Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations
2005 Resident enteric flora modulates the development of colitis in gnotobiotic mice Albert E. Jergens Iowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Allergy and Immunology Commons, Immunology and Infectious Disease Commons, and the Medical Immunology Commons
Recommended Citation Jergens, Albert E., "Resident enteric flora modulates the development of colitis in gnotobiotic mice " (2005). Retrospective Theses and Dissertations. 1824. https://lib.dr.iastate.edu/rtd/1824
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Resident enteric flora modulates the development of colitis in gnotobiotic
by
Albert E. Jergens
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Major: Immunobiology
Program of Study Committee: Michael J. Wannemuehler, Co-major Professor Randy Sacco, Co-major Professor Michael G. Conzemius Susan L. Carpenter Mark R. Ackermann
Iowa State University
Ames, Iowa
2005
Copyright © Albert E. Jergens, 2005. All rights reserved. UMI Number: 3175166
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
UMI
UMI Microform 3175166 Copyright 2005 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 11
Graduate College Iowa State University
This is to certify that the doctoral Dissertation of
Albert E. Jergens has met the dissertation requirements of Iowa State University
Signature was redacted for privacy. Co-Major Professor
Signature was redacted for privacy.
Co-Major Professor
Signature was redacted for privacy.
For the Major Program iii
TABLE OF CONTENTS
LIST OF FIGURES
LIST OF TABLES
CHAPTER 1. GENERAL INTRODUCTION 1 Research Problem 1 Overview of Inflammatory Bowel Disease in Humans 1 References 24
CHAPTER 2. COMPOSITION OF THE RESIDENT ENTERIC FLORA MODULATES THE DEVELOPMENT OF COLITIS 33 Abstract 34 Introduction 36 Materials and Methods 38 Results and Discussion 43 References 59
CHAPER 3. GNOTOBIOTIC MICE COLONIZED WITH HELICOBACTER BILIS DEMONSTRATE ANTIGEN- SPECIFIC IMMUNE RESPONSESTO RESIDENT ENTERIC FLORA 65 Abstract 66 Introduction 68 Materials and Methods 69 Results and Discussion 77 References 94
CHAPTER 4. GENERAL CONCLUSIONS 100 General Discussion 100 Future Studies 101 Acknowledgements 108 iv
LIST OF FIGURES
CHAPTER 1. GENERAL INTRODUCTION
Figure 1. Host-microbial-environmental interactions which contribute 6 the development of IBD
Figure 2. Electron photomicrographs of helicobacter-like organisms in the lumen of the mouse cecum 22
CHAPTER 2. COMPOSITION OF THE RESIDENT ENTERIC FLORA MODULATES THE DEVELOPMENT OF COLITIS
Figure 1. Histological changes in the cecal mucosa of defined 46 flora mice after bacterial infection
Figure 2A. Antibody responses to antigens derived from members of 48 the altered schaedler flora (ASF)
Figure 2B. Pooled antibody responses to antigens derived from 49 members of the altered schaedler flora (ASF)
Figure 3A. Detection of cytokine production to individual ASF 51 antigens in culture supernatant fluid from splenocytes (SPL) or mesenteric lymph node (MLN) cells
Figure 3B. Detection of pooled cytokine responses to ASF antigens 52 per group in culture supernatant fluid from splenocytes (SPL) or mesenteric lymph node (MLN) cells
CHAPER 3. GNOTOBIOTIC MICE COLONIZED WITH HELICOBACTER BILIS DEMONSTRATE ANTIGEN- SPECIFIC IMMUNE RESPONSES TO RESIDENT ENTERIC FLORA
Figure 1. Photograph of an agarose gel depicting PCR analysis 77 of murine fecal samples for the presence of H. bilis
Figure 2. Histological changes in the cecal mucosa 79 of defined flora mice after infection with H. bilis
Figure 3 A. Serum immunoglobulin levels from H. Mz's-infected 80 defined flora (DF) mice and non-infected DF mice V
Figure 3B. Pooled serum immunoglobulin levels from H. bilis- 81 infected defined flora (DF) mice and non-infected DF mice
Figure 4. Pooled serum IgG isotype levels from H. Mz's-infected 82 defined flora (DF) mice
Figure 5. Alterations in mucosal T and B lymphocyte populations 83 from H. M/s-infected defined flora (DF) mice and non-infected DF mice vi
LIST OF TABLES
CHAPTER 1. GENERAL INTRODUCTION
Table 1. Diagnostic tests for LBD 4
Table 2. Etiologic theories for DBD 7
Table 3. Categories of animal models of intestinal inflammation 11 based on method of induction
Table 4. The influence of the resident bacterial flora on inflammation in animal models 14
CHAPTER 2. COMPOSITION OF THE RESIDENT ENTERIC FLORA MODULATES THE DEVELOPMENT OF COLITIS
Table 1. Bacterial members comprising the altered schaedler flora 38
Table 2. Scoring system for histopathological evaluation of 42 gastrointestinal inflammation
Table 3. Gross pathologic observations in gnotobiotic mice 44
Table 4. Histopathological scores in gnotobiotic mice infected with 45 and without H. bilis or B. hyodysenteriae
CHAPER 3. GNOTOBIOTIC MICE COLONIZED WITH HELICOBACTER BILIS DEMONSTRATE ANTIGEN- SPECIFIC IMMUNE RESPONSES TO RESIDENT ENTERIC FLORA
Table 1. Primer sequences for identification of ASF bacteria 71
Table 2. Scoring system for histopathological evaluation of 74 gastrointestinal inflammation
Table 3. Increased concentrations of cytokines in mesenteric lymph 85 node (MLN) and splenic (SPL) supematants derived from altered schaedler flora (ASF) bacteria stimulated lymphocytes in H. bilis- infected defined flora (DF) and non-DF mice
Table 4. Summary data of cytokine analysis in gnotobiotic mice 86 1
CHAPTER 1. GENERAL INTRODUCTION
Research Problem: Chronic intestinal inflammation, as seen with inflammatory bowel
disease in humans, results from aberrant and poorly understood mucosal immune responses to intraluminal bacteria of the gastrointestinal tract in genetically susceptible individuals.
Although considerable research evidence indicates that luminal bacteria provide the antigenic stimulation for intestinal inflammation, the evaluation of bacterial-specific host responses mediating intestinal injury (as a consequence of changes in the composition of the resident enteric flora) have not been performed.
Overview of Inflammatory Bowel Disease in Humans:
Introduction
The chronic idiopathic inflammatory bowel diseases (DBD), which include Crohn's disease (CD), and ulcerative colitis (UC), are recognized as important causes of gastrointestinal disease in adults and children. Inflammatory bowel disease occurs worldwide, although it is more common in some regions (e.g., United States, United
Kingdom, and Scandinavia) than in others with incidence rates of4-10/100,000 persons per year and prevalence rates between 40-100/100,000 persons.(l) These disorders are most commonly diagnosed between the third and fourth decades of life, with no difference noted between males and females. Approximately 20% of all patients with DBD develop symptoms during childhood, with about 5% being diagnosed before 10 years of age. The ratio of UC to
CD varies widely according to the country of origin of the survey but in most countries UC is found with greater frequency than CD.(2) 2
Defining Ulcerative Colitis and Crohn's Disease
Ulcerative Colitis
Ulcerative colitis is a disease in which the inflammatory response and histological
changes are localized to the colon. The rectum is affected in 95% of patients with variable
degrees of proximal extension. Inflammation is limited primarily to the mucosa and consists
of diffuse involvement of variable severity with ulceration, edema, and hemorrhage
predominating along the length of the colon. The characteristic histologic findings are
lamina propria infiltration with mononuclear cells and neutrophils, crypt abcessation,
distortion of the mucosal glands, and goblet cell depletion.
Crohn's Disease
In contrast to UC, CD can involve any part of the gastrointestinal tract but also primarily involves the colon. Diseased segments frequently are separated by intervening normal bowel (e.g., patchy lesion distribution) with severe inflammation typically occurring as a transmural lesion. Histologic findings include small ulcerations, focal chronic inflammation extending down to the submucosa, and sometimes granuloma formation. The most common location for lesions is the ileocecal region, followed by the terminal ileum alone, diffuse small bowel involvement or focal colonic disease in decreasing order of frequency (e.g., ileocecal region>terminal ileum>small intestine.colon).
Intestinal Manifestations of Disease
Ulcerative Colitis
The most consistent feature of UC is the presence of blood and mucus in the stool, accompanied by lower abdominal cramping. The presence of diarrhea with blood and mucous as opposed to the absence to blood is used clinically to differentiate UC from 3
irritable bowel syndrome, an important and clinically-relevant IBD mimic. Ulcerative colitis
is usually diagnosed earlier after the onset of symptoms than is CD because of the presence
of blood in the stool, which generally alerts the person to the presence of a primary
gastrointestinal disorder. Abdominal pain (cramping) is often present in the left lower
quadrant with distal disease, and this discomfort may extend to involve the entire abdomen with pancolitis. Pediatric patients tend to have a higher frequency of pancolitis, a higher likelihood of proximal extension of the disease over time, and a higher risk of surgical intervention (e.g., colectomy) compared to adult-onset patients.(3)
Crohn's Disease
In contrast to UC, the presentation of CD is often subtle leading to a delay in definitive diagnosis. Gastrointestinal symptoms depend upon the location, extent, and severity of inflammation. Gastroduodenal CD presents with early nausea, vomiting, epigastric pain, and/or dysphagia. Due to post-prandial pain and a delay in gastric emptying, patients with gastroduodenal CD often limit their caloric intake to diminish their discomfort.
Colonic CD may mimic UC in that patients may present with diarrhea containing blood and mucous, lower abdominal cramping, and pain on defecation. Perianal disease is common, as are anal fissures and fistulae. Increasing abdominal cramping, distension, and emesis accompanied by borborygmi (e.g., intestinal "gurgling" are signs of progression of the inflammatory process to focal luminal stenosis causing partial/complete obstruction.
The course of IBD may be complicated by one or more extraintestinal manifestations including fever, weight loss, delayed growth and sexual maturation in children, arthralgia/arthritis, mucocutaneous lesions, ophthalmologic complications, hepatobiliary disease, and/or renal disease.(4) These extraintestinal lesions may be diagnosed concurrently 4
with active bowel disease, following a flare of IBD, or occasionally, may be the initial
presentation of IBD preceding intestinal symptomatology.
Diagnosis of IBD
The importance of excluding enteric pathogens before confirming a diagnosis of IBD,
or during IBD exacerbations, cannot be overemphasized. There are a diverse number of
bacterial pathogens that may mimic IBD and are discussed in a separate section of this dissertation. Once enteric infections are excluded, further diagnostic evaluation, including endoscopic mucosal biopsy which is required for definitive diagnosis, is performed (Table 1).
Test Finding
Complete blood counts Microcytic anemia, leukocytosis with band forms, thrombocytosis
Elevated sedimentation rate and serum orosomucoid, and C-reactive Acute-phase reactants protein levels
Chemistries Low serum iron level, hypoalbuminemia. elevated liver enzyme levels
Special serologic tests pANCA, ASCA
Exclude bacterial pathogens, ova and parasites, occult blood, and Stool examinations.* ' fecal leukocytes
Endoscopic evaluation ..... Esophagogastroduodenoscopy with biopsy, colonoscopy with biopsy
Upper gastrointestinal tract with small bowel follow-through, Radiologic evaluation enteroclysis (as indicated), barium enema
Table 1. Diagnostic tests for IBD. These tests are generally performed in a step-wise manner but always require histopathologic evaluation of intestinal biopsy specimens for diagnosis. pANCA= perinuclear anti-neutrophil cytoplasmic antibody; ASCA= anti- Saccharomyces cerevisiae antibodies. Modified from Hendrickson BA, Gokhale R, Cho J. Clinical aspects and pathophysiology of inflammatory bowel disease. Clin Micro Rev 2002; 15:79-94.
Treatment of IBD The management of IBD involves several strategies including: (1) control of acute symptoms (e.g., diarrhea, obstruction, megacolon), (2) induction and maintenance of remission (generally with corticosteroids, 5-ASA derivatives [sulfaslazine], antibiotics 5
[metronidazole, ciprofloxacin], immunosuppressive drugs [azathioprine, cyclosporine], and
biologic therapies [infliximab -> a novel TNF-a monoclonal antibody], (3) surgical
intervention for masses and stenoses, (4) nutritional support [dietary modification, use of
pre/probiotics] and (5) cancer surveillance.
Prognosis of UC and CD
The long-term prognosis for patients with IBD is extremely variable and is a
consequence of differences in disease extent, frequency, and severity of disease. For UC, the
relapse rate is approximately 40% during the first year following intensive medical therapy
with an additional 13% and 16% during the second and third years, respectively.(5) Most of these relapses may be controlled with medical therapy, but surgery will be required in approximately 1/3 of patients necessitating intensive treatment for complications (e.g., toxic dilatation of the colon).(6,7) For CD, the need for surgery occurs in greater than 50% of patients and a majority of patients will experience recurrent disease with the need for subsequent operative intervention.(8) The prognosis of IBD must also take into account the increased risk of colon carcinoma that is present in patients who have pan-UC for more than
8 years (9), but which may also occur in patients who have CD for more than 15 years.(lO)
As a result, it is recommended that high risk patients who have IBD undergo endoscopic surveillance with multiple colonic biopsies as part of the long-term management of their disease.
In summary, idiopathic IBD represents two distinct entities that share a number of clinical similarities and disease manifestations. Although the exact cause for UC and CD remains unknown, it is reasonable to expect that the further development and use of animal models to explore mechanisms of gastrointestinal inflammation will be important. 6
Additionally, animal models will continue to provide important insights into the cause for
IBD in humans, as well as aid in the design of more effective treatment modalities.
ETIOPATHOGENESIS OF INFLAMMATORY BOWEL DISEASE: MICROBIAL INFLUENCES IN ANIMAL MODELS OF DISEASE
Hypotheses Regarding Etiopathogenesis
Human inflammatory bowel diseases (IBD), including Crohn's disease and ulcerative
colitis, are poorly understood chronic immunologically-mediated diseases of unknown
etiology.(ll) Although numerous questions regarding the cause for IBD remain, familial and
epidemiologic data indicate that these debilitating intestinal inflammatory disorders result
from complex interactions between a genetically susceptible host, the mucosal immune system, and environmental factors.(12) (Figure 1)
Environmental Luminal antigens and adjuvants triggers
Host genetic susceptibility
Normal Tolerance Loss of Tolerance (Microflora?)
Figure 1. Host-microbial-environmental interactions which contribute to the development of IBD. Note that microbial factors consist of adjuvants and antigens derived from commensal enteric bacteria. With a loss of tolerance, the scale is tipped toward mucosal inflammation which may culminate in IBD. 7
However, neither the specific genes or environmental triggers have been conclusively
identified. Although the preponderance of data indicates that commensal luminal bacterial
constituents provide the constant antigenic drive for chronic intestinal inflammation, other
possibilities include dietary contributions, persistent pathogens, and alterations of the
virulence factors of commensal bacteria.(13) This section will briefly discuss the most
widely accepted etiologic hypotheses for IBD (Table 2).
Table 2. Etiologic theories for IBD
Persistent pathogen: Mycobacterium paratuberculosis, virulent E. coli Pseudomonas species, Listeria monocytogenes, Helicobacter species, measles Defective clearance of pathogenic and commensal bacteria Defective mucosal barrier: enhanced permeability, ineffective healing Dysbiosis: altered balance of protective/detrimental commensals Dysregulated immune response: overly aggressive effectors, loss of tolerance
Table 2. Etiologic theories for IBD. Modified from Sartor RB. Microbial influences in inflammatory bowel diseases: role in pathogenesis and clinical implications. In: Sartor RB, Sandbom WJ, eds. Kirsner's Inflammatory Bowel Diseases, 6th edn. London: Elsevier 2004, page 148.
Persistent Pathogenic Infection
A number of microbial pathogens have been proposed as causes of UC or CD, including Mycobacterium paratuberculosis, adherent/invasive E.coli, Pseudomonas spp.,
Listeria monocytogenes, or Helicobacter species. To date, the vast majority of these organisms have not been confirmed by blinded, controlled investigations. Adherent/invasive
E.coli may contribute to post-operative recurrence of Crohn's disease and the role of 8
Helicobacter species has yet to be fully explored. The availability of sensitive molecular techniques to detect microbial agents may yet allow identification of a specific bacterial pathogen.
Impaired Clearance of Pathogenic and Commensal Organisms
Defective killing of invading commensal bacteria, opportunistic bacteria, or traditional enteric pathogens may cause tissue inflammation and the induction of pathogenic immune responses. Some humans with CD have defective neutrophil function.(14) It has been shown that some Bacteroides species impair neutrophil phagocytosis and microbicidal activity, suggesting that enteric bacteria mediate these defects. It is noteworthy that microbial products can also inhibit host defenses. Bacteroides species may decrease neutrophil phagocytosis and bacterial killing (15) and defective T-cell function may foster the growth of opportunistic pathogens, such as intestinal Helicobacters which cause typhlitis and hepatobiliary disease in T-cell deficient mice.(16) Lastly, suppression of neutrophil function by nicotine and the administration of non-steroidal anti-inflammatory drugs
(NSAIDs) could explain several other environmental risk factors for CD.
Defective Mucosal Barrier Function
Intrinsic (genetically determined) or acquired (environmental agent) defects in mucosal barrier function or healing can lead to continuous uptake of luminal antigens that overwhelm host protective mechanisms. Endogenous luminal bacteria and their phlogistic products traverse the inflamed mucosa in IBD, especially in CD and experimental enterocolitis.(17) A correlation between disease activity and altered mucosal permeability in both CD and UC, and enhanced permeability predicting flares of CD, has been previously reported.( 18-20) Additionally, increased uptake of bacterial products derived from 9
translocating bacteria suggests an intrinsic defect in mucosal barrier function which may
precipitate intestinal inflammation. Previous studies have shown that mucosally-associated
bacterial concentrations are dramatically increased in IBD patients.(21)
Altered Balance of Protective/Detrimental Commensal Bacteria
Normal (otherwise healthy) hosts may develop chronic intestinal inflammation as a
consequence of altered composition of commensal enteric bacteria. The balance between
beneficial and detrimental enteric bacteria appears to be disturbed in patients with IBD,
especially in the western, industrialized populations where IBD is most prevalent. In brief,
increased fecal concentrations of intestinal bacteria (predominantly anaerobes) are present in
CD patients and their asymptomatic relatives.(22) Similar observations in experimental models have demonstrated the inflammatory potential of bacterial species, providing additional support for the concept that composition of the resident microflora modulates disease severity. Similar to human IBD, streptococci, clostridial species, and Bacteroides
(particularly B. vulgatus) may cause colitis in specific animal models. In contrast, lactobacilli and bifidobacteria have protective roles in pro-biotic and pre-biotic studies.
Disregulated Immune Responses to Commensal Bacteria (Loss of Tolerance)
Human DBD patients and rodents with chronic intestinal inflammation have exaggerated humoral and cellular immune responses to commensal bacteria and/or microbial pathogens. A Thl cytokine profile is found in CD patients (23) and most animal models.
(24) On the other hand, UC evokes a mixed Thl :Th2 profile (25) and several rodent models, such as the TCRav" mice, have a Th2 dominant response (26). Mechanisms of immune cell regulation largely depend on the interplay between antigen presenting cells (APC) and T lymphocytes. In normal hosts, regulatory T cells and APC inhibit pathogenic immune 10
responses to commensal bacteria (e.g., the phenomenon of immune tolerance) by several
pathways including IL-10 and TGF-(3 secretion. Taken together, the observations
predominantly made in animal models (see below) demonstrate (1) the importance of
interacting innate and acquired immune responses, (2) the complex regulation of tolerance to
luminal bacteria, and (3) the many potential mechanisms by which genetically-determined
defects in immunoregulation can lead to chronic, immune-mediated intestinal inflammation.
Animal Models of Intestinal Inflammation
Recent advances in experimental animal models have enhanced our understanding of the contributions of mucosal immunity in IBD. The advantages of such models include the use of inbred strains of mice, as well as standardized housing conditions and diet that minimize inter-subject variation during initial onset and development of disease. The main limitation is that none of the current animal models reproduce human IBD completely. A large number of animal models exist, and they may be categorized into (a) those in which disease spontaneously arises, (b) those in which disease is induced with exogenous reagents,
(c) those where disease occurs secondary to genetic manipulation, and (d) those involving transfer of immune cells to immunodeficient animals which subsequently develop disease.(27,28) (Table 3) 11
Table 3. Categories of animal models of intestinal inflammation based on method of induction
Induced Spontaneous Genetic T-cell transfer Acetic acid Cotton-top HLA-B27p2g TG rat CD45RBl"-»-SCID Immune complex/formalin tamarin IL-2" " BM-*-CD3eTG Carageenan C3H/Hej Bir IL-7™ TG DSS Samp-1 /Yit IL-10-/~, IL-1OR Indomethacin TCRor'- TNBS/alcohol Gir/.2~'~ PG-PS Mdr la"'" Oxazalone N-cadherin DN Methotrexate A20 ' TNF^ STAT-3 ' STAT-4 T-betTG WASP
-/-, deficient, knockout; DN, dominate negative; TO, transgenic; BM, bone marrow.
Table 3. Categories of animal models of intestinal inflammation based on the method of injury induction. DSS = dextran sodium sulfate; TNBS= trinitrobenezene sulfonic acid; PG- PS=peptidoglycan-polysaccharide; WASP= Wiskott-Aldrich syndrome protein; SCID=severe combined immunodeficiency; mdr=multidrug resistance. Modified from Sartor RB. Animal models of intestinal inflammation. In: Sartor RB, Sandbom WJ, eds. Kirsner's Inflammatory Bowel Diseases, 6th edn. London: Elsevier 2004, page 121.
Spontaneous colitis that develops in cotton top tamarins resembles IBD.(29)
Additionally, C3H/HeJBir mice develop predominantly right-sided colitis early in life that largely resolves by 3 months of age.(30) Experimental colitis may be induced by a variety of chemical or natural substances that damage the intestinal mucosa and produce inflammation, such as acetic acid, dextran sodium sulfate (DSS), trinitrobenzenesulfonic acid (TNBS) or oxazolone together with ethanol, peptidoglycan polysaccharide, indomethacin, or carrageenan. (31-34) Other models have been generated by gene-targeting methods to produce intestinal inflammation when rodents are housed under conventional conditions. 12
Several of these models utilize mice with specific mutations that affect cytokine secretion or
CD4+ T cell populations. In IL-2 deficient (IL-2"/") mice, an IL-12-driven Thl response,
characterized by high IFN-y, results in the development of colonic inflammation with crypt
hyperplasia, focal ulceration, and infiltration of the lamina propria with mononuclear
cells.(35,36) Subsequent studies have suggested that CD4+ T cells, but not B cells, are critical to the pathogenesis of mucosal injury in IL-2"7" mice.(37) Similarly, IL-10 deficient
(IL-10" ") mice develop a chronic enterocolitis mediated by Thl lymphocytes which synthesize IL-12 and pro-inflammatory cytokines such as IFN-y and TNF.(38,39)
Colitis with crypt distortion and lamina proprial cellular infiltrate has also been observed in mice with targeted mutations of either T-cell receptor a or T-cell receptor J3 genes.(40) Furthermore, rats transgenic for HLA-B27 spontaneously develop a predominant
CD4+ T cell-mediated colitis and gastritis when raised in conventional or SPF environments.(41) Other investigations have shown that defects in macrophage function may contribute to intestinal inflammation. In this regard, mice lacking transcription factor STAT-
3 have macrophages that fail to be inhibited by IL-10, a key anti-inflammatory cytokine.(42)
The requirement for a protective epithelial barrier to luminal antigens or bacteria has been demonstrated by several novel models. Mice with altered N-cadherin expression in the intestine develop patchy IBD resembling CD.(43) Other mice, having a defect in the multi drug resistance gene (mdr-1), show intestinal inflammation similar to UC.(44) Another example includes mice lacking intestinal trefoil factor which die of extensive colitis after administration of dextran sulfate sodium.(45)
Lastly, the adoptive transfer of CD4+ T cells expressing CD45RBhlghinto an immunodeficient animal (i.e., SCID mouse) causes systemic wasting and a Thl-mediated 13
colitis. (46) In addition, transfer of the reciprocal population, CD45RBlow, with the
pathogenic CD45RBhlgh subset prevents colitis. Protection of colitis in this model by this
CD45RBlow subset of CD4+ T cells is due to their ability to downregulate immune responses;
and thus, they are referred to as regulatory T cells. Further work has shown that these
regulatory cells express CD25, and exert their effects through the production of cytokines
TGF-P and IL-10.(47-49) These studies indicate that the balance between mucosal
inflammation and oral tolerance depends upon the presence of different CD4+ T cell subsets,
and that the protective effects are mediated by the synthesis and release of regulatory
cytokines. The importance of regulatory cytokines has been further demonstrated recently; whereas, the severity of murine colitis can be reduced when mice are given Lactococcus lactis genetically engineered to secrete IL-10.(50)
Role of the microflora in IBD
Both clinical observations and animal models support the hypothesis that aberrant immune responses to resident (commensal) luminal bacteria drive chronic inflammation in genetically susceptible hosts (Table 4). Clinical improvement and decreased intestinal inflammation is observed in humans with IBD when intestinal bacteria are decreased by antibiotic administration.(51,52) Rodent models of IBD demonstrate marked reductions in clinical and histologic signs of intestinal inflammation when the animals are housed in a germ-free environment.(27,53-55) Collectively, these data indicate that inappropriate responses triggered by bacterial antigens may dictate the onset and/or maintenance of colitis as much as, or even more than, predisposing genetic factors. 14
Table 4. The influence of the resident bacterial environment on inflammation in animal models
Model Species SPF Germ-Free Antibiotics A. Induced disease
Indomethacin Rat Acute SB, colonic Attenuated acute, 4 by metronidazole, and gastric iilccrs. Usent chronic tetracycline chronic SB ulcers C'irraqeenan Guinea pig Cecal No colitis 4 by metronidazole, infiam nation clindamycin DSS Mouse Colitis t orI colitis 4 by Cipro, imipenum/ vancomycin (acute phase) TNBS Rat Colitis ND f by amoxicillin, davulanic acid
B. Genetically engineered HLA-B27 Rat Gastritis, colitis, No Gl or joint 4 by metronidazole transgenic arthritis inflammation vancomycin/ imipenum CD45 RB Mouse Colitis No colitis 4 by streptomycin -» SCID and b.uitMcin IL-2 ' Mouse Colitis, gastritis, Absent-attenuated ND hepatitis inflammation IL-10" Mouse Colitis No colitis 4 by metronidazole, Cipro, vancomycin, imipenum TCRa-'- Mouse Culitis No inflammation ND mdr lu" Mouse Colitis ND 4 by streptomycin, neomycin, bacitracin, amphoteracin'
C. Spontaneous mutations Samp l/Yit Mouse No ileitis 4 metronidazole/
Cotton-top Marmoset Co t s tamarin
SB, small bowel; Gl, gastrointestinal; ND, not done; 4, attenuation of disease;f, potentiation of disease.
Table 4. The influence of the resident bacterial flora on inflammation in animal models. Note that select models are included and that this list is not exhaustive. DSS = dextran sodium sulfate; TNBS= trinitrobenezene sulfonic acid; PG-PS=peptidoglycan- polysaccharide; WASP= Wiskott-Aldrich syndrome protein; SCID=severe combined immunodeficiency; mdr=multidrug resistance. Modified from Sartor RB. Microbial influences in inflammatory bowel diseases: role in pathogenesis and clinical implications. In: Sartor RB, Sandbom WJ, eds. Kirsner's Inflammatory Bowel Diseases, 6th edn. London: Elsevier 2004, page 145. 15
The lumen of the distal ileum and colon contains a vast ecosystem of bacterial species, dominated by strict anaerobes which outnumber aerobic bacteria by a factor of 1000 to 1 .(56) Recent investigations suggest that resident enteric bacteria may have differing abilities to induce and perpetuate inflammation in humans and animals. Increased luminal concentrations of Bacteroides vulgatus and functionally altered E. coli have been incriminated in the pathogenesis of human IBD.(57,58) Bacteroides vulgatus plays an essential role in the pathogenesis of carrageenan-induced colitis in guinea pigs(59), while sera from spontaneously colitic C3H/HeJBir mice show strong antibody reactivity to bacterial antigens from members of the Enterobacteriaceae and Enterococcus spp.(60)
Furthermore, several species of Helicobacter have been described, (61,62) including H. hepaticus (63) and H. bilis, (61,64,65) which have been shown to colonize the liver and intestine and elicit IBD in immunodeficient mice and rats.(66)
These previous studies indicate a theme of host-microbial interactions and genetic regulation of host responses to commensal and pathogenic microbial agents. The diversity of animal models indicates that multiple genetic defects in immune function and disturbances in barrier integrity can lead to pathogenic host responses. Furthermore, these rodent model results suggest that each host genetic background may have a dominant bacterial stimulus and thus has important implications with regards to designing optimal therapy for individual patients. Therefore, it is important to identify which components of the indigenous microflora are responsible for the antigen-specific immune responses which contribute to the development of colitis. 16
The Brachyspira hyodysenteriae model of intestinal inflammation
Brachyspira hyodysenteriae is the etiologic agent of swine dysentery, an economically important disease of swine.(67-69) Histologic lesions in pigs share similarity to those of UC in humans, and include mucosal epithelial erosions, mononuclear inflammatory cell infiltration of the lamina propria, and coagulative necrosis of the superficial mucosa.(70,71) Putative virulence determinants of B. hyodysenteriae might include multiple p-hemolysin(s) and a lipopolysaccharide (LPS) or LPS-like moiety; however, the pathogenesis of the disease remains unknown.(72,73) The disease has been reproduced in conventional pigs with pure cultures of B. hyodysenteriae (74-76) and in gnotobiotic pigs co-infected with certain obligate anaerobic bacteria, including Bacteroides fragilis.{77,78). Subsequent studies have demonstrated that B. hyodysenteriae induces gross and microscopic lesions similar to those of swine dysentery in the large intestine of mice following oral inoculation.(79,80) Furthermore, the presence of synergistic bacteria appears to be a prerequisite for B. hyodysenteriae infection to express its pathogenicity in germfree pigs (77,81) and mice (77,80,82), suggesting that disease caused by B. hyodysenteriae infection may be influenced by the nature of the intestinal flora.
Gnotobiotic Studies
The luminal microenviroment may be manipulated by studying germ-free (sterile) rodents or ex-germ-free mice and rats colonized with a single (monoassociated) or a combination of bacterial species. In these studies, the severity and location of intestinal inflammation correlates closely with the magnitude of microbial stimulation.(83) For example, IL- 10" " (knockout) mice raised under conventional conditions develop lethal small 17
and large intestinal inflammation.(84) However, specific pathogen free (SPF) mice have
non-lethal inflammation restricted to the colon; germ-free IL-10"A mice exhibit no clinical,
histologic, or immunologic evidence of colitis.(85) A similar lack of colitis and gastritis is
found in germ-free HLA-B27/p 2 -microglobulin transgenic rats. Additionally, gnotobiotic
B27 transgenic rats colonized with SPF bacteria develop progressively more aggressive
colitis which becomes statistically significant 4 weeks after colonization. (41) A consistent
lack of colitis in other germ-free knockout and transgenic murine colitis models studied to
date and in most induced models indicates the near universal requirement for commensal
bacteria to induce chronic immune-mediated enterocolitis (Table 4). The acute DSS model is the only experimental model to date where the sterile environment does not markedly diminish experimental colitis although conflicting results have been reported.(86,87)
Gnotobiotic studies do show that resident bacterial species have differential capacities to induce inflammation and that the dominant bacterial stimuli may depend upon the host immunologic (and perhaps genetic) background. Well recognized pro-inflammatory bacterial species include Bacteroides vulgatus, Clostridium spp., Enterococcus faecalis, certain strains of E. coli, and Helicobacter species. Importantly, the phenotype of disease in the same host is different when these different bacterial species are present. Thus, various hosts require different bacterial subsets to induce chronic immune-mediated intestinal inflammation and illustrate the complexity of interpreting clinical investigations in humans.
Lastly, host genetic susceptibility and the ability to effectively regulate host responses to resident flora contribute to IBD in humans. Polymorphisms in the leucine-rich-repeat
(LRR) domain of intracellular NOD2/CARD15 are associated with CD.(88,89) This domain
(which is expressed in normal monocytes, macrophages, and dendritic cells, and in intestinal 18
epithelial cells of IBD patients) binds to LPS and peptidoglycan (especially in Gram negative
bacteria) to activate the nuclear transcription factor NFKB.(90) The NFKB signaling pathway
is a key determinant of the inflammatory response (via production of pro-inflammatory
cytokines such as IL-1(3, TNF, IL-6, and IL-8) and maintenance of mucosal homeostasis.
Conclusions from animal models
Animal models have revealed that a variety of alterations in the immune response can
result in predominant Thl- (53,91,92) or Th2- (33,93) induced intestinal inflammation. The
recurring themes derived from these models include: (1) chronic inflammation is T
lymphocyte mediated; (2) defective immunoregulatory or mucosal barrier function can
induce chronic intestinal inflammation; (3) commensal enteric bacteria provide the constant antigenic and adjuvant stimuli driving chronic enterocolitis; (4) host genetic background modulates disease activity. Considerable evidence also indicates that abnormal responses to antigens in the normal bacterial flora exist suggesting that a break in oral tolerance to these microorganisms may be the trigger for chronic intestinal inflammation. This may occur due to faulty mechanisms that normally drive and regulate mucosal immunity or because of some dysfunction in the epithelial cell barrier that leads to inappropriate penetration of microbial antigens. However, the identity and mechanism(s) by which specific bacteria (or their products) interact with the host's immune system during development of intestinal disease has not been well characterized. Gnotobiotic animals, containing a defined intestinal microflora, serve as a useful tool to search for possible microbial provocateurs of chronic immune-mediated intestinal inflammation.
USE OF A NOVEL GNOTOBIOTIC MURINE MODEL OF COLITIS
The long term goal of this laboratory is to investigate how the composition of the 19
resident enteric microflora contributes to the development of immunologically-mediated intestinal disease. The hypothesis of this research is that alterations in the composition of the resident enteric microflora will induce host immune responses which modulate the development of colitis. In this regard, we propose the use of a novel gnotobiotic mouse model in which host immune responses to antigens derived from the resident bacterial flora might be measured.
Development of the B. hyodysenteriae-Challenge Model of Murine Typhlocolitis:
Our research group has a longstanding interest in the investigation of microbial-host interactions; in particular, the utilization of the Brachyspira hyodysenteriae-challenge model to study experimentally-induced typhlocolitis in mice. Over the past 13 years, this laboratory has published on the immunopathogenesis (73,94,95), comparative effects of spirochete infection (96), mouse strain susceptibility (97), histopathological features (98), and disease development (99,100) in mice infected with B. hyodysenteriae. Several of these earlier investigations deserve additional commentary as they provide key observations concerning this unique model of intestinal inflammation. Note to committee: the genus name for the causative agent for swine dysentery has gone through several changes (i.e., Treponema—>
Serpulina —> Brachyspira). The organism is presently placed in the genus Brachyspira.
Pathogenesis of Treponema hyodysenteriae: induction of interleukin-1 and tumor necrosis factor by a treponemal butanol/water extract (endotoxin). Greer JM,
Wannemuehler MJ. Microb Pathog 1989; 7:279-288.
The biologic activities of lipopolysaccharide-like (LPS-like, phenol/water extract) and endotoxin-like (butanol/water extract) preparations from Brachyspira hyodysenteriae 20
were examined on murine peritoneal exudate cells (PECs). Both extract preparations were less toxic than E. coli LPS for murine PECs. The brachyspiral butanol/water extract did induce IL-1 and TNF production but at doses 5- and 50-fold higher than that derived from E. coli LPS. These data indicate that butanol/water extracts from B. hyodysenteriae are more biologically active than the phenol/water extract and that brachyspiral endotoxin may contribute to intestinal inflammation by inducing IL-1 and TNF production.
Susceptibility of inbred mouse strains to infection with Serpulina (Treponema) hyodysenteriae. Nibbelink SK, Wannemuehler MJ. Infect Immun 1991; 59:3111-3118.
Several inbred strains of mice were orally inoculated with Brachyspira hyodysenteriae B204 to determine susceptibility to infection. The influence of host genes Ips and ity on disease development were also assessed. Different inbred strains exhibited different susceptibilities to infection, with the C3H/HeN strain being the most susceptible.
The ity gene had no apparent effect on susceptibility of infection. These data indicate that differences in disease susceptibility between mouse strains exist independent of the Ips locus suggesting a possible causal role for the intestinal microflora, or other environmental factors, in disease pathogenesis.
An enhanced murine model for studies of Serpulina (Treponema) hyodysenteriae pathogenesis. Nibbelink SK, Wannemuehler MJ. Infect Immun 1992; 60:3433-3436.
A defined diet was used to increase the susceptibility of mice infected with
Brachyspira hyodysenteriae. Mice fed the defined diet for 7 to 14 days prior to and during the challenge period manifested more severe cecal lesions than did mice maintained on 21
normal rodent chow. The reason for the increase in susceptibility to B. hyodysenteriae
infection was unclear but the defined diet appeared to enhance cecal colonization by B.
hyodysenteriae. Subsequent studies (unpublished data) have shown that the diet induces a
100-1000 fold increase in total cultivable bacteria from the cecum suggesting a contributory
role for gut flora in lesion development following B. hyodysenteriae challenge.
A comparison of the morphologic effects of Serpulina hyodysenteriae or its beta-
hemolysin on the murine cecal mucosa. Hutto DL, Wannemuehler MJ. Vet Pathol 1999;
36:412-422.
Morphologic changes in the ceca of mice infected with either B. hyodysenteriae or
exposed to ^-hemolysin were compared. Macroscopic lesions were first apparent at 14 hours
post-infection while ultrastructurally, luminal bacteria were translocated through epithelial
cells into the lamina propria. In other experiments, the placement of purified B.
hyodysenteriae hemolysin into surgically closed murine ceca resulted in similar
ultrastructural changes as seen with B. hyodysenteriae inoculation. Thus, the ^-hemolysin of
B. hyodysenteriae causes the same early morphologic changes in the cecal mucosa of mice as are present in mice infected with the organism itself. Based on the observed bacterial
translocation, luminal bacteria also appear to play a unique role in lesion development in this
model.
We have since extended these earlier observations to show that the use of antibiotic
therapy to selectively deplete members of the microflora (e.g., gram negative anaerobes)
abolishes the ability of B. hyodysenteriae to induce colitis.(lOl) It is apparent from these
investigations that the singular presence of B. hyodysenteriae in murine ceca is 22
insufficient to cause disease, and that enteric bacteria are necessary for the
development of intestinal inflammation. Apparently, the indigenous flora provides the
necessary antigenic or phlogistic stimulation to induce colitis in affected mice. Preliminary
data indicate that B. hyodysenteriae-mfected mice develop a polarized Thl immune response
characterized by prominent IgG2a production and IFN-y secretion.(102) In addition,
evaluation of inflamed ceca has demonstrated that a spiral shaped bacterium significantly
invades the mucosa (18-24 hours post-infection) following infection with B. hyodysenteriae.
This translocated bacterium has similar morphologic features to Helicobacter spp. on the
basis of electron micrographs (103) (Figure 2). Analysis by polymerase chain reaction
(PGR) techniques hffas confirmed the presence of Helicobacter spp. in cecal specimens obtained from similarly infected mice. These accumulated preliminary data strongly incriminate normal flora (including Helicobacter spp.) in the pathogenesis of intestinal inflammation in conventional mice infected with B. hyodysenteriae.
Figure 2. (A) Electron photomicrograph of helicobacter-like organisms in the lumen of the mouse cecum. (B) Photomicrograph of the murine cecum obtained 24 hours following challenge with B. hyodysenteriae depicting multiple helicobacter-like organisms (arrows) within mucosal epithelial cells. Images from Hutto DL, Wannemuehler MJ. A comparison of the morphologic effects of Serpulina hyodysenteriae or its beta-hemolysin on the murine cecal mucosa. Vet Pathol 1999; 36:412-422. 23
In subsequent studies, we have enhanced this model to characterize antigen-specific immune responses to a defined gastrointestinal flora in the pathogenesis of experimental colitis. Our current model utilizes gnotobiotic C3H mice harboring an altered schaedler flora
(consisting of eight anaerobic organisms) which are orally infected with B. hyodysenteriae.
Preliminary results indicate that the onset of disease is slower and lesion severity is less in gnotobiotic mice in comparison to C3H mice with a complex, conventional flora.
Additionally, the introduction of a non-resident bacterium, such as Helicobacter bilis, into this model alters the immunological responses and lesion severity of these gnotobiotic mice subsequent to the onset of colitis. These data indicate that the nature of the gastrointestinal flora significantly influences the immunological bias of the host immune response modulating the severity of colitis. 24
REFERENCES
1. Kirsner JB, Shorter RG. Recent developments in "non-specific" inflammatory bowel disease. N Engl J Med 1982; 306:775-785.
2. Whelan G. Epidemiology of inflammatory bowel disease. Med Clin North Am 1990; 74:1-12.
3. Fazio ZW. Conservative surgery for Crohn's disease of the small bowel: The role of stricturplasty. Med Clin North Am 1990; 74:169-181.
4. Rankin GB. Extraintestinal and systemic manifestations of inflammatory bowel disease. Med Clin North Am 1990; 74:39-50.
5. Karesen R, Sgerch-Hannsen A, Thoresen BO, et al. Crohn's disease. Long-term results of surgical treatment. Scand J Gastroenterol 1981; 16:57-64.
6. Cello JP, Schneiderman DJ. Ulcerative Colitis. In Scleisinger MH, Fordtran JS (eds): Gastrointestinal Disease: Pathophysiology, Diagnosis and Management. (Ed 4), Philadelphia, PA, Saunders, 1989, pp 1435-1477.
7. Greenstein AJ, Sachar DD, Gibas A, et al. Outcome of toxic dilatation in ulcerative colitis and Crohn's colitis. J Clin Gastroenterol 1985; 7:137-144.
8. Greenstein AJ, Sachar DD, Pastemack BS, et al. Reoperation and recurrence in Crohn's colitis and ileocolitis: Crude and cumulative rates. N Engl J Med 1975; 293:685-690.
9. Korelitz BI. Consideration of surveillance, dysplasia, carcinoma of the colon in the management of ulcerative colitis and Crohn's disease. Med Clin North Am. 1990; 74:189-199.
10. Petras RE, Mir Madjlessi JH, Farmer RG. Crohn's disease and intestinal carcinoma. A report of 11 cases with emphasis on associated epithelial dysplasia. Gastroenterology 1987; 93:1307-1314.
11. Sartor RB. Current concepts of the etiology and pathogenesis of ulcerative colitis and Crohn's disease. Gastroenterol Clin North Am 1995; 24:475-506.
12. Sartor RB. Insights into the pathogenesis of inflammatory bowel diseases provided by new rodent models of spontaneous colitis. Inflam Bowel Dis 1995; 1:64-75.
13. Sartor RB. Microbial influences in inflammatory bowel diseases: Role in pathogenesis and clinical implications. Sartor RB, Sandbom WJ (eds): Kirsner's Inflammatory Bowel Diseases, Philadephia, PA, Saunders, 2004, pp 138-162. 25
14. Korzenik JR, Dieckgraefe BK. Crohn's disease and immunodeficiency? A hypothesis suggesting possible early events in the pathogenesis of Crohn's disease. Dig Dis Sci 2000; 45:1121-1129.
15. Rotstein OD, Vittorini T, Kao J, et al. A soluble Bacteroides by-product impairs phagocytic killing of Escherichia coli by neutrophils. Infect Immun 1989; 57:745- 753.
16. Shomer NH, Dangler CA, Fox JG. Outbreak of diarrhea associated with dual Helicobacter bilislHelicobacter rodentium in a colony of scid mice. Lab Anim Sci 1997; 47:439-440.
17. DeMeo MT, Mutlu EA, Keshavarzian A, et al. Intestinal permeation and gastrointestinal disease. J Clin Gastroenterol 2002; 35:385-396.
18. Hollander D, Vadheim CM, Brettholz E, et al. Increased intestinal permeability in patients with Crohn's disease and their relatives. A possible etiologic factor. Ann Intern Med 1986; 105:883-885.
19. Gitter AH, Wullstein F, Fromm M, et al. Epithelial barrier defects in ulcerative colitis: characterization and quantification by electrophysiologic imaging. Gastroenterology 2001; 121:1320-1328.
20. Tibbie J A, Sigthorsson G, Bridger S, et al. Surrogate markers of intestinal inflammation are predictive of relapse in patients with inflammatory bowel disease. Gastroenterology 2000; 119:15-22.
21. Swidsincki A, Ladhoff A, Pemthaler A, et al. Mucosal flora in inflammatory bowel disease. Gastroenterology 2002; 122:44-54.
22. van de Merwe JP, Schroder AM, Wensinck F, et al. The obligate anaerobic faecal flora of patients with Crohn's disease and their first-degree relatives. Scand J Gastroenterol 1988; 23:1125-1131.
23. Fuss IJ, Neurath M, Boirivant M, et al. Disparate CD4+ lamina propria (LP) lymphokine secretion profiles in inflammatory bowel disease. Crohn's disease LP cells manifest increased secretion of IFN y, whereas ulcerative colitis LP cells manifest increased secretion of IL-5. J Immunol 1996; 157:1261-1270.
24. Cong Y, Brandwein SL, McAbe RP, et al. CD4+ T-cells reactive to enteric bacterial antigens in spontaneously colitic C3H/HeJBir mice: increased T-helper cell type I response and ability to transfer disease. J Exp Med 1998; 187:855-864.
25. Onderdonk AB, Hermos J A, Dzink JL, et al. Protective effect of metronidazole in 26
experimental ulcerative colitis. Gastroenterology 1978; 74:521-526.
26. Mizoguchi A, Mizoguchi E, Chiba C, et al. Cytokine imbalance and autoantibody production in T-cell receptor-a mutant mice with inflammatory bowel disease. J Exp Med 1996; 183:847-856.
27. Dieleman LA, Pena AS, Meuwissen SGM, et al. Role of animal models for the pathogenesis and treatment of inflammatory bowel disease. Scand J Gastroenterol 1997; 32(Suppl.223):99-104.
28. Powrie F, Leach MW, Mauze S, et al. Phenotypically distinct subsets of CD4+ T cells induce or protect from chronic intestinal inflammation in C.B-17 SCID mice. Int Immunol 1993; 5:1461-1471.
29. Madara JL, Podolsky DK, King NW, et al. Characterization of spontaneous colitis in cotton-top tamarins (Saguinus oedipus) and its reponse to sulfasalazine. Gastroenterology 1985; 88:13-19.
30. Sundberg JP, Elson CO, Bedigain H, et al. Spontaneous, heritable colitis in a new substrain of C3H/HeJ mice. Gastroenterology 1994; 107:1726-1735.
31. Morris GP, Beck PL, Herridge MS, et al. Hapten-induced model of chronic inflammation and ulceration in the rat colon. Gastroenterology 1989; 96:795-803.
32. Elson CO, Beagley KW, Sharmanov AT, et al. Hapten-induced model of murine inflammatory bowel disease: mucosa immune responses and protection by tolerance. J Immunol 1996; 157:2174-2185.
33. Boirivant M, Fuse IJ, Chu A, et al. Oxazolone colitis: a murine model of T helper cell type 2 colitis treatable with antibodies to interleukin 4. J Exp Med 1998; 188:1929- 1939.
34. Sartor RB, Bender DE, Allen JB, et al. Chronic experimental enterocolitis and extra intestinal inflammation are T lymphocyte dependent. Gastroenterology 1993; 104:A775.
35. Sadlack B, Merz H, Schorle H, et al. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 1993; 75:253-261.
36. Ehrhardt RO, Ludviksson BR, Gray, et al. Induction and prevention of colonic inflammation in IL-2-defïcient mice. J Immunol 1997; 158:566-573.
37. Ma A, Datta M, Margosian E, et al. T cells, but not B cells, are required for bowel inflammation in interleukin 2-deficient mice. J Exp Med 1995; 182:1567-1572. 27
38. Rennick DM, Fort MM. Lessons from genetically engineered animal models. XII. IL- 10-deficient (IL-10"A) mice and intestinal inflammation. Am J Physiol Gastrointest Liver Physiol 2000; 278:0829-833.
39. Kuhn R, Lohler D, Rennick K, et al. Interleukin-10-deficient mice develop chronic entercolitis. Cell 1993; 75:263-274.
40. Monbaerts P, Mizoguchi E, Grusby MJ, et al. Spontaneous development of inflammatory bowel disease in T cell receptor mutant mice. Cell 1993; 75:274-282.
41. Rath HC, Herfarth HH, Ikeda JS, et al. Normal luminal bacteria, especially Bacteroides species, mediate chronic colitis, gastritis, and arthritis in HLA- B27/human beta2 microglobulin transgenic rats .J Clin Invest 1996; 98:945-953.
42. Takeda K, Kaisho T, Terada N, et al. Enhanced Thl activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 1999; 10:34-49.
43. Hermiston ML, Gordon JL. Inflammatory bowel disease and adenomas in mice expressing a dominant negative N-cadherin. Science 1995; 270:1203-1207.
44. Panwala CM, Jones JC, Viney JL. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistant gene, mdr la, spontaneously develop colitis. J Immunol 1998; 161:5733-5744.
45. Mashimo H, Wu DC, Podolsky DK, et al. Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor. Science 1996; 274:262-265.
46. Leach MW, Bean AG, Mauze S, et al. Inflammatory bowel disease in C.B-17 SCID mice reconstituted with the CD45RBhlgh subset of CD4+ T cells. Am J Pathol 1996; 148:1503-1515.
47. Powrie F. T cells in inflammatory bowel disease: protective and pathogenic roles. Immunity 1995; 3:171-174.
48. Read S, Malmstrom V, Powrie F. Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25(+)CD4(+) regulatory cells that control intestinal inflammation. J Exp Med 2000; 192:295-302.
49. Sakaguchi S. Regulatory T cells: key controllers of immunologic self-tolerance. Cell 2000; 101:455-458.
50. Steidler L, Hans W, Schotte L, et al. Treatment of murine colitis by Lactococcus lactis secreting interleukin-10. Science 2000; 289:1352-1355. 28
51. Colombel JF, Lemann M, Cassagnou M, et al. A controlled trial comparing ciprofloxacin with mesalazine for the treatment of active Crohn's Diesase. Am J Gastroenterol 1999; 94:674-678.
52. Turumen U, Fakkila M, Yaltonen V, et al. Longterm outcome of ciprofloxacin treatment in severe perianal or fistulous Crohn's disease. Gastroenterology 1993; 104:A793.
53. Blumberg RS, Saubermann LJ, Strober W. Animal models of mucosal inflammation and their relation to human inflammatory bowel disease. Curr Opin Immunol 1999; 11:648-656.
54. Elson CO, Sartor RB, Tennyson GS, et al. Experimental models of inflammatory bowel disease. Gastroenterology 1995; 109:1344-1367.
55. Strober W, Ludviiksson BR, Fuss IJ. The pathogenesis of mucosal inflammation in murine models of inflammatory bowel disease and Crohn's disease. Ann Intern Med 1998; 128:848-856.
56. Okayasu I, Hatakeyama S, Yamada M, et al. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990; 98:694.
57. Krook A, Lindstrom B, Kjellander J. Relation between concentrations of metronidazole and Bacteroides spp. in faeces of patients with Crohn's disease and healthy individuals. J Clin Pathol 1981; 34:645.
58. van de Merwe JP, Schroder AM, Wensinck F. The obligate anaerobic faecal flora of patients with Crohn's disease and their first-degree relatives. Scand J Gastroenterol 1988; 23:1125.
59. Onderdonk AB, Franklin ML, Cisneros RL. Production of experimental ulcerative colitis in gnotobiotic guinea pigs with simplified microflora. Infect Immun 1981; 32:225-231.
60. Brandwein SL, McCabe RP, Cong Y, et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol 1997; 159:44-52.
61. Franklin CL, Riley LK, Livingston RS, et al. Enteric lesions in SOD mice infected with "Helicobacter typhlonicus," a novel urease-negative Helicobacter species. Lab Anim Sci 1999; 49:496-505.
62. Shen Z, Fox JG, Dewhirst FE, et al. Helicobacter rodentium sp. nov., a urease- negative Helicobacter species isolated from laboratory mice. Int J Syst Bacteriol 29
1997; 47:627-634.
63. Kullberg MC, Ward JM, Gorelick PL, et al. Helicobacter hepaticus triggers colitis in specific-pathogen-free interleukin-10 (IL-lO)-deficient mice through an IL-12- and y- interferon-dependent mechanism. Infect Immun 1998; 66:5157-5166.
64. Shomer NH, Dangler CA, Schrenzel MD, et al. Helicobacter bilis-induced inflammatory bowel disease in scid mice with defined flora. Infect Immun 1997; 65:4858-4864.
65. Franklin CL, Riley LK, Livingston RS, et al. Enterohepatic lesions in SCID mice infected with Helicobacter bilis. Lab Anim Sci 1998; 48:334-339.
66. Haines DC, Gorelick PL, Battles JK, et al. Inflammatory large bowel disease in immunodeficient rats naturally and experimentally infected with Helicobacter bilis. Vet Pathol 1998; 65:3126.
67. Harris DL, Glock RD. Swine dysentery and spirochetal diseases. Iowa State University Press, Ames 1986.
68. Stanton TB, Jensen NS, Casey TA, et al. Reclassification of Treponema hyodysenteriae and Treponema innocens in a new genus, Serpula gen. no v., as Serpula hyodysenteriae comb. nov. and Serpula innocens comb. nov. Int J Syst Bacteriol 1991; 41:50.
69. Stanton TB. Proposal to change the genus designation Serpula to Serpulina gen. nov. containing the species Serpulina hyodysenteriae comb. nov. and Serpulina innocens comb. nov. Int J Syst Bacteriol 1992; 42:189.
70. Albassam MA, Olander HL, Thacker HI, et al. Ultrastructural characterization of colonic lesions in pigs inoculated with Treponema hyodysenteriae. Can J Comp Med 1982; 49:384-390.
71. Taylor DJ, Blakemore WF. Spirochaetal invasion of the colonic epithelium in swine dysentery. Res Vet Sci 1971; 12:177-179.
72. Saheb SA, Massicotte L, Picard B. Purification and characterization of Treponema hyodysenteriae hemolysin. Biochimie 1980; 62:779-785.
73. Greer JM, Wannemuehler MJ. Pathogenesis of Treponema hyodysenteriae: induction of interleukin-1 and tumor necrosis factor by a treponemal butanol/water extract (endotoxin). Microb Pathog 1989; 7:279-288.
74. Brandenburg AC, Miniats OP, Geissinger HD, et al. Swine dysentery: inoculation of gnotobiotic pigs with Treponema hyodysenteriae and Vibrio coli and a 30
Peptostreptococcus. CanJComp Med 1997; 41:294-301.
75. Hamdy AH, Glenn MW. Transmission of swine dysentery with Treponema hyodysenteriae and Vibrio coli. Am J Vet Res 1974; 35:791-.
76. Harris DL, Clock RD, Christensen CR, et al. Inoculation of pigs with Treponema hyodysenteriae (new species) and reproduction of the disease. Vet Med Small Anim Clin 1972; 67:61-68.
77. Whipp SC, Robinson IM, Harris DL, et al. Pathogenic synergism between Treponema hyodysenteriae and other selected anaerobes in gnotobiotic pigs. Infect Immun 1979; 26:1042-1047.
78. Harris DL, Alexander TJL, Whipp SC, et al. Swine dysentery: studies of gnotobiotic pigs inoculated with Treponema hyodysenteriae, Bacteroides vulgatus, and Fusobacterium necrophorum. J Am Vet Med Assoc 1978; 172:468-471.
79. Joens LA, Robinson IM, Clock RD, et al. Production of lesions in gnotobiotic mice by inoculation with Treponema hyodysenteriae. Infect Immun 1981; 31:504-506.
80. Suenaga I, Yamazaki T. Experimental Treponema hyodysenteriae infection of mice. Zbl Bakt Hyg A 1984; 257:348-356.
81. Meyer RC, Simon J, Byerly CS. The etiology of swine dysentery. III. The role of selected gram-negative obligate anaerobes. Vet Pathol 1975; 12:46-54.
82. Hayashi T, Suenaga I, Komeda T, et al. Role of Bacteroides uniformis in susceptibility of Ta:CF# 1 mice to infection by Treponema hyodysenteriae. Zentralbl Bakteriol 1990; 274:118-125.
83. Sartor RB. Intestinal microflora in human and experimental inflammatory bowel disease. Curr Opin Gastroenterol 2001; 17:555-561.
84. Kuhn R, Lohler J, Rennick D, et al. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 1993; 75:263-274.
85. Sellon RK, Tonkonogy S, Schultz M, et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10- deficient mice. Infect Immun 1998; 66:5224-5231.
86. Axelsson LG, Midtvedt T, Bylun-Fellenius AC. The role of intestinal bacteria, bacterial translocation and endotoxin in dextran sodium sulfate-induced colitis in the mouse. Microb Ecol Help Dis 1996; 9:225-237.
87. Hudcovic T, Stepankova R, Cebra J, et al. The role of microflora in the development 31
of intestinal inflammation: Acute and chronic colitis induced by dextran sulfate in germ-free and conventionally reared immunocompenent and immunodeficient mice. Folia Microbiol 2001; 46:565-572.
88. Givardin SE, Boneca IG, Viala J, et al. NOD2 is a general sensor of peptidoglycan through MDP detection. J Biol Chem 2003; 278:8869-8872.
89. Bonen DK, Ogura Y, Nicolae DL, et al. NOD2 variants associated with Crohn's disease share a signaling defect in response to lipopolysaccharide and peptidoglycan. Gastroenterology 2002; 124:140-146.
90. Jobin C, Sartor RB. The IB/NF B system: a key determinant of mucosal inflammation and protection. Am J Physiol Cell Physiol 2000; 278:C451-C462.
91. MacDonald TT, Monteleone G, Ponder S LE. Recent developments in the immunology of inflammatory bowel disease. Scand J Immunol 2000; 51:2-9.
92. Merger M., Croitoru K. Infections in the immunopathogenesis of chronic inflammatory bowel disease. Semin Immunol 1998; 10:69-78.
93. Mizoguchi A, Mizoguchi E, Bhan AK. The critical role of interleukin-4 but not interferon gamma in the pathogenesis of colitis in T-cell receptor a mutant mice. Gastroenterology 1999; 116:320-326.
94. Nibbelink SK, Sacco RE, Wannemuehler MJ. Pathogenicity of Serpulina hyodysenteriae: in vivo induction of tumor necrosis factor and interleukin-6 by a serpulinal butanol/water extract (endotoxin). Microb Pathog 1997; 23:181-187.
95. Sacco RE, Nibblelink SK, Baarsch MJ, et al. Induction of interleukin-1(3 and IL-8 mRNA expression in orcine macrohages by lipopolysaccharide from Serpulina hyodysenteriae. Infect Immun 1996; 64:4369-4372.
96. Hutto DL, Wannemuehler MJ. A comparison of the morphologic effects of Serpulina hyodysenteriae or its beta-hemolysin on the murine cecal mucosa. Vet Pathol 1999; 36:412-422.
97. Nibbelink SK, Wannemuehler MJ. Susceptibilitiy of inbred mouse strains to infection wtih Serpulina (Treponema) hyodysenteriae. Infect Immun 1991; 59:3111-3118.
98. Nibbelink SK, Wannemuehler MJ. An enhanced murine model for studies of Serpulina (Treponema) hyodysenteriae pathogenesis. Infect Immun 1992; 60:3433- 3436.
99. Hutto DL, Galvin JE, Wannemuehler MJ. Morphologic and temporal characterization of lesions in an enhanced murine model of Serpulina hyodysenteriae infection. J Med 32
Microbiol 1998; 47:275-280.
100. Nibbelink SK. The role of tumor necrosis factor and secondary bacteria in the pathogenesis of swine dysentery. PhD Diss., Iowa State University, Ames, IA, 1992.
101. Galvin JE. Pathogenesis of swine dysentery: The role of luminal antigens in the activation of mucosal T lymphocytes. PhD Diss., Iowa State University, Ames, IA, 1995.
102. Khalifeh MS. The role of T-cell mediated immune response in the development and resolution of colitis induced by Serpulina hyodysenteriae. MS Thesis, Iowa State University, Ames, IA, 1999.
103. Fox JG. Personal communication. 33
CHAPTER 2. COMPOSITION OF THE RESIDENT ENTERIC FLORA MODULATES THE DEVELOPMENT OF COLITIS
A paper to be submitted for publication to the journal Gastroenterology
Albert E. Jergens, DVM, MS1'2; Andrea Dorn, BS1; Jenny Wilson, BS1;
Krystal Dingbaum1; Abigail Henderson, BS1; Zhiping Liu, BS1;
Jesse Hostetter, DVM, PhD3; MJ Wannemuehler, PhD1
From the Departments of Veterinary Microbiology and Preventive Medicine1, Veterinary
Clinical Sciences2, and Veterinary Pathology3, College of Veterinary Medicine, Iowa State
University, Ames, Iowa 50010, USA
Corresponding Author: AE Jergens
Phone: 515-294-4900
Fax: 515-294-9281
Email: [email protected] 34
ABSTRACT
Background: Previous investigations from this laboratory have shown that infection of C3H
strain mice with Brachyspira hyodysenteriae induces a typhlocolitis with features that are
similar to ulcerative colitis. The immunological response of these conventional C3H/HeOuJ
mice has been shown to be a predominant Thl-like response (e.g., antigen-specific IgG2a
responses and IFN-y responses). While the spirochetal pathogen initiates the onset of disease, this model of bacterial-induced colitis has been shown to be dependent upon the nature of the resident bacterial flora and the host's inflammatory response. Aim: To characterize antigen-specific immune responses to a defined gastrointestinal flora in the pathogenesis of experimental colitis. Methods: Gnotobiotic C3H/HeN mice possessing an altered schaedler flora (8 separate organisms) were used to evaluate the host's response following challenge with B. hyodysenteriae. Immunologic parameters evaluated included altered cecal morphology, histologic lesion severity scores, isotype of the antigen-specific serum antibody (ELISA), and antigen-induced cytokine responses. Results: Results indicate that the onset of disease is slower and lesion severity is less in the gnotobiotic mice in comparison to C3H mice with a complex, conventional flora. The immunologic response of the gnotobiotic mice subsequent to onset of disease was of mixed Thl :Th2 phenotype, but predominantly Th2-like. Because the conventional colony of C3H mice was colonized with
Helicobacter species, we co-infected the gnotobiotic C3H mice with H. bilis to assess the influence of Helicobacters on the severity of disease and the bias of the immune response.
Results indicate that colonization of the gnotobiotic C3H mice with H. bilis did enhance the severity of the colonic lesions but that the immune response was shown to be Th2-like.
Conclusions: These data indicate that the nature of the gastrointestinal flora significantly 35
influences the immunologie bias of the immune response and the presence of Helicobacter species do not apriori predispose toward a Thl immune response. The B. hyodysenteriae challenge model provides reproducible typhlocolitis quickly and consistently in immunocompetent mice and can be used to assess the host's immune response following onset of colitis. 36
Introduction
Aberrant or exaggerated immune responses to bacterial antigens derived from the intestinal lumen are thought to serve as the initiating events leading to the development of inflammatory bowel disease (IBD).1 For example, humans who express the HLA-B27 haplotype are known to be predisposed to colitis.2 The recent observation that germfree,
HLA-B27 transgenic rats fail to develop colitis suggests that host immunologic responses to bacterial antigens derived from the intestinal microflora are a part of the pathogenic mechanism.3,4 The importance of immune responsiveness to normal bacterial antigens in the pathogenesis of disease has additionally been demonstrated using genetically manipulated
(i.e., knock-out) mice (e.g., IL-2-, IL-10-, T-cell receptor-a deficient mice).1 Collectively, these and other observations support the hypothesis that unregulated or inappropriate responses to normal resident microflora may dictate the initiation or perpetuation of chronic intestinal inflammation as much as, or even more than, predisposing genetic factors. This contention is supported by observations that genetic disruptions in the immune response are not pathognomonic in themselves as is demonstrated when these mice are reared under gnotobiotic or specific-pathogen free (SPF) conditions.3,5,6 In addition, humans with IBD and experimental models with IBD enter a period of remission following antibiotic therapy.1,7"11 However, the unequivocal endorsement of this concept has been clouded by the use of experimental models relying on spontaneous development, as well as, difficulties in ascertaining whether the observed colitis has been directly mediated by acute inflammatory responses or acquired immune responses. In order to distinguish between these possibilities, a predictable and highly reproducible model by which microbial-induced inflammation can be initiated and examined is needed. 37
Previously, we have shown that infection of C3H mice with Brachyspira
hyodysenteriae induces a typhlocolitis with features that are similar to ulcerative colitis.12'13
The immunological response of these conventional C3H/HeOuJ mice was shown to be
predominantly Thl-like (e.g., antigen-specific IgG2a and IFN-y responses). While the
spirochete, B. hyodysenteriae, initiates the onset of disease, this model of bacterial-induced
colitis is dependent upon the nature of the resident bacterial flora and the host's inflammatory
response.14 In addition, evaluation of inflamed ceca has demonstrated that a spiral shaped
bacterium significantly invades the mucosa (18-24 hours post-infection) following infection
with B. hyodysenteriae}2 In subsequent studies, we have utilized electron microscopy and polymerase chain reaction (PGR) techniques to confirm that the translocated bacteria are
Helicobacters.15 These accumulated preliminary data strongly incriminate the normal microflora (including Helicobacter spp.) in the pathogenesis of intestinal inflammation in conventional mice infected with B. hyodysenteriae.
To better understand the nature of microbial populations inciting intestinal inflammation, we first infected gnotobiotic C3H mice (harboring an altered schaedler flora composed of eight separate organisms) with H. bilis followed by co-infection 3 weeks later with B. hyodysenteriae. We addressed the hypothesis that alterations of the resident microflora modulate the susceptibility to the development of experimental colitis. Results indicate that the onset of disease is slower and lesion severity is significantly less in gnotobiotic mice in comparison to C3H mice with a complex, conventional flora. Moreover, the introduction of a non-resident bacterium, such as H. bilis, into this model system alters the immunological responses and lesion severity of these gnotobiotic mice subsequent to the onset of colitis. These observations indicate that the composition of the enteric microflora 38
influences the immunological bias of the host response to luminal bacteria and mediates the intensity of colitis.
Materials and Methods
Animals. Four- to eight-week old gnotobiotic reared C3H/HeN mice (mostly female) were obtained from Taconic Farms (Gerrnantown, N.Y.). The gnotobiotic mice were colonized with an altered schaedler flora (ASF) consisting of eight anaerobic bacteria (Table l).16
Gnotobiotic mice were housed in Trexler plastic isolators under sterile conditions and fed an irradiated diet (e.g., Harlan-Teklad) and autoclaved water for the duration of the project. All mice were certified free of Helicobacter spp. by the vendor and re-tested on-site prior to study enrollment. All manipulations performed on mice were approved by the Iowa State
University Committee on Animal Care.
Taxon Strain
Lactobacillus acidophilus ASF 360 Lactobacillus animalis ASF 361 Bacteroides distasonis ASF 519 Flexistipes phylum ASF 457 Clostridium cluster XIV ASF 356 Eubacterium plexicaudatum ASF 492 Low G + C-content spp. ASF 500 Clostridium cluster XIV ASF 502
Table 1. Bacterial members comprising the altered schaedler flora (ASF).
Treatment Groups and Study Design. Gnotobiotic mice were assigned to one of four treatment groups on the basis of H. bilis infection and B. hyodysenteriae inoculation as follows: Group 1 (control) - no infection; Grdup 2 - infected with B. hyodysenteriae alone;
Group 3 - infected with H. bilis alone; Group 4 - dual-infected with H. bilis and with B. 39
hyodysenteriae. Representative experimental and control mice were euthanized by CO?
asphyxiation on B. hyodysenteriae post-infection day 21, with samples processed for gross
lesions, bacteriology, histopathology, antigen-specific serum IgG isotype concentrations, and
levels of cytokines secreted from antigen stimulated cells.
Bacterial Inoculation. Mice were orally infected with a bacterial inoculum (0.3 ml,
approximately 108-109 CFU/ml) of H. bilis (ATCC strain 51630) administered every other
day for three doses. Dual-infected mice received the H. bilis inoculum 3 weeks prior to challenge with B. hyodysenteriae. Confirmation of H. bilis infection post-inoculum was made by PCR evaluation of feces or cecal contents and culture. Dual-infected mice were inoculated with 108 CFU/ml B. hyodysenteriae organisms given by orogastric intubation.13'17'18 Previous experiments utilizing conventional C3H mice had indicated that characteristic histological lesions were evident 72 to 96 hours post-inoculation, with the spirochete infection confirmed at necropsy by demonstration of organisms grown on selective media.19
Helicobacter bilis and ASF-Specific PCR. Fecal samples or cecal contents were analyzed for Helicobacter spp and H. bilis as described previously.20'21 For generic Helicobacter PCR,
5jo,l of quantitated fecal DNA was used as template while for H. bilis PCR, IOJJLI of quantitated fecal DNA was used as template for all samples. Terminal confirmation of ASF colonization was performed by PCR of fecal pellet DNA from defined flora mice using ASF- specific primers16, with modifications made to some primer sequences and the PCR conditions.
Bacterial Antigens. The H. bilis organisms were cultivated in Columbia broth and the bacteria were harvested by centrifugation. The cells were washed with sterile PBS, the cell 40
pellet was frozen, cells were lyophilized, and then stored at -20° C until used. Brachyspira
hyodysenteriae B204 was grown anaerobically in trypticase soy broth supplemented with 2
% horse serum. Cells were grown overnight and harvested by centrifugation. Subsequently,
cells were washed with buffer, lyophilized, and stored at -20° C until further use. Each
member of the altered schaedler flora (ASF 356, ASF 360, ASF 361, ASF 457, ASF 492,
ASF 500, ASF 502, and ASF 519) was grown in anaerobically prepared medium and
cultured at 37°C for five to seven days. Cells were grown in either reinforced Clostridium
medium (RCM) supplemented with 5 % calf serum (ASF 360, ASF 361, ASF 356, ASF 502,
and ASF 519) or schaedler broth supplemented with 5 % sheep serum (ASF 457, ASF 492,
and ASF 500). Because many of these organisms are extremely oxygen sensitive (EOS), all
inoculations were performed in a Coy anaerobic chamber. Culture flasks were sealed in
anaerobic jars and then placed in an incubator. As above, the cells were harvested from broth
by centrifugation, washed in PBS, and lyophilized.
Bacterial antigens (e.g., H. bilis, B. hyodysenteriae, and all eight ASF strains)
used for ELISA or for stimulation of lymphocyte cultures were prepared from the lyophilized
cells. Briefly, cells were weighed and resuspended in buffer or tissue culture medium to a
final concentration of 2 mg/mL (dry weight to volume). The cell suspension was then placed on ice and sonicated for 5 minutes to prepare whole cell sonicates (WCS). Sonication was performed using 30 second pulses to prevent the suspension from overheating (i.e., denaturing of the proteins). Cell disruption was monitored microscopically. Protein content was determined by BCA analysis per manufacturer's instructions (Pierce Laboratories). For the preparation of antigen for in vitro stimulation of lymphocytes, the WCS were sterilized by UV light. Additionally, sterility was confirmed by bacteriological methods (e.g., aerobic 41
and anaerobic blood agar cultures). These methods were used to prepare all antigens used for
these studies. In order to ensure that all studies were performed with the same lot of
antigens, each of the bacterial species to be used was grown during the first six months of the
project to provide sufficient antigenic mass to complete these experiments.
Gross Pathology. Macroscopic cecal lesions were scored using previous published
criteria.13 Briefly, ceca were evaluated macroscopically for atrophy, edema, and/or increased
mucus in the ingesta, and given a gross lesion score (range 0-3:0 = normal, 3 = severe cecal
lesion). Representative tissue sections were fixed in neutral buffered 10% formalin for histopathologic evaluation.
Histology. Formalin-fixed cecal tissues were embedded in paraffin, sectioned at 5 pm, and stained with hematoxylin and eosin (H&E) for assessment of inflammation. Tissue sections were coded to blind the pathologist (J Hostetter, Dept. of Veterinary Pathology) to the infection status of the animal. The cecal tissue sections from each mouse were scored on severity of mucosal epithelial damage, architectural/glandular alterations, and magnitude/character of lamina propria cellular infiltrate (Table 2). 42
Table 2. Scoring System for Histopathological Evaluation of Gastrointestinal Inflammation
Parameters Scoring Criteria Ratio of crypt depth to width Mucosal height Rising score from 1-5 (mild-*severe hyperplasia) Lymphocytes/plasma cells are the expected population LP immune cells Mixed inflammation = increased neutrophils
Erosions Denotes quantity of cellular infiltrates in the LP Inflammatory score Rising score from 1-5 (normal -*• severe inflammation with necrosis Rising score from 1-5 (1 = mild edema; 5 = severe edema with Edema score architectural distortion)
Other Submucosal lymphoid hyperplasia (present of absent)
Table 2. Scoring system for the histopathological evaluation of gastrointestinal inflammation. LP = lamina propria.
Antigen-Specific Serum Antibodies. Blood samples were obtained via cardiac puncture at the same time tissues were collected for analysis. Resulting sera samples were stored at -20°
C until assays were performed. Determination of H. bilis-, B. hyodysenteriae-, and ASF- specific antibodies in sera was performed by ELISA as previously described.22 Briefly, 96- well microliter plates (Immunlon H) were coated with sonicated whole cell lysates of each of the eight anaerobic bacteria comprising the altered schaedler flora, H. bilis, and B. hyodysenteriae. Diluted serum (1:200) was added to each well and incubated at 4°C overnight. Then, alkaline phosphatase conjugated goat anti-mouse IgGl or IgG2a was added and incubated for 1 hour at room temperature. Wells were colorimetrically developed using p-nitrophenyl phosphate at room temperature. Optical densities were measured at 405 nm using a microplate reader.
Cytokine Analysis by Multiplexed Flow Cytometric Assay. Lymphocytes isolated from 43
the spleen and mesenteric lymph nodes were incubated at 2.5 x 106 cells/ml with or without whole cell lysates of the ASF organisms, H. bilis, and B. hyodysenteriae for 72 hours. Cell cultures were treated with concanavalin A to evaluate the overall nature of the T cell response. Cell-free supematants were harvested and analyzed for their concentration of Thl
(TNF-a, IFN-y, IL-2, IL-12) and Th2 (IL-4, IL-10) cytokines using a multiplexed flow cytometric assay (The FlowMetric™ System, Luminex, Austin, TX). Cytokine concentrations were measured using a murine cytokine detection kit (Mouse Cytokine
LINCOplex Kit, Linco Research, St. Charles, MO) specifically designed for use with the
Luminex systems.
Data Analysis. All data are expressed as mean + SEM with values derived from 3 independent experiments. For all analyses, non-parametric assays were utilized with a
P<0.05 considered significant.
Results
Colonization with H. bilis, B. hyodysenteriae, and ASF bacteria
Mice inoculated with H. bilis became positive by fecal PCR 12-14 days post infection. Both Helicobacter genus and H. Mw-specific primers consistently detected infection under optimal conditions. In some instances, culture of cecal contents at necropsy was also used to confirm colonization with Helicobacter spp. Fecal samples recovered from uninfected control animals remained PCR negative for H. bilis. Confirmation of infection with B. hyodysenteriae was made from feces collected from infected mice, with the organism subsequently grown on selective media. Specific PCR products for members of the ASF
(with the exception of that derived from ASF member 360) were reliably obtained by 44
amplification of feces or cecal contents obtained at necropsy from defined flora mice using
the ASF-specific primers in a multiplex format (data not shown).16
Gnotobiotic mice develop typhlocolitis of varying severity subsequent to colonization by
H. bilis and B. hyodysenteriae
Clinical signs of colitis (e.g., diarrhea) were variably observed in dual-infected
defined flora (DP) mice and those colonized with B. hyodysenteriae alone. Cecal scores
from these groups were significantly ÇP<0.05) increased as compared to scores in defined flora and H. bilis-infected groups (Table 3). Grossly, diseased ceca had thickened cecal
walls and contained pasty contents. In contrast, H. bilis-infected mice had only mild inflammation characterized by cecal involution and local mesenteric lymphadenopathy.
Control mice had no detectable lesions.
Treatment group Cecal score Comment
Defined flora Grossly normal
Ceca slightly smaller H. bilis infected 0.2 t .08 Mesentric lymphadenopathy B. hyodysenteriae 1.4 +0.la Modei ato • marked.edema infected ' Dual infected 1.4 +0.1 Small ceca / mucoid contents Moderate edema
Table 3. Gross pathological scores of gnotobiotic mice infected with or without H. bilis or B. hyodysenteriae. Numbers reflect mean scores + SEM derived from 6-8 mice per treatment group averaged over 3 independent experiments. Maximum score is 3.0 (See Methods for scoring criteria). aP<0.05 versus defined flora and H. Mz's-infected mice. 45
Similar to the gross observations, histologic lesions in dual-infected DF mice and
mice infected with B. hyodysenteriae were significantly (P<0.05) increased over controls and
H. bilis-infected littermates (Table 4). Cecal inflammation in H. bilis-infected mice was
characterized by predominantly mononuclear infiltration of the lamina propria (LP) with
scattered foci of neutrophils. A similar but more intense infiltrate (accompanied by increased
mucosal edema) was observed in B. hyodysenteriae-infected DF mice (Figure 1, panel C).
Cecal tissues from dual-infected DF mice showed slightly more inflammation than B.
hyodysenteriae-mfected mice, with even greater LP cellular infiltrate, increased mucosal
height, crypt hyperplasia, and mucosal edema (Figure 1, panel D). Tissue sections of ceca
from non-infected control mice were histologically normal.
Intestinal colonization Histologic score3
Defined flora 3.6 +0.1
H. bilis 5.6 + 0.1b
B. hyodysenteriae 9.0 + 0.2'
Dual infected 9.3+0.3 c
Table 4. Histopathological scores in gnotobiotic mice infected with and without H. bilis or B. hyodysenteriae. Numbers reflect mean scores + SEM derived from 6-8 mice per treatment group averaged over 3 independent experiments. a Maximum value for each parameter except that assigned to inflammatory cells is 5, and maximum total histology score is 20. b P<0.05 for H. bilis versus defined flora and B. hyodysenteriae or dual infected. c P<0.05 for B. hyodysenteriae or dual versus H. bilis and defined flora. 46
C D Figure 1. Histological changes in the cecal mucosa of defined flora mice after bacterial infection. (A) Controls - no infection; (B) Mice infected with H. bilis alone; (C) Mice infected with B. hyodysenteriae alone. Note the severe mucosal edema, cellular infiltrate, and diffuse epithelial erosions; (D) Mice infected with both H. bilis and B. hyodysenteriae. All images (160X) at Pi-day 42. 47
Gnotobiotic mice develop antigen-specific IgGl/IgG2a responses to the resident microflora following colonization with H. bilis and B. hyodysenteriae
Elevated serum concentrations of IgGland IgG2a antibodies directed against specific members of the ASF were observed in DF mice colonized with either novel bacterium, and these responses were greatest in H. Mzs-infected mice (Figure 2A). The evaluation of pooled antibody responses revealed significant group differences in IgG isotype levels directed at antigens derived from members of the resident flora (Figure 2A). For
IgGl, all colonization groups evoked significantly (P<0.05) increased anti-//. bilis antibody responses compared to control mice, with the greatest response observed in H. bilis-infected mice (Figure 2B). Similarly, both H. bilis and dual infected mice had significantly (P<0.05) increased IgG2a responses directed against H. bilis antigen when compared to B. hyodysenteriae-mfected mice and non-infected controls (Figure 2B). 48
lgG1
• ASF 356 • ASF 360 • ASF 361 ASF 457 Control H. bilis B.hyo Dual • • ASF 492 ASF 500 lgG2a • m ASF 502 ASF 519
Control H. bilis B.hyo Dual
Figure 2A. Antibody responses to antigens derived from members of the altered schaedler flora (ASF). Serum was collected from gnotobiotic mice 21 days following challenge with B. hyodysenteriae. The serum samples from individual mice were diluted (1:200) and analyzed individually by ELIS A using sonicated whole cells of ASF bacteria as antigen. Numbers reflect means + SEM of the optical density (absorbance) for each treatment group. Each mean value comprises triplicate wells of individual mouse serum from 4-8 mice per treatment group averaged over 3 independent experiments. The control group consisted of gnotobiotic mice colonized with the 8 organisms comprising the ASF; the H. bilis group was infected with H. bilis on day -21; the B. hyodysenteriae group were gnotobiotic mice colonized with B. hyodysenteriae on day 0; and the dual-infected group were mice infected with both H. bilis (day -21) and B. hyodysenteriae (day 0). ASF 356 = Clostridium cluster XIV; ASF 360 = Lactobacillus acidophilus; ASF 361 = Lactobacillus animalis; ASF 457 = Flexistipes phylum; ASF 492 = Eubacterium plexicaudatum; ASF 500 = Low G + C-content spp.; ASF 502 = Clostridium cluster XIV; ASF 519 = Bacteroides distasonis. 49
igGl
S 0.4
Control I H. bills l.hyo I Dual Control P<0.05 for a vs.b.vs.c.vs.d H. bilis • B. hyo lgG2a
E c Ln 0.8
£ 0.6 S c 5 0.4
-Q 0.2 <
Control ' H.bills « B.hyo • Dual
1 P<0.05 for H. bilis vs. B. hyo and control ' P<0.05 for dual vs. B. hyo and control
Figure 2B. Pooled antibody responses to antigens of the altered schaedler flora (ASF). Serum was collected from gnotobiotic mice 21 days following challenge with B. hyodysenteriae. The serum samples from individual mice were diluted (1:200) and analyzed individually by ELIS A using sonicated whole cells of ASF bacteria as antigen. Numbers reflect means + SEM of the pooled optical density (absorbance) for all 8 ASF antigens averaged over 3 independent experiments. The control group consisted of gnotobiotic mice colonized with the 8 organisms comprising the ASF; the H. bilis group was infected with H. bilis on day -21; the B. hyodysenteriae group were gnotobiotic mice colonized with B. hyodysenteriae on day 0; and the dual-infected group were mice infected with both H. bilis (day -21) and B. hyodysenteriae (day 0). ASF 356 = Clostridium cluster XIV; ASF 360 = Lactobacillus acidophilus; ASF 361 = Lactobacillus animalis; ASF 457 = Flexistipes phylum; ASF 492 = Eubacterium plexicaudatunv, ASF 500 = Low G + C-content spp.; ASF 502 = Clostridium cluster XIV; ASF 519 = Bacteroides distasonis. Statistical inferences are noted under each histogram in Figure 2B. 50
Colonization of gnotobiotic mice with H. bilis or B. hyodysenteriae evokes compartmentalized cytokine responses to members of the resident microflora
Cytokine responses in lymphocyte culture supernatants from the spleen (SPL) and mesenteric lymph nodes (MLN) were compartmentalized in their magnitude and varied between treatment groups (Figure 3A). Responses in SPL supernatants were greatest for IL-
4 and IL-10 while IFN-y responses were greater in MLN cultures. When analysis of pooled cytokine réponses was performed, significant (P<0.05) differences between groups were observed for all cytokines in both SPL and MLN cultures (Figure 3B). The details of these inferences are included under each histogram of Figure 3B. Supernatants derived from lymphocyte cultures from non-infected DF mice showed minimal but detectable levels
(pg/ml) of IFN-y, IL-4, and IL-10. 51
• NS • B204 • H. bilis Control • 360 • 492 • 500 m 502 El 519
1400
Control
• NS • B204 • H. bilis • 360 • 492 • 500 SPL IFN-y 0 502 1400 • 519 t 1200 1000
800
600
400 3 200 Control B. hyo
Figure 3A. Detection of cytokine production to individual ASF antigens in culture supernatant fluid from splenocytes (SPL) or mesenteric lymph node (MLN) cells. Lymphocytes recovered from mice in each of four treatment groups were cultured in the presence of specific antigens (25 ng/mL) or concanavalin A (5 pg/mL) for 72 hrs and harvested for analysis. Undiluted supernatant fluid was analyzed by multiplexed flow cytometric assay for the amount of IFN-y, IL-10 or IL-4. Data represent means + SEM of cytokine concentration (pg/ml) derived from 3 independent experiments. 360 = Lactobacillus acidophilus; 492 = Eubacterium plexicaudatum; 500 = Low G + C-content species; 502 = Clostridium cluster XIV; 519 = Bacteroides distasonis; H. bilis = Helicobacter bilis; B. hyo = Brachyspira hyodysenteriae B204. 52
MLN IL-4 SPL IL-4
Control 'H.bills rr-B.hvo ' Dual Control 'H. bills 8. hyo 1 Dual 3 P<0.05 for dual vs. H.bilis and control 8 P<0.05 for dual vs.other 3 groups b P<0.05 for B. hyo vs. other 3 groups
H Control MLN IL-10 • H. bilis SPL IL-10 • 8, hyo 1400 — 1400 Hi Dual 1200
1000 1000
800
600 600 Is 400
5 200 200
Control H.bilis B.hyo Dual Control H. bills B.hyo Dual
P<0.05 for B. hyo vs. other 3 groups P<0.05 for a vs.b vs.c vs.d b P<0.05 for dual and H. bilis vs. control
B Control -y SPL IFN-Y MLN IFN • H. bilis • B. hyo S M Dual 1
Control H. bills B.hyo Control H. bills 8. hyo Dual
a P<0.05 for B.hyo vs.other 3 groups * P<0,05 for dual vs. other 3 groups b P<0.05 for dual vs.H.bilis and control
Figure 3B. Detection of pooled cytokine responses to ASF antigens per group in culture supernatant fluid from splenocytes (SPL) or mesenteric lymph node (MLN) cells following antigenic stimulation. Lymphocytes recovered from mice in each of four treatment groups were cultured in the presence of specific ASF antigens (25 jig/mL) for 72 hours and harvested for analysis. Undiluted supernatant fluid was analyzed by multiplexed flow cytometric assay for the amount of IFN-y, IL-10 or IL-4. Data represent means + SEM of the pooled cytokine concentrations (pg/ml) to all 8 ASF antigens per group derived from 3 independent experiments. Statistical inferences are noted under each histogram in Figure 3B. 53
Discussion
The B. hyodysenteriae-challenge model of colitis is unique and differs from most other mouse models. Its distinct advantages include (a) the initiating etiologic agent (B. hyodysenteriae) is known; (b) a defined bacterial flora (gnotobiotic or conventional) is necessary to develop intestinal inflammation; (c) this model provides reproducible typhlocolitis quickly and consistently allowing temporal studies to be performed; and (d) immunocompetent mice are used to assess the host's immune response following onset of colitis. We have previously reported on the strain-related differential susceptibility in conventional mice to B. hyodysenteriae infection and on the use of a defined diet to enhance the susceptibility of mice to the pathogenic effects of the spirochete infection.13'17 We have since extended these observations to show that the use of antibiotic therapy to selectively deplete members of the microflora (e.g., gram negative anaerobes) abolishes the ability of B. hyodysenteriae to induce colitis.13,23 It is apparent from these investigations that the singular presence of B. hyodysenteriae in murine ceca is insufficient to cause disease, and that enteric bacteria are necessary for the development of intestinal inflammation. Apparently, the indiginous flora provides the necessary antigenic or phlogistic stimulation to induce colitis in affected mice.
Previous studies demonstrate a crucial role for resident bacteria in the pathogenesis of experimental colitis and inflammatory bowel disease (IBD) in humans.1,24,25
Both spontaneous and induced inflammation in a diverse range of rodent models have been associated with commensal resident bacteria.3,6,26"35 Determining the nature of those microbial populations that are responsible for the initiation and perpetuation of colitis is difficult given the complex microbial environment present in most models. Importantly, not 54
all luminal bacteria have equivalent abilities to induce inflammation. Bacteroides vulgatus
induces colitis in carrageenan-fed guinea pigs32 and HLA-B27 transgenic rats3,36 and induces
a comparable degree of colitis in monoassociated HLA-B27 transgenic rats to lesions
observed in transgenic rats colonized with six bacterial species (including B. vulgatus)?6
Both HLA-B27 transgenic rats monoassociated with E. coli and IL-10"7" mice
monoassociated with B. vulgatus, Helicobacter hepaticus, Clostridium sordelii or viridans-
type streptococci fail to develop colitis.37'38 On the other hand, Enterococcus faecalis induces
IBD in IL-10"7" mice.39 Thus different bacteria and/or their products are required to evoke chronic immune-mediated inflammation in various susceptible hosts.
The gnotobiotic mouse model is a useful tool for evaluating the roles of bacterial species in the development of intestinal inflammation. Our rationale was that the use of an available defined flora mouse model that is more complex, and seemingly more realistic, than monoassociated models would assist in the study of microbially-triggered host responses that predispose to or mediate intestinal inflammation.16 We chose to introduce H. bilis into the B. hyodysenteriae-challenge model as a novel non-resident bacterium (e.g., provocateur), based on its role as a potential pathogen in conventional mice infected with B. hyodysenteriae and based on the association of Helicobacter spp. with IBD in other rodent models.35'40"44 It was anticipated that intestinal inflammation would be mediated by a pro inflammatory Thl immune response (based on previous studies in conventional flora mice colonized with B. hyodysenteriae) directed at members of the resident microflora, and that this response would be potentiated following the introduction of H. bilis. While we did observe modest increases in gross/histologic inflammatory indices in dual-infected mice, the ability of H. bilis infection to modulate immunologic responses (e.g., to a balanced Thl :Th2 55
profile) to resident microflora at a single time point was an unexpected finding. This
observation suggests that the introduction of a previously non-resident bacterium may alter
the homeostatic balance of the commensal flora and evoke antigen-specific responses
capable of inciting an inflammatory response in a susceptible host.
Some earlier studies suggest that infection with some Helicobacter species evokes
Thl-mediated chronic gastrointestinal inflammation.45"47 In the present study, the profile of
antibody and cytokine responses to antigens derived from the resident flora were of mixed
Thl :Th2 expression, but with Th2 responses predominating in the Helicobacter groups. We observed only mild gross and histologic lesions in H. bilis-infected mice while more severe colitis was seen in B. hyodysenteriae- and dual-infected mice. While these observations demonstrate that B. hyodysenteriae can induce cecal inflammation in gnotobiotic mice, they also suggest that additional bacterial interactions (e.g., introduction of H. bilis into the intestinal microflora) contribute to the genesis of host immunologic responses.3 We hypothesize that colonization with H. bilis perturbed the local microecology and influenced the immunological bias of the host response to luminal bacteria (i.e., broke tolerance or overcame immunological ignorance). In turn, these protective Th2 responses generated against commensal members, as a consequence of H. bilis colonization, mitigated lesion severity in dual-infected mice by apposing the pro-inflammatory (e.g., Thl-like) responses characteristic of B. hyodysenteriae infection alone.
The profile of antibodies and cytokines in gnotobiotic mice having different compositions of resident microflora suggest that subpopulations of luminal bacteria exert a dominant influence on the induction of subsequent immune responses. Elevated serum levels of IgGl and IgG2a to diverse ASF members (in particular ASF356, ASF360, ASF457) were 56
observed in H. bilis-, B. hyodysenteriae-, and dual-infected groups, with the greater antibody responses seen in H. Mis-infected mice. Increased concentrations of IgG directed against luminal commensal bacteria have been reported in several different animal models of colitis.6'48"50 Defined flora mice colonized with H. bilis produced greater serum IgGl and
IgG2a antibody responses to H. bilis (relative to the responses to the 8 ASF) similar to that described in other Helicobacter-associated IBD models.35'51 Induction of antigen-specific secretion of IL-4, IL-10 and IFN-y were differentially present in lymphocyte cultures of gnotobiotic mice. Relative to non-infected control mice, we observed increased Thl/Th2 cytokine concentrations between the different mouse groups with B. hyodysenteriae- and dual-infected mice evoking the greatest cytokine responses.
The compartmentalized Th2-like cytokine responses present in dual-infected mice, characterized by increased IL-4 and IL-10 in splenic cultures but decreased IFN-y in
MLN cultures are noteworthy, especially when these results are compared to those findings in B. hyodysenteriae-infected mice. Maggio-Price et al35 have recently reported decreased
IFN-y transcripts in colonic tissues of H. hepaticus-mîecXeà mdr la" "mice having mild lesions of IBD. The decreased IFN-y secretion in dual-infected mice was surprising but may be attributable to the effects of H. bilis infection which may down-regulate this pro inflammatory cytokine and lessen its role in promoting colitis in a susceptible murine host.35
In keeping with this Th2 profile of cytokines, we found that spleen cells recovered from dual- infected mice also secreted greater concentrations of IL-10 following antigenic stimulation than cells recovered from the other three groups of mice. Cecal bacterial lysates or LPS may induce high concentrations of IL-10 by murine mesenteric lymph node cells or splenocytes with most being produced by macrophages or dendritic cells.52 IL-10 is an important 57
cytokine in modulating inflammatory responses in IBD, likely through T regulatory cells
(Trl) and also by B cells and dendritic cells.35,53"56 The anti-inflammatory actions of IL-10
include inhibition of antigen-specific proliferation and cytokine production by Thl
lymphocytes and down regulatory effects on antigen presenting cells via suppression of
macrophage activation and IL-12 production.56"59 Kullberg et al45 showed that CD4+ T cells
from H. hepaticus-mfected wildtype mice could prevent colitis in Rag" " mice when co- transferred with CD4+ T cells from H. hepaticus-colonized IL-10"7" mice; and that this antigen-specific protection was mediated through the secretion of IL-10. However, IL-10 may have diverse roles in mediating Helicobacter-indaced inflammation since increased IL-
10 levels accompany severe IBD in mdr la"7" mice with or without H. bilis infection but levels are not increased in H. hepaticus-infected mdr la"7" having delayed IBD development.35
These results indicate that perturbation of the microflora may evoke antigen- specific immune responses to nonpathogenic bacteria but they do not completely explain those bacterial components responsible for host responses. Both adjuvants and antigens derived from commensal enteric bacteria may stimulate cell-mediated immune responses.
Luminal bacteria produce several non-viable bacterial products (e.g., LPS1 [from Gram- negative bacteria], peptidoglycan-polysaccharide (PG-PS) complexes60 [from both Gram- positive and Gram-negative bacteria], and bacterial DNA61 [containing CpG motifs]) which can stimulate innate immunity through pattern recognition receptors, especially toll-like receptors (TLR).62"64 Bacterial flagellin, an immunodominant antigen present in several ASF bacteria (ASF502, ASF492) as well as flagellin from some Treponema spp., may also stimulate pathogenic intestinal immune reactions through TLR 5.65 Serum and mucosal 58
antibody responses likely indicate increased mucosal permeability and/or enhanced
immunologic responsiveness to multiple resident species.1 Increased levels of inflammatory
cytokines, such as IFN-y, may also impair epithelial barrier integrity and contribute to
mucosal inflammation.6 Furthermore, Helicobacter spp. infection may initiate the
development of intestinal inflammation through diverse mechanisms including the
elaboration of specific toxins (e.g., cytolethal distending toxins66), IFN-y -mediated compromise of intestinal epithelial barrier function35'67, the production of commensal- specific CD4+ T cells27, LPS-mediated activation of innate immunity through TLR46, and/or altered epithelial cell gene expression. It is likely that host responses to commensal luminal bacteria are quite heterogeneous and that numerous mechanisms contribute to intestinal inflammation.
In summary, our study describes the use of a gnotobiotic model to investigate the nature of microbial populations inciting intestinal inflammation. The introduction of a novel bacterium (H. bilis and/or B. hyodysenteriae) perturbs the local microbial environment and evokes an array of antigen-specific host responses against commensal bacterial flora.
While it was anticipated that gnotobiotic mice would produce Thl immune responses to commensal flora following colonization by one or both novel bacteria, instead it was shown that H. Mz's-infected and dual-infected mice produced predominant serum IgGl and IL-10 but decreased locally-derived IFN-y, suggestive of a Th2 immune response. These findings indicate that the nature of the gastrointestinal flora significantly influences the immunologic bias of the host response and the presence of Helicobacter species does not apriori predispose toward a Thl inflammatory response. 59
References
1. Sartor RB. Animal models of intestinal inflammation. In: Sartor RB, Sandbom WJ, eds. Kirsner's Inflammatory Bowel Diseases, 6th edn. London: Elsevier 2004,120- 137.
2. Sartor RB. Microbial influences in inflammatory bowel diseases: role in pathogenesis and clinical implications. In: Sartor RB, Sandbom WJ, eds. Kirsner 's Inflammatory Bowel Diseases, 6th edn. London: Elsevier 2004,138-162.
3. Rath HC, Herfarth HH, Ikeda JS, et al. Normal luminal bacteria, especially Bacteroides species, mediate chronic colitis, gastritis and arthritis in HLA- B27/human beta2 microglobulin transgenic rats. J Clin Invest 1996; 98:945-953.
4. Taurog JD, Richardson JA, Croft JT, et al. The germ-free state prevents the development of gut and joint inflammatory disease in HLAB27 transgenic rats. J Exp Med 1994; 180:2359-2364.
5. Sadlack B, Marz H, Schorle H, et al. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 1993; 75:253-261.
6. Sellon RK, Tonkonogy S, Schultz M, et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10- deficient mice. Infect Immun 1998; 66:5224-5231.
7. Colombel JF, Cortot A, Van Kruiningen HJ. Antibiotics in Crohn's disease. Gut 2001;49:873-874.
8. Madsen KL, Doyle JS, Taveminimm, et al. Antibiotic therapy attenuates colitis in interleukin-10 gene-deficient mice. Gastroenterology 2000; 118:1094-1105.
9. Onderdonk AB, Hermos J A, Dzink JL, et al. Protective effect of metronidazole in experimental ulcerative colitis. Gastroenterology 1978; 74:521-526.
10. Videla S, Vilaseca J, Guarner F, et al. Role of intestinal microflora in chronic inflammation and ulceration of the rat colon. Gut 1994; 35:1090-1097.
11. Bamias G, Marini M, Moskaluk CA, et al. Down-regulation of intestinal lymphocyte activation and TH1 cytokine production by antibiotic therapy in a murine model of Crohn's disease. J Immunol 2002; 169:5308-5314.
12. Hutto DL, Wannemuehler MJ. A comparison of the morphologic effects of Serpulina hyodysenteriae or its beta-hemolysin on the murine cecal mucosa. Vet Pathol 1999; 36:412-422. 60
13. Nibbelink SK, Wannemuehler MJ. An enhanced murine model for studies of Serpulina (Treponema) hyodysenteriae pathogenesis. Infect Immun 1992; 60:3433- 3436.
14. Khalifeh MS. The role of T-cell mediated immune response in the development and resolution of colitis induced by Serpulina hyodysenteriae. MS Thesis, Iowa State University, Ames, LA, 1999.
15. Fox JG. Personal communication.
16. Sarma-Rupavtarm RB, Ge Z, Schauer DB, et al. Spacial distribution and stability of the eight microbial species of the altered schaedler flora in the mouse gastrointestinal tract. Appl Environ Microbiol 2004; 70:2791-2800.
17. Nibbelink SK, Wannemuehler MJ. Susceptibilitiy of inbred mouse strains to infection wtih Serpulina (Treponema) hyodysenteriae. Infect Immun 1991; 59:3111-3118.
18. Hutto DL, Galvin JE, Wannemuehler MJ. Morphologic and temporal characterization of lesions in an enhanced murine model of Serpulina hyodysenteriae infection. J Med Microbiol 1998; 47:275-280.
19. Jergens AE, Dorn A, Hutto D, et al. Induction of Th2-like immune responses by C3H mice bearing a defined flora following onset of colitis. Gastroenterology, 2002; 16:249.
20. Riley LK, Franklin CL, Hook RR, et al. Identification of murine Helicobacter by PCR and restriction enzyme analyses. J Clin Microbiol 1996; 34:942-946.
21. Fox JG, Yan LL, Dewhirst FE, et al. Helicobacter bilis sp. Nov., a novel Helicobacter species isolated from bile, livers, and intestines of aged inbred mice. J Clin Microbiol 1995; 33:445-454.
22. Sacco RE, Jensen RJ, Thoen CO, et al. Cytokine secretion and adhesion molecule expression by granuloma T-lymphocytes in Mycobacterium avium infection. Am J Pathol 1996; 148:1935-1948.
23. Galvin JE. Pathogenesis of swine dysentery: The role of luminal antigens in the activation of mucosal T lymphocytes. PhD Diss., Iowa State University, Ames, LA, 1995.
24. Sartor RB. Review article: Role of the enteric microflora in the pathogenesis of intestinal inflammation and arthritis. Aliment Pharmacol Ther 1997; 11 :Supp 3:17- 23.
25. Sartor RB, Rath HC, Sellon RK. Microbial factors in chronic intestinal inflammation. 61
Curr Opin Gastroenterol 1996; 12:327-333.
26. Aranda R, Sydora BC, McAllister PL, et al. Analysis of intestinal lymphocytes in mouse colitis mediated by transfer of CD4+, CD45 RBhlgh T-cells to SCÏÏ) recipients. J Immunol 1997; 158:3464-3473.
27. Cong Y, Brandwein SL, McCabe RP, et al. CD4+ T-cells reactive to enteric bacterial antigens in spontaneously colitic C3H-HeJBir mice: increased T-helper cell-type 1 . response and ability to transfer disease. J Exp Med 1998; 187:855-864.
28. Contractor NV, Bassiri H, Reya T, et al. Lymphoid hyperplasia, autoimmunity and compromised intestinal intraepithelial lymphocyte development in colitis-free gnotobiotic IL-2 deficient mice. J Immunol 1998; 160:385-394.
29. Dianda L, Hanby AM, Wright NA, et al. T-cell receptor-alpha beta-deficient mice fail to develop colitis in the absence of a microbial environment. Am J Pathol 1997; 150:91-97.
30. Garcia-Lafuente A, Antolin M, Guamer F, et al. Incrimination of anaerobic bacteria in the induction of experimental colitis. Am J Physiol 1997; 272:G10-G15.
31. Kuhn R, Lohler J, Rennick D, et al. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 1993; 75:263-274.
32. Onderdonk AB, Franklin ML, Cisneros RL. Production of experimental ulcerative colitis in gnotobiotic guinea pigs with simplified microflora. Infect Immun 1981; 32:225-231.
33. Veltkamp C, Tonkonogy SL, De Jong YP, et al. Continuous stimulation by normal luminal bacteria is essential for the development and perpetuation of colitis in Tg (Epsilon 26) mice. Gastroenterology 2001; 120:900-913.
34. Yamada T, Deitch E, Specian RD, et al. Mechanisms of acute and chronic intestinal inflammation induced by indomethacin. Inflammation 1993; 17:641-662.
35. Maggio Price L, Shows D, Waggie K, et al. Helicobacter bilis infection accelerates and H. hepaticus infection delays the development of colitis in multiple-drug resistance-deficient (mdr la-/-) mice. Am J Pathol 2002; 160:739-751.
36. Rath HC, Wilson KH, Sartor RB. Differential induction of gastritis and colitis in HLA-B27 transgenic rats selectively colonized with Bacteroides vulgatus or Escherichia coli. Infect Immun 1999; 67:2969-2974.
37. Dieleman LA, Arends A, Tonkonogy SL, et al. Helicobacter hepaticus does not induce or potentiate colitis in interleukin-10-deficient mice. Infect Immun 2000; 62
68:5107-5113.
38. Sydora BC, Tavemini MM, Jewell LD, et al. Effective bacterial monoassociation on tolerance and intestinal inflammation in IL-10 gene-deficient mice. Gastroenterology 2001; 120:A517.
39. Balish E, Warner T. Enterococcus faecalis induced inflammatory bowel disease in interleukin-10 knockout mice. Am J Pathol 2002; 160:2253-2257.
40. Cahill RJ, Foltz CJ, Fox JG, et al. Inflammatory bowel disease: An immunity- mediated condition triggered by bacterial infection with Helicobacter hepaticus. Infect Immun 1997; 65:3126-3131.
41. Chin EY, Dangler CA, Fox JG, et al. Helicobacter hepaticus infection triggers inflammatory bowel disease in T-cell receptor-aB mutant mice. Comp Med 2000; 50:586-594.
42. Fox JG, Yan L, Shames B, et al. Persistent hepatitis and enterocolitis in germ-free mice infected with Helicobacter hepaticus. Infect Immun 1996; 64:3673-3681.
43. Franklin CL, Riley LK, Livingston RS, et al. Enterohepatic lesions in SCDD mice infected with Helicobacter bilis. Lab Anim Sci 1998; 48:334-339.
44. Shomer NH, Dangler CA, Schrenzel MD, et al. Helicobacter Mis-induced inflammatory bowel disease in SCID mice with defined flora. Infect Immun 1997; 65:4858-4864.
45. Kullberg MC, Ward JM, Gorelick PL, et al. Helicobacter hepaticus triggers colitis in specific pathogen-free interleukin-10 (IL-10)-deficient mice through an IL-12-and y interferon-dependent mechanisms. Infect Immun 1998; 66:5157-5166.
46. Burich A, Hershberg R, Waggie K, et al. Helicobacter-induced inflammatory bowel disease in IL-10- and T-cell-deficient mice. Am J Physiol Gastrointest Liver Physiol 2001; 281 :G764-G778.
47. Whary MT, Morgan TJ, Dangler CA, et al. Chronic active hepatitis-induced by Helicobacter hepaticus in the A/JCr mouse is associated with a Thl cell-mediated immune response. Infect Immunol 1998; 66:3142-3148.
48. Elson CO. Commensal bacteria as targets in Crohn's disease. Gastroenterology 2000; 119:254-257.
49. Brandwein SL, McCabe RP, Kong Y, et al. Spontaneously colitic C3H/HeJ Bir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol 1997; 159:44-52. 63
50. Mizoguchi A, Mizoguchi E, Chiba C, et al. Cytokine imbalance and autoantibody production in T-cell receptor-a mutant mice with inflammatory bowel disease. J Exp Med 1996; 183:847-856.
51. Shomer NH, Dangler CA, Schrenzel MD, et al. Cholangiohepatitis and inflammatory bowel disease induced by a novel urease-negative Helicobacter species in A/J and Tac:ICR:HasrirffRF mice. Exp Biol Med 2001 ; 226:420-428.
52. Albright CA, Tonkongy SL, Sartor RB. Antigen presenting cells produce IL-10 in response to IFN gamma. Gastroenterology 2003; 124:A332.
53. Asseman C, Mauze S, Leach MW, et al. An essential role for interleukin-10 in the function of regulatory T-cells that inhibit intestinal inflammation. J Exp Med 1999; 190:995-1004.
54. Duchmann R, Schmitt E, Knolle P, et al. Tolerance toward resident intestinal flora in mice is abrogated in experimental colitis and restored by treatment with interleukin- 10 or antibodies to interleukin-12. Eur J Immunol 1996; 26:934-938.
55. Rennick DM, Fort MM. Lessons from genetically engineered animal models. XIIIL- 10-deficient (IL-10"7') mice and intestinal inflammation. Am J Physiol Gastrointest Liver Physiol 2000; 278:G829-G833.
56. Dieleman LA, Hoentjen F, Qian B-F, et al. Reduced ratio of protective versus proinflammatory cytokine responses to commensal bacteria in HLA-B 27 transgenic rats. Clin Exp Immunol 2004; 136:30-39.
57. Moore KW, O'Garra A, de Waal M, Alefyt R, et al. Interleukin-10. Annu Rev Immunol 1993; 11:165-190.
58. Tripp CS, Wolfe SF, Unanuc ER. Interleukin-12 and tumor necrosis factor alpha are co-stimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin-10 is a physiologic antagonist. Proc Natl Acad Sci 1993; 90:3725.
59. Moore KW, de Waal M, Coffman RL, et al. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 2001; 19:683-765.
60. Schwab JH. Phlogistic properties of peptidoglycan-polysaccaride polymers from cell walls of pathogenic and normal-flora bacteria which colonize humans. Infect Immun 1993;61:4535-4539.
61. Rachmilewitz D, Karmeli F, Takabayashi K, et al. Immunostimulatory DNA ameliorates experimental and spontaneous murine colitis. Gastroenterology 2002; 64
122:1428-1441.
62. Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000; 406:782-787.
63. Anderson KV. Toll-signaling pathways in the innate immune response. Curr Opin Immunol 2000; 12:13-19.
64. Krug A, Towarowski A, Britsch S, et al. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendridic cells which synergizes with CD40 ligand to induced high amounts of IL-12. Eur J Immunol 2001; 31:3026-3037.
65. Lodes MJ, Cong Yingzi, Elson CO, et al. Bacterial flagellin is a dominant antigen in Crohn disease. J Clin Invest 2004; 113:1296-1306.
66. Young VB, Chien CC, Knox KA, et al. Cytolethal distending toxin in avian and human isolates of Helicobacter pullorum. J Infect Dis 2000; 182:620-623.
67. Oshima T, Laroux FS, Coe LL, et al. Interferon-y and interleukin-10 reciprocally regulate endothelial junction integrity and barrier function. Microvasc Res 2001; 61:130-143. 65
CHAPTER 3. GNOTOBIOTIC MICE COLONIZED WITH HELICOBACTER BILIS DEMONSTRATE ANTIGEN-SPECIFIC IMMUNE RESPONSES TO RESIDENT ENTERIC FLORA
A paper to.be submitted for publication to the journal Gut
Albert E. Jergens, DVM, MS1'2; Jenny Wilson, BS1; Andrea Dorn, BS1;
Abigail Henderson, BS1; Krystal Dingbaum1; Zhiping Liu, BS1;
Jesse Hostetter, DVM, PhD3; MJ Wannemuehler, PhD1
From the Departments of Veterinary Microbiology and Preventive Medicine1, Veterinary
Clinical Sciences2, and Veterinary Pathology3, College of Veterinary Medicine, Iowa State
University, Ames, Iowa 50010, USA
Corresponding Author: AE Jergens
Phone: 515-294-4900
Fax: 515-294-9281
Email: [email protected] 66
ABSTRACT
Background and Aims: Infection with Helicobacter species has been associated with the development of mucosal inflammation and inflammatory bowel disease (IBD) in several mouse models. However, consensus regarding the role of Helicobacter as a potential pathogen or its utility as a model organism to study intestinal inflammation is confounded by the presence of a complex colonic microbiota. The aims of this study were to determine whether colonization of gnotobiotic mice with Helicobacter bilis provokes an antigen- specific immune response to the resident enteric flora, and to investigate the kinetics of this response. Methods: Gnotobiotic C3H/HeN mice possessing a defined flora (e.g., altered schaedler flora consisting of 8 intestinal bacteria) were used to evaluate the host's response following colonization with H. bilis over a 10 week period. Immunologic parameters evaluated include gross cecal morphology, histopathology, mucosal immunohistochemistry, isotype of the antigen-specific serum antibody (ELISA), and antigen-induced Thl :Th2 cytokine responses. Results: Results indicate that H. bilis colonized gnotobiotic mice demonstrate diverse antigen-specific immune responses to their resident flora in comparison to gnotobiotic C3H mice having a defined flora alone. The immunologic responses of the gnotobiotic C3H mice colonized with H. bilis developed rapidly, generally persisted over the
10 week study and demonstrated a mixed Thl:Th2 phenotype. Although marked histologic lesions were not observed in H. bilis-colonized mice, alterations in mucosal B220 and CD4+
T cell and CD8+ T cell populations indicated that local immunity was disturbed.
Conclusions: Gnotobiotic animals provide a useful tool for evaluation of the provocative potential of intestinal bacteria in the pathogenesis of intestinal inflammation. These studies support a potential pathogenic role for H. bilis in perturbing the normal resident microflora 67
and inducing antigen-specific immune responses against multiple resident bacterial species.
Our model suggests that changes in the homeostatic balance of the intestinal microbiota
(following colonization with H. bilis) and the resulting host response may initiate mucosal inflammation, particularly in a setting where natural tolerance to the bacterium does not exist. 68
Introduction
The mammalian gastrointestinal (GI) tract harbors a complex microbial population
which is remarkably stable throughout life and resists colonization by pathogenic bacteria.[l]
This ecosystem is vast, both quantitatively and in terms of diversity, with the presence of at
least 400-500 different species.[2] Most gut bacteria are commensals that coexist with the
host in a mutualistic relationship. Several studies have demonstrated a beneficial role for the
GI microflora in the provision of essential nutrients (e.g., vitamin K, short-chain fatty acids),
the development of intestinal epithelium, vasculature, and lymphoid tissue, and the
contribution to colonization resistance which protects the host from pathogenic infections.[3][4]
In contrast, altered composition and functional activities of the luminal microflora have been linked to the pathogenesis of chronic enterocolitis, such as inflammatory bowel disease (IBD). A number of animal models of human IBD provide compelling evidence for bacterial flora driving an inflammatory process. For example, both IL-2_/~ [5] and IL-10" " [6] mice spontaneously develop IBD when housed under conventional conditions, but there is no evidence of colitis when animals are maintained under germ-free conditions. [7] Adoptive transfer of CD45RB1" T cells mediates less severe wasting disease in immunodeficient mice harboring a reduced intestinal flora [8]; furthermore, T-cell mediated gut inflammation can be transferred with effector T cells against enteric bacteria. [8][9] It appears that a constant bacterial stimulus is needed for the induction and perpetuation of inflammation [10], and that resident bacteria have different capacities to induce mucosal inflammation.[11][12][13]
These accumulated observations incriminate intestinal bacteria in the initiation and perpetuation of chronic intestinal inflammation, although the critical bacterial species or 69
antigen(s) remain undetermined. It is likely that select components of the normal microflora
and the antigen-specific immune responses that they evoke are crucial for the development of
colitis.
Infection with Helicobacter species has been associated with the development of
mucosal inflammation and EBD in several mouse models.[14][15][16][17][18][19] While some studies indicate that Helicobacter species do not induce EBD in germ-free IL-10"/" mice or worsen EBD in IL-lO7" mice that have been reconstituted with specific pathogen free
(SPF) flora [7][20], others have shown that Helicobacter can be an important factor contributing to murine colitis in an SPF environment.[21] [22] It is clear that the consensus opinion regarding the role of Helicobacter as a potential pathogen or its ability to interact with commensal luminal bacteria and induce intestinal inflammation is confounded by the presence of a complex colonic microbiota. The aim of this study was to determine if introduction of a novel bacterial species, Helicobacter bilis, into the microflora would perturb the homeostatic balance (e.g., immunologically) between the host and its resident flora.
Materials and Methods
Animals
Four-to-8 week old male and female C3H/HeN mice populated with a defined flora
(e.g., altered Schaedler flora [ASF] comprised of 8 bacterial species) were obtained from
Taconic Farms (Albany, NY). All mice were certified free of Helicobacter spp. by the vendor and re-tested on-site prior to study enrollment. Cohorts of mice were bred and maintained within the murine gnotobiotic facility at the College of Veterinary Medicine,
Iowa State University (ISU). Animals were housed in Trexler plastic isolators using standard 70
gnotobiotic techniques. Mice were fed ad libitum an irradiated diet (e.g., Harlan-Teklad) and
autoclaved water. All animal procedures were approved by the ISU Animal Care and Use
Committee.
Experimental Design
Gnotobiotic C3H mice were assigned to one of two study groups: (1) defined flora
alone receiving sham inoculations or (2) defined flora mice colonized with H. bilis.
Representative experimental and control mice (6-12 mice per time point) were euthanized by
CO2 asphyxiation on days 21,42, or 60 post-infection. Tissue samples were processed for evaluation of gross lesions, bacteriology, histopathology, immunohistochemistry, serum antibody levels, concentration of cytokines, and polymerase chain reaction (PCR) analysis for bacterial colonization.
Infection with Helicobacter bilis
An H. bilis isolate (ATCC strain 51630) was kindly provided by Dr Nancy Lynch
(College of Medicine, University of Iowa). Organisms were streaked onto Columbia blood agar plates supplemented with 5% horse serum and grown under microaerophilic conditions
(80 % N2,10 % H2, and 10 % CO2) and kept at 37° C. Bacteria were collected from 3-5 plates and suspended into tryptic soy broth on the day of inoculation. Prior to inoculation, organisms were collected under sterile conditions and examined for their purity, morphology, and motility by dark phase microscopy. Samples were confirmed to be urease positive.
Organisms were then suspended in broth to an approximate concentration of 108-109
CFU/ml. Gnotobiotic mice were orally infected with a bacterial inoculum (0.3 ml) of H. bilis administered every other day for three doses. Confirmation of H. bilis infection post- inoculum was made by PCR evaluation of feces or cecal contents and bacteriological culture. 71
Helicobacter bilis and ASF-Specific PCR
Fecal samples or cecal contents were analyzed for the presence of Helicobacter
spp and H. bilis as described previously.[23] [24] For generic Helicobacter PCR, 5 p.1 of
quantitated fecal DNA was used as template while for H. bilis PCR, 10 pi of quantitated fecal
DNA was used as template for all samples. Confirmation of ASF colonization at the
termination of the appropriate period was performed by PCR of fecal pellet DNA from
defined flora mice using ASF-specific primers with minor modifications made to PCR conditions.[25] Primers and their sequences used are summarized in Table 1.
Size of Primer Position of Band ASF Name primer in ORF Primer Sequences Produced Member 50-F 980-1000 CCAGGTCTTGACATCTAG 483 360 50-R 87-1004 ACGGCTCCTTCCACATAAG 49-F 73-90 TGCACTCACCGATAAAGAG 125 361 49-R 178-197 GTTACCATGCGGTAACTATG 51-F 801-818 AGGTGTGGGGGGACTGAC 320 500 51-R 1103-1121 CTAGAGTGCTCTTGCGTAG 52-F 792-811 GTGTCGGGGAGGAATTCCC 461 356 52-R 1232-1253 GGTTTTTGTGCTTTGCTTAACG 53-F 48-65 GAAGCACTTTTTTAGAAC 147 502 53-R 175-195 GTACCATGCGGTACCGGGGTC 54-F 194-212 GTTTTAAAAAGAAAACTCC 442 492 54-R 617-636 CCTCCGACACTCCAGCCCGG 55-F 145-166 ATGCCGGATGAGTTATATAAG 855 457 55-R 980-1000 CATTATCTCTAACGCCTTCTG 56-F 148-168 CTAATACCGCATAAAACAGGG 685 519 56-R 815-833 GTGCCGCTTACTGTGTATC
Table 1. Primer sequences for identification of ASF bacteria. Primer sequences for identification of ASF361 and ASF492 are different than previously published sequences.25 Modifications to primer sequences for detection of ASF361 and ASF492 were based on optimized PCR conditions and product detection using a multiplex format as compared to bacterial DNA positive control. ASF 356 = Clostridium cluster XIV; ASF 360 = Lactobacillus acidophilus; ASF 361 = Lactobacillus animalis; ASF 457 — Flexistipes phylum; ASF 492 = Eubacterium plexicaudatum; ASF 500 = Low G + C-content spp.; ASF 502 = Clostridium cluster XIV; ASF 519 = Bacteroides distasonis. 72
Preparation of H. bilis and Bacterial Antigens
Helicobacter bilis organisms were cultivated in Columbia broth, recovered, and
the bacteria collected by centrifugation. The cells were washed with sterile PBS, the cell
pellet was frozen, cells were lyophilized, and then stored at -20° C until used.
Each member of the schaedler flora (ASF 360, ASF 361, ASF 356, ASF 457, ASF
492, ASF 500, ASF 502, and ASF 519) was grown in anaerobically prepared medium and
cultured at 37°C for five to seven days. Cells were grown in either reinforced Clostridium
medium (RCM) supplemented with 5 % calf serum (ASF 360, ASF 361, ASF 356, ASF 502, and ASF 519) or schaedler broth supplemented with 5 % sheep serum (ASF 457, ASF 492, and ASF 500). Because many of these organisms are extremely oxygen sensitive (EOS), all inoculations were performed in a Coy anaerobic chamber. Culture flasks were sealed in anaerobic jars and then placed in an incubator. As above, the cells were harvested from broth by centrifugation, washed in PBS, and lyophilized.
Bacterial antigens (e.g., H. bilis and all eight ASF strains) used for ELISA or for stimulation of lymphocyte cultures were prepared from the lyophilized cells. Briefly, cells were weighed and resuspended in buffer or tissue culture medium to a final concentration of
2 mg/mL (dry weight to volume). The cell suspension was then placed on ice and sonicated for 5 minutes to prepare whole cell sonicates (WCS). Sonication was performed using 30 second pulses to prevent the suspension from overheating (i.e., denaturing of the proteins).
Cell disruption was monitored microscopically. Protein content was determined by BCA
(Pierce Laboratories). For the preparation of antigen for in vitro stimulation of lymphocytes, 73
the WCS were sterilized by UV light. Additionally, sterility was confirmed by bacteriological methods (e.g., aerobic and anaerobic blood agar cultures). These methods were used to prepare all antigens used for these studies. In order to ensure that all studies were performed with the same lot of antigens, each of the bacterial species to be used was grown during the first six months of the project to provide sufficient antigenic mass to complete these experiments.
Evaluation of Macroscopic Cecal Lesions
Macroscopic cecal lesions were scored using previous published criteria. [26] In brief, ceca were evaluated macroscopically for atrophy, edema, and increased mucus in the ingesta, given a gross lesion score (0-3: 0 = normal, 3 = severe cecal lesion), and placed in
10% neutral buffered formalin for histopathologic evaluation.
Histopathologic Evaluation of Murine Tissues
Sections of cecum and proximal colon were routinely processed, embedded in paraffin, and sectioned at 5pm for microscopic examination. Cecal and intestinal mucosa were stained with hematoxylin and eosin (H&E) for assessment of inflammation. Tissue sections were coded to blind the pathologist (JH) to the infection status of the animal. The cecum and proximal colon from each mouse were scored on severity of mucosal epithelial damage, architectural/glandular alterations, and magnitude/character of lamina propria cellular infiltrate (Table 2). 74
Table 2. Scoring System for Histopathological Evaluation of Gastrointestinal Inflammation
Parameters Scoring Criteria Ratio of crypt depth to width Mucosal height Rising score from 1 -5 (mild—severe hyperplasia) Lymphocytes/plasma cells are the expected population LP immune cells Mixed inflammation = increased neutrophils
Erosions Rising score from 1-5 (0 = no erosions;5 = ulceration Denotes quantity of cellular infiltrates in the LP Inflammatory score Rising score from 1-5 (normal severe inflammation with necrosis Rising score from 1-5(1 - mild edema;5 = severe edema wi'tfi- Edema score architectural distortion)
Other Submucosal lymphoid hyperplasia (present of absent)
Table 2. Scoring system used for the histopathological evaluation of gastrointestinal
inflammation. LP = lamina propria.
Analysis of Antigen-Specific Serum Antibodies
Serum antibody levels in mice were determined by ELISA as previously
described. [27] Briefly, 96-well plates were coated with sonicated whole cell lysates of each
of the eight anaerobic bacteria comprising the ASF and H. bilis. Diluted serum (1:200) was
added to each well and incubated at 4° C overnight. Then, alkaline phosphatase conjugated
goat anti-mouse IgGl or IgG2a was added and incubated for 1 hour at room temperature.
Wells were developed using p-nitrophenyl phosphate at room temperature. Color changes
were measured using an ELISA plate reader at 405 nm.
Immunohistochemical Analysis
Cecal tissue sections were placed in an enriched cryopreservative media (O.C.T.), snap frozen on dry ice, stored at -80° C, and later warmed to -20° C, sectioned at 6|im, and stained for identification of mucosal CD4+ and CD8+ T cells and B220 B+ cells. Endogenous 75
peroxidase was inhibited by incubating tissue in buffer containing 0.3% H2O2. Antibodies
used for section staining included: biotinylated rat anti-mouse CD4 (clone GK 1.5; l|ig/ml,
Becton Dickenson); biotinylated rat anti-mouse CD8a (clone 53-6.7; 1 p.g/ml, Southern
Biotechnology); and biotinylated rat anti-mouse CD45R (B220) (clone RA3-6B2; 1 fig/ml,
PharMingen). All monoclonal antibodies were diluted in 1% (vol/vol) PCS in PBS.
Streptavidin-HRP (1:2000) was added and the tissues incubated for 30 minutes at room temperature. A diaminobenzidine chromogen was used to visualize stained cells and sections were lightly counterstained with hematoxylin. Mucosal cell populations were enumerated using an ocular grid. Cells were quantified by a single investigator (ZL) evaluating 5-10 randomly selected and optimally-oriented microscopic fields (160x or 400x) per section.
Cytokine Analysis by Multiplexed Flow Cytometric Assay
Lymphocytes isolated from the spleen and mesenteric lymph nodes were incubated at 2.5 x 106 cells per ml with or without whole cell lysates of the ASF organisms and H. bilis for 72 hours. Cell cultures were treated with concanavalin A to evaluate the overall nature of the T cell response. Cell-free supernatants were harvested and analyzed for their concentration of Thl (TNF-a, IFN-y, IL-2, IL-12) and Th2 (IL-4, IL-10) cytokines using a multiplexed flow cytometric assay (The FlowMetric™ System, Luminex, Austin,
TX). Cytokine concentrations were measured using a murine cytokine detection kit (Mouse
Cytokine LINCOplex Kit, Linco Research, St. Charles, MO) specifically designed for use with the Luminex systems. 76
Statistical Methods
For immunohistochemical analysis, mucosal immune cell populations were expressed
as mean cells per microscopic field + standard error of the mean (SEM). Cells counts in the
2 murine groups (control versus H. 6//zs-infected) were then compared using a non-
parametric analysis. Serum antibody data were evaluated in two ways. First, the ratio of
absorbance recorded in H. 6z7z's-infected mice to absorbance recorded in non-infected
controls was determined at 3-, 6-, and 10-weeks PI. These antibody ratios were then
expressed as the mean ratio OD (absorbance) + standard deviation. Secondly, non-
parametric analysis was performed on the means and SEM of the pooled optical density
(absorbance) for all 8 ASF antigens at 3-, 6-, and 10 weeks PI. The IgG isotype responses to
H. bilis antigen were assessed using identical analyses as per the pooled ASF antibody responses.
For analysis of cytokine concentrations, the study design had 4 factors: organ (2 levels), cytokine (5 levels), organism (8 levels) and time (3 and 4 levels). Comparisons among levels of factors (e.g., spleen versus lymph node) were performed by testing the difference in proportions of median responses (e.g., determined as the ratio of antigen- specific cytokine concentration to background [no stimulation] concentration) that were at least 4 times background level. The normal approximation to the binomial distribution was assessed as valid and was used as the inferential procedure.[28] These were planned comparisons (rather than post-hoc), so that it was not necessary to adjust the P-values to control for type I error inflation.[29] A f-value of < 0.05 was considered statistically significant for all inferences. 77
Results
Colonization with H. bilis and ASF Bacteria
Mice inoculated with H. bilis became positive by fecal PCR 12-14 days post infection and remained so for the 10 week study period (Figure 1). Both Helicobacter genus and H. Mzs-specific primers consistently detected colonization. In some instances, culture of cecal contents at necropsy was also performed to confirm colonization with Helicobacter spp. Uninfected control animals remained Helicobacter fecal PCR and bacteriologically negative. Specific PCR products were reliably obtained by amplification of feces or cecal contents obtained at necropsy from defined flora mice using the ASF-specific primers in a multiplex format. Consistent with recent observations [25], detection of ASF member 360 from cecal contents of different mice at different time points was variable.
Figure 1. Photograph of an agarose gel depicting PCR analysis of murine fecal samples for the presence of H. bilis, C3H/HeNTac mice bearing a defined bacterial flora were colonized six weeks prior to sample collection with H. bilis. Fecal samples were collected and extracted using the QIAamp DNA Stool kit (Qiagen) to recover bacterial DNA. Using specific PCR primers for H. bilis, fecal samples from 11 separate mice were assayed for the presence of H. bilis. Sample 1, DNA from pure culture of H. bilis; Samples 2-10, fecal samples from gnotobiotic mice orally inoculated with H. bilis six weeks earlier; Samples 11-12, fecal samples from control gnotobiotic mice sham inoculated with sterile culture media. Outside lanes contain DNA size markers. 78
Clinical, Gross, and Histopathologic Findings Observed in H.6z7»-lnfected Defined
Flora Mice
Over the 10 weeks of the study, wasting disease and overt diarrhea were not observed
in H. bilis infected mice. Similarly, there was no significant weight change in H.bilis
infected mice as compared to non-infected controls (data not shown). Significant differences in cecal morphology subsequent to H. bilis colonization were not observed at necropsy; however, infected ceca were uniformly smaller with regional mesenteric lymphadenopathy frequently present in 6-and 10-week infected mice as compared to non-infected controls.
Microscopic changes of mild inflammation were observed in cecal tissue recovered from 3- and 6-week H. bilis infected mice. Histopathologic findings included increased cellular infiltrates, diffuse epithelial erosions, and submucosal edema. The cellular infiltrate in these specimens was confined to the lamina propria and consisted primarily of lymphocytes and plasma cells. While an increase in inflammation (e.g., increased mucosal cellularity, mucosal hyperplasia, submucosal edema, lymphoid hyperplasia [Figure 2]) and histology scores was noted for cecal tissues from 10-week infected mice, these changes were not significant. 79
4iJi® yiÊit ^ f T*& »f \. ^ j*,^v/'%
A. B. C.
Figure 2. Histological changes in the cecal mucosa of defined flora mice after infection with H. bilis. (A) Controls - no infection; (B) Mice infected with H. bilis for 6 weeks - mild typhlocolitis is evident and is characterized by the presence of submucosal edema, mild infiltration of the lamina propria (LP) with mononuclear cells and mild crypt hyperplasia; (C) Mice infected with H. bilis for 6 weeks - moderate typhlocolits as evidenced by marked mononuclear and neutrophilic infiltrates in the LP accompanied by moderate crypt hyperplasia. All images at 100X.
Antigen-Specific IgGl/IgG2a Antibody Responses Subsequent to H.bilis Colonization
Mis-infected gnotobiotic mice demonstrated diverse antigen-specific immune responses to their resident flora in comparison to non-infected mice (Figure 3A). Antibody responses developed quickly, persisted over the 10-week study, and they demonstrated a mixed Thl:Th2 phenotype. At all time points evaluated, pooled IgGl and IgG2a responses to ASF antigens were significantly (P<0.05) increased in infected mice as compared to non- infected controls (Figure 3B). Furthermore, the IgGl response to pooled ASF antigens at 6- weeks PI was significantly (P<0.05) increased as compared to the IgGl levels seen in 10- week infected mice. It is noteworthy that IgG responses to several ASF members including
ASF 457 (increased IgG2a at 10-weeks PI), ASF 500 (increased IgG2a at 10-weeks PI), ASF
502 (increased IgGl at 3-weeks PI), and ASF 519 (increased IgG2a at 10-weeks PI) were significantly (P<0.05) increased as compared to the antibody response to other ASF members. The IgGl and IgG2a responses to H.bilis were significantly (P<0.05) increased at 80
6-weeks PI when compared to antibody responses observed in mice 3- and 10-week PL
Serum collected from control DF mice did not demonstrate any antibody response to H. bilis
antigens (Figure 4) at any time point (data not shown).
IgGl
BASF 356 H ASF 360 3 weeks 6 weeks 10 weeks • ASF 361 PI PI PI • ASF 457 lgG2a • ASF 492 • ASF 500 • ASF 502 O O • ASF 519 O +-» ro cc
3 weeks 6 weeks 10 weeks PI PI PI
Figure 3A. Serum immunoglobulin responses from H. Mzs-infected defined flora (DF) mice and non-infected DF mice. Immunoglobulin isotypes (IgGl and IgG2a) to bacterial antigens of the altered schaedler flora (ASF) at 3-, 6,- and 10-weeks post-#, bilis infection are shown. H. bilis-infected DF mice produce a broad immunoglobulin response to numerous ASF antigens which generally peaks at 3 to 6 weeks post-infection. Numbers reflect means and standard deviations of the ratio of optical density (e.g., ratio OD calculated as the ratio absorbance in H. bilis-infected mice to absorbance in non-infected mice). Each mean value comprises triplicate wells of individual mouse serum from 4-8 mice per group averaged over 3 independent experiments. ASF 356 = Clostridium cluster XTV; ASF 360 = Lactobacillus acidophilus; ASF 361 = Lactobacillus animalis; ASF 457 = Flexistipes phylum; ASF 492 = Eubacterium plexicaudatum; ASF 500 = Low G + C-content spp.; ASF 502 = Clostridium cluster XIV; ASF 519 = Bacteroides distasonis. 81
IgGl £ 0.5 E g 0.4
euv 0.3 | 0.2 o £ 0.1 <
3 6 10 weeks weeks weeks H Control PI PI PI H H. bilis lgG2a "2 0.5 — lo 0.4
3 6 10 weeks weeks weeks PI PI PI
Figure 3B. Pooled serum immunoglobulin levels from H. bilis-infected defined flora (DF) mice and non-infected (control) DF mice. Serum immunoglobulin responses (IgGl and IgG2a) to bacterial antigens of the altered schaedler flora (ASF) at 3-, 6- and 10-weeks post ai. bilis infection were determined by ELISA as described in materials and methods. Numbers reflect the means and SEM of the pooled optical density (absorbance) for all 8 ASF antigens averaged over 3 independent experiments. * P<0.05 for H. bilis-infected mice versus control (non-infected) mice. f P<0.05 for H. bilis-infected mice at 6 weeks versus H. Mis-infected mice at 10 weeks. 82
IgG Isotype Response to H. bilis
2.4 2.1 1.8 1.5 1.2 0.9 0.6 0.3
3 weeks 6 weeks 10 weeks
Figure 4. Pooled serum IgG isotype responses from H. Mis-infected defined flora mice. Absorbance determined at 3-, 6-, and 10-weeks post-infection (PI) as described in materials and methods. Numbers reflect the means and SEM of the pooled optical density (absorbance) for H. bilis IgGl and IgG2a averaged over 3 independent experiments. * P<0.05 for IgGl at 6 weeks-PI versus 3- and 10-weeks PI. f P<0.05 for IgG2a at 6 weeks-PI versus 3- and 10-weeks PL
Alterations in Mucosal B and T Lymphocyte Populations in 11. Mzs-Infected Mice
Colonization of defined flora C3H mice with H. bilis was associated with altered mucosal populations of B and T lymphocytes. As compared to non-infected control mice, ocular morphometry revealed that CD4+ T cells were the most numerous mucosal immune cell within the lamina propria in infected mice followed by lesser numbers of CD8a+ T cells and B220 cells. For each cell type evaluated, there appeared to be a similar trend with mean cell numbers peaking at 3 weeks then declining towards the number of cells detected at time
0 (baseline) by week 10 (Figure 5). 83
CD4 T cells
weeks weeks weeks weeks
CD8 T cells
weeks weeks weeks weeks
weeks weeks weeks weeks
Figure 5. Alterations in mucosal T and B lymphocyte populations from H. bilis-infected defined flora (DF) mice (red bars) and non-infected DF mice (green bars). Mucosal cellularity of CD4+ T cells, CD8a+ T cells and B220 cells is increased at 3-, 6-, and 10-weeks post-infection in H. bilis-infected mice compared with non-infected DF mice. Two columns of data are shown. Left column - mean cells per microscopic field and standard deviations derived from pooled tissues of 6-8 mice per group. Right column - representative immunohistochemical staining of cecal tissues using monoclonal antibodies for CD4 (top), CD8a (middle), and B220 (bottom). *P<0.05 for H. bilis-infected versus non-infected for each cell type. 84
Antigen-Specific Cytokine Responses Obtained from Lymphocyte Cultures
Supernatants derived from antigen stimulated lymphocytes derived from H.bilis-
infected defined flora mice showed elevated levels (pg/ml) of IFN-y, TNF-a, IL-6, IL-10, and
IL-12 but marginally detectable levels of IL-2 and IL-4. Therefore, subsequent analysis of
IL-2 and IL-4 cytokines was not performed. Overall, more numerous and robust (at least
four-fold) responses to ASF members were observed from antigen-stimulated splenic
lymphocyte cultures (Table 3). In contrast, mesenteric lymph node supernatants produced
lesser quantities of each cytokine at all time points with the exception of IL-6. Evaluation of these immunologically compartmentalized responses demonstrated that the overall splenic response (e.g., concentration ratios for IFN-y, TNF-a, IL-6, and IL-10 at 3-, 6-, and 10-weeks post-infection and for IL-12 at 3- and 6-weeks post-infection) significantly (P<0.05) exceeded the cytokine response derived from mesenteric lymph node cultures (Table 4).
Significantly (P<0.05) greater overall cytokine responses were induced by stimulation with
ASF members 360, 500, 502, and 519 in comparison to responses of stimulated lymphocytes derived from the mesenteric lymph node. A comparison of individual cytokine responses between immune compartments showed that the concentration derived from splenic lymphocyte cultures for each cytokine was significantly (P<0.05) greater than the ratio produced by the same cytokine derived from mesenteric lymph node cultures (e.g., splenic
IFN- y > mesenteric lymph node IFN-y, etc.). 85
Reactive *ASF Bacteria Reactive *ASF Bacteria
IFN-Y !» 360 166457 l§2!: 500 562' 519 im. 360N 361 457 492 500 502 519 wo X X X X 3w-PI
6w-PI ' X X XX X X 10W-PI X X X X X 2 TNF-a wo X X 3w-PI X X X X X X X XXX X X 6w-Pl X X X X 1ÛW-PI X X X X IL-6 — X wo X X X X X X X 3w-PI X X X M X X X X 6w-PI X X X M X X X X X X X lOw-PI X X X X X IL-10 wo X 1c X 3w-PI X 6w-PI X X X X X X lOw-PI X X X X X . IL-12
WO X X 3W-PI X X X X X X X XXX X 6w-PI X X X X X X X lOw-PI _
Table 3. Increased concentrations of cytokines in mesenteric lymph node (MLN) and splenic (SPL) supernatants derived from altered schaedler flora (ASF) bacteria stimulated lymphocytes in H. bilis- infected defined flora (DF) mice and non-infected DF mice. Lymphocytes were cultured for 72 hours, then supernatants were harvested and surveyed via multiplexed flow cytometric assay. *Reactive ASF bacteria are denoted by an X, and comprise those bacterial members which evoked at least a four-fold increase in median cytokine concentration (determined as the ratio of antigen- specific cytokine concentration to background [no stimulation] concentration) subsequent to stimulation. Note the apparent compartmentalized responses between MLN and SPL cultures. ASF 356 = Clostridium cluster XIV; ASF 360 = Lactobacillus acidophilus; ASF 361 = Lactobacillus animalis; ASF 457 = Flexistipes phylum; ASF 492 = Eubacterium plexicaudatum; ASF 500 = Low G+ C-content spp.; ASF 502 = Clostridium cluster XIV; ASF 519 = Bacteroides distasonis. 86
Variable Analysis /•-value
Total cytokines3 SPL versus MLN 0.00001 IFN-y SPL versus MLN 0.0389 TNF-a SPL versus MLN 0.0199 IL-6 SPL versus MLN 0.0455 IL-10 SPL versus MLN 0.00001 IL-12" SPL versus MLN 0.0014 ASF 356 SPL versus MLN 0.5475 ASF 360 SPL versus MLN 0.0364 ASF 361 SPL versus MLN 0.6313 ASF 457 SPL versus MLN 0.6756 ASF 492 SPL versus MLN 0.0970 ASF 500 SPL versus MLN 0.0013 ASF 502 SPL versus MLN 0.0086 ASF 519 SPL versus MLN 0.0224
Table 4. Summary data of cytokine analysis in gnotobiotic mice. See methods section for explanation of statistical analyses performed. * Analyses reflect direct comparison of median cytokine concentrations derived from splenic (SPL) and mesenteric lymph node (MLN) cultures. For all comparisons, a f-value < 0.05 is considered statistically significant. ASF 356 = Clostridium cluster XIV; ASF 360 = Lactobacillus acidophilus; ASF 361 = Lactobacillus animalis\ ASF 457 = Flexistipes phylum; ASF 492 = Eubacterium plexicaudatum; ASF 500 = Low G+ C-content spp.; ASF 502 = Clostridium cluster XIV; ASF 519 = Bacteroides distasonis. a Comparison of all cytokines (e.g., IFN-y, TNF-a, IL-6, IL-10, and IL-12) across all time points (e.g., time 0, 3-, 6-, and 10-weeks post-#, bilis infection for all cytokines but IL-12 which was evaluated only at 0, 3-, and 6-weeks post-#, bilis infection). b Only supernatant samples at time 0, 3-, and 6-weeks post-#, bilis infection were available for analysis. 87
Discussion
Determining the relative contributions of host responses to enteric bacteria which
modulate intestinal inflammation is problematic due to the presence of a complex microbiota.
To assess which subsets of resident bacteria are most responsible for induction of
experimental gastrointestinal inflammation, gnotobiotic studies employing a defined flora
host colonized with a single (e.g., monoassociated) bacterium or combination of a limited
number of bacteria species have been performed. Reconstitution studies in gnotobiotic HLA-
B27 transgenic (TG) rats containing six different obligate and facultative intestinal anaerobic
bacteria, including Bacteroides vulgatus, develop much more active colitis and gastritis than
littermates colonized with the same selected bacteria without B. vulgatus. [ 11] Furthermore,
HLA-B27 TG rats colonized with SPF bacteria had more inflammation than gnotobiotic rats
colonized with the defined flora including B. vulgatus. In subsequent monoassociation studies, it has also been shown that B. vulgatus but not E. coli induced colitis of equal severity to that observed in gnotobiotic TG rats.[30] Helicobacter species may or may not be associated with gastrointestinal inflammation in different animal models depending upon the composition of the resident flora and host susceptibility. [ 17][22] [31 ][32] [33] [34][3 5] These accumulated results suggest that a subset of luminal bacteria (especially anaerobes) have differing abilities to contribute to the onset of colitis, that introduction of a novel bacterium perturbs the local microbial ecology thereby provoking host immune responses, and that this ecological and/or immunological perturbation provides the constant antigenic stimulus for immune-mediated colonic inflammation.
Other studies performed using a variety of experimental models have shown that the resident microflora plays an important role in the pathogenesis of 88
IBD.[5][6][7][36][37][38][39] In most of these models, Thl immune responses are directed
toward commensal intestinal bacteria and contribute to gut inflammation. Salient examples
of these phenomena include colitis which may be caused by the transfer of bacterial antigen-
specific CD4+ T cells from spontaneously colitic C3H/HeJ Bir mice [9]; the observation that
monoassociated IL-10" " mice develop antigen-specific immune responses to colitis-
producing bacteria (e.g., E. coli, Enterococcus faecalis) but not to bacteria incapable of
producing disease [40]; the finding that CD4+ T cells derived from C3H/HeJBir mice
demonstrate strong antibody (e.g., IgG2a) reactivity to certain antigens derived from the
resident enteric flora (e.g., Enterococcus spp. and Enterobacteriaceae) but not to epithelial
cells or to food antigens [41]; and observations by Onderdonk et al that show that high
concentrations of E. coli and Enterococcus species are associated with severe colitis in HLA-
B27 TG rats.[42] While it is clear that luminal bacteria have important but complex roles in initiating and sustaining intestinal inflammation, the contribution of antigen-specific host responses directed against resident flora in this process has not been critically evaluated.
We initially investigated host immune reactivity to the resident microflora in conventionalized C3H mice infected with the spirochete, Brachyspira hyodysenteriae.[26] [43] [44] Previous experiments have indicated that infected mice develop a polarized Thl response characterized by prominent IgG2a production, increased IFN-y secretion, and severe typhlocolitis (MJ Wannemuehler, unpublished data). The resident microflora is a important cofactor for disease development in this model as the use of antibiotic therapy to selectively deplete members of the microflora (e.g., gram-negative anaerobes) abolishes the ability of the spirochete to induce colitis.[45] In subsequent studies, we have confirmed the presence of Helicobacter spp. in inflamed ceca suggesting that these 89
bacteria potentially contribute to intestinal inflammation in infected mice. [46] To further
explore the pathogenesis of microbial-induced colitis, we infected gnotobiotic C3H mice
(harboring an ASF flora) with H. bilis and evaluated antigen-specific immune responses to
the resident flora. We found that the introduction of H. bilis into defined flora mice evoked
diverse host responses to commensal ASF members and that this perturbation may "trigger"
the development of colitis.
Helicobacter spp. have been incriminated as provocateurs of microbial-induced
colitis in a number of animal models. In separate experiments, H. hepaticus induced chronic
colitis in SPF-reared IL-10"7" mice [21] and caused significant mucosal inflammation in the
cecum and colon of TCR-aP mutant mice.[15] Burich et al observed that both H. bilis and H.
hepaticus may cause histologic lesions of EBD of varying severity in genetically susceptible
hosts.[22] The monoassociation of SCID mice with H. muridarum provokes the
development of IBD; however, these mice did not develop wasting disease or colitis. [19]
Still other models suggest a less pathogenic role for Helicobacter spp. and have shown that
Helicobacter does not induce IBD in germ-free IL-10"7" mice [20] or potentiate IBD in germfree IL-10"7" mice reconstituted with a SPF flora.[7] Also, H. hepaticus infection delays the development of EBD in mdrla"7" mice. [47] We and others [22] suggest that the contrasting observations from some studies are due to variability in genetic susceptibility to
IBD and to different compositions of intestinal flora in these animal models. The use of an immunocompetent gnotobiotic mouse which harbors a defined flora with a limited number of bacterial species (which are stable from mouse to mouse), such as the model used in the present study, represents a unique opportunity for evaluating the specificity of the resident flora in the initiation of intestinal inflammation.[25] Additionally, evaluation of host 90
responses in mice having a functionally normal immune system is more realistic to the
human condition, where IBD predominantly effects immunologically-competent patients.
Defined flora mice infected with H. bilis developed only mild, histologically-evident
typhlocolits after chronic colonization. Significant wasting disease with watery diarrhea was
not observed; however, many mice were noted to have pasty, mucoid feces at necropsy.
Gross lesions of cecal involution and mesenteric lymphadenopathy were common in 6- and
10-week infected mice in comparison to non-infected gnotobiotic mice. Histologic lesions of
mild typhlocolitis were characterized by increased mucosal infiltrates, submucosal edema,
and increased inflammatory scores which worsened over time. Additionally, both the quantity and character of the lamina proprial infiltrate changed (e.g., from a mononuclear cell
infiltrate to that containing increased neurtrophils) in tissues evaluated from 10-week H.
Mz's-infected mice. Our findings of mild colitis in mice colonized with H. bilis have been reported by others using Raglv" mice, that lack both B and T lymphocytes.[22]
An unexpected finding in this study was the balanced Thl :Th2 profile of host immune responses following colonization with H. bilis. In most instances, these responses were persistant with regards to cytokine production and exhibited distinct patterns of compartmentalization between the spleen and mesenteric lymph node. Gnotobiotic mice infected with H. bilis developed a dominant serum IgG2a antibody response at 6 weeks PI
(e.g., Thl profile) as previously observed in other animal models infected with Helicobacter spp.[21][48][49][50] Antibody responses to ASF members for both immunoglobulin isotypes followed a similar pattern of peaking at 6 weeks post-infection. The observed IgGl
(e.g., Th2-like) response to select ASF bacteria following H. bilis colonization was unexpected. Our hypothesis for this observation is that this Th2 immune bias develops 91
following the introduction of H. bilis into the gut because this alters or perturbs the local microbial ecology, thereby influencing the immunological response of the host to non pathogenic luminal bacteria.
We observed disturbances in local immunity (e.g., alterations in mucosal B and T lymphocyte populations) of H.bilis-infected mice that broadly correlated with peak antibody responses. Immunohistochemical studies performed on cecal tissues of H. bilis-infected mice showed increases in CD4+ T cells, CD8+ T cells, and B220+ cells which then decreased to baseline values by week 10 of infection. The phenotype (e.g., helper or regulatory T cell) and antigen specificity of the infiltrating CD4+ T cells was not determined; however, it is tempting to speculate that the increase was in response to conventional antigens of the bacterial flora as reported by others.[9][51]
Up-regulation of Thl cytokines like IFN- y and TNF-a has been noted in other bacterial models of IBD [52] and has been reported to characterize Helicobacter-mâuced disease.[21] [22] [49] Thus, it was not surprising to observe increases in these cytokines along with IL-6 in lymphocyte supernatants following antigenic stimulation. It was noteworthy that increased production of IL-12 was observed in lymphocyte cultures from both the lymph nodes and spleens recovered from mice colonized with H. bilis. The production of IL-12 from macrophages or dendritic cells may occur in response to diverse stimuli including live bacteria, bacterial products such as LPS and lipotechoic acid, and/or prokaryotic
DNA.[53][54][55][56] The results of this study suggest that resident luminal bacterial products may also stimulate IL-12 production. IL-12 induced by stimulation with microbial products has been associated with the development of autoimmune disease [39] and loss of tolerance to resident luminal bacteria in experimental colitis.[57] It is also possible that 92
increased IL-12 production caused excess production of pro-inflammatory IFN-y, thereby,
altering gut epithelial barrier integrity. While this contention would be histologically
supported by the presence of overt inflammation, one explanation for the lack of mucosal
inflammation in this model is that lesion severity was attenuated by the increased production
of IL-10. Animal studies have shown that IL-10 may modulate inflammatory responses in
IBD, presumably through regulatory T cell activity.[57][58] In contrast, Maggio-Price et al
have shown that severe IBD may occur in conjunction with increased colonic IL-10 in
mdrlai1' mice infected with H. hepaticus, and that delayed development of IBD is not
necessarily accompanied by increased production of IL-10 in these same mice.[47] Future
studies will more specifically address the role of IL-10 in modulation of typhlocolitis in H.
Mzs-infected gnotobiotic mice.
The up-regulated antigen-specific cytokine responses observed from splenic cultures
demonstrate that compartmentalized host responses to the resident bacteria occur subsequent
to H. bilis colonization. Furthermore, these data suggest that different members or subpopulations of resident bacteria have the potential to initiate host immune responses and contribute to the onset of colitis. Mechanisms by which H. bilis colonization evokes host immune responses in these mice are not fully known. As semi-quantitative PCR confirmed the presence of all ASF bacteria on necropsy, alterations in commensal members following
H. bilis colonization seem unlikely. It is possible that quantitative differences in bacterial numbers or their location within the gut (e.g., luminal versus adherent - not measured in this study) following H. bilis infection might have influenced the intensity of immune responses to the individual ASF members.[7] Additionally, Helicobacter spp. may initiate the development of intestinal inflammation through diverse mechanisms including the 93
elaboration of specific toxins (e.g., cytolethal distending toxins) [59], IFN-y -mediated
compromise of intestinal epithelial barrier function [47] [60], the recruitment of commensal-
specific CD4+ T cells to the colonic lamina propria [9], LPS-mediated activation of toll-like
receptors found on dendritic cells and macrophages which trigger the innate immune system
[22], and/or altered epithelial cell gene expression. Whether some or all of these mechanisms
are responsible for the initiation of intestinal inflammation in immunocompetent C3H mice
bearing a defined flora mice following colonization with H. bilis remains to be determined.
These results indicate (suggest) that perturbation of the microbial ecology, following
the introduction of a novel bacterial species such as H. bilis, may predispose or set the stage
for the development of colitis in gnotobiotic mice. It would appear that normal luminal
bacteria play an important role in the initiation of host immune responses, that these
responses are of mixed Thl :Th2 phenotype, that these responses are compartmentalized in
their magnitude, and that further studies are warranted. Lastly, some commensal bacteria may exert a more dominant role than others in the induction of colitis, particularly in a setting where natural tolerance to the introduced bacterium does not exist. [22] 94
References
1. Hooper LV, Wong MH, Thelin A, et al. Molecular analysis of commensal host- microbial relationships in the intestine. Science 2001; 291:881-884.
2. Simon GL, Gorbach SL. Intestinal flora in health and disease. Gastroenterology 1984; 86:174-193.
3. Berg RD. The indiginous gastrointestinal microflora. Trends Microbiol 1996; 4:430- 435.
4. Midtvedt T. Microbial functional activities. In: Hanson LA, Yolken RH eds. Intestinal Microflora, Nestle Nutrition Workshop Series, Philadelphia, Lippincott - Raven, 1999, pp.79-96.
5. Sadlack B, Marz H, Schorle H, et al. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 1993; 75:253-261.
6. Kuhn R, Olhler J, Rennick D, et al. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 1993; 75:263-274.
7. Sellon RK, Tonkonogy S, Schultz M, et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10- deficient mice. Infect Immun 1998; 66:5224-5231.
8. Aranda R, Sydora BC, McAllister PL, et al. Analysis of intestinal lymphocytes in mouse colitis mediated by transfer of CD4+, CD45 RBh,gh T-cells to SCID recipients. J Immunol 1997; 158:3464-3473.
9. Cong Y, Brandwein SL, McCabe RP, et al. CD4+ T-cells reactive to enteric bacterial antigens in spontaneously colitic C3H-HeJBir mice: increased T-helper cell-type 1 response and ability to transfer disease. J Exp Med 1998; 187:855-864.
10. Veltkamp C, Tonkonogy SL, De Jong YP, et al. Continuous stimulation by normal luminal bacteria is essential for the development and perpetuation of colitis in Tg (Epsilon 26) mice. Gastroenterology 2001; 120:900-913.
11. Rath HC, Herfarth HH, Ikeda JS, et al. Normal luminal bacteria, especially Bacteroides species, mediate chronic colitis, gastritis and arthritis in HLA- B27/human beta2 microglobulin transgenic rats. J Clin Invest 1996; 98:945-953.
12. Onderdonk AB, Franklin ML, Cisneros RL. Production of experimental ulcerative colitis in gnotobiotic Guinea Pigs with simplified microflora. Infect Immunol 1981; 32:225-231. 95
13. Rath HC, Schultz M, Grenther WB, et al. Colitis, gastritis and antibacterial lymphocyte responses in HLA-B27 transgenic rats monoassociated with Bactericides vulgatus ox Escherichia coli. Gastroenterology 1997; 112:A1068.
14. Cahill RJ, Foltz CJ, Fox JG, et al. Inflammatory bowel disease: An immunity- mediated condition triggered by bacterial infection with Helicobacter hepaticus. Infect Immun 1997; 65:3126-3131.
15. Chin EY, Dangler CA, Fox JG, et al. Helicobacter hepaticus infection triggers inflammatory bowel disease in T-cell receptor-a|3 mutant mice. Comp Med 2000; 50:586-594.
16. Fox JG, Yan L, Shames B, et al. Persistent hepatitis and enterocolitis in germ-free mice infected with Helicobacter hepaticus. Infect Immun 1996; 64:3673-3681.
17. Franklin CL, Riley LK, Livingston RS, et al. Enterohepatic lesions in SCID mice infected with Helicobacter bilis. Lab Anim Sci 1998; 48:334-339.
18. Shomer NH, Dangler CA, Schrenzel MD, et al. Helicobacter Mz's-induced inflammatory bowel disease in SCID mice with defined flora. Infect Immun 1997; 65:4858-4864.
19. Jiang Han-Quing, Kushnir Natasha, Thurnheer MC, et al. Monoassociation of SCID mice with Helicobacter muridarum, but not for other enterics, provokes IBD upon receipt of T-cells. Gastroenterology 2002; 122:1346-1354.
20. Dieleman LA, Arends A, Tonkonogy SL, et al. Helicobacter hepaticus does not induce or potentiate colitis in interleukin-10-deficient mice. Infect Immun 2000; 68:5107-5113.
21. Kullberg MC, Ward JM, Gorelick PL, et al. Helicobacter hepaticus triggers colitis in specific pathogen-free interleukin-10 (IL-lO)-deficient mice through an IL-12-and y interferon-dependent mechanisms. Infect Immun 1998; 66:5157-5166.
22. Burich A, Hershberg R, Waggie K, et al. Helicobacter-induced inflammatory bowel disease in IL-10- and T-cell-deficient mice. Am J Physiol Gastrointest Liver Physiol 2001; 281:G764-G778.
23. Riley LK, Franklin CL, Hook RR, et al. Identification of murine Helicobacter by PCR and restriction enzyme analyses. J Clin Microbiol 1996; 34:942-946.
24. Fox JG, Yan LL, Dewhirst FE, et al. Helicobacter bilis sp. Nov., a novel Helicobacter species isolated from bile, livers, and intestines of aged inbred mice. J Clin Microbiol 1995; 33:445-454. 96
25. Sarma-Rupavtarm RB, Ge Z, Schauer DB, et al. Spacial distribution and stability of the eight microbial species of the altered schaedler flora in the mouse gastrointestinal tract. Appl Environ Microbiol 2004; 70:2791-2800.
26. Nibbelink SK, Wannemuehler MJ. An enhanced murine model for studies of Serpulina (Treponema) hyodysenteriae pathogenesis. Infect Immun 1992; 60:3433- 3436.
27. Sacco RE, Jensen RJ, Thoen CO, et al. Cytokine secretion and adhesion molecule expression by granuloma T-lymphocytes in Mycobacterium avium infection. Am J Pathol 1996; 148:1935-1948.
28. Moore DS, McCabe GP. Introduction to the Practice of Statistics; WH Freeman and Co., 1989; p 399.
29. Ramsey FL, Schafer DW. The Statistical Sleuth. A Course in Methods of Data Analysis, 2nd edition, 2002; p 160.
30. Rath HC, Wilson KH, Sartor RB. Differential induction of gastritis and colitis in HLA-B27 transgenic rats selectively colonized with Bacteroides vulgatus or Escherichia coli. Infect Immun 1999; 67:2969-2974.
31. Fox JG, Gorelick PL, Kullberg MC, et al. A novel urease-negative Helicobacter species associated with colitis and typhlitis in IL-10-deficient mice. Infect Immun 1999; 67:1757-1762.
32. Franklin CL, Riley LK, Livingston RS, et al. Enteric lesions in SCID mice infected with "Helicobacter typhlonicusa novel urease-negative Helicobacter species. Lab Anim Sci 1999; 49:496-505.
33. Li X, Fox JG, Whary MT, et al. SCID/NCr mice naturally infected with Helicobacter hepaticus develop progressive hepatitis, proliferative typhlitis, and colitis. Infect Immun 1998; 66:5477-5484.
34. Ward JM, Anver MR, Haines DC, et al. Chronic active hepatitis in mice caused by Helicobacter hepaticus. Am J Pathol 1994; 145:959-968.
35. Ward JM, Anver MR, Haines DC, et al. Inflammtory large bowel disease in imunodeficient mice naturally infected with Helicobacter hepaticus. Lab Anim Sci 1996; 46:15-20.
36. Duchmann R, Kaiser I, Hermann E, et al. Tolerance exists towards resident intestinal flora, but is broken in active inflammatory bowel disease (IBD). Clin Exp Immunol 1995; 102:448-455. 97
37. Panwala CM, Jones JC, Viney JL. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdrla, spontaneously develop colitis. J Immunol 1998; 161:5733-5744.
38. Fiocchi C. Inflammatory bowel disease: Etiology and pathogenesis. Gastroenterology 1998; 115:182-205.
39. Sartor RB. Review article: Role of the enteric microflora in the pathogenesis of intestinal inflammation and arthritis. Aliment Pharmacol Ther 1997; 11 :Supp 3:17- 23.
40. Kim SC, Tonkongy SL, Albright CA, et al. Regional and host specificity of colitis in mice monoassociated with different non-pathogenic bacteria. Gastroenterology 2003; 124:789.
41. Brandwein SL, McCabe RP, Kong Y, et al. Spontaneously colitic C3H/HeJ Bir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol 1997; 159:44-52.
42. Onderdonk AB, Richardson JA, Hammer RE, et al. Correlation of cecal microflora of HLA-B27 transgenic rats with inflammatory bowel disease. Infect Immun 1998; 66:6022-6023.
43. Hutto DL, Galvin JE, Wannemuehler MJ. Morphologic and temporal characterization of lesions in an enhanced murine model of Serpulina hyodysenteriae infection. J Med Microbiol 1998; 47:275-280.
44. Nibbelink SK, Wannemuehler MJ. Susceptibility of inbred mouse strains to infection with Serpulina (Treponema) hyodysenteriae. Infect Immun 1991; 59:3111-3118.
45. Nibbelink SK. 1989. MS Thesis. Iowa State University, Ames, pp 105-115.
46. Jergens AE, Dom A, Hutto D, et al. Induction of Th2-like immune responses by C3H mice bearing a defined flora following onset of colitis. Gastroenterology, 2002; 16:249.
47. Maggio Price L, Shows D, Waggie K, et al. Helicobacter bilis infection accelerates and H. hepaticus infection delays the development of colitis in multiple-drug resistance-deficient (mdrla-/-) mice. Am J Pathol 2002; 160:739-751.
48. Shomer NH, Dangler CA, Schrenzel MD, et al. Cholangiohepatitis and inflammatory bowel disease induced by a novel urease-negative Helicobacter species in A/J and Tac:ICR:Hascz'
49. Whary MT, Morgan TJ, Dangler CA, et al. Chronic active hepatitis-induced by Helicobacter hepaticus in the A/JCr mouse is associated with a Thl cell-mediated immune response. Infect Immunol 1998; 66:3142-3148.
50. Mohammadi M, Czinn S, Redline R, et al. Helicobacter specific cell-mediated immune responses display a predominant Thl phenotype and promote a delayed-type hypersensitive response to the stomachs of mice. J Immunol 1996; 156:4729-4738.
51. Dieleman LA, Hoentjen F, Quian BF, et al. Reduced ratio of protective versus proinflammatory cytokine responses to commensal bacteria in HLA-B27 transgenic rats. Clin Exp Immunol 2004; 136:30-39.
52. Higgins LM, Frankel G, Douce G, et al. Citrobacter rodentium infection in mice elicits a mucosal Thl cytokine response and lesions similar to those in murine inflammatory bowel disease. Infect Immun 1999; 67:3031-3039.
53. Cella M, Scheidegger D, Plamer-Lehmann K, et al. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T-cell stimulatory capacity: T-T help via APC activation. J Exp Med 1996; 184:747-752.
54. Halpern MD, Kurlander RJ, Pisetsky DS. Bacterial DNA induced murine interferon-y production by stimulation of interleukin-12 and tumor necrosis factor-a. Cell Immunol 1996; 167:72-78.
55. Miller MA, Skeen MJ, Ziegler HK. Non-viable bacterial antigens administered with IL-12 generate antigen-specific T-cell responses and protective immunity against Listeria monocytogenes. J Immunol 1995; 155:4817-4828.
56. Skeen MJ, Ziegler HK. Activation of yôT-cells for production of IFN-y is mediated by bacteria via macrophage-derived cytokines IL-1 and IL-12. J Immunol 1995; 155:5832-5841.
57. Duchmann R, Schmitt E, Knolle P, et al. Tolerance toward resident intestinal flora in mice is abrogated in experimental colitis and restored by treatment with interleukin- 10 or antibodies to interleukin-12. Eur J Immunol 1996; 26:934-938.
58. Asseman C, Mauze S, Leach MW, et al. An essential role for interleukin-10 in the function of regulatory T-cells that inhibit intestinal inflammation. J Exp Med 1999; 190:995-1004.
59. Young VB, Chien CC, Knox KA, et al. Cytolethal distending toxin in avian and human isolates of Helicobacter pullorum. J Infect Dis 2000; 182:620-623.
60. Oshima T, Laroux FS, Coe LL, et al. Interferon-y and interleukin-10 reciprocally regulate endothelial junction integrity and barrier function. Microvasc Res 2001; 99
61:130-143. 100
CHAPTER 4. GENERAL CONCLUSIONS
To better understand how bacteria "trigger" intestinal inflammation in a susceptible host, we have developed a novel mouse model of bacterial-induced colitis.
In a series of subsequent experiments, we used this model to investigate host-microbial interactions contributing to the development of typhlocolitis in gnotobiotic mice. This model would appear to have several advantages over other models of intestinal inflammation including: (a) the initiating etiologic agent (B. hyodysenteriae) is known; (b) mice having a defined flora with a limited number of bacterial species (which are consistent from mouse to mouse) is needed to develop gut inflammation; (c) this model provides reproducible typhlocolitis quickly and consistently allowing chronological studies of both acute and chronic inflammation to be performed; and (d) immunocompetent mice are used to assess the host's immune response following onset of colitis.
While immune responses of the gnotobiotic mice of in our preliminary studies were of mixed Thl/Th2 phenotype, the original pilot data (e.g., experiment 1 in the dual- infection study [paper 2]) did not establish whether these responses were persistent over time or the nature of the microbial populations associated with them. The H. bilis temporal studies (paper 1) did address the kinetics of the host immune responses to the ASF bacteria over time in a systematic fashion. These additional experiments revealed that host responses persist ad a mixed Thl :Th2 expression over the 10-week study period, that these responses are compartmentalized (e.g., spleen versus mesenteric lymph node) in their magnitude, and that some commensal bacteria may exert a more dominant role than others in the induction of host responses modulating the development of colitis. These accumulated data clearly indicate that future studies evaluating host responses following introduction of a novel 101
bacterium in defined flora mice are warranted. In particular, we would like to more critically
evaluate sub-populations of the ASF and the relative contributions they make with regards to
generation of host immune responses.
FUTURE STUDIES OVER THE NEXT 2 YEARS
Specific Aim. Evaluate the characteristics of the resident flora that are critical in eliciting
immune responses in experimental colitis.
Rationale: These proposed experiments will examine host-microbial interactions which test
the hypothesis that specific resident bacteria are important in triggering immune
responses. Based on our preliminary data, we have noted that select ASF bacteria in
gnotobiotic mice tend to be more or less immunogenic as previously measured. However,
which critical "mix" of flora is most important at evoking immune responsiveness has not
been demonstrated. Selective bacterial reconstitution studies in germfree mice will be
performed to evaluate the resultant immune response. Characterization of the identity and
location of ASF bacteria contributing to antigen-specific immunity will be performed by
fluorescent in situ hybridization (FISH).
Experimental Design
Derivation of germ free mouse groups.
Three to six week old germfree (GF) C3H mice will be obtained from Taconic
Farms. Foundation stock for this strain is cesarean-derived with expansion stock maintained under germfree conditions. All mice will be certified free of bacterial species, including
Helicobacter spp., by the vendor and retested on site before each experiment. Animals will 102
be strictly housed in a germfree environment in gnotobiotic isolators while at our facility.
The GF mice will be assigned to one of 4 treatment groups based on H. bilis and B.
hyodysenteriae infection status: Group 1 (control) - entirely GF with no bacterial infection;
Group 2 - infected with B. hyodysenteriae alone; Group 3 - infected with H. bilis alone;
Group 4 - infected with H. bilis and B. hyodysenteriae. Following bacterial reconstitution
experiments (described below), representative control and experimental mice will be
euthanized on day 75 PI and samples will be taken for gross cecal morphology,
histopathology, immunohistochemistry, bacteriology, serum antibody levels, B cell
ELISPOT, and levels of cytokines.
Bacterial reconstitution studies.
The 8 ASF species will be equally divided into 2 types of organisms based on
their ability to evoke antigen-specific immune responses as measured in our preliminary
studies. Type A organisms will consist of those defined flora bacteria which were generally
observed to be more immunogenic - ASF members 356, 361,457, and 492. Type B
organisms will consist of those defined flora bacteria which were generally observed to be less immunogenic - ASF members 360,500,502 and 519. Earlier work has established the need to introduce a Lactobacillus spp. (e.g., ASF 360 or 361) first, to facilitate colonization
by other more oxygen-sensitive ASF members. Presumably, these Lactobacilli lower the
luminal redox potential favoring growth conditions for EOS bacterial species. The 4 GF murine groups will then be colonized by both Type A and Type B defined bacterial species in separate experiments. We will next compare the effects of Type A (more immunogenic) bacteria and Type B (less immunogenic) bacteria on induction of Thl and Th2 immune responses in individual gnotobiotic groups. 103
Establishment of H. bilis and B. hyodysenteriae infections in GF mice.
The establishment of H. bilis and B. hyodysenteriae infections in GF mice will be performed as previously described. Dual infected GF mice will be first orally infected with
H. bilis, followed 21 days later by oral administration with 2 x 108 B. hyodysenteriae organisms.
Assessment of immunopathoiogic parameters.
Following euthanasia, samples will be taken for assessment of gross cecal lesions, histopathology, immunohistochemistry, bacteriology, analysis of antigen-specific serum antibodies, B cell ELISPOT, and cytokine analysis. These results will be compared between
Type A and Type B ASF members, with Type A members predicted to elicit greater Th2 immune responses, especially in dual infected GF mice.
Identification of ASF species using a fluorescent in situ hybridization technique.
Although previous data indicate that immune responses to select ASF members occur, confirmation of their mucosal location (e.g. intraluminal versus attaching) has not been performed. Furthermore, immune responses may be influenced by relative concentrations of select ASF. Fluorescent in situ hybridization (FISH) with probes targeting each ASF member will be used to quantitatively detect the presence and location of these bacteria. A limited number of probes are available targeting gut-associated bacteria.
Prospective FISH probes will be validated experimentally for each bacterium in the ASF. If necessary, additional probes targeting 16S rRNA will be designed using Vector NTI software package (InfoMax, Bethesda, MD) with GenBank and RDP databases. Specificity of probes will be determined experimentally. Tissues will be formaldehyde-fixed at time of necropsy 104
and stored at -20°C until hybridized. One to three probes, with different fluorescent labels,
will be hybridized to a sample in a single operation following standard FISH protocols.
Hybridized samples will be visualized and images captured using a fluorescence microscope
fitted with a digital camera and imaging software. These studies will be performed under the
guidance of Dr. Cherie Ziemer's laboratory at the USDA.
Anticipated Results
It is our intent to use these gnotobiotic GF mice colonized with a subset of the
ASF organisms to identify which collection of ASF bacteria is most important in driving host
immune responses. It is our expectation that infection of GF mice with Type B ASF bacteria
(e.g., less immunogenic species) will evoke less immunologic responses as compared to
Type A ASF bacteria which tend to be more immunogenic. Based on our previous data, we surmise that immune responses to ASF bacteria following H. bilis infection will be predominantly Th2-like, while immune responses to ASF bacteria following B. hyodysenteriae infection will be characteristically Thl-like. Thus, GF mice infected with H. bilis should have no gross and histologic lesions, similar to non-infected GF controls. In contrast, GF mice infected with B. hyodysenteriae will have significant mucosal inflammation as a consequence of Thl-mediated responses to their ASF bacteria. Lastly, dual-infected GF mice should have intestinal inflammation of intermediate severity between these two extremes as Th2 responses elicited by the presence of H. bilis with the ASF flora modulate (down-regulate) the Thl-driven immunity to B. hyodysenteriae. 105
Potential Difficulties, Limitations, and Alternative Approaches
Arguably, the optimal time point for evaluation of C3H GF mice has not been
established. The choice of PI day 75 for necropsy is arbitrarily based on very limited pilot
studies in GF BALB/c mice which failed to demonstrate consistent intestinal lesions until 60-
70 days following B. hyodysenteriae infection. It is quite possible that our expected results
may vary since we will be evaluating the gnotobiotic mice later in disease progression and
we will be evaluating subsets of the ASF bacteria rather than the total ASF flora. It is also
possible that some of the ASF organisms may not induce detectable immune responses
regardless of the time that evaluation occurs.
There are also some potential pitfalls regarding FISH analysis of the flora.
Preparation of gut wall samples will require some adaptation of other established procedures.
Only 2 of the ASF strains have been typed as species which may require some 16S rDNA
sequencing to determine where they fall prior to application or design of probes. This may
need to be done for all ASF members in order to confirm 16S rDNA phylogeny for correctly
determining target sequences (even for using available probes but especially for designing
probes). If the Clostridium and Lactobacillus strains are too closely related it may be
difficult or even impossible to develop probes specific enough to differentiate among them.
FUTURE STUDIES ANTICIPATED OVER THE NEXT 3-5 YEARS
Experiments during this time frame will be in line with the long term goals of our
laboratory and will evolve, to some degree, on results generated from the germ-free mouse
studies. We have previously shown that the introduction of H. bilis into gnotobiotic mice which are subsequently co-infected with B. hyodysenteriae alters host immune responses to 106
bacterial antigens modulating the severity of colitis. This response might be mediated
through bacterial-epithelial cell interactions which in turn produce cytokines, chemokines,
and other mediators which induce activation of the mucosal immune system. Several recent
reports have demonstrated altered epithelial gene products involved in mucosal defense and
inflammation associated with ubiquitous enteric bacteria. We hypothesize that Type A and
Type B ASF bacteria will differ in their ability to modulate colitis in gnotobiotic mice, and
that these differences will be associated with induction of different epithelial gene products
which may be detected using microarray analysis and/or real time PGR. These procedures will be performed on intestinal specimens previously obtained from each group of gnotobiotic mice archived during completion of the germ-free studies. Gene expression in gnotobiotic mice will also be compared to that observed in conventional mice. This novel approach will allow the identification of known, and perhaps novel, gene products involved in mucosal defense against luminal microorganisms and their associated inflammatory response.
Mechanisms by which immune responses to the enteric microflora are controlled so that chronic inflammation does not occur in the gut have recently been demonstrated. Of interest, IL-10 deficient but not wild-type (WT) mice develop colitis after infection with
Helicobacter hepaticus. Using a modification of the CD4/SCIDIBD model, investigators induced colitis in H. hepaticus-infected recombination activation gene (RAG) knockout (KO) mice by the transfer of CD4+ T cells from infected, colitic, IL-10 KO mice. They subsequently analyzed the disease protective effects of the co-transfer of various CD4+ populations from WT mice. Results indicate that H. hepaticus infection induces a distinct population in WT mice of regulatory CD4+CD25+ T cells which prevent bacterial-induced 107
colitis. The contribution of responses induced by antigens derived from the normal flora
were not examined. These data were determined in mice colonized with a conventional,
complex flora and whose immune responses were evaluated shortly after H. hepaticus
infection.
We propose to further investigate the interaction between H. bilis and the normal
flora in the development of a regulatory T (Treg) cell response by studying changes in the
responses of the Treg cells recovered from the mucosa and MLN. It is unknown whether or
not the Treg cell response persists over time. For these studies, gnotobiotic mice will be
infected with H. bilis and the cecal mucosa and MLN will be collected at various times after colonization. The CD45RBlow population of CD4+ T cells will be collected and stimulated
+ low with antigens from H. bilis or antigens of the ASF organisms. The CD4 CD45RB Treg cells will be enriched using magnetic bead separation (for CD4) and cell sorting (for the
CD45RBl0W population) using a flow cytometer. The recovered cells will be stimulated in vitro with specific antigens in the presence of IL-2 and culture supematants will be analyzed for the production of IL-10 and/or TGF-J3. These data will indicate whether Treg cells are responsive to H. bilis antigens as well as to antigens derived from the normal flora. In addition, evaluating this response at several time points will provide evidence as to when this response in maximal and whether the response is differentially induced by antigens from the various members of defined flora. 108
ACKNOWLEDGEMENTS
What a voyage.. .with still some yet to come. Clearly I would like to thank Dr. Mike
Wannemuehler and the personnel in the Mucosal Immunology Laboratory most prominently.
Mike has been a great mentor. He's given me latitude to do my own work - always offering suggestions but not micro-managing - and never making me feel stupid although I truly have done some stupid things in the lab. Without your encouragement, expertise, and persistence to strive for excellence... .we would not have been successful on our NIH grant. Also, thanks
Mike for being so forgiving of my brutal clinic schedule which surely got in the way of experiments and data analysis. Thanks also to Jenny Wilson and Andrea Dorn (both of you for everything), Abby Henderson for Luminex expertise, Zhiping Liu for histologic staining and morphometric analysis, Krystal Johnson for DNA/RNA work, and Jesse Hostetter for the excellent interpretation/photography of cecal mucosal pathology specimens. Without this combined assistance and expertise of these valuable faculty, staff, students, and graduate students, the completion of this dissertation would not be possible. Special thanks also to
Mike Conzemius for his comradery in my home department ofVCS and for his desire to be the best. My wife, Dr. Kristina Miles, is simply wonderful - thanks for all of your love and support and for taking on additional responsibilities, with our son Travis, so I could work in the lab.
Lastly, I'd like to thank my POS Committee for your critical and constructive comments on the NIH grant made to Dr. Wannemuehler and I during my preliminary examination. Your points were well taken and clearly resulted in the formulation of a more focused and competitive research proposal. Thanks too to Sandy Popelka for all of her typing/formatting expertise in the construction of this dissertation.