoter to show that sodium choleate addition resulted in a significantly reduced ability of ToxT to activate transcription of regulated genes. In sum, these results suggested that ToxT interacts directly with bile or with a factor induced in the presence of bile to alter its ability to regulate target genes (Schuhmacher and Klose, 1999).
22 Furthering the studies of the Klose laboratory, Chatterjee et al. examined bile- regulated virulence factor expression by elaborately fractioning crude bile to identify the components mediating virulence gene repression and enhancement of motility in V. cholerae (Chatterjee et al., 2007). They isolated the unsaturated fatty acids arachidonic, linoleic and oleic acids from bile and showed them to repress expression of the ctxAB and tcpA genes independent of ToxT. These fatty acids also increased expression of flrA, the first gene in a cascade controlling motility. It was proposed that the ToxR-ToxT system that negatively regulates motility is nonfunctional in the presence of unsaturated fatty acids. The resulting increase in motility was also observed upon addition of cholesterol.
However, Hung and Mekalanos later reported that purified bile acids, unlike crude bile extracts, do not inhibit CT or TcpA expression. Interestingly, this work shows that bile acids can activate CT expression in a ToxR-dependent, ToxT-independent manner (Hung and Mekalanos, 2005).
Vibrio cholerae also express outer membrane proteins that are affected by bile.
ToxR activity, independent of ToxT, leads to reciprocal expression of OmpU and OmpT, two general diffusion porins that affect bile resistance (Chakrabarti et al., 1996;
Champion et al., 1997). Gupta and Chowdhury reported that crude ox bile extracts increased V. cholerae motility in a ToxR-independent manner but had no effect on
OmpU/OmpT expression (Schuhmacher and Klose, 1999). However, Provenzano et al. later demonstrated that bile increased OmpU expression in a ToxR-dependent manner to confer enhanced bile resistance for V. cholerae (Duret and Delcour, 2006; Provenzano et al., 2000; Provenzano and Klose, 2000).
23 Similar to other enteric gram-negative pathogens, V. cholerae expresses an efflux
system contributing to antimicrobial resistance. Bina et al. recently characterized two
RND-family efflux systems called vexAB and vexCD that provide V. cholerae resistance
to bile (Bina et al., 2006). Microarrays were used previously to show that the two open
reading frames, now known to encode vexAB, were upregulated in stool of cholera
patients and in rabbit ileal loops (Bina et al., 2003; Merrell et al., 2002; Xu et al., 2003).
Experiments by Bina et al. showed that expression of the vexAB and vexCD efflux systems are regulated by bile acids and that these pathways have overlapping roles in the resistance to bile (Bina et al., 2006). Surprisingly though, they demonstrated that vexB, vexD and vexB-vexD deletion strains efficiently colonized the infant mouse, suggesting the dispensability of these systems in vivo or the involvement of other as of yet uncharacterized efflux systems.
Food-processing and storage expose the gram-positive bacterium Listeria monocytogenes to growth challenges including cold temperatures, acidic pH and high osmolarity (Vazquez-Boland et al., 2001). The surviving bacteria contaminate food and subsequently can infect a human host, where temperatures are higher, pH is lower, osmolarity shifts during transit through the gastrointestinal tract, and bile is present
(Gahan and Hill, 1999). Similar to S. Typhimurium described above, pre-exposure of
Listeria to sublethal concentrations of bile prepares cells for subsequent growth in otherwise lethal amounts of bile. Begley et al. mimicked experiments performed by
Flahaut et al. in E. faecalis (Flahaut et al., 1996) and showed this adaptation phenomenon in low levels of bile to occur in as little as five seconds (Begley et al., 2002). Although bile sensing yields coordinate changes to cellular physiology through as of yet unknown
24 mechanisms, it has been suggested that adaptation to other stresses also confers cross-
protection to bile. Indeed, exposing exponential phase L. monocytogenes to acidic pH, high temperature, 5% NaCl or 0.01% SDS increased bile tolerance (Begley et al., 2002).
Listeria expresses bile salt hydrolases (BSHs) thought to be important for bile resistance. These enzymes catalyze hydrolysis of the amide bond between the C-24 position of the steroid moiety and the amino acid side chain of bile acids. It has been proposed that deconjugation of bile salts by BSHs represents a detoxification mechanism that promotes Listeria persistence in the gastrointestinal tract (Begley et al., 2005a). A bsh gene deletion in L. monocytogenes created by Dussurget et al. decreased the MICs for both bile and bile salts and displayed reduced bacterial faecal carriage after oral infection of guinea pigs (Dussurget et al., 2002). In addition, the bsh gene is activated by PrfA, the major virulence gene regulator of L. monocytogenes. Interestingly, when wild type cells carried the bsh gene on a plasmid, researchers observed an increase in intestinal multiplication.
Begley et al. corroborated these results using a rifampin marked strain in a murine model of infection, showing that bsh mutants could not be found in the intestine three days post oral inoculation (Begley et al., 2005b). They also showed involvement of the general stress responsive sigma factor σB in bsh gene regulation. This indicates that
anaerobic conditions of the intestine trigger the sigma B regulon to prepare Listeria for
environmental stressors including bile. Genomic sequences revealed bsh to be absent
from nonpathogenic Listeria, further implicating BSH activity as a specific mediator of
bile resistance for successful colonization of the host.
25 Another virulence determinant in L. monocytogenes is the recently described bile
tolerance locus BilE, which contains two distinct ATP-dependent bile acid permease
signature sequences common to multidrug efflux pumps (Sleator et al., 2005). Sleator et
al. revealed that a bilE mutant retained approximately 1.5 times the amount of
radiolabelled bile as the wild type, rendering it bile sensitive. Intriguingly, they showed
that bile susceptibility is more pronounced in a bilE deletion compared to a bsh mutant,
suggesting that active extrusion of bile salts is more effective than detoxification of
internalized bile. The authors also present data showing that bilE transcription is
coordinately controlled by sigma B and prfA, much like BSH enzymes mentioned above.
In addition to altering the pathogenic course of invasive bacteria, bile is known to affect disease outcome for a variety of viral types. Human immunodeficiency virus type
1 (HIV-1) transmission and pathogenic progression requires infection or propagation of viral replication in CD4+ T lymphocytes. This mechanism has been suggested to rely
upon an important interaction between the gp120 envelope glycoprotein of HIV-1 with
DC-specific ICAM-3 grabbing nonintegrin (DC-SIGN) expressed on dendritic cells
(DCs) and a subset of B cells (Geijtenbeek et al., 2000; Hu et al., 2000; Pope et al.,
1995b). DC-SIGN is a transmembrane C-type lectin that recognizes the major
Mycobacterium tuberculosis surface lipoglycans, mannose-capped lipoarabinomannan
(ManLAM) and higher-order phosphatidyl-myo-inositol mannosides (PIMs) (Azad et al.,
2008; Torrelles et al., 2006). Naarding et al. demonstrated that Lewis X (LeX) found in
human milk could inhibit DC-SIGN dependent transfer of HIV-1 to CD4+ T lymphocytes
by binding to DC-SIGN and blocking the interaction between virus and receptor
(Naarding et al., 2005). They further showed that bile salt-stimulated lipase (BSSL), a
26 LeX-carrying glycoprotein secreted by the pancreas and activated by bile salts in the intestine, was the primary compound in human milk binding to DC-SIGN and inhibiting
HIV-1 transfer (Naarding et al., 2006). BSSL variations caused alterations in LeX expression that limited viral activity, suggesting a potential role for bile derivatives against HIV-1 transmission. In another study investigating the effects of bile on HIV-1 activity, Al-Jabri et al. showed that tyrosine-conjugated tri- and dihydroxy bile salt derivatives exhibited high surfactant activity, low cellular toxicity to human tissues, and anti-HIV-1 virucidal activity (Al-Jabri et al., 2000).
The presence of bile acids seems to be required for the growth of porcine enteric calicivirus (PEC), a small, nonenveloped virus responsible for a high proportion of nonbacterial gastroenteritis outbreaks in the United States each year (Chang et al., 2004).
The PEC strain Cowden can be propagated by serial passage in a continuous cell line
(LLC-PK), but only with addition of intestinal content (IC) fluid filtrate obtained from uninfected gnotobiotic pigs. Chang et al. elucidated bile acids cholic acid, glycocholic acid, chenodeoxycholic and glycochenodeoxycholic acid in IC as the essential active factors mediating growth of PEC in cultured cells. The presence of bile during PEC replication triggered the protein kinase A cell-signaling pathway and induced increased cAMP levels in LLC-PK cells, leading to a down-regulation of innate immunity associated with decreased IFN-mediated signal transducer and activator of transcription 1 phosphorylation. Interestingly, addition of cAMP/protein kinase A pathway inhibitors to infected LLC-PK cells suppressed bile acid-mediated PEC replication. The dependence of PEC growth on the presence of bile suggests that bile salts may actively suppress
27 innate immune function in susceptible target cells so that enteric viruses such as PEC may utilize this mechanism to establish gut infections (Chang et al., 2004).
1.3 Chronic Carriage, Gallstones, and Carcinoma
During systemic typhoid infections, S. Typhi can reach the gallbladder and establish an acute, active infection (cholecystitis) or persist in this organ long after overt symptoms subside (Vaishnavi et al., 2005; Sinnott and Teall, 1987). Historically, clinically administered antibiotics have demonstrated variable efficacies against dissolution of the persistent bacterial infection. In the early 1940s, regimens of
iodophthalein, sulphonamides, phenothiazine, penicillin, streptomycin, and
choloromycetin individually or in combination were discredited as appropriate treatment
options (Paterson, 1949). A study by Levine et al. in 1982 demonstrated that serovar
Typhi could be recovered in stool samples for over 1 year from at least 2 to 5% of those
suffering acute typhoid illnesses (Levine et al., 1982), yet bacterial recovery in feces is
sporadic and as such a poor diagnostic tool. Shedding of S. Typhi into the environment
by chronic carriers accelerates the fecal-oral route of person-to-person transmission in endemic areas, suggesting the need for improved food and water sanitation, awareness of personal hygiene in public health, and the development of novel therapeutic strategies.
An estimated 25% of asymptomatic carriers have no history of typhoid fever
(Parry et al., 2002), making the chronic carrier state difficult to confirm and an understudied aspect of global human health. Vi agglutination from blood and bone marrow samples has long been used as a method of identifying typhoid carriers
(Bhatnagar, 1948), yet not all clinical isolates express Vi-antigen and patients recovering
28 from acute typhoid infections have low titres of serum IgG antibodies to Vi antigens
(Losonsky et al., 1987). Multiplex PCR is a recent advancement in technology that
selectively amplifies Vi antigen (viaB), flagellar antigens (fliC-d and fliC-a), and O- antigen synthesis (tyv and prt) to detect S. Typhi in human samples (Hirose et al., 2002).
Despite difficulties in diagnosis, we understand that the asymptomatic carrier state is frequently associated with gallbladder abnormalities, particularly gallstones (Lai et al., 1992). Cholelithiasis afflicts approximately 10 to 15% of the adult population world-wide and more than 25 million individuals in the United States (Shoheiber et al.,
1997). Gallstone formation (cholelithogenesis) is attributed to a combination of environmental and genetic causes including obesity, female gender, multiple pregnancies, nutrition, old age, and Crohn’s disease, and can occur in patients for many years without symptoms (Shoheiber et al., 1997; Afdhal, 1999). Under appropriate physicochemical conditions, cholesterol monohydrate crystals supersaturate from bile and nucleate in the gelled mucin glycoprotein scaffolding (biliary sludge) of the gallbladder wall to form gallstones (Maurer et al., 2009). The primary constituent of gallbladder stones is cholesterol, whereas calcium bilirubinate predominates in bile duct stones (Hofmann,
2005). Biliary epithelial cells express mucin genes and secrete immunoglobulin proteins and a variety of cytokines during innate and adaptive immunity of the gastrointestinal tract (Maurer et al., 2009; Reynoso-Paz et al., 1999; Andrianifahanana et al., 2006), yet gallbladder biology and the associated immune response in typhoid carriage, particularly in those patients with gallstone biofilms, remain unknown.
In patients carrying both S. Typhi and cholesterol gallstones in the gallbladder, clinically administered antibiotics are typically ineffective against dissolution of the
29 persistent bacterial infection (Lai et al., 1992). Removal of the gallbladder
(cholecystectomy) remains the most effective treatment option for these individuals, a treatment option first proposed by Dehler in 1907 (Paterson, 1949). In 1994, the United
States alone spent an estimated 8.0 billion dollars treating gallbladder diseases, suggesting a strong need for alternative treatment options in areas of the world where typhoid fever is endemic and surgical intervention is cost-prohibitive. Chronic typhoid carriers with gallstones also experience an 8.47-fold-higher risk for developing hepatobiliary diseases, including carcinoma of the gallbladder (Dutta et al., 2000; Kumar et al., 2006; Surette and Bassler, 1999). In 1994, Caygill et al. demonstrated that gallbladder cancers were associated with long-term typhoid carriage, but not acute infections (Caygill et al., 1994).
The association between chronic bacterial gallbladder infections, gallstones, and carcinoma of this organ has also been a subject of recent investigation in Helicobacter.
For example, Fox et al. sequenced PCR-amplified 16S rRNA fragments of DNA isolated from human bile and gallbladder tissue samples and showed that H. bilis was found in the gallbladders of five out of eight Chilean patients with chronic cholecystitis and gallbladder cancer (Fox et al., 1998; Fox et al., 1995). Several reports have evaluated the correlation between gallstones and the presence of H. pylori in the gallbladder. Its existence in this organ is inherently intriguing because H. pylori are susceptible to bile in vitro (Tiwari et al., 2006). Apostolov et al. used immunohistochemistry with H. pylori- specific CagA and VacA antigens and observed a high prevalence of this strain in gallbladder epithelial cells of Ukrainian patients needing cholecystectomy (Ananieva et al., 2002; Apostolov et al., 2005).
30 On the other hand, Bohr et al. draw little analogy between the presence of
Helicobacter and cholecystitis (Bohr et al., 2007). Immunohistochemical analysis of gallbladder tissues from German patients with gallstones demonstrated a low prevalence of Helicobacteraceae. In addition, Maurer et al. used C57L/J mice, a strain in which gallstone formation can be induced by a lithogenic diet, to conclude that H. pylori infection plays no role in murine cholesterol gallstone formation (Maurer et al., 2006).
The limited amount of contradictory literature suggests that the cause and effect relationship between the presence of Helicobacter and induction of various hepatobiliary diseases, as influenced by bile during infection, needs further investigation.
1.4 Bacterial Biofilm Formation
Biofilm formation was made clinically relevant in 1978 by Dr. R.J. Gibbons
(Jefferson, 2004) and is currently thought to characterize 65% of chronic infections treated by physicians (Stoodley, 2002). Bacterial biofilm infections develop on live and dead tissues and medical devices, are slow to produce overt symptoms, demonstrate heightened resistance to cellular and humoral immune host responses and commonly administered antibiotic regimens and household sanitizers, and persist for long periods of time with intermittent recurrence of symptoms until the community is physically removed (for a review see reference (Costerton et al., 1999)).
Over the past two decades, bacterial biofilms have been increasingly implicated as burdens to food and public safety worldwide, and are broadly defined as heterogeneous communities of microorganisms that adhere to each other and to inert or live substrates
(Costerton et al., 1995; Davey and O'toole, 2000; Watnick and Kolter, 2000; Stewart and
31 Franklin, 2008; Monds and O'Toole, 2009). Biofilm formation occurs in sequential, highly regulated stages that begin with adherence of free-swimming, planktonic bacteria
to a surface. Subsequent biofilm maturation is characterized by the production of a self-
initiated extracellular matrix (ECM) composed of nucleic acid, proteins, or
exopolysaccharides (EPS) that encase the community of microorganisms and provide
structure and protection. Planktonic cells from this sessile, matrix-bound population are
continuously shed, which can result in reattachment and fortification of the biofilm, or
systemic infection and release of the organism into the environment (Fig. 1.4).
Wild-type and mutant bacteria strains have been investigated to determine
important ligands mediating biofilm development using static microtiter plates, dynamic
flow cell apparati, tissue cultured cells, or even human gallstones (Costerton et al., 1999;
Stewart and Costerton, 2001; Prouty and Gunn, 2003; Ma et al., 2009). This includes
diverse species of commensal and pathogenic microorganisms including Streptococcus
mutans (Idone et al., 2003; Wen and Burne, 2002; Svensater et al., 2001), Staphylococcus
aureus (Caiazza and O'Toole, 2003; Vaudaux et al., 1995; Gross et al., 2001), non-
typeable Haemophilus influenzae (NTHI) (Jurcisek et al., 2007), Escherichia coli (Pratt
and Kolter, 1998; Danese et al., 2000), Vibrio cholerae (Hung et al., 2006; Lejeune,
2003; Yildiz and Schoolnik, 1999), and Pseudomonas aeruginosa (Ma et al., 2009;
O'Toole and Kolter, 1998b; Davies et al., 1993; Whiteley et al., 2001). Interestingly,
bacterial gene expression profiles differ between planktonic and biofilm phenotypes
(Stoodley et al., 2002; Jefferson, 2004), and these changes are likely regulated by
external stimuli including nutrient availability, oxygen tension, pH, the presence or
32 absence of antimicrobials, and the composition of binding substrates, suggesting that biofilm development is a highly-ordered, multifactorial process.
Bacterial biofilms resist the deleterious effects of antibiotics whereas planktonic cells dispersed from the biofilm microenvironment quickly regain susceptibility to those antibiotics, suggesting that biofilm-mediated resistance is not acquired through mutations or horizontal transfer of genes (Stewart and Costerton, 2001; Anwar et al., 1989;
Williams et al., 1997). For example, a Klebsiella pneumoniae strain lacking β-lactamase production was killed in aqueous solution by ampicillin at concentrations as low as 2
µg/ml but, when grown as a biofilm, was unaffected by 5,000 µg/ml ampicillin (Anderl et al., 2000). It was also demonstrated that established mechanisms of resistance to antimicrobials and bile salts including efflux pumps and the multiple antibiotic resistance
(mar) locus of E. coli did not provide protection to bacteria in biofilms (Williams et al.,
1997; Maira-Litran et al., 2000), suggesting that biofilm-mediated mechanisms of resistance may differ from those conventionally employed by planktonic cells.
Biofilm formation by P. aeruginosa has been hypothesized to mediate colonization and antibiotic resistance in the context of cystic fibrosis, a lung disease that features persistent airway neutrophil accumulation. Interestingly, human neutrophils were shown in vitro to enhance P. aeruginosa biofilm development and even settle on the mature biofilm to become phagocytically engorged, degranulated, immobilized, and rounded during compromised host defense (Walker et al., 2005; Jesaitis et al., 2003).
Similarly, S. epidermidis biofilm formation mediates a protective response in vitro against complement deposition and neutrophil-dependent killing (Kristian et al., 2008).
33 Mathematical approaches and empirical observations are constantly challenging and redefining the developmental model of microbial biofilm formation (Monds and
O'Toole, 2009; van Loosdrecht et al., 2002; Picioreanu et al., 2007; Saravanan and
Sreekrishnan, 2006). Recent work in P. aeruginosa has investigated stage-specific factors including twitching motility, cell-to-cell signaling, stationary phase sigma factor expression, and polysaccharide synthesis locus (PSL) activity that contribute to biofilm development in flow cell systems using statistical analysis and direct visualization
(Heydorn et al., 2002; Ma et al., 2009). Other polysaccharides important for P. aeruginosa ECM biosynthesis include alginate, and Pel, a seven gene operon regulated by mediators of quorum sensing (Ryder et al., 2007; Ramsey and Wozniak, 2005;
Sakuragi and Kolter, 2007). The term quorum sensing was introduced in reference to the cell-density-linked, coordinated gene expression observed in Vibrio fischeri, and is hypothesized to play a role in biofilm formation for some organisms under certain conditions (reviewed in (von Bodman et al., 2008; Kjelleberg and Molin, 2002)).
The molecular genetic mechanisms mediating adherence and microcolony formation during early biofilm growth are beginning to be elucidated for many microorganisms. Flagella, for example, promote surface binding during the initial stages of biofilm development (Pratt and Kolter, 1998; O'Toole and Kolter, 1998b) as well as adhesion during biofilm-mediated colonization of tissue cultured cells and mucus by P. aeruginosa (Rudner et al., 1992; Lillehoj et al., 2002), Campylobacter jejuni
(McSweegan and Walker, 1986), E. coli (Giron et al., 2002), and S. enterica spp. (Dibb-
Fuller et al., 1999; La Ragione et al., 2003; Budiarti et al., 1991; Allen-Vercoe and
Woodward, 1999). Expression of the serovar Typhimurium flagella has been shown to
34 inhibit biofilm formation on polystyrene wells (Teplitski et al., 2006) and promote biofilm development on human gallstones when bile is added to the growth media
(Prouty et al., 2002a; Prouty and Gunn, 2003), but the stage at which this appendage positively or negatively impacts Salmonella biofilms remains undefined.
Interestingly, flagellar-mediated phenotypes including swimming motility and chemotaxis differentially contributed to colonization and biofilm formation depending on environmental cues (O'Toole and Kolter, 1998b; Pratt and Kolter, 1998; Prouty and
Gunn, 2003; Huber et al., 2002; Mey et al., 2005). Bile increases motility and is a
chemical attractant at physiological concentrations for V. cholerae (Butler and Camilli,
2005), acts as a repellent for Helicobacter pylori (Worku et al., 2004), and enhances
tumbling frequency while downregulating motility in S. enterica (Prouty et al., 2004b).
Swimming contributes positively to biofilm formation of P. aeruginosa (O'Toole and
Kolter, 1998b) and E. coli (Pratt and Kolter, 1998), but a motA mutant of serovar
Typhimurium did not affect mature biofilm formation on gallstones in vitro (Prouty and
Gunn, 2003). In the motA595::Tn10 strain, flagellar motor function is defective while
biosynthesis remains unaffected (Kutsukake et al., 1990). Mutations in the same gene of
E. coli and Burkholderia cepacia affected early biofilm formation, but each recovered
from the transient defect to form mature biofilms (Huber et al., 2002). Bacterial
chemotaxis (tumbling motility) is controlled by clockwise flagella rotation and has been
shown to be dispensable for E. coli biofilms in a PVC microtitre dish assay (Pratt and
Kolter, 1998), but important for V. cholerae biofilms on polystyrene wells (Mey et al.,
2005).
35 Fimbriae have been shown to mediate adherence during biofilm initiation and cell-cell interactions during biofilm growth for a variety of microorganisms (Davey and
O'toole, 2000; O'Toole and Kolter, 1998b). The serovar Typhimurium genome encodes
13 putative fimbrial operons, some of which are not expressed in vitro (Nuccio et al.,
2007). Type 1 fimbriae have been shown to be important for biofilm formation on HEp-2 tissue culture cells, the murine intestinal epithelium, and chicken intestinal epithelium
(Boddicker et al., 2002; Ledeboer and Jones, 2005), but not on human gallstones incubated with bile (Prouty et al., 2002a). Production of filamentous type IV pili was recently described in the airway pathogen NTHI and demonstrated to enhance adherence to human respiratory epithelial cells, colonization of the chinchilla respiratory tract as well as biofilm formation in vitro and in vivo (Bakaletz et al., 2005; Jurcisek et al., 2007).
Expression of type IV pili also contributes to biofilm development in P. aeruginosa and
V. cholerae (Deziel et al., 2001; Moorthy and Watnick, 2004).
ECM material within bacterial biofilms is thought to be heterogeneous and to provide both rigidity to the biofilm and protection to bacteria embedded within established biofilms. It has previously been shown that Salmonella biofilm-associated
ECM factors are not uniformly required for biofilm formation on all surfaces (Prouty and
Gunn, 2003). Cellulose and colonic acids have been shown to play a role in biofilm formation on biotic as well as abiotic surfaces, as mutations in either wcaM or yhjN have been shown to disrupt serovar Typhimurium biofilm formation in flow through chambers on HEp-2 cells (Ledeboer and Jones, 2005). However, in the presence of bile, cellulose and colanic acid are not a factor in biofilm formation on human gallstones (Prouty and
36 Gunn, 2003). In E. coli, cellulose mediated biofilm formation occurs independently of
know regulators csgD and adrA (Da Re and Ghigo, 2006).
Atomic force microscopy of serovar Typhimurium biofilms grown on agar plates
or mica slides demonstrated that curli and cellulose were important for ECM production
and suggested that expression of surface appendages may be co-regulated during biofilm formation (Jonas et al., 2007). AgfD (CsgD) is an important regulator of Salmonella
biofilm formation (Brombacher et al., 2003; Romling et al., 1998) and has been
demonstrated to control biosynthesis of the recently identified O-antigen (O-ag) capsule
(Gibson et al., 2006). This exopolysaccharide is membrane linked by 2-hydroxymyristic
acid (like a capsule), similar in structure to the LPS O-ag of serovar Enteritidis,
conserved amongst salmonellae, and encoded by two divergent operons (yihU-yshA and
yihV-yihW) (Gibson et al., 2006). Despite having similar repeating sugar units, the O-ag capsule and the LPS O-ag differ in size, charge, substitution patterns, and immunoreactivity (White et al., 2003). O-ag capsule expression was found to be necessary for serovar Enteritidis biofilm formation leading to enhanced plant colonization
(Barak et al., 2007). Interestingly, Salmonella biofilm formation has also been observed on growing bean sprouts and parsley sprigs (Warriner et al., 2003; Lapidot et al., 2006).
In addition to polysaccharides, biofilm-associated proteins (BAPs) contribute to
ECM production in S. aureus and E. faecalis biofilms (Latasa et al., 2006). Salmonellae express a large cell surface protein encoded by bapA that was shown to be important for serovar Enteritidis biofilm formation but not for serovar Typhimurium (Latasa et al.,
2005; Jonas et al., 2007). Two protein domain superfamilies, glutamate-alanine-leucine
(EAL) and GGDEF, have been demonstrated to control Salmonella and Vibrio biofilm
37 formation by regulating the levels of the novel second messenger cyclic di-guanylic acid
(c-di-GMP) (Tischler and Camilli, 2004; Simm et al., 2005; Simm et al., 2004; Garcia et al., 2004). The role of these and other proteins in ECM production during biofilm formation needs further investigation.
1.5 Hypothesis and Goals
The asymptomatic, chronic carrier state of Salmonella enterica serovar Typhi occurs in the human gallbladder, is frequently associated with the presence of cholesterol gallstones, and does not subside with antibiotic treatment (Levine et al., 1982; Lai et al.,
1992), yet the progression from infection to persistence remains unknown. The gallbladder is also the storage organ for bile, suggesting novel mechanisms utilized by the bacterium to mediate colonization in a hostile environment. Therefore, we hypothesize that biofilm formation on cholesterol gallstone surfaces enhances persistence in this hostile environment and, thus, person-to-person transmission of typhoid fever in impoverished nations.
We have previously demonstrated that bile promotes biofilm formation in an in vitro human gallstone test tube assay, and that the ECM of these biofilms can be preserved and visualized by SEM (Fig. 1.5) (Prouty et al., 2002a). Interestingly, the support matrix seemed to provide signals that determined Salmonella biofilm components, and those differed for gallstones and glass surfaces (Prouty and Gunn,
2003). This dissertation attempts to define Salmonella constituents mediating adherence
(early) and ECM production (late) events during biofilm development specifically on cholesterol surfaces, and evaluate the contribution of gallstone biofilms during
38 asymptomatic typhoid carriage in humans and a new murine model. A better understanding of the regulatory mechanisms that mediate Salmonella biofilm formation and maintenance promises to elucidate important therapeutic targets for eliminating chronic carriage in the gallbladder in patients with bile-induced typhoid gallstone biofilms.
39
Figure 1.1: Karl Eberth’s typhoid bacilli, hand drawn with the camera lucida and presented in The British Medical Journal on March 25, 1882 (Coats, 1882). Intestinal tissue from an infected individual was stained with methyl-violet and observed at 1,500 diameters. Pale circles represent red corpuscles while the darker ones are nuclei of lymphatic cells. Typhoid bacilli were detected as aggregates or isolated rods.
40
Figure 1.2: Typhoid endemic nations and global incidence of antimicrobial resistant serovar Typhi strains adapted from Bhan et al. (Bhan et al., 2005). Clinical isolates are increasingly tolerant to nalidixic acid (NAR) in southeastern Asia (1990-2004).
41
Figure 1.3: Bacterial intestinal pathogens discussed in this chapter that are affected by bile. Listed are microbes known to cause acute or chronic disease in the gallbladder or the intestinal tract. Interactions between invading microorganism and bile, which is produced in the liver and found in the intestine and gallbladder, affect various genes and virulence properties (listed) that enhance colonization and persistence.
42
Mature Biofilm Shedding
Microcolonies
Monolayer Re- Attachment
Binding Growth/Recruitment Self-Initiated ECM
Figure 1.4: The sequential, highly regulated stages of biofilm development. Planktonic, free-swimming bacteria adhere to biotic or abiotic surfaces as mediated by environmental conditions and swim along the substrate to facilitate monolayer formation. The growing community is enlarged and fortified by replication and recruitment of new cells. Subsequent biofilm formation is characterized by the production of a self-initiated extracellular matrix (ECM) composed of nucleic acid, proteins, or exopolysaccharides (EPS) that encase the microorganisms and provide structure and protection. Planktonic cells from this sessile, matrix-bound population are continuously shed and can reattach or spread to distal sites.
43 A. C. E.
D. F.
B.
31 μm
Figure 1.5: S. enterica bile-induced gallstone biofilms visualized by confocal and scanning electron microscopy. Human gallstones were incubated with salmonellae and 3% bile for 12 or 18 days, washed in LB, fixed in glutaraldehyde, and observed. (A) CLSM micrograph of S. enterica serovar Typhi biofilm constitutively expressing green fluorescent protein. (B) Three-dimensional assembly of Z-scan CLSM images demonstrating serovar Typhi biofilm thickness at approximately 31 μm. (C) SEM micrograph showing the multilayered, heterogeneous surface of a cholesterol gallstone incubated in LB broth without bacteria. (D) Serovar Typhimurium biofilm visualized by SEM. The sample was air-dried overnight prior to fixation to harden extracellular matrix constituents. (E and F) SEM micrographs of serovar Typhimurium mature biofilms. The web-like strands or flocculent material were preserved by immediate fixation and are indicative of exopolysaccharides in the biofilm ECM.
44
Chapter 2
The Salmonella enterica serovar Typhimurium flagellum mediates attachment to and biofilm development on cholesterol-coated surfaces
2.1 Abstract
The asymptomatic, chronic carrier state of Salmonella enterica serovar Typhi occurs in the bile-rich gallbladder and is frequently associated with the presence of cholesterol gallstones. We have previously demonstrated that salmonellae form biofilms on human gallstones and cholesterol-coated surfaces in vitro and thus hypothesize that bile-induced biofilm formation on cholesterol gallstones promotes gallbladder colonization and maintenance of the carrier state. Random transposon mutants of S. enterica serovar Typhimurium were screened for impaired adherence and biofilm formation on cholesterol-coated Eppendorf tubes in the Tube Biofilm Assay (TBA), but not on glass and plastic surfaces. We identified 49 mutants with this phenotype. The results indicate that genes involved in flagella biosynthesis and structure primarily mediated attachment to cholesterol. Subsequent analysis in the TBA suggests that the presence of the flagellar filament and functional chemotaxis enhance binding/biofilm formation in the presence of bile, while flagellar motility and expression of type 1 fimbriae are unimportant. Purified Salmonella flagellar proteins used in a modified TBA
45 ELISA showed that FliC was the critical subunit mediating binding to cholesterol. These studies provide a better understanding of early events during biofilm development, specifically how salmonellae bind to cholesterol, and suggest a target for therapies that may alleviate biofilm formation on cholesterol gallstones and the chronic carrier state.
2.2 Introduction
The serovars of Salmonella enterica are diverse, infect a broad array of hosts, and cause significant morbidity and mortality in impoverished and industrialized nations worldwide. Salmonella enterica serovar Typhi is the etiologic agent of typhoid fever, a severe illness characterized by sustained bacteraemia and a delayed onset of symptoms that afflicts approximately 20 million people each year (Butler et al., 1978; Crump et al.,
2004). Serovar Typhi can establish a chronic infection of the human gallbladder, suggesting that this bacterium utilizes novel mechanisms to mediate enhanced colonization and persistence in a bile-rich environment.
There is a strong correlation between gallbladder abnormalities, particularly gallstones, and development of the asymptomatic Salmonella carrier state (Lai et al.,
1992). Antibiotic regimens are typically ineffective in carriers with gallstones (Lai et al.,
1992), and these patients have an 8.47-fold-higher risk for developing hepatobiliary carcinomas (Dutta et al., 2000; Kumar et al., 2006). Elimination of chronic infections usually requires gallbladder removal (Lai et al., 1992), but surgical intervention is cost- prohibitive in developing countries where serovar Typhi is prevalent. Thus, understanding the progression of infection to the carrier state and developing alternative treatment options are of critical importance to human health.
46 The formation of biofilms on gallstones has been hypothesized to be a facilitator for enhanced colonization of and persistence in the gallbladder. Over the past two decades, bacterial biofilms have been increasingly implicated as burdens to food and public safety worldwide, and are broadly defined as heterogeneous communities of microorganisms that adhere to each other and to inert or live surfaces (Costerton et al.,
1995; Davey and O'toole, 2000; Watnick and Kolter, 2000; Stewart and Franklin, 2008;
Monds and O'Toole, 2009). This sessile environment provides selective advantages in natural, medical, and industrial ecosystems to a diverse species of commensal and pathogenic bacteria including Streptococcus mutans (Idone et al., 2003; Wen and Burne,
2002; Svensater et al., 2001), Staphylococcus aureus (Caiazza and O'Toole, 2003;
Vaudaux et al., 1995; Gross et al., 2001), Escherichia coli (Pratt and Kolter, 1998;
Danese et al., 2000), Vibrio cholerae (Hung et al., 2006; Lejeune, 2003; Yildiz and
Schoolnik, 1999), and Pseudomonas aeruginosa (Ma et al., 2009; O'Toole and Kolter,
1998b; Davies et al., 1993; Whiteley et al., 2001). Bacterial biofilms are increasingly associated with many chronic infections in humans, and demonstrate heightened resistance to commonly administered antibiotics and engulfment by professional phagocytes of the host innate immune system (Lewis, 2001; Lewis, 2007; Mah et al.,
2003). Bacterial gene expression profiles differ between planktonic and biofilm phenotypes (Stoodley et al., 2002; Jefferson, 2004), and these changes are likely regulated by external stimuli including nutrient availability, the presence or absence of antimicrobials, and the composition of binding substrates.
Biofilm formation occurs in sequential, highly ordered stages that begin with attachment of free-swimming, planktonic bacteria to a surface. Subsequent biofilm
47 maturation is characterized by the production of a self-initiated extracellular matrix
(ECM) composed of nucleic acid, proteins, or exopolysaccharides (EPS) that encase the
community of microorganisms. Planktonic cells from this sessile, matrix-bound
population are continuously shed, which can result in reattachment and fortification of
the biofilm, or systemic infection and release of the organism into the environment.
Shedding of serovar Typhi by asymptomatic carriers can contaminate food and water to
account for much of the person-to-person transmission in underdeveloped countries.
Our laboratory has previously reported that bile is required for mature biofilm formation with characteristic EPS production of S. enterica serovars Typhimurium,
Enteritidis, and Typhi on human gallstones and cholesterol-coated Eppendorf tubes
(Prouty et al., 2002a; Crawford et al., 2008). It was also demonstrated that Salmonella
biofilms formed on different surfaces had unique phenotypes and required expression of
specific EPS (Prouty and Gunn, 2003; Crawford et al., 2008), yet the factors mediating
Salmonella binding to gallstones/cholesterol-coated surfaces during the initiation of
biofilm formation remain unknown. Here, we show that the presence of serovar
Typhimurium flagella promotes binding specifically to cholesterol in the early stages of
biofilm development and that the FliC subunit is a critical component. Bound
salmonellae expressing intact flagella provided a scaffold for other cells to bind during
later stages of biofilm growth. Elucidating key mechanisms that mediate adherence to
cholesterol during Salmonella bile-induced biofilm formation on gallstone surfaces
promises to reveal novel drug targets for alleviating biofilm formation in chronic cases.
48 2.3 Materials and Methods
2.3.1 Bacterial strains, growth conditions, and molecular biology techniques
The Salmonella strains used in this study are listed in Table 2.1. LB broth and
agar were used for bacterial growth, creation of mutants, biofilm assays, and flagella
purification. For biofilm formation experiments, strains were grown on a rotating drum
in the presence or absence of 3% crude ox bile extract (Sigma, St. Louis, MO) to mid- to
late exponential phase (optical density at 600 nm [OD600] of 0.6 to 0.8). When necessary, antibiotics were added at appropriate concentrations: ampicillin, 50 μg/ml; kanamycin, 25
μg/ml; chloramphenicol, 25μg/ml; and tetracycline, 15 μg/ml. Molecular cloning and
PCR were completed according to established protocols. Plasmids were purified using
QIAprep spin mini prep kits (Qiagen, Valencia, CA) and transformed by electroporation as previously described (Schmid and Roth, 1983).
2.3.2 Transposon mutagenesis and screening
Cholesterol-binding deficient, tetracycline (Tet) resistant serovar Typhimurium strains were created by random transposon mutagenesis using established methodology
(Schmid and Roth, 1983). Briefly, a pool of Tn10d-Tet transposons was introduced into
wild-type serovar Typhimurium by generalized, P22 HT int-105-mediated phage
transduction. Strains containing Tn10d transposon insertions were selected on LB agar-
Tet plates and 40,000 individual colonies were pooled together in LB broth-Tet. The
serovar Typhimurium transposon mutant pool was grown to log phase in LB broth-Tet
with 3% crude ox bile extract and added in 100 μl amounts to siliconized Eppendorf
tubes (Fisher Scientific, Pittsburgh, PA) coated with 1 mg each of chromatography-grade
49 cholesterol (Sigma, St. Louis, MO). Following incubation for 24 hours at room
temperature on a Nutator shaker (Labnet International, Edison, NJ), 10 μl of planktonic,
non-adherent culture was removed and added to 90 μl of fresh LB broth-Tet with 3%
crude ox bile in a new cholesterol-coated, siliconized Eppendorf tube. This panning for
cholesterol binding deficient bacteria was repeated every 24 hours for 10 days. Serial
dilutions of the final planktonic culture were plated on LB agar-Tet, and 500 individual colonies were screened for loss/defect of biofilm formation on cholesterol-coated surfaces (0-25% of wild-type values) and preservation of biofilm formation on glass and plastic coverslips (75-100% of wild-type values). Colonies were reconfirmed for a non- biofilm forming (on cholesterol) phenotype by back-transduction using P22 HT int-105.
2.3.3 Cholesterol, glass, and plastic surface biofilm assays
Salmonella strains were tested for their ability to form biofilms in the tube biofilm assay (TBA) and on cholesterol-coated, glass, and plastic coverslips as described previously (Crawford et al., 2008). In brief, log phase Salmonella strains grown with or without 3% crude ox bile were added to cholesterol-coated Eppendorf tubes or plastic 24- well plates (Fisher Scientific, Pittsburgh, PA) containing Chromerge-cleaned glass, plastic, and cholesterol-coated coverslips. These cultures were incubated on a Nutator shaker at room temperature for 6 days. Every 24 hours, the medium was removed, the tubes were washed three times with LB, and fresh medium (LB with or without 3% bile) was added. Bound bacterial samples were fixed at 60°C for 1 hour and a solution of
0.1% crystal violet (gentian violet in isopropanol-methanol-1 x PBS [1:1:18]) was then added to stain cells for 5 minutes at room temperature. The dye was extracted using 33%
50 acetic acid and then quantified with optical density readings at 570 nm to determine the amount of dye retained by each biofilm.
2.3.4 DNA sequencing and bioinformatics
Sequencing of transposon mutant genomic DNA from serovar Typhimurium
cholesterol binding deficient colonies with primer JG1787 (5’-
CCTTTTTCCGTGATGGTA-3’) was performed using an Applied Biosystems 3730
DNA Capillary Analyzer and BigDye cycle fluorescent terminator chemistry in the Plant-
Microbe Genomics Facility at The Ohio State University. Transposon insertion sites of
recovered sequences were determined using Blastx at the NCBI (Johnson et al., 2008).
2.3.5 Mutant and complement construction
A serovar Typhimurium strain containing mutations in both a putative fimbrial
protein (FimW) and a transcriptional regulator (FimZ) was created by P22 HT int-105-
mediated, generalized transduction between fimW and fimZ single mutant strains (Schmid
and Roth, 1983). The correct construct was verified by a high frequency of co-
transduction of the antibiotic markers from a potential ΔfimWΔfimZ double mutant strain
into a wild-type serovar Typhimurium background. For complementation, the fimW gene
from serovar Typhimurium was amplified with primers JG1843 (5’-
GCAAGCTTTTTTTTATGCTGCGTATCGCTATTAA-3’) and JG1844 (5’-
CCCTCTAGATTTACTTACTGAGTAAGAAATGAAG-3’), and cloned into the XbaI
r and HindIII sites of the arabinose inducible pBAD18 (ColE1 ori, PBAD L(+) Ap ) vector.
51 The resulting construct was introduced into the fimW single mutant strain of serovar
Typhimurium by electrotransformation.
2.3.6 Adherence assay of live and dead bacteria
Wild-type and flagellar transcriptional activator (FlhC) mutant strains of serovar
Typhimurium were grown overnight at 37°C in LB broth with or without 3% crude ox bile extract, diluted 1:100, and allowed to reach an optical density at 600 nm of 0.6.
Bacteria in these cultures were killed by incubation for 40 minutes in 10% formalin or heat fixation for 20 minutes at 65°C. Triplicates of live and dead salmonellae were added in 100 μl aliquots to 24-well polystyrene tissue culture plates (Becton Dickinson
Labware, Franklin Lakes, NJ) coated with 1 mg of cholesterol per well, and plates were centrifuged at 165 relative centrifugal force (rcf) for 5 minutes to initiate contact between flagellin and cholesterol. A 3 hour adherence incubation at room temperature was followed by 5 washes in 1 x PBS, staining of wells with a solution of 0.1% crystal violet
(gentian violet in isopropanol-methanol-1 x PBS [1:1:18]) for 5 minutes, and 5 more washes with 1 x PBS. The dye retained by bound cells was extracted using 33% acetic acid and quantified by optical density measurements at 570 nm.
2.3.7 Live and dead scaffold assay
Late log phase cultures of serovar Typhimurium wild-type and flagellar transcriptional activator (FlhC) mutant strains were formalin fixed or heat killed as described above and added in 100 μl aliquots to siliconized Eppendorf tubes coated with
1 mg each of chromatography grade cholesterol. Following incubation at room
52 temperature on a Nutator shaker for 24 hours, cultures were removed and tubes were
washed three times in LB broth to remove non-adherent bacteria. Live cultures of late
log phase wild-type or ΔflhC serovar Typhimurium strains were added to these tubes and examined for biofilm formation using the TBA as indicated earlier.
2.3.8 Purification of serovar Typhimurium flagellin
Serovar Typhimurium wild-type, phase 1 (FliC; H:i) mutant, and phase 2 (FljB;
H:1,2) mutant, and type C flagellin (FliC) mutant strains were grown to late log phase in
LB at 37°C. These cultures (500 ml) were centrifuged at 8,000 g for 15 minutes. Cell pellets were washed once, resuspended in 15 ml 1 x PBS, and sheared mechanically for 3 minutes at 30,000 rpm using a Power Gen 125 tissue homogenizer (Fisher Scientific,
Pittsburgh, PA). Flagellar filaments were separated from cellular debris by spinning 10 minute at 8,000 g. The flagellin containing supernatants were collected and centrifuged
at 100,000 g for 1 hour. Filaments were gently resuspended overnight in 1 x PBS by
slow shaking at 4°C and centrifuged at 100,000 g. This 24 hour wash cycle was repeated
twice and the final pellets of purified serovar Typhimurium flagellin were resuspended in
1 x PBS and stored at -20°C. Protein concentrations of isolated flagellin were measured
with a bicinchoninic acid (BCA) assay kit (Pierce Biotechnology Inc., Rockford, IL), and
purity was confirmed by sodium dodecyl sulphate (SDS)-polyacrylamide gel
electrophoresis (PAGE) and staining with GelCode Blue Reagent (Pierce Biotechnology
Inc., Rockford, IL).
53 2.3.9 Western blotting
Monoclonal antibodies against Salmonella species flagellum (Maine
Biotechnology Services, Portland, ME) and FliC subunit protein (BioLegend, San Diego,
CA) were used to probe purified flagellin from serovar Typhimurium wild-type, FljB mutant, and FliC mutant strains in Western blot analysis. For each sample, 10 μl
containing 1 μg purified flagellin was mixed with an equal volume of SDS-PAGE
loading buffer and boiled for 15 minutes. Preparations were separated by 10% SDS-
PAGE and transferred to Hybond-ECL nitrocellulose (Amersham Biosciences,
Pittsburgh, PA) using a Trans-Blot semi-dry transfer apparatus (Bio-Rad, Hercules, CA).
Membranes were blocked overnight in 5% bovine serum albumin (BSA, Sigma, St.
Louis, MO) and incubated with anti-flagella (diluted 1:200 in PBS) or anti-FliC (5 μg
diluted in 5 ml PBS) antibody for 4 hours. Goat anti-mouse-horseradish peroxidase
(HRP) conjugate (Bio-Rad, Hercules, CA) diluted 1:5000 in PBS (2 hour incubation) and
enhanced chemiluminescence (ECL) reagants (GE Healthcare, Pittsburgh, PA) were used
to detect bound antibodies. Bands were visualized post exposure and development on
HyBlot CL autoradiography film (Denville Scientific Inc., Metuchen, NJ). All washes
were performed in 1 x PBS.
2.3.10 Subunit binding ELISA
Purified flagellin from serovar Typhimurium wild-type, FljB mutant, and FliC
mutant strains was assayed for cholesterol binding ability using a modified enzyme-
linked immunosorbent assay (ELISA) approach. Chromatography-grade cholesterol was
dissolved in anhydrous ether (J. T. Baker, Phillipsburg, NJ) at a concentration of 25
54 mg/ml and delivered in 100 μl aliquots to polystyrene wells of a 96-well Microtest tissue culture plate (Becton Dickinson Labware, Franklin Lakes, NJ). Six replicates of 1 μg each of a purified flagellin sample were then added to the cholesterol-coated wells.
Following a 3 hour binding-incubation at room temperature, plates were washed three times in 1 x PBS and blocked overnight with 3% BSA. Wells were emptied, washed, and incubated with anti-flagella (diluted 1:20 in 0.3% BSA) or anti-FliC (diluted 1:100 in
0.3% BSA) antibody for 2 hours, each in triplicate. Another wash step was followed by addition of goat anti-rabbit HRP peroxidase conjugate (Bio-Rad, Hercules, CA) diluted
1:5,000 in 0.3% BSA for 1 hour. Measurements of flagellin binding to cholesterol were obtained using a Bio-Rad HRP substrate kit according to the manufacturer’s specifications. Reaction products were transferred to an uncoated 96-well plate for optical density readings at 415 nm.
2.3.11. Statistical analysis
Two-tailed Student’s t tests were used to determine associations of significance between or within groups where indicated. Observed differences were considered statistically significant for p values < 0.05.
2.4 Results
2.4.1 Identification of serovar Typhimurium mutants deficient for binding to cholesterol but not glass or plastic
The molecular genetic mechanisms mediating initiation of biofilm formation vary with growth media and substrate, and are beginning to be elucidated for microorganisms
55 such as E. coli (Prigent-Combaret et al., 2000; Danese et al., 2000; Pratt and Kolter,
1998), S. aureus (Caiazza and O'Toole, 2003; Vaudaux et al., 1995; Gross et al., 2001),
Enterococcus faecalis (Hufnagel et al., 2004; Toledo-Arana et al., 2001), and
Pseudomonas spp. (O'Toole and Kolter, 1998b; Ma et al., 2009; Sauer et al., 2002;
O'Toole and Kolter, 1998a). As described previously, S. enterica serovars Typhimurium,
Enteritidis, and Typhi form mature biofilms on cholesterol-coated Eppendorf tubes (Tube
Biofilm Assay, TBA) when grown in 3% crude ox bile extract. To identify novel genes
regulating binding to cholesterol, a pool of Tn10d-Tet transposons was introduced into
wild-type serovar Typhimurium 14028s by generalized, P22 HT int-105-mediated phage
transduction. A total of 40,000 colonies were pooled together to generate a mutant library of random Tn10d transposon insertions. The mutant pool was grown to log phase
in LB broth-Tet with 3% crude ox bile extract and added in 100 μl amounts to siliconized
Eppendorf tubes coated with 1 mg each of cholesterol. Following incubation for 24
hours, 10 μl of planktonic, non-adherent culture was removed and added to 90 μl of fresh
LB broth-Tet with 3% bile in new cholesterol-coated tubes. The panning for cholesterol binding deficient bacteria was repeated every 24 hours for 10 days and the final supernatant was diluted and plated.
To examine whether these mutations affected biofilm formation on other surfaces,
500 individual colonies were assayed in the presence of bile for binding to cholesterol- coated tubes or to glass or plastic coverslips. We identified 49 strains deficient in biofilm formation on cholesterol-coated tubes but not on glass or plastic surfaces, demonstrating specificity of binding mediated by these mutations. To rule out second-site mutations,
56 mutants were transduced back into the parent strain and their biofilm forming phenotypes
were confirmed.
2.4.2 Sequencing of Tn10d transposon insertion sites
Genomic DNA sequencing from the transposon 5’ end and sequence analyses
revealed that the Tn10d insertions mapped to several genes corresponding to serovar
Typhimurium LT2 loci fimW, ompC, flhA, fliF, fliA, fliJ, fliL, and sseI (Table 2.2).
Eighteen Tn10d insertion sites were within the fimW open reading frame, one at base pair
(bp) position 98 (JSG3058) and seventeen others at 125 (JSG3055) within the open
reading frame (orf). Colonies recovered with transposon insertions in fimW were more
numerous than for any other gene recovered in the cholesterol binding screen. FimW
negatively regulates production of type 1 fimbriae by interacting with FimY (Saini et al.,
2009) and possibly with FimZ (Tinker et al., 2001), two proteins that independently
activate the PfimA promoter which controls the expression of the fim structural genes (Saini
et al., 2009). Serovar Typhimurium chromosomal fimW mutants expressed four- to eight-
fold more type 1 fimbriae compared to the parent strain (Tinker et al., 2001). Therefore,
serovar Typhimurium strains carrying Tn10d insertions in fimW would exhibit hyper-
fimbriate phenotypes, suggesting that over production of type 1 fimbriae inhibited
adherence to cholesterol.
Nine identical Tn10d transposon insertions within flhA were located at bp position
1917 (JSG3059). The cytoplasmic membrane protein FlhA mediates type III export of
axial components of the Salmonella flagellum and the scaffolding proteins for its assembly (Kihara et al., 2001; Saijo-Hamano et al., 2005). All three Tn10d insertions
57 within the fliF open reading frame were located downstream of start at bp position 872
(JSG3060). Structural subunits of the transmembrane protein FliF comprise the membrane-supramembrane ring (MS-ring) and proximal rod of the flagellar basal body of serovar Typhimurium, and have been shown to interact with the chemotactic motor/switch protein FliG (Ueno et al., 1992; Thomas et al., 2001; Thomas et al., 2006).
Two Tn10d insertion sites within fliA (JSG3061) were located at bp position 532 relative to the start codon. The conserved alternative sigma factor σ28 encoded by the class 2
regulatory gene fliA directs transcription from class 3 promoters of flagellar filament late
assembly genes in E. coli (Liu and Matsumura, 1995; Chilcott and Hughes, 2000) and
serovar Typhimurium (Ohnishi et al., 1990; Chilcott and Hughes, 2000; Frye et al.,
2006). The Tn10d insertion in JSG3062 was located in the fliJ open reading frame at bp
position 142 relative. FliJ is a soluble, cytoplasmic chaperone of the type III flagellar
protein apparatus that associates with the transmembrane domain of FlhA and is
implicated in export of filament (FliC) and rod/hook substrates (FlgD) (Minamino et al.,
2000; Fraser et al., 2003; McMurry et al., 2004). One Tn10d transposon insertion site
was located downstream of the fliL start site at bp position 252 (JSG3063). The function
of the membrane-associated component of the flagellar basal body encoded by fliL is
relatively unknown (Schoenhals and Macnab, 1999). Recent evidence suggests that FliL
prevents rod fracture caused by torsional stress during swarming motility
(Attmannspacher et al., 2008).
Genomic DNA sequences revealed insertions in serovar Typhimurium outside of
flagellar genes that also contribute to cholesterol binding. Of the fourteen Tn10d
insertions within ompC, five were located downstream of the start codon at bp position
58 252 (JSG3064) and nine others were found at position 346 (JSG3073). The outer
membrane protein OmpC is a porin influenced differentially by medium osmolarity to allow passage of nutrients and antibiotics between the extra- and intra-cellular milieu, and has been well characterized in E. coli, V. cholerae, and Salmonella (Puente et al.,
1991; Toro et al., 1990; Pagel et al., 2007; Yang et al., 2008; Alba and Gross, 2004). One
Tn10d insertion site was within sseI at bp position 552 relative to the start codon. SseI is
an effector protein translocated via the Salmonella pathogenicity island 2 (SPI-2) type III
secretion system (TTSS) encoded by the lambdoid phage Gifsy-2 (Miao et al., 2003;
Ehrbar and Hardt, 2005). Although SseI colocalizes with the polymerizing actin
cytoskeleton, no virulence defects were detected during infection of mice with an sseI
mutant strain of serovar Typhimurium (Miao et al., 2003; Ehrbar and Hardt, 2005; Ho
and Slauch, 2001a). The roles of OmpC and SseI in mediating binding of serovar
Typhimurium to cholesterol will not be investigated further here, but will be considered
in the discussion.
In sum, the majority (34/49, or 70%) of the Tn10d insertions disrupted genes
involved in flagellar and type 1 fimbrial biosynthesis and structural components,
suggesting that the presence of the serovar Typhimurium flagella mediates binding to
cholesterol to initiate biofilm formation whereas over production of fimbriae is
unimportant. A schematic of the tranposon insertion sites within fimbrial- and flagellar-
related genes found through random mutagenesis is depicted in Fig. 2.1.
59 2.4.3 Fimbriae production and FimW-mediated over expression of type 1 fimbriae in serovar Typhimurium play negative roles in biofilm formation on cholesterol
Fimbriae have been shown to mediate adherence during biofilm initiation and cell-cell interactions during biofilm growth for a variety of microorganisms (Davey and
O'toole, 2000; O'Toole and Kolter, 1998b). The serovar Typhimurium genome encodes
13 putative fimbrial operons, some of which are not expressed in vitro (Nuccio et al.,
2007). Type 1 fimbriae have been shown to be important for biofilm formation on HEp-2 tissue culture cells, the murine intestinal epithelium, and chicken intestinal epithelium
(Boddicker et al., 2002; Ledeboer and Jones, 2005), but not on human gallstones incubated with bile (Prouty et al., 2002a). A serovar Typhimurium SR11 strain containing mutations in four fimbrial operons (fim, agf, lpf, and pef) was added to the
TBA to examine biofilm formation on cholesterol-coated surfaces. In both the presence and absence of bile, the amount of biofilm formed by the quadruple mutant SR11 strain equaled that of wild-type serovar Typhimurium 14028s (Fig. 2.2), suggesting that fimbriae encoded by the fim, agf, lpf, and pef operons do not contribute to biofilm formation in this static assay. To test whether serovar Typhimurium cholesterol binding deficient mutants affecting type 1 fimbriae could form mature biofilms, strains carrying
Tn10d transposon insertions in fimW were added to cholesterol-coated Eppendorf tubes in the TBA as described previously (Crawford et al., 2008). As shown in Fig. 2.2, a fimW mutation renders serovar Typhimurium deficient for biofilm formation in the presence and absence of 3% bile, whereas complementation of fimW with pBAD18 restores the amount of biofilm growth to wild-type levels in both media conditions. These results suggest that type 1 fimbriae play a negative role during Salmonella binding to
60 cholesterol, and that this interference prevents subsequent cholesterol biofilm maturation
by the bacterium.
2.4.4 Flagella-mediated binding to cholesterol is necessary for biofilm development in
serovar Typhimurium
The highly ordered transcriptional hierarchy controlling expression of flagella is
comprised of three classes of genes and is regulated by many global signals (Frye et al.,
2006; Karlinsey et al., 2000). Therefore, it is no surprise that flagella contribute
differentially to biofilm formation depending on environmental conditions such as binding substrate material, nutrient limitation, temperature, media flow rate, and others factors for enterobacteraciae V. cholerae (Watnick and Kolter, 2000; Watnick et al.,
2001; Moorthy and Watnick, 2004; Lauriano et al., 2004) and E. coli (Pratt and Kolter,
1998; Prigent-Combaret et al., 2000; McClaine and Ford, 2002; Landini and Zehnder,
2002), as well as P. aeruginosa (Deziel et al., 2001; O'Toole and Kolter, 1998b; Barken et al., 2008; Merritt et al., 2007). Expression of the serovar Typhimurium flagella has been shown to inhibit biofilm formation on polystyrene wells (Teplitski et al., 2006) and promote biofilm development on human gallstones when bile is added to the growth media (Prouty et al., 2002a; Prouty and Gunn, 2003), but the stage at which this appendage positively or negatively impacts Salmonella biofilms remains undefined. To examine whether production of the flagellar filament is necessary for biofilm formation on cholesterol, a mutation at the apex of transcriptional regulation (flhC) was created in serovar Typhimurium. This mutant strain does not form a mature biofilm on cholesterol,
61 providing direct evidence for the importance of flagella during biofilm development (Fig.
2.2).
2.4.5 Serovar Typhimurium flagellar motility inhibits biofilm formation on cholesterol
surfaces whereas functional chemotaxis appears important
As demonstrated above, serovar Typhimurium mutations in flagella structural and
biosynthesis genes affected binding to and biofilm formation on cholesterol. To
determine if the physical presence of the flagellar filament or flagella-mediated motility was required for biofilm formation, mutants that maintained flagella but could not engage
in swimming or chemotaxis were examined. In the TBA, a serovar Typhimurium motA
mutation did not reduce biofilm levels on cholesterol surfaces in the presence or absence
of bile compared to the parent strain, suggesting that motility is not critical to serovar
Typhimurium biofilm development on cholesterol-coated surfaces (Fig. 2.2).
Chemotactic behavior responds to chemical attractants or deterrents with
appropriate movement (Adler, 1975) and is controlled in serovar Typhimurium by the five gene Meche operon (Stock and Stock, 1987). To determine the affects of chemotaxis
during biofilm formation on cholesterol, a cheZ serovar Typhimurium mutant strain characterized by an increased tumbling phenotype was created and added to the TBA
(Parkinson, 1993). Loss of this critical phosphatase significantly reduced the amount of
biofilm formed by the mutant when grown in bile, but did not alter biofilm formation in
LB alone (Fig. 2). Bile-mediated tumbling may be an important mechanism that steers
planktonic salmonellae away from a detergent-like signal toward an appropriate surface
to initiate biofilm development, and protection.
62 2.4.6 The number of surface-expressed serovar Typhimurium flagella is not regulated by
bile
The presence of bile was shown to moderately down regulate serovar
Typhimurium flagellar gene expression in β–galactosidase assays using MudJ fusions to
flhC, flgC, and fliC (Prouty et al., 2004b). Interestingly, bile is required for mature biofilm formation on cholesterol-coated Eppendorf tubes, and flagella biosynthesis mediates, at least in part, attachment to this surface for a biofilm to develop. To determine if the bile-mediated downregulation of flagellar genes resulted in a loss of flagella, or whether bile altered the expression of flagella at a post-transcriptional level, wild-type and flhC mutant strains of serovar Typhimurium were grown to late exponential phase with or without 3% bile and examined by TEM. The wild-type strain averaged nearly 6 flagella per individual bacteria regardless of growth conditions, whereas no detection of flagella was observed for the flhC mutant (Fig. 2.3). Therefore, while exposure to bile may transcriptionally downregulate flagellar genes, there is no effect of bile on the number of flagella.
2.4.7 Formalin fixed and heat killed salmonellae expressing an intact flagella bind to cholesterol
To test whether dead salmonellae expressing intact flagella could bind to cholesterol in the absence of active metabolism and secreted effectors, wild-type and
ΔflhC strains of serovar Typhimurium were fixed in 10% formalin for 40 minutes or heat killed at 65°C for 20 minutes and added to cholesterol-coated wells of a 24-well tissue culture plate. Live and dead wild-type cells bound to cholesterol following a 3 hour
63 incubation period, and this association was only modestly enhanced by bile (Table 2.3).
Strains lacking FlhC production did not bind to cholesterol in any of the tested
conditions, further suggesting that the serovar Typhimurium flagellar filament mediates
binding to cholesterol in the early stages of biofilm formation.
2.4.8 Dead salmonellae bound to cholesterol provide a scaffold for biofilm formation of
live cells
Mathematical approaches and empirical observations are constantly challenging
and redefining the developmental model of microbial biofilm formation (Monds and
O'Toole, 2009; van Loosdrecht et al., 2002; Picioreanu et al., 2007; Saravanan and
Sreekrishnan, 2006). Recent work in P. aeruginosa has investigated stage-specific
factors including twitching motility, cell-to-cell signaling, stationary phase sigma factor
expression, and polysaccharide synthesis locus (PSL) activity that contribute to biofilm
development in flow cell systems using statistical analysis and direct visualization
(Heydorn et al., 2002; Ma et al., 2009). To determine if flagella-mediated binding could provide a scaffold for serovar Typhimurium biofilm maturation, formalin fixed
salmonellae were incubated in cholesterol-coated Eppendorf tubes for 24 hours and
washed vigorously with 1 x PBS. A late logarithmic culture of wild-type serovar
Typhimurium grown in 3% bile was added atop the bound cells and the standard 6 day
TBA was performed. Formalin fixed salmonellae, while shown above to bind to
cholesterol at 3 hours, did not progress to a mature biofilm in the TBA (Table 2.4).
Interestingly, killed, bound cells were able to support biofilm formation of live wild-type
64 serovar Typhimurium, and the amount of these biofilms were higher than for salmonellae
grown in the TBA without this scaffold (Table 2.4).
To test whether the presence of flagella contributed to later events during biofilm development, a live serovar Typhimurium flhC mutant culture was added to the scaffold of bound, dead wild-type cells and a TBA was performed. Loss of flagella in an flhC mutant, shown to alleviate biofilm formation on cholesterol-coated surfaces (Fig. 2.2A
and B), did not affect biofilm formation on a substrate of dead cells, suggesting that the
presence of serovar Typhimurium flagellar filament, while necessary for binding to
cholesterol, does not contribute to subsequent biofilm development (Table 2.4).
Furthermore, the amount of biofilm formed by an flhC mutant on dead cells significantly
exceeded that of the wild-type strain in the same condition, suggesting that flagella may
be inhibitory to biofilm growth (Table 2.4).
Bacterial biofilms are characterized by the production of a self-initiated
extracellular matrix (ECM), and we have previously demonstrated that the O-antigen (O- ag) capsule is a bile-induced exopolysaccharide necessary for Salmonella biofilm
formation on cholesterol surfaces (Crawford et al., 2008). Interestingly, a live serovar
Typhimurium yihO mutant strain deficient for O-ag capsule production did not form a mature biofilm on a bound, dead scaffold of wild-type cells (Table 2.4). These results suggest that biofilm development will not progress without ECM production, and that the
O-ag capsule is a critical component.
65 2.4.9 The serovar Typhimurium flagellar subunit FliC is critical for binding to cholesterol
The flagellar filament of S. enterica is approximately 10 μm long and is comprised of two antigenically distinct flagellin proteins, FliC (H:i) and FljB (H:1,2) (de
Vries et al., 1998; Chilcott and Hughes, 2000). During the well characterized process of
phase variation, these subunits are alternatively expressed by a mechanism of
posttranscriptional control (Silverman et al., 1979; Bonifield and Hughes, 2003; Aldridge
et al., 2006). To determine which subunit protein was mediating binding of the serovar
Typhimurium flagellar filament to cholesterol, antibody to Salmonella whole flagella and
FliC was used in a quantitative binding ELISA as described above. Briefly, flagella were
isolated and purified from serovar Typhimurium wild-type, ΔfliC, ΔfljB, and ΔfliCfljB
strains using a protocol of mechanical shearing adapted from Andersen-Nissen et al.
(Andersen-Nissen et al., 2007). Wild-type and phase-locked mutant flagellin preparations (1 μg each) were separated by 10% SDS-PAGE gel electrophoresis. Amino
acid sequences of FliC and FljB predicted 51.6 and 52.5 kDa proteins, respectively
(Uchiya and Nikai, 2008), and this approximate 1 kb difference was detected by
Coomassie staining (Fig. 2.4A) and Western blotting with monoclonal anti-flagellin
antibodies (Fig. 2.4B) that recognized either a peptide common to FliC and FljB, or
specifically FliC. The identity of each band was confirmed by comparing wild-type with
mutant lanes (Fig. 2.4A and B). Purified proteins from all samples were added to
cholesterol-coated wells of a 96-well tissue culture plate and analyzed by a modified
ELISA. Flagella from wild-type and ΔfljB strains bound to cholesterol in equal amounts,
and these levels were significantly higher than those observed for a fliC mutant,
66 suggesting that FliC is the critical serovar Typhimurium flagellar subunit mediating binding to cholesterol (Fig. 2.5).
2.5 Discussion
Approximately 5% of patients suffering from typhoid fever carry Salmonella in the gallbladder (Levine et al., 1982), and evidence indicates a high correlation between those individuals who become carriers and those who have gallstones (Dutta et al., 2000;
Lai et al., 1992). Because antibiotic treatments are ineffective at removing chronic infections in such cases (Lai et al., 1992), we hypothesize that the asymptomatic existence of serovar Typhi is frequently if not always a result of biofilm formation on cholesterol gallstone surfaces. In this work we show that the flagellar filament, and specifically the FliC subunit, of serovar Typhimurium is necessary for and specific toward cholesterol binding during the initiation of biofilm formation.
Bacteria express a diverse arsenal of factors during biofilm development that are uniquely required depending on environmental stimuli such as growth media and substrate hydrophobicity and charge. It was previously shown that S. enterica serovars
Typhi, Typhimurium, and Enteritidis formed bile-induced biofilms on human cholesterol gallstones and cholesterol-coated Eppendorf tubes in vitro (Prouty et al., 2002a;
Crawford et al., 2008). To determine the critical genes of early biofilm events, specifically those involved in attachment, a randomly mutagenized serovar Typhimurium strain was screened in the TBA for loss of adherence. Genomic DNA from mutants that did not bind to cholesterol but retained biofilm formation on glass and plastic surfaces were sequenced to locate the Tn10d insertion site. Disruptions in genes affecting type 1
67 fimbriae and flagella structure and biogenesis were most frequently recovered, and fimW
was prevalent.
Tn10d insertions were also recovered in genes encoding an outer membrane protein (ompC) and a translocated effector of the SPI-2 TTSS (sseI). The OmpC porin is
regulated by osmolarity, permits passive diffusion of nutrients and antibiotics between
the extra- and intra-cellular environments, and mediates intestinal colonization of serovar
Typhimurium in chickens and adherence of serovar Typhimurium to macrophages
(Puente et al., 1991; Methner et al., 2004; Negm and Pistole, 1999). Bacteria within
biofilms are thought to encounter higher osmolarity than in the liquid phase (Prigent-
Combaret et al., 1999), and preliminary experiments performed in our laboratory indicate
that loss of OmpC causes a decrease in serovar Typhimurium biofilm formation in
conditions of high osmolarity (3% bile, LB + 0.3 M NaCl) but leads to increased biofilm
growth compared to the wild-type strain in low media osmolarity (LB + 0.05 M NaCl)
(data not shown). These results suggest that OmpC is necessary for binding and biofilm
formation in the presence of bile, possibly by mediating electrostatic interactions between
salmonellae and the cholesterol surface, promoting overall biofilm health as a nutrient
channel, or regulating cell-cell interactions as is the case in E. coli biofilms.
SseI is a secreted effector protein belonging to the GDSL family of lipases that
colocalizes with the polymerizing actin cytoskeleton (Miao et al., 2003). SPI-1 has been
implicated in directing cholesterol distribution during mammalian cell entry (Garner et
al., 2002), and GDSL proteins associated with SPI-2 have been shown to hydrolyse
phospholipids and esterify cholesterol intracellularly (Nawabi et al., 2008; Buckley et al.,
1984). The lambdoid phage Gifsy-2 encodes SseI (Miao et al., 2003; Ehrbar and Hardt,
68 2005), and the receptor for Gifsy-2 is OmpC (Ho and Slauch, 2001b). Although the
Gifsy bacteriophages and SPI-2 secreted effectors are generally virulence regulators of serovar Typhimurium in mice, the association between SseI and OmpC, and the known interaction of SseI with cholesterol, suggests a role for adherence to/modification of cholesterol during biofilm formation.
Fimbriae are attributed, in part, to serovar Typhimurium biofilm formation on
HEp-2 tissue culture cells and the intestinal epithelium of mice and chickens (Boddicker et al., 2002; Ledeboer and Jones, 2005; Baumler et al., 1996). In studies by Prouty et al., a serovar Typhimurium SR11 strain containing mutations in four fimbrial operons was observed to adhere and form biofilms on cholesterol gallstones in a manner similar to wild-type serovar Typhimurium (Prouty et al., 2002a). Similarly, the amount of biofilm formed by the quadruple mutant SR11 strain equaled that of wild-type serovar
Typhimurium in both the presence and absence of bile in the TBA, suggesting that fimbriae encoded by the fim, agf, lpf, and pef operons do not drastically contribute to biofilm formation on cholesterol-coated surfaces.
FimW has recently been shown to downregulate production of type 1 fimbriae by inhibiting FimY, a protein that enhances expression of the fim structural genes by activating the fimA promoter (Saini et al., 2009), and chromosomal fimW mutants expressed four- to eight-fold more type 1 fimbriae compared to the parent strain (Tinker et al., 2001). Therefore, frequent recovery of serovar Typhimurium colonies carrying
Tn10d insertions in fimW during a screen for adherence mutants suggests that over production of type 1 fimbriae is inhibitory to cholesterol binding. To test whether a serovar Typhimurium mutant deficient for attachment to cholesterol could form mature
69 biofilms, a strain carrying a Tn10d transposon insertion in fimW was added to
cholesterol-coated Eppendorf tubes in the TBA and shown to significantly effect biofilm
formation. Complementation of fimW with pBAD18 restored the amount of biofilm
growth to wild-type levels. These results suggest that over expression of type 1 fimbriae
play a negative role during Salmonella binding to cholesterol and subsequent biofilm
formation by the bacterium.
Flagella promote surface binding during biofilm formation (Pratt and Kolter,
1998; O'Toole and Kolter, 1998b) as well as adhesion during colonization of tissue
cultured cells and mucus by P. aeruginosa (Rudner et al., 1992; Lillehoj et al., 2002),
Campylobacter jejuni (McSweegan and Walker, 1986), E. coli (Giron et al., 2002), and S.
enterica spp. (Dibb-Fuller et al., 1999; La Ragione et al., 2003; Budiarti et al., 1991;
Allen-Vercoe and Woodward, 1999). Flagella biogenesis is controlled by the FlhDC
master operon (Frye et al., 2006) and has been shown to regulate biofilm formation of
Yersinia pseudotuberculosis (Wang et al., 2007). To examine whether the physical presence of the flagellar filament is necessary for biofilm formation on cholesterol, a serovar Typhimurium flhC mutant was examined in the TBA and shown not to form a mature biofilm on cholesterol. These results provide direct evidence for the importance of flagella during biofilm development.
Flagellar-mediated motility and chemotaxis differentially contribute to colonization and biofilm formation depending on environmental cues (O'Toole and
Kolter, 1998b; Pratt and Kolter, 1998; Prouty and Gunn, 2003; Huber et al., 2002; Mey et al., 2005). Bile, for example, increases motility and is a chemical attractant at physiological concentrations for V. cholerae (Butler and Camilli, 2005), acts as a
70 repellent for Helicobacter pylori (Worku et al., 2004), and enhances tumbling frequency while downregulating motility in S. enterica (Prouty et al., 2004b). Serovar
Typhimurium mutant strains lacking motor function (motA) and control of chemotactic behavior (cheZ) were analyzed for biofilm formation in the TBA. Loss of the CheZ phosphatase significantly decreased biofilm formation in LB broth with bile, whereas neither motA or cheZ affected biofilm development in LB broth. These results indicate that flagellar motility is dispensable to biofilm formation on cholesterol surfaces, but regulation of tumbling in the presence of bile is an important factor.
Bile has also been shown to affect transcription of serovar Typhimurium flagella structural genes flhC, flgC, and fliC (Prouty et al., 2004b). We report here that wild-type salmonellae grown with or without bile and visualized by TEM express equal amounts of flagella, suggesting that prolonged exposure to bile does not alter the ultimate production of flagella. Thus, reductions in the levels of flhC, flgC, and fliC transcription in bile, while slightly below those observed in the absence of bile, are still above the threshold necessary for normal flagella production in this condition and allow flagella-mediated binding to cholesterol.
Flagella are necessary for the initial stages of biofilm development on a variety of surfaces (Pratt and Kolter, 1998; O'Toole and Kolter, 1998b) and colonization of tissue cultured cells and mucus by P. aeruginosa (Rudner et al., 1992; Lillehoj et al., 2002),
Campylobacter jejuni (McSweegan and Walker, 1986), E. coli (Giron et al., 2002), and S. enterica spp. (Dibb-Fuller et al., 1999; La Ragione et al., 2003; Budiarti et al., 1991;
Allen-Vercoe and Woodward, 1999). To determine whether dead cultures of serovar
Typhimurium could bind to cholesterol in the absence of secreted factors, formalin fixed
71 or heat killed wild-type and flhC mutant strains were added to cholesterol-coated wells of
24 well plates and incubated for 3 hours. The results of these experiments indicate that
surface expression of intact flagella is sufficient and necessary to mediate binding to
cholesterol. Interestingly, bound and inactivated cells provided a scaffold for biofilm
formation of live, wild-type cells in the TBA, and the amount of these biofilms exceeded
those of salmonellae grown in the TBA without this scaffold. To elucidate factors
important for microcolony growth and recruitment, serovar Typhimurium flagella (FlhC)
or O-antigen capsule (YihO) mutants were added to the layer of adherent, dead cells and
examined for biofilm development. The flhC mutant showed an increase in biofilm formation on a substrate of bound bacteria, suggesting that the flagellar filament, while critical for initial binding to and biofilm formation on cholesterol, does not mediate subsequent biofilm growth following attachment. The live serovar Typhimurium yihO
mutant did not form a mature biofilm when tested under the same conditions, indicating
that O-antigen capsule production is a mandatory component of developing bile-induced
biofilms.
The flagellar filament of S. enterica is comprised of two antigenically distinct subunit proteins, FliC (H:i) and FljB (H:1,2), and is a pathogen-associated molecular pattern detected by mammalian cells via surface-expressed toll-like receptor 5 and cytosolic Nod-like receptors (Rochon and Romling, 2006; Simon and Samuel, 2007).
Secretion of interleukin-1 beta by mouse cell lines is activated comparably by the FliC and FljB flagellins (Simon and Samuel, 2008), but memory CD4+-T-cells preferentially recognize FliC during adaptive immunity and Salmonella committed to expressing only
FljB is attenuated in vivo (Bergman et al., 2005; Ikeda et al., 2001). To determine which
72 flagellar subunit mediated adherence to cholesterol, ELISA was performed using anti-
flagella or anti-FliC antibodies against purified flagella proteins from serovar
Typhimurium wild-type, fliC, fljB, and fliC fljB mutant strains bound to cholesterol- coated wells. The FliC subunit was shown to be a critical factor mediating attachment to cholesterol. Interestingly, S. Typhi is monophasic, harboring only the fliC gene (Baker et al., 2007), and FliC expression was anatomically restricted to certain tissues during systemic serovar Typhimurium mouse infections (Cummings et al., 2006).
In this work, we have shown that expression of the serovar Typhimurium flagellar filament mediates bile-induced adherence to cholesterol surfaces primarily with the FliC subunit to initiate biofilm formation, but is inhibitory to subsequent biofilm development.
It could be hypothesized that FliC production in the human gallbladder may be an evolutionary adapted mechanism facilitating binding to cholesterol gallstones or the gallbladder epithelium and biofilm formation during the asymptomatic, chronic carrier state. This new understanding of how bile regulates early events during Salmonella biofilm formation on cholesterol-coated surfaces via flagella provides a therapeutic target with the potential for alleviating asymptomatic gallbladder carriage of S. Typhi and thus the human-to-human transmission that makes this pathogen a global concern.
73 Strain Characteristic(s) Source or reference
S. Typhimurium JSG210 ATCC 14208s (CDC6516-60); wild-type ATTC JSG526 flhC98::Tn10 (TH2934) Gift of Hughes JSG1174 Δ(fim-aph-11::Tn10)-391 lpfC::Kan agfB::Cam Gift of Baumler pefC::Tet JSG1178 Hin108::Tn10d-Cam Gift of Cookson JSG1179 fliC::Tn10 Gift of Cookson JSG1190 Hin108::Tn10d-Cam fliC::Tn10 Gift of Cookson JSG1547 motA595::Tn10 Gift of T. Lino JSG2897 yihO unmarked deletion Crawford JSG2953 fimZ::Kan Gift of S. Clegg JSG2954 JSG2953 complemented with fimZ Gift of S. Clegg JSG3024 cheZ::Tn10 Gift of B. Ahmer JSG3055 fimW::Tn10d-Tet; Site 1, 17 insertions This study JSG3056 JSG3055 complemented with fimW This study JSG3057 fimW::Tn10d-Tet fimZ::Kan This study JSG3058 fimW::Tn10d-Tet; Site 2, 1 insertion This study JSG3059 flhA::Tn10d-Tet; 9 insertions This study JSG3060 fliF::Tn10d-Tet; 3 insertions This study JSG3061 fliA::Tn10d-Tet; 2 insertions This study JSG3062 fliJ::Tn10d-Tet; 1 insertion This study JSG3063 fliL::Tn10d-Tet; 1 insertion This study JSG3064 ompC::Tn10d-Tet; 5 insertions This study JSG3065 sseI::Tn10d-Tet; 1 insertion This study JSG3073 ompC::Tn10d-Tet; 9 insertions This study
Table 2.1: Bacterial strains and relevant characteristics
74 Gene No. No. Function Colonies Insertions fimW 18 2 Inhibitor of type 1 fimbriae regulator FimZ ompC 14 2 Outer membrane protein; passive diffusion of ions, hydrophilic solutes flhA 9 1 Flagellar export apparatus, biosynthesis membrane protein fliF 3 1 Flagellar cytoplasmic anchor MS-ring protein fliA 2 1 Flagellar biosynthesis sigma factor fliJ 1 1 Rod/hook and filament biosynthesis chaperone fliL 1 1 Basal body protein; stability of MotAB complexes of MS-ring sseI 1 1 Secreted effector; colocalizes with host polymerizing actin cytoskeleton
Table 2.2: Transposon insertion sites, frequencies, and functions
75 Strain and growth condition Live Dead Serovar Typhimurium, LB + + Serovar Typhimurium, LB + 3% Bile + + Serovar Typhimurium flhC mutant, LB - - Serovar Typhimurium flhC mutant, LB + 3% Bile - -
Table 2.3: Binding quantification assay. Three hour binding quantification assay on cholesterol-coated wells of live or dead serovar Typhimurium wild-type and flhC mutant strains. Crystal violet stained material was extracted with acetic acid, and optical density at 570 nm for quantification. +, binding amounts equivalent to wild-type in appropriate condition; -, severe defect in or complete loss of adherence (0 to 10% of wild-type values). Shown is a representative experiment peformed in triplicate (n = 3).
76 Organism grown in 3% bile Biofilm development on* Cholesterol Dead Cells Serovar Typhimurium + ++ Serovar Typhimurium flhC mutant - ++ Serovar Typhimurium yihO mutant - -
Table 2.4: Summary of biofilm formation on cholesterol or formalin fixed bacteria. *Biofilms grown on cholesterol-coated Eppendorf tubes or a substrate of inactivated, bound cells in the TBA. Dye was extracted with acetic acid, and optical density at 570 nm for quantification. +, robust, mature biofilm formation at wild type levels; ++, increased biofilm present (1.5 – 2.0-fold higher than wild-type values); -, severe defect in or complete loss of biofilm formation (0 to 10% of wild-type values). These data correspond to 3 independent experiments done in triplicate.
77 JSG3055 JSG3058 JSG3059
fimW STM0551 fimY fimZ fimF cheZ flhB flhA flhE
500 bp JSG3061 JSG3060 JSG3062 JSG3063
fliA STM1957 fliF fliG fliH fliI fliJ fliK fliL
Figure 2.1: Schematic of Tn10d transposon insertion sites in serovar Typhimurium cholesterol-binding mutants affecting type 1 fimbriae and flagella structure and biogenesis. Arrows indicate the size and orientation of neighboring genes and triangles depict the location of each transposon insertion.
78 3
2.5 No Bile 2 3% Bile
1.5 * OD570 1 * 0.5 *
0 S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium 1234567 ΔfimW ΔfimW Comp. Δfim ΔflhC ΔmotA ΔcheZ
Figure 2.2: Biofilm formation of serovar Typhimurium strains grown with and without 3% crude ox bile extract on cholesterol-coated Eppendorf tubes. Crystal violet-stained TBA biofilms were extracted with acetic acid, and absorbance was measured for at 570 nm. Data, presented as means + SD, are a representative experiment done in triplicate (n = 3). *, statistically significant reduction in biofilm formation (P < 0.005) based on a two-tailed Student t test. OD570, optical density at 570 nm.
79
A. C. D.
B.
Figure 2.3: Expression of flagella on the surface of serovar Typhimurium strains grown in the presence or absence of bile visualized by negative staining under transmission electron microscopy. (A) Serovar Typhimurium flhC mutant. (B) Serovar Typhimurium flhC mutant + 3% bile. (C) Serovar Typhimurium wild-type. (D) Serovar Typhimurium wild-type + 3% bile. Shown are micrographs representative of 3 independent experiments.
80
1 2 3 4 A.
Coomassie FljB (52.5 kD) FliC (51.6 kD)
B. FljB (52.5 kD) α-Flagella FliC (51.6 kD)
α-FliC FliC (51.6 kD)
Figure 2.4: Identification of flagellin proteins from wild-type and mutant serovar Typhimurium strains. Flagella were isolated from late log phase bacterial cultures using mechanical shearing, purified, separated by 10% SDS-PAGE gel electrophoresis, and analyzed by GelCode Blue staining (A) and Western blotting (B). Detection with anti- flagella (B, top panel) and anti-FliC monoclonal antibodies (B, lower panel) are shown. Lanes: 1, wild-type serovar Typhimurium; 2, fliC mutant strain; 3, fljB mutant strain; 4, fliC fljB double mutant strain. FliC; 51.6 kD, FljB; 52.5 kD. The stain and blot is representative of at least 3 independent experiments.
81
0.8
0.7
0.6 Flagellum Ab 0.5 FliC Ab 0.4
OD415 0.3 * 0.2
0.1 ** 0 S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium 1234 ΔfliC ΔfljB ΔfliCΔfljB
Figure 2.5: Expression of purified flagella proteins from serovar Typhimurium wild-type, fliC, fljB, and fliC fljB mutant strains adhered to cholesterol-coated wells. ELISA was performed using anti-flagella or anti-FliC monoclonal antibodies and binding to cholesterol was quantified by measuring bound HRP substrate at optical density 415 nm. Means + SD are reported for an independent experiment done in triplicate (n = 3). Statistical significance for reduction in cholesterol binding based on a two-tailed Student t test, *; P < 0.05, **; P < 0.005.
82
Chapter 3
Identification of a bile-induced exopolysaccharide required for Salmonella Biofilm formation on gallstone surfaces
3.1 Abstract
Salmonella enterica serovar Typhi can establish a chronic, asymptomatic infection of the human gallbladder, suggesting that this bacterium utilizes novel mechanisms to mediate enhanced colonization and persistence in a bile-rich environment.
Gallstones are one of the most important risk factors for developing carriage, and we have previously demonstrated that salmonellae form biofilms on human gallstones in vitro. Thus, we hypothesize that bile-induced biofilms on gallstone surfaces promote gallbladder colonization and maintenance of the carrier state. A colanic acid/cellulose S. enterica serovar Typhimurium double mutant formed a mature biofilm on gallstones in a test tube assay and in a new, gallstone-independent assay using cholesterol-coated
Eppendorf tubes. These data suggest the presence of an unidentified exopolysaccharide necessary for mature biofilm development and demonstrate specific binding affinity between salmonellae and cholesterol. Our experiments indicate that the Salmonella O- antigen capsule (yihU-yshA and yihV-yihW) is a crucial determinant in gallstone and cholesterol biofilms but that expression of this exopolysaccharide is not necessary for
83 binding to glass or plastic. Real-time PCR revealed that growth in bile resulted in
upregulation of the O-antigen capsule-encoding operon in an agfD-independent manner.
Thus, the O-antigen capsule genes are bile induced, and the capsule produced by the
enzymes of this operon is specifically required for biofilm formation on cholesterol
gallstones. These studies provide new therapeutic targets for preventing asymptomatic
serovar Typhi gallbladder carriage.
3.2 Introduction
Salmonellae remain pathogens of worldwide concern, particularly in nonindustrialized societies with inefficient food and water sanitation systems. The
diverse Salmonella enterica serovars infect a broad range of hosts and are increasingly
resistant to commonly administered antibiotics (Boyle et al., 2007). Gastroenteritis and
enteric (typhoid) fever are the two most prevalent clinical manifestations, both of which
cause significant morbidity and mortality.
Salmonella enterica serovar Typhi is the etiologic agent of typhoid fever in
humans, a systemic illness afflicting approximately 20 million people globally each year
(Crump et al., 2004). Bacteria reaching the gallbladder can induce an active local
infection (cholecystitis) or exist asymptomatically in a chronic carrier state. Nearly 5%
of patients suffering from typhoid fever become Salmonella carriers (Levine et al., 1982).
This condition is frequently associated with abnormalities of the gallbladder, including
gallstones, and Salmonella carriage is the largest risk factor for cancer of this organ
(Dutta et al., 2000; Kumar et al., 2006; Lai et al., 1992).
84 During colonization of the intestine and gallbladder, Salmonella spp. interact with bile, a complex, lipid-rich, and protein poor digestive secretion produced by the liver at nearly 1 liter per day (Boyle et al., 2007). Bile consists of many components, including bile acids, cholesterol, phospholipids, and bilirubin, and serves as a potent antimicrobial agent in the gastrointestinal tract (Hofmann, 1999). Salmonellae, however, resist its surface-acting, amphipathic, detergent-like properties (van Velkinburgh and Gunn, 1999), indicating that bile resistance is an important phenotype associated with Salmonella pathogenesis during both acute and chronic infections. The presence of bile is also known to cause pleiotropic responses that affect production of virulence factors (SPI-I- mediated type III secretion, motility, adhesion, antibiotic and bile resistance, efflux pump expression, and biofilm formation) in S. enterica (Prouty and Gunn, 2000; Prouty et al.,
2004b) and in enteric commensals and pathogens, including Vibrio cholerae (Bina and
Mekalanos, 2001; Chatterjee et al., 2007; Hung and Mekalanos, 2005; Hung et al.,
2006)(Provenzano et al., 2000; Schuhmacher and Klose, 1999; Wibbenmeyer et al.,
2002), Campylobacter jejuni (Lin et al., 2005b), Escherichia coli (Torres et al., 2007), and Listeria monocytogenes (Sleator et al., 2005).
The main site of human serovar Typhi carriage is the bile-rich gallbladder, suggesting unique or enhanced bile resistance mechanisms utilized by the bacterium that lead to survival in this environment. The formation of biofilms on gallstones has been hypothesized to be a facilitator for enhanced colonization of and persistence in this organ.
A biofilm is defined as a community of microorganisms that adhere to each other and to a biotic or abiotic surface, resulting in stability and protection from antibiotics and other environmental factors mediated in part by a self-initiated exopolysaccharide (EPS)
85 matrix. Bacterial biofilms have been implicated as the causes of many chronic infections
in humans and are associated with medical and industrial ecosystems (Costerton et al.,
1995). Planktonic cells from this sessile, matrix-bound population are continuously shed,
which can result in systemic infection or release of the organism into the environment.
Bacteria shed by asymptomatic carriers contaminate food and water and account for
much of the person-to-person transmission of serovar Typhi in underdeveloped countries.
As mentioned above, it has been demonstrated that patients with gallbladder
abnormalities, such as gallstones, are at a much higher risk for serovar Typhi carriage, yet
the progression of infection to the carrier state is undefined. Antibiotic regimens can be ineffective in carriers with gallstones (Lai et al., 1992), and the cost of surgery to remove gallbladders is prohibitive in developing countries where serovar Typhi is prevalent.
Interestingly, bile has been shown to promote biofilm formation of S. enterica serovar
Typhimurium and serovar Typhi in an in vitro human gallstone test tube assay (Prouty et al., 2002a). To date, the EPS matrix of Salmonella bile-induced biofilms on gallstones remains poorly characterized. A better understanding of the key EPS constituents of
Salmonella bile-induced biofilms promises to better characterize the asymptomatic carrier state and elucidate important therapeutic targets for alleviating biofilm formation in chronic cases. Here, we define a bile-induced EPS, the O-antigen (O-ag) capsule, required for biofilm formation specifically on gallstone and cholesterol-coated surfaces.
86 3.3 Materials and Methods
3.3.1 Bacterial strains and growth conditions
The Salmonella strains and plasmids used in this study are listed in Table 3.1.
Luria-Bertani (LB) broth and agar were used for bacterial growth, creation of mutants,
biofilm assays, and expression studies. When necessary, antibiotics were added at
appropriate concentrations: ampicillin, 50 µg/ml; kanamycin, 25 µg/ml; and tetracycline,
15 µg/ml.
3.3.2 Molecular biology and genetic techniques
DNA purification and PCR were completed according to established procedures
(using a QIAprep spin mini prep kit) (1989). Plasmids were transformed by
electroporation as previously described (Schmid and Roth, 1983). Quantitative real-time
PCR was performed using RNA extracted from log-phase (optical density of 0.6 at 600
nm) Salmonella cultures with an RNeasy kit (Qiagen, Valencia, CA). Samples grown in
3% crude ox bile extract (Sigma, St. Louis, MO) were quickly washed three times in 1x
phosphate-buffered saline (PBS) before extraction. RNA quality and quantity were
measured with the Experion automated electrophoresis system (Bio-Rad, Hercules, CA),
and 1 microgram was reverse transcribed to cDNA with Superscript II RNase H- reverse
transcriptase (Invitrogen, Carlsbad, CA). Five nanograms of converted cDNA was added
to Sybr green PCR master mix for quantitative real-time PCR with a Bio-Rad iCycler
apparatus. Table 3.2 shows the primers used for expression of the target gene yihU and the housekeeping gene dnaN. Relative copy numbers were calculated according to a published protocol (Gavrilin et al., 2006).
87
3.3.3 Construction of ΔbcsE ΔwcaA, yihO, and yihP mutants
The serovar Typhimurium cellulose/colanic acid double mutant (ΔbcsE ΔwcaA)
was created by P22 HT105 int-102-mediated, generalized transduction between strains
carrying single mutations in bcsE or wcaA (Schmid and Roth, 1983). The lambda Red-
mediated mutagenesis method of gene disruption was used to create a deletion of yihO in
serovar Typhimurium and of yihP in serovar Typhi (Datsenko and Wanner, 2000).
Primer pairs JG1281/JG1282 and JG1643/JG1644 (Table 3.2) were designed to amplify
yihO’-kan-‘yihO and yihP’-kan-‘yihP, respectively, using pKD4 as a template. The
kanamycin cassettes and surrounding regions of homology were exchanged into the
chromosome of serovar Typhimurium or serovar Typhi, generating strains carrying
ΔyihO::kan in serovar Typhimurium and ΔyihP::kan in serovar Typhi. Correct placement of these constructs in the Salmonella genome was confirmed by PCR, using primers
JG1283 and JG1284 for serovar Typhimurium and primers JG1647 and JG1648 for serovar Typhi. The kanamycin cassettes were then resolved by introducing pCP20, and the resulting strains were named JSG2897 (carrying ΔyihO) and JSG2950 (carrying
ΔyihP) (Table 3.1). For complementation, the yihO gene from serovar Typhimurium was amplified and cloned into the HindIII and EcoRI sites of vector pUC18 (GenScript
Corporation, Piscataway, NJ) and expressed from the lac promoter. The resulting construct was introduced into JSG2897 by electrotransformation.
88 3.3.4 Gallstone tube assay
Uniform gallstone samples composed primarily of cholesterol and retrieved from
a single patient were used in this study. Salmonella strains were grown overnight in LB
broth with or without 3% crude ox bile extract. Each overnight culture was diluted 1:10,
added to LB broth in test tubes containing human gallstones (with or without bile), and
incubated in a rotating drum at 37°C with aeration. To attempt to mimic normal gallbladder physiology, the medium and bacteria were removed from the tubes every 24 hours, the gallstones were washed three times in LB by light vortexing, and fresh medium
(with or without bile) was returned. The optimal growth period was 12 days, as described previously (Prouty et al., 2002a).
3.3.5 Tube biofilm assay (TBA)
Chromatography-grade cholesterol (product number C8667; Sigma, St. Louis,
MO) was dissolved in anhydrous ether (J. T. Baker, Phillipsburg, NJ) at a concentration of 10 mg/ml and delivered in 100 µl aliquots to siliconized Eppendorf tubes (Fisher
Scientific, Pittsburgh, PA). The ether was allowed to evaporate, consistently leaving tubes with a 1 mg coating of cholesterol to which 100 µl of bacterial culture could be added. Salmonella strains were grown overnight in LB broth with or without 3% crude ox bile extract, diluted 1:100 the following day, and subsequently grown to an optical density at 600 nm of 0.6. These cultures (100 µl) were incubated in cholesterol-coated
Eppendorf tubes at room temperature on a Nutator shaker (Labnet International, Edison,
NJ). Every 24 hours, the medium was removed, the tubes were washed three times with
89 LB, and fresh medium (LB with or without 3% bile) was added. Each strain was examined in triplicate, and the experiment proceeded for a period of 6 days.
3.3.6 Plastic/glass binding assay
Round, Chromerge-cleaned glass coverslips were placed in plastic 24-well plates
(Fisher Scientific, Pittsburgh, PA). Liquid cultures of S. enterica diluted 1:100 following overnight growth were allowed to reach an optical density at 600 nm of 0.6 in the presence or absence of 3% crude ox bile extract and then added to each coverslip- containing well in 2 ml volumes and incubated at room temperature on a Nutator shaker.
The assay continued for 6 days, with removal of medium, washing, and addition of fresh medium occurring every 24 hours. Each strain was tested with triplicate wells. Biofilms on the plastic 24-well plates and on the glass coverslips were examined as described below.
3.3.7 Crystal violet quantification of biofilms
Following bacterial growth on cholesterol-coated tubes in the TBA or on glass/plastic in binding assays, samples were washed three times in LB and incubated at
60°C for 1 hour to fix the cells. A solution of 0.1% crystal violet (gentian violet in isopropanol-methanol-1x PBS [1:1:18]) was then added to stain cells for 5 minutes at room temperature. Specimens were washed thoroughly with 1x PBS until the liquid ran clear. The dye was extracted using 33% acetic acid and then quantified with optical density readings at 570 nm to determine the amount of dye retained by the biofilm cells.
90 3.3.8 Immunofluorescence microscopy of tube biofilms
After completion of the TBA as described above, cells were visualized using immunofluorescence microscopy for the production of O-ag capsule EPS in the presence
or absence of 3% crude ox bile extract. Three vigorous washes with 1x PBS were
followed by 4 hours of incubation with 5% bovine serum albumin (Sigma, St. Louis,
MO). Cells were washed and then exposed to capsule-specific primary antibody (diluted
1:2,000 in PBS) at room temperature for 2 hours. This polyclonal antibody was
generated in rabbits and showed no cross-reactivity with commercially purified
lipopolysaccharide (LPS) from S. enterica serovar Enteritidis (Gibson et al., 2006). The
tube contents were washed three additional times and incubated with a 1:5,000 dilution of
fluorescein-conjugated, goat affinity-purified antibody to rabbit immunoglobulin G
(ICN/Cappel, Aurora, OH) in the dark for 2 hours. Biofilm samples were washed,
scraped gently from the tubes by using a microspatula, diluted in 1x PBS, transferred to
glass slides, and visualized on a BX51 Olympus fluorescence microscope.
3.3.9 Tube biofilm ELISA
Cells from the TBA were measured for production of O-ag capsule EPS by using
a modified enzyme-linked immunosorbent assay (ELISA) approach. After 6 days in the
TBA, the tubes were washed three times with 1x PBS and incubated with 5% bovine
serum albumin for 4 hours. After three more washes with 1x PBS, capsule-specific
antibody (diluted 1:2,000 in PBS) was added to the tubes at room temperature for 2
hours. Another set of three washes was followed by a 2 hour incubation period with a
goat anti-rabbit immunoglobulin G (H+L) horseradish peroxidase (HRP) conjugate
91 diluted 1:5,000 in PBS (Bio-Rad, Hercules, CA). Measurements of O-ag capsule
expression in biofilms were obtained using a Bio-Rad HRP substrate kit according to the
manufacturer’s specifications. Reactions were performed with the TBA Eppendorf tubes, and the reaction products were transferred to 96-well plates for optical density readings at
415 nm.
3.3.10 Scanning electron microscopy (SEM)
Following sample growth for 12 days, gallstones were washed twice with LB.
Specimens were either fixed immediately in 2% glutaraldehyde or air dried overnight in a
Laminar flow hood before being fixed. All samples were dehydrated postfixation using a
Cressington critical point drier at The Ohio State University Campus Microscopy and
Imaging Facility. The samples were sputter coated with a Pelco Model 3 and viewed
using a FEI Nova NanoSEM.
3.3.11 Murine infections with serovar Typhimurium wild-type and yihO mutant strains
Female BALB/c mice (Harlan Laboratories, Indianapolis, IN) weighing 16 to 18
grams (6 to 8 weeks) were inoculated orally with approximately 1x106 CFU wild-type (n
= 7) or O-ag capsule mutant (ΔyihO) (n = 7) strains of serovar Typhimurium. Dilutions of the stationary phase culture inoculum were plated on LB agar to determine the actual number of administered bacteria. Animals were euthanized upon attainment of early removal criteria at days 7, 10, or 14 post infection.
92 3.3.12 Statistics
To determine associations of significance between groups, two-tailed Student’s t
tests were performed. Observed differences were considered statistically significant for p
values < 0.05.
3.4 Results
3.4.1 A serovar Typhimurium colanic acid/cellulose double mutant forms mature
gallstone biofilms
The extracellular matrix produced by bacterial biofilms is frequently composed of
polysaccharides and has been well characterized for organisms such as E. coli, V.
cholerae, and Pseudomonas aeruginosa (Danese et al., 2000; Hung et al., 2006; Read and
Costerton, 1987). As described previously, the EPS of bile-induced Salmonella biofilms
on gallstones can be preserved and visualized by SEM (Prouty et al., 2002a). Individual
mutants unable to produce the known Salmonella EPS components cellulose and colanic
acid and the ViAg capsule (serovar Typhi) were previously shown to maintain the ability
to form a biofilm on gallstones (Prouty and Gunn, 2003). To extend these results, a
ΔbcsE ΔwcaA double mutation was created in serovar Typhimurium. Mutant and wild-
type strains were incubated in the presence of 3% crude ox bile extract and a human
gallstone under established assay conditions. Gallstones were fixed immediately in 2%
glutaraldehyde and examined by SEM (Fig. 3.1). Biofilm formation and the presence of
EPS (flocculent and stringy material) were equally robust for wild-type and mutant strains, suggesting involvement of an as-yet-unidentified EPS.
93 3.4.2 S. enterica binds to and forms biofilms on cholesterol-coated Eppendorf tubes
Though regional differences in diet and other environmental and genetic factors can alter gallstone development, human gallstones are primarily composed of cholesterol or calcium bilirubin. To eliminate dependence on human gallstone samples and to allow gallstone constituents to be analyzed individually for their abilities to interact with salmonellae, siliconized Eppendorf tubes were coated with 1 mg of cholesterol to mimic gallstone surfaces.
As shown in Fig. 3.2A, Eppendorf tubes required a coating of cholesterol to support Salmonella biofilm formation, suggesting that salmonellae bind to cholesterol.
The presence of bile in this TBA significantly enhanced biofilm formation on cholesterol as it did for human gallstones, further promoting the hypothesis that bile in the gallbladder helps to establish biofilm formation on cholesterol gallstones (Fig. 3.2A and
B). It was also observed that bacteria preincubated with bile (grown overnight in 3% bile) formed more-robust biofilms and formed them earlier than bacteria encountering bile for the first time upon addition to cholesterol-coated tubes (data not shown).
Additionally, tubes coated with bilirubin supported significantly less biofilm than those coated with cholesterol, though bile still induced bilirubin-coated tube biofilm formation
(Fig. 3.3). Therefore, bile is an important environmental signal for salmonellae that enhances biofilm formation on cholesterol-coated surfaces.
94 3.4.3 The Salmonella O-ag capsule is necessary for binding to cholesterol versus binding
to glass or plastic
In addition to cellulose and colanic acid, E. coli expresses a variety of chemically
and serologically distinct capsules (Whitfield and Roberts, 1999). One such EPS is the
O-ag capsule, the composition of which is similar to that of the LPS O polysaccharides
(Roberts, 1996). Recently, Gibson and colleagues identified an O-ag capsule associated
with the serovar Enteritidis extracellular matrix that was shown to be important for
environmental persistence (Gibson et al., 2006). Assembly and translocation of the
conserved O-ag capsule involve the enzymes produced by two operons, yihU-yshA and
yihVW. Mutations in several genes of these operons, including yihO, have been shown to
eliminate expression of this capsule.
To determine the role of the O-ag capsule in biofilm formation on cholesterol-
coated surfaces, deletions of yihO in serovar Typhimurium and of yihP in serovar Typhi
were created by lambda Red-mediated recombination and were examined in the TBA.
The data show that the O-ag is a necessary component of Salmonella biofilms on
cholesterol-coated Eppendorf tubes in serovar Typhimurium, serovar Typhi, and serovar
Enteritidis (Fig. 3.2A and B). Real-time PCR experiments confirmed that the serovar
Typhimurium yihO deletion did not have a polar effect on downstream genes (data not
shown). Thus, we performed complementation experiments with plasmid-borne yihO.
These studies resulted in amounts of bile-induced biofilm formation on cholesterol of the yihO mutant similar to those for wild-type serovar Typhimurium (Fig. 3.2B).
The O-ag capsule was originally identified by White et al. (White et al., 2003) in association with the AgfD-regulated extracellular matrix. AgfD (CsgD) is an important
95 regulator of Salmonella biofilm formation (Brombacher et al., 2003; Romling et al.,
1998) and has been demonstrated to control O-ag capsule biosynthesis (Gibson et al.,
2006). To determine the role of AgfD in bile-mediated biofilm formation on gallstone/cholesterol-coated surfaces, a serovar Typhimurium agfD mutant was added to the TBA. As shown in Fig. 3.2B, loss of AgfD had no effect on biofilm formation in these assays.
To examine whether the O-ag capsule was important for biofilm formation on other surfaces, wild-type and yihO and yihP deletion strains were assayed in the presence of bile for their abilities to bind to glass or plastic coverslips. As shown in Table 3.3, wild-type salmonellae formed mature biofilms on glass, plastic, or cholesterol-coated surfaces. However, absence of the O-ag capsule eliminated biofilm formation on cholesterol-coated tubes but not on glass or plastic coverslips. Furthermore, a ΔbcsE
ΔwcaA double mutant formed poor biofilms on glass and plastic surfaces but formed a biofilm similar to that of the wild-type strain on cholesterol-coated tubes (Table 3.3).
These data suggest specificity of binding to cholesterol mediated directly or indirectly by the O-ag capsule.
3.4.4 The extracellular-matrix-associated O-ag capsule is a critical component of
Salmonella gallstone biofilms
To evaluate the role of the O-ag capsule in bile-induced Salmonella gallstone biofilms, O-ag mutants were examined by electron microscopy for biofilm formation on gallstone surfaces. As shown in Fig. 3.4, wild-type serovar Typhimurium, serovar Typhi, and serovar Enteritidis formed mature biofilms on human gallstones after 12 days of
96 incubation with 3% bile. The extracellular-matrix material was preserved in a more
natural state by air drying samples overnight before fixation in 2% glutaraldehyde. This
extra step accounted for the visual differences in Salmonella gallstone biofilm ECM
composition observed in Fig. 3.1 (samples subjected to immediate fixation) and Fig. 3.4
(samples air dried before fixation). Unlike the wild-type strains, none of the three O-ag
capsule mutant strains formed detectable biofilms on gallstones (Fig. 3.4B, D, and F).
These results implicate the extracellular-matrix-associated O-ag capsule as a crucial component of bile-mediated biofilm formation on gallstones.
3.4.5 Bile increases Salmonella O-ag capsule production in biofilms
The presence of bile has been shown to alter protein production, antibiotic and bile resistance, virulence, and EPS synthesis for enteric bacterial groups, including
Shigella flexneri (Olive et al., 2007; Pope et al., 1995a), Helicobacter pylori (Tiwari et al., 2006), Campylobacter spp. (Lin et al., 2005b; Stintzi et al., 2005), and V. cholerae
((Bina and Mekalanos, 2001; Hung et al., 2006); for a review, see reference (Begley et al., 2005a)). To examine the effect of bile on capsule expression in biofilms grown on cholesterol-coated surfaces, antibody to Salmonella O-ag was used in a quantitative TBA
ELISA. Growth in 3% bile significantly enhanced O-ag capsule induction for wildtype serovar Typhimurium, serovar Typhi, and serovar Enteritidis as well as the serovar
Typhimurium colanic acid/cellulose double mutant (Fig. 3.5A). This was not seen with strains deficient for O-ag production.
Because some of the differences observed in Fig. 3.5A may be due to the reduction in biofilm in the absence of bile, fluorescence microscopy of Salmonella
97 biofilm material removed from the TBA was also used to measure O-ag capsule
expression (Fig. 3.5B). As with the modified ELISA, the images show that production of
the O-ag capsule increased in biofilms for all wild-type strains and the ΔbcsE ΔwcaA mutant when bacteria were grown in bile. Quantification of signal intensity indicated that bile mediated a 166 to 278% fluorescence increase in the Salmonella strains examined.
The yihO and yihP mutants of serovar Typhimurium, serovar Typhi, and serovar
Enteritidis showed little O-ag expression in the presence or absence of bile (Fig. 3.5B).
In addition, there was no significant difference in thickness of biofilm material between samples from tubes with and without bile (data not shown). Furthermore, a fluorescence increase was also observed on a single-cell basis for bacteria grown in the presence of 3% bile versus those grown without bile (data not shown). These results further implicate the importance of the O-ag capsule in Salmonella biofilm ECM and demonstrate that its production is bile induced.
3.4.6 Transcription of O-ag capsule genes is upregulated by bile in an AgfD-independent manner
Bile has been shown to influence the expression of microbial virulence factors at the level of gene transcription. For example, eukaryotic cell invasion by serovar
Typhimurium is repressed by bile, as evidenced by transcriptional downregulation of genes within Salmonella pathogenicity island I (Prouty and Gunn, 2000). To examine the effect of bile on transcription of O-ag genes, real-time PCR was performed using wild- type serovar Enteritidis, serovar Typhimurium, and serovar Typhi and an agfD mutant of serovar Typhimurium, all grown in the presence or absence of bile (Fig. 3.6).
98 Transcription of yihU, a putative oxidoreductase located in the O-ag operon, was
enhanced 18-fold for serovar Enteritidis, 24-fold for serovar Typhimurium, 11-fold for
serovar Typhi, and 23-fold for serovar Typhimurium ΔagfD when strains were grown in
the presence of bile, suggesting that bile is a signal resulting in increased transcription of
the O-ag cluster independently of AgfD.
3.4.7 Serovar Typhimurium O-ag capsule mutants are attenuated for virulence during oral
murine infections
Serovar Typhimurium is a facultative intracellular pathogen that mediates a systemic, typhoid-fever like illness and rapid death in mouse strains lacking the
macrophage phagosome-specific protein Nramp1, and certain genetic manipulations in
Salmonella prevent pathogenesis in this model (reviewed in (Skamene et al., 1998)). To
determine whether the loss of O-ag capsule expression attenuates serovar Typhimurium
virulence, female BALB/c mice were orally inoculated with wild-type and yihO mutant
6 strains (10 bacteria) at 2 logs above the dose necessary to kill 50% (LD50). Infections
with wild-type salmonellae resulted in death at 7 to 10 days P.I., whereas mice given a
yihO mutant experienced overt symptoms and subsequent recovery, and were euthanized
2 weeks P.I. These results are preliminary, (performed twice, total n = 7), and suggest
that expression of the O-ag capsule is necessary for full virulence during oral infection of
susceptible murine animals.
99 3.5 Discussion
Bacterial biofilms are increasingly associated with serious illnesses in humans and
animals. We hypothesize that the Salmonella chronic carriage state is frequently if not always a result of biofilm formation on gallstones. In limited studies, a high correlation was shown to exist between those individuals who became carriers and those who have gallstones (Dutta et al., 2000; Lai et al., 1992), and the protection afforded the bacteria within the biofilm would help explain their resistance to killing by bile and antibiotics. In this work, we describe a bile-induced EPS necessary for and specific toward biofilm formation on gallstones and cholesterol-coated surfaces.
ECM material within bacterial biofilms is thought to be heterogeneous and to provide both rigidity to the biofilm and protection to bacteria embedded within these biofilms. It was previously shown that the serovar Typhi Vi antigen did not contribute to the establishment of gallstone biofilms (Prouty and Gunn, 2003). Furthermore, serovar
Typhimurium and serovar Enteritidis do not produce this EPS but form biofilms on gallstones that are indistinguishable from those of serovar Typhi. To further examine the role of EPSs in Salmonella gallstone biofilms, a double mutation in the known
Salmonella ECM constituents colanic acid and cellulose was created. When assayed by
SEM for biofilm formation on human gallstones, robust biofilms and ECM material were
still clearly present. These data suggested the presence of an undetermined EPS in the
Salmonella gallstone microenvironment.
Previous work performed by Gibson et al. (Gibson et al., 2006) identified a conserved serovar Enteritidis EPS termed the O-ag capsule. This substance was similar in structure to the LPS O-ag of serovar Enteritidis and was encoded by two divergent
100 operons (yihU-yshA and yihV-yihW) (Gibson et al., 2006). Despite having similar
repeating sugar units, the O-ag capsule and the LPS O-ag differ in size, charge,
substitution patterns, and immunoreactivity (White et al., 2003). In addition, this capsule
is linked to the membrane via a lipid anchor. O-ag capsule expression was found to be
necessary for serovar Enteritidis biofilm formation leading to enhanced plant colonization
(Barak et al., 2007). To examine the role of the O-ag capsule in Salmonella gallstone
biofilms, a yihO deletion was constructed in serovar Typhimurium and yihP was deleted
in serovar Typhi. Lack of O-ag capsule production proved to be critical, as these strains
failed to form a biofilm on gallstone surfaces. Similar results were observed for an O-ag
serovar Enteritidis mutant, though they were not as exaggerated as those observed for
serovar Typhimurium or serovar Typhi.
Human gallstones in North America are primarily cholesterol but also contain calcium bilirubin and other components. Interaction of salmonellae with cholesterol has been described to occur in host cells, as cholesterol is recruited to the Salmonella- containing vacuole and esterified by the SPI-2 effector SseJ (Catron et al., 2002; Nawabi et al., 2008). Because of such known cellular associations with cholesterol and because cholesterol is the primary constituent of the human gallstones used in our assays, we examined Salmonella biofilm formation on Eppendorf tubes coated with cholesterol
(TBA). The results of these experiments mimicked those of the experiments performed with gallstones in test tubes for all wild-type and mutant strains examined, suggesting that S. enterica binds to cholesterol. Biofilms on gallstones were previously shown to often occur in patches (Prouty et al., 2002a), which, given this new knowledge, may reflect the local distribution of cholesterol on the gallstone surface. Furthermore, bile
101 was shown to enhance biofilm formation on cholesterol as it did for human gallstones.
This model has advantages over that of human gallstones as it is more efficient, is
amenable to large-scale mutagenesis screens, avoids retrieval of patient materials, and will allow other gallstone constituents to be analyzed for Salmonella binding in the future.
It has previously been shown that Salmonella biofilm-associated factors are not uniformly required for biofilm formation on all surfaces (Prouty and Gunn, 2003).
Interestingly, serovar Typhimurium, serovar Typhi, and serovar Enteritidis O-ag capsule mutants were all shown to be deficient in biofilm formation on cholesterol-coated surfaces and human gallstones but produced robust biofilms on glass and plastic coverslips when grown in the presence of bile. Cellulose and colanic acid mutants had the opposite phenotype, as they did not form biofilms on glass or plastic coverslips but formed mature biofilms on human gallstones and in the TBA. Interestingly, cellulose and colonic acids have been shown to play a role in biofilm formation on biotic as well as abiotic surfaces, as mutations in either wcaM or yhjN have been shown to disrupt serovar
Typhimurium biofilm formation in flow through chambers on HEp-2 cells (Ledeboer and
Jones, 2005). However, in the presence of cholesterol and bile, cellulose and colanic acid are not a factor in biofilm formation.
A modified ELISA and immunofluorescence microscopy were used to determine if bile enhanced O-ag capsule expression in Salmonella biofilms on cholesterol. Both experiments showed that bile increased not only biofilm formation but also production of the O-ag capsule in all wild-type strains as well as the serovar Typhimurium ΔbcsE
ΔwcaA double mutant. Real-time PCR analysis indicated that bile-mediated O-ag
102 capsule induction occurred at the level of transcription of the yih genes. Gibson and
colleagues showed that AgfD, an important regulatory factor of biofilm formation
(Brombacher et al., 2003; Romling et al., 1998), controls expression of the yih operons
(Gibson et al., 2006). However, loss of AgfD had no effect on biofilm formation in the
TBA. Furthermore, real-time PCR revealed that bile upregulated transcription of the yih
operon in an agfD-independent manner, suggesting that another bile-responsive
transcription factor is involved in yih gene expression.
To date, our understanding of serovar Typhi pathogenesis and associated
pathology during typhoid fever has been inferred from infections of inbred mouse strains
lacking the Nramp1 protein with serovar Typhimurium (Jones and Falkow, 1996).
Mutations in a variety of virulence related genes render Salmonella incapable of killing
otherwise susceptible mice, including constitutive expression of the PhoP regulon, and an
observed effect can depend on the route of infection (Galan and Curtiss, 1991; Miller and
Mekalanos, 1990). Here, the effect of O-ag capsule expression on pathogenesis in this
model was examined. Our results, though preliminary, indicate that production of the O-
ag capsule is a necessary component of full virulence, as mice inoculated orally with 106
CFU of a yihO serovar Typhimurium mutant cleared all infections. To account for any
bile-mediated virulence effects on the O-ag capsule that may have occurred during oral
inoculation, these experiments will be repeated intraperitoneally to bypass the
gastrointestinal tract.
We have identified a critical EPS in the extracellular matrix of Salmonella bile-
induced biofilms on gallstones and a new method of examining Salmonella-gallstone
interactions (the TBA). It could be hypothesized that bile induction of the O-ag capsule
103 has evolved to aid chronic carriage of S. enterica specifically in the gallbladder environment. This new understanding of how bile mediates Salmonella gallstone biofilm formation via O-ag capsule expression provides a therapeutic target for potentially alleviating carriage in the gallbladder and subsequently much of the human-to-human transmission that makes this pathogen a relevant global concern.
104 Strain or Characteristics Source or reference plasmid Strains S. Typhimurium JSG210 ATCC 14208s (CDC6516-60), wild type ATTC JSG2896 JSG210 ΔbcsEΔwcaA This study JSG2897 JSG210 ΔyihO This study JSG2971 JSG2897 complemented with yihO on pUC18 This study JSG2956 ATCC 14028s ΔagfD Gift of Jones S. Typhi JSG698 Ty2 ATTC JSG2950 JSG210 ΔyihP This study S. Enteritidis JSG2439 2765-3b, wild type Gift of Kay JSG2440 2765-3b yihO::Tn5 Gift of Kay
Plasmids pCP20 FLP recombinase expression plasmid (Cmr Apr) Gift of Datsenko pKD46 R101 ori, rep101ts, PBAD expressing λ γ β exo Gift of Datsenko (Apr) r pKD4 oriR6K, FRT::kan::FRT template plasmid (Ap ) Gift of Datsenko
Table 3.1: Bacterial strains, plasmids and relevant characteristics
105 Name 5'→ 3' Sequence Purpose JG1122 GGCCGAACACTCTTTGTGGT Amplification of dnaN HK gene JG1123 GTATAATTTCGGTCGCATCCGT Amplification of dnaN HK gene JG1281 GATGGATAAAGCGGCAAGCGTCGTTTAATT λ-Red deletion of yihO GTGTAGGCTGGAGCTGCTTC JG1282 CGTTTTGAGAGGCGATTATGTCTAATCATG λ-Red deletion of yihO ATCATATGAATATCCTCCTTA JG1643 GAGAAGAATAATGAGTCAAACATCTGTGTA λ-Red deletion of yihP GGCTGGAGCTGCTTC JG1644 GTTATATTTTATTGTTGTTAAACCGTATGCA λ-Red deletion of yihP TATGAATATCCTCCTTA JG1283 GTAGCGTATAGGTATTGGTC Determination of correct deletion of yihO JG1284 GCTGGATGCTAACGCAAATC Determination of correct deletion of yihO JG1647 GTTGCGATTGGACGCTGTACCTG Determination of correct deletion of yihP JG1648 GTAATATGCAGGCATCCCGAGTTC Determination of correct deletion of yihP JG1498 CATTTATCGGGTTGGGACAG Amplification of yihU JG1499 CACATCCATCATGCTGAACC Amplification of yihU
Table 3.2: Oligonucleotide primers
106 Strains grown in 3% bile Biofilm development* Cholesterol Glass Plastic Serovar Enteritidis ++ ++ ++ Serovar Enteritidis yihO mutant - ++ ++ Serovar Typhimurium ++ ++ ++ Serovar Typhimurium yihO mutant - ++ ++ Serovar Typhimurium bcsE wcaA mutant ++ + + Serovar Typhi ++ ++ ++ Serovar Typhi O-ag capsule yihP mutant - + ++
Table 3.3: Summary of biofilm formation on cholesterol, glass, and plastic surfaces from a representative experiment performed in triplicate (n = 3). *Biofilms grown on cholesterol-coated, glass, and plastic surfaces were stained with crystal violet. Dye was extracted with acetic acid and optical density was measured at 570 nm for quantification. ++, robust mature biofilm formation compared to that of the wild-type; +, reduced biofilm present (50-80% of wild-type values); -, severe defect in or complete loss in biofilm formation (0-10% of wild-type values).
107 A.A. B. C. C.
Figure 3.1: The loss of colanic acid and cellulose does not affect Salmonella gallstone biofilm formation. (A) SEM micrograph showing the multi-layered, heterogeneous surface of a cholesterol gallstone incubated in LB broth without bacteria. (B) S. Typhimurium wild-type (14028s) strain exposed to a human gallstone for 12 days in the presence of 3% bile forms a mature biofilm. (C) S. Typhimurium bcsE-wcaA- strain exposed to a human gallstone for 12 days in the presence of 3% bile also forms a mature biofilm. The web-like strands or flocculent material are indicative of exopolysaccharide in the biofilm ECM. Micrographs are representative of 3 independent experiments.
108 S. Typhimurium S. Enteritidis S. Enteritidis S. Typhimurium S. Typhimurium S. Typhimurium S. Typhi S. Typhi yihO- yihO- bcsE-wcaA- yihP-
AA.
Cholesterol - + + + + + + + 2.5
* * * B B. 2 * * *
1.5 No Bile 3% Bile OD570 1
0.5
0 S. Enteritidis S. Enteritidis S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium S. Typhimurium S. Typhi S. Typhi 1 yihO-2 3 yihO-4 yihO-5Comp. agfD-6 bcsE-wcaA-7 8 yihP-9
Figure 3.2: Eppendorf tubes coated with 1 mg cholesterol support Salmonella biofilm formation in the tube biofilm assay (TBA). The TBA spanned 6 days with washings every 24 hours to mimic emptying of the gallbladder. (A) Salmonella biofilms from the TBA were stained with crystal violet and photographed using the BioChemi System (UVP BioImaging). (B) Crystal violet stained TBA biofilms were extracted with acetic acid and absorbance was measured for at 570 nm. All experiments were performed in triplicate and means + SD are given (n = 3). * denotes statistical significance between bile and no bile groups (P < 0.005) based on two-tailed Student t-Test.
109
3.5
3
2.5 Cholesterol, No Bile Cholesterol, 3% Bile 2 Bilirubin, No Bile Bilirubin, 3% Bile
OD570 1.5
1 * * 0.5 * *
0 S. Typhimurium12 S. Typhi
Figure 3.3: Comparison of Salmonella biofilm formation in the tube biofilm assay (TBA) on cholesterol- or bilirubin-coated tubes. The TBA spanned 6 days with washings every 24 hours to mimic emptying of the gallbladder. Crystal violet stained biofilms were extracted with acetic acid and absorbance was measured for at 570 nm. Data are presented as means + SD from a representative experiment done in triplicate (n = 3). * denotes statistically significant difference in biofilm formation on cholesterol vs. bilirubin (P < 0.005) based on two-tailed Student t-Test.
110
A.A B.B
C.C D.D
E.E FF.
Figure 3.4: Mutations in the O-ag operon affect Salmonella gallstone biofilm formation. Human gallstones were incubated with Salmonella and 3% bile for 12 days, washed in LB, air-dried overnight, fixed in glutaraldehyde, and visualized by SEM. (A) S. Typhimurium wild-type (B) S. Typhimurium yihO mutant (C) S. Typhi wild-type (D) S. Typhi yihP mutant (E) S. Enteritidis wild-type (F) S. Enteritidis yihO mutant. Experiments were performed at least 3 times and presented are representative micrographs.
111 0.8 A * A. 0.7 * * * 0.6
0.5
0.4 No Bile
OD415 3% Bile 0.3
0.2
0.1
0 S. Enteritidis1234567S. Enteritidis S. Typhimurium S. Typhimurium S. Typhimurium S. Typhi S. Typhi yihO- yihO- bcsE-wcaA- yihP- B.B
S. Enteritidis S. Enteritidis S. Typhimurium S. Typhimurium S. Typhimurium S. Typhi S. Typhi yihO- yihO- bcsE-wcaA- yihP-
Bile + - + - + - + - + - + - + - % Fluorescence increase in bile
275 6.9 208 1.8 166 278 4.6
Figure 3.5: The effect of bile on Salmonella O-ag capsule expression. (A) Modified ELISA in the TBA. Salmonellae were incubated with or without bile in cholesterol- coated Eppendorf tubes for six days with washings every 24 hours. Samples in the tubes were then blocked with BSA, exposed to O-ag capsule antisera and the appropriate HRP- conjugated secondary antibody, and developed. (B) Immunofluorescent microscopy of TBA biofilms gently removed from the tubes. Primary O-ag capsule antibody was used with a fluorescein-conjugated secondary for visualization with an Olympus fluorescent microscope. All experiments were performed in triplicate and means + SD are given (n = 3). * denotes statistical significance of P < 0.005 between bile and no bile groups based on two-tailed Student t-Test.
112 400 * * 350 * 300 No Bile 250 3% Bile 200 * 150
100 Relative Copy Number Copy Relative 50 0 S. Enteritidis S. Typhimurium S. Typhimurium S. Typhi 1234agfD-
Figure 3.6: Real-time PCR measuring O-ag capsule transcription for S. enterica serovars Enteritidis, Typhimurium and Typhi and S. Typhimurium ΔagfD grown in the presence or absence of bile. Primers target yihU, a putative oxido-reductase located in the O-ag capsule encoding operon. Means + SD are given for a representative experiment done in triplicate (n = 3). * denotes statistical significance of P < 0.005 between bile and no bile groups based on two-tailed Student t-Test.
113
Chapter 4
Gallstones play a significant role in Salmonella spp. gallbladder colonization and carriage
4.1 Abstract
Approximately 5% of patients suffering from typhoid fever carry S. enterica serovar Typhi in the bile-rich gallbladder long after overt symptoms subside, suggesting that this bacterium utilizes novel mechanisms to mediate enhanced colonization of and persistence in this hostile environment. The asymptomatic carrier state is frequently associated with the presence of gallstones and is a significant risk factor for carcinoma of this organ. We have previously shown that salmonellae form bile-mediated biofilms on human gallstones and cholesterol-coated surfaces in vitro and thus hypothesize that biofilm formation on cholesterol gallbladder stones facilitates typhoid carriage. Naturally resistant 129X1/SvJ mice fed a lithogenic diet (normal chow supplemented with 1% cholesterol and 0.5% cholic acid) developed cholesterol gallstones and, as a result, demonstrated enhanced colonization of gallbladder tissue and bile as well as fecal shedding during persistent serovar Typhimurium infection. This was specific to the gallbladder as there were no significant differences in bacteria recovered from the spleen over 21 days post infection. Furthermore, cholesterol gallstones were shown to associate with significant amounts of salmonellae that increased with time post infection.
114 Individuals seeking cholecystectomy due to gallstones were analyzed for asymptomatic
serovar Typhi carriage at the Hospital Infantil in Mexico City to test our hypothesis in humans from an area endemic to typhoid fever. Results indicate that 5% of patients with cholelithiasis carried serovar Typhi and that bacterial biofilms could be visualized on gallstones from 3/4 of these carriers. Biofilm formation was not observed on patients positive for other bacteria or whose gallbladders failed to possess culturable aerobic bacteria, suggesting that gallstone biofilms are a typhoid specific phenomenon. These findings offer direct evidence that gallstone biofilms occur in humans and mice carrying salmonellae without symptoms, which facilitates gallbladder colonization and shedding.
In addition, this work brings forward a new model for evaluating therapeutic targets against typhoid fever transmission.
4.2 Introduction
Global public health continues to be burdened with significant morbidity and mortality caused by salmonellae. The greater than 2,400 serovars of Salmonella enterica
are ubiquitous in nature, distinguished by somatic differences in surface antigen
expression, and as such have evolved to infect a broad array of host organisms and resist
commonly administered antibiotics (Boyle et al., 2007; Rabsch et al., 2001). S. enterica
serovar Typhi has adapted to induce disease exclusively in humans and is the etiologic
agent of typhoid fever, a debilitating illness characterized by interstitial inflammation, a
gradual onset of symptoms, and, ultimately, bacterial dissemination to systemic sites
(Tsolis et al., 2008). The Centers for Disease Control and Prevention estimate that at
least 22 million people world-wide are stricken with typhoid fever each year, yet many
115 more go unreported due in part to poor diagnostic testing world-wide (Butler et al., 1978;
Crump et al., 2004; Parry et al., 2002).
The hallmarks of salmonellosis caused by non-typhoidal S. enterica serovars
Enteritidis or Typhimurium differ from those of enteric fever and include intestinal
neutrophilia, localized inflammatory diarrhea, the loss of electrolytes, serum protein and
fluid, as well as sepsis-induced death in immunocompromised individuals (Tsolis et al.,
2008; Dharmana et al., 2002; Fleisher, 1991; Santos et al., 2002). Interestingly, much of
what is known about the systemic pathogenesis of S. Typhi during typhoid fever has been
extrapolated from infections of inbred mouse strains lacking Nramp1 (BALB/c and
C57BL/6) with non-typhoidal serovar Typhimurium. In this model, translocation of the
intestinal epithelium at microfold (M) cells is followed by invasion of phagocytic cells of
the underlying lymphoid tissue, a primary bacteraemia in the blood, and uncontrolled
replication within macrophages of the liver, spleen, and bone marrow leading to death at
7 to 10 days post infection (Jepson and Clark, 2001; Jones and Falkow, 1996; Galan and
Curtiss, 1991; Richter-Dahlfors et al., 1997; Salcedo et al., 2001).
In humans, serovar Typhi reaching the gallbladder can establish an acute, active
infection (cholecystitis) or persist in this organ long after symptoms subside, suggesting
novel mechanisms utilized by the bacterium to mediate colonization in a bile-rich
environment (Vaishnavi et al., 2005; Sinnott and Teall, 1987). Bile is an important
digestive secretion manufactured in the liver that serves as a potent emulsifying and
antimicrobial agent in the gastrointestinal tract, yet salmonellae have adapted to resist its
surface-acting, amphipathic, detergent-like properties (van Velkinburgh and Gunn, 1999).
116 Development of chronic typhoid carriage is frequently associated with the
presence of gallbladder abnormalities, especially gallstones, yet the progression from infection to the carrier state remains undefined (Lai et al., 1992). Gallstone formation
(cholelithogenesis) is attributed to a combination of environmental and genetic causes typically linked to cholesterol supersaturation from bile, and can occur in patients for many years without symptoms (Maurer et al., 2009; Shoheiber et al., 1997). The primary constituent of gallbladder stones is cholesterol, whereas calcium bilirubinate predominates in bile duct stones (Hofmann, 2005). In patients carrying both S. Typhi and cholesterol gallstones in the gallbladder, clinically administered antibiotics are typically ineffective against dissolution of the persistent bacterial infection (Lai et al., 1992) and the risk factor for developing hepatobiliary carcinomas is high (Dutta et al., 2000; Kumar et al., 2006). Similarly, survival of Helicobater pylori in the hostile, acidic stomach often leads to persistence of this microorganism and an increased risk of adenocarcinoma
(Blaser et al., 1995). To date, removal of the gallbladder (cholecystectomy) remains the most effective treatment option for chronic typhoid carriers with gallstones. In 1994, the
United States alone spent an estimated 8.0 billion dollars treating gallbladder diseases, suggesting a strong need for alternative treatment options in areas of the world where typhoid fever is endemic and surgical intervention is cost-prohibitive.
This description led us to hypothesize that asymptomatic S. Typhi carriage in the presence of bile was facilitated by the formation of biofilms on cholesterol gallstones.
Over the past two decades, bacterial biofilms associated with medical and industrial ecosystems have been implicated as the cause of many antibiotic resistant, persistent infections in humans (Stewart and Costerton, 2001; Costerton et al., 1999). Biofilm
117 formation occurs in sequential, highly regulated stages that include adherence of free- swimming bacteria to a surface, development of a protective, self-initiated extracellular
(ECM) matrix, and continual release of planktonic cells from this sessile community into the environment (Costerton et al., 1995). Shedding of S. Typhi from asymptomatic, chronic carriers is thought to account for much of the person-to-person transmission of typhoid fever in impoverished societies.
We have demonstrated that bile-dependent mature biofilm formation with characteristic ECM production of S. enterica serovars Typhimurium, Enteritidis, and
Typhi occurs on human gallstones and on cholesterol-coated Eppendorf tubes in vitro
(Prouty et al., 2002a; Crawford et al., 2008). However, S. Typhi biofilm formation on cholesterol gallstones has never been investigated as a mechanism mediating the chronic carrier state of typhoid fever in vivo. To address this issue, we present clinical evidence that serovar Typhi forms biofilms on gallstones in asymptomatic, human carriers. In addition, we have developed a murine model of Salmonella persistence in mice with lithogenic diet-induced cholesterol gallstones. Interestingly, mice with gallstones harbor significantly more serovar Typhimurium in the gallbladder tissue, bile, and fecal matter than control mice, and salmonellae can be recovered from homogenized gallstones in increasing amounts over time post infection. These findings offer direct evidence that gallstone biofilms occur in individuals carrying S. Typhi, and point to a new therapeutic target against the spread of typhoid fever.
118 4.3 Materials and Methods
4.3.1 Bacterial strains and growth conditions
The S. enterica strains used in this study are listed in Table 4.1. Cultures were grown in Luria-Bertani (LB) broth with or without 3% crude ox bile extract (Sigma, St.
Louis, MO) overnight on a rotating drum at 37°C and diluted to mid- to late exponential phase (optical density at 600 nm [OD600] of 0.6 to 0.8) for use in biofilm and mouse colonization assays. When necessary, antibiotics were added at appropriate concentrations: ampicillin, 50 μg/ml; kanamycin, 25 μg/ml; chloramphenicol, 25μg/ml; and tetracycline, 15 μg/ml.
4.3.2 Serovar Typhimurium infections in mice
Female 129X1/SvJ mice (Jackson Laboratories, Bar Harbor, ME) weighing 16 to
18 grams (6 to 8 weeks) were fed a normal rodent diet (Harlan-Teklad cat. 2014) or a lithogenic, gallstone-inducing diet consisting of mouse chow (Harlan-Teklad cat. 7912) supplemented with 1% cholesterol (Sigma, St. Louis, MO) and 0.5% cholic acid (Sigma,
St. Louis, MO) for 8 weeks. To make the lithogenic diet, equal parts (weight: volume) powdered ingredients and UltraPure distilled water (Invitrogen, Carlsbad, CA) were mixed in zip-top bags until homogenous, and pellets weighing between 5 to 7 grams were shaped by hand to resemble normal chow and air dried overnight in a Laminar flow hood.
Mice were inoculated (n = 42; 21 per diet group) intraperitoneally with approximately
1x104 CFU or left as uninfected controls (n = 18; 9 per diet group), and euthanized at days 3, 7, and 21 post infection. Dilutions of the stationary phase culture inoculum were plated on LB agar to determine the actual number of delivered bacteria. For analysis of
119 organ burdens (CFU), spleens and gallbladders were aseptically removed at the stated time points, homogenized, serially diluted in 1 x PBS, and plated on LB agar. To enumerate CFU, gallstones (present only in the lithogenic diet groups) and gallbladder tissues were separated, homogenized in a 50 ml conical tube containing 1 ml of 1 x PBS, and gallbladder bile was diluted and plated. To monitor shedding of serovar
Typhimurium, infected mice from both diet groups were isolated overnight in individual cages prior to sacrifice at day 21. Approximately 5 to 7 fresh pellets were collected from
each mouse, weighed in 50 ml conical tubes, homogenized in 1 x PBS, diluted, and
plated on SS-agar (BD, Franklin Lakes, NJ) for CFU determination.
4.3.3 Sample collection from human donors
Patients seeking surgical removal of their gallbladder (cholecystectomy) at the
Hospital Infantil in Mexico City were tested for asymptomatic typhoid carriage during a
2 year study. To diagnose the presence of serovar Typhi, gallbladder tissues, gallstone
sections, and stool samples were homogenized and plated, and bile was obtained and
plated directly. If bacteria were present, serotyping was performed using standard
clinical techniques. Genomic DNA from positive samples was purified and selectively
amplified by multiplex PCR for Vi antigen (viaB), flagellar antigens (fliC-d and fliC-a),
and O-antigen synthesis (tyv and prt) as previously described (Hirose et al., 2002) to confirm identity of serovar Typhi. Gallstones and gallbladder tissues from positive patients and negative controls were sent to The Ohio State University (OSU) and
analyzed for gallstone biofilms by scanning electron microscopy (SEM) or tissue
inflammation and cellular infiltration by histopathology.
120 4.3.4 Scanning electron microscopy
Gallstones recovered from patients at the Hospital Infantil in Mexico City positive for asymptomatic carriage of serovar Typhi were rinsed with sterile PBS, fixed in 2% glutaraldehyde, air dried in a Laminar flow hood, and sent by overnight courier to OSU.
All specimens were dehydrated postfixation using a Cressington critical point drier at the
Campus Microscopy and Imaging Facility (OSU CMIF), sputter coated with a Pelco
Model 3, and viewed using a FEI Nova NanoSEM at 5.00 kV under varying magnifications.
4.3.5 Histopathology
Gallbladder tissues from human patients seeking cholecystectomy in Mexico City as well as from infected and uninfected mice belonging to lithogenic and normal diet groups (all time points) were collected for histological examination. Human clinical samples were rinsed in sterile saline, fixed in 10% buffered formalin (Sigma, St. Louis,
MO) for 18 hours, washed with purified 1 x PBS, placed in 30% sucrose for 24 hours, frozen at -70°C, and shipped to OSU. Mice gallbladders were removed immediately post sacrifice, rinsed aseptically in 1 x PBS, and fixed in 10% neutral buffered formalin
(Fisher Scientific, Pittsburgh, PA) for 72 hours. All tissues were embedded in paraffin blocks, mounted on slides in 4 μm thick sections, and stained with hematoxylin/eosin
(H&E) by the Comprehensive Cancer Center Histology Core Facility (OSU) for subsequent pathologic examination by the Comparative Pathology & Mouse Phenotyping
Shared Resource (OSU).
121 4.3.6 MIC assays of bile resistance
Laboratory strains and clinical isolates of serovar Typhi were challenged with
crude ox bile extract at concentrations of 0.02% to 60%. Standard MIC testing of
susceptibility to bile was performed as previously described (Steinberg et al., 1997).
Briefly, strains were grown in Mueller-Hinton broth overnight, diluted, and 104 cells
were added to individual round-bottomed wells of polypropylene microtiter plates
(Costar Corp., Cambridge, MA). Bacteria were tested for growth (as visualized by a pellet accumulation) against serial dilutions of bile following incubation for 24 hours at
37°C.
4.3.7 Biofilm formation assays on cholesterol
Salmonellae formed biofilms on cholesterol-coated surfaces as described previously (Crawford et al., 2008). Briefly, log phase serovar Typhimurium grown with or without 3% crude ox bile was added to cholesterol-coated Eppendorf tubes in the tube biofilm assay (TBA) or plastic 24-well plates (Fisher Scientific, Pittsburgh, PA) containing Chromerge-cleaned coverslips coated with cholesterol. Chromatography- grade cholesterol (product number C8667; Sigma, St. Louis, MO) was dissolved in anhydrous ether (J. T. Baker, Phillipsburg, NJ) at a concentration of 10 mg/ml or 25 mg/ml and delivered in 100 μl aliquots to siliconized Eppendorf tubes (Fisher Scientific,
Pittsburgh, PA) or coverslips, respectively. The ether was allowed to evaporate, consistently leaving a homogenous coating of cholesterol. Bacteria were incubated in tubes or plates on a Nutator shaker at room temperature for 6 days and washed every 24 hours with LB followed by addition of fresh LB meda (+/- bile). Bound samples were
122 fixed at 60°C for 1 hour and stained with 0.1% crystal violet (gentian violet in isopropanol-methanol-1 x PBS [1:1:18]) for 5 minutes at room temperature. The dye was extracted using 33% acetic acid, added to 96-well plates, and measured at optical density
570 nm to quantify biofilm formation.
4.3.8 Antibiotic challenge of biofilm and planktonic cells
Serovar Typhimurium biofilms were grown on cholesterol-coated Eppendorf tubes (TBA). Biofilm and planktonic cells were removed at day 6, diluted, and plated on
LB agar for enumeration. TBA assays were performed again, and equivalent amounts of biofilm and planktonic cells obtained from appropriate dilutions of the planktonic supernatant were incubated with 25 μg/ml ciprofloxacin, 25 μg/ml chloramphenicol, or
30% bile for 2, 4, or 6 hours. Samples were diluted and plated at these time points on LB agar to determine bacterial counts.
4.3.9 Neutrophil isolation and effect on established biofilms v. planktonic cells
Human neutrophils were obtained from heparinized venous blood of a healthy adult volunteer (in compliance with IRB protocols at OSU) by density gradient centrifugation as previously described (Pizza et al., 2001). Briefly, blood samples were diluted 1:1 in normal saline and centrifuged at 800 x g for 40 minutes over a Ficoll-
Hypaque (Amersham Biosciences, Pittsburgh, PA) density cushion to isolate peripheral blood mononuclear cells (PBMCs). Neutrophils were separated from the red blood cell pellet by sedimentation with 3% dextran, washed in calcium and magnesium free Hanks’ balanced salt solution (HBSS, Invitrogen, Carlsbad, CA), and centrifuged to enrich.
123 Residual red blood cells were lysed with distilled water, and neutrophils (2.82x107) were suspended in HBSS. The neutrophils were added to serovar Typhimurium biofilms grown on cholesterol-coated coverslips in 24-well plates or planktonic cells removed from each biofilm-containing well, and incubated for 30 or 60 minutes. Biofilms were quantified with crystal violet as described above and the number of planktonic cells was measured by optical density readings at 570 nm.
4.3.10 Statistical analysis
Statistical significance between groups was based on p values < 0.05 obtained from two-tailed Student’s t tests.
4.4 Results
4.4.1 Salmonella resistant mice form cholesterol gallstones
Serovar Typhimurium is a facultative intracellular pathogen that mediates a systemic, typhoid-fever like illness and rapid death in mouse strains lacking the macrophage-specific protein Nramp1 (for a review, see reference (Skamene et al., 1998)), but persists without symptoms in naturally resistant mice (Nramp1+/+) (Nauciel et al.,
1988). Recent experiments monitoring Salmonella infections in wild-type mice reported recovery of salmonellae from the gallbladders of asymptomatic animals at late time points post infection (P.I.) (Monack et al., 2004; Deng et al., 2008). The murine gallbladder has also been shown to carry diet-induced gallstones in certain inbred strains used to study cholesterol gallstone genetics and pathogenesis (Reihner and Stahlberg,
1996; Wittenburg et al., 2003). To determine whether strains resistant to serovar
124 Typhimurium infection could harbor gallbladder stones, female 129X1/SvJ mice were
fed a gallstone-inducing diet for 8 weeks. Consumption of the lithogenic diet (normal
mouse chow supplemented with 1% cholesterol and 0.5% cholic acid) induced
cholesterol gallstone formation in 25/30 gallbladders of 129sv mice (Fig. 4.1A), and
these materials could be surgically removed for further examination (Fig. 4.1B and C).
4.4.2 Cholesterol gallstones enhance Salmonella gallbladder colonization and fecal
shedding during persistent murine infections
We hypothesize that S. Typhi persistence in the gallbladders of asymptomatic human carriers is facilitated in large part by the formation of biofilms on cholesterol gallstones, and have previously demonstrated that S. enterica serovars Typhimurium,
Enteritidis, and Typhimurium formed bile-induced biofilms on human gallstones and cholesterol-coated surfaces in vitro (Prouty et al., 2002a; Crawford et al., 2008). To determine whether cholesterol gallbladder stones enhanced gallbladder colonization and carriage of salmonellae in vivo, 129X1/SvJ mice were fed a lithogenic diet or normal mouse chow for 8 weeks and inoculated intraperitoneally with 1.4x104 CFU serovar
Typhimurium or left as uninfected controls.
Similar spleen burdens between diet groups were observed at days 3, 7, and 21
P.I. (Fig. 4.2A), indicating that hypercholesterolemia did not impair general host
immunity during infection, unlike apolipoprotein E-deficient mice that exhibited high
susceptibility to Mycobacterium tuberculosis infections when fed a high cholesterol diet
(Martens et al., 2008). Over 106 CFU were recovered from the spleen 3 weeks P.I. (Fig.
2A) whereas no salmonellae were obtained in this organ from uninfected controls.
125 Biliary epithelial cells express mucin genes and secrete immunoglobulin proteins, and thus participate along with bile in both innate and adaptive immunity of the gastrointestinal tract (Maurer et al., 2009; Reynoso-Paz et al., 1999; Andrianifahanana et al., 2006). To investigate the prevalence of serovar Typhimurium within the gallbladder epithelium during persistent infections, gallbladder tissues were separated from luminal contents, homogenized, and plated to enumerate CFU. The number of salmonellae harbored in the gallbladder epithelium of mice with diet-induced cholesterol gallstones increased over time P.I., and was significantly higher than observed in mice without gallbladder stones at time points 3 (4-fold), 7 (12-fold), and 21 (541-fold) days P.I. (Fig.
4.2B). Gallbladder tissues from uninfected mice in both diet groups yielded no salmonellae.
The presence of gallstones also correlated with higher levels of serovar
Typhimurium recovered from gallbladder bile, and these amounts increased as the infection progressed (Fig. 4.3A). Conversely, the amounts of salmonellae detected in gallbladder bile of mice without cholesterol gallstones decreased over time P.I. and were lower than mice with gallstones at time points 3 (5-fold), 7 (24-fold), and 21 (5,300-fold) days (Fig. 4.3A). No bacteria were recovered from uninfected control mice. These results suggest that cholesterol gallstones enhance colonization and persistence of
Salmonella in gallbladder tissues and bile during systemic murine infections, possibly by providing a substrate for biofilm-mediated protection and stability against the host immune response.
To determine whether gallstones themselves supported serovar Typhimurium growth, gallbladder stones were removed, homogenized with a microspatula and vigorous
126 pipetting, diluted, and plated on LB agar. As shown in Fig. 4.3B, the association between salmonellae and cholesterol gallstones was robust, and the amount of salmonellae
recovered from gallstone material increased by over 2 logs from days 3 to 21 P.I.
Gallstones from uninfected mice were Salmonella-free. These results indicate that
salmonellae colonize gallbladder stones, likely developing a biofilm as has been
demonstrated in vitro (Prouty et al., 2002a; Crawford et al., 2008).
Individuals typically contract serovar Typhi by ingesting food or water
contaminated with excretions from typhoid carriers (Parry et al., 2002). It was
demonstrated previously that subsets of persistently infected 129sv mice shed high levels
of serovar Typhimurium in feces, and that these groups rapidly transmitted the infection
to naïve mice (Lawley et al., 2008). To determine whether cholesterol gallbladder stones
enhanced shedding of serovar Typhimurium, 129X1/SvJ mice from both diet groups were
isolated overnight in individual cages prior to sacrifice at day 21 and approximately 5 to
7 fresh fecal pellets were collected, weighed, and plated on SS agar to detect salmonellae
(Fig. 4.4A). Interestingly, mice harboring gallstones shed 3 logs more serovar
Typhimurium than infected mice on the control diet, whereas stools from uninfected
groups were Salmonella-free (Fig. 4.4B). Therefore, the observed association of
salmonellae with cholesterol gallstones and its elevated recovery from gallbladder tissue,
bile, and feces at late time points post infection suggest that the presence of diet-induced
gallstones in 129X1/SvJ mice mediates gallbladder colonization and enhanced shedding
following serovar Typhimurium infection, and could be used as a model of
asymptomatic typhoid carriage by humans.
127 4.4.3 Serovar Typhi forms biofilms on gallstones of asymptomatic carriers from Mexico
City
In 1982, Levine et al. demonstrated that serovar Typhi could be recovered in stool
samples for over 1 year from at least 2 to 5% of those suffering acute typhoid illnesses
(Levine et al., 1982). It is now understood that gallbladder stones are frequently present in asymptomatic carriers of serovar Typhi (Lai et al., 1992). To better define the
association between gallstones and typhoid carriage in an area endemic to typhoid fever,
individuals seeking surgical gallbladder removal due to gallstones (cholecystectomy) at
the Hospital Infantil in Mexico City (age range 21-92 yrs; mean = 44.3 yrs; 12
unreported) were analyzed for the asymptomatic presence of serovar Typhi during a study lasting 2 years. Multiplex PCR using genomic DNA purified from gallbladder
tissues, bile, gallstone sections, and stool samples revealed that 5/103 patients with
cholelithiasis (4.9%) tested positive for typhoid carriage, of which 3 were female (ages
52, 58, and 60) and 2 were male (ages 41 and 46). Colony forming units (CFU) for each
typhoid positive biological sample are depicted in Table 4.2. All 5 carriers were positive
for serovar Typhi in gallstone sections, 2 of which also harbored salmonellae in
gallbladder epithelial tissues. Only 1 carrier tested positive for serovar Typhi in bile, and
none were diagnosed by stool determinations. Additionally, the presence of Escherichia
coli was detected in 13 typhoid negative patients and Shigella flexneri was recovered
from 3 stool samples.
Gallstones from 4 of the 5 asymptomatic serovar Typhi carriers were sent to OSU
and examined by scanning electron microscopy (SEM) to determine whether typhoid
biofilms on gallstones contributed to chronic carriage. Interestingly, biofilms were
128 visualized with an estimated 80-95% surface coverage on 3/4 gallstones from typhoid
carriers. A representative sample is highlighted in Fig. 4.5 at various magnifications
(panels A-D), while specimens from the other typhoid positive patients are presented in
Fig. 4.6A and B. A single gallstone from this group lacked biofilm formation (Fig.
4.6C), an observation likely attributed to a variety of gallstone and patient specific factors
including the uniqueness in surface structure, smallness of the sample size, and the
possibility that the primary constituent of this stone was not cholesterol, but rather calcium bilirubin as indicated by its black color. We have demonstrated previously that
Eppendorf tubes coated with bilirubin supported significantly less biofilm than those
coated with cholesterol in vitro, suggesting that serovar Typhi may not form biofilms on
gallstones comprised of calcium bilirubinate in vivo (Crawford et al., 2008).
To determine if gallstone biofilm formation was mediated specifically by serovar
Typhi, gallstones from 6/13 E. coli positive patients were also sent to OSU and examined
by SEM. Of this group, 4 samples lacked biofilm formation, whereas small patches of
bacteria covering an estimated 5-20% of the surface were visualized on 2 others.
Additionally, no biofilm formation was observed on gallstones from a patient positive for
both E. coli and S. flexneri (Fig. 4.6D) or from patients free of culturable
enterobacteraciae. Table 4.2 provides a summary of biofilm formation and respective
tissue burden for patients in this study. These results suggest that bacterial biofilms on
gallstones of individuals presenting with cholelithiasis are mediated by serovar Typhi,
providing the first clinical evidence that gallstone biofilms facilitate asymptomatic
typhoid carriage.
129 4.4.4 Histology of infected gallbladder tissues
S. enterica serovars Typhimurium and Typhi mediate different clinical
manifestations in humans and, not surprisingly, distinct changes to intestinal pathology during infection (Raffatellu et al., 2006). Severe typhoid fever is marked by hypertrophy/ischaemia of intestinal tissue and necrosis or ulceration of the mesenteric lymph including Peyer’s patches (Everest et al., 2001), yet the histopathology of the gallbladder epithelium in response to infection remains unknown. To examine the amount of gallbladder inflammation/damage caused by Salmonella infections and/or the presence of gallstones, gallbladder tissues from infected and uninfected mice with or without cholesterol gallstones were collected at days 3, 7, and 21 P.I., fixed in formalin, embedded in paraffin, sectioned and mounted on slides, and stained with H&E.
Microscopic evaluation demonstrated that the presence of eosinophils, lymphocytes, and plasma cells was minimal or nonexistent at acute and persistent time points P.I. and did not vary with infection or gallstones, and that epithelial cells appeared normal (Fig. 4.7).
Any observed tissue mucosal hyperplasia or intralumenal crystals were not associated with infection, lithogenic diet, or time, but, rather, were artifacts of either instrumental crushing during removal, or hyalinosis, a condition affecting the nasal cavity, trachea, lung, esophagus, stomach, bile, pancreatic duct, and gallbladder of genetically engineered mice (2000).
Human gallbladder tissues from patients seeking cholecystectomy were rinsed in sterile saline, fixed in formalin, washed, and frozen in 30% sucrose in Mexico City, and processed for histological analysis at OSU. Microscopic examination revealed no pathological damage, including loss of epithelial folds, thickening of the mucosa, or
130 formation of debris, attributed to asymptomatic carriage of serovar Typhi (Fig. 4.8B) and
E. coli (Fig. 4.8C), or in individuals without culturable bacteria (Fig. 4.8A). Occasional
crush or cautery artifacts due to surgery were observed. Collectively, these results
suggest that gallbladder inflammation and associated histopathological alterations to
epithelial integrity are minimal during bacterial infection and gallstone formation, and
that this response does not change appreciably with time.
4.4.5 Serovar Typhi laboratory strains and clinical isolates demonstrate the same level of bile tolerance, and this resistance is independent of Vi antigen
Bile is known to affect virulence phenotypes including adhesion, antibiotic resistance, motility, and biofilm-related factors in many enterobacteraciae (Prouty and
Gunn, 2000; Prouty et al., 2004b; Crawford et al., 2008; Lin et al., 2005b; Sleator et al.,
2005; Torres et al., 2007; Chatterjee et al., 2007; Hung et al., 2006; Hung and Mekalanos,
2005; Whitfield and Roberts, 1999). Serovar Typhi strains express a polysaccharide capsule termed the Vi-antigen (Vi-ag) that is encoded by Salmonella pathogenicity island
(SPI) 7 (Parkhill et al., 2001). It has been demonstrated that Vi expression in vitro is influenced by culture conditions including osmolarity (Pickard et al., 1994) and that SPI7 can be lost upon laboratory passage (Nair et al., 2004).
Although Vi agglutination can be used to identify typhoid carriers (Bhatnagar,
1948), not all clinical isolates express Vi-ag (Losonsky et al., 1987). We hypothesize that the Vi-ag capsule may play a role in bile resistance and be differentially expressed by systemic and gallbladder serovar Typhi isolates compared with laboratory strains. To compare bile tolerance amongst laboratory and clinical isolates, minimal inhibitory
131 concentration (MIC) assays were performed by challenging strains overnight with 0.2 to
60% crude ox bile extract. Serovar Typhi blood and gallstone isolates shared a 1% MIC
value with laboratory strain Ty2, and this was far lower than observed for serovar
Typhimurium 14028s (10%, Table 4.3). Interestingly, serovar Typhi Vi-capsule mutants
constructed in the laboratory (tviB and rcsB) or obtained from 2 clinical isolates
(unpublished observation, Geoffrey Gonzalez) were more tolerant to bile (6%) than wild-
type Ty2 or clinical isolates. These results suggest that laboratory and patient serovar
Typhi strains demonstrate equal resistance to bile, and that Vi-capsule expression may
prevent tolerance to higher concentrations.
4.4.6 Cholesterol-bound serovar Typhimurium biofilms resist antibiotics but planktonic
cells are susceptible
In general, bacterial biofilms resist commonly administered antibiotics while the
viability of dispersed planktonic cells in such antimicrobials is drastically reduced
(Costerton et al., 1999). Here, serovar Typhimurium biofilms were grown on cholesterol- coated Eppendorf tubes in the TBA and equivalent amounts of biofilm and planktonic cells were challenged with 25 μg/ml ciprofloxacin, 25 μg/ml chloramphenicol, or 30%
bile for 2, 4, or 6 hours. Salmonellae embedded in biofilms resisted killing by all three
antimicrobial agents, whereas planktonic cells were highly susceptible. Ciprofloxacin, a
potent fluoroquinolone of clinical last resort, mediated a dramatic 2.5 log reduction in
planktonic salmonellae but did not affect biofilm bacteria (Fig. 4.9). Chloramphenicol
treatment reduced planktonic viability by 1.5 logs and a high concentration of bile
decreased growth of free-swimmers by nearly 1 log (Fig. 4.9). These results further
132 suggest a strong need for alternative treatment methods against biofilm-mediated persistent infections, particularly asymptomatic carriage facilitated by serovar Typhi biofilms on cholesterol gallstones.
4.4.7 Serovar Typhimurium biofilm bacteria, but not dispersed planktonic cells, are resistant to neutrophil-mediated killing
Human PMNs have been demonstrated in vitro to enhance biofilm formation by
Pseudomonas aeruginosa (Walker et al., 2005; Jesaitis et al., 2003) and be unable to kill or disperse Staphylococcus epidermidis biofilms (Kristian et al., 2008). To investigate the response of serovar Typhimurium biofilms on cholesterol to an important component of innate immunity, purified human neutrophils were added to biofilm bacteria and dispersed planktonic cells. These results are preliminary (performed once in triplicate), and suggest that free swimming cells are rapidly susceptible to neutrophil-mediated killing (30 and 60 minutes) whereas those in biofilms were resistant (Fig. 4.10).
Therefore, typhoid biofilms on gallstones may mediate, in part, resistance to the phagocytic array of toxic oxygen species, defensins, and other degrading enzymes associated with neutrophils, should this host defense cell type be present in the gallbladder during typhoid colonization and persistence.
4.5 Discussion
Bacterial biofilm infections develop on live and dead tissues and medical devices, are slow to produce overt symptoms, resist cellular and humoral immune host responses and antibiotic regimens, and persist for long periods of time with intermittent recurrence
133 of symptoms until the sessile community is surgically removed (for a review see reference (Costerton et al., 1999)). Biofilm formation is thought to characterize 65% of chronic infections treated by physicians (Schaechter, 1987) and has been observed directly in a variety of clinical manifestations including nontypable Haemophilus
influenzae (NTHI) mediated otitis media. NTHI has recently been shown to form
biofilms on respiratory epithelial cells and the chinchilla respiratory tract in vitro and in
vivo (Bakaletz et al., 2005; Jurcisek et al., 2007). The asymptomatic, chronic carrier state
of Salmonella enterica serovar Typhi occurs in the bile-rich gallbladder, is almost always
associated with the presence of cholesterol gallstones, and does not subside with
antibiotic treatment (Levine et al., 1982; Lai et al., 1992), yet the progression from
infection to persistence remains unknown. We hypothesize that gallbladder typhoid
carriage is frequently a result of biofilm formation on cholesterol gallstone surfaces and
have demonstrated that salmonellae form bile-induced biofilms on human gallstones and
cholesterol-coated surfaces in vitro (Prouty et al., 2002a; Crawford et al., 2008). In this
work, we develop a murine model of Salmonella persistence in naturally resistant mice
harboring cholesterol gallstones and present clinical evidence that biofilms occur on
gallstones from asymptomatic, human typhoid carriers.
Our understanding of S. Typhi pathogenesis and associated pathology during
typhoid fever has been inferred from infections of susceptible inbred mouse strains
lacking Nramp1 (BALB/c and C57BL/6) with non-typhoidal serovar Typhimurium
(Jones and Falkow, 1996; Galan and Curtiss, 1991). Naturally resistant Nramp+/+ mice
inoculated with serovar Typhimurium carried salmonellae asymptomatically in spleens
and gallbladders for long extensions of time (Nauciel et al., 1988; Monack et al., 2004).
134 Interestingly, gallbladder abnormalities are typically studied using a C57 variant that develops gallstones following 8 week consumption of a cholesterol-rich diet (Reihner and
Stahlberg, 1996; Wittenburg et al., 2003). Here, resistant 129X1/SvJ mice fed a lithogenic diet (normal chow supplemented with 1% cholesterol and 0.5% cholic acid) consistently formed gallstones that enhanced colonization and persistence of serovar
Typhimurium in gallbladder tissue and bile following intraperitoneal infection. The presence of this gallstone material associated with significant numbers of salmonellae that increased over time, and mediated a 3-log increase in fecal shedding compared with infected controls lacking gallstones. Equivalent numbers of serovar Typhimurium were recovered from spleens between groups with or without gallstones at all time points suggesting that, unlike observations in Mycobacterium tuberculosis (Martens et al.,
2008), hypercholesterolemia did not impair general host immunity during murine infection with salmonellae.
Taken together, these results indicate that persistently infected 129X1/SvJ mice harboring diet-induced cholesterol gallstones increased gallbladder colonization and thus have the potential to serve as a model for the study of typhoid carriage. Mutants of serovar Typhimurium in factors shown to be important for gallstone biofilm formation in vitro including flagellar filament and O-antigen capsule expression could be tested for effects on gallbladder persistence in vivo. Furthermore, treatments shown to resolve murine cholesterol gallstones such as beta-muricholic acid or fatty acid bile conjugates
(Wang and Tazuma, 2002; Leikin-Frenkel et al., 2008) could be added to mice carrying salmonellae to examine how the dissolution of stones impacts gallbladder carriage.
135 An estimated 25% of asymptomatic carriers have no history of typhoid fever and
shedding is known to be sporadic (Parry et al., 2002), making the chronic carrier state
difficult to confirm and an understudied aspect of global human health. It has been
shown that typhoid carriage accelerates person-to-person transmission, is almost always associated with abnormalities of the gallbladder, including gallstones, and represents the
largest risk factor for cancer of this organ (Dutta et al., 2000; Kumar et al., 2006; Lai et al., 1992). To better understand the association between gallstones and the chronic carrier state, individuals seeking cholecystectomy in an area endemic to typhoid fever were analyzed for the asymptomatic presence of serovar Typhi. Approximately 5% of this population was shown to be positive for typhoid in gallbladder tissue, bile, or gallstone sections analyzed by multiplex PCR. Interestingly, 3 of 4 gallstones from serovar Typhi positive patients visualized by SEM showed bacterial biofilms completely covering the surface. The negative sample was black pigmented and had a unique surface composition, suggesting that the main constituent of this gallstone was calcium bilirubinate, a substrate shown in vitro to support significantly less Salmonella biofilm formation than cholesterol (Crawford et al., 2008).
Gallstones from patients positive for E. coli were also analyzed by SEM and shown to be biofilm negative, although 2 of the 6 samples had small patches of bacteria on approximately 5-20% of the surface. Additionally, no biofilm formation was detected on gallstones from an E. coli and S. flexneri double positive individual or gallbladders free of bacteria, suggesting that, of those culturable bacteria, biofilm formation on gallstones is mediated specifically by serovar Typhi.
136 The human intestine is a dynamic organ that regulates nutrient and ion transport and acts as a critical mucosal immune barrier distinguishing the commensal microflora from enteric pathogens (Lippolis, 2008). Human enterocolitis induces massive neutrophilia whereas typhoid fever is characterized by mononuclear infiltrate, suggesting that the intestine employs separate response arsenals of pathogen recognition receptors
(PRRs) and cytokines depending on the pathogen-associated molecular patterns (PAMPs)
(for a review, see references (Tukel et al., 2006; Harris et al., 1972)). Interestingly, histopathological examination of H&E stained sections from human and mouse single cell-layered gallbladder epithelium samples did not reveal tissue damage or inflammatory mediators resulting from exposure to gallstones and/or acute or persistent bacterial infections.
Successful host colonization by enteric pathogens requires resistance to the detergent-like activity of bile salts. The mechanisms mediating bile tolerance are beginning to be elucidated, such as the Acr and Emr efflux pumps in E. coli (Thanassi et al., 1997), ToxR and ToxT regulated genes, and Vex efflux systems in Vibrio cholerae
(Provenzano et al., 2000; Schuhmacher and Klose, 1999; Bina et al., 2006; Chatterjee et al., 2007), and the PhoP-PhoQ two-component regulatory system, Tol and MarRAB operons, Acr efflux pump, enterobacterial common antigen, and DNA adenine methylase activity in S. enterica serovars Typhimurium and Typhi (van Velkinburgh and Gunn,
1999; Prouty et al., 2002b; Prouty et al., 2004a; Ramos-Morales et al., 2003; Heithoff et al., 2001; Prieto et al., 2004). The SPI7 locus of serovar Typhi encodes expression of the
Vi-capsule antigen, is genetically unstable and can be lost upon laboratory passage, and is absent from the serovar Typhimurium chromosome altogether (Nair et al., 2004). The
137 Vi-capsule has been shown to prevent Toll-like receptor 4 recognition (Wilson et al.,
2008), and its loss in serovar Typhi isolates increased TNF-α production or IL-8 secretion production in macrophage or epithelial cell lines, respectively (Hirose et al., 1997;
Sharma and Qadri, 2004). Vi agglutination from blood and bone marrow samples has long been used as a method of identifying typhoid carriers (Bhatnagar, 1948), yet not all clinical isolates express Vi-antigen and patients recovering from acute typhoid infections have low titres of serum IgG antibodies to Vi antigens (Losonsky et al., 1987). To compare resistance of laboratory and clinical isolates as well as Vi-antigen mutants, MIC assays were performed with crude ox bile extract at concentrations from 0.2 to 60%.
Blood and gallstone isolates tolerated bile at the same levels as laboratory strain Ty2 whereas Vi mutants resisted bile at higher levels similar to serovar Typhimurium, suggesting that Vi-capsule expression may be inhibitory to bile resistance. We have demonstrated previously that Vi polysaccharides are not necessary for biofilm formation on gallstones in vitro (Prouty and Gunn, 2003). During typhoid carriage in the gallbladder, it is possible that Vi expression is lower than in other systemic sites to facilitate bile-induced gallstone biofilms. This hypothesis is purely speculative and needs investigation.
As mentioned above, bacterial biofilms resist commonly administered antibiotics and as a result are frequently implicated in persistent infections (Stewart and
Costerton, 2001; Costerton et al., 1999). Bacteria dispersed from the biofilm microenvironment quickly regain susceptibility to those antibiotics, suggesting that biofilm-mediated resistance is not acquired through mutations or horizontal transfer of genes (Stewart and Costerton, 2001; Anwar et al., 1989; Williams et al., 1997).
138 Interestingly, established mechanisms of resistance including efflux pumps and the multiple antibiotic resistance (mar) locus of E. coli did not provide protection to bacteria
in biofilms (Williams et al., 1997; Maira-Litran et al., 2000). In this study we grew
serovar Typhimurium biofilms on cholesterol and challenged an equivalent amount of
biofilm-embedded bacteria and planktonic cells with 25 μg/ml ciprofloxacin, 25 μg/ml
chloramphenicol, or 30% bile for 2, 4, or 6 hours. The results from these experiments
support a protective role for biofilm formation, showing that salmonellae encased in
biofilms tolerate high concentrations of antimicrobials whereas planktonic cells are
highly susceptible. Thus, there is a strong need for alternative treatment methods against
biofilm-mediated persistent infections.
Biliary epithelial cells express mucin genes and secrete immunoglobulin proteins
and a variety of cytokines during innate and adaptive immunity of the gastrointestinal
tract (Maurer et al., 2009; Reynoso-Paz et al., 1999; Andrianifahanana et al., 2006), yet
gallbladder biology and the associated immune response in typhoid carriage, particularly in those patients with gallstones biofilms, remain unknown. Biofilm formation by P. aeruginosa has been hypothesized to mediate colonization and antibiotic resistance in the context of cystic fibrosis, a lung disease that features persistent airway neutrophil accumulation. Interestingly, human neutrophils were shown in vitro to enhance P. aeruginosa biofilm development and even settle on the mature biofilm to become phagocytically engorged, degranulated, immobilized, and rounded during compromised host defense (Walker et al., 2005; Jesaitis et al., 2003). Similarly, S. epidermidis biofilm formation mediates a protective response in vitro against complement deposition and neutrophil-dependent killing (Kristian et al., 2008). Preliminary experiments reported
139 here suggest that serovar Typhimurium bacteria in cholesterol-bound biofilms resist neutrophil-mediated killing mechanisms but planktonic cells are susceptible.
We have developed a murine model of cholesterol gallstone-mediated typhoid
carrier state, and provided the first clinical evidence that typhoid biofilms on gallstones
may facilitate bacterial persistence in the hostile gallbladder during chronic carriage. We
also demonstrated that biofilm-embedded bacteria are more resistant than dispersed
planktonic cells to high concentrations of antimicrobials and innate immune mediators.
These new observations and model system provide a better understanding of the typhoid
carrier state and an important alternative, therapeutic target for alleviating asymptomatic
gallbladder carriage of S. Typhi and human-to-human transmission.
140 Strain Characteristic(s) Source or reference S. Typhimurium JSG210 ATCC 14208s (CDC6516-60); wild-type ATCC
S. Typhi JSG691 Blood isolate, San Antonio, TX Univ. Hospital, J. Jorgensen JSG698 Ty2; wild-type ATCC JSG791 Clinical isolate, Mexico City U.N.A.M., C. Alpuche-Aranda JSG792 Clinical isolate, Mexico City U.N.A.M., C. Alpuche-Aranda JSG1213 Ty2; tviB::Kan Popoff laboratory JSG1214 Ty2; rcsB::Kan Popoff laboratory JSG3074 Gallstone isolate, Mexico City U.N.A.M., C. Alpuche-Aranda JSG3075 Gallstone isolate, Mexico City U.N.A.M., C. Alpuche-Aranda JSG3076 Gallbladder tissue isolate, Mexico City U.N.A.M., C. Alpuche-Aranda
Table 4.1: Bacterial strains and relevant characteristics
141 No. GB Tissue Bile Gallstones Biofilm 1 S. Typhi 1.2x103 CFU/ml No Growth S. Typhi 1.4x103 CFU/ml ++ 2 No Growth No Growth S. Typhi 80 CFU/ml ++ 3 S. Typhi 20 CFU/ml S. Typhi 20 CFU/ml S. Typhi 40 CFU/ml ++ 4 No Growth No Growth S. Typhi 20 CFU/ml - 5 E. coli 5x105 CFU/ml E. coli 3x105 CFU/ml E. coli 4.5x105 CFU/ml + 6 E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml + 7 E. coli 3x104 CFU/ml E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml - 8 E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml - 9 E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml E. coli 1x105 CFU/ml - 10c E. coli 3.6x105 CFU/ml E. coli 5x105 CFU/ml E. coli 3x105 CFU/ml -
Table 4.2: Gallstone biofilm formationa and bacterial burdenb in patient samples. aGallstones from patients seeking cholecystectomy in Mexico City were visualized by SEM for the presence of bacterial biofilms. ++, robust biofilm formation covering an estimated 80-95% of gallstone surface; +, little biofilm present (covering approximately 5-20% gallstone surface); -, absence of biofilm formation on gallstone surface. b Bacteria recovered from the gallbladder tissues, bile, and gallstone sections in patients with gallstones were plated for CFU and identified using multiplex PCR as described in materials and methods.
142 Strain Description MICa JSG210 S. Typhimurium wild-type 14028s (ATCC) 10 JSG791 S. Typhi clinical isolate (Vi-ag negative) 6 JSG792 S. Typhi clinical isolate (Vi-ag negative) 6 JSG1213 S. Typhi Ty2 tviB::Kan 6 JSG1214 S. Typhi Ty2 rcsB::Kan 6 JSG691 S. Typhi blood isolate 1 JSG698 S. Typhi wild-type Ty2 (ATCC) 1 JSG3074 S. Typhi gallstone isolate 1 JSG3075 S. Typhi gallstone isolate 1 JSG3076 S. Typhi blood isolate 1
Table 4.3: Bile MICs for clinical isolates and laboratory strains of serovar Typhi from a representative independent experiment done in triplicate (n = 3). aPresented as percentage of crude ox bile extract
143 A. B.
C.
Gallstones Gallbladder
Figure 4.1: Effects of an 8 week lithogenic diet (mouse chow supplemented with 1% cholesterol and 0.5% cholic acid) in mice naturally resistant to serovar Typhimurium infections (n = 30, 2 independent experiments). (A) Cholesterol diet-induced gallstones in the gallbladder of Nramp1+/+ 129X1/SvJ mice. (B) Gallbladder stones removed and pictured with a 25-gage needle for scale. (C) Placement of gallstone material in 1.7 ml Eppendorf tubes with 1 x PBS prior to homogenization.
144 1.00E+07
1.00E+06 CFU
1.00E+05 3 7 21 123
No Diet, Infection Diet, Infection
1.00E+06 * 1.00E+05
1.00E+04
1.00E+03 CFU 1.00E+02
1.00E+01
1.00E+00 3 7 21 123 Days Post Infection
No Diet, Infection Diet, Infection
Figure 4.2: CFU enumerations (mg/ml) from organs of 129X1/SvJ mice fed normal chow or lithogenic diet at days 3, 7, and 21 post intraperitoneal infections with 1.4x104 serovar Typhimurium 14028s (n = 42, 21 mice for each diet group, 7 per time point; 2 individual experiments; means + SD are given). (A) Intake of excessive dietary cholesterol did not enhance general infection or spleen burden at any time point. (B) The presence of gallstones significantly increased the amount of salmonellae recovered from gallbladder tissues at late time points compared with diet control during persistent murine infections. *, statistical significance (P < 0.01) based on a two-tailed Student t test.
145
A 1.00E+07 * 1.00E+06 * 1.00E+05
1.00E+04
CFU 1.00E+03
1.00E+02
1.00E+01
1.00E+00 3 7 21 123 Days Post Infection
No Diet, Infection Diet, Infection
1.00E+07 B * 1.00E+06
1.00E+05
1.00E+04
CFU 1.00E+03
1.00E+02
1.00E+01
1.00E+00 3 7 21 123 Days Post Infection
Figure 4.3: Cholesterol gallstones harbor salmonellae and increase the recovery of serovar Typhimurium from bile of persistently infected 129X1/SvJ mice (presented are means + SD for 2 independent experiments; n = 42; 21 mice per diet group, 7 for each time point). (A) CFU from gallbladder bile increases significantly with time post infection in mice fed a lithogenic diet for 8 weeks compared to infected mice fed normal chow. (B) Salmonellae were recovered from homogenized gallstones, and CFU values increased over time post infection. *, statistical significance (P < 0.01) based on a two- tailed Student t test.
146 A B 1.0E+05
1.0E+04
1.0E+03
CFU/mg 1.0E+02 *
1.0E+01
1.0E+00 Diet, Infection No Diet, Infection 12 Day 21 Post Infection
Figure 4.4: Serovar Typhimurium is shed in fecal matter from infected 129X1/SvJ mice. (A) Approximately 5 to 7 fresh stool pellets were collected from mice belonging to both diet groups 3 weeks post infection, weighed, homogenized, and plated on SS agar. Salmonellae are indicated by colorless colonies with black centers. (B) Mice harboring cholesterol gallstones shed 3 logs more serovar Typhimurium than those on a normal chow diet. Means + SD are given for 2 independent experiments using 7 infected animals per diet group. *, statistical significance (P < 0.01) based on a two-tailed Student t test.
147 A B
C D
Figure 4.5: Gallbladder stones from an asymptomatic typhoid carrier in Mexico City support biofilm formation. SEM micrographs show serovar Typhi bacilli embedded in biofilms on the surfaces of gallstones at magnifications of 1,500x (A), 2,000x (B), 2,400x (C), and 16,000x (D).
148 A. B.
C. D.
Figure 4.6: Biofilm formation on human gallstones was observed only in patients seeking cholecystectomy at the Hospital Infantil positive for typhoid carriage. SEM micrographs show bacterial biofilms on gallstones of 2 asymptomatic typhoid carriers in panels A and B. (C) Biofilm formation was not detected on gallstone fragments from a single serovar Typhi carrier. The unique surface texture and pigment were suggestive of black, calcium bilirubinate gallstones. (D) Absence of biofilm formation on gallbladder stones from a patient positive for E. coli and S. flexneri.
149 A
B
C
Figure 4.7: Gallbladder tissues stained by hematoxylin and eosin (H&E) from human patients seeking cholecystectomy in Mexico City. After surgical removal, samples were rinsed in sterile saline, fixed in 10% buffered formalin, washed, placed in 30% sucrose, and frozen at -70°C, and shipped to OSU. Tissues were embedded in paraffin blocks, mounted on slides in 4 μm thick sections, and stained with H&E for pathologic examination. (A) Tissue from patient with no culturable bacteria (n = 4). (B) Representative section from individual carrying serovar Typhi (n = 5). (C) Tissue from patient harboring E. coli (n = 9).
150 Day 0 Day 3 Day 7 Day 21
No Infection
Infection
Figure 4.8: Representative H&E stained gallbladder sections from mice with gallstones at days 3, 7, and 21 post infection from 2 independent experiments. Mice gallbladders (n = 2 per time point) were removed immediately post sacrifice, rinsed aseptically in saline, and fixed in 10% neutral buffered formalin for 72 hours. Samples were paraffin- embedded, sectioned to a thickness of 4 μm, and observed for histopatholigical changes compared with uninfected controls.
151
1.00E+09 Biofilm, No Antibiotic
Biofilm, Cipro 1.00E+08 Biofilm, Bile
U Biofilm, Cam
CF Planktonic, No antibiotic
1.00E+07 Planktonic, Cipro Planktonic, Bile Planktonic, Cam
1.00E+06
0246 Hours
Figure 4.9: Serovar Typhimurium biofilms grown on cholesterol-coated Eppendorf tubes resist antibiotics but planktonic cells are susceptible. Equivalent amounts of Salmonella biofilm bacteria and dispersed planktonic cells from a 6 day TBA were challenged with 25 μg/ml ciprofloxacin, 25 μg/ml chloramphenicol, or 30% bile for 2, 4, or 6 hours. The viability of planktonic cells decreased by nearly 2.5, 1.5, and 1 logs, after incubation with ciprofloxacin, chloramphenicol, and bile, respectively whereas biofilm cells were unaffected. Shown are mean values from 3 independent experiments.
152 1.6
1.4
1.2 Planktonic 1 Planktonic + PMN 0.8 Biofilm OD570 0.6 Biofilm + PM N
0.4
0.2 0 0 30 60 123 Minutes
Figure 4.10: Biofilm embedded serovar Typhimurium resist neutrophil-mediated killing but dispersed planktonic cells are significantly susceptible. Human neutrophils were purified and added to serovar Typhimurium biofilms grown on cholesterol-coated coverslips in 24-well plates or planktonic cells removed from each biofilm-containing well, and incubated for 30 or 60 minutes. Planktonic cells and crystal violet stained biofilms were quantified by measuring optical density at 570 nm. Data are preliminary, and represent a single experiment performed in triplicate.
153
Chapter 5
General Discussion
The ubiquitous existence of microorganisms in natural reservoirs has shaped the evolutionary dynamics of planet Earth. As a result, microbial pathogens have induced diseases in humans and animals on every continent and in every century throughout history. One such manifestation, typhoid fever, causes greater than 22 million illnesses and 600,000 deaths world-wide each year, with particular concentration in impoverished, endemic societies (Butler et al., 1978; Crump et al., 2004). S. enterica serovar Typhi, a gram-negative bacterium exquisitely adapted to induce disease strictly in humans, was first cultured in 1884 and is the etiologic agent of typhoid fever. Person-to-person spread of serovar Typhi occurs via the fecal-oral route and is enhanced by its low infectious dose.
The introduction of multi-drug resistant strains is making typhoid fever management particularly problematic (Bhan et al., 2005). Antibiotics are also influencing the clonal expansion of serovar Typhi. Nalidixic acid and fluoroquinolone resistant variants that are prevalent in southeastern Asia originated in the early 1990s, migrated to Africa, and were shown to be phylogenetically different than the H58 parent
(Roumagnac et al., 2006). Despite these recent shifts, the overall population structure of
154 serovar Typhi remains without large disruptions and is thus indicative of neutral evolution (Roumagnac et al., 2006). Divergence and differentiation resulting from
geographic isolation, clonal replacement, selective sweeps, and population bottlenecks is
evident in the genomes of monomorphic pathogens including Mycobacterium
tuberculosis and Yersinia pestis, but not serovar Typhi (Roumagnac et al., 2006). All
typhoid haplotypes descended from the H45 strain before the Neolithic period and are
thought to maintain neutral evolution and genetic buffering by existence in an
asymptomatic, chronic carrier state (Roumagnac et al., 2006). Subsequent outbreaks or
infections may provide a vehicle for intercontinental transmission and a global
distribution of carriers for multiple haplotypes (Roumagnac et al., 2006), making
surveillance of the carrier state an important public health initiative.
Serovar Typhi persists asymptomatically in the gallbladder of approximately 3-
5% of patients suffering from typhoid fever and is shed in feces long after overt symptoms subside (Levine et al., 1982). This percentage is low, but even a single typhoid carrier exacerbates transmission in endemic areas and has a multiplicative effect.
The idea of healthy carriers in the epidemiology of typhoid fever was first championed by
Robert Koch in 1902 (Mortimer, 1999), long before the implementation of the science of bacteriology and its associated advances to the practice of medicine. Although the most notorious contemporary carrier has come to be Typhoid Mary, Mr. N the milker initiated more outbreaks during the same time period in Folkestone, England (Mortimer, 1999).
Historically, development of chronic typhoid carriage is linked to the presence of gallbladder stones (Lai et al., 1992). Gallstone formation (cholelithogenesis) was first described in 1507, observed in mummified Egyptians, and typically induced by
155 cholesterol supersaturation from bile (Maurer et al., 2009; Portincasa et al., 2006).
World-wide, the primary constituent of gallbladder stones is cholesterol whereas only
10% are calcified (Portincasa et al., 2006). To date, removal of the gallbladder
(cholecystectomy) remains the most effective treatment option for these individuals.
In patients carrying both S. Typhi and cholesterol gallstones in the gallbladder, clinically administered antibiotics are typically ineffective against dissolution of the persistent bacterial infection (Lai et al., 1992). Chronic typhoid carriers with gallstones also experience an 8.47-fold-higher risk for developing hepatobiliary diseases, including carcinoma of the gallbladder (Dutta et al., 2000; Kumar et al., 2006; Surette and Bassler,
1999). In 1994, Caygill et al. demonstrated that gallbladder cancers were associated with long-term typhoid carriage, but not acute infections (Caygill et al., 1994). It is possible that persistent expression of bacterial endotoxin or sustained, low levels of inflammation and epithelial tissue damage due to the formation and presence of gallstones and the acute stage of infection may be carcinogenic.
We hypothesize that biofilm formation on cholesterol gallstones facilitates colonization and persistence of serovar Typhi in the bile-rich gallbladder. Bacterial biofilms are increasingly associated with medical and industrial ecosystems and have been implicated as the cause of many antibiotic resistant, persistent infections in humans
(Stewart and Costerton, 2001; Costerton et al., 1999). Biofilm formation is characterized by adherence of bacteria to a surface, growth and recruitment, development of a protective extracellular (ECM) matrix, and release of planktonic cells from this sessile community into the environment (Costerton et al., 1995). Similarly, shedding of S. Typhi from asymptomatic, chronic carriers is thought to account for much of the person-to-
156 person transmission of typhoid fever in impoverished societies, and we have demonstrated that bile is required for mature biofilm formation with characteristic ECM
production of S. enterica serovars Typhimurium and Typhi on human gallstones in vitro
(Prouty et al., 2002a; Prouty and Gunn, 2003).
The work in this dissertation sought to advance this seminal observation through
the following aims: determine the critical genes mediating bile-induced adherence specifically to cholesterol surfaces during the initiation of biofilm formation (early events); identify bile-mediated factors of the extracellular matrix (ECM) of biofilms specifically on gallstones/cholesterol surfaces (late events); evaluate the role of gallstone biofilms in a human population of typhoid carriers, and develop a model of chronic
Salmonella gallbladder carriage in mice with gallstones.
We show that the flagellar filament of serovar Typhimurium is necessary for and specific toward cholesterol binding during the initiation of biofilm formation, and that the
FliC subunit is uniquely required. Salmonella flagella subunits FliC (phase 1) and FljB
(phase 2) control directional motility and are alternately expressed in a process called phase variation (Bonifield and Hughes, 2003). Recent experiments suggested that a luxS serovar Typhimurium mutant strain polarized flagellar phase variation toward the more immunogenic phase 1 flagellin independently of quorum sensing (Karavolos et al., 2008).
Quorum sensing is a process of cell-cell communication in bacteria that involves production and detection of signaling molecules (autoinducers (AIs)) and has been hypothesized to play a role in biofilm formation (reviewed in (von Bodman et al., 2008)).
Interestingly, a serovar Typhimurium luxS mutant unable to produce AI-2 did not affect biofilm formation on cholesterol-coated tubes in the TBA (data not shown). This
157 observation suggests that Salmonella biofilm formation does not involve quorum sensing,
or, alternatively, that flagella locked in phase 1 (FliC) mediated binding to cholesterol
and subsequent biofilm development in the luxS mutant. S. Typhi is monophasic,
harboring only the fliC gene (Baker et al., 2007), and FliC expression was anatomically
restricted to certain tissues during systemic serovar Typhimurium mouse infections
(Cummings et al., 2006). It is possible that control of FliC expression in serovar Typhi
during human infection is an evolutionarily adapted mechanism mediating binding to
cholesterol gallstones and biofilm formation, thus facilitating typhoid gallbladder
colonization and persistence in chronic carriers.
The majority of colonies (18/49) affecting serovar Typhimurium adherence to
cholesterol carried transposon insertions in fimW, an inhibitor of type 1 fimbriae
production. Mutations in fimW exhibit a four-to eightfold increase in fimbrial expression
(Tinker et al., 2001) compared with parent strains, suggesting that a hyperfimbriate
phenotype may inhibit binding to and biofilm formation on cholesterol surfaces. FimW
was recently shown to downregulate expression of FimY, a putative regulatory protein
that activates transcription of type 1 fimbriae by direct binding to the FimA promoter
(Saini et al., 2009). Interestingly, FimY interacts with and enhances expression of FimZ,
a molecular switch in serovar Typhimurium that positively regulates production of
fimbriae by activating the fimA promoter, and negatively impacts SPI-1 mediated
invasion by upregulation of hilE, a known repressor (Saini et al., 2009). It has also been
demonstrated that tetracycline-mediated overexpression of FimZ decreased flagellar
antigen production and, in turn, motility (Clegg and Hughes, 2002). However, transmission electron micrographs revealed the presence of intact flagellar filaments in
158 these strains and it is unknown whether FimZ binds to the FlhDC master operon promoter
(Clegg and Hughes, 2002), suggesting that a direct link between FimZ and motility
remains unconfirmed.
Fimbriae are attributed, in part, to aiding serovar Typhimurium biofilm formation
on HEp-2 tissue culture cells and the intestinal epithelium of mice and chickens
(Boddicker et al., 2002; Ledeboer and Jones, 2005; Baumler et al., 1996). In studies by
Prouty et al. and unpublished data here, a serovar Typhimurium SR11 strain containing
mutations in four fimbrial operons was observed to adhere and form biofilms on
cholesterol gallstones and cholesterol-coated Eppendorf tubes in a manner similar to
wild-type serovar Typhimurium (Prouty et al., 2002a). These data suggest that fimbriae
encoded by the fim, agf, lpf, and pef operons do not drastically affect biofilms on cholesterol-coated surfaces. Therefore, regulation of serovar Typhimurium fimbrial expression is a complex process that may be dictated by the extracellular milieu (both
time and space) and have overlapping effects on other virulence phenotypes including
flagella production, invasion, and biofilm formation. Transcriptional alterations of
singular genes in these cascades may not always show predicted phenotypic variations due to functional redundancies, regulation by other genes, or post-translational
modifications.
A high number of colonies with transposon insertions in ompC were also
demonstrated to affect binding of serovar Typhimurium to cholesterol. The OmpC porin
is regulated by osmolarity, permits passive diffusion of nutrients and antibiotics between
the extra- and intra-cellular environments, and mediates both intestinal colonization of
serovar Typhimurium in chickens and adherence of serovar Typhimurium to
159 macrophages (Puente et al., 1991; Methner et al., 2004; Negm and Pistole, 1999).
Bacteria within biofilms are thought to encounter higher osmolarity than in the liquid phase (Prigent-Combaret et al., 1999), and preliminary experiments performed in our laboratory indicate that loss of OmpC causes a significant decrease in serovar
Typhimurium biofilm formation in conditions of high osmolarity (3% bile, LB + 0.3 M
NaCl) but leads to increased biofilm growth compared to the wild-type strain in low media osmolarity (LB + 0.05 M NaCl) (data not shown). These results suggest that
OmpC is necessary for binding and biofilm formation in the presence of bile, possibly by mediating electrostatic interactions between salmonellae and the cholesterol surface, promoting overall biofilm health as a nutrient channel, or regulating cell-cell interactions as is the case in E. coli biofilms. Interestingly, internal glucose stores did not enhance biofilm formation by exponentially growing cultures of S. enteritidis, whereas OmpC mediated intake of environmental glucose was a critical component (Bonafonte et al.,
2000). Similarly, OmpC expression may be needed to allow sensing and internalization of bile salts that positively regulate gene transcription involved in Salmonella biofilm formation on cholesterol surfaces and gallstones.
Our results also suggest that chemotaxis is necessary for biofilm formation on cholesterol in the presence of bile, whereas swimming motility and fimbrial expression are dispensable. Bacterial flagellar filament, motility, and chemotaxis have been implicated in biofilm formation for a variety of enterobacteraciae including P. aeruginosa
(O'Toole and Kolter, 1998b; Watnick et al., 2001) and E. coli (Pratt and Kolter, 1998;
Prigent-Combaret et al., 2000). We also demonstrate that swarming, a specialized form of surface movement and colonization unrelated to swimming (Wang et al., 2004), is
160 important for adherence to cholesterol surfaces and that flagella are not needed during late events of biofilm formation. Therefore, the involvement of flagella during bile- mediated biofilm formation appears to be highly regulated and stage specific, and may occur in the following manner. Initially, planktonic cells growing in bile use chemotactic behavior (enhanced tumbling) rather than traditional swimming motility to locate and approach cholesterol surfaces, and swarming to evaluate substrate fitness. Subsequent adherence to cholesterol is mediated by the flagellar filament subunit FliC in combination with other factors including OmpC, but can be inhibited by overexpression of fimbriae.
Late stages of biofilm formation require ECM production independently of flagella, as a flagellar mutant was unaffected for biofilm formation when added to a layer of fixed bacteria. Lack of a flagellum induced exopolysaccharide (EPS) expression and biofilm formation in V. cholerae (Lauriano et al., 2004). Therefore, temporal regulation of flagella may serve as an important signal required for early biofilm events (attachment), but downregulated during late biofilm events (ECM production).
The work presented here also identified a bile-induced EPS, the O-antigen (O-ag) capsule, required for biofilm formation specifically on gallstone and cholesterol-coated surfaces. The O-ag capsule, characterized in the laboratory of William Kay, is conserved amongst salmonellae, similar in structure to the O-ag of LPS, and encoded by two divergent operons (yihU-yshA and yihV-yihW) (Gibson et al., 2006). Despite having similar repeating sugar units, the O-ag capsule and the LPS O-ag differ in size, charge, substitution patterns, and immunoreactivity (White et al., 2003). In addition, this capsule is linked to the membrane via a lipid anchor. O-ag capsule expression was found to be necessary for serovar Enteritidis biofilm formation leading to enhanced plant colonization
161 (Barak et al., 2007). Gibson and colleagues showed that AgfD, an important regulatory
factor of biofilm formation (Brombacher et al., 2003; Romling et al., 1998), controls
expression of the yih operons (Gibson et al., 2006). However, loss of AgfD had no effect
on biofilm formation in the TBA. Furthermore, real-time PCR revealed that bile
upregulated transcription of the yih operon in an agfD-independent manner, suggesting
that another bile-responsive transcription factor is involved in yih gene expression.
Production of the O-ag capsule is encoded by two divergent operons, yihU-yshA and yihVW, yet little is known about the regulation of these genes during assembly and translocation. Serovar Typhimurium strains carrying lacZ reporter fusions to O-ag capsule promoters could be randomly mutagenized using a pool of Tn10d-Tet transposons to characterize bile-mediated transcription of genes in these operons.
Recent work in P. aeruginosa has investigated stage-specific factors including twitching motility, cell-to-cell signaling, stationary phase sigma factor expression, and polysaccharide synthesis locus (PSL) activity that contribute to biofilm development in flow cell systems using statistical analysis and direct visualization (Heydorn et al., 2002).
To determine the temporal involvement of the O-ag capsule, biofilm formation on cholesterol surfaces could be similarly monitored using a flow cell apparatus (Ma et al.,
2009). At various time points, biofilms from GFP-labeled wild-type, yihO mutant, and yihO overexpressing strains would be examined for O-ag capsule production using specific primary antibody and a fluorescein-conjugated secondary under confocal laser or immunofluorescence microscopy. Alternatively, O-ag expression could be controlled in space and time by an arabinose-inducible promoter in a mutant background during
162 biofilm formation in the static TBA. Crystal violet staining of biofilms over time could determine when O-ag production is necessary.
Interestingly, much of what is known about the systemic pathogenesis and associated pathology of S. Typhi during typhoid fever has been extrapolated from infections of inbred mouse strains lacking Nramp1 (BALB/c and C57BL/6) with non- typhoidal serovar Typhimurium. Nramp1 is a macrophage transmembrane protein hypothesized to affect transport of cations (Skamene et al., 1998). In this model, bacterial mediated endocytosis at microfold (M) cells in the intestinal epithelium is followed by interaction with phagocytic cells of the underlying lymphoid tissue, a primary bacteraemia in the blood, and uncontrolled replication within macrophages of the liver, spleen, and bone marrow leading to death at 7 to 10 days post infection (Jepson and
Clark, 2001; Jones and Falkow, 1996; Galan and Curtiss, 1991; Richter-Dahlfors et al.,
1997; Salcedo et al., 2001).
Recent experiments monitoring Salmonella infections in wild-type 129X1/SvJ
(Nramp+/+) mice reported recovery of salmonellae from the gallbladders of asymptomatic
animals at late time points post infection (Monack et al., 2004; Deng et al., 2008). The
murine gallbladder has also been shown to carry gallstones following an 8 week
lithogenic diet (normal chow supplemented with 1% cholesterol and 0.5% cholic acid) in
a C57 inbred variant strain (Reihner and Stahlberg, 1996; Wittenburg et al., 2003). Here,
resistant 129X1/SvJ mice fed a lithogenic diet consistently formed gallstones and, as a
result, demonstrated enhanced colonization of gallbladder tissue and bile as well as fecal
shedding during persistent serovar Typhimurium infection. Equivalent numbers of
serovar Typhimurium were recovered from spleens between groups with or without
163 gallstones at all time points suggesting that, unlike observations in Mycobacterium tuberculosis (Martens et al., 2008), hypercholesterolemia did not impair general host immunity during murine infection with salmonellae. Cholesterol gallbladder stones were shown to associate with significant amounts of salmonellae that increased with time post infection. Furthermore, the amount of serovar Typhimurium recovered at 3 weeks post infection from fecal pellets of mice with gallstones was significantly higher than observed for mice on the control diet.
These results indicate that persistently infected 129X1/SvJ mice harboring diet- induced cholesterol gallstones increased gallbladder colonization and fecal shedding, and thus have the potential to serve as a model for the study of typhoid carriage. Mutants of serovar Typhimurium in factors shown to be important for gallstone biofilm formation in vitro including flagellar filament and O-antigen capsule expression could be tested for effects on gallbladder persistence in vivo. However, serovar Typhimurium O-ag capsule mutants were attenuated for virulence during oral infection of BALB/c mice. In these experiments, salmonellae were recovered in the spleen but not the Peyer’s patches or gallbladder. Therefore, O-ag mutants may need to be infected directly into the gallbladders of 129X1/SvJ mice harboring gallstones, and this will be attempted at Ohio
State using micro-injection guided by a VisualSonics ultrasound machine. Direct injection of microorganisms into the gallbladder has been demonstrated in cannulated guinea pigs (Lavergne et al., 1977) and, if unsuccessful here, could be attempted using an established model of cholelithiasis in prairie dogs (Giurgiu et al., 1997).
The Vi-capsule antigen of serovar Typhi has been demonstrated to reduce Toll- like receptor (TLR) dependent cytokine production by preventing TLR4 recognition in
164 tissue cultured models (Wilson et al., 2008). This stealth mechanism has been proposed to facilitate intestinal invasion and systemic infection by masking the proinflammatory effects of LPS (Tsolis et al., 2008). The O-ag capsule is expressed specifically by salmonellae, is larger than LPS, and was shown to be a critical bile-induced component of gallstone biofilms in vitro ECM whereas Vi-capsule was not. The production of O-ag capsule in typhoid gallstone biofilms may similarly prevent TLR-mediated inflammation in the gallbladder as a mechanism of host immune evasion during establishment and maintenance of the asymptomatic carrier state. RNA from gallbladder tissues persistently infected with wild-type and O-ag capsule overexpressing strains could be isolated, converted to cDNA, and analyzed by real-time PCR for the levels of cytokines and chemokines using a mouse immune panel from Applied Biosystems (Ordway et al.,
2006).
Treatments shown to resolve murine cholesterol gallstones such as beta- muricholic acid or fatty acid bile conjugates (Wang and Tazuma, 2002; Leikin-Frenkel et al., 2008) could be administered to mice carrying salmonellae to examine how the dissolution of stones impacts gallbladder carriage. In fact, the clinical administration of bile has therapeutic activity. Specifically, bile acids have been shown to be efficacious as topical agents countering sexually transmitted diseases and intravenously for viral hepatitis (Chen et al., 2003; Herold et al., 1999). The viral hepatitides, common causes of liver disease globally, have been shown to encounter bile during pathogenesis, and bile duct damage is a characteristic histopathological consequence of the massive immune response triggered by chronic hepatitis C virus (HCV) infection (Haruna et al., 2001;
Lefkowitch et al., 1993). It has been noted that administration of bile acids, such as urso
165 deoxycholic acid, induced significant improvements in serum transaminase activities in hepatitis B and hepatitis C (Chen et al., 2003). Bile acid therapy may not resolve typhoid biofilms on gallstone surfaces during asymptomatic carriage, but could initiate biofilm dispersal in conjunction with drugs targeting specific ECM constituents, or kill planktonic bacteria to prevent environmental shedding.
Enhancing the bile salt hydrolase properties of probiotics could increase the demand for cholesterol in the liver for de novo bile acid synthesis, thereby removing it from the blood to provide a treatment for patients with hypercholesterolaemia (Begley et al., 2005a). In malnourished individuals who are susceptible to enteric infections, increasing bile acid levels in the intestine via oral administration or by an increase in hormones that result in increased bile production or secretion would bolster their defense arsenal against invading pathogens. As long as the integrity of the normal microbial flora is maintained, compounds such as those discussed above could be manufactured to target known factors contributing to bile resistance. It is likely that future bile research will target temporal and spatial sensing mechanisms by bacteria, as bile-mediated virulence factor expression leading to colonization and persistence must be better understood.
Efflux pump inhibitors (EPIs) also present a new avenue of intervention, and towards this goal, Lin et al. recently showed that oral administration of two different EPIs reduced colonization of C. jejuni in chickens at two to four days post inoculation, whereas cmeABC mutants failed to do so at any point during the 20 day study (Lin et al.,
2003; Lin and Martinez, 2006). The CmeABC efflux pump is required for
Campylobacter resistance to bile salts, the very same compounds that enhanced both expression of this locus and tolerance to multiple antibiotics including cefotaxime,
166 novobiocin and fusidic acid in culture media (Lin et al., 2005b). The Salmonella AcrAB
efflux pump is similarly necessary for bile tolerance (Prouty et al., 2004b), and represents
a potential target of EPI therapy.
S. Typhi biofilm formation on cholesterol gallstones as a mechanism mediating
the chronic carrier state of typhoid fever in humans was investigated here for the first
time. Individuals seeking cholecystectomy due to gallstones were analyzed for
asymptomatic serovar Typhi carriage at the Hospital Infantil in Mexico City. Results
indicate that 5% of patients with cholelithiasis carried serovar Typhi and that bacterial
biofilms could be visualized on gallstones from 3/4 of these carriers. Biofilm formation
was not observed on patients positive for other bacteria or whose gallbladders failed to
possess culturable aerobic bacteria, suggesting that gallstone biofilms are a typhoid
specific phenomenon.
It has been demonstrated that salmonellae do not form biofilms on every area of
human gallstones in vitro, and that salmonellae form significantly more biofilms on
Eppendorf tubes coated with cholesterol than with bilirubin. These results suggest that gallstone composition plays a significant role in biofilm formation during typhoid gallbladder carriage. Interestingly, a study of cholecystectomized patients in Athens,
Greece, demonstrated that older patients had multiple small gallstones and little gallbladder inflammation, whereas younger patients presented with solitary gallbladder stones and tissue damage (Domeyer et al., 2008). Because the risk for typhoid carriage is severe in the elderly population and gallbladder inflammation is hypothesized to be low during human cholesterol gallstone formation (Maurer et al., 2009), a collection of small
167 stones and minimal inflammation may increase the risk of persistent serovar Typhi gallbladder colonization during human infection.
Detection of asymptomatic carriers is made difficult by the irregular nature of shedding from these individuals (Parry et al., 2002). V. cholerae is also transmitted via the fecal-oral route, and bile acids have been shown to mediate biofilm of this microorganism by regulating the vps genes (Vibrio polysaccharide synthesis) and their transcriptional activator VpsR (Hung et al., 2006). A recent epidemiological and ecological survey of V. cholerae in the drinking water from an area susceptible to annual cholera outbreaks demonstrated that persistence in aquatic environments required biofilm-induced nonculturability (Alam et al., 2007). V. cholerae biofilms were also present in fresh stool samples from infected human volunteers, suggesting that bacterial biofilms enhance environmental fitness and allow stealthy transmission. It would be of great interest to know whether person-to-person passage of serovar Typhi from chronic carriers involves biofilms in feces or contaminated food and water.
Prevention of typhoid fever demands better food and water sanitation methods in impoverished countries that cannot afford them, and improvement from vaccines that generate strong side effects or modest immunogenicity. This issue is further complicated by the many defense mechanisms needed to clear typhoid infections, including mucosal and systemic immune responses. Travel to India, Pakistan, Mexico, Bangladesh, the
Philippines, and Haiti accounted for 76% of all travel acquired typhoid fever infections in patients from developed countries (Bhan et al., 2005). Inactivated whole cell vaccines against typhoid have largely been discontinued as a global public health tool due to their high reactogenicity (Guzman et al., 2006), leaving Vi-based subunit vaccines and live
168 attenuated oral vaccines as the only licensed alternatives. The Vi parenteral vaccine, however, does not provide immunological memory, as immune responses against polysaccharides do not involve T cells (Guzman et al., 2006). Live attenuated oral vaccines were first administered in the 1970s but risk reversion to virulence and increase the amount of genetically manipulated strains shed into the environment (Abd El Ghany et al., 2007; Kotton and Hohmann, 2004). The live typhoid vaccine Ty21a is an attenuated Ty2 derivative with an RpoS-, GalE-, and Vi-negative phenotype (Santander et al., 2007) that required three or four doses to confer protection in controlled field studies, but had variable effectiveness in trials (Wahdan et al., 1982; Levine et al., 1987).
Typhoid fever remains a significant burden to public health and safety world- wide. The hope for serovar Typhi eradication rests with multi-faceted treatment and prevention strategies that seek to improve sanitation and hygiene, diagnostic tools, immunizations, and targeted drug therapies. To that end, this dissertation provides a better understanding of the regulatory mechanisms and bacterial surface components that mediate Salmonella biofilm formation on gallstones and cholesterol surfaces and, thus, novel therapeutic targets for potentially alleviating gallbladder carriage and much of the human-to-human transmission linked to the asymptomatic, chronic carrier state.
169
List of References
1. Abd El Ghany, M., A. Jansen, S. Clare, L. Hall, D. Pickard, R. A. Kingsley, and G. Dougan. 2007. Candidate live, attenuated Salmonella enterica serotype Typhimurium vaccines with reduced fecal shedding are immunogenic and effective oral vaccines. Infect Immun 75:1835-42.
2. Adler, J. 1975. Chemotaxis in bacteria. Annu Rev Biochem 44: 341-56.
3. Afdhal, N. H. 1999. Crohn's and stones. Am J Gastroenterol 94:1130-2.
4. Al-Jabri, A. A., M. D. Wigg, E. Elias, R. Lambkin, C. O. Mills, and J. S. Oxford. 2000. In vitro anti-HIV-1 virucidal activity of tyrosine-conjugated tri- and dihydroxy bile salt derivatives. J Antimicrob Chemother 45:617-21.
5. Alam, M., M. Sultana, G. B. Nair, A. K. Siddique, N. A. Hasan, R. B. Sack, D. A. Sack, K. U. Ahmed, A. Sadique, H. Watanabe, C. J. Grim, A. Huq, and R. R. Colwell. 2007. Viable but nonculturable Vibrio cholerae O1 in biofilms in the aquatic environment and their role in cholera transmission. Proc Natl Acad Sci U S A 104:17801-6.
6. Alba, B. M. and C. A. Gross. 2004. Regulation of the Escherichia coli sigma- dependent envelope stress response. Mol Microbiol 52:613-9.
7. Aldridge, P. D., C. Wu, J. Gnerer, J. E. Karlinsey, K. T. Hughes, and M. S. Sachs. 2006. Regulatory protein that inhibits both synthesis and use of the target protein controls flagellar phase variation in Salmonella enterica. Proc Natl Acad Sci U S A 103:11340-5.
170 8. Allen, K. J. and M. W. Griffiths. 2001. Effect of environmental and chemotactic stimuli on the activity of the Campylobacter jejuni flaA sigma(28) promoter. FEMS Microbiol Lett 205:43-8.
9. Allen-Vercoe, E. and M. J. Woodward. 1999. The role of flagella, but not fimbriae, in the adherence of Salmonella enterica serotype Enteritidis to chick gut explant. J Med Microbiol 48:771-80.
10. Ananieva, O., I. Nilsson, T. Vorobjova, R. Uibo, and T. Wadstrom. 2002. Immune responses to bile-tolerant helicobacter species in patients with chronic liver diseases, a randomized population group, and healthy blood donors. Clin Diagn Lab Immunol 9:1160-4.
11. Anderl, J. N., M. J. Franklin, and P. S. Stewart. 2000. Role of antibiotic penetration limitation in Klebsiella pneumoniae biofilm resistance to ampicillin and ciprofloxacin. Antimicrob Agents Chemother 44:1818-24.
12. Andersen-Nissen, E., K. D. Smith, R. Bonneau, R. K. Strong, and A. Aderem. 2007. A conserved surface on Toll-like receptor 5 recognizes bacterial flagellin. J Exp Med 204:393-403.
13. Andrianifahanana, M., N. Moniaux, and S. K. Batra. 2006. Regulation of mucin expression: mechanistic aspects and implications for cancer and inflammatory diseases. Biochim Biophys Acta 1765:189-222.
14. Anwar, H., T. van Biesen, M. Dasgupta, K. Lam, and J. W. Costerton. 1989. Interaction of biofilm bacteria with antibiotics in a novel in vitro chemostat system. Antimicrob Agents Chemother 33:1824-6.
15. Apostolov, E., W. A. Al-Soud, I. Nilsson, I. Kornilovska, V. Usenko, V. Lyzogubov, Y. Gaydar, T. Wadstrom, and A. Ljungh. 2005. Helicobacter pylori and other Helicobacter species in gallbladder and liver of patients with chronic cholecystitis detected by immunological and molecular methods. Scand J Gastroenterol 40:96-102.
16. Attmannspacher, U., B. E. Scharf, and R. M. Harshey. 2008. FliL is essential for swarming: motor rotation in absence of FliL fractures the flagellar rod in swarmer cells of Salmonella enterica. Mol Microbiol 68:328-41.
171 17. Azad, A. K., J. B. Torrelles, and L. S. Schlesinger. 2008. Mutation in the DC- SIGN cytoplasmic triacidic cluster motif markedly attenuates receptor activity for phagocytosis and endocytosis of mannose-containing ligands by human myeloid cells. J Leukoc Biol 84:1594-603.
18. Bakaletz, L. O., B. D. Baker, J. A. Jurcisek, A. Harrison, L. A. Novotny, J. E. Bookwalter, R. Mungur, and R. S. Munson Jr. 2005. Demonstration of Type IV pilus expression and a twitching phenotype by Haemophilus influenzae. Infect Immun 73:1635-43.
19. Baker, S., K. Holt, S. Whitehead, I. Goodhead, T. Perkins, B. Stocker, J. Hardy, and G. Dougan. 2007. A linear plasmid truncation induces unidirectional flagellar phase change in H:z66 positive Salmonella Typhi. Mol Microbiol 66:1207-18.
20. Barak, J. D., C. E. Jahn, D. L. Gibson, and A. O. Charkowski. 2007. The role of cellulose and O-antigen capsule in the colonization of plants by Salmonella enterica. Mol Plant Microbe Interact 20:1083-91.
21. Baranova, N. and H. Nikaido. 2002. The baeSR two-component regulatory system activates transcription of the yegMNOB (mdtABCD) transporter gene cluster in Escherichia coli and increases its resistance to novobiocin and deoxycholate. J Bacteriol 184:4168-76.
22. Barken, K. B., S. J. Pamp, L. Yang, M. Gjermansen, J. J. Bertrand, M. Klausen, M. Givskov, C. B. Whitchurch, J. N. Engel, and T. Tolker-Nielsen. 2008. Roles of type IV pili, flagellum-mediated motility and extracellular DNA in the formation of mature multicellular structures in Pseudomonas aeruginosa biofilms. Environ Microbiol 10:2331-43.
23. Barthel, M., S. Hapfelmeier, L. Quintanilla-Martinez, M. Kremer, M. Rohde, M. Hogardt, K. Pfeffer, H. Russmann, and W. D. Hardt. 2003. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both pathogen and host. Infect Immun 71:2839-58.
24. Baumler, A. J., R. M. Tsolis, and F. Heffron. 1996. The lpf fimbrial operon mediates adhesion of Salmonella typhimurium to murine Peyer's patches. Proc Natl Acad Sci U S A 93:279-83.
172 25. Begley, M., C. G. Gahan, and C. Hill. 2002. Bile stress response in Listeria monocytogenes LO28: adaptation, cross-protection, and identification of genetic loci involved in bile resistance. Appl Environ Microbiol 68:6005-12.
26. Begley, M., C. G. Gahan, and C. Hill. 2005a. The interaction between bacteria and bile. FEMS Microbiol Rev 29:625-51.
27. Begley, M., R. D. Sleator, C. G. Gahan, and C. Hill. 2005b. Contribution of three bile-associated loci, bsh, pva, and btlB, to gastrointestinal persistence and bile tolerance of Listeria monocytogenes. Infect Immun 73:894-904.
28. Bergman, M. A., L. A. Cummings, R. C. Alaniz, L. Mayeda, I. Fellnerova, and B. T. Cookson. 2005. CD4+-T-cell responses generated during murine Salmonella enterica serovar Typhimurium infection are directed towards multiple epitopes within the natural antigen FliC. Infect Immun 73:7226-35.
29. Bhan, M. K., R. Bahl, and S. Bhatnagar. 2005. Typhoid and paratyphoid fever. Lancet 366:749-62.
30. Bhatnagar, S. S. 1948. Modern laboratory methods in the diagnosis and control of typhoid fever. Indian Physician 7:210.
31. Bina, J., J. Zhu, M. Dziejman, S. Faruque, S. Calderwood, and J. Mekalanos. 2003. ToxR regulon of Vibrio cholerae and its expression in vibrios shed by cholera patients. Proc Natl Acad Sci U S A 100:2801-6.
32. Bina, J. E. and J. J. Mekalanos. 2001. Vibrio cholerae tolC is required for bile resistance and colonization. Infect Immun 69:4681-5.
33. Bina, J. E., D. Provenzano, C. Wang, X. R. Bina, and J. J. Mekalanos. 2006. Characterization of the Vibrio cholerae vexAB and vexCD efflux systems. Arch Microbiol 186:171-81.
34. Blaser, M. J., G. I. Perez-Perez, H. Kleanthous, T. L. Cover, R. M. Peek, P. H. Chyou, G. N. Stemmermann, and A. Nomura. 1995. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res 55:2111-5.
173 35. Blocker, A., K. Komoriya, and S. Aizawa. 2003. Type III secretion systems and bacterial flagella: insights into their function from structural similarities. Proc Natl Acad Sci U S A 100:3027-30.
36. Boddicker, J. D., N. A. Ledeboer, J. Jagnow, B. D. Jones, and S. Clegg. 2002. Differential binding to and biofilm formation on, HEp-2 cells by Salmonella enterica serovar Typhimurium is dependent upon allelic variation in the fimH gene of the fim gene cluster. Mol Microbiol 45:1255-65.
37. Boggs, J. M. 1987. Lipid intermolecular hydrogen bonding: influence on structural organization and membrane function. Biochim Biophys Acta 906:353- 404.
38. Bohr, U. R., D. Kuester, F. Meyer, T. Wex, M. Stillert, A. Csepregi, H. Lippert, A. Roessner, and P. Malfertheiner. 2007. Low prevalence of Helicobacteraceae in gall-stone disease and gall-bladder carcinoma in the German population. Clin Microbiol Infect 13:525-31.
39. Bonafonte, M. A., C. Solano, B. Sesma, M. Alvarez, L. Montuenga, D. Garcia-Ros, and C. Gamazo. 2000. The relationship between glycogen synthesis, biofilm formation and virulence in salmonella enteritidis. FEMS Microbiol Lett 191:31-6.
40. Bonifield, H. R. and K. T. Hughes. 2003. Flagellar phase variation in Salmonella enterica is mediated by a posttranscriptional control mechanism. J Bacteriol 185:3567-74.
41. Bortolini, O., A. Medici, and S. Poli. 1997. Biotransformations on steroid nucleus of bile acids. Steroids 62:564-77.
42. Boyle, E. C., J. L. Bishop, G. A. Grassl, and B. B. Finlay. 2007. Salmonella: from pathogenesis to therapeutics. J Bacteriol 189:1489-95.
43. Brenner, F. W., R. G. Villar, F. J. Angulo, R. Tauxe, and B. Swaminathan. 2000. Salmonella nomenclature. J Clin Microbiol 38:2465-7.
174 44. Brombacher, E., C. Dorel, A. J. Zehnder, and P. Landini. 2003. The curli biosynthesis regulator CsgD co-ordinates the expression of both positive and negative determinants for biofilm formation in Escherichia coli. Microbiology 149:2847-57.
45. Buckley, J. T., R. McLeod, and J. Frohlich. 1984. Action of a microbial glycerophospholipid:cholesterol acyltransferase on plasma from normal and LCAT-deficient subjects. J Lipid Res 25:913-8.
46. Budiarti, S., Y. Hirai, J. Minami, S. Katayama, T. Shimizu, and A. Okabe. 1991. Adherence to HEp-2 cells and replication in macrophages of Salmonella derby of human origin. Microbiol Immunol 35:111-23.
47. Butler, S. M. and A. Camilli. 2005. Going against the grain: chemotaxis and infection in Vibrio cholerae. Nat Rev Microbiol 3:611-20.
48. Butler, T., W. R. Bell, J. Levin, N. N. Linh, and K. Arnold. 1978. Typhoid fever. Studies of blood coagulation, bacteremia, and endotoxemia. Arch Intern Med 138:407-10.
49. Caiazza, N. C. and G. A. O'Toole. 2003. Alpha-toxin is required for biofilm formation by Staphylococcus aureus. J Bacteriol 185:3214-7.
50. Catron, D. M., M. D. Sylvester, Y. Lange, M. Kadekoppala, B. D. Jones, D. M. Monack, S. Falkow, and K. Haldar. 2002. The Salmonella-containing vacuole is a major site of intracellular cholesterol accumulation and recruits the GPI-anchored protein CD55. Cell Microbiol 4:315-28.
51. Caygill, C. P., M. J. Hill, M. Braddick, and J. C. Sharp. 1994. Cancer mortality in chronic typhoid and paratyphoid carriers. Lancet 343:83-4.
52. Chakrabarti, S. R., K. Chaudhuri, K. Sen, and J. Das. 1996. Porins of Vibrio cholerae: purification and characterization of OmpU. J Bacteriol 178:524-30.
53. Champion, G. A., M. N. Neely, M. A. Brennan, and V. J. DiRita. 1997. A branch in the ToxR regulatory cascade of Vibrio cholerae revealed by characterization of toxT mutant strains. Mol Microbiol 23:323-31.
175 54. Chang, K. O., S. V. Sosnovtsev, G. Belliot, Y. Kim, L. J. Saif, and K. Y. Green. 2004. Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1. Proc Natl Acad Sci U S A 101:8733-8.
55. Chatterjee, A., P. K. Dutta, and R. Chowdhury. 2007. Effect of fatty acids and cholesterol present in bile on expression of virulence factors and motility of Vibrio cholerae. Infect Immun 75:1946-53.
56. Chen, W., J. Liu, and C. Gluud. 2003. Bile acids for viral hepatitis. Cochrane Database Syst RevCD003181.
57. Chilcott, G. S. and K. T. Hughes. 2000. Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar typhimurium and Escherichia coli. Microbiol Mol Biol Rev 64:694-708.
58. Clegg, S. and K. T. Hughes. 2002. FimZ is a molecular link between sticking and swimming in Salmonella enterica serovar Typhimurium. J Bacteriol 184:1209-13.
59. Coats, J. 1882. Eberth's Typhoid Bacillus. The British Medical Journal421.
60. Coburn, B., G. A. Grassl, and B. B. Finlay. 2007. Salmonella, the host and disease: a brief review. Immunol Cell Biol 85:112-8.
61. Coleman, J. P. and L. L. Hudson. 1995. Cloning and characterization of a conjugated bile acid hydrolase gene from Clostridium perfringens. Appl Environ Microbiol 61:2514-20.
62. Costerton, J. W., Z. Lewandowski, D. E. Caldwell, D. R. Korber, and H. M. Lappin-Scott. 1995. Microbial biofilms. Annu Rev Microbiol 49:711-45.
63. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial biofilms: a common cause of persistent infections. Science 284:1318-22.
64. Crawford, R. W., D. L. Gibson, W. W. Kay, and J. S. Gunn. 2008. Identification of a bile-induced exopolysaccharide required for Salmonella biofilm formation on gallstone surfaces. Infect Immun 76:5341-9. 176 65. Crosa, J. H., D. J. Brenner, W. H. Ewing, and S. Falkow. 1973. Molecular relationships among the Salmonelleae. J Bacteriol 115:307-15.
66. Crump, J. A., S. P. Luby, and E. D. Mintz. 2004. The global burden of typhoid fever. Bull World Health Organ 82:346-53.
67. Cummings, L. A., W. D. Wilkerson, T. Bergsbaken, and B. T. Cookson. 2006. In vivo, fliC expression by Salmonella enterica serovar Typhimurium is heterogeneous, regulated by ClpX, and anatomically restricted. Mol Microbiol 61:795-809.
68. Da Re, S. and J. M. Ghigo. 2006. A CsgD-independent pathway for cellulose production and biofilm formation in Escherichia coli. J Bacteriol 188:3073-87.
69. Danese, P. N., L. A. Pratt, and R. Kolter. 2000. Exopolysaccharide production is required for development of Escherichia coli K-12 biofilm architecture. J Bacteriol 182:3593-6.
70. Datsenko, K. A. and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640-5.
71. Davey, M. E. and G. A. O'toole. 2000. Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 64:847-67.
72. Davies, D. G., A. M. Chakrabarty, and G. G. Geesey. 1993. Exopolysaccharide production in biofilms: substratum activation of alginate gene expression by Pseudomonas aeruginosa. Appl Environ Microbiol 59:1181-6.
73. de Jesus, M. C., A. A. Urban, M. E. Marasigan, and D. E. Barnett Foster. 2005. Acid and bile-salt stress of enteropathogenic Escherichia coli enhances adhesion to epithelial cells and alters glycolipid receptor binding specificity. J Infect Dis 192:1430-40.
74. De Smet, I., P. De Boever, and W. Verstraete. 1998. Cholesterol lowering in pigs through enhanced bacterial bile salt hydrolase activity. Br J Nutr 79:185-94.
177 75. de Vries, N., K. A. Zwaagstra, J. H. Huis in't Veld, F. van Knapen, F. G. van Zijderveld, and J. G. Kusters. 1998. Production of monoclonal antibodies specific for the i and 1,2 flagellar antigens of Salmonella typhimurium and characterization of their respective epitopes. Appl Environ Microbiol 64:5033-8.
76. Deng, S. X., A. C. Cheng, M. S. Wang, P. Cao, B. Yan, N. C. Yin, S. Y. Cao, and Z. H. Zhang. 2008. Quantitative studies of the regular distribution pattern for Salmonella enteritidis in the internal organs of mice after oral challenge by a specific real-time polymerase chain reaction. World J Gastroenterol 14:782-9.
77. Deziel, E., Y. Comeau, and R. Villemur. 2001. Initiation of biofilm formation by Pseudomonas aeruginosa 57RP correlates with emergence of hyperpiliated and highly adherent phenotypic variants deficient in swimming, swarming, and twitching motilities. J Bacteriol 183:1195-204.
78. Dharmana, E., M. Keuter, M. G. Netea, I. C. Verschueren, and B. J. Kullberg. 2002. Divergent effects of tumor necrosis factor-alpha and lymphotoxin-alpha on lethal endotoxemia and infection with live Salmonella typhimurium in mice. Eur Cytokine Netw 13:104-9.
79. Dibb-Fuller, M. P., E. Allen-Vercoe, C. J. Thorns, and M. J. Woodward. 1999. Fimbriae- and flagella-mediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145 ( Pt 5):1023-31.
80. Domeyer, P. J., T. N. Sergentanis, F. Zagouri, B. Tzilalis, E. Mouzakioti, A. Parasi, A. Nonni, A. Mariolis, G. Androulakis, and G. C. Zografos. 2008. Chronic cholecystitis in elderly patients. Correlation of the severity of inflammation with the number and size of the stones. In Vivo 22:269-72.
81. Dorman, C. J., S. Chatfield, C. F. Higgins, C. Hayward, and G. Dougan. 1989. Characterization of porin and ompR mutants of a virulent strain of Salmonella typhimurium: ompR mutants are attenuated in vivo. Infect Immun 57:2136-40.
82. Duret, G. and A. H. Delcour. 2006. Deoxycholic acid blocks vibrio cholerae OmpT but not OmpU porin. J Biol Chem 281:19899-905.
178 83. Dussurget, O., D. Cabanes, P. Dehoux, M. Lecuit, C. Buchrieser, P. Glaser, and P. Cossart. 2002. Listeria monocytogenes bile salt hydrolase is a PrfA- regulated virulence factor involved in the intestinal and hepatic phases of listeriosis. Mol Microbiol 45:1095-106. Notes: CORPORATE NAME: European Listeria Genome Consortium
84. Dutta, U., P. K. Garg, R. Kumar, and R. K. Tandon. 2000. Typhoid carriers among patients with gallstones are at increased risk for carcinoma of the gallbladder. Am J Gastroenterol 95:784-7.
85. Ehrbar, K. and W. D. Hardt. 2005. Bacteriophage-encoded type III effectors in Salmonella enterica subspecies 1 serovar Typhimurium. Infect Genet Evol 5:1-9.
86. Everest, P., J. Wain, M. Roberts, G. Rook, and G. Dougan. 2001. The molecular mechanisms of severe typhoid fever. Trends Microbiol 9:316-20.
87. Fass, E. and E. A. Groisman. 2009. Control of Salmonella pathogenicity island- 2 gene expression. Curr Opin Microbiol 12:199-204.
88. Feng, X., R. Oropeza, and L. J. Kenney. 2003. Dual regulation by phospho- OmpR of ssrA/B gene expression in Salmonella pathogenicity island 2. Mol Microbiol 48:1131-43.
89. Feng, X., D. Walthers, R. Oropeza, and L. J. Kenney. 2004. The response regulator SsrB activates transcription and binds to a region overlapping OmpR binding sites at Salmonella pathogenicity island 2. Mol Microbiol 54: 823-35.
90. Flahaut, S., A. Hartke, J. C. Giard, A. Benachour, P. Boutibonnes, and Y. Auffray. 1996. Relationship between stress response toward bile salts, acid and heat treatment in Enterococcus faecalis. FEMS Microbiol Lett 138: 49-54.
91. Fleisher, G. R. 1991. Management of children with occult bacteremia who are treated in the emergency department. Rev Infect Dis 13 Suppl 2: S156-9.
92. Fox, J. G., F. E. Dewhirst, Z. Shen, Y. Feng, N. S. Taylor, B. J. Paster, R. L. Ericson, C. N. Lau, P. Correa, J. C. Araya, and I. Roa. 1998. Hepatic Helicobacter species identified in bile and gallbladder tissue from Chileans with chronic cholecystitis. Gastroenterology 114:755-63.
179 93. Fox, J. G., L. L. Yan, F. E. Dewhirst, B. J. Paster, B. Shames, J. C. Murphy, A. Hayward, J. C. Belcher, and E. N. Mendes. 1995. Helicobacter bilis sp. nov., a novel Helicobacter species isolated from bile, livers, and intestines of aged, inbred mice. J Clin Microbiol 33:445-54.
94. Franklund, C. V., S. F. Baron, and P. B. Hylemon. 1993. Characterization of the baiH gene encoding a bile acid-inducible NADH:flavin oxidoreductase from Eubacterium sp. strain VPI 12708. J Bacteriol 175:3002-12.
95. Fraser, G. M., B. Gonzalez-Pedrajo, J. R. Tame, and R. M. Macnab. 2003. Interactions of FliJ with the Salmonella type III flagellar export apparatus. J Bacteriol 185:5546-54.
96. Frye, J., J. E. Karlinsey, H. R. Felise, B. Marzolf, N. Dowidar, M. McClelland, and K. T. Hughes. 2006. Identification of new flagellar genes of Salmonella enterica serovar Typhimurium. J Bacteriol 188:2233-43.
97. Gahan, C. G. and C. Hill. 1999. The relationship between acid stress responses and virulence in Salmonella typhimurium and Listeria monocytogenes. Int J Food Microbiol 50:93-100.
98. Galan, J. E. and R. Curtiss 3rd. 1989. Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells. Proc Natl Acad Sci U S A 86:6383-7.
99. Galan, J. E. and R. Curtiss 3rd. 1991. Distribution of the invA, -B, -C, and -D genes of Salmonella typhimurium among other Salmonella serovars: invA mutants of Salmonella typhi are deficient for entry into mammalian cells. Infect Immun 59:2901-8.
100. Garcia, B., C. Latasa, C. Solano, F. Garcia-del Portillo, C. Gamazo, and I. Lasa. 2004. Role of the GGDEF protein family in Salmonella cellulose biosynthesis and biofilm formation. Mol Microbiol 54:264-77.
101. Garner, M. J., R. D. Hayward, and V. Koronakis. 2002. The Salmonella pathogenicity island 1 secretion system directs cellular cholesterol redistribution during mammalian cell entry and intracellular trafficking. Cell Microbiol 4:153- 65.
180 102. Gavrilin, M. A., I. J. Bouakl, N. L. Knatz, M. D. Duncan, M. W. Hall, J. S. Gunn, and M. D. Wewers. 2006. Internalization and phagosome escape required for Francisella to induce human monocyte IL-1beta processing and release. Proc Natl Acad Sci U S A 103:141-6.
103. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, J. Middel, I. L. Cornelissen, H. S. Nottet, V. N. KewalRamani, D. R. Littman, C. G. Figdor, and Y. van Kooyk. 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100:587-97.
104. Gibson, D. L., A. P. White, S. D. Snyder, S. Martin, C. Heiss, P. Azadi, M. Surette, and W. W. Kay. 2006. Salmonella produces an O-antigen capsule regulated by AgfD and important for environmental persistence. J Bacteriol 188:7722-30.
105. Giron, J. A., A. G. Torres, E. Freer, and J. B. Kaper. 2002. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol Microbiol 44:361-79.
106. Giurgiu, D. I., K. D. Saunders-Kirkwood, J. J. Roslyn, and M. Z. Abedin. 1997. Sequential changes in biliary lipids and gallbladder ion transport during gallstone formation. Ann Surg 225:382-90.
107. Grill, J. P., C. Cayuela, J. M. Antoine, and F. Schneider. 2000a. Isolation and characterization of a Lactobacillus amylovorus mutant depleted in conjugated bile salt hydrolase activity: relation between activity and bile salt resistance. J Appl Microbiol 89:553-63.
108. Grill, J. P., S. Perrin, and F. Schneider. 2000b. Bile salt toxicity to some bifidobacteria strains: role of conjugated bile salt hydrolase and pH. Can J Microbiol 46:878-84.
109. Grkovic, S., M. H. Brown, and R. A. Skurray. 2002. Regulation of bacterial drug export systems. Microbiol Mol Biol Rev 66:671-701, table of contents.
110. Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoP- PhoQ. J Bacteriol 183:1835-42.
181 111. Groisman, E. A. and H. Ochman. 1996. Pathogenicity islands: bacterial evolution in quantum leaps. Cell 87:791-4.
112. Gross, M., S. E. Cramton, F. Gotz, and A. Peschel. 2001. Key role of teichoic acid net charge in Staphylococcus aureus colonization of artificial surfaces. Infect Immun 69:3423-6.
113. Gunn, J. S. 2000. Mechanisms of bacterial resistance and response to bile. Microbes Infect 2:907-13.
114. Gunn, J. S. 2008. The Salmonella PmrAB regulon: lipopolysaccharide modifications, antimicrobial peptide resistance and more. Trends Microbiol 16:284-90.
115. Gunn, J. S., E. L. Hohmann, and S. I. Miller. 1996. Transcriptional regulation of Salmonella virulence: a PhoQ periplasmic domain mutation results in increased net phosphotransfer to PhoP. J Bacteriol 178:6369-73.
116. Gupta, S. and R. Chowdhury. 1997. Bile affects production of virulence factors and motility of Vibrio cholerae. Infect Immun 65:1131-4.
117. Guzman, C. A., S. Borsutzky, M. Griot-Wenk, I. C. Metcalfe, J. Pearman, A. Collioud, D. Favre, and G. Dietrich. 2006. Vaccines against typhoid fever. Vaccine 24:3804-11.
118. Hale, T. L. 1991. Genetic basis of virulence in Shigella species. Microbiol Rev 55:206-24.
119. Hardison, W. G. 1978. Hepatic taurine concentration and dietary taurine as regulators of bile acid conjugation with taurine. Gastroenterology 75:71-5.
120. Hardt, W. D., L. M. Chen, K. E. Schuebel, X. R. Bustelo, and J. E. Galan. 1998. S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell 93:815-26.
121. Harris, J. C., H. L. Dupont, and R. B. Hornick. 1972. Fecal leukocytes in diarrheal illness. Ann Intern Med 76:697-703.
182 122. Haruna, Y., T. Kanda, M. Honda, T. Takao, and N. Hayashi. 2001. Detection of hepatitis C virus in the bile and bile duct epithelial cells of hepatitis C virus- infected patients. Hepatology 33:977-80.
123. Heithoff, D. M., E. Y. Enioutina, R. A. Daynes, R. L. Sinsheimer, D. A. Low, and M. J. Mahan. 2001. Salmonella DNA adenine methylase mutants confer cross-protective immunity. Infect Immun 69:6725-30.
124. Herold, B. C., R. Kirkpatrick, D. Marcellino, A. Travelstead, V. Pilipenko, H. Krasa, J. Bremer, L. J. Dong, and M. D. Cooper. 1999. Bile salts: natural detergents for the prevention of sexually transmitted diseases. Antimicrob Agents Chemother 43:745-51.
125. Heydorn, A., B. Ersboll, J. Kato, M. Hentzer, M. R. Parsek, T. Tolker- Nielsen, M. Givskov, and S. Molin. 2002. Statistical analysis of Pseudomonas aeruginosa biofilm development: impact of mutations in genes involved in twitching motility, cell-to-cell signaling, and stationary-phase sigma factor expression. Appl Environ Microbiol 68:2008-17.
126. Hirose, K., T. Ezaki, M. Miyake, T. Li, A. Q. Khan, Y. Kawamura, H. Yokoyama, and T. Takami. 1997. Survival of Vi-capsulated and Vi-deleted Salmonella typhi strains in cultured macrophage expressing different levels of CD14 antigen. FEMS Microbiol Lett 147:259-65.
127. Hirose, K., K. Itoh, H. Nakajima, T. Kurazono, M. Yamaguchi, K. Moriya, T. Ezaki, Y. Kawamura, K. Tamura, and H. Watanabe. 2002. Selective amplification of tyv (rfbE), prt (rfbS), viaB, and fliC genes by multiplex PCR for identification of Salmonella enterica serovars Typhi and Paratyphi A. J Clin Microbiol 40:633-6.
128. Ho, T. D. and J. M. Slauch. 2001a. Characterization of grvA, an antivirulence gene on the gifsy-2 phage in Salmonella enterica serovar typhimurium. J Bacteriol 183:611-20.
129. Ho, T. D. and J. M. Slauch. 2001b. OmpC is the receptor for Gifsy-1 and Gifsy- 2 bacteriophages of Salmonella. J Bacteriol 183:1495-8.
130. Hofmann, A. F. 1998. Bile secretion and the enterohepatic circulation of bile acids, pp. 937-948. Sleisenger and Fordtran’s Gastrointestinal and Liver Disease, 6 ed. W.B. Saunders, Co., Philadelphia, PA. 183 131. Hofmann, A. F. 1999. Bile Acids: The Good, the Bad, and the Ugly. News Physiol Sci 14:24-29.
132. Hofmann, A. F. 2005. Helicobacter and cholesterol gallstones: do findings in the mouse apply to man? Gastroenterology 128:1126-9.
133. Hofmann, A. F. and K. J. Mysels. 1992. Bile acid solubility and precipitation in vitro and in vivo: the role of conjugation, pH, and Ca2+ ions. J Lipid Res 33:617- 26.
134. Hofmann, A. F. and A. Roda. 1984. Physicochemical properties of bile acids and their relationship to biological properties: an overview of the problem. J Lipid Res 25:1477-89.
135. Hohmann, E. L., C. A. Oletta, K. P. Killeen, and S. I. Miller. 1996. phoP/phoQ-deleted Salmonella typhi (Ty800) is a safe and immunogenic single- dose typhoid fever vaccine in volunteers. J Infect Dis 173:1408-14.
136. Howell, N. E., C. Hamilton, J. New, I. Lane, and J. Brace. 2008. Linking veterinary and human public-health education: collaborations at the University Of Tennessee. J Vet Med Educ 35:203-6.
137. Hu, J., M. B. Gardner, and C. J. Miller. 2000. Simian immunodeficiency virus rapidly penetrates the cervicovaginal mucosa after intravaginal inoculation and infects intraepithelial dendritic cells. J Virol 74:6087-95.
138. Huber, B., K. Riedel, M. Kothe, M. Givskov, S. Molin, and L. Eberl. 2002. Genetic analysis of functions involved in the late stages of biofilm development in Burkholderia cepacia H111. Mol Microbiol 46:411-26.
139. Hufnagel, M., S. Koch, R. Creti, L. Baldassarri, and J. Huebner. 2004. A putative sugar-binding transcriptional regulator in a novel gene locus in Enterococcus faecalis contributes to production of biofilm and prolonged bacteremia in mice. J Infect Dis 189:420-30.
140. Hung, D. T. and J. J. Mekalanos. 2005. Bile acids induce cholera toxin expression in Vibrio cholerae in a ToxT-independent manner. Proc Natl Acad Sci U S A 102:3028-33.
184 141. Hung, D. T., J. Zhu, D. Sturtevant, and J. J. Mekalanos. 2006. Bile acids stimulate biofilm formation in Vibrio cholerae. Mol Microbiol 59:193-201.
142. Idone, V., S. Brendtro, R. Gillespie, S. Kocaj, E. Peterson, M. Rendi, W. Warren, S. Michalek, K. Krastel, D. Cvitkovitch, and G. Spatafora. 2003. Effect of an orphan response regulator on Streptococcus mutans sucrose- dependent adherence and cariogenesis. Infect Immun 71:4351-60.
143. Ikeda, J. S., C. K. Schmitt, S. C. Darnell, P. R. Watson, J. Bispham, T. S. Wallis, D. L. Weinstein, E. S. Metcalf, P. Adams, C. D. O'Connor, and A. D. O'Brien. 2001. Flagellar phase variation of Salmonella enterica serovar Typhimurium contributes to virulence in the murine typhoid infection model but does not influence Salmonella-induced enteropathogenesis. Infect Immun 69:3021-30.
144. Jansson, P. E., A. A. Lindberg, B. Lindberg, and R. Wollin. 1981. Structural studies on the hexose region of the core in lipopolysaccharides from Enterobacteriaceae. Eur J Biochem 115:571-7.
145. Jefferson, K. K. 2004. What drives bacteria to produce a biofilm? FEMS Microbiol Lett 236:163-73.
146. Jeong, K. C., M. Y. Kang, C. Heimke, J. A. Shere, I. Erol, and C. W. Kaspar. 2007. Isolation of Escherichia coli O157:H7 from the gall bladder of inoculated and naturally-infected cattle. Vet Microbiol 119:339-45.
147. Jepson, M. A. and M. A. Clark. 2001. The role of M cells in Salmonella infection. Microbes Infect 3:1183-90.
148. Jesaitis, A. J., M. J. Franklin, D. Berglund, M. Sasaki, C. I. Lord, J. B. Bleazard, J. E. Duffy, H. Beyenal, and Z. Lewandowski. 2003. Compromised host defense on Pseudomonas aeruginosa biofilms: characterization of neutrophil and biofilm interactions. J Immunol 171:4329-39.
149. Johnson, L. R. 1998. Bile secretion and gallbladder function, pp. 465-471. Essential Medical Physiology, 2 ed. Lippincott-Raven, Philadelphia, PA.
185 150. Johnson, M., I. Zaretskaya, Y. Raytselis, Y. Merezhuk, S. McGinnis, and T. L. Madden. 2008. NCBI BLAST: a better web interface. Nucleic Acids Res 36:W5-9.
151. Jonas, K., H. Tomenius, A. Kader, S. Normark, U. Romling, L. M. Belova, and O. Melefors. 2007. Roles of curli, cellulose and BapA in Salmonella biofilm morphology studied by atomic force microscopy. BMC Microbiol 7:70.
152. Jones, B. D. and S. Falkow. 1996. Salmonellosis: host immune responses and bacterial virulence determinants. Annu Rev Immunol 14:533-61.
153. Jurcisek, J. A., J. E. Bookwalter, B. D. Baker, S. Fernandez, L. A. Novotny, R. S. Munson Jr, and L. O. Bakaletz. 2007. The PilA protein of non-typeable Haemophilus influenzae plays a role in biofilm formation, adherence to epithelial cells and colonization of the mammalian upper respiratory tract. Mol Microbiol 65:1288-99.
154. Kaper, J. B., J. G. Morris Jr, and M. M. Levine. 1995. Cholera. Clin Microbiol Rev 8:48-86.
155. Karavolos, M. H., D. M. Bulmer, K. Winzer, M. Wilson, P. Mastroeni, P. Williams, and C. M. Khan. 2008. LuxS affects flagellar phase variation independently of quorum sensing in Salmonella enterica serovar typhimurium. J Bacteriol 190:769-71.
156. Karlinsey, J. E., S. Tanaka, V. Bettenworth, S. Yamaguchi, W. Boos, S. I. Aizawa, and K. T. Hughes. 2000. Completion of the hook-basal body complex of the Salmonella typhimurium flagellum is coupled to FlgM secretion and fliC transcription. Mol Microbiol 37:1220-31.
157. Kato, A. and E. A. Groisman. 2004. Connecting two-component regulatory systems by a protein that protects a response regulator from dephosphorylation by its cognate sensor. Genes Dev 18:2302-13.
158. Kihara, M., T. Minamino, S. Yamaguchi, and R. M. Macnab. 2001. Intergenic suppression between the flagellar MS ring protein FliF of Salmonella and FlhA, a membrane component of its export apparatus. J Bacteriol 183:1655-62.
186 159. Kjelleberg, S. and S. Molin. 2002. Is there a role for quorum sensing signals in bacterial biofilms? Curr Opin Microbiol 5:254-8.
160. Knarreborg, A., R. M. Engberg, S. K. Jensen, and B. B. Jensen. 2002. Quantitative determination of bile salt hydrolase activity in bacteria isolated from the small intestine of chickens. Appl Environ Microbiol 68:6425-8.
161. Kotton, C. N. and E. L. Hohmann. 2004. Enteric pathogens as vaccine vectors for foreign antigen delivery. Infect Immun 72:5535-47.
162. Kristian, S. A., T. A. Birkenstock, U. Sauder, D. Mack, F. Gotz, and R. Landmann. 2008. Biofilm formation induces C3a release and protects Staphylococcus epidermidis from IgG and complement deposition and from neutrophil-dependent killing. J Infect Dis 197:1028-35.
163. Kumar, S., S. Kumar, and S. Kumar. 2006. Infection as a risk factor for gallbladder cancer. J Surg Oncol 93:633-9.
164. Kutsukake, K., Y. Ohya, and T. Iino. 1990. Transcriptional analysis of the flagellar regulon of Salmonella typhimurium. J Bacteriol 172:741-7.
165. La Ragione, R. M., W. A. Cooley, P. Velge, M. A. Jepson, and M. J. Woodward. 2003. Membrane ruffling and invasion of human and avian cell lines is reduced for aflagellate mutants of Salmonella enterica serotype Enteritidis. Int J Med Microbiol 293:261-72.
166. Lai, C. W., R. C. Chan, A. F. Cheng, J. Y. Sung, and J. W. Leung. 1992. Common bile duct stones: a cause of chronic salmonellosis. Am J Gastroenterol 87:1198-9.
167. Landini, P. and A. J. Zehnder. 2002. The global regulatory hns gene negatively affects adhesion to solid surfaces by anaerobically grown Escherichia coli by modulating expression of flagellar genes and lipopolysaccharide production. J Bacteriol 184:1522-9.
168. Lapidot, A., U. Romling, and S. Yaron. 2006. Biofilm formation and the survival of Salmonella Typhimurium on parsley. Int J Food Microbiol 109:229- 33.
187 169. Lara-Tejero, M., F. S. Sutterwala, Y. Ogura, E. P. Grant, J. Bertin, A. J. Coyle, R. A. Flavell, and J. E. Galan. 2006. Role of the caspase-1 inflammasome in Salmonella typhimurium pathogenesis. J Exp Med 203:1407- 12.
170. Latasa, C., A. Roux, A. Toledo-Arana, J. M. Ghigo, C. Gamazo, J. R. Penades, and I. Lasa. 2005. BapA, a large secreted protein required for biofilm formation and host colonization of Salmonella enterica serovar Enteritidis. Mol Microbiol 58:1322-39.
171. Latasa, C., C. Solano, J. R. Penades, and I. Lasa. 2006. Biofilm-associated proteins. C R Biol 329:849-57.
172. Lauriano, C. M., C. Ghosh, N. E. Correa, and K. E. Klose. 2004. The sodium- driven flagellar motor controls exopolysaccharide expression in Vibrio cholerae. J Bacteriol 186:4864-74.
173. Lavergne, G. M., H. F. James, C. Martineau, B. B. Diena, and H. Lior. 1977. The guinea pig as a model for the asymptomatic human typhoid carrier. Lab Anim Sci 27:806-16.
174. Lawley, T. D., D. M. Bouley, Y. E. Hoy, C. Gerke, D. A. Relman, and D. M. Monack. 2008. Host transmission of Salmonella enterica serovar Typhimurium is controlled by virulence factors and indigenous intestinal microbiota. Infect Immun 76:403-16.
175. Ledeboer, N. A. and B. D. Jones. 2005. Exopolysaccharide sugars contribute to biofilm formation by Salmonella enterica serovar typhimurium on HEp-2 cells and chicken intestinal epithelium. J Bacteriol 187:3214-26.
176. Lee, A. K., C. S. Detweiler, and S. Falkow. 2000a. OmpR regulates the two- component system SsrA-ssrB in Salmonella pathogenicity island 2. J Bacteriol 182:771-81.
177. Lee, C. A., M. Silva, A. M. Siber, A. J. Kelly, E. Galyov, and B. A. McCormick. 2000b. A secreted Salmonella protein induces a proinflammatory response in epithelial cells, which promotes neutrophil migration. Proc Natl Acad Sci U S A 97:12283-8.
188 178. Lefkowitch, J. H., E. R. Schiff, G. L. Davis, R. P. Perrillo, K. Lindsay, H. C. Bodenheimer Jr, L. A. Balart, T. J. Ortego, J. Payne, J. L. Dienstag, and a. l. et. 1993. Pathological diagnosis of chronic hepatitis C: a multicenter comparative study with chronic hepatitis B. The Hepatitis Interventional Therapy Group. Gastroenterology 104:595-603.
179. Leikin-Frenkel, A., P. Parini, F. M. Konikoff, L. Benthin, D. Leikin-Gobbi, I. Goldiner, C. Einarsson, and T. Gilat. 2008. Hypocholesterolemic effects of fatty acid bile acid conjugates (FABACs) in mice. Arch Biochem Biophys 471:63-71.
180. Lejeune, P. 2003. Contamination of abiotic surfaces: what a colonizing bacterium sees and how to blur it. Trends Microbiol 11:179-84.
181. Levine, M. M., R. E. Black, and C. Lanata. 1982. Precise estimation of the numbers of chronic carriers of Salmonella typhi in Santiago, Chile, an endemic area. J Infect Dis 146:724-6.
182. Levine, M. M., C. Ferreccio, R. E. Black, and R. Germanier. 1987. Large- scale field trial of Ty21a live oral typhoid vaccine in enteric-coated capsule formulation. Lancet 1:1049-52.
183. Lewis, K. 2001. Riddle of biofilm resistance. Antimicrob Agents Chemother 45:999-1007.
184. Lewis, K. 2007. Persister cells, dormancy and infectious disease. Nat Rev Microbiol 5:48-56.
185. Lillehoj, E. P., B. T. Kim, and K. C. Kim. 2002. Identification of Pseudomonas aeruginosa flagellin as an adhesin for Muc1 mucin. Am J Physiol Lung Cell Mol Physiol 282:L751-6.
186. Lin, J., M. Akiba, O. Sahin, and Q. Zhang. 2005a. CmeR functions as a transcriptional repressor for the multidrug efflux pump CmeABC in Campylobacter jejuni. Antimicrob Agents Chemother 49:1067-75.
187. Lin, J., C. Cagliero, B. Guo, Y. W. Barton, M. C. Maurel, S. Payot, and Q. Zhang. 2005b. Bile salts modulate expression of the CmeABC multidrug efflux pump in Campylobacter jejuni. J Bacteriol 187:7417-24. 189 188. Lin, J. and A. Martinez. 2006. Effect of efflux pump inhibitors on bile resistance and in vivo colonization of Campylobacter jejuni. J Antimicrob Chemother 58:966-72.
189. Lin, J., O. Sahin, L. O. Michel, and Q. Zhang. 2003. Critical role of multidrug efflux pump CmeABC in bile resistance and in vivo colonization of Campylobacter jejuni. Infect Immun 71:4250-9.
190. Lippolis, J. D. 2008. Immunological signaling networks: integrating the body's immune response. J Anim Sci 86:E53-63.
191. Liu, X. and P. Matsumura. 1995. An alternative sigma factor controls transcription of flagellar class-III operons in Escherichia coli: gene sequence, overproduction, purification and characterization. Gene 164:81-4.
192. Lomovskaya, O. and K. Lewis. 1992. Emr, an Escherichia coli locus for multidrug resistance. Proc Natl Acad Sci U S A 89:8938-42.
193. Losonsky, G. A., C. Ferreccio, K. L. Kotloff, S. Kaintuck, J. B. Robbins, and M. M. Levine. 1987. Development and evaluation of an enzyme-linked immunosorbent assay for serum Vi antibodies for detection of chronic Salmonella typhi carriers. J Clin Microbiol 25:2266-9.
194. Lugowski, C. and E. Romanowska. 1991. Characterization of an enterobacterial common antigen (ECA) epitope recognized by anti-ECA-tetanus toxoid conjugate serum. FEMS Microbiol Lett 61:315-8.
195. Luo, N., O. Sahin, J. Lin, L. O. Michel, and Q. Zhang. 2003. In vivo selection of Campylobacter isolates with high levels of fluoroquinolone resistance associated with gyrA mutations and the function of the CmeABC efflux pump. Antimicrob Agents Chemother 47:390-4.
196. Lyons, S., L. Wang, J. E. Casanova, S. V. Sitaraman, D. Merlin, and A. T. Gewirtz. 2004. Salmonella typhimurium transcytoses flagellin via an SPI2- mediated vesicular transport pathway. J Cell Sci 117:5771-80.
197. Ma, D., D. N. Cook, J. E. Hearst, and H. Nikaido. 1994. Efflux pumps and drug resistance in gram-negative bacteria. Trends Microbiol 2:489-93.
190 198. Ma, L., M. Conover, H. Lu, M. R. Parsek, K. Bayles, and D. J. Wozniak. 2009. Assembly and Development of the Pseudomonas aeruginosa Biofilm Matrix. PLoS Pathog 5:e1000354.
199. MacVittie, T. J., A. D. O'Brien, R. I. Walker, and S. R. Weinberg. 1982. Inflammatory response of LPS-hyporesponsive and LPS-responsive mice to challenge with Gram-negative bacteria Salmonella typhimurium and Klebsiella pneumoniae. Adv Exp Med Biol 155:325-34.
200. Mah, T. F., B. Pitts, B. Pellock, G. C. Walker, P. S. Stewart, and G. A. O'Toole. 2003. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature 426:306-10.
201. Maira-Litran, T., D. G. Allison, and P. Gilbert. 2000. Expression of the multiple antibiotic resistance operon (mar) during growth of Escherichia coli as a biofilm. J Appl Microbiol 88:243-7.
202. Martens, G. W., M. C. Arikan, J. Lee, F. Ren, T. Vallerskog, and H. Kornfeld. 2008. Hypercholesterolemia impairs immunity to tuberculosis. Infect Immun 76:3464-72.
203. Maurer, K. J., M. C. Carey, and J. G. Fox. 2009. Roles of infection, inflammation, and the immune system in cholesterol gallstone formation. Gastroenterology 136:425-40.
204. Maurer, K. J., A. B. Rogers, Z. Ge, A. J. Wiese, M. C. Carey, and J. G. Fox. 2006. Helicobacter pylori and cholesterol gallstone formation in C57L/J mice: a prospective study. Am J Physiol Gastrointest Liver Physiol 290:G175-82.
205. McClaine, J. W. and R. M. Ford. 2002. Characterizing the adhesion of motile and nonmotile Escherichia coli to a glass surface using a parallel-plate flow chamber. Biotechnol Bioeng 78:179-89.
206. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-6.
191 207. McCormick, B. A., C. A. Parkos, S. P. Colgan, D. K. Carnes, and J. L. Madara. 1998. Apical secretion of a pathogen-elicited epithelial chemoattractant activity in response to surface colonization of intestinal epithelia by Salmonella typhimurium. J Immunol 160:455-66.
208. McGhie, E. J., L. C. Brawn, P. J. Hume, D. Humphreys, and V. Koronakis. 2009. Salmonella takes control: effector-driven manipulation of the host. Curr Opin Microbiol 12:117-24.
209. McMurry, J. L., J. S. Van Arnam, M. Kihara, and R. M. Macnab. 2004. Analysis of the cytoplasmic domains of Salmonella FlhA and interactions with components of the flagellar export machinery. J Bacteriol 186:7586-92.
210. McPhee, M. S. a. G. N. J. 1987. Diseases of the gallbladder and bile duct, pp. 1358-1362. Harrison's Principles of Internal Medicine, 11 ed. McGraw-Hill, New York, NY.
211. McSweegan, E. and R. I. Walker. 1986. Identification and characterization of two Campylobacter jejuni adhesins for cellular and mucous substrates. Infect Immun 53:141-8.
212. Merrell, D. S., S. M. Butler, F. Qadri, N. A. Dolganov, A. Alam, M. B. Cohen, S. B. Calderwood, G. K. Schoolnik, and A. Camilli. 2002. Host-induced epidemic spread of the cholera bacterium. Nature 417:642-5.
213. Merritt, J. H., K. M. Brothers, S. L. Kuchma, and G. A. O'Toole. 2007. SadC reciprocally influences biofilm formation and swarming motility via modulation of exopolysaccharide production and flagellar function. J Bacteriol 189:8154-64.
214. Methner, U., P. A. Barrow, D. Gregorova, and I. Rychlik. 2004. Intestinal colonisation-inhibition and virulence of Salmonella phoP, rpoS and ompC deletion mutants in chickens. Vet Microbiol 98:37-43.
215. Mey, A. R., S. A. Craig, and S. M. Payne. 2005. Characterization of Vibrio cholerae RyhB: the RyhB regulon and role of ryhB in biofilm formation. Infect Immun 73:5706-19.
192 216. Miao, E. A., M. Brittnacher, A. Haraga, R. L. Jeng, M. D. Welch, and S. I. Miller. 2003. Salmonella effectors translocated across the vacuolar membrane interact with the actin cytoskeleton. Mol Microbiol 48:401-15.
217. Miller, S. I. and J. J. Mekalanos. 1990. Constitutive expression of the phoP regulon attenuates Salmonella virulence and survival within macrophages. J Bacteriol 172:2485-90.
218. Minamino, T., R. Chu, S. Yamaguchi, and R. M. Macnab. 2000. Role of FliJ in flagellar protein export in Salmonella. J Bacteriol 182:4207-15.
219. Mohapatra, N. P., S. Soni, B. L. Bell, R. Warren, R. K. Ernst, A. Muszynski, R. W. Carlson, and J. S. Gunn. 2007. Identification of an orphan response regulator required for the virulence of Francisella spp. and transcription of pathogenicity island genes. Infect Immun 75:3305-14.
220. Monack, D. M., D. M. Bouley, and S. Falkow. 2004. Salmonella typhimurium persists within macrophages in the mesenteric lymph nodes of chronically infected Nramp1+/+ mice and can be reactivated by IFNgamma neutralization. J Exp Med 199:231-41.
221. Monds, R. D. and G. A. O'Toole. 2009. The developmental model of microbial biofilms: ten years of a paradigm up for review. Trends Microbiol 17:73-87.
222. Moorthy, S. and P. I. Watnick. 2004. Genetic evidence that the Vibrio cholerae monolayer is a distinct stage in biofilm development. Mol Microbiol 52:573-87.
223. Mortimer, P. P. 1999. Mr N the milker, and Dr Koch's concept of the healthy carrier. Lancet 353:1354-6.
224. Mower, H. F., R. M. Ray, R. Shoff, G. N. Stemmermann, A. Nomura, G. A. Glober, S. Kamiyama, A. Shimada, and H. Yamakawa. 1979. Fecal bile acids in two Japanese populations with different colon cancer risks. Cancer Res 39:328- 31.
225. Muhlradt, P. F. 1976. Topography of outer membrane assembly in Salmonella. J Supramol Struct 5:103-8.
193 226. Murray, P. R. R. K. S. K. G. S. a. P. M. A. 2002. Medical Microbiology. In Medical Microbiology, 4 ed. Mosby, Inc., St. Louis, MO.
227. Naarding, M. A., A. M. Dirac, I. S. Ludwig, D. Speijer, S. Lindquist, E. L. Vestman, M. J. Stax, T. B. Geijtenbeek, G. Pollakis, O. Hernell, and W. A. Paxton. 2006. Bile salt-stimulated lipase from human milk binds DC-SIGN and inhibits human immunodeficiency virus type 1 transfer to CD4+ T cells. Antimicrob Agents Chemother 50:3367-74.
228. Naarding, M. A., I. S. Ludwig, F. Groot, B. Berkhout, T. B. Geijtenbeek, G. Pollakis, and W. A. Paxton. 2005. Lewis X component in human milk binds DC-SIGN and inhibits HIV-1 transfer to CD4+ T lymphocytes. J Clin Invest 115:3256-64.
229. Nachamkin, I., B. M. Allos, and T. Ho. 1998. Campylobacter species and Guillain-Barre syndrome. Clin Microbiol Rev 11:555-67.
230. Nair, S., S. Alokam, S. Kothapalli, S. Porwollik, E. Proctor, C. Choy, M. McClelland, S. L. Liu, and K. E. Sanderson. 2004. Salmonella enterica serovar Typhi strains from which SPI7, a 134-kilobase island with genes for Vi exopolysaccharide and other functions, has been deleted. J Bacteriol 186:3214-23.
231. Nauciel, C., E. Ronco, J. L. Guenet, and M. Pla. 1988. Role of H-2 and non-H- 2 genes in control of bacterial clearance from the spleen in Salmonella typhimurium-infected mice. Infect Immun 56:2407-11.
232. Nawabi, P., D. M. Catron, and K. Haldar. 2008. Esterification of cholesterol by a type III secretion effector during intracellular Salmonella infection. Mol Microbiol 68:173-85.
233. Negm, R. S. and T. G. Pistole. 1999. The porin OmpC of Salmonella typhimurium mediates adherence to macrophages. Can J Microbiol 45:658-69.
234. Nikaido, H. 1976. Outer membrane of Salmonella typhimurium. Transmembrane diffusion of some hydrophobic substances. Biochim Biophys Acta 433:118-32.
235. Nikaido, H. a. V. M. 1987. Outer Membrane, pp. 7-22. Escherichia coli and Salmonella typhimurium , 1 ed. American Society for Microbiology, Washington, DC. 194 236. Norioka, S., G. Ramakrishnan, K. Ikenaka, and M. Inouye. 1986. Interaction of a transcriptional activator, OmpR, with reciprocally osmoregulated genes, ompF and ompC, of Escherichia coli. J Biol Chem 261:17113-9.
237. Nuccio, S. P., D. Chessa, E. H. Weening, M. Raffatellu, S. Clegg, and A. J. Baumler. 2007. SIMPLE approach for isolating mutants expressing fimbriae. Appl Environ Microbiol 73:4455-62.
238. O'Toole, G. A. and R. Kolter. 1998a. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28:449-61.
239. O'Toole, G. A. and R. Kolter. 1998b. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30:295-304.
240. Ohnishi, K., K. Kutsukake, H. Suzuki, and T. Iino. 1990. Gene fliA encodes an alternative sigma factor specific for flagellar operons in Salmonella typhimurium. Mol Gen Genet 221:139-47.
241. Olive, A. J., R. Kenjale, M. Espina, D. S. Moore, W. L. Picking, and W. D. Picking. 2007. Bile salts stimulate recruitment of IpaB to the Shigella flexneri surface, where it colocalizes with IpaD at the tip of the type III secretion needle. Infect Immun 75:2626-9.
242. Opleta, K., J. D. Butzner, E. A. Shaffer, and D. G. Gall. 1988. The effect of protein-calorie malnutrition on the developing liver. Pediatr Res 23:505-8.
243. Ordway, D., M. Harton, M. Henao-Tamayo, R. Montoya, I. M. Orme, and M. Gonzalez-Juarrero. 2006. Enhanced macrophage activity in granulomatous lesions of immune mice challenged with Mycobacterium tuberculosis. J Immunol 176:4931-9.
244. Pagel, M., V. Simonet, J. Li, M. Lallemand, B. Lauman, and A. H. Delcour. 2007. Phenotypic characterization of pore mutants of the Vibrio cholerae porin OmpU. J Bacteriol 189:8593-600.
195 245. Parkhill, J., G. Dougan, K. D. James, N. R. Thomson, D. Pickard, J. Wain, C. Churcher, K. L. Mungall, S. D. Bentley, M. T. Holden, M. Sebaihia, S. Baker, D. Basham, K. Brooks, T. Chillingworth, P. Connerton, A. Cronin, P. Davis, R. M. Davies, L. Dowd, N. White, J. Farrar, T. Feltwell, N. Hamlin, A. Haque, T. T. Hien, S. Holroyd, K. Jagels, A. Krogh, T. S. Larsen, S. Leather, S. Moule, P. O'Gaora, C. Parry, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848-52.
246. Parkinson, J. S. 1993. Signal transduction schemes of bacteria. Cell 73:857-71.
247. Parry, C. M., T. T. Hien, G. Dougan, N. J. White, and J. J. Farrar. 2002. Typhoid fever. N Engl J Med 347:1770-82.
248. Paterson, J. C. 1949. Typhoid and the paratyphoids; a review. Postgrad Med J 25:413-20.
249. Paumgartner, G. and T. Sauerbruch. 1991. Gallstones: pathogenesis. Lancet 338:1117-21.
250. Picioreanu, C., J. U. Kreft, M. Klausen, J. A. Haagensen, T. Tolker-Nielsen, and S. Molin. 2007. Microbial motility involvement in biofilm structure formation--a 3D modelling study. Water Sci Technol 55:337-43.
251. Pickard, D., J. Li, M. Roberts, D. Maskell, D. Hone, M. Levine, G. Dougan, and S. Chatfield. 1994. Characterization of defined ompR mutants of Salmonella typhi: ompR is involved in the regulation of Vi polysaccharide expression. Infect Immun 62:3984-93.
252. Pizza, F. X., T. J. McLoughlin, S. J. McGregor, E. P. Calomeni, and W. T. Gunning. 2001. Neutrophils injure cultured skeletal myotubes. Am J Physiol Cell Physiol 281:C335-41.
253. Pope, L. M., K. E. Reed, and S. M. Payne. 1995a. Increased protein secretion and adherence to HeLa cells by Shigella spp. following growth in the presence of bile salts. Infect Immun 63:3642-8.
196 254. Pope, M., S. Gezelter, N. Gallo, L. Hoffman, and R. M. Steinman. 1995b. Low levels of HIV-1 infection in cutaneous dendritic cells promote extensive viral replication upon binding to memory CD4+ T cells. J Exp Med 182: 2045-56.
255. Popoff, M. Y., J. Bockemuhl, and F. W. Brenner. 2000. Supplement 1998 (no. 42) to the Kauffmann-White scheme. Res Microbiol 151:63-5.
256. Portincasa, P., A. Moschetta, and G. Palasciano. 2006. Cholesterol gallstone disease. Lancet 368:230-9.
257. Pratt, L. A. and R. Kolter. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol 30:285-93.
258. Prieto, A. I., F. Ramos-Morales, and J. Casadesus. 2004. Bile-induced DNA damage in Salmonella enterica. Genetics 168:1787-94.
259. Prigent-Combaret, C., G. Prensier, T. T. Le Thi, O. Vidal, P. Lejeune, and C. Dorel. 2000. Developmental pathway for biofilm formation in curli-producing Escherichia coli strains: role of flagella, curli and colanic acid. Environ Microbiol 2:450-64.
260. Prigent-Combaret, C., O. Vidal, C. Dorel, and P. Lejeune. 1999. Abiotic surface sensing and biofilm-dependent regulation of gene expression in Escherichia coli. J Bacteriol 181:5993-6002.
261. Prouty, A. M., I. E. Brodsky, S. Falkow, and J. S. Gunn. 2004a. Bile-salt- mediated induction of antimicrobial and bile resistance in Salmonella typhimurium. Microbiology 150:775-83.
262. Prouty, A. M., I. E. Brodsky, J. Manos, R. Belas, S. Falkow, and J. S. Gunn. 2004b. Transcriptional regulation of Salmonella enterica serovar Typhimurium genes by bile. FEMS Immunol Med Microbiol 41:177-85.
263. Prouty, A. M. and J. S. Gunn. 2000. Salmonella enterica serovar typhimurium invasion is repressed in the presence of bile. Infect Immun 68:6763-9.
197 264. Prouty, A. M. and J. S. Gunn. 2003. Comparative analysis of Salmonella enterica serovar Typhimurium biofilm formation on gallstones and on glass. Infect Immun 71:7154-8.
265. Prouty, A. M., W. H. Schwesinger, and J. S. Gunn. 2002a. Biofilm formation and interaction with the surfaces of gallstones by Salmonella spp. Infect Immun 70:2640-9.
266. Prouty, A. M., J. C. Van Velkinburgh, and J. S. Gunn. 2002b. Salmonella enterica serovar typhimurium resistance to bile: identification and characterization of the tolQRA cluster. J Bacteriol 184:1270-6.
267. Provenzano, D. and K. E. Klose. 2000. Altered expression of the ToxR- regulated porins OmpU and OmpT diminishes Vibrio cholerae bile resistance, virulence factor expression, and intestinal colonization. Proc Natl Acad Sci U S A 97:10220-4.
268. Provenzano, D., D. A. Schuhmacher, J. L. Barker, and K. E. Klose. 2000. The virulence regulatory protein ToxR mediates enhanced bile resistance in Vibrio cholerae and other pathogenic Vibrio species. Infect Immun 68:1491-7.
269. Puente, J. L., A. Verdugo-Rodriguez, and E. Calva. 1991. Expression of Salmonella typhi and Escherichia coli OmpC is influenced differently by medium osmolarity; dependence on Escherichia coli OmpR. Mol Microbiol 5:1205-10.
270. Rabsch, W., H. Tschape, and A. J. Baumler. 2001. Non-typhoidal salmonellosis: emerging problems. Microbes Infect 3:237-47.
271. Raffatellu, M., D. Chessa, R. P. Wilson, C. Tukel, M. Akcelik, and A. J. Baumler. 2006. Capsule-mediated immune evasion: a new hypothesis explaining aspects of typhoid fever pathogenesis. Infect Immun 74:19-27.
272. Ramos-Morales, F., A. I. Prieto, C. R. Beuzon, D. W. Holden, and J. Casadesus. 2003. Role for Salmonella enterica enterobacterial common antigen in bile resistance and virulence. J Bacteriol 185:5328-32.
273. Ramsey, D. M. and D. J. Wozniak. 2005. Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol Microbiol 56:309-22. 198 274. Read, R. R. and J. W. Costerton. 1987. Purification and characterization of adhesive exopolysaccharides from Pseudomonas putida and Pseudomonas fluorescens. Can J Microbiol 33:1080-90.
275. Reed, R. P., F. O. Wegerhoff, and A. D. Rothberg. 1996. Bacteraemia in malnourished rural African children. Ann Trop Paediatr 16:61-8. Notes: GENERAL NOTE: PIP: TJ: ANNALS OF TROPICAL PAEDIATRICS.
276. Reihner, E. and D. Stahlberg. 1996. Lithogenic diet and gallstone formation in mice: integrated response of activities of regulatory enzymes in hepatic cholesterol metabolism. Br J Nutr 76:765-72.
277. Reynoso-Paz, S., R. L. Coppel, I. R. Mackay, N. M. Bass, A. A. Ansari, and M. E. Gershwin. 1999. The immunobiology of bile and biliary epithelium. Hepatology 30:351-7.
278. Richter-Dahlfors, A., A. M. Buchan, and B. B. Finlay. 1997. Murine salmonellosis studied by confocal microscopy: Salmonella typhimurium resides intracellularly inside macrophages and exerts a cytotoxic effect on phagocytes in vivo. J Exp Med 186:569-80.
279. Rivera-Amill, V., B. J. Kim, J. Seshu, and M. E. Konkel. 2001. Secretion of the virulence-associated Campylobacter invasion antigens from Campylobacter jejuni requires a stimulatory signal. J Infect Dis 183:1607-16.
280. Roberts, I. S. 1996. The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu Rev Microbiol 50:285-315.
281. Rochon, M. and U. Romling. 2006. Flagellin in combination with curli fimbriae elicits an immune response in the gastrointestinal epithelial cell line HT-29. Microbes Infect 8:2027-33.
282. Rodriguez-Morales, O., M. Fernandez-Mora, I. Hernandez-Lucas, A. Vazquez, J. L. Puente, and E. Calva. 2006. Salmonella enterica serovar Typhimurium ompS1 and ompS2 mutants are attenuated for virulence in mice. Infect Immun 74:1398-402.
199 283. Romling, U., W. D. Sierralta, K. Eriksson, and S. Normark. 1998. Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfD promoter. Mol Microbiol 28:249-64.
284. Roumagnac, P., F. X. Weill, C. Dolecek, S. Baker, S. Brisse, N. T. Chinh, T. A. Le, C. J. Acosta, J. Farrar, G. Dougan, and M. Achtman. 2006. Evolutionary history of Salmonella typhi. Science 314:1301-4.
285. Royle, M. C., S. Totemeyer, L. C. Alldridge, D. J. Maskell, and C. E. Bryant. 2003. Stimulation of Toll-like receptor 4 by lipopolysaccharide during cellular invasion by live Salmonella typhimurium is a critical but not exclusive event leading to macrophage responses. J Immunol 170:5445-54.
286. Rudner, X. L., L. D. Hazlett, and R. S. Berk. 1992. Systemic and topical protection studies using Pseudomonas aeruginosa flagella in an ocular model of infection. Curr Eye Res 11:727-38.
287. Ryder, C., M. Byrd, and D. J. Wozniak. 2007. Role of polysaccharides in Pseudomonas aeruginosa biofilm development. Curr Opin Microbiol 10:644-8.
288. Saijo-Hamano, Y., K. Imada, T. Minamino, M. Kihara, R. M. Macnab, and K. Namba. 2005. Crystallization and preliminary X-ray analysis of the C- terminal cytoplasmic domain of FlhA, a membrane-protein subunit of the bacterial flagellar type III protein-export apparatus. Acta Crystallogr Sect F Struct Biol Cryst Commun 61:599-602.
289. Saini, S., J. A. Pearl, and C. V. Rao. 2009. Role of FimW, FimY, and FimZ in regulating the expression of type i fimbriae in Salmonella enterica serovar Typhimurium. J Bacteriol 191:3003-10.
290. Sakuragi, Y. and R. Kolter. 2007. Quorum-sensing regulation of the biofilm matrix genes (pel) of Pseudomonas aeruginosa. J Bacteriol 189:5383-6.
291. Salcedo, S. P., M. Noursadeghi, J. Cohen, and D. W. Holden. 2001. Intracellular replication of Salmonella typhimurium strains in specific subsets of splenic macrophages in vivo. Cell Microbiol 3:587-97.
200 292. Sambrook, J. E. F. F. a. T. M. 1989. Molecular cloning: a laboratory manual. In Molecular cloning: a laboratory manual, 2 ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
293. Santander, J., S. Y. Wanda, C. A. Nickerson, and R. Curtiss 3rd. 2007. Role of RpoS in fine-tuning the synthesis of Vi capsular polysaccharide in Salmonella enterica serotype Typhi. Infect Immun 75:1382-92.
294. Santos, R. L., S. Zhang, R. M. Tsolis, A. J. Baumler, and L. G. Adams. 2002. Morphologic and molecular characterization of Salmonella typhimurium infection in neonatal calves. Vet Pathol 39:200-15.
295. Saravanan, V. and T. R. Sreekrishnan. 2006. Modelling anaerobic biofilm reactors--a review. J Environ Manage 81:1-18.
296. Sauer, K., A. K. Camper, G. D. Ehrlich, J. W. Costerton, and D. G. Davies. 2002. Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J Bacteriol 184:1140-54.
297. Schaechter, M. a. N. F. C. 1987. Introduction, pp. 1-2. Escherichia coli and Salmonella Typhimurium Cellular and Molecular Biology, 1 ed. American Society for Microbiology, Washington, DC.
298. Schmid, M. B. and J. R. Roth. 1983. Genetic methods for analysis and manipulation of inversion mutations in bacteria. Genetics 105:517-37.
299. Schoenhals, G. J. and R. M. Macnab. 1999. FliL is a membrane-associated component of the flagellar basal body of Salmonella. Microbiology 145 ( Pt 7):1769-75.
300. Schuhmacher, D. A. and K. E. Klose. 1999. Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae. J Bacteriol 181:1508-14.
301. Sharma, A. and A. Qadri. 2004. Vi polysaccharide of Salmonella typhi targets the prohibitin family of molecules in intestinal epithelial cells and suppresses early inflammatory responses. Proc Natl Acad Sci U S A 101:17492-7.
201 302. Shoheiber, O., J. E. Biskupiak, and D. B. Nash. 1997. Estimation of the cost savings resulting from the use of ursodiol for the prevention of gallstones in obese patients undergoing rapid weight reduction. Int J Obes Relat Metab Disord 21:1038-45.
303. Silverman, M., J. Zieg, M. Hilmen, and M. Simon. 1979. Phase variation in Salmonella: genetic analysis of a recombinational switch. Proc Natl Acad Sci U S A 76:391-5.
304. Simm, R., J. D. Fetherston, A. Kader, U. Romling, and R. D. Perry. 2005. Phenotypic convergence mediated by GGDEF-domain-containing proteins. J Bacteriol 187:6816-23.
305. Simm, R., M. Morr, A. Kader, M. Nimtz, and U. Romling. 2004. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol Microbiol 53:1123-34.
306. Simon, R. and C. E. Samuel. 2007. Activation of NF-kappaB-dependent gene expression by Salmonella flagellins FliC and FljB. Biochem Biophys Res Commun 355:280-5.
307. Simon, R. and C. E. Samuel. 2008. Interleukin-1 beta secretion is activated comparably by FliC and FljB flagellins but differentially by wild-type and DNA adenine methylase-deficient salmonella. J Interferon Cytokine Res 28:661-6.
308. Sinnott, C. R. and A. J. Teall. 1987. Persistent gallbladder carriage of Salmonella typhi. Lancet 1:976.
309. Sjovall, J. 1959. Dietary glycine and taurine on bile acid conjugation in man; bile acids and steroids 75. Proc Soc Exp Biol Med 100:676-8.
310. Skamene, E., E. Schurr, and P. Gros. 1998. Infection genomics: Nramp1 as a major determinant of natural resistance to intracellular infections. Annu Rev Med 49:275-87.
311. Sleator, R. D., H. H. Wemekamp-Kamphuis, C. G. Gahan, T. Abee, and C. Hill. 2005. A PrfA-regulated bile exclusion system (BilE) is a novel virulence factor in Listeria monocytogenes. Mol Microbiol 55:1183-95.
202 312. Slutsker, L., S. F. Altekruse, and D. L. Swerdlow. 1998. Foodborne diseases. Emerging pathogens and trends. Infect Dis Clin North Am 12:199-216.
313. Stecher, B., S. Hapfelmeier, C. Muller, M. Kremer, T. Stallmach, and W. D. Hardt. 2004. Flagella and chemotaxis are required for efficient induction of Salmonella enterica serovar Typhimurium colitis in streptomycin-pretreated mice. Infect Immun 72:4138-50.
314. Steinberg, D. A., M. A. Hurst, C. A. Fujii, A. H. Kung, J. F. Ho, F. C. Cheng, D. J. Loury, and J. C. Fiddes. 1997. Protegrin-1: a broad-spectrum, rapidly microbicidal peptide with in vivo activity. Antimicrob Agents Chemother 41:1738-42.
315. Stewart, P. S. and J. W. Costerton. 2001. Antibiotic resistance of bacteria in biofilms. Lancet 358:135-8.
316. Stewart, P. S. and M. J. Franklin. 2008. Physiological heterogeneity in biofilms. Nat Rev Microbiol 6:199-210.
317. Stintzi, A., D. Marlow, K. Palyada, H. Naikare, R. Panciera, L. Whitworth, and C. Clarke. 2005. Use of genome-wide expression profiling and mutagenesis to study the intestinal lifestyle of Campylobacter jejuni. Infect Immun 73:1797- 810.
318. Stock, A. M. and J. B. Stock. 1987. Purification and characterization of the CheZ protein of bacterial chemotaxis. J Bacteriol 169:3301-11.
319. Stoodley, P., K. Sauer, D. G. Davies, and J. W. Costerton. 2002. Biofilms as complex differentiated communities. Annu Rev Microbiol 56:187-209.
320. Surette, M. G. and B. L. Bassler. 1999. Regulation of autoinducer production in Salmonella typhimurium. Mol Microbiol 31:585-95.
321. Svensater, G., J. Welin, J. C. Wilkins, D. Beighton, and I. R. Hamilton. 2001. Protein expression by planktonic and biofilm cells of Streptococcus mutans. FEMS Microbiol Lett 205:139-46.
203 322. Tauxe, R. V. 2002. Emerging foodborne pathogens. Int J Food Microbiol 78:31- 41.
323. Teplitski, M., A. Al-Agely, and B. M. Ahmer. 2006. Contribution of the SirA regulon to biofilm formation in Salmonella enterica serovar Typhimurium. Microbiology 152:3411-24.
324. Thanassi, D. G., L. W. Cheng, and H. Nikaido. 1997. Active efflux of bile salts by Escherichia coli. J Bacteriol 179:2512-8.
325. Thomas, D., D. G. Morgan, and D. J. DeRosier. 2001. Structures of bacterial flagellar motors from two FliF-FliG gene fusion mutants. J Bacteriol 183:6404- 12.
326. Thomas, D. R., N. R. Francis, C. Xu, and D. J. DeRosier. 2006. The three- dimensional structure of the flagellar rotor from a clockwise-locked mutant of Salmonella enterica serovar Typhimurium. J Bacteriol 188:7039-48.
327. Tinker, J. K., L. S. Hancox, and S. Clegg. 2001. FimW is a negative regulator affecting type 1 fimbrial expression in Salmonella enterica serovar typhimurium. J Bacteriol 183:435-42.
328. Tischler, A. D. and A. Camilli. 2004. Cyclic diguanylate (c-di-GMP) regulates Vibrio cholerae biofilm formation. Mol Microbiol 53:857-69.
329. Tiwari, S. K., A. A. Khan, M. Ibrahim, M. A. Habeeb, and C. M. Habibullah. 2006. Helicobacter pylori and other Helicobacter species DNA in human bile samples from patients with various hepato-biliary diseases. World J Gastroenterol 12:2181-6.
330. Toledo-Arana, A., J. Valle, C. Solano, M. J. Arrizubieta, C. Cucarella, M. Lamata, B. Amorena, J. Leiva, J. R. Penades, and I. Lasa. 2001. The enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation. Appl Environ Microbiol 67:4538-45.
331. Toro, C. S., S. R. Lobos, I. Calderon, M. Rodriguez, and G. C. Mora. 1990. Clinical isolate of a porinless Salmonella typhi resistant to high levels of chloramphenicol. Antimicrob Agents Chemother 34:1715-9.
204 332. Torrelles, J. B., A. K. Azad, and L. S. Schlesinger. 2006. Fine discrimination in the recognition of individual species of phosphatidyl-myo-inositol mannosides from Mycobacterium tuberculosis by C-type lectin pattern recognition receptors. J Immunol 177:1805-16.
333. Torres, A. G., C. B. Tutt, L. Duval, V. Popov, A. B. Nasr, J. Michalski, and I. C. Scaletsky. 2007. Bile salts induce expression of the afimbrial LDA adhesin of atypical enteropathogenic Escherichia coli. Cell Microbiol 9:1039-49.
334. Trabulsi, L. R., R. Keller, and T. A. Tardelli Gomes. 2002. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis 8:508-13.
335. Tsolis, R. M., G. M. Young, J. V. Solnick, and A. J. Baumler. 2008. From bench to bedside: stealth of enteroinvasive pathogens. Nat Rev Microbiol 6:883- 92.
336. Tukel, C., M. Raffatellu, D. Chessa, R. P. Wilson, M. Akcelik, and A. J. Baumler. 2006. Neutrophil influx during non-typhoidal salmonellosis: who is in the driver's seat? FEMS Immunol Med Microbiol 46:320-9.
337. Uchiya, K. and T. Nikai. 2008. Salmonella virulence factor SpiC is involved in expression of flagellin protein and mediates activation of the signal transduction pathways in macrophages. Microbiology 154:3491-502.
338. Ueno, T., K. Oosawa, and S. Aizawa. 1992. M ring, S ring and proximal rod of the flagellar basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF. J Mol Biol 227:672-7.
339. Vaishnavi, C., S. Singh, R. Kochhar, D. Bhasin, G. Singh, and K. Singh. 2005. Prevalence of Salmonella enterica serovar typhi in bile and stool of patients with biliary diseases and those requiring biliary drainage for other purposes. Jpn J Infect Dis 58:363-5.
340. Valtonen, M. V., U. M. Larinkari, M. Plosila, V. V. Valtonen, and P. H. Makela. 1976. Effect of enterobacterial common antigen on mouse virulence of Salmonella typhimurium. Infect Immun 13:1601-5.
205 341. Van Eldere, J., P. Celis, G. De Pauw, E. Lesaffre, and H. Eyssen. 1996. Tauroconjugation of cholic acid stimulates 7 alpha-dehydroxylation by fecal bacteria. Appl Environ Microbiol 62:656-61.
342. van Loosdrecht, M. C., J. J. Heijnen, H. Eberl, J. Kreft, and C. Picioreanu. 2002. Mathematical modelling of biofilm structures. Antonie Van Leeuwenhoek 81:245-56.
343. van Velkinburgh, J. C. and J. S. Gunn. 1999. PhoP-PhoQ-regulated loci are required for enhanced bile resistance in Salmonella spp. Infect Immun 67:1614- 22.
344. Vaudaux, P. E., P. Francois, R. A. Proctor, D. McDevitt, T. J. Foster, R. M. Albrecht, D. P. Lew, H. Wabers, and S. L. Cooper. 1995. Use of adhesion- defective mutants of Staphylococcus aureus to define the role of specific plasma proteins in promoting bacterial adhesion to canine arteriovenous shunts. Infect Immun 63:585-90.
345. Vazquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Dominguez- Bernal, W. Goebel, B. Gonzalez-Zorn, J. Wehland, and J. Kreft. 2001. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev 14:584-640.
346. Vazquez-Torres, A., J. Jones-Carson, A. J. Baumler, S. Falkow, R. Valdivia, W. Brown, M. Le, R. Berggren, W. T. Parks, and F. C. Fang. 1999. Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature 401:804-8.
347. Vazquez-Torres, A., B. A. Vallance, M. A. Bergman, B. B. Finlay, B. T. Cookson, J. Jones-Carson, and F. C. Fang. 2004. Toll-like receptor 4 dependence of innate and adaptive immunity to Salmonella: importance of the Kupffer cell network. J Immunol 172:6202-8.
348. von Bodman, S. B., J. M. Willey, and S. P. Diggle. 2008. Cell-cell communication in bacteria: united we stand. J Bacteriol 190:4377-91.
349. Wahdan, M. H., C. Serie, Y. Cerisier, S. Sallam, and R. Germanier. 1982. A controlled field trial of live Salmonella typhi strain Ty 21a oral vaccine against typhoid: three-year results. J Infect Dis 145:292-5.
206 350. Walker, T. S., K. L. Tomlin, G. S. Worthen, K. R. Poch, J. G. Lieber, M. T. Saavedra, M. B. Fessler, K. C. Malcolm, M. L. Vasil, and J. A. Nick. 2005. Enhanced Pseudomonas aeruginosa biofilm development mediated by human neutrophils. Infect Immun 73:3693-701.
351. Wang, D. Q. and S. Tazuma. 2002. Effect of beta-muricholic acid on the prevention and dissolution of cholesterol gallstones in C57L/J mice. J Lipid Res 43:1960-8.
352. Wang, Q., J. G. Frye, M. McClelland, and R. M. Harshey. 2004. Gene expression patterns during swarming in Salmonella typhimurium: genes specific to surface growth and putative new motility and pathogenicity genes. Mol Microbiol 52:169-87.
353. Wang, Y., L. Ding, Y. Hu, Y. Zhang, B. Yang, and S. Chen. 2007. The flhDC gene affects motility and biofilm formation in Yersinia pseudotuberculosis. Sci China C Life Sci 50:814-21.
354. Ward, J. M. 2000. Pathology of Genetically Engineered Mice. In J. F. M. R. R. a. S. J. P. Mahler (ed.), Pathology of Genetically Engineered Mice, 1 ed. Iowa State University Press, Ames, Iowa.
355. Warriner, K., S. Spaniolas, M. Dickinson, C. Wright, and W. M. Waites. 2003. Internalization of bioluminescent Escherichia coli and Salmonella Montevideo in growing bean sprouts. J Appl Microbiol 95:719-27.
356. Watnick, P. and R. Kolter. 2000. Biofilm, city of microbes. J Bacteriol 182:2675-9.
357. Watnick, P. I., C. M. Lauriano, K. E. Klose, L. Croal, and R. Kolter. 2001. The absence of a flagellum leads to altered colony morphology, biofilm development and virulence in Vibrio cholerae O139. Mol Microbiol 39:223-35.
358. Wen, Z. T. and R. A. Burne. 2002. Functional genomics approach to identifying genes required for biofilm development by Streptococcus mutans. Appl Environ Microbiol 68:1196-203.
207 359. White, A. P., D. L. Gibson, S. K. Collinson, P. A. Banser, and W. W. Kay. 2003. Extracellular polysaccharides associated with thin aggregative fimbriae of Salmonella enterica serovar enteritidis. J Bacteriol 185:5398-407.
360. Whiteley, M., M. G. Bangera, R. E. Bumgarner, M. R. Parsek, G. M. Teitzel, S. Lory, and E. P. Greenberg. 2001. Gene expression in Pseudomonas aeruginosa biofilms. Nature 413:860-4.
361. Whitfield, C. and I. S. Roberts. 1999. Structure, assembly and regulation of expression of capsules in Escherichia coli. Mol Microbiol 31: 1307-19.
362. Wibbenmeyer, J. A., D. Provenzano, C. F. Landry, K. E. Klose, and A. H. Delcour. 2002. Vibrio cholerae OmpU and OmpT porins are differentially affected by bile. Infect Immun 70:121-6.
363. Williams, I., W. A. Venables, D. Lloyd, F. Paul, and I. Critchley. 1997. The effects of adherence to silicone surfaces on antibiotic susceptibility in Staphylococcus aureus. Microbiology 143 ( Pt 7):2407-13.
364. Wilson, R. P., M. Raffatellu, D. Chessa, S. E. Winter, C. Tukel, and A. J. Baumler. 2008. The Vi-capsule prevents Toll-like receptor 4 recognition of Salmonella. Cell Microbiol 10:876-90.
365. Wittenburg, H., M. A. Lyons, B. Paigen, and M. C. Carey. 2003. Mapping cholesterol gallstone susceptibility (Lith) genes in inbred mice. Dig Liver Dis 35 Suppl 3:S2-7.
366. Wolf, J. L., D. H. Rubin, R. Finberg, R. S. Kauffman, A. H. Sharpe, J. S. Trier, and B. N. Fields. 1981. Intestinal M cells: a pathway for entry of reovirus into the host. Science 212:471-2.
367. Worku, M. L., Q. N. Karim, J. Spencer, and R. L. Sidebotham. 2004. Chemotactic response of Helicobacter pylori to human plasma and bile. J Med Microbiol 53:807-11.
368. Worley, M. J., K. H. Ching, and F. Heffron. 2000. Salmonella SsrB activates a global regulon of horizontally acquired genes. Mol Microbiol 36:749-61.
208 369. Xu, Q., M. Dziejman, and J. J. Mekalanos. 2003. Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro. Proc Natl Acad Sci U S A 100:1286-91.
370. Yang, X., Q. Ma, and T. K. Wood. 2008. The R1 conjugative plasmid increases Escherichia coli biofilm formation through an envelope stress response. Appl Environ Microbiol 74:2690-9.
371. Yildiz, F. H. and G. K. Schoolnik. 1999. Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation. Proc Natl Acad Sci U S A 96:4028-33.
372. Zgurskaya, H. I. and H. Nikaido. 1999. Bypassing the periplasm: reconstitution of the AcrAB multidrug efflux pump of Escherichia coli. Proc Natl Acad Sci U S A 96:7190-5.
209