Balance Between Short and Long Isoforms of Cflip Regulates Fas-Mediated Apoptosis in Vivo

Balance between short and long isoforms of cFLIP regulates Fas-mediated apoptosis in vivo

Daniel R. Rama, Vladimir Ilyukhab, Tatyana Volkovab, Anton Buzdinc,d, Albert Taie, Irina Smirnovae, and Alexander Poltoraka,b,e,1

aProgram in Immunology, Sackler Graduate School, Tufts University, Boston, MA 02111; bInstitute of High-Tech Biomedicine, Petrozavodsk State University, Petrozavodsk, Republic of Karelia, 117198 Russia; cLaboratory of Bioinformatics, D. Rogachyov Federal Research Center for Pediatrics Hematology, Oncology and Immunology, Moscow, 117198 Russia; dCentre for Convergence of Nano-, Bio-, Information and Cognitive Sciences and Technologies, National Research Centre “Kurchatov Institute,” Moscow, 123182 Russia; and eDepartment of Integrative Physiology and Pathobiology, Tufts University School of Medicine, Boston, MA 02111

Edited by Hao Wu, Harvard Medical School, Boston, MA, and approved December 16, 2015 (received for review September 4, 2015) cFLIP, an inhibitor of apoptosis, is a crucial regulator of cellular death more stable than CASP8 homodimers, thereby preventing processing by apoptosis and necroptosis; its importance in development is of CASP8 into the fully active p18 and p10 products that can cleave exemplified by the embryonic lethality in cFLIP–deficient animals. A caspase 3 and inhibit apoptosis. Nevertheless, the cFLIP (an inhibitor homolog of caspase 8 (CASP8), cFLIP exists in two main isoforms: of apoptosis)-p43CASP8 heterodimer is still able to cleave the kinase cFLIPL (long) and cFLIPR (short). Although both splice variants regulate domain of full-length RIP1 (6, 9), thereby preventing necroptosis in- death receptor (DR)-induced apoptosis by CASP8, the specific role of duction. Similar to cFLIPL, the short variant of cFLIP, cFLIPR,sta- each isoform is poorly understood. Here, we report a previously un- bilizes pro-CASP8 and makes it available for execution of apoptosis identified model of resistance to Fas receptor-mediated liver failure in (10). There are three major cFLIP isoforms in the literature: one long the wild-derived MSM strain, compared with susceptibility in C57BL/6 (cFLIP ) and two short (cFLIP and cFLIP ). Only cFLIP and (B6) mice. Linkage analysis in F2 intercross (B6 x MSM) progeny iden- L R S L tified several MSM loci controlling resistance to Fas-mediated death, cFLIPR have been shown to be present in mice (11) whereas all three including the caspase 8- and FADD-like apoptosis regulator (Cflar) are found in humans. Precisely how the cFLIP isoforms reg- locus encoding cFLIP. Furthermore, we identified a 21-bp insertion ulate apoptotic signaling in vivo is poorly understood in part in the 3′ UTRofthefifthexonofCflar in MSM that influences differ- because cFLIP deficiency is embryonically lethal (12, 13). RIP3 ential splicing of cFLIP mRNA. Intriguingly, we observed that MSM is able to rescue cFLIP deficiency but only in the absence of

liver cells predominantly express the FLIPL variant, in contrast to B6 FADD (13). Furthermore, RIP3 or CASP8 deficiency is em- liver cells, which have higher levels of cFLIPR. In keeping with this bryonically lethal, but RIP3/CASP8 double knockout mice are finding, genome-wide RNA sequencing revealed a relative abundance viable (14), demonstrating the complex interplay among the of FLIPL transcripts in MSM hepatocytes whereas B6 liver cells had components of CD95-mediated signaling. significantly more FLIPR mRNA. Importantly, we show that, in the In terms of CD95-mediated apoptosis, cells can be broadly MSM liver, CASP8 is present exclusively as its cleaved p43 product, categorized as type I (mitochondria-independent) or type II bound to cFLIPL. Because of partial enzymatic activity of the hetero- (mitochondria-dependent) (1, 15). Type II cells, including hepato- dimer, it might prevent necroptosis. On the other hand, it prevents cytes, require synergistic activation of the mitochondria-dependent cleavage of CASP8 to p10/20 necessary for cleavage of caspase 3 and, pathway, most likely to amplify an initially weaker death signal. thus, apoptosis induction. Therefore, MSM hepatocytes are predis- posed for protection from DR-mediated cell death. Significance

apoptosis | liver failure | Fas-receptor | caspase 8 | cFLIP To our knowledge, this article is the first report explaining how cFLIP, an inhibitor of apoptosis, regulates apoptosis in vivo. Al- he Fas receptor [also called cluster of differentiation 95 (CD95), though the antiapoptotic role of cFLIP was proposed based on TAPO-1, or TNFRSF6] is a death receptor family member in vitro studies and the early embryonic lethality of cFLIP-deficient constitutively expressed by most tissues, including the liver (1), mice, the specific role of cFLIPL (long) and cFLIPR (short) isoforms is where ligation of ubiquitously expressed CD95 leads to poten- poorly understood. In this study, we describe a previously tially lethal hepatitis and liver failure. Although CD95L (Fas ligand) unidentified allele of caspase 8- and FADD-like apoptosis regulator is the only known physiological ligand of CD95 (2), the agonistic (Cflar) (encoding cFLIP) that makes mice of MSM strain resistant to antibody Jo2 has been used extensively to ligate CD95 and model Fas-mediated lethality. The mutant allele affects the ratio of cFLIPL: CD95-mediated hepatotoxicity and mortality in mice (3). In contrast cFLIP , leading to high levels of long FLIP in MSM. As a result, the to the ability of tumor necrosis factor receptor (TNFR)-mediated R abundant cFLIPL forms enzymatically active heterodimers signaling to lead to profound inflammatory responses in addition to with caspase 8 (CASP8) in MSMs, which prevents formation of cell death (4), CD95 is predominantly used in apoptosis and necrosis proapoptotic CASP8 p10/p20 and cleaves receptor interacting and therefore engages a limited number of downstream components protein kinase 1 (RIP1), thus setting up a higher threshold for CD95- (5). Specifically, ligand binding induces CD95 oligomerization mediated apoptosis and RIP1-mediated necroptosis. and binding of Fas-associated death domain (FADD) via its

death domain (DD), which then recruits caspase 8 (CASP8) via a Author contributions: D.R.R. and A.P. designed research; D.R.R., V.I., and I.S. performed death effector domain (DED), forming the death-inducing sig- research; T.V. contributed new reagents/analytic tools; D.R.R., A.B., A.T., and A.P. analyzed naling complex (DISK) comprising receptor interacting protein data; and D.R.R. and A.P. wrote the paper. kinase 1 (RIP1), FADD, and CASP8 (6). The authors declare no conflict of interest. Interactions of caspase 8 (CASP8) with its enzymatically inactive This article is a PNAS Direct Submission. homolog cFLIPL further complicate the regulation of CD95-mediated Data deposition: The data reported in this paper have been deposited in the Gene Ex- signaling (7): CASP8 forms partially enzymatically active hetero- pression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE72454). dimers with long splice variant cFLIPL in which CASP8 is partially 1To whom correspondence should be addressed. Email: [email protected]. cleaved into its p43 form from its pro-caspase p55 form through This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. transcleavage via other CASP8 molecules (8). These heterodimers are 1073/pnas.1517562113/-/DCSupplemental.

1606–1611 | PNAS | February 9, 2016 | vol. 113 | no. 6 www.pnas.org/cgi/doi/10.1073/pnas.1517562113 Downloaded by guest on September 24, 2021 ABC the wild-derived strain MSM to be extremely resistant to LPS- induced lethality, which correlated with reported resistance of other wild-derived strains to septic shock (19, 21). Because LPS- induced lethality is mediated in part through TNFα (22), we decided to investigate whether this resistance extended to other death receptor-mediated signaling. CD95 is a member of the DEF tumor necrosis factor superfamily of receptors that has been extensively characterized for its role in apoptotic signaling (23). Thus, we decided to examine MSM responses to Jo2, an agonistic mAb that ligates CD95 and induces lethality characterized by hepatocyte death and liver hemorrhage. Compared with B6, MSM mice showed resistance to lethal i.p. doses of Jo2 (Fig. 1 Fig. 1. MSM/Ms are resistant to Fas-mediated liver mortality and hepatic A–D). Electron microscopy of the livers of B6, but not MSM, mice injury. (A) Electron micrograph of hepatocytes from MSM/Ms and B6 after injected with Jo2 showed nuclear fragmentation and mitochondrial injection of 10 μg Jo2 showing nuclei (site A) and mitochondria (site B). (B) swelling (Fig. 1A), accompanied by substantial hemorrhaging (Fig. Gross morphology of livers from MSM/Ms, B6, and F1 (MSM/Ms × B6) 4.5 h 1B), whereas MSM livers appeared grossly normal, and F1 (B6 × post-Jo2 i.p. injection. (C) H&E staining of liver sections from B.(D) Kaplan- MSM) livers showed intermediate damage (Fig. 1B). Similarly, = = Meier curve showing lethality data for MSM/Ms (n 10), B6 (n 11), and F1 H&E staining of livers (Fig. 1C) after Jo2 injection showed severe (n = 18) mice after i.p. injections of 10 μg of Jo2. (E) A time course for the ALT levels in mice injected with Jo2. (F) Western blot analysis of a time tissue damage and leukocyte infiltration in B6 livers, but MSM course of caspase 3 activation in the livers of stimulated with Jo2 B6 (B6), livers appeared unaffected. Again, the livers of F1 hybrids exhibited MSM/Ms (MSM), or F1 (B6 × MSM) mice. GSTP (glutathione S-transferase P, intermediate pathology (Fig. 1C). In keeping with these pathology 44 kDa) is shown as a loading control. findings, F1 mice showed increased resistance to Jo2-induced lethality compared with B6 mice whereas MSM mice were completely resistant (Fig. 1D). High levels of ALT (a marker of liver injury) Differences in oligomerization of the DISK components downstream (23) in B6, but not MSM, serum indicated liver failure as the of Jo2 vs. CD95L may determine the overall apoptotic effect (16). main cause of death in B6 mice. To confirm apoptosis in the livers Here, we report a previously unidentified model of resistance to of Jo2-injected mice, we probed liver lysates for cleaved caspase 3 CD95-mediated liver failure in which mice of the wild-derived MSM (CASP3), the so-called executioner caspase of the death receptor strain survived injection of the Jo2 agonistic antibody to CD95 (17, pathway. In B6 livers, injection of Jo2 induced cleavage of CASP3, 18) at doses lethal to wild-type controls [C57BL6 (B6)]. This re- resulting in the appearance of the p17 band after 4.5 h whereas F1 sistance was tissue-specific because MSM thymocytes were suscepti- livers exhibited delayed CASP3 cleavage after 6 h. No band was ble to Jo2-mediated toxicity. Furthermore, this resistance could be observed in MSM livers, suggesting that their hepatocytes are spe- overcome by multimeric Fas Ligand (MegaFasL). F1 hybrids (B6 × cifically resistant to Jo2-induced apoptosis. MSM) were partially resistant to Jo2, allowing us to pursue this phenotype via classical genetic analysis using F2 intercross (B6 × The CD95 Signaling Pathway Is Functional in MSM Mice. Genome- MSM) progeny and identify the Casp8/caspase 8- and FADD- wide gene expression analysis by means of RNA and exome se- like apoptosis regulator (Cflar) locus as one of the loci linked to quencing revealed multiple polymorphisms in MSM genes Jo2 resistance in MSM. encoding components of the CD95 signaling pathway, including Further analysis revealed that CASP8 in MSM livers is pre- CASP8, FADD, RIP1, and CD95 itself. To dismiss the possibility dominantly present in its cleaved p43 isoform whereas cFLIP is of defective signaling due to one of these polymorphisms, we present predominantly in its FLIPL form. In contrast, B6 mice exhibit compared in vivo responses to Jo2 in B6 and MSM in livers higher levels of cFLIPR relative to the FLIPL form. Concordant with (predominantly made up of hepatocytes, which are type II cells) the ratio of short and long FLIPs, B6 have higher levels of p55 with Jo2 responses in thymocytes in vitro (24), which are type I CASP8 in their livers compared with MSM mice. cells and thus have less stringent requirements for execution of We sequenced cFLIP cDNA from MSM and identified a 21-bp CD95-mediated apoptosis. To mimic the natural cross-linking insertion in the 3′ UTR of the fifth exon of Cflar that was also that is observed in in vivo injections of antibodies, we added conserved in other wild-derived strains, including MOLF/Ei and protein G to facilitate cross-linking of the monoclonal Jo2 an- SPRET/Ei mice that are similarly resistant to death receptor- tibodies (18). In contrast to the in vivo liver data, there was a mediated lethality (19), as well as in Rat (Rattus norvegicus). The substantially cytotoxic effect of Jo2 on freshly isolated MSM insertion was identical to the U2snRNP binding region (20), and this finding may provide insight into why the ratio of FLIP isoforms is skewed toward cFLIPR in MSM mice. Indeed, genome- wide RNA sequencing revealed a relative abundance of the long ABCD FLIP transcript in MSM mice and significantly more FLIPR mRNA in B6 mice, thus suggesting that splicing of FLIP in MSM/Ms is preferentially skewed toward spliced FLIPL mRNA. These data support a model according to which, in MSM mice, CASP8 is predominantly bound to FLIPL, producing an enzymatically active INFLAMMATION

heterodimer that cleaves RIP1, which might prevent necroptosis, Fig. 2. The resistance to Jo2-induced apoptosis is tissue-specific phenotype IMMUNOLOGY AND and processes CASP8 to p43, thus increasing the threshold for in MSM. (A) Thymocytes from both B6 and MSM/Ms are susceptible to Jo2- CD95-mediated initiation of apoptosis. We propose that the ratio mediated lethality. Thymocytes were cultured in triplicate plus Jo2 plus of cFLIP isoforms in a given cell type may be a critical component protein G (PG) plus zVAD for 8 h, and an ATP assay for viability was carried of detecting signal strength. out for the various stimulations at the end of the assay. (B) Susceptibility of C57BL6 or MSM/Ms thymocytes to membrane-bound FasL (mFasL). (C)Sus- Results ceptibility of peritoneal macrophages to Jo2. (D) MEFs from MSM/Ms and B6 are susceptible to Jo2. For A–D, the viability was measured using the ATP assay MSM Mice Are Resistant to Jo2-Induced Liver Injury. In a genetic (CelltiterGlo), and survival was made relative to values from the untreated group screen for novel innate immune phenotypes, we observed mice of (media only). All data are representative of three independent experiments.

Ram et al. PNAS | February 9, 2016 | vol. 113 | no. 6 | 1607 Downloaded by guest on September 24, 2021 ADefficient ligation of CD95 in MSM livers seems capable of overcoming their resistance to apoptosis, resulting in liver failure and death. These data confirmed that MSM mice have a higher threshold for CD95 ligation and activation than B6 mice, which is overcome by the more potent CD95 agonist, MegaFasL. This finding is in agreement with the reported ability of MegaFasL to overcome resistance from exogenously expressed cFLIP in a dose- dependent manner (10, 26). To further characterize the apoptotic cascade in the livers of B6 and MSM mice injected with MegaFasL, we looked at the B E proteolytic cleavage of caspases 9 and 3 (Fig. 3D). Specifically, we observed a decrease in pro-caspase9 and pro-caspase3, as well as a modest increase in the active subunit of caspase3 (p17) upon injection with MegaFasL. Interestingly, we also observed a decrease in the levels of cleaved RIP1 after MegaFasL injection— suggesting a breakdown in the regulation of necroptosis via caspases after MegaFasL injection.

Genome-Wide Analysis Suggests That Resistance to Apoptosis Preexists C in MSM. To further investigate the resistance phenotype in MSM at the molecular level, we performed genome-wide analysis of mRNA levels in the liver and thymus of MSM and B6 mice in response to MegaFasL. First, we compared expression levels of typical genetic markers of liver injury (27), such as the Saa-group of genes, histones, and some cytokines (Fig. 3E). Based on the heat map and relation between the samples in the cladogram in Fig. 3E, the samples divided into two groups: one associated with the liver-specific expression and the other associated with the thymus. The levels of mRNAs for these groups were not dra- Fig. 3. MSM/Ms are susceptible to MegaFasL-induced liver damage. (A)H&E matically different within the liver or thymus but were strikingly of liver sections from MSM/Ms injected with either 10 μgofJo2(Left)or different between the tissues. Furthermore, CD95 ligation did not 2.4 μg of MegaFasL (Right). (B) Kaplan–Meier curve showing mouse survival significantly affect the expression of these genes: If they were after an i.p. injection of 1.5 μg of MegaFasL. (C) ALT levels in mice 2 h highly expressed in resting liver cells, expression remained high in postinjection with either PBS or MegaFasL (1.2 μg per mouse). (D) Western MegaFasL-treated hepatocytes (such as the top half of the com- blot analysis from liver lysates looking at activation of apoptotic proteins pared genes, Fig. 3E). Nevertheless, based on this gene pattern, − + caspase-9, caspase-3, and RIP1 from mice either uninjected ( ) or injected ( ) MSM thymus and MegaFasL-activated MSM liver were posi- with MegaFasL 2 h postinjection. (E) Cladogram showing how gene profiles tioned at the most distal branches of the cladogram, suggesting between livers and thymi change after MegaFasL injection in MSM and B6 mice; alignment of RNA-sequencing data was done using GenePattern unique differences for MSM in their genetic makeup. Genome- software. wide comparison of all genes in unstimulated and stimulated tissues confirmed that MSM thymus, in its gene-expression pattern, is significantly different from other tissues (Fig. 3E). Based on thymocytes (Fig. 2A), comparable with the effect of Jo2 on B6 these data, we hypothesized that resistance to apoptosis in MSMs thymocytes. Addition of the pan-caspase inhibitor zVAD com- is not necessarily conferred by response to CD95 ligation, but, pletely reversed this cytotoxicity, confirming apoptosis as the rather, conditions for such resistance preexist in MSM before underlying route of thymocyte death. To address the possibility activation of the Fas pathway. of protein G possibly confounding our results, we also tested thymocytes with mFasL (25) and observed similar responses in Linkage and Sequencing Analysis Identifies Cflar as One of the Loci thymocytes to mFasL as were seen in response to Jo2 (Fig. 2B). Conferring the Trait. As was shown earlier (Fig. 1 B–D), the re- To further confirm the functionality of CD95-mediated signaling sistance of MSM to Jo2-induced lethality was transmitted at the in cells other than thymocytes, we examined the responses of F1 hybrid level and therefore constituted a genetic trait that MSM and BL/6 mouse embryonic fibroblasts (MEFs) (Fig. 2D) could be pursued by classical genetic analysis. Accordingly, we and peritoneal macrophages (Fig. 2C) to mFasL and found produced second-generation intercross F2 mice and injected similar susceptibility to CD95-mediated death. them with a dose of Jo2, which is lethal for B6 mice, and monitored the survival. Next, using linkage analysis QTL software MSM Mice Are Susceptible to MegaFasL-Induced Liver Injury. Hepa- (28), we looked for association between the survival and the tocytes are type II cells (1) that require activation of the mito- genomic loci in the F2 panel of mice. We identified several loci chondrial loop to synergize with the CASP8 pathway to induce that may contribute to resistance to Jo2, in an F2 panel using apoptosis whereas thymocytes are type I cells in which CD95 QTL analyses (Fig. S1). A 2D analysis, which tries to identify ligation is more efficient and is sufficient for apoptotic signaling. whether particular genotypes on different chromosomes are Because MSM hepatocytes, but not thymocytes, were resistant to coinherited, identified loci on chromosomes (Chr) 1 and 7 as Jo2, we hypothesized that Jo2 may not provide strong enough being particularly interesting (Fig. S1). The genomic area on ligation of CD95 in MSM livers, rendering them resistant to Chr1 was proximal to both the Casp8 and cFlip genes, which we death. Accordingly, we next examined the effect of multimeric then sequenced in B6 and MSM. Although there were no SNPs FasL (MegaFasL), which stimulates more efficient CD95 liga- in MSM Casp8, we identified a 21-bp insertion in the region tion, on MSM mice. We observed that MSM mice were, similarly following the fifth exon of MSM cFLIP involved in alternative to B6 mice, sensitive to MegaFasL-induced lethality (Fig. 3B) splicing of short and long isoforms of cFLIP mRNA (Fig. 4). This whereas histological analysis (Fig. 3A) and elevated ALT levels region is the 3′ UTR for cFLIPR and the intronic region for (Fig. 3C) after injection indicated severe liver injury. Thus, more cFLIPL. This insertion is not present in B6 mice but is conserved

1608 | www.pnas.org/cgi/doi/10.1073/pnas.1517562113 Ram et al. Downloaded by guest on September 24, 2021 Cflar Casp8 calculated the ratio between long and short cFLIP using the 58,760 000 58,800 000 LONG FLIP number of reads for a particular transcript normalized per million SHORT FLIP of mapped reads (FPKM value). The results of this comparison are 1 2 3 4 5 3'UTR 6 7 8 9 10 1 2 3 shown in Fig. 5B and confirm a significant bias toward long cFLIP ATG STOP STOP in MSM livers compared with B6 livers. The ratio between the AGTGCTAACATTATAGCAGGA isoforms becomes equal in the thymus (Fig. 5B). To provide a Fig. 4. Linkage analysis identifies Cflar as one of the gene candidates that causative link between the MSM insert and the splicing, we cloned confer resistance of MSM to Fas-mediated liver failure. A genetic map of the exon 5 of mouse Cflar, together with the flanking intronic regions, Cflar locus is shown with a 21-bp insertion in the 3′ UTR of the short variant into the multiple cloning site of exon-trapping vector pET01 (Fig. of cFLIP in MSM/Ms. 5D) that also contains two additional exons (Donor and Acceptor in Fig. 5D)with5′ donor and 3′ acceptor sites (31). Next, using high-pressure tail-vein i.v. injection (32), we expressed these con- in other wild-derived strains such as MOLF/Ei (Mus musculus structs in the liver of B6 mice and used complement to exons F1, molossinus), PWK/Ei (Mus musculus musculus), and SPRETUS/ R1, and R2 primers to compare efficiency of splicing in both B6 Ei (Mus spretus). Neither of the classical inbred strains from and MSM constructs. The semiquantitative PCR (semi-Q-PCR) Mus musculus domesticus or the CAST/Ei strain (Mus musculus data in Fig. 5E show that the only PCR product observed is from castaneus) preserved the insertion, suggesting that the poly- the B6 construct, which confirms relatively efficient splicing cor- morphism arose during subspeciation of mouse strains. Fur- respondent to the short cFLIP transcript. Furthermore, Q-PCR of thermore, this insertion is also conserved in R. norvegicus (rat). A the fragment correspondent to the long form of FLIP was more striking feature about this insertion is that it contains a putative efficient in MSM than B6 constructs (Fig. 5C). Thus, the 21-bp binding site for the U2 snRNP. In MSM/Ms mice, there is also MSM insertion promotes splicing between plasmid exons, resulting the presence of a U2AF putative binding site in close proximity in significant attenuation of the short cFLIP transcript. These data — to the introduced U2 binding site (Fig. S2) suggesting that, confirm that the 21-bp insertion promotes preferential splicing of compared with B6, MSM/Ms may recruit the spliceosome com- the long cFLIP. Thus, the insertion likely promotes alternative plex more efficiently in this region, either leading to more effi- splicing of cFLIP in MSM livers, thereby resulting in pre- cient splicing of the intronic region between exons 5 and 6— L dominantly cFLIPL mRNA. producing more cFLIPL transcript—or creating an exon-skipping event of Exon 6 (20) leading to an ineffective transcript, or possibly Low Levels of p55 CASP8 and RIP1 Cleavage in MSM Are Linked With making it physically difficult for the transcription of cFLIPR,either Differential Splicing of cFLIP. To determine the consequence of way decreasing the total amount of cFLIP transcript that is R high levels of cFLIPL in MSM livers, we analyzed CASP8, FLIP, produced. and RIP1 protein expression. First, the ratio analysis of p55 and Although the 21-bp insertion is not conserved in humans, human data from the 1000 Genomes Project showed that there are SNPs within the 3′ UTR of the terminal exon for cFLIRR that may alter the binding sequence for U2 as well as for U2AF AB (Fig. S2). Interestingly, these sequences appear in close proximity to one another—suggesting a possible recruitment locus for the spliceosome–leading to splice modification, depending on the SNPs that are present. SNPs that abrogate the putative binding of U2 or U2AF are present in the minority of the pop- ulation, suggesting that U2 and U2AF binding may be important in this region (Fig. S3). Intronic sequence polymorphisms have C been shown to play a role in human diseases, such as familial dysautonomia (29). In this way, the insertion in MSM mice can serve as a tool for investigating the regulation of alternative splicing of cFLIP.

The 21-bp Insert in Cflar Causes Preferential Splicing to Long cFLIP D in MSM Livers. Next generation RNA sequencing (NGS) data allowed for comparison of the ratio of long and short cFLIP in E the liver and thymus of B6 and MSM mice at baseline (unstimulated). First, using Sashimi plots and Bam format alignments (30) of gene-expression data, we visualized the RNA-sequencing reads and their splicing for the short and long isoforms of cFLIP. Fig. 5A shows the results of such visualization using the IGV – Fig. 5. Liver-specific preferential splicing of Cflar into cFLIPL in MSM. genomic browser for exons 4, 5 (circled in red), and 6 8ofCflar. (A) Sashimi plot showing the number of reads between the exons of strain- Only reads that span two or more exons were included. For ex- specific (C57BL6 or MSM) and tissue-specific (liver or thymus) splice variants ample, for B6 liver, relative to 10 reads connecting exons 4 and 5, of long cFLIP. IGV software was used for visualization of the reads. The fifth there were six reads connecting exons 5 and 6 corresponding to exon of Cflar is in a red circle; a red arrow on top depicts the splicing of INFLAMMATION

the long form of cFLIP. In contrast, all 16 connections between interest; and numbers correspond to the number of spliced reads. (B) Ratios IMMUNOLOGY AND exons 4 and 5 in MSM liver extend to exons 5 and 6—coding for of long/short isoforms quantified from RNA-seq data from unstimulated long cFLIP—thus indicating relative skewing of splicing toward MSM/Ms and B6. FPKM, number of fragments per kilobase of aligned per the long cFLIP in MSM livers. Furthermore, cFLIP from thymus million sequenced base pairs. (C) Q-PCR analysis of cDNA correspondent to did not show differential splicing, suggesting that the skewing cFLIPR or cFLIPL amplified with either F1/R1 or F1/R2 primers from the liver of mice injected with plasmids encoding the fifth exon of Cflar.(D) A map of toward long cFLIP mRNA in MSM could be a liver-specific the cloning of exon 5 Cflar into pET01 and the positions of the PCR primers

phenomenon. These data suggested higher levels of transcripts and products correspondent to short (cFLIPR) and long (cFLIPL) isoforms of for cFLIPL and lower levels for cFLIPR transcript in MSM than cFLIP. (E) RT-PCR of the short FLIP from livers of mice after injection with in B6 livers. In further support of the splicing analysis data, we MSM or B6 constructs.

Ram et al. PNAS | February 9, 2016 | vol. 113 | no. 6 | 1609 Downloaded by guest on September 24, 2021 A BC protein expression patterns and mouse strain differences observed in the liver were unmatched in other organs, and, as a result, we decided to focus our efforts on the liver. cFLIPR and p55 CASP8 levels were reproducibly lower in a small panel of MSM mice compared with B6 mice (Fig. 6D). Levels of cleaved RIP1 (RIP1-CL) were also higher in MSM mice compared with DEFB6. Interestingly neither XIAP nor CIAP2 protein levels were different between the strains (Fig. 6D). To directly examine possible interaction of cFLIP with CASP8, we immunoprecipitated FLIP from unstimulated MSM and B6 livers and then analyzed the amounts of bound RIP1 and CASP8. Whereas p43 CASP8 almost exclusively bound FLIP in MSM livers, B6 FLIP was bound to both full-length CASP8 and p43 CASP8 Fig. 6. The ratio of CASP8 cleavage products and cFlip isoforms may de- (Fig. 6E). This result suggests that both cFLIPR and cFLIPL form termine resistance to liver failure in MSM mice. (A) Western blot analysis of complexes with caspase 8 in B6 mouse livers whereas cFLIPL is the caspase 8 from livers of C57BL/6 (B6), MSM/Ms (MSM), or F1 (B6 x MSM) mice. predominant isoform that complexes with caspase 8 in MSM (B) Time course of ratio (L/R beneath) of cFLIP isoforms from livers of Jo2- mouse livers. Furthermore, higher levels of cleaved RIP1 were primed B6 or MSM mice. (C) Tissue-specific RIP1 and CASP8 cleavage and detected in MSM livers compared with B6 (Fig. 6E), again sug- cFLIP isoforms. CL, cleaved RIP; FL, full-length RIP. (D) Differential levels of gesting the preferential formation of the p43 CASP8/cFLIPL het- several apoptotic components in the livers of age-matched unstimulated erodimer in MSM mouse livers. (four mice) B6 or (five mice) MSM mice. (E) Immunoprecipitation of cFLIP followed by Western blot analysis of CASP8 isoforms and RIP1 in MSM and To address strain-specific effects on apoptotic protein process- B6 mouse livers. DCL, depleted cell lysate; IB, immunoblot; IP, immunopreci- ing and to determine whether the 21-bp insertion in MSM mice pitated. (F) Western blot analysis of cFLIP, CASP8, and RIP1 from unstimu- plays a role in creating a prosurvival environment, we generated MSM/MSM lated livers from (three mice) genetically distinct N5F3-CflarMSM/MSM mice. N5F3.Cflar mice. To do that, we crossed F1 (MSM × B6) mice five times back to B6, selecting mice with heterozygosity for MSM Cflar. Next, we intercrossed N5 progeny to produce mice p43 isoforms of CASP8 in B6 and MSM livers revealed relatively with ∼96% of the B6 genome and homozygosity for the 21-bp similar levels of p55 and p43 in B6, with a noticeable shift toward insertion in the 3′ UTR of Exon5 in Cflar (Fig. 4). Compared the p43 isoform upon injection of mice with Jo2 (Fig. 6A). In with unstimulated B6 and MSM livers, protein expression pat- contrast, CASP8 in MSM livers consisted almost exclusively terns of cFLIP and CASP8 in three individual and genetically dis- of the p43 isoform, and Jo2 did not significantly shift this tinct N5F3.CflarMSM/MSM mice were more similar to MSM than to ratio toward full-length CASP8 (Fig. 6A). F1 animals also pre- B6 (Fig. 6F). Specifically, the congenic mice exhibited low cFLIPR, dominantly expressed CASP8 p43. Such a bias toward CASP8 low p55 CASP8, and a noticeably high level of cFLIPL than B6 p43 in MSM livers might be the result of self-cleavage events mice. Furthermore, we also observed enhanced cleavage of RIP1 in (33) upon constitutive TNF receptor 1 activation, which occur the N5F3.CflarMSM/MSM mice—similar to what we observed in the when CASP8 forms a heterodimeric complex with cFLIPL. One MSM parental strain (Fig. 6F). This result strongly suggests that all of the factors affecting CASP8 processing could be the expres- of the differences in cFLIP, CASP8, and RIP1 that we observed in sion level of the two cFLIP isoforms: If present at high levels, parental strains are due to the 21-bp insertion that alters cFLIP cFLIPR binds to procaspase 8 (p55 CASP8) via homotypic in- isoform levels in MSM mice. teractions, keeping it intact until receptor-mediated oligomerization of CASP8 is induced. The resultant heterodimers are Discussion even more stable than p55 homodimers but cannot form pro- The data presented herein provide previously unidentified in- apoptotic tetramers p10/p18 until Fas-receptor ligation. On the sights into the regulation of the death receptor pathway and the contrary, cFLIPL associates with p55 CASP8 through homotypic role of cFLIP in this process (13). Specifically, we show that interactions to produce enzymatically active heterodimers that resistance to CD95-mediated lethality in MSM correlates with potentially could cleave CASP8 (8) p55 to p43 via transcleavage relatively high levels of FLIPL and low levels of FLIPR in the events in the proximity of constitutive “leaky” death receptor- livers of the resistant MSM mice. We identify a 21-bp insertion in mediated signaling, such as TNFR-mediated oligomerization the fifth exon of the Cflar in MSM, which corresponds to the 3′ (34). The RNA sequencing and Q-PCR data show similar levels UTR of the short FLIP mRNA and may prevent transcription of of TNF mRNA in MSM and B6 livers, thus dismissing differ- short FLIP, leading to preferential alternative splicing and thus ential TNF activation as the reason for p55 CASP8 processing in increased transcription and translation of long FLIP. In the ab- MSM. cFLIPL itself is not involved in the cleavage events but sence of the short FLIP isoform, which is capable of titrating rather serves to stabilize caspase 8 as p43 caspase8 through the away and blocking CASP8, long FLIP stabilizes CASP8 and forms formation of the heterodimer. Accordingly, the relatively low an enzymatically active heterodimer that cleaves p55 CASP8 into levels of cFLIPR found in MSM livers compared with B6 (Fig. p43 CASP8 through transcleavage events. This heterodimer of p43 6B), in agreement with the cFLIP mRNA analysis (Fig. 5), CASP8/cFLIPL is also able to constitutively cleave RIP1, creating confirms that the long cFLIP is the dominant isoform in the liver an environment of both apoptotic and necroptotic inhibition. Al- of MSM mice. This relative abundance of cFLIPL could also most complete cleavage of RIP1 and processing of CASP8 into explain our detection of the p43 CASP8 isoform in MSM livers p43 in MSM suggest that components of the DISK complex are because CASP8/cFLIPL forms an enzymatically active hetero- preassembled, even in the absence of activation. One of the dimer capable of cleaving itself as well as other components of conditions for CASP8 processing to p43CASP8 might be consti- the necrotopic pathway, notably RIP1 (13). Given our results tutive activation of the TNF receptor upon leaky TNF-induced suggesting that the resistance was liver-specific (Fig. 1), we de- signaling. However, neither Q-PCR nor RNA sequencing cided to look at CASP8, RIP1, and cFLIP (Fig. 6C) in several revealed substantial differences in TNF mRNA between the organs of unstimulated MSM and B6 mice. RIP1 was used as an strains, which would explain preferential processing of CASP8 indicator of p43caspase 8/cFLIPL heterodimer proteolytic ac- in MSM. tivity because this complex has been implicated in cleaving RIP1 The identification of the 21-bp insertion in short FLIP mRNA in unstimulated cells to maintain cellular homeostasis (35). The of MSM was made possible by an unbiased genetic analysis of

1610 | www.pnas.org/cgi/doi/10.1073/pnas.1517562113 Ram et al. Downloaded by guest on September 24, 2021 in vivo resistance to death receptor-mediated lethality. Using anticipate that other wild-derived strains retaining identical in- lethality as a readout, we identified several loci linked to sertions in Cflar, such as MOLF and PWK, will likewise share this resistance, with a Chr1 locus showing the highest linkage. We resistance phenotype, particularly because N5F3.CflarMSM/MSM complemented this genetic mapping with a genomics approach congenic mice recapitulate the biochemistry of apoptotic compo- that used genome-wide RNA sequencing and pathway analysis. nents observed in the parental MSM strain. In fact, wild-derived Based on NGS analysis of FLIP transcripts and FLIP proteins in SPRETUS mice were reported to be resistant to TNF-induced various mouse tissues of the MSM mouse, we discerned that the lethality although their resistance was mapped to different loci than 21-bp insert is a 100% match with the branching splicing motif in MSM (19, 21). that might be interacting with the splicing machinery protein in a tissue-specific manner: namely, it affects splicing only in MSM Experimental Procedures liver tissue, providing an explanation as to why the resistance to Phenotype. A panel of F2 (MSM/Ms × B6) mice was generated from brother–sister apoptosis is liver-specific in MSM mice whereas thymocytes re- mating of F1 mice. When 8 wk old, the mice were injected intraperitoneally with main susceptible. The fact that the insert does not result in 10 μg of Jo2 or 2 μg of MegaFasL and monitored for 24 h. Kaplan–Meier curves similar splicing in all MSM tissues could be explained by other were used to compare the differences in the survival of B6 with MSM/Ms, using tissue-specific factors. the Logrank test to determine significance. The apoptosis resistance model in MSM mice relates to one of the dogmas in the field: i.e., weak versus strong signaling correlates RNA-Sequencing. Seventy-five–base pair pair-end reads from cDNA libraries with cell death in type I versus type II cells, respectively (36). were generated on MiSeq (Illumina) and aligned using TopHat2 and Cufflinks Specifically, one of the components of the “weak signaling” cas- software. The data are available at the National Center for Biotechnology In- cade might be a lack or low abundance of the DISK components, formation Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/query/acc.cgi? such as full-length CASP8. In MSM mice, CASP8 predominantly acc=GSE72454). exists in the form of enzymatically active heterodimers as CASP8/ Tufts University Medical School Animal Care and Use Committees cFLIPL because of high levels of long cFLIP and a higher affinity of approved all animal work. Please see SI Experimental Procedures for CASP8 to FLIPL than to itself. CASP8 in the CASP8/cFLIPL more information on the methods. heterodimer might potentially cleave itself to p43, but further cleavage to p10/18 CASP8, which is the classically active CASP8 ACKNOWLEDGMENTS. We thank Bridget Larkin and Brigitte Huber for able to cleave CASP3 and drive apoptosis, is prevented. reading the manuscript. This work was supported by NIH Grants AI056234 and AI090419, Russian Federation Government Grant 220(11.G34.31.0052), In conclusion, this previously uncharacterized model of in vivo RFFI Grant NK13-04-40267-H/15, and Russian Science Fund Project 15-15- resistance to Fas-mediated lethality is, to our knowledge, the 00100 (RNA-sequencing, Figs. 3 and 5) (to A.P.). We are grateful for the first that is able to distinguish between two different ligands. We generous support of the Eshe Fund.

1. Jost PJ, et al. (2009) XIAP discriminates between type I and type II FAS-induced apo- 19. Staelens J, et al. (2002) Hyporesponsiveness of SPRET/Ei mice to lethal shock induced ptosis. Nature 460(7258):1035–1039. by tumor necrosis factor and implications for a TNF-based antitumor therapy. Proc 2. Ehrenschwender M, Wajant H (2009) The role of FasL and Fas in health and disease. Natl Acad Sci USA 99(14):9340–9345. Adv Exp Med Biol 647:64–93. 20. Shao C, et al. (2014) Mechanisms for U2AF to define 3′ splice sites and regulate al- 3. Ogasawara J, Suda T, Nagata S (1995) Selective apoptosis of CD4+CD8+ thymocytes ternative splicing in the human genome. Nat Struct Mol Biol 21(11):997–1005. by the anti-Fas antibody. J Exp Med 181(2):485–491. 21. Mahieu T, et al. (2006) The wild-derived inbred mouse strain SPRET/Ei is resistant to – 4. Muppidi JR, Tschopp J, Siegel RM (2004) Life and death decisions: Secondary com- LPS and defective in IFN-beta production. Proc Natl Acad Sci USA 103(7):2292 2297. 22. Beutler B, Krochin N, Milsark IW, Luedke C, Cerami A (1986) Control of cachectin plexes and lipid rafts in TNF receptor family signal transduction. Immunity 21(4): (tumor necrosis factor) synthesis: mechanisms of endotoxin resistance. Science 232(4753): 461–465. 977–980. 5. Schütze S, Tchikov V, Schneider-Brachert W (2008) Regulation of TNFR1 and CD95 23. Tuñón MJ, Alvarez M, Culebras JM, González-Gallego J (2009) An overview of animal signalling by receptor compartmentalization. Nat Rev Mol Cell Biol 9(8):655–662. models for investigating the pathogenesis and therapeutic strategies in acute hepatic 6. Feoktistova M, et al. (2011) cIAPs block Ripoptosome formation, a RIP1/caspase-8 failure. World J Gastroenterol 15(25):3086–3098. containing intracellular cell death complex differentially regulated by cFLIP isoforms. 24. Krammer PH, Arnold R, Lavrik IN (2007) Life and death in peripheral T cells. Nat Rev – Mol Cell 43(3):449 463. Immunol 7(7):532–542. 7. Oztürk S, Schleich K, Lavrik IN (2012) Cellular FLICE-like inhibitory proteins (c-FLIPs): 25. Jodo S, et al. (2000) CD95 (Fas) ligand-expressing vesicles display antibody-mediated, Fine-tuners of life and death decisions. Exp Cell Res 318(11):1324–1331. FcR-dependent enhancement of cytotoxicity. J Immunol 165(10):5487–5494. 8. Pop C, et al. (2011) FLIP(L) induces caspase 8 activity in the absence of interdomain 26. Neumann L, et al. (2010) Dynamics within the CD95 death-inducing signaling complex caspase 8 cleavage and alters substrate specificity. Biochem J 433(3):447–457. decide life and death of cells. Mol Syst Biol 6:352. 9. Boatright KM, Deis C, Denault JB, Sutherlin DP, Salvesen GS (2004) Activation of 27. Jeong J, Adamson LK, Hatam R, Greenhalgh DG, Cho K (2003) Alterations in the ex- caspases-8 and -10 by FLIP(L). Biochem J 382(Pt 2):651–657. pression and modification of histones in the liver after injury. Exp Mol Pathol 75(3): 10. Fricker N, et al. (2010) Model-based dissection of CD95 signaling dynamics reveals 256–264. both a pro- and antiapoptotic role of c-FLIPL. J Cell Biol 190(3):377–389. 28. Manichaikul A, Moon JY, Sen S, Yandell BS, Broman KW (2009) A model selection 11. Ueffing N, et al. (2008) Mutational analyses of c-FLIPR, the only murine short FLIP approach for the identification of quantitative trait loci in experimental crosses, al- – isoform, reveal requirements for DISC recruitment. Cell Death Differ 15(4):773–782. lowing epistasis. Genetics 181(3):1077 1086. 12. Weinlich R, et al. (2013) Protective roles for caspase-8 and cFLIP in adult homeostasis. 29. Carmel I, Tal S, Vig I, Ast G (2004) Comparative analysis detects dependencies among ′ – Cell Reports 5(2):340–348. the 5 splice-site positions. RNA 10(5):828 840. 13. Dillon CP, et al. (2012) Survival function of the FADD-CASPASE-8-cFLIP(L) complex. Cell 30. Wu E, Nance T, Montgomery SB (2014) SplicePlot: A utility for visualizing splicing quantitative trait loci. Bioinformatics 30(7):1025–1026. Reports 1(5):401–407. 31. Rogaev EI, Grigorenko AP, Faskhutdinova G, Kittler EL, Moliaka YK (2009) Genotype 14. Weinlich R, Green DR (2014) The two faces of receptor interacting protein kinase-1. analysis identifies the cause of the “royal disease”. Science 326(5954):817. Mol Cell 56(4):469–480. 32. Tward AD, et al. (2007) Distinct pathways of genomic progression to benign and 15. Walter D, et al. (2008) Switch from type II to I Fas/CD95 death signaling on in vitro malignant tumors of the liver. Proc Natl Acad Sci USA 104(37):14771–14776. culturing of primary hepatocytes. Hepatology 48(6):1942–1953. 33. Kallenberger SM, et al. (2014) Intra- and interdimeric caspase-8 self-cleavage controls

16. Schüngel S, et al. (2009) The strength of the Fas ligand signal determines whether INFLAMMATION

strength and timing of CD95-induced apoptosis. Sci Signal 7(316):ra23. IMMUNOLOGY AND – hepatocytes act as type 1 or type 2 cells in murine livers. Hepatology 50(5):1558 1566. 34. Jiang Y, Woronicz JD, Liu W, Goeddel DV (1999) Prevention of constitutive TNF re- 17. Ogasawara J, et al. (1993) Lethal effect of the anti-Fas antibody in mice. Nature ceptor 1 signaling by silencer of death domains. Science 283(5401):543–546. 364(6440):806–809. 35. Micheau O, et al. (2002) The long form of FLIP is an activator of caspase-8 at the Fas 18. Nishimura Y, et al. (1997) In vivo analysis of Fas antigen-mediated apoptosis: Effects death-inducing signaling complex. J Biol Chem 277(47):45162–45171. of agonistic anti-mouse Fas mAb on thymus, spleen and liver. Int Immunol 9(2): 36. Kaufmann T, Strasser A, Jost PJ (2012) Fas death receptor signalling: Roles of Bid and 307–316. XIAP. Cell Death Differ 19(1):42–50.

Ram et al. PNAS | February 9, 2016 | vol. 113 | no. 6 | 1611 Downloaded by guest on September 24, 2021