The Molecular and Electrophysiological Characterisation of Catecholaminergic Polymorphic Ventricular Tachycardia

THE MOLECULAR AND ELECTROPHYSIOLOGICAL CHARACTERISATION OF CATECHOLAMINERGIC POLYMORPHIC VENTRICULAR TACHYCARDIA

A Thesis submitted to the University of Manchester for the degree of

Master of Philosophy

in the Faculty of Medical and Human Sciences

2015

CLAIRE BAILEY

School of Medicine

Contents

List of Figures ...... 4 List of Tables ...... 5 List of Abbreviations ...... 6 Abstract ...... 8 Declaration ...... 9 Copyright Statement ...... 10 Acknowledgments ...... 11 Preface ...... 12 Introduction ...... 13 Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT) ...... 13 Clinical Features of CPVT ...... 13 Treatment of CPVT ...... 14 Genetics of CPVT ...... 15 Cardiac Ryanodine Receptor gene (RYR2) ...... 16 The cardiac ryanodine receptor and calcium handling ...... 17 Embryonic stem cells and induced pluripotent stem cells ...... 21 Application of human induced pluripotent stem cells in modelling inherited cardiac conditions ...... 22 The present study ...... 25 Hypotheses ...... 26 Methods ...... 27 Ethics and Funding ...... 27 Clinical Details ...... 27 Generation of hiPSCs ...... 29 Cardiomyocyte differentiation ...... 29 Immunostaining ...... 30 Sequencing for Single Nucleotide Polymorphisms ...... 30 Nonsense mediated decay ...... 31 RNA extraction and cDNA production ...... 32 Quantitative PCR ...... 32 Calcium Imaging ...... 34 Baseline Imaging ...... 35 Effects of Isoproterenol ...... 35 Store Overload Induced Calcium Release ...... 36 Effects of Carvedilol ...... 36 Results ...... 37 hiPSCs carrying the p.(Arg4790Ter) mutation are pluripotent and can be differentiated into cardiomyocytes ...... 37

hiPSC-CMs with the p.(Arg4790Ter) mutation express both RYR2 alleles...... 38 Nonsense mediated decay...... 42 Calcium imaging ...... 44 RYR2 hiPSC-CMs display calcium transient abnormalities at baseline ...... 44 Isoproterenol induces calcium transient abnormalities in the RYR2 hiPSC-CMs ...... 45 The RYR2 hiPSC-CMs have an increased propensity to develop calcium waves at lower external calcium concentrations ...... 46 Carvedilol corrects calcium transient abnormalities in RYR2 hiPSC-CMs ...... 47 Discussion ...... 49 Does the p.(Arg4790Ter) RYR2 mutation result in haploinsufficiency? ...... 49 How does the p.(Arg4790Ter) RYR2 mutation result in an abnormal calcium handling phenotype? ...... 52 Arrhythmias at Baseline ...... 52 Effects of Isoproterenol ...... 52 Store Overload Induced Calcium Release ...... 53 Pharmacological correction of calcium transient abnormalities ...... 54 Further Work ...... 56 Limitations of Study ...... 58 Conclusions ...... 60 References ...... 61 Appendix ...... 66

Word count: 18892

List of Figures

Figure 1. Episode of bidirectional ventricular tachycardia during an exercise stress test in a patient with catecholaminergic polymorphic ventricular tachycardia. (From Venetucci et al Nature Reviews Cardiology, 2012)...... 14 Figure 2. Mutation clustering within the RYR2 gene. (Adapted from Medeiros-Domingo A et al J Am Coll Cardiol 2009.(26)) ...... 16 Figure 3. Systolic calcium release. (Adapted with permission from a figure courtesy of Dr L Venetucci)...... 18 Figure 4. Diastolic calcium release resulting in arrhythmias. (Adapted with permission from a figure courtesy of Dr L Venetucci)...... 19 Figure 5. Triggered activity and DAD. (Adapted with permission from a figure courtesy of Dr L Venetucci)...... 19 Figure 6. Pedigree of family in which the p.(Arg4790Ter) RYR2 mutation was identified. 29 Figure 7. Immunostaining of undifferentiated RYR2 hiPSC colonies for the pluripotent markers NANOG, OCT4, SSEA4 and TRA-1-60...... 37 Figure 8. Immunostaining of RYR2 hiPSC-CMs for the cardiac markers troponin I and α– actinin...... 38 Figure 9. Sequence trace of DNA extracted from hiPSCs showing the RYR2 mutation, c.14368C>T p.(Arg4790Ter)...... 38 Figure 10. qPCR for total RYR2 expression on RNA extracted from cardiomyocytes generated from two RYR2 hiPSC clones (RYR2-1 and RYR2-3) and a control hiPSC line (UN1-22) ...... 39 Figure 11. Allele-specific qPCR where allele specificity is based on rs684923 on RNA isolated from cardiomyocytes generated from two RYR2-hiPSC clones (RYR2-1 and RYR2- 3) and a control hiPSC line (UN1-22)...... 40 Figure 12. Allele-specific qPCR where allele specificity is based on rs3765097 from RNA isolated from cardiomyocytes generated two RYR2 clones (RYR2-1 and RYR2-3) and a control hiPSC line (UN1-22)...... 41 Figure 13. Total RYR2 expression assessed by general primers used in the allele-specific qPCR based on rs684923 on RNA extracted from cardiomyocytes generated from the RYR2 hiPSC clones (RYR2-1 and RYR2-3) and the control hiPSC line...... 41 Figure 14. qPCR demonstrating total LAMP2 expression in Danon hiPSC-CMs treated with cycloheximide for 3, 6 and 9 hours relative to vehicle-control treated cells ...... 42 Figure 15. qPCR for total RYR2 expression on RNA extracted from cardiomyocytes generated from two RYR2 hiPSC clones (RYR2-1 and RYR2-3) and a control hiPSC line after treatment with cycloheximide (300µg/ml for 9 hours) relative to vehicle-control treated cells ...... 43 Figure 16. Percentage of RYR2 and control hiPSC-CMs displaying calcium transient abnormalities at baseline...... 44 Figure 17. Whole cell [Ca2+]i transients in the RYR2 and control hiPSC-CMs...... 45 Figure 18. Percentage of RYR2 and control hiPSC-CMs developing calcium transient abnormalities following the application of 10µM isoproterenol...... 46 Figure 19. Whole cell [Ca2+]i transients in a RYR2 hiPSC-CM at baseline and after treatment with isoproterenol ...... 46 Figure 20. Percentage of RYR2 hiPSC-CMs and control hiPSC-CMs displaying calcium transients when bathed in solutions with varying calcium concentrations...... 47 Figure 21. Whole cell [Ca2+]i transients in a single RYR2 hiPSC-CM at baseline and after treatment with 1μM carvedilol...... 48

List of Tables

Table 1. Primers designed for the identification of the presence of RYR2 SNPs within the RYR2 line and the control line ...... 31

Table 2. Primers designed for total RYR2 expression and the housekeeping gene GAPDH...... 32

Table 3. Primers designed based on the rs684923 and rs3765097 SNPs in RYR2 which were used for the allele specific qPCRs ...... 33

Table 4. LAMP2 primers used for qPCR to assess total LAMP2 expression ...... 33

Table 5. Details of SNPs in the RYR2 gene and information on their presence in the RYR2 and control hiPSC lines...... 39

List of Abbreviations

AP Action potential

ARVD2 Arrhythmogenic right ventricular cardiomyopathy type 2 cDNA Single stranded copy-DNA derived from RNA by a reverse transcriptase reaction

CICR Calcium Induced Calcium Release

CPVT Catecholaminergic Polymorphic Ventricular Tachycardia

CRU Calcium release unit

DAD Delayed afterdepolarizations

DNA Deoxyribonucleic acid

EAD Early afterdepolarization

EB Embryoid body

ECG Electrocardiogram

EEG Electroencephalogram hiPSC Human induced pluripotent stem cell hiPSC-CM Cardiomyocytes derived from human induced pluripotent stem cell

HEK Human embryonic kidney

ICD Implantable cardioverter defibrillator

MLPA Multiplex ligation dependent probe amplification

MRI Magnetic resonance imaging

NCX Na+/Ca2+ exchanger

NGS Next generation sequencing

PCR Polymerase chain reaction

PVC Premature ventricular complex qPCR Quantitative polymerase chain reaction

RNA Ribonucleic acid

RYR2 Cardiac ryanodine receptor

SERCA Sarcoplasmic reticulum Ca2+ ATPase

SOICR Store Overload Induced Calcium Release

SR Sarcoplasmic reticulum

TA Triggered activity

VF Ventricular fibrillation

VT Ventricular tachycardia

Abstract The University of Manchester Claire Bailey Master of Philosophy The molecular and electrophysiological characterisation of catecholaminergic polymorphic ventricular tachycardia September 2015

Introduction Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT) is an inherited arrhythmogenic cardiac condition which is characterised by episodes of ventricular tachycardia (VT) typically triggered by stress, exercise or emotion. CPVT displays incomplete penetrance and variable expressivity, even within families. The majority of cases of CPVT are due to mutations within the cardiac ryanodine receptor gene (RYR2) and most of these mutations are missense mutations causing a gain of function of RYR2. To our knowledge, no nonsense mutations in RYR2 associated with a cardiac phenotype have been reported.

Methods We identified a novel heterozygous nonsense mutation of RYR2, p.(Arg4790Ter), in a young woman who suffered a cardiac arrest during sexual intercourse. Other individuals in the family were found to carry the mutation, some of whom were entirely asymptomatic and had normal cardiac evaluation suggesting incomplete penetrance. Human induced pluripotent stem cells (hiPSCs) were generated from the young woman who carries this nonsense mutation. These hiPSCs were differentiated into cardiomyocytes (hiPSC-CMs). Quantitative PCR and allele- specific quantitative PCR were undertaken to determine whether the mutation results in haploinsufficiency. Laser confocal calcium imaging was performed on the hiPSC- CMs to identify calcium handling abnormalities.

Results Quantitative PCR showed that the total expression of RYR2 within the RYR2 hiPSC- CMs is approximately half of that seen in the control hiPSC-CMs, however allele- specific quantitative PCRs showed that both alleles are expressed suggesting that the p.(Arg4790Ter) mutation does not result in haploinsufficiency. The RYR2 hiPSC- CMs displayed significantly more calcium transient abnormalities at baseline compared to control hiPSC-CMs. More RYR2 hiPSC-CMs developed calcium transient abnormalities in response to isoproterenol and the RYR2 hiPSC-CMs also demonstrated calcium waves at lower external calcium concentrations compared to control cells suggesting a lower threshold for store overload induced calcium release (SOICR). Treatment with carvedilol corrected calcium transient abnormalities in the RYR2 hiPSC-CMs at baseline.

Discussion The RYR2 hiPSC-CMs display a clearly abnormal calcium handling phenotype. The p.(Arg4790Ter) mutation appears to result in a decreased threshold for SOICR, similar to many previously reported gain of function missense mutations in RYR2. The RYR2 hiPSC-CMs express approximately 50% less RYR2 than control hiPSC- CMs, however both alleles are expressed suggesting that the p.(Arg4790Ter) mutation does not result in haploinsufficiency. Further work is needed to understand the mechanism that results in reduced RYR2 expression in these cells and whether this reduction in RYR2 might explain the reduced penetrance of the mutation within the family, meaning that the combination of the reduced expression with the mutation might be needed for this mutation to result in a clinical phenotype.

Declaration

No portion of the work referred to in the thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning.

i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes.

ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made.

iii. The ownership of certain Copyright, patents, designs, trade marks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions.

iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=487), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.manchester.ac.uk/library/aboutus/regulations) and in The University’s policy on Presentation of Theses

Acknowledgments

This research was funded by the Central Manchester University Hospitals Research and Innovation Division Strategic Investment Scheme 2014/15 and also a BIRAX Regenerative Medicine Initiative Fellowship.

I would like to acknowledge my supervisors, Professor Bill Newman and Professor Sue Kimber, for their help during this project. I would particularly like to thank Professor Newman for his help in setting up the project and obtaining funding to undertake this research. I would also like to thank my academic advisor, Dr Luigi Venetucci, for his enthusiasm throughout the project and also for continued guidance throughout the year.

I also wish to thank Professor Gepstein and all the members of his laboratory in the Faculty of Medicine at the Technion, Israel Institute of Technology. I would particularly like to thank Irit Huber for generating the hiPSC lines and also Amira Gepstein and Gil Arbel for their help and guidance with culturing and differentiating the hiPSCs. I owe a huge amount of thanks to Anke Tijsen and Leonid Maizels for the time, effort and patience that they put into teaching me.

Preface

The author is a specialty registrar in Clinical Genetics and this work was undertaken as part of a period of research whilst out of programme from her training.

The hiPSC lines used in this work were generated by Dr Irit Huber in Professor Gepstein’s laboratory in the Faculty of Medicine at the Technion, Israel Institute of Technology. Some control data (24 cells) for the store overload induced calcium release (SOICR) experiments was kindly provided by Leonid Maizels. Genetic testing performed on the proband and other family members was undertaken in Manchester Regional Genetic Laboratory. All other work and results were undertaken and obtained by the author.

Introduction

Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT)

Clinical Features of CPVT

CPVT is an inherited arrhythmogenic disorder which was first described in 1975.(1) It is characterised by bidirectional (Figure 1) or polymorphic ventricular tachycardia (VT) which is typically induced by stress, emotion or exertion as these events result in the release of catecholamines. The prevalence of CPVT is estimated to be around 1 in 10,000.(2) The condition usually presents in childhood (with the median onset of symptoms being 9 years(3)), often with syncope or seizure-like episodes. However, the first manifestation of the condition within a family is often the sudden unexpected death of a young individual. (3, 4) Unlike many other inherited arrhythmogenic disorders, CPVT is often asymptomatic. Many affected individuals have a normal resting electrocardiogram (ECG),(3) although some individuals harbouring a pathogenic mutation may display a slightly lower resting heart rate.(3)

The diagnosis of CPVT is made based on catecholamine induced VT or premature polymorphic ventricular beats in the presence of a normal ECG and a structurally normal heart.(5) In individuals over 40 years of age with arrhythmias suggestive of CPVT, it is particularly important that the presence of significant coronary artery disease and structural heart abnormalities are excluded. Exercise ECG testing is used in both the diagnosis and monitoring response to treatment in patients with CPVT, although again some mutation carriers may display no abnormalities on testing.(3, 6)

Treatment of CPVT

If left untreated the mortality of CPVT is high – estimated to be around 30-50% by 30 years.(8) It is therefore important to ensure patients are treated appropriately.

Individuals with CPVT can be given beta blockers to reduce the likelihood of arrhythmias. The non-selective, long acting beta blocker, nadolol, is the preferred beta blocker for the treatment of CPVT.(5)

Carvedilol has been shown to be one of the most effective beta blockers in reducing mortality and preventing ventricular tachyarrhythmias in patients with heart failure.(9, 10) Although carvedilol is not commonly used in clinical practice as a treatment for CPVT, it has been shown to be effective on an experimental level. Zhou et al demonstrated that carvedilol is able to suppress store overload induced calcium release (SOICR).(11) SOICR occurs when

14 the level of calcium within the sarcoplasmic reticulum (SR) reaches a threshold triggering RYR2 channels to open releasing calcium into the cytosol.(12) Of the beta blockers tested by Zhou et al, carvedilol was the only beta blocker which was found to suppress SOICR.(11) As carvedilol can suppress SOICR, it may be an effective treatment for patients with CPVT where there is a reduced threshold for SOICR. They showed that carvedilol has a direct effect on RYR2, reducing the frequency and duration of the opening of the channel. Furthermore, carvedilol also has antioxidant activity which along with its beta blocking properties reduces calcium leak from the SR.

Although beta blockers are usually effective in reducing life threatening arrhythmias, they do not provide full protection in all individuals. In an 8 year period, over 25% of individuals with CPVT may experience fatal arrhythmic events whilst being treated with beta blockers.(13) For this reason, and also because some individuals are unable to tolerate beta blockers due to their side effects (commonly fatigue and dizziness), other medications are also used in the treatment of CPVT. Flecainide has been shown to reduce ventricular arrhythmias in patients with CPVT. In a study of 33 genotype positive CPVT patients, flecainide reduced ventricular arrhythmias in 76% of patients with 48% of patients showing no ventricular arrhythmias.(14) The mechanism of action of flecainide in the treatment of CPVT is not fully understood, however there are two main theories regarding the possible mechanism of action(15): 1) It may directly block RYR2 channels, preventing calcium release during diastole and 2) It may

(16) block INa which increases the threshold for triggered activity.

Insertion of an implantable cardioverter defibrillator (ICD) is indicated in individuals who experience syncope or episodes of sustained VT whilst on maximal medical therapy or those who are successfully resuscitated from a cardiac arrest.(17) ICDs are not fully protective and shocks can triggers the release of catecholamines resulting in arrhythmic storms.(18) The implantation of ICDs in children and young adults can be associated with problems, including the long term complications of having an ICD such as lead erosion and also the psychological impact of having inappropriate shocks.(19)

Left cardiac sympathetic denervation has been shown to be effective in reducing arrhythmias in patients with CPVT.(20, 21) Although it requires surgery, and therefore carries associated surgical risks, it may be a viable treatment option for patients who continue to have symptoms despite maximal medical therapy.

Genetics of CPVT

In 1999, Swan et al mapped CPVT by genetic linkage to a locus on 1q42-q43.(8) Subsequently, two separate groups identified mutations within the cardiac ryanodine receptor gene (RYR2) located at 1q43 that cause CPVT. Priori et al identified missense mutations in

RYR2 in four out of 12 patients clinically labelled as having CPVT.(22) Laitinen et al screened individuals from three families with CPVT and identified three different RYR2 mutations, which were shown to fully co-segregate with the disease.(23)

Mutations in RYR2 are responsible for approximately 50-60% of CPVT cases(4) and cause an autosomal dominant form of CPVT (CPVT1, MIM 604772). However, a rare recessive form of CPVT, CPVT2 (MIM 611938), is due to mutations in the cardiac calsequestrin 2 gene (CASQ2).(24) The CASQ2 gene was originally implicated in CPVT in 2001 when it was identified in Bedouin families in Israel. More recently, mutations within triadin (TRDN) (25) and calmodulin 1 (CALM1) (26) have also been shown to cause recessive and dominant forms of CPVT respectively.

The phenotype of CPVT is variable, even within families, and penetrance is incomplete, estimated to be around 78%.(3) This, combined with the high mortality of the condition, emphasises the need for techniques to enable the phenotype in individuals to be predicted and also to determine which therapeutic agents are most likely to be beneficial in reducing symptoms and mortality associated with the condition.

Cardiac Ryanodine Receptor gene (RYR2)

The cardiac ryanodine receptor gene (RYR2) is found on the long arm of chromosome 1 and encompasses 105 exons. The majority of mutations within the RYR2 gene are clustered in three functionally important domains – the N-terminal domain, the central domain and the channel region (Figure 2).(27)

Figure 2. Mutation clustering within the RYR2 gene. Mutations are clustered within 3 domains; the N-terminal domain, the central domain and the channel region. (Adapted from Medeiros-Domingo A et al J Am Coll Cardiol 2009.(27))

Mutations within RYR1, a paralogue of RYR2, cause central core disease, malignant hyperthermia syndrome, congenital myopathies and fetal akinesia. (28) RYR1 mutations mainly lie in three main domains, which are the respective domains where corresponding RYR2 mutations are found.(29) The majority of mutations within RYR2 reported to date are

16 missense changes. To our knowledge there are currently no reported cases of nonsense mutations within the RYR2 gene associated with a cardiac phenotype.

As well as CPVT, mutations within RYR2 have been associated with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2) (30) and idiopathic ventricular fibrillation (VF).(31) RYR2 is also expressed in the brain and has been associated with neurological phenotypes including epilepsy (32, 33) and possibly intellectual disability.(34)

The cardiac ryanodine receptor and calcium handling

To understand how mutations within the RYR2 gene result in CPVT we first need to review calcium handling within cardiomyocytes.

The RYR2 gene encodes a receptor which is located on the sarcoplasmic reticulum (SR) of cardiomyocytes and is responsible for the transport of calcium ions out of the SR, which is necessary for contraction of the cardiomyocytes. Under normal conditions, the voltage sensitive L-type Ca2+ channels, which line the transverse (T) tubules, open in response to depolarization of the cell membrane. This allows the influx of calcium into the cell. The T tubules are deep invaginations into the cell, which allow synchronous release of calcium throughout the cell. This release of calcium into the cytosol is by itself not enough to trigger contraction of the cell. Therefore, it induces the release of calcium ions by the RYR2 channels from the SR into the cytosol, a phenomenon known as calcium induced calcium release (CICR).(35) The significant increase in calcium ion concentration in the cytosol is known as the systolic calcium transient. The calcium in the cytosol binds to troponin C leading to changes in myosin filaments which result in muscle contraction.(36) To allow for relaxation of the cell, cytosolic calcium concentrations are decreased causing calcium to dissociate from myofilaments resulting in muscle relaxation.(37) The cytosolic calcium levels are reduced by closing of the RYR2 channels and removal of calcium from the cytosol by the SR Ca2+ ATPase (SERCA) which pumps calcium back into the SR. The Na+/Ca2+ exchanger (NCX) also plays an important role in decreasing cytosolic calcium levels. However, when calcium is removed from the cell by the NCX the result is that of a net inward depolarizing current. This is because 3 Na+ enter the cell in exchange for 1 Ca2+ leaving. Under normal conditions, SERCA accounts for around two thirds of calcium removal compared to a third removed by the NCX.(7) These events are summarised in Figure 3.

Figure 3. Systolic calcium release. Calcium enters the cell via the L-type calcium channels (1) causing the RYR2 channels to open releasing calcium from the SR (CICR) (2). The increase in calcium in the cytosol causes contraction of myofilaments. Calcium is removed from the cytosol via SERCA (3) and the NCX (4). (Adapted with permission from a figure courtesy of Dr L Venetucci).

Beta adrenergic stimulation has inotropic and chronotropic effects on the heart. Beta adrenergic stimulation is positively chronotropic and inotropic meaning it results in an increase in the rate and force of contractions of the heart. Beta adrenergic stimulation causes the activation of cyclic AMP-dependent protein kinase A (PKA). This leads to the phosphorylation of the L-type Ca2+ channels and phospholamban (which is an inhibitor of SERCA). Phosphorylation of the L-type Ca2+ channels causes an increase in calcium influx. The phosphorylation of phospholamban prevents it inhibiting SERCA. Overall this leads to a significant increase in the SR calcium content.(36) Increased levels of calcium are released from the SR into the cytosol resulting in a larger systolic calcium transient. The systolic calcium transient is one of the main modulators of cardiac contractility. Increases in the amplitude of calcium transient in pacemaker cells can also result in an increase in the firing

(38) rate (by modulating the INaCa) causing an increased heart rate.

A number of mutations within RYR2 have been shown to result in a gain of function causing an increased sensitivity to activation by calcium within the SR (luminal calcium) and thus a reduced threshold for Store Overload Induced Calcium Release (SOICR).(12) SOICR occurs when the level of calcium within the SR reaches a critical level. The increased level of calcium activates the RYR2 channels and calcium is released into the cytosol via the RYR2 channels. This causes an increase in cytosolic calcium due to spontaneous calcium release occurring after completion of the action potential. This starts as a localised event in a single calcium release unit (CRU) (which is composed of several RYR2 channels lying close to the L-type Ca2+ channels) but can spread to neighbouring CRUs causing further calcium release. This causes a calcium wave within the cell which in turn causes the NCX to be activated resulting in an inward current and depolarisation of the cell membrane after the action potential. These depolarisations are known as delayed afterdepolarisations (DADs).(36) These DADs, if large enough, can trigger an action potential. Several DADs of large enough

18 amplitude can cause propagating action potentials which can result in arrhythmic activity.(7) These events are summarised in Figure 4. Figure 5 shows a DAD and triggered activity.

Figure 4. Diastolic calcium release resulting in arrhythmias. A) Normal systolic calcium release. B) When the SR is overloaded, a threshold is reached and calcium is spontaneously released from the SR into the cytosol (SOICR). A wave of calcium travels across the cell. The NCX results in a net inward current resulting in DADs, triggered activity and VT. (Adapted with permission from a figure courtesy of Dr L Venetucci).

Figure 5. Triggered activity and DAD. (A) Trace of cytosolic calcium. (B) Membrane potential trace. Stimulation (vertical bars) triggers an action potential (seen in (B)) which is associated with a calcium transient (seen in (A)). When stimulation is stopped a large calcium wave (A – red) results in triggered activity (B – red). A smaller calcium wave (A - blue) causes a DAD (B - blue) but is not large enough to result in triggered activity. (Adapted with permission from a figure courtesy of Dr L Venetucci).

There are two main theories by which it is believed that mutations within RYR2 alter the sensitivity of RYR2 channels to luminal and/or cytosolic calcium activation resulting in the

CPVT phenotype. The first of these is the ‘domain unzipping’ mechanism. Mutations within the N-terminal and central domains cause weakening of the links between these two domains. These links are important for the stability of the closed state of the channel. Reduction in this stability can cause increased sensitivity to certain stimuli resulting in increased opening of the channel and spontaneous calcium release.(39, 40) The other proposed theory is that mutations in RYR2 result in reduced binding affinity between the channel and the stabilizing protein, FKBP12.6.(32, 41) Binding between the RYR2 channel and FKBP12.6 is regulated by phosphorylation. During catecholaminergic stress there is PKA mediated phosphorylation of RYR2 causing the dissociation of FKBP12.6. This results in RYR2 being less stable causing the release of calcium from the SR. This theory seems to be applicable to certain RYR2 mutations but not others.(36)

Jiang et al initially showed that three mutations (p.Asn4104Lys, p.Arg4496Cys and p.Asn4895Asp) which lie within the C-terminal region of the RYR2 gene result in RYR2 channels displaying an increased sensitivity to activation by luminal calcium.(12) Later they went on to assess the effect of mutations in other regions of the gene on the sensitivity to activation by luminal calcium to determine whether only mutations within the C-terminal region have an effect on luminal calcium sensing or whether mutations in other regions also effect this sensing. They studied six mutations, two mutations in the N-terminal region, two in the central region and two mutations in the C-terminal region.(42) All of the mutations resulted in an increased sensitivity to activation by luminal calcium and a reduced threshold for SOICR irrespective of the location of the mutation within the gene. They hypothesised that the mutations located in the C-terminal region, which encompasses the channel pore and luminal portion, interfere with binding of calcium to the luminal sensor. Mutations in other locations of the gene may not directly influence calcium binding to the luminal sensor but these regions lie close to the luminal sensor in the 3D structure of RYR2 and it is therefore possible that these regions may physically interact.

A loss of function mutation within RYR2 has also been identified as causing a cardiac phenotype. The p.Ala4860Gly mutation within RYR2 has been shown to be associated with idiopathic VF. By incorporating WT and p.Ala4860Gly mutant RYR2 channels into lipid bilayers, Jiang et al showed that the p.Ala4860Gly mutation reduces the sensitivity of the RYR2 channels to activation by luminal calcium. (31) They found that the mutation had little effect on the channel’s sensitivity to activation by cytosolic calcium. The maximum mean opening time of the RYR2 mutant channels was shorter than that of wild type channels suggesting that this residue is important in channel gating. The mutation was shown to abolish SOICR in HEK293 cells and HL-1 cardiac cells transfected with the mutation displayed a reduced propensity for SOICR compared to HL-1 cells transfected with wild type RYR2. This demonstrates that loss of function mutations within RYR2 can result in an arrhythmogenic phenotype by a different mechanism to the well reported gain of function mutations within RYR2. Zhao et al studied the p.Ala4860Gly mutation to further understand

20 the mechanism by which loss of function mutations can result in arrhythmias.(43) They studied cardiomyocytes from mice heterozygous for the p.Ala4860Gly mutation, which demonstrated early afterdepolarisations (EADs). They also demonstrated that the calcium transient amplitude was lower in these cells. They hypothesised that the EADs may occur as a result of the reduced calcium transient amplitude, because it could cause a gradual increase of calcium within the SR until the threshold is reached where the RYR2 channels are opened causing prolonged release of calcium into the cytosol.

Chen et al have also shown that the Glu4872 residue, which is located in the helix bundle crossing region, is important for luminal calcium sensing.(44) They found that p.Glu4872Ala mutant RYR2 channels were completely unresponsive to luminal calcium, however when a negative charge was introduced next to this residue the activation by luminal calcium was restored. This suggests that the negative charge at or near to the Glu4872 residue is vital for activation by luminal calcium. These studies all highlight that this particular region within RYR2 is important for luminal calcium sensing and SOICR and that loss of function mutations within RYR2 can cause a cardiac phenotype by a different mechanism to the well reported gain of function mutations.

Embryonic stem cells and induced pluripotent stem cells

Embryonic stem cells are found within the inner mass of mammalian blastocysts. These cells are pluripotent meaning they are able to differentiate into any of the three germ layers; endoderm, ectoderm and mesoderm. They are also able to divide indefinitely. These properties mean that they are ideal cells to use to study disease mechanisms, test efficacy of existing medications and also to identify new drug targets.

In 2006, Takahashi and Yamanaka demonstrated the ability to derive pluripotent stem cells from mouse fibroblasts, which are end-stage differentiated cells. By addition of four transcription factors (OCT3/4, SOX2, c-MYC, and KLF4) by retroviral transduction they de- differentiated these fibroblasts to induced pluripotent stem cells,(45) which like embryonic stem cells, are able to differentiate in all cell types of interest. They later showed this could be applied to human fibroblasts and generated human induced pluripotent stem cells (hiPSCs).(46) This opened the possibility to study cells or tissue of any patient with a disease of interest where normally these cells cannot be obtained due to ethical or other reasons. hiPSCs can be coaxed to differentiate into a number of different cell types, including cardiomyocytes. hiPSCs can be differentiated into cardiomyocytes using various different methods. Previously the embryoid body (EB) differentiation protocol, as described by Moretti

21 et al (47), was frequently used. However, recently Burridge et al described a chemically defined differentiation protocol using a monolayer of cells.(48) This is less time-consuming and more efficient in the amount of cardiomyocytes derived from the same amount of hiPSCs. This protocol uses a medium containing recombinant human albumin, L-ascorbic acid 2- phosphate and the basal medium RPMI 1640. At day 0 CHIR99021 is added to the medium, at day 2 Wnt-C59 and from day 4 no additions to the medium are made. The CHIR99021 activates the Wnt pathway and the Wnt-C59 is a Wnt signalling inhibitor. Using this protocol, cell contractions are noted from between day 7 and 9. This method is quicker than the EB differentiation protocol – areas of spontaneous contraction are not usually seen until day 20 -30 when using the EB differentiation protocol. Once the hiPSCs have been differentiated into cardiomyocytes, immunofluorescence staining can be used to demonstrate the expression of cardiac specific markers such as cardiac troponin I and alpha-sarcomeric- actinin. The presence of cardiac specific markers can also be demonstrated by quantitative polymerase chain reaction (qPCR).

Application of human induced pluripotent stem cells in modelling inherited cardiac conditions

The technique of using hiPSCs has been used to produce patient specific in vitro models for a number of different conditions including a number of inherited cardiac conditions. Long QT syndrome type 1 was the first condition to be modelled using cardiomyocytes generated from hiPSCs (hiPSC-CMs).(47) Since then, a number of different inherited cardiac conditions, including CPVT, have been modelled using hiPSC-CMs. These models provide an opportunity to study and measure the cellular phenotype, which correlates to the clinical phenotype (unlike in multisystem disorders which involve many cell types), and also allow identification of potential new therapeutic targets. This is particularly valuable in inherited cardiac conditions as obtaining a cardiac biopsy is both extremely risky and invasive. The other advantage of using hiPSC-CMs to study inherited cardiac conditions is that they are patient-specific models unlike mouse models which are mutation specific. These patient specific models are ideal for testing the efficacy of therapeutic agents and also for investigating human-specific disease mechanisms that might include the underlying reasons for variable penetrance within families.

There are a number of studies in which hiPSC lines have been generated from individuals with RYR2 mutations.(49-54) These have largely demonstrated the abnormal electrophysiological phenotype of the hiPSC-CMs and the efficacy of current treatments, namely beta blockers. Furthermore, some studies have begun to use these models to

22 investigate possible new treatment agents. Jung et al generated hiPSC-CMs from a symptomatic individual with a novel missense mutation, p.(Ser406Leu), which lies in the N- terminal domain in RYR2.(53) They tested the effects of dantrolene, which is a drug used in the treatment of malignant hyperthermia caused by mutations in RYR1. Interestingly, treatment with dantrolene abolished all DADs and triggered activity in the CPVT hiPSC-CMs. A further study examined the effects of dantrolene in clinically affected CPVT patients with six different RYR2 mutations, located within different parts of the RYR2 gene.(55) The patients underwent three exercise stress tests, one at baseline, one after an intravenous infusion of dantrolene sodium (Dantrium, 1.5mg per kg of body weight) and one final exercise test the day after the infusion of dantrolene sodium. Dantrolene reduced the number of premature ventricular complexes (PVCs) in two thirds of the patients. Interestingly, dantrolene significantly reduced PVCs in patients with mutations in the N-terminal and central domains however had little effect in reducing PVCs in patients with mutations beyond the central domain and in the channel domain. The group made hiPSC lines from the patients and examined the effect of dantrolene on calcium handling abnormalities in hiPSC-CMs. They found that the results in the hiPSC-CMs correlated with the in vivo results – dantrolene had a dramatic effect on reducing arrhythmias in mutations in the N-terminal and central domains, however had less of an effect when the mutations lay in other regions of the gene.

Di Pasquale et al generated CPVT-hiPSC-CMs to look specifically at the effects of the inhibition of calmodulin-dependent serine-threonine protein kinase II (CaMKII).(54) CaMKII had been implicated in the development of arrhythmias in CPVT by increasing calcium leak from the SR. It has previously been shown that inhibition of CaMKII prevents ventricular arrhythmias in mouse models of CPVT.(56) hiPSCs were generated from an individual with a missense mutation in RYR2, p.(Glu2311Asp). DADs, both at rest and in response to beta adrenergic stimulation with isoproterenol were noted in the CPVT-hiPSC-CMs. After the application of isoproterenol, the CPVT-hiPSC-CMs were exposed to a CaMKII inhibitor, KN- 93. The application of KN-93 reduced the presence of isoproterenol induced DADs in the CPVT-hiPSC-CMs. An inactive stereoisomer, KN-92, had no effect on the presence DADs. The AP morphology in healthy control hiPSC-CMs did not change when exposed to the KN- 93.

It is a matter of debate whether hiPSC-CMs display an immature phenotype and, specifically in relation to CPVT, whether they have an immature calcium handling phenotype lacking functional SR stores. Hwang et al compared the calcium handling properties of hiPSC-CMs differentiated using a monolayer approach from three different centres.(57) They showed that all the hiPSC-CMs (age over 21 days from the start of cardiac differentiation) had SR calcium stores which could be released by caffeine and the calcium release induced by caffeine in these cells was of a similar magnitude to that seen in rabbit and mouse cardiomyocytes. The hiPSC-CMs also displayed cytosolic calcium buffering properties similar to that of the freshly isolated rabbit cardiomyocytes. However, they showed that cells 15 days from the start of

23 cardiac differentiation displayed smaller calcium twitch and had lower SR content compared to cells of 21 days. There was no difference in the results from the cells which were 21 days old and those which were 30 days old. This study suggests that hiPSC-CMs do display robust calcium handling and are appropriate for modelling disease such as CPVT. It also suggests that it is important that cells used for analysis are at least 21 days after the start of differentiation.

Now that hiPSC-CMs have been shown to be a valid and reliable way of studying the effects of mutations associated with inherited cardiac conditions including CPVT, they can be used to try to understand the mechanisms behind more complex and uncertain mutations. They can also be used to study in more detail the functional importance of different regions of the gene, identify possible therapeutic agents and potentially provide a tool to study the underlying reasons for variable penetrance in certain conditions.

The present study

We identified a novel heterozygous nonsense mutation within RYR2 in a young woman who suffered a cardiac arrest during sexual intercourse. To our knowledge, no nonsense mutations within the RYR2 gene resulting in a cardiac phenotype have previously been reported.

The c.14368C>T, p.(Arg4790Ter) mutation lies in the channel region of the RYR2 gene. The mutation is predicted to cause deletion of a region which is implicated in formation of the channel gate and luminal calcium sensing.(31, 44) There are several possible mechanisms by which this mutation may cause CPVT. The mutation could result in haploinsufficiency caused by nonsense mediated decay of the mutated mRNA, which means the mutated mRNA is degraded and no mutant protein is formed. This would mean there would be a reduced number of RYR2 channels. Tamoxifen inducible, cardiomyocyte-specific RYR2 knockout mice with approximately 50% loss of RYR2 protein in the heart have been shown to display bradycardia and arrhythmias similar to those associated with traditional gain of function RYR2 mutations.(58) It is possible that a reduction in the total number of RYR2 channels could mean that with each beat there is a gradual build-up of calcium within the SR. The threshold for SOICR would be reached causing RYR2 channels to be activated and calcium released into the cytosol in the absence of an action potential. The p.(Arg4790Ter) mutation is located in exon 100 of the RYR2 gene and lies close to the terminal end of the gene. It may therefore be unlikely that the mutation would result in nonsense mediated decay and the protein formed would be structurally very similar to the wild type version. However, we do know that very small changes in protein structure can have dramatic effects on function.

Another possibility is that the p.(Arg4790Ter) could result in a gain of function and cause arrhythmias by a similar mechanism to the well described gain of function mutations. The region in which the mutation lies has been implicated in the formation of the channel gate. A mutation in this region could therefore cause partial formation or alterations in the channel gate which could potentially result in an increased open probability of the channel. Alternatively, the mutation could result in a loss of function. The p.(Arg4790Ter) mutation is predicted to result in deletion of a region which is important in the sensing of luminal calcium. Amino acid substitutions within this region have been shown to cause a decreased sensitivity of the channel to activation by luminal calcium and an increased threshold for SOICR.(31, 44) Deletion of this region could cause an inability to sense luminal calcium and therefore an increased threshold for SOICR.

We plan to generate hiPSC-CMs from the young woman who suffered a cardiac arrest and carries the p.(Arg4790Ter) mutation in RYR2. We will study the hiSPC-CMs to characterise the mutation and to understand the mechanism by which it results in a CPVT phenotype.

Hypotheses

 The p.(Arg4790Ter) mutation within RYR2 will not result in haploinsufficiency.  The hiPSC-CMs containing the nonsense RYR2 mutation will display significantly more calcium transient abnormalities at baseline compared to healthy control hiPSC- CMs.  The RYR2 hiPSC-CMs will develop more calcium transient abnormalities in the presence of isoproterenol compared to control hiPSC-CMs.  The RYR2 hiPSC-CMs will display a decreased propensity to develop calcium transients in keeping with a loss of function mechanism.  Calcium transient abnormalities in the RYR2 hiPSC-CMs will be able to be corrected pharmacologically.

Methods

Ethics and Funding

Funding for this project was provided by the Central Manchester Teaching Hospital Research and Innovation Division Strategic Investment Scheme and also the BIRAX Regenerative Medicine Initiative Fellowship Scheme.

Ethical approval for this project was obtained from the South Manchester NHS Research Ethics Committee in January 2011 (11/H1003/3) and also from the University of Manchester.

Clinical Details

The proband (from whom the hiPSC line was generated) is a 33 year old female who suffered a cardiac arrest whilst having sexual intercourse at the age of 29 years. Prior to this episode, when she was 24 years old, she is reported as having had an episode of loss of consciousness during sexual intercourse and was reported to have been incontinent of urine and have bitten her tongue. After this episode she was seen by a Neurologist and had a normal MRI of her brain and a normal EEG. Interestingly, the proband was reported to have had absences and episodes of loss of consciousness as a child. The proband has a normal resting ECG with a normal QT interval. She has also had a normal cardiac MRI. She has not had an exercise ECG as she was unable to comply with this due to hypoxic brain injury which she suffered due to the cardiac arrest. She is now on bisoprolol (2.5mg BD) and has an ICD in situ.

The proband was screened for mutations in genes associated with cardiac arrhythmias. This was done in a clinical laboratory using next generation sequencing (NGS) of a targeted panel of 57 genes associated with inherited cardiac conditions (Manchester Regional Genetics Laboratory Molecular Autopsy NGS panel - see Appendix). The horizontal coverage for all genes except SCN1B and SNTA1 is 100%. For SCN1B and SNTA1 the horizontal coverage is 98% and 99% respectively. The sensitivity of the test exceeds 95%. She was identified as having a nonsense mutation within RYR2, c.14368C>T p.(Arg4790Ter). All exons of the RYR2 gene were screened, thus eliminating the possibility of a concurrent likely pathogenic mutation within the gene. The molecular autopsy also includes testing for large deletions or duplications of RYR2, PKP2, DSG2, DSC2, JUP and DSP by Multiplex ligation dependent probe amplification (MLPA). Whole exome sequencing was also subsequently undertaken. Enrichment was performed using the SureSelect Human All Exon Kit (version 5; Aligent) for

27 the Illumina HiSeq 2500 system and variant analysis was undertaken using the Genome Analysis Tool Kit software (https://www.broadinstitute.org/gatk/). Variants were filtered to remove those with a minor allele frequency of greater than 0.005. The variants were then compared to in house allele frequencies and frequencies on publicly available databases: Exome Aggregation Consortium (ExAC), Cambridge, MA (http://exac.broadinstitute.org), Exome Variant Server (http://evs.gs.washington.edu/EVS/) and Single Nucleotide Polymorphism database (dbSNP - http://www.ncbi.nlm.nih.gov/projects/SNP/). SIFT (http://sift.jcvi.org) and PolyPhen (http://genetics.bwh.harvard.edu/pph2) were used to predict whether the variants were likely to be benign or deleterious. Whole exome sequencing did not identify any other likely pathogenic variants which could be responsible for the cardiac phenotype seen in the proband.

The proband’s sister (III:6) was diagnosed with dilated cardiomyopathy during pregnancy at the age of 24 years. Following this diagnosis next generation sequencing of a panel of genes associated with inherited cardiac conditions was performed in a clinical laboratory. This was the same molecular autopsy NGS panel which was performed on the proband, however when performed on the proband’s sister LMNA, CALM1 and TRDN were not included in the panel and MYH11 was included. This testing identified three potentially pathogenic heterozygous variants; RYR2 c.14368C>T p.(Arg4790Ter), ABCC9 c.4570_4572delinsAAAT and TTN c.2962G>A p.(Val988Met). The proband does not carry the TTN and ABCC9 mutations. Heterozygous mutations within ABCC9 are associated with familial atrial fibrillation, hypertrichotic osteochondrodysplasia and also dilated cardiomyopathy. The c.4570_4572delinsAAAT variant in ABCC9 has been previously reported in a patient with dilated cardiomyopathy and has been shown to disrupt the function of the cardiac KATP channel.(59) Mutations within TTN can cause cardiomyopathy, both hypertrophic and dilated. The c.2962G>A p.(Val988Met) variant in TTN is present on dbSNP, however splice site prediction tools (Alamut v.2.3) predict that it may disrupt normal splicing of the TTN gene. Interestingly in addition to dilated cardiomyopathy, the proband’s sister has also suffered from episodes of loss of consciousness and was previously diagnosed with epilepsy. She has a normal resting ECG and exercise test.

The proband’s daughter (IV:3), who is currently 11 years of age, has suffered from absences and episodes of loss of consciousness and was initially investigated by a neurologist for this. After identification of the RYR2 mutation in her mother, she had testing and was also found to carry the mutation. She has a normal resting ECG (with a normal QT interval) and normal echocardiogram. She is currently being treated with propranolol (15mg BD).

The proband’s son (IV:4), who is currently 6 years old, carries the RYR2 mutation however remains asymptomatic. He has a normal resting ECG with a normal QT interval. He is currently being treated with propranolol (10mg BD).

The proband’s mother (II:2) was identified as carrying both the RYR2 mutation and the TTN variant. She is now in her 7th decade and has remained asymptomatic throughout her life.

She has also had normal cardiac investigations. Both of the proband’s brothers (III:2 and III:8) carry the RYR2 mutation. They are both asymptomatic and have had normal cardiac assessments. The proband’s father (II:3) is asymptomatic and has had a normal cardiac evaluation. Genetic testing showed that he does not carry the RYR2 mutation. III:2’s children are both asymptomatic and do not to carry the mutation in RYR2.

Figure 6. Pedigree of family in which the p.(Arg4790Ter) RYR2 mutation was identified. Carriers of the mutation are denoted with a black dot and symptomatic individuals are shaded in red. The proband is denoted by an arrow.

Generation of hiPSCs

A skin biopsy was taken from the proband and dermal fibroblasts were isolated from this sample. hiPSCs were established by retroviral delivery of OCT4, SOX2 and KLF4 followed by treatment with valproic acid. Several clones were generated and two of these were expanded (RYR2-1 and RYR2-3). A control hiPSC line (UN1-22) was generated from a healthy male individual with no personal or family history of cardiac disease or sudden death.

Cardiomyocyte differentiation

The hiPSCs were differentiated into cardiomyocytes with a chemically defined protocol using a monolayer of cells as previously described by Burridge et al. (48) Prior to differentiation the

29 hiPSCs were passaged using 0.5mM EDTA and treated with thiazovivin (Cayman Chemical). Three to four days after passage, when the cells are around 85% confluent, differentiation would be started, day 0. The medium was changed to CDM3, which is composed of three components: RPMI 1640 basal medium (Life Technologies), 500µg/ml O.sativa derived recombinant albumin (Sigma-Aldrich) and 213 µg/ml L-ascorbic acid 2-phosphate (Sigma- Aldrich). The medium was changed every two days. On day 0 the CDM3 medium was supplemented with an inhibitor of glyogen synthase kinase 3, 6µM CHIR99021 (Stemgent). CHIR99021 activates Wnt signaling. On day 2 the medium was supplemented with a Wnt signalling inhibitor, 2µM Wnt-C59 (Selleck Chemicals). The medium continued to be changed every other day and from day 7 to day 9 of the protocol contracting cells were seen.

Immunostaining

Undifferentiated cells were fixed with 4% paraformaldehyde and were then permeabilised with 1% triton. 5% horse serum was used for blocking and then primary antibodies for the pluripotency markers OCT4, SSEA4, TRA-1-60 and NANOG were applied. Secondary antibodies were then applied. Nuclei were stained with DAPI (1:500). The specimens were then examined using a laser confocal microscope (Zeiss LSM-710).

Cells which had been differentiated into cardiomyocytes were stained for cardiac specific markers. The cells were fixed, permeabilised and blocked as described above. Primary antibodies for the cardiac specific markers, alpha-actinin and troponin I were applied. Following this secondary antibodies were applied. Nuclei were stained with DAPI (1:500). The cells were then visualised using a laser confocal microscope (Zeiss LSM-710).

Sequencing for Single Nucleotide Polymorphisms

Primers for regions of known single nucleotide polymorphisms (SNPs) within RYR2 were designed (Table 1). Polymerase chain reaction (PCR) was performed using 100ng genomic DNA from one RYR2 clone (RYR2-3) and from the control line.

For rs2253273 and rs684923 for the RYR2 line the PCR conditions were as follows: 30 seconds at 98˚C, then 35 cycles of 10 seconds at 98˚C, 30 seconds at 60˚C, 2 minutes at 72˚C and then finally 5 minutes at 72˚C. For rs3765097 the same conditions were used except the annealing temperature was set as 58˚C.

The control line was sequenced only for SNP 1 and 3. PCR conditions were as follows: 30 seconds at 98˚C, followed by 40 cycles of 10 seconds at 98˚C, 30 seconds at 57˚C and 1 minute at 72˚C and finally 5 minutes at 72˚C.

Following this the fragments were separated using gel electrophoresis and the bands were cut out of the gel. The Nucleospin Gel and PCR clean up kit (Macherey Nagel) was used to isolate DNA out of the gel and prepare the DNA for sequencing.

Target SNP Forward Primer Reverse Primer rs3765097 ACAGTGATGTAGGGAGAGAG TCAGGGCTCGTAGTCTGTTC rs2253273 TCACCACTGGTTACCACTGTG ACAGCCAGAACTAAGGTCATG rs684923 AGATTCAGGTCCTTGGCTG TCCCAGCGTCAAGCATGATG

Table 1. Primers designed for the identification of the presence of RYR2 SNPs within the RYR2 line and the control line.

Nonsense mediated decay

Cycloheximide, an inhibitor of eukaryotic protein synthesis, can be used to inhibit nonsense mediated decay. Cycloheximide is thought to exert this effect by inhibiting the elongation phase of translation by binding to the ribosome and inhibiting translocation.(60) Cells from a line created from a patient with Danon disease, caused by a nonsense mutation in LAMP2 (IVS2+1G>A) known to result in non-sense mediated decay, was used as a positive control. The splice mutation IVS2+1G>A in LAMP2 causes deletion of exon 2 creating a frameshift and a premature stop codon. In order to find an optimal duration of incubation with cycloheximide, cells from the Danon line were either treated with cycloheximide 300µg/ml (Sigma-Aldrich) or with the same volume of water as vehicle-control for varying lengths of time (3 hours, 6 hours and 9 hours). After incubation RNA was extracted.

Following identification of an optimal incubation time, cells from the RYR2 line (2 different clones – RYR2-1 and RYR2-3) and also cells from a control line were treated with cycloheximide 300µg/ml or vehicle-control for 9 hours. RNA was then extracted from these cells.

RNA extraction and cDNA production

RNA was extracted from hiPSC-CMs using TRIzol (Life Technologies) according to manufacturer’s protocol. DNase treatment was carried out on 1000ng RNA. Reverse transcription into cDNA was undertaken using Superscript II (Invitrogen).

Quantitative PCR

Real-time quantitative PCR (qPCR) was performed in duplo using SYBR green (Roche) in the StepOne plus Real-Time PCR machine (Applied Biosystems). GAPDH was used as a housekeeping gene. All qPCR reactions used a 10µl reaction volume.

Specific primers for total RYR2 expression were designed (Table 2) to assess total RYR2 expression in the RYR2 and control hiPSC-CMs. Conditions were as follows: 5 minutes at 95˚C then 40 cycles of 10 seconds at 95˚C, 20 seconds at 60˚C and 20 seconds at 72˚C and the final step of the programme was a meltcurve to confirm specific amplification of the amplicon of interest. RYR2 expression was normalised to GAPDH expression levels.

Target Forward Reverse RYR2 ACAGAGTTTGGCACACAGCAG ACAGCAACATGACCACCATATCC GAPDH ACCCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCAAATT

Table 2. Primers designed for total RYR2 expression and the housekeeping gene GAPDH.

Allele-specific qPCRs based on two SNPs within RYR2 (rs3765097 and rs684923) were designed to identify whether only one or both alleles were expressed. The primers used for the allele-specific qPCRs are shown in Table 3. Conditions for these reactions were as follows: 5 minutes at 95˚C then 40 cycles of 10 seconds at 95˚C, 20 seconds at 60˚C (66˚C for rs3765097) and 20 seconds at 72˚C and the final step of the programme was a meltcurve. Three PCR reactions were used for one SNP. For each SNP, the reactions all had the same forward or reverse primer and a corresponding allele-specific reverse or forward primer which was different in the last nucleotide of the primer. These allele-specific primers allowed the detection of both alleles separately. This was then normalised to the total amplification of the amplicon by an almost identically placed corresponding forward or reverse primer which did not contain the SNP. The percentage of expression from the total was calculated for both alleles.

Target Target Allele specific Primer General Forward Primer General Reverse Primer Allele

RYR2 - C TGCCTATAGAGTCCGTAAGC GATTTGCCTATAGAGTCCGTAAG TCTTCAGGGCTCGTAGTCTG rs3765097 allele

RYR2 - T TGCCTATAGAGTCCGTAAGT GATTTGCCTATAGAGTCCGTAAG TCTTCAGGGCTCGTAGTCTG rs3765097 allele

RYR2 - C TTAAGAGGCATCTTTGCG TCCATAGAAGTTTGTTTACTCTC TTTAAGAGGCATCTTTGC rs684923 allele

RYR2 - T TTAAGAGGCATCTTTGCA TCCATAGAAGTTTGTTTACTCTC TTTAAGAGGCATCTTTGC rs684923 allele

Table 3. Primers designed based on the rs684923 and rs3765097 SNPs in RYR2 which were used for the allele specific qPCRs.

Primers for exon 1 within the LAMP2 gene were designed and qPCR was used to assess differences in levels of expression of LAMP2 between the Danon hiPSC-CMs which had been treated with cycloheximide and those which were left untreated. The conditions for the qPCR reaction were as follows: 5 minutes at 95˚C then 40 cycles of 10 seconds at 95˚C, 20 seconds at 60˚C and 20 seconds at 72˚C and the final step of the programme was a meltcurve.

Target Forward Reverse

LAMP2 ATCAGTGCTCTTGACCCAGG AGGACTAGGCAGACCAGAAC

Table 4. LAMP2 primers used for qPCR to assess total LAMP2 expression.

All qPCR analyses were done using the using the LineRegPCR software. (61)

Statistical analysis was performed on the qPCR for total RYR2 expression using a two-tailed t-test. A two-tailed t-test was also used to analyse the data from the qPCR for RYR2 expression in hiPSC-CMs treated with cycloheximide and hiPSC-CMs left untreated. A p value of less than 0.05 was deemed significant. In all qPCR experiments the n value relates to the number of wells of cells used.

Calcium Imaging

Laser confocal calcium imaging was undertaken on the RYR2 hiPSC-CMs and also on hiPSC-CMs generated from a control line (UN1-22).

In confocal microscopy there is a pinhole at the confocal plane. This pinhole blocks out of focus light meaning only light produced by fluorescence in the same focal plane is detected. This therefore means that the resolution of the microscope is improved compared to standard microscopes.

To prepare cells for laser confocal imaging, cells were dissociated into MatTek glass bottom dishes (MatTek Corporation). This was done by removing the media which the monolayer of hiPSC-CMs were in and washing the cells with 1ml phosphate buffered saline (PBS). 1ml TypLE (Life Technologies) was placed in each well and the cells were incubated at 37˚C for 15 minutes. The cells were then removed from the bottom of the well and collected into 9ml of RPMI-B27 media. RPMI-B27 medium was made by adding 10ml B-27 Supplement without insulin (Life Technologies) to 500ml RPMI 1640 medium (Life Technologies). Penicillin and streptomycin was also added to the medium. The medium containing the cells was passed through a 40µm cell strainer and was centrifuged at 1,100 rpm for 5 minutes. The supernatant was discarded and the cell pellet resuspended in 3ml of RPMI-B27 medium supplemented with 2µM thiazovivin. Varying amounts (75µl - 250µl) of the cell suspension were plated onto pre-prepared matrigel coated MatTek glass bottom dishes. After 24 hours a further 2ml of RPMI-B27 medium was placed onto cells in the MatTek dishes. The cells were imaged once they were noted to be spontaneously contracting, this usually occurred approximately 5 days after dissociation. All the cells imaged were between 25 and 70 days old, with the age being from the day of last passage as undifferentiated hiPSCs to the day calcium imaging was undertaken on the dissociated hiPSC-CMs. All calcium imaging was performed on hiPSC-CMs from one RYR2 clone, RYR2-3. hiPSC-CMs which had been dissociated were loaded with 5µM Fluo-4 AM (Life Technologies), a fluorescent calcium indicator, so whole cell calcium transients could be recorded. Fluo-4 is a non-ratiometric calcium indicator. On binding to calcium, Fluo-4 displays a shift in fluorescent intensity and the calcium concentration is determined by relative changes in fluorescent intensity. Unlike ratiometric dyes, Fluo-4 is unable to correct for unequal loading and bleaching. (62)

All Experiments were conducted in tyrodes solution; (in mmol/l) NaCl 140, KCl 5.4, CaCl2 1.8,

MgCl2 1, HEPES 10 and glucose 10. Cells were incubated at 37˚C throughout the experiments. A Zeiss LSM -710 confocal system was used to perform all of the fluorescent calcium imaging.

When assessing calcium transients at baseline and after the application of isoproterenol and carvedilol, calcium transient abnormalities were defined as spontaneous transients which

34 contained multiple (greater than one) peaks. Normal calcium transients were defined as spontaneous calcium transients with single peaks.

All calcium traces were reviewed using ImageJ software. The background fluorescence was subtracted from the trace. The background fluorescence was measured by selecting an area with least fluorescence on the trace and calculating the mean of all fluorescence values from this region. F0 was calculated by selecting a region prior to a calcium transient and calculating the mean of these values. The mean background fluorescence was subtracted from the mean F0. All fluorescence values from the total one minute trace were then divided by this value giving F/F0. Microsoft Excel was then used to draw a trace using these values.

Analysis of the calcium imaging data was undertaken using the Chi squared test. The n value for each experiment relates to the total number of cells. A p value of less than 0.05 was deemed significant.

Power calculations were used to calculate the number of cells which would need to be studied to detect a significant difference in calcium transient abnormalities at baseline between the RYR2 and control hiPSC-CMs. Based upon the data from Itzhaki et al we calculated that at least 14 cells from each group would need to be studied to detect a significant difference between the RYR2 and control hiPSC-CMs (power 0.8, α0.05). (49) Data from Itzhaki et al showed that the application of isoproterenol to hiPSC-CMs resulted in new triggered events and/or broad double-humped transients in 60% (6 out of 10) whilst no control cells displayed these abnormalities after the application of isoproterenol (n=18). We therefore estimated that when assessing the effects of isoproterenol we would only need to study a small number of cells to demonstrate a significant difference between the control and RYR2 hiPSC-CMs.

Baseline Imaging

Baseline imaging of RYR2 and control hiPSC-CMs was performed in tyrodes solution. Cells were scanned using a single line for one minute. The presence of calcium transient abnormalities was recorded.

Effects of Isoproterenol

The effect of isoproterenol on RYR2 and control hiPSC-CMs was assessed. Cells were scanned using a single line for one minute. This baseline scanning was performed in tyrodes solution. After scanning each cell the position on the stage was saved on the confocal

35 system. After baseline scanning was performed, 10µM isoproterenol (Sigma-Aldrich) was added to the tyrodes solution surrounding the cells. After 15 minutes incubation time, the cells were re-scanned for one minute using a single line.

Store Overload Induced Calcium Release

To assess SOICR in RYR2 and control hiPSC-CMs, cells were initially line scanned for one minute at baseline and the position of each cell was saved on the stage of the confocal system. After initial baseline scanning had been performed the tyrodes solution was removed and replaced with tyrodes solution with varying CaCl concentrations (0.1mM, 0.2mM, 0.5mM, 1.0mM, 1.8mM, 3.0mM and 4.0mM). At each concentration, after the tyrodes solution had been changed it was left to incubate at 37˚C for 10 minutes after which 10µM tetrodotoxin (Alomone labs), 50µm lidocaine (Sigma-Aldrich) and 5mM caesium chloride (Sigma-Aldrich) was added and left to incubate at 37˚C for 20 minutes. This was done to block INa and If and to prevent action potential dependent calcium release. The same cells were then rescanned for one minute using a single line and the presence or absence of calcium transients was recorded. After scanning the cells at increasing calcium concentrations they were then rescanned in standard tyrodes solution.

Effects of Carvedilol

Cells were line scanned at baseline for one minute and then 1µM carvedilol (Sigma-Aldrich) was applied. The cells were left to incubate for 20 minutes at 37˚C following the application of carvedilol. After this the cells were rescanned for one minute, using a single line, to identify whether the calcium transient abnormalities seen at baseline had been corrected by carvedilol.

Results

hiPSCs carrying the p.(Arg4790Ter) mutation are pluripotent and can be differentiated into cardiomyocytes

To confirm that the generated hiPSC line was pluripotent, we stained undifferentiated cells with OCT4, NANOG, SSEA4 and TRA-1-60. We confirmed the presence of these pluripotency markers in the undifferentiated hiPSCs (Figure 7).

To confirm the ability of the hiPSCs to differentiate into cardiomyocytes, we stained the differentiated cells with the cardiac specific markers, alpha-actinin and troponin I. We confirmed the expression of these markers in the hiPSCs which had been differentiated into cardiomyocytes (Figure 8).

Figure 7. Immunostaining of undifferentiated RYR2 hiPSC colonies for the pluripotent markers NANOG (pink), OCT4 (pink), SSEA4 (green) and TRA-1-60 (red). Nuclei are stained with DAPI (blue) in all images.

Figure 8. Immunostaining of RYR2 hiPSC-CMs for the cardiac markers troponin I (red) and α–actinin (red). Nuclei are stained with DAPI (blue) in both images.

Genomic DNA extracted from undifferentiated RYR2 hiPSCs was sequenced and the presence of the p.(Arg4790Ter) (c.14368C>T) mutation was verified (Figure 9).

Figure 9. Sequence trace of DNA extracted from hiPSCs showing the RYR2 mutation, c.14368C>T p.(Arg4790Ter).

hiPSC-CMs with the p.(Arg4790Ter) mutation express both RYR2 alleles.

To determine whether the p.(Arg4790Ter) results in haploinsufficiency, a quantitative PCR (qPCR) for total RYR2 expression was undertaken on RNA extracted from cardiomyocytes generated from two different RYR2 hiPSC clones (RYR2-1 and RYR2-3) and also a control line. This qPCR revealed that the total RYR2 expression in cardiomyocytes generated from both RYR2 hiPSC clones was significantly different to the expression of RYR2 in cardiomyocytes generated from the control line (p=0.02). In addition to this there was no significant difference in RYR2 expression in cardiomyocytes generated from the two RYR2 clones (RYR2-1 and RYR2-3), RYR2 expression in the cardiomyocytes generated from both

RYR2 hiPSC clones was approximately half of that seen in the cardiomyocytes generated from the control line (Figure 10), suggesting that the mutation results in haploinsufficiency.

Figure 10. qPCR for total RYR2 expression on RNA extracted from cardiomyocytes generated from two RYR2 hiPSC clones (RYR2-1 and RYR2-3) and a control hiPSC line (UN1-22). RYR2 expression was normalized to GAPDH and RYR2 expression in the RYR2 clones is shown relative to the expression in the control line. Expression of RYR2 in the 2 RYR2 clones is almost half of that in the control line. For each line n=3, p<0.01.

To further confirm that the p.(Arg4790Ter) mutation results in haploinsufficiency, allele- specific qPCRs based on a single nucleotide polymorphisms in RYR2 were designed. Sequencing of gDNA from undifferentiated hiPSCs revealed that the line was heterozygous for several common single nucleotide polymorphisms (SNPs) within the RYR2 gene. The control line was also sequenced for these SNPs. The RYR2 line is homozygous (for the minor allele) for rs2253273 and heterozygous for rs684923 and rs3765097, while the control line, UN1-22, is homozygous for rs684923 and heterozygous for rs3765097. Details of these SNPs are found in Table 5.

SNP Exon Minor Allele Percentage of RYR2 line Control Frequency population line (%) heterozygous for SNP (%) rs684923 51 45.00 50 Heterozygous Homozygous rs2253273 26 17.33 28 Homozygous Not for minor allele determined rs3765097 15 45.37 49 Heterozygous Heterozygous

Table 5. Details of SNPs in the RYR2 gene and information on their presence in the RYR2 and control hiPSC lines.

Allele-specific qPCRs where the allele specificity was based on rs684923 and rs3765097 were performed on RNA isolated from cardiomyocytes generated from the two RYR2 hiPSC clones (RYR2-1 and RYR2-3) and the control line.

The allele-specific qPCR based on rs684923 confirmed allele specificity of the primers in the control line which is homozygous for the SNP (Figure 11). In the two RYR2 hiPSC clones, which are heterozygous for the SNP, both the C and T alleles were expressed.

Figure 11. Allele-specific qPCR where allele specificity is based on rs684923 on RNA isolated from cardiomyocytes generated from two RYR2-hiPSC clones (RYR2-1 and RYR2-3) and a control hiPSC line (UN1-22). The qPCR confirmed allele specificity of the primers in the control line which is homozygous for rs684923. The RYR2 line is heterozygous for this SNP. The allele-specific qPCR demonstrated that both the C allele and the T allele are expressed in both of the RYR2 clones. For both RYR2 clones n=3 and for the control line n=4.

To further confirm expression of both alleles, an allele-specific qPCR based on rs3765097 (for which both the RYR2 line and the control line are heterozygous) was performed. This allele-specific qPCR showed that both alleles are expressed in both of the RYR2 clones (Figure 12).

As part of the allele-specific qPCRs (based on both rs684923 and rs3765097) the regions surrounding the SNPs were amplified independently of the SNP using general forward and reverse primers. This provided information on total RYR2 expression independent of the SNP. This allowed us to confirm that again there was a significant difference in the expression of RYR2 in cardiomyocytes generated from both RYR2 hiPSC clones compared to those generated from the control line (p=0.02). There was approximately half the expression of RYR2 in the cardiomyocytes generated from the RYR2 line compared to those generated from the control line in two further independent primer sets, further supporting that there is reduced RYR2 expression in the RYR2 hiPSC-CMs. Figure 13 shows the total expression of RYR2, assessed by the general forward and reverse primers used in the allele- specific qPCR based on rs684923, in the cardiomyocytes generated from both RYR2 clones relative to the control cardiomyocytes.

Figure 12. Allele-specific qPCR where allele specificity is based on rs3765097 from RNA isolated from cardiomyocytes generated two RYR2 clones (RYR2-1 and RYR2-3) and a control hiPSC line (UN1-22). Both the RYR2 line and the control line are heterozygous for this SNP. The allele-specific qPCR demonstrated both the C and T alleles are expressed in both RYR2 clones. For each line n=3.

Figure 13. Total RYR2 expression assessed by general primers used in the allele-specific qPCR based on rs684923 on RNA extracted from cardiomyocytes generated from the RYR2 hiPSC clones (RYR2-1 and RYR2-3) and the control hiPSC line. RYR2 expression was normalized to GAPDH and expression of RYR2 in the RYR2 clones is shown relative to the expression in the control line. Expression of RYR2 in both RYR2 hiPSC clones (RYR2-1 and RYR2-3) is approximately half of that seen in the control line as seen in the original qPCR for total RYR2 expression. For both RYR2 clones n=3 and for the control line n=4.

Nonsense mediated decay

Nonsense mediated decay is the process by which a cell eliminates mRNA transcripts which contain premature stop codons to prevent the formation of mutant proteins which could result in a deleterious gain of function or dominant negative effect. To assess whether the p.(Arg4790Ter) mutation results in nonsense mediated decay an experiment using cycloheximide was undertaken. Cycloheximide is an inhibitor of nonsense mediated decay. Initially cardiomyocytes generated from a Danon hiPSC line were treated with cycloheximide or vehicle-control for 3 hours, 6 hours and 9 hours. After incubation, RNA was extracted from the cells and a qPCR was performed to assess the relative expression of LAMP2 in the treated and untreated cells. Figure 14 shows the relative LAMP2 expression in the hiPSC- CMs treated with cycloheximide relative to the vehicle-control cells.

Figure 14. qPCR demonstrating total LAMP2 expression in Danon hiPSC-CMs treated with cycloheximide for 3, 6 and 9 hours (orange) relative to vehicle-control treated cells (blue). The largest increase in expression of LAMP2 in cycloheximide treated cells compared to the vehicle-control treated cells was seen at 9 hours incubation. For vehicle and cycloheximide at each incubation time n=1.

At both 6 and 9 hours the relative expression of LAMP2 in the cycloheximide treated cells was increased compared to the vehicle-control cells and a time-response effect was seen. The increase in LAMP2 expression was the highest after 9 hours of incubation therefore we decided to treat the RYR2-hiPSC-CMs with cycloheximide for 9 hours. hiPSC-CMs from two clones of the RYR2 line (RYR2-1 and RYR2-3) and also from the control line (UN1-22) were treated with 300μg/ml cycloheximide or vehicle-control for 9 hours. A qPCR to assess relative RYR2 expression was performed on RNA extracted from these cells. For this qPCR the general forward and general reverse primers for the SNP rs3765097 were used. As these primers were not specific to the SNP, they were able to provide

42 information on total RYR2 expression. Figure 15 shows the expression of RYR2 in the RYR2 hiPSC-CMs and control hiPSC-CMs after treatment with cycloheximide relative to vehicle- control treated cells. In both RYR2 clones the expression of RYR2 in the cycloheximide treated cells was almost doubled compared to the vehicle-control treated cells. Strikingly, this doubling was also seen in the healthy control line treated with cycloheximide compared to the vehicle-control cells. This would suggest the presence of nonsense mediated decay in the control line which cannot be the case as it is a healthy control line with no mutation to induce nonsense mediated decay. These results therefore suggest that there are other non- specific factors affecting the expression of RYR2 and causing its upregulation.

Figure 15. qPCR for total RYR2 expression on RNA extracted from cardiomyocytes generated from two RYR2 hiPSC clones (RYR2-1 and RYR2-3) and a control hiPSC line (UN1-22) after treatment with cycloheximide (300µg/ml for 9 hours) (orange) relative to vehicle-control treated cells (blue). hiPSC-CMs generated from both RYR2 clones and also the control line showed a significant difference in expression of RYR2 when treated with cycloheximide compared to those left untreated (p≤0.01). Treatment with cycloheximide resulted in an increase in relative expression of RYR2 in both RYR2 clones and also in the control line.

Calcium imaging

RYR2 hiPSC-CMs display calcium transient abnormalities at baseline

Significantly more RYR2 hiPSC-CMs displayed calcium transient abnormalities at baseline compared to control cells (p<0.001). 66.7% (126 of 189) of RYR2 hiPSC-CMs displayed calcium transient abnormalities whilst only 28.0% (21 of 75) control hiPSC-CMs displayed calcium transient abnormalities at baseline (Figure 16).

Figure 16. Percentage of RYR2 and control hiPSC-CMs displaying calcium transient abnormalities at baseline. 66.7% of RYR2 hiPSC-CMs (n=189) and 28.0% control hiPSC-CMs (n=75) displayed calcium transient abnormalities at baseline (p<0.001).

The calcium transient abnormalities recorded in the RYR2 hiPSC-CMs were more significant and complex than those seen in the control line. Double, triple and quadruple humped transients were seen in the RYR2 hiPSC-CMs (Figure 17a) although larger humps and more complex arrhythmias were also seen (Figure17b). When the transient abnormalities seen in the RYR2 and control hiPSC-CMs were divided into groups of double humped transients, triple humped transients and quadruple or larger humped transients, the RYR2 hiPSC-CMs showed a significantly greater predominance of quadruple and larger humped transients compared to the control cells (p<0.001). Of the control hiPSC-CMs which displayed arrhythmic humps at baseline the majority (47.62%) were double humped transients whilst only 24.12% of humped transients seen in the RYR2 hiPSC-CMs were double humped transients (p<0.001). The majority of humps (54.84%) seen in the RYR2 hiPSC-CMs were quadruple peaked humps or larger and only 28.57% of humps seen in the control hiPSC- CMs were quadruple peaked humps or larger (p<0.001).

Figure 17. Whole cell [Ca2+]i transients in the RYR2 and control hiPSC-CMs. (A to C) Line scan images showing changes in intracellular Ca2+ in fluo-4 loaded hiPSC-CMs. (A,B) Whole-cell [Ca2+] transients in RYR2 hiPSC-CMs and (C) control hiPSC-CMs. (A,B) Note the development of significant whole cell transient abnormalities manifested as double and triple humps and broad humps.

Isoproterenol induces calcium transient abnormalities in the RYR2 hiPSC-CMs

52.6% (10 of 19) of RYR2 hiPSC-CMs which displayed normal calcium transients at baseline developed calcium transient abnormalities after the application of 10µM isoproterenol whilst only 19.0% (4 of 21) of control hiPSC-CMs developed these irregularities after the application of isoproterenol (Figure 18). The development of transient irregularities following application of isoproterenol in the RYR2 line was significantly more compared to the control line (p<0.05). RYR2 hiPSC-CMs which displayed normal calcium transients at baseline typically developed double or triple humped transients after the application of isoproterenol (Figure 19).

Figure 18. Percentage of RYR2 and control hiPSC-CMs developing calcium transient abnormalities following the application of 10µM isoproterenol. 52.6% of RYR2 hiPSC-CMs (n=21) and 19.0% of control hiPSC-CMs (n=19) developed calcium transient abnormalities after the application of isoproterenol (p<0.05).

Figure 19. Whole cell [Ca2+]i transients in a RYR2 hiPSC-CM at baseline (A) and after treatment with isoproterenol (B). Note the development of double and triple humped transients after treatment with isoproterenol.

The RYR2 hiPSC-CMs have an increased propensity to develop calcium waves at lower external calcium concentrations

Significantly more RYR2 hiPSC-CMs displayed calcium transients when bathed in solutions with lower calcium concentrations compared to the proportion of control hiPSC-CMs (p<0.001 for all calcium concentrations, n=29 for RYR2 and n=36 for control for each concentration) – Figure 20. The RYR2 hiPSC-CMs developed spontaneous calcium waves at lower external calcium concentrations. This could be explained by the RYR2 hiPSC-CMs having a lower threshold for SOICR than control hiPSC-CMs. However, it could also be explained by the RYR2 hiPSC-CMs running a higher SR calcium content than the control

46 hiPSC-CMs. To try and distinguish between these points, measurements of SR calcium content would need to be undertaken.

Figure 20. Percentage of RYR2 hiPSC-CMs (orange) and control hiPSC-CMs (blue) displaying calcium transients when bathed in solutions with varying calcium concentrations. n= 29 and n=36 for RYR2 and control hiPSC-CMs respectively, p<0.001 for all bath calcium concentrations.

Carvedilol corrects calcium transient abnormalities in RYR2 hiPSC- CMs

Of the RYR2 hiPSC-CMs which displayed calcium transient abnormalities at baseline, 80.0% (8 of 10 cells) of these cells displayed normal calcium transients after treatment with 1μM carvedilol. Figure 21 shows double humped transients recorded from a single RYR2 hiPSC- CM which were corrected with carvedilol treatment. In the cells in which carvedilol did not abolish the calcium transient abnormalities it was noted that the abnormalities became less severe and less arrhythmic in appearance after treatment.

Figure 21. Whole cell [Ca2+]i transients in a single RYR2 hiPSC-CM at baseline (A) and after treatment with 1μM carvedilol (B). Note that after treatment with carvedilol there is resolution of the double humped transients which were seen at baseline.

Discussion

We have identified a novel nonsense mutation in RYR2 in a young women with a history of cardiac arrest. We have undertaken work to determine whether the p.(Arg4790Ter) mutation results in haploinsufficiency and identify how it affects calcium handling within cardiomyocytes.

Does the p.(Arg4790Ter) RYR2 mutation result in haploinsufficiency?

To determine the expression levels of RYR2 we performed a qPCR on RNA extracted from cardiomyocytes generated from both of the RYR2 hiPSC clones and also from a control hiPSC line. This qPCR revealed that the expression of RYR2 in the RYR2 hiSPC-CMs is approximately half that seen in the cardiomyocytes generated from the control line. This suggests that the p.(Arg4790Ter) mutation results in haploinsufficiency, however two different allele-specific qPCRs (where allele specificity was based on rs684923 and rs3765097 within RYR2) showed that both alleles were expressed at comparable levels and responsible for half of the total expression. Strikingly, the measurement of total RYR2 levels by primers surrounding the SNPs which the allele-specific qPCR was based on again showed that total expression was approximately half of that seen in the control line, which means that this 50% reduction in total RYR2 levels was found using 3 primersets in different regions of the RYR2 gene. A possible explanation for seeing reduced expression of both RYR2 alleles is non-specific binding of one primer in the allele-specific qPCRs, however the allele specificity of the primers for rs684923 was confirmed in the control line. Furthermore, we performed two independent allele-specific qPCRs based on two different SNPs, which showed similar results. This reduces the possibility that non-specific binding of the primers was an issue in these allele-specific qPCRs.

It is unclear how it is possible that we detect only half of the RYR2 expression, while both alleles are expressed at similar levels and further work needs to be done to explore this. One possible hypothesis is that the reduced expression could be due to SNPs within regulatory regions, such as enhancers, which affect RYR2 expression. For each allele to be expressed at approximately 50% of what would normally be expected, the proband would need to be homozygous for a single SNP or heterozygous for two different SNPs which have a regulatory influence.

Within the family in which the p.(Arg4790Ter) mutation was identified there is clear evidence of reduced penetrance. There are a number of individuals who carry the mutation but are asymptomatic and have had normal cardiac investigations. The altered expression of RYR2

49 could be a reason for the incomplete penetrance of the mutation within the family, because it might be that the mutation only becomes pathogenic when the wild-type allele is not able to compensate for the mutant allele. The proband’s mother, who is in her 7th decade, carries the RYR2 mutation but has had a normal cardiac evaluation and has remained entirely asymptomatic throughout her life. Based on the hypothesis of SNPs in regulatory regions causing reduced expression of RYR2, the reduced expression of both RYR2 alleles in the proband indicates that a suppressive SNP is present on both alleles of the proband. The proband inherited her mutant allele with the suppressive SNP from her mother, which indicates that expression of this mutant allele should also be suppressed in the mother. The fact that the mother remained symptomatic till her 7th decade indicates that she most probably does not carry a suppressive regulatory SNP on her wild-type allele. The combination of suppression of the mutant allele without affecting the wild-type allele would shift the allelic balance towards there being more healthy than mutant protein. The effect of a shift in balance between healthy and mutant protein on the phenotype of cardiac arrhythmias has been shown before for regulatory SNPs in the 3’UTR of KCNQ1 on the severity of long QT syndrome type 1. (63)

The above hypothesis of the balance and expression of both healthy and mutant protein in these two family members suggests that the proband would have half of the mutant version of the protein and only half of the functional RYR2 protein resulting in her having half of the total number of RYR2 channels and with half of these channels being functionally abnormal. The proband’s mother would have 75% of total RYR2 channels of what would normally be expected but only one third of these would be expected to be functionally abnormal. The presence of reduced amounts of fully functional RYR2 channels in combination with mutant channels could mean a threshold is reached, where the normal RYR2 allele is not able to compensate for the abnormal function of the mutant allele, which leads to a clinical phenotype only in the proband.

Liu et al created a mouse model of the exon-3 deletion in RYR2.(64) They showed that the heterozygous exon-3 deletion mice were not susceptible to stress induced tachyarrhythmias, however the exon-3 deletion hearts showed a significantly lower level of RYR2 protein expression compared to wild-type hearts. They then created inducible cardiac specific conditional knockouts of the wild-type RYR2 allele in heterozygous exon-3 deletion mice. These mice displayed bradycardia and a higher rate of death than control mice. They hypothesised that the possible shift of predominant expression of the wild type allele to predominant expression of the mutant allele was the cause of the phenotype. It is also possible that the phenotype could have arisen due to the absolute reduction in total RYR2 expression or this combined with a shift in the allelic balance. This fits with our hypothesis that greater total RYR2 expression and predominant expression of the wild type allele in the proband’s mother could be the reason for the absence of a clinical phenotype in her.

It would be interesting to assess RYR2 expression levels in other family members who carry the mutation. If varying levels of RYR2 expression are found in other family members, linkage analysis could be undertaken in the hope of identifying regions of interest which may contain the regulatory SNPs responsible for the expression of RYR2. If other family members who carry the RYR2 mutation are found to have higher levels of RYR2 expression compared to the proband, studying hiPSC-CMs generated from these individuals would provide further insight into the specific effect of the p.(Arg4790Ter) mutation and also the contributing effect of the reduced number of RYR2 channels on the calcium handling phenotype.

To add further weight to the qPCR results and to confirm that the p.(Arg4790Ter) mutation does not result in nonsense mediated decay we conducted an experiment using cycloheximide, a compound which inhibits nonsense mediated decay. A hiPSC line which was generated from an individual who carries a LAMP2 mutation, which is known to result in nonsense mediated decay, was used as positive control to demonstrate that cycloheximide inhibits nonsense mediated decay. We confirmed that cycloheximide increased the expression of LAMP2 in this line the most at 9 hours of incubation and therefore treated cells from the RYR2 line and the control line with cycloheximide for 9 hours. The qPCR for total RYR2 expression showed that the expression of RYR2 was significantly greater in the cycloheximide treated cells in both RYR2 clones. Unfortunately, the expression of RYR2 in the control line was increased to similar levels after treatment with cycloheximide. The control line would not be expected to display nonsense mediated decay of RYR2. This indicates that there were other non-specific factors which lead to elevated expression of RYR2. The elevated expression of RYR2 seen in all lines is probably a direct result of the prolonged exposure of cycloheximide at a concentration of 300µg/ml. In previous work where cycloheximide has been used to demonstrate the presence of nonsense mediated decay lower concentrations of cycloheximide have been used, ranging from 25μg/ml to 100µg/ml. (65-68) In order to draw conclusions about nonsense mediated decay in the RYR2 line the timecurve should be repeated at a lower concentration of cycloheximide on both cells from the Danon line and also the control line. This would allow for identification of an optimal time and concentration at which nonsense mediated decay is prevented in the Danon line but no effect of cycloheximide on LAMP2 or RYR2 expression is seen in the control line. Using this concentration and incubation time of cycloheximide the experiment could be repeated on cells from hiPSC-CMs from the two RYR2 clones. As the allele specific qPCR showed expression of both alleles, one would not expect to see evidence of nonsense mediated decay in the RYR2 lines, however this experiment could provide further confirmation of this.

How does the p.(Arg4790Ter) RYR2 mutation result in an abnormal calcium handling phenotype?

Although the p.(Arg4790Ter) RYR2 mutation does not result in haploinsufficiency, it is predicted to cause deletion of a functionally important region of the RYR2 gene that has been shown to be implicated in formation of the channel gate and also for sensing of calcium levels within the SR. (31, 44) The presence of abnormal RYR2 protein in addition to a reduction in the amount of functional RYR2 may be what leads to a clinically observable phenotype.

Arrhythmias at Baseline

Significantly more calcium transient abnormalities were seen in the RYR2 hiPSC-CMs at baseline compared to the control hiPSC-CMs. The transient abnormalities seen in the RYR2 hiPSC-CMs were mainly large humped transients. These humped transients have previously been reported in hiPSC-CMs generated from a CPVT patient with a missense mutation in RYR2.(49) The p.(Arg4790Ter) mutation is predicted to cause deletion of a region which is proposed as forming the gate of RYR2.(31, 44) The p.(Arg4790Ter) mutation may cause partial formation or alterations in the channel gate resulting in a leaky RYR2 channel with an increased open probability. This would result in prolonged and unprovoked calcium release from the SR.

The reduced expression of RYR2 in the RYR2 hiPSC-CMs which was shown on the qPCRs could mean that there is a reduced number of structurally and functionally normal RYR2 channels. This could result in a gradual increase in SR calcium content with each pulse resulting in the SOICR threshold being reached more rapidly causing a large and prolonged unprovoked calcium release from the SR. This theory has previously been hypothesised as a mechanism for the loss of function mutation p.Ala4860Gly resulting in EADs. (43) To explore this theory further the SR calcium content could be measured. This could be done using caffeine, which activates RYR2 channels and stimulates the release of calcium from the SR.

Effects of Isoproterenol

Treatment with isoproterenol caused RYR2 hiPSC-CMs which displayed normal calcium transients at baseline to develop calcium transient abnormalities, typically double or triple humped transients. Significantly more RYR2 hiPSC-CMs developed calcium transient

52 abnormalities in response to isoproterenol compared to control hiPSC-CMs. Patients with CPVT typically develop arrhythmias in response to adrenergic stimulation therefore it would be expected that the RYR2 hiPSC-CMs would develop calcium transient abnormalities in response to treatment with isoproterenol. This has previously been shown in hiPSC-CMs generated from CPVT patients with nonsense mutations in RYR2.(49, 53) Isoproterenol appears to accentuate the phenotype which was seen in the RYR2 hiPSC-CMs. This could be because isoproterenol results in increased levels of calcium within the SR. Data from Kashimura et al has shown that adrenergic stimulation produces calcium waves in ventricular myocytes from a mouse with a missense mutation in RYR2 by increasing SR calcium content and not by reducing the threshold.(69) If a mutation results in a reduction in SOICR threshold, an increase in SR calcium caused by adrenergic stimulation will result in the SOICR threshold being reached more rapidly. Once the threshold is reached, the RYR2 channels are stimulated causing them to open and release calcium into the cytosol.

Store Overload Induced Calcium Release

These experiments were designed to identify whether the p.(Arg4790Ter) mutation results in a reduced threshold for SOICR which has been described in a number of gain of function missense mutations in RYR2.(12, 42, 49)

More RYR2 hiPSC-CMs displayed calcium transients in the presence of lower external calcium concentrations compared to control hiPSC-CMs suggesting that the RYR2 hiPSC- CMs have a lower threshold for SOICR compared to the control cells. This suggests that the mutant RYR2 channels may have an increased sensitivity to activation by luminal calcium. The region of the gene in which the p.(Arg4790Ter) mutation lies has previously been shown to be important for luminal calcium sensing.(31, 44) A number of amino acid substitutions in a region which lies close to the p.(Arg4790Ter) mutation have been shown to result in a reduced sensitivity to activation by luminal calcium.(31, 44) Chen et al proposed that electrostatic alterations between certain residues occur when calcium associates with the Gly4872 residue and this causes the channel to have an increased likelihood of being open.(44) Mutations of these residues therefore disrupt this and result in a reduced sensitivity to luminal calcium activation. As the p.(Arg4790Ter) mutation causes deletion of these residues where these electrostatic alterations occur it might be expected that the RYR2 hiPSC-CMs would display an reduced sensitivity to activation by luminal calcium (and an increased threshold for SOICR), however our data may suggest that the p.(Arg4790Ter) mutation results in an increased sensitivity to activation by luminal calcium. It is important to note however that these experiments were not directly measuring the SOICR threshold and they could not distinguish between a reduced threshold for SOICR and higher levels of calcium within the SR. Further work assessing SR calcium content would help address this

53 issue. Work using single RYR2 mutant channels could also be done to explore the effects of the p.(Arg4790Ter) mutation on sensitivity to activation by luminal calcium.

Data from the qPCR showed reduced total RYR2 expression in the RYR2 hiPSC-CMs. This may suggest that there is an overall reduction in RYR2 channels which could result in a gradual build-up of calcium within the SR with each beat. This build-up of calcium within the SR, combined with an increased sensitivity to activation by luminal calcium, will lead to the threshold for SOICR being reached more readily and the release of calcium from the SR in absence of an action potential. This gradual build-up of calcium in the SR could lead to SOICR in the absence of adrenergic stimulation explaining the calcium transient abnormalities seen at baseline. However, this process may be exacerbated and brought on earlier by adrenergic stimulation or other factors which increase the SR calcium content.

Pharmacological correction of calcium transient abnormalities

Treatment with 1µM carvedilol corrected calcium transient abnormalities in 80.0% of RYR2 hiPSC-CMs which displayed calcium transient abnormalities at baseline. Cells in which the carvedilol did not completely abolish the calcium transient abnormalities did show an improvement in the calcium transient abnormalities. The abnormalities appeared less complex although this could not be tested statistically as n=2.

Prior to the RYR2 hiPSC-CMs being treated with carvedilol they were not treated with isoproterenol. This data shows that carvedilol works in the absence of adrenergic stimulation suggesting its effects are not solely related to its beta blocking properties. One possible explanation for this is that carvedilol directly inhibits RYR2. Zhou et al have shown that carvedilol inhibits SOICR in HEK293 cells which expressed a mutation within RYR2, p.Arg4496Cys, which promotes SOICR.(11) These cells were treated with a much higher concentration of carvedilol, 30µM. They did however demonstrate that 1µM carvedilol reduced the frequency and occurrence of SOICR in cardiomyocytes from mice with the same RYR2 mutation. They also showed that 1µM carvedilol reduced the mean open time and open probability of mutant RYR2 channels from SR microsomes in lipid bilayers. Another possible explanation for the action of carvedilol in the absence of adrenergic stimulation is that carvedilol exerts an indirect effect on calcium handling and causes modulation of SR calcium content. Further studies are needed to fully understand the mechanism of action of carvedilol.

If the RYR2 hiPSC-CMs display a lower threshold for SOICR and carvedilol inhibits SOICR, it would be expected that pre-treatment with carvedilol would reduce the development of transient abnormalities when cells are exposed to isoproterenol. It would also be expected that carvedilol would be able to correct calcium transient abnormalities in cells which develop

54 calcium transient abnormalities after the application of isoproterenol. Unfortunately this was not tested in the RYR2 hiPSC-CMs, however this is something that could be done as part of further work.

Carvedilol reversibly binds to beta adrenergic receptors on cardiomyocytes. It would be interesting to assess whether the cells in which carvedilol corrected calcium transient abnormalities develop abnormalities again if they were washed out and re-incubated in normal tyrodes solution following treatment with carvedilol.

The proband is currently being treated with bisoprolol. The data from Zhou et al showed that bisoprolol did not cause inhibition of SOICR in HEK293 cells expressing the SOICR promoting mutation, p.Arg4496Cys.(11) It would be interesting to identify whether bisoprolol is able to rescue the abnormal calcium handling within the RYR2 hiPSC-CMs and whether it was as successful at doing this as carvedilol has proven to be.

Further Work

The qPCRs showed that there is approximately half the expression of RYR2 in the RYR2 hiPSC-CMs compared to the control hiPSC-CMs. It would also be interesting to assess RYR2 expression within other family members and to try to identify possible SNPs which regulate RYR2 expression. If SNPs which regulate the expression of RYR2 were identified, the mutation could be introduced into a control hiPSC line which does not carry the SNPs which alter the expression of RYR2. This would allow for the mutation to be studied without the effect of reduced RYR2 expression influencing the phenotype.

Repeating the timecurve with cycloheximide at a lower concentration on cells from both the Danon line and also the control line would allow for an optimal incubation time, at which there is no upregulation of RYR2 or LAMP2 in the control line, to be identified. Cells from the RYR2 line could then be treated with the cycloheximide whilst other cells from the line are left untreated. Absence of differences in RYR2 expression between the treated and untreated cells would allow us to confidently state that there is no nonsense mediated decay occurring within the RYR2 gene in the line.

Undertaking calcium imaging whilst simultaneously measuring action potentials would provide information on what effect the calcium transient abnormalities have on the action potential. This would lead to a greater insight into how the calcium transient abnormalities lead to cardiac arrhythmias. This simultaneous measuring would also allow different cardiomyocyte cell sub-types to be distinguished between.

Assessing SR calcium content using caffeine would be interesting as this would allow us to explore the hypothesis that the overall reduction in number of RYR2 channels causes the level of calcium in the SR to gradually rise until a threshold is reached causing calcium to be released into the cytosol via the RYR2 channels. Measuring SR calcium content would also help us to understand whether the p.(Arg4790Ter) mutation definitely results in a reduced threshold for SOICR.

Carvedilol was effective in correcting calcium transient abnormalities in the RYR2 hiPSC- CMs at baseline. As CPVT is characterised by the development of arrhythmias in response to adrenergic stimulation, assessing whether carvedilol can prevent the development of calcium transient abnormalities in the RYR2 hiPSC-CMs in response to isoproterenol would be a further important aspect to investigate. Washing out cells after treatment with carvedilol to assess whether cells in which the calcium transient abnormalities appear to be corrected by carvedilol redevelop transient abnormalities may further support the corrective action of carvedilol as it is known that carvedilol reversibly binds to beta adrenergic receptors in cardiomyocytes. It would also be interesting to investigate whether other beta blockers, in particular bisoprolol with which the proband is being treated, have an impact on calcium

56 transient abnormalities seen in the RYR2 hiPSC-CMs and, if they do, whether they are as effective as carvedilol.

Limitations of Study

The control hiPSC-CMs used in this study were generated from a healthy male with no personal or family history of cardiovascular problems or sudden cardiac death. The subject from which the control line had been generated had not undergone any form of genetic testing. Although the individual had no history of cardiac problems, it is possible that they could harbour a mutation within a gene associated with an arrhythmogenic cardiac condition. Performing whole exome sequencing or a targeted panel of relevant cardiac genes would overcome this issue. This however raises ethical issues as there is the potential of identifying variants of uncertain significance which can be difficult to interpret, particularly in a healthy individual. The results of this testing could also have implications for other family members.

The levels of total expression of RYR2 was checked in RNA extracted from two clones of the RYR2 hiPSC-CMs. The cells were over 21 days from the start of differentiation and the control hiPSC-CMs used were the same age reducing the likelihood that the differences seen were due to differing maturation of cells. We did not however check total RYR2 expression levels in control and RYR2 hiPSC-CMs of varying ages. Confirming that these differences in expression levels are in cells which are older would further reduce the chance of this. Examining the levels of expression of other cardiac specific markers in the cells would be useful as if no differences in expression levels are seen in the RYR2 and control hiPSC-CMs this would further confirm the significance of our results.

Although we confirmed that there is reduced expression of RYR2 at the mRNA level we did not show this at the protein level. This could be achieved by doing a western blot, although this could be challenging due to the large size of the RYR2 protein. Proving this at the protein level would add further weight to altered RYR2 expression having an influence on the clinical phenotype.

Creating an isogenic control line using the CRISPR-Cas9 system, although costly and time- consuming, can ensure that other genetic factors which may influence the phenotype are accounted for. This therefore means that the differences seen between the line being studied and the control line can be attributed to the mutation in question. It may however be preferable to introduce the p.(Arg4790Ter) mutation into a healthy control hiPSC line as then the mutation could be studied independent of the effects of the reduced expression of RYR2.

Although two different RYR2 hiPSC clones were used for the molecular analysis, only one clone was used for the calcium imaging experiments. The benefit of using two different clones is that similar results obtained from the two clones eliminates the possibility of clonal variation.

The type of cardiomyocyte (atrial, ventricular or nodal) being studied in the calcium imaging experiments was unclear. This is important because the different subtypes of cardiomyocyte may display different calcium handling phenotypes. Simultaneous calcium imaging and

58 recording of action potentials would help to distinguish between the different cell types and would help overcome this issue.

All of the hiPSC-CMs used for the calcium imaging experiments were between 25 and 70 days from the day of last passage as undifferentiated hiPSCs. It has been shown that it is important for hiPSC-CMs to be at least 21 days from the start of differentiation when calcium studies are undertaken as it is around this time when they develop mature calcium handling. (57) In this study the cells used for calcium imaging were at least 21 days from the start of differentiation, however the age range of the cells used was large. This means that it is possible that although all of these cells may display a mature calcium handling phenotype, the age of them may result in differences in calcium handling. Using a smaller age range of cells would overcome this issue and help to reduce the variability of the results.

Conclusions

The RYR2 hiPSC-CMs display a clearly abnormal calcium handling phenotype in that a significant number display calcium transient abnormalities at baseline and they also develop these abnormalities in response to adrenergic stimulation. They also develop spontaneous calcium waves at lower external calcium concentrations suggesting a lower threshold for SOICR. The p.(Arg4790Ter) mutation appears to behave in a similar manner to the well described gain of function mutations in RYR2. It is however uncertain to what extent the mutation is responsible for this abnormal phenotype and to what extent the reduced expression of RYR2 contributes to this. It is possible that the p.(Arg4790Ter) mutation may cause an abnormal calcium handling phenotype at a cellular level but may not be significant enough alone to result in a clinical phenotype.

Further work is required to establish the mechanism which causes reduced expression of RYR2 in the proband and whether this has a significant contribution to the clinical phenotype.

References

1. Reid DS, Tynan M, Braidwood L, Fitzgerald GR. Bidirectional tachycardia in a child. A study using His bundle electrography. Br Heart J. 1975;37(3):339-44. 2. van der Werf C, Wilde AA. Catecholaminergic polymorphic ventricular tachycardia: from bench to bedside. Heart. 2013;99(7):497-504. 3. Postma AV, Denjoy I, Kamblock J, Alders M, Lupoglazoff JM, Vaksmann G, et al. Catecholaminergic polymorphic ventricular tachycardia: RYR2 mutations, bradycardia, and follow up of the patients. J Med Genet. 42. England2005. p. 863-70. 4. Priori SG, Napolitano C, Memmi M, Colombi B, Drago F, Gasparini M, et al. Clinical and molecular characterization of patients with catecholaminergic polymorphic ventricular tachycardia. Circulation. 2002;106(1):69-74. 5. Priori SG, Wilde AA, Horie M, Cho Y, Behr ER, Berul C, et al. HRS/EHRA/APHRS expert consensus statement on the diagnosis and management of patients with inherited primary arrhythmia syndromes: document endorsed by HRS, EHRA, and APHRS in May 2013 and by ACCF, AHA, PACES, and AEPC in June 2013. Heart Rhythm. 2013;10(12):1932-63. 6. Hayashi M, Denjoy I, Extramiana F, Maltret A, Roux-Buisson N, Lupoglazoff JM, et al. The role of stress test for predicting genetic mutations and future cardiac events in asymptomatic relatives of catecholaminergic polymorphic ventricular tachycardia probands. Europace. 2012;14(9):1344-51. 7. Venetucci L, Denegri M, Napolitano C, Priori SG. Inherited calcium channelopathies in the pathophysiology of arrhythmias. Nat Rev Cardiol. 2012;9(10):561-75. 8. Swan H, Piippo K, Viitasalo M, Heikkila P, Paavonen T, Kainulainen K, et al. Arrhythmic disorder mapped to chromosome 1q42-q43 causes malignant polymorphic ventricular tachycardia in structurally normal hearts. J Am Coll Cardiol. 1999;34(7):2035-42. 9. Poole-Wilson PA, Swedberg K, Cleland JG, Di Lenarda A, Hanrath P, Komajda M, et al. Comparison of carvedilol and metoprolol on clinical outcomes in patients with chronic heart failure in the Carvedilol Or Metoprolol European Trial (COMET): randomised controlled trial. Lancet. 2003;362(9377):7-13. 10. Kowey PR. A review of carvedilol arrhythmia data in clinical trials. J Cardiovasc Pharmacol Ther. 2005;10 Suppl 1:S59-68. 11. Zhou Q, Xiao J, Jiang D, Wang R, Vembaiyan K, Wang A, et al. Carvedilol and its new analogs suppress arrhythmogenic store overload-induced Ca2+ release. Nat Med. 2011;17(8):1003-9. 12. Jiang D, Xiao B, Yang D, Wang R, Choi P, Zhang L, et al. RyR2 mutations linked to ventricular tachycardia and sudden death reduce the threshold for store-overload-induced Ca2+ release (SOICR). Proc Natl Acad Sci U S A. 2004;101(35):13062-7. 13. Hayashi M, Denjoy I, Extramiana F, Maltret A, Buisson NR, Lupoglazoff JM, et al. Incidence and risk factors of arrhythmic events in catecholaminergic polymorphic ventricular tachycardia. Circulation. 2009;119(18):2426-34. 14. van der Werf C, Kannankeril PJ, Sacher F, Krahn AD, Viskin S, Leenhardt A, et al. Flecainide therapy reduces exercise-induced ventricular arrhythmias in patients with catecholaminergic polymorphic ventricular tachycardia. J Am Coll Cardiol. 2011;57(22):2244-54. 15. Smith GL, MacQuaide N. The direct actions of flecainide on the human cardiac ryanodine receptor: keeping open the debate on the mechanism of action of local anesthetics in CPVT. Circ Res. 116. United States2015. p. 1284-6. 16. Bannister ML, Thomas NL, Sikkel MB, Mukherjee S, Maxwell C, MacLeod KT, et al. The Mechanism of Flecainide Action in CPVT Does Not Involve a Direct Effect on RyR2. Circ Res. 116. United States: 2015 American Heart Association, Inc.; 2015. p. 1324-35.

17. Napolitano C, Priori SG. Diagnosis and treatment of catecholaminergic polymorphic ventricular tachycardia. Heart Rhythm. 2007;4(5):675-8. 18. Pizzale S, Gollob MH, Gow R, Birnie DH. Sudden death in a young man with catecholaminergic polymorphic ventricular tachycardia and paroxysmal atrial fibrillation. J Cardiovasc Electrophysiol. 2008;19(12):1319-21. 19. Sherrid MV, Daubert JP. Risks and challenges of implantable cardioverter- defibrillators in young adults. Prog Cardiovasc Dis. 2008;51(3):237-63. 20. Wilde AA, Bhuiyan ZA, Crotti L, Facchini M, De Ferrari GM, Paul T, et al. Left cardiac sympathetic denervation for catecholaminergic polymorphic ventricular tachycardia. N Engl J Med. 2008;358(19):2024-9. 21. De Ferrari GM, Dusi V, Spazzolini C, Bos JM, Abrams DJ, Berul CI, et al. Clinical Management of Catecholaminergic Polymorphic Ventricular Tachycardia: The Role of Left Cardiac Sympathetic Denervation. Circulation. 2015;131(25):2185-93. 22. Priori SG, Napolitano C, Tiso N, Memmi M, Vignati G, Bloise R, et al. Mutations in the cardiac ryanodine receptor gene (hRyR2) underlie catecholaminergic polymorphic ventricular tachycardia. Circulation. 2001;103(2):196-200. 23. Laitinen PJ, Brown KM, Piippo K, Swan H, Devaney JM, Brahmbhatt B, et al. Mutations of the cardiac ryanodine receptor (RyR2) gene in familial polymorphic ventricular tachycardia. Circulation. 2001;103(4):485-90. 24. Lahat H, Pras E, Olender T, Avidan N, Ben-Asher E, Man O, et al. A missense mutation in a highly conserved region of CASQ2 is associated with autosomal recessive catecholamine-induced polymorphic ventricular tachycardia in Bedouin families from Israel. Am J Hum Genet. 2001;69(6):1378-84. 25. Roux-Buisson N, Cacheux M, Fourest-Lieuvin A, Fauconnier J, Brocard J, Denjoy I, et al. Absence of triadin, a protein of the calcium release complex, is responsible for cardiac arrhythmia with sudden death in human. Hum Mol Genet. 2012;21(12):2759-67. 26. Nyegaard M, Overgaard MT, Sondergaard MT, Vranas M, Behr ER, Hildebrandt LL, et al. Mutations in calmodulin cause ventricular tachycardia and sudden cardiac death. Am J Hum Genet. 2012;91(4):703-12. 27. Medeiros-Domingo A, Bhuiyan ZA, Tester DJ, Hofman N, Bikker H, van Tintelen JP, et al. The RYR2-Encoded Ryanodine Receptor/Calcium Release Channel in Patients Diagnosed Previously With Either Catecholaminergic Polymorphic Ventricular Tachycardia or Genotype Negative, Exercise-Induced Long QT SyndromeA Comprehensive Open Reading Frame Mutational Analysis. Journal of the American College of Cardiology. 2009;54(22):2065-74. 28. McKie AB, Alsaedi A, Vogt J, Stuurman KE, Weiss MM, Shakeel H, et al. Germline mutations in RYR1 are associated with foetal akinesia deformation sequence/lethal multiple pterygium syndrome. Acta Neuropathol Commun. 2014;2:148. 29. McCarthy TV, Quane KA, Lynch PJ. Ryanodine receptor mutations in malignant hyperthermia and central core disease. Hum Mutat. 2000;15(5):410-7. 30. Tiso N, Stephan DA, Nava A, Bagattin A, Devaney JM, Stanchi F, et al. Identification of mutations in the cardiac ryanodine receptor gene in families affected with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2). Hum Mol Genet. 2001;10(3):189-94. 31. Jiang D, Chen W, Wang R, Zhang L, Chen SR. Loss of luminal Ca2+ activation in the cardiac ryanodine receptor is associated with ventricular fibrillation and sudden death. Proc Natl Acad Sci U S A. 2007;104(46):18309-14. 32. Lehnart SE, Mongillo M, Bellinger A, Lindegger N, Chen BX, Hsueh W, et al. Leaky Ca2+ release channel/ryanodine receptor 2 causes seizures and sudden cardiac death in mice. J Clin Invest. 2008;118(6):2230-45. 33. Nagrani T, Siyamwala M, Vahid G, Bekheit S. Ryanodine calcium channel: a novel channelopathy for seizures. Neurologist. 2011;17(2):91-4.

34. Hamdan FF, Srour M, Capo-Chichi JM, Daoud H, Nassif C, Patry L, et al. De novo mutations in moderate or severe intellectual disability. PLoS Genet. 2014;10(10):e1004772. 35. Fabiato A. Calcium-induced release of calcium from the cardiac sarcoplasmic reticulum. Am J Physiol. 1983;245(1):C1-14. 36. Priori SG, Chen SR. Inherited dysfunction of sarcoplasmic reticulum Ca2+ handling and arrhythmogenesis. Circ Res. 2011;108(7):871-83. 37. Bers DM. Cardiac excitation-contraction coupling. Nature. 415. England2002. p. 198-205. 38. Ju YK, Allen DG. How does beta-adrenergic stimulation increase the heart rate? The role of intracellular Ca2+ release in amphibian pacemaker cells. J Physiol. 1999;516 ( Pt 3):793-804. 39. Ikemoto N, Yamamoto T. Postulated role of inter-domain interaction within the ryanodine receptor in Ca(2+) channel regulation. Trends Cardiovasc Med. 2000;10(7):310- 6. 40. Tateishi H, Yano M, Mochizuki M, Suetomi T, Ono M, Xu X, et al. Defective domain- domain interactions within the ryanodine receptor as a critical cause of diastolic Ca2+ leak in failing hearts. Cardiovasc Res. 2009;81(3):536-45. 41. Wehrens XH, Lehnart SE, Huang F, Vest JA, Reiken SR, Mohler PJ, et al. FKBP12.6 deficiency and defective calcium release channel (ryanodine receptor) function linked to exercise-induced sudden cardiac death. Cell. 2003;113(7):829-40. 42. Jiang D, Wang R, Xiao B, Kong H, Hunt DJ, Choi P, et al. Enhanced store overload- induced Ca2+ release and channel sensitivity to luminal Ca2+ activation are common defects of RyR2 mutations linked to ventricular tachycardia and sudden death. Circ Res. 2005;97(11):1173-81. 43. Zhao YT, Valdivia CR, Gurrola GB, Powers PP, Willis BC, Moss RL, et al. Arrhythmogenesis in a catecholaminergic polymorphic ventricular tachycardia mutation that depresses ryanodine receptor function. Proc Natl Acad Sci U S A. 112. United States2015. p. E1669-77. 44. Chen W, Wang R, Chen B, Zhong X, Kong H, Bai Y, et al. The ryanodine receptor store-sensing gate controls Ca2+ waves and Ca2+-triggered arrhythmias. Nat Med. 2014;20(2):184-92. 45. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126(4):663-76. 46. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007;131(5):861-72. 47. Moretti A, Bellin M, Welling A, Jung CB, Lam JT, Bott-Flugel L, et al. Patient-specific induced pluripotent stem-cell models for long-QT syndrome. N Engl J Med. 2010;363(15):1397-409. 48. Burridge PW, Matsa E, Shukla P, Lin ZC, Churko JM, Ebert AD, et al. Chemically defined generation of human cardiomyocytes. Nat Methods. 2014;11(8):855-60. 49. Itzhaki I, Maizels L, Huber I, Gepstein A, Arbel G, Caspi O, et al. Modeling of catecholaminergic polymorphic ventricular tachycardia with patient-specific human- induced pluripotent stem cells. J Am Coll Cardiol. 2012;60(11):990-1000. 50. Kujala K, Paavola J, Lahti A, Larsson K, Pekkanen-Mattila M, Viitasalo M, et al. Cell model of catecholaminergic polymorphic ventricular tachycardia reveals early and delayed afterdepolarizations. PLoS One. 2012;7(9):e44660. 51. Zhang XH, Haviland S, Wei H, Saric T, Fatima A, Hescheler J, et al. Ca2+ signaling in human induced pluripotent stem cell-derived cardiomyocytes (iPS-CM) from normal and catecholaminergic polymorphic ventricular tachycardia (CPVT)-afflicted subjects. Cell Calcium. 2013;54(2):57-70.

52. Fatima A, Xu G, Shao K, Papadopoulos S, Lehmann M, Arnaiz-Cot JJ, et al. In vitro modeling of ryanodine receptor 2 dysfunction using human induced pluripotent stem cells. Cell Physiol Biochem. 2011;28(4):579-92. 53. Jung CB, Moretti A, Mederos y Schnitzler M, Iop L, Storch U, Bellin M, et al. Dantrolene rescues arrhythmogenic RYR2 defect in a patient-specific stem cell model of catecholaminergic polymorphic ventricular tachycardia. EMBO Mol Med. 2012;4(3):180-91. 54. Di Pasquale E, Lodola F, Miragoli M, Denegri M, Avelino-Cruz JE, Buonocore M, et al. CaMKII inhibition rectifies arrhythmic phenotype in a patient-specific model of catecholaminergic polymorphic ventricular tachycardia. Cell Death Dis. 2013;4:e843. 55. Penttinen K, Swan H, Vanninen S, Paavola J, Lahtinen AM, Kontula K, et al. Antiarrhythmic Effects of Dantrolene in Patients with Catecholaminergic Polymorphic Ventricular Tachycardia and Replication of the Responses Using iPSC Models. PLoS One. 2015;10(5):e0125366. 56. Liu N, Ruan Y, Denegri M, Bachetti T, Li Y, Colombi B, et al. Calmodulin kinase II inhibition prevents arrhythmias in RyR2(R4496C+/-) mice with catecholaminergic polymorphic ventricular tachycardia. J Mol Cell Cardiol. 2011;50(1):214-22. 57. Hwang HS, Kryshtal DO, Feaster TK, Sanchez-Freire V, Zhang J, Kamp TJ, et al. Comparable calcium handling of human iPSC-derived cardiomyocytes generated by multiple laboratories. J Mol Cell Cardiol. 2015;85:79-88. 58. Bround MJ, Asghari P, Wambolt RB, Bohunek L, Smits C, Philit M, et al. Cardiac ryanodine receptors control heart rate and rhythmicity in adult mice. Cardiovasc Res. 2012;96(3):372-80. 59. Bienengraeber M, Olson TM, Selivanov VA, Kathmann EC, O'Cochlain F, Gao F, et al. ABCC9 mutations identified in human dilated cardiomyopathy disrupt catalytic KATP channel gating. Nat Genet. 2004;36(4):382-7. 60. Schneider-Poetsch T, Ju J, Eyler DE, Dang Y, Bhat S, Merrick WC, et al. Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat Chem Biol. 2010;6(3):209-17. 61. Ruijter JM, Ramakers C, Hoogaars WM, Karlen Y, Bakker O, van den Hoff MJ, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45. 62. Rudolf R, Mongillo M, Rizzuto R, Pozzan T. Looking forward to seeing calcium. Nat Rev Mol Cell Biol. 2003;4(7):579-86. 63. Amin AS, Giudicessi JR, Tijsen AJ, Spanjaart AM, Reckman YJ, Klemens CA, et al. Variants in the 3' untranslated region of the KCNQ1-encoded Kv7.1 potassium channel modify disease severity in patients with type 1 long QT syndrome in an allele-specific manner. Eur Heart J. 2012;33(6):714-23. 64. Liu Y, Wang R, Sun B, Mi T, Zhang J, Mu Y, et al. Generation and characterization of a mouse model harboring the exon-3 deletion in the cardiac ryanodine receptor. PLoS One. 2014;9(4):e95615. 65. Zhang M, D'Aniello C, Verkerk AO, Wrobel E, Frank S, Ward-van Oostwaard D, et al. Recessive cardiac phenotypes in induced pluripotent stem cell models of Jervell and Lange- Nielsen syndrome: disease mechanisms and pharmacological rescue. Proc Natl Acad Sci U S A. 2014;111(50):E5383-92. 66. Parrini E, Mei D, Pisanti MA, Catarzi S, Pucatti D, Bianchini C, et al. Familial periventricular nodular heterotopia, epilepsy and Melnick-Needles Syndrome caused by a single FLNA mutation with combined gain-of-function and loss-of-function effects. J Med Genet. 2015;52(6):405-12. 67. Wu L, Tang HD, Huang XJ, Zheng L, Liu XL, Wang T, et al. PRRT2 truncated mutations lead to nonsense-mediated mRNA decay in Paroxysmal Kinesigenic Dyskinesia. Parkinsonism Relat Disord. 2014;20(12):1399-404.

68. Luan CJ, Shen W, Yu Z, Chen L, Gu Y, Tang LY, et al. Two nonsense mutations cause protein C deficiency by nonsense-mediated mRNA decay. Thromb Res. 2015;135(4):733-8. 69. Kashimura T, Briston SJ, Trafford AW, Napolitano C, Priori SG, Eisner DA, et al. In the RyR2(R4496C) mouse model of CPVT, beta-adrenergic stimulation induces Ca waves by increasing SR Ca content and not by decreasing the threshold for Ca waves. Circ Res. 2010;107(12):1483-9.

Appendix

1. List of genes included in Manchester Regional Genetics Laboratory Molecular Autopsy Next Generation Sequencing Panel (57 gene screen).

ABCC9 KCNE1 RBM20 ACTC1 KCNE2 RYR2 ACTN2 KCNE3 SCN1B AKAP9 KCNH2 SCN3B ANK2 KCNJ2 SCN4B CACNA1C KCNJ5 SCN5A CALM1 KCNQ1 SGCD CASQ2 LAMP2 SLC25A4 CSRP3 LMNA SNTA1 DES MYBPC3 TCAP DSC2 MYH6 TMEM43 DSG2 MYH7 TMPO DSP MYL2 TNNC1 EYA4 MYL3 TNNI3 FHL1 MYLK2 TNNT2 GLA NEXN TPM1 GPD1L PKP2 TRDN HCN4 PLN TTN JUP PRKAG2 VCL