Page 1 of 30 International Journal of Cancer
Identification of ZNF217, hnRNP-K, VEGF-A and IPO7 as targets for microRNAs that are downregulated in prostate carcinoma
Jaroslaw Szczyrba1*, Elke Nolte2*, Martin Hart1, Celina Döll1, Sven Wach2, Helge Taubert2, Bastian Keck2, Elisabeth Kremmer3, Robert Stöhr4, Arndt Hartmann4, Wolf Wieland5, Bernd Wullich2* and Friedrich A. Grässer1*
1Dept. of Virology, Saarland University Medical School, Kirrbergerstrasse 100, D 66421 Homburg/Saar, Germany; 2University Clinic of Urology and 4Department of Pathology, Friedrich Alexander University Erlangen Nürnberg, Krankenhausstrasse 12, D 91054 Erlangen, Germany; 3Helmholtz Zentrum München, Institute of Molecular Immunology (IMI), Service Unit Monoclonal Antibodies, Marchioninistrasse 25, D 81377 München, Germany; 5University Clinic of Urology, University Regensburg, Landshuter Strasse 65, D 93053 Regensburg, Germany.
*These authors contributed equally.
Corresponding author: Friedrich A. Grässer PhD Institut für Medizinische Mikrobiologie und Hygiene, Abteilung Virologie, Haus 47, Universitätsklinikum, 66421 Homburg/Saar Tel: +49 6841 162 3983; Fax: +49 6841 162 3980; E mail: [email protected]
Novelty and Impact statement: We identify ZNF217, hnRNP-K, VEGF-A and IPO7 as novel targets of microRNAs miR-24, miR-22, miR-205 and miR-29b, respectively, that are down regulated in prostate carcinoma (PCa). We show that ZNF217, which is a known proto oncogene in breast or colon carcinoma, to be up regulated in PCa. So far, a role for ZNF217 in PCa has not been described. Our results may help to design novel strategies in cancer therapy via manipulation of miRNA levels.
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/ijc.27731 International Journal of Cancer Page 2 of 30
Abstract In primary prostate cancer (PCa), a major cause of cancer related death in men, the expression of various microRNAs (miRNAs) is deregulated. We previously detected several miRNAs, e.g., miR-24 and miR-22, as significantly down regulated in PCa 1. An in silico search predicted that zinc finger protein 217 (ZNF217) and importin 7 (IPO7) were potential target genes of these miRNAs. Additionally, for two genes that are deregulated in PCa (heterogeneous nuclear ribonucleoprotein K, hnRNP-K, and vascular endothelial growth factor A, VEGF-A), we identified two regulatory miRNAs, miR-205 and miR-29b. The regulation of the 3’ untranslated regions (3’UTRs) of the four genes by their respective miRNAs was confirmed by luciferase assays. As expected, the up regulation of ZNF217, hnRNP-K, VEGF-A and IPO7 could be verified at the protein level in the PCa cell lines LNCaP and DU145. ZNF217 and IPO7, which had not yet been studied in PCa, were analyzed in more detail. ZNF217 mRNA is over expressed in primary PCa samples, and this overexpression translates to an elevated protein level. However, IPO7 was upregulated at the protein level alone. The inhibition of ZNF217 and IPO7 by siRNA resulted in reduced proliferation of the PCa cell lines. ZNF217 could thus be identified as an oncogene that is overexpressed in PCa and affects the growth of PCa cell lines while the function of IPO7 remains to be elucidated in greater detail.
2 John Wiley & Sons, Inc. Page 3 of 30 International Journal of Cancer
Introduction
The induction and maintenance of tumors are facilitated by a variety of genetic changes that convert normal, resting cells into continuously proliferating cells (reviewed elsewhere 2). The deregulation of microRNAs (miRNAs) has recently been recognized as one mechanism that contributes to the induction and growth of various tumors, including prostate cancer (PCa) (for a review, see 3). MiRNAs are short, non coding RNAs of approximately 19 25 nucleotides that preferentially bind to specific sequences in the 3’ untranslated region (3’UTR) of mRNAs but may also bind to the 5’UTR or the open reading frame (ORF) of their targets in rare cases 4. The interaction of a miRNA and its target mRNA results in either translational repression or mRNA degradation, which ultimately leads to reduced protein synthesis. Binding to the target mRNA is accomplished via an association with the Argonaute (Ago ) proteins within the RNA induced silencing complex (RISC) (for a review, see 5). We have established miRNA profiles of prostate carcinoma and normal prostate tissue by a deep sequencing approach 1. Based on this analysis, we have shown that myosin VI, which is known to be up regulated in PCa, is a target for miRNAs miR-145 and miR-143, which are both down regulated in this tumor. We could subsequently identify that the Sec23A mRNA is a target for miR-200c and miR-375, which are induced in PCa, and that the Sec23A mRNA and protein are indeed down regulated in PCa. Conversely, the overexpression of Sec23A results in the reduced growth of prostate cancer cell lines 6. In an ongoing effort to identify target genes of the miRNAs that are deregulated in PCa, we followed two bioinformatic approaches. First we identified IPO7 and ZNF217 as potential target genes for the deregulated miRNAs miR-22 and miR-24 1. As an alternative approach, we selected two genes that are reproducibly overexpressed in PCa, VEGF-A and hnRNP-K 7, 8, and found the miRNAs miR-29b and miR-205 that are predicted to target these genes. ZNF217 is located on chromosome 20q13.2, which is often amplified in different carcinomas. Overexpression of ZNF217 has been implicated in the induction of breast 9, pancreatic 10, 11, ovarian 12, cervical 13 and colon carcinomas 14, as well as glioblastoma 15, possibly due to its ability to inhibit pro apoptotic signals 16. IPO7, which is located on chromosome 11, belongs to the Ran binding protein super family 17. It is thought to act as a nuclear transport factor, and the IPO7 transcript is
3 John Wiley & Sons, Inc. International Journal of Cancer Page 4 of 30
upregulated in colorectal carcinoma 18. VEGF A is known to be involved in prostate carcinogenesis and as such is a target for treatment 19. HnRNP K is a multifunctional protein involved in various aspects of RNA metabolism and is also known to be up regulated in PCa where a correlation of hnRNP-K expression and Gleason score is established 20. Herein we demonstrate that the ZNF217, IPO7, VEGF-A and hnRNP-K genes are targets of miR-24, miR-22, miR-29b and miR-205, respectively.
4 John Wiley & Sons, Inc. Page 5 of 30 International Journal of Cancer
Materials and Methods
Clinical Samples A total of 26 cryo conserved tumor tissue samples were available for miRNA and mRNA expression analysis. The median age of the patients at the time of diagnosis was 67.5 years (46 75 years). The Gleason score of these tumors ranged from 5 to 9. The tissue samples were macrodissected prior to RNA extraction to ensure that there was a tumor content of more than 70% in the tumor samples. The non tumor tissue, as defined by histologic examination, was prepared from the same organ as control tissue.
Cell lines, tissue culture and antibodies The human PCa cell lines DU145, LNCaP and human 293T were purchased from the German collection of microorganisms and cell cultures (DSMZ). Primary normal prostate fibroblasts (PNF 08) were kindly provided by Prof. Gerhard Unteregger (Dept. of Urology, University of Saarland Medical School). Cells were cultured as previously described 1. Anti ZNF217 monoclonal antibodies were generated in C57/BL6 mice by immunization with a GST ZNF217 fusion peptide. The coding sequence for amino acids 969 1049 of ZNF217 was amplified and cloned into the pGEX 4T 1 vector (GE Healthcare, Munich, Germany). The resulting GST ZNF217 fusion protein was purified from E.coli BL21/DE3 cells 21 and subsequently used to immunize C57BL/6 mice according to a standard protocol 6. A clone designated ZNF 8C11 (mouse IgG2b) that reacted specifically with ZNF217 was sub cloned and used for further analysis.
Plasmids
The pSG5 miR-22 expression construct was generated by PCR amplification of the nucleotides 1617008 1617429 of chromosome 17 and insertion of the PCR product into the pSG5 expression plasmid (Stratagene, Heidelberg, Germany). To express hsa-miR-24, which maps on chromosome 9, the nucleotides 97848174 97848512 were PCR amplified to obtain pSG5 miR-24. To obtain pSG5 miR-205 and hsa-miR- 29b, the nucleotides 209605356 209605771 of chromosome 1 and 130562034 130562416 of chromosome 7, respectively, were amplified by PCR with specific
5 John Wiley & Sons, Inc. International Journal of Cancer Page 6 of 30
primers. The dual luciferase reporter plasmid pMIR RL has been described elsewhere 22. The entire 3’UTR of hnRNP-K (accession number: NM_006364.2), nucleotides 1 460 of the IPO7 3’UTR (accession number: NM_006391.2), nucleotides 892 1830 of the VEGF-A 3’UTR (accession number: NM_001171623.1) and nucleotides 1056 1950 of the ZNF217 3’UTR (accession number: NM_006526.2) were cloned via PCR amplification using specific primers from testis cDNA and ligated into the SpeI, SacI or NaeI restriction sites of pMIR RL. Mutation of the predicted target site seed sequences of the pMIR constructs were carried out by site directed mutagenesis with the QuickChange Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). The primer sequences for PCR amplification and site directed mutagenesis are given in supplemental Table 1. The expression plasmid for ZNF217 HA was a kind gift from Dr. J. Torchia (London, Ontario, Canada).
Transfections, luciferase assays and Western blots 293T cells were cultivated in 24 well plates and transfected with 0.2 g of reporter construct and 0.8 g of miRNA expression plasmid using the Nanofectin transfection reagent (PAA, Coelbe, Germany). The luciferase assays were performed 48 hours after transfection using a Dual Luciferase Reporter Assay System according to the manufacturer’s instructions (Promega, Mannheim, Germany). For Western blots, approximately 2x105 LNCaP or DU145 cells grown in 6 well plates were transfected with 2 g of plasmid DNA using jetPRIME (Polyplus transfection, Sélestat, France). After 48 h, the cells were lysed with 2x lysis buffer (130 mM Tris/HCl, 6% SDS, 10% 3 Mercapto 1,2 propandiol, 10% glycerol, and 0.05% Bromophenol blue). 30 g of the extracted proteins were separated by 7% SDS PAGE and transferred to a nitrocellulose membrane (Whatman, GE Healthcare, Freiburg, Germany) by electroblotting. The primary antibodies used were anti ZNF217 monoclonal mouse antibody 8C11, anti hnRNP K (D 6, Santa Cruz, Heidelberg, Germany), anti VEGF A (A 20, Santa Cruz), anti IPO7 (SAB4200152, Sigma Aldrich, Munich, Germany), rabbit mAb anti GAPDH (14C10, NEB Cell signaling, Frankfurt, Germany) and anti HA (3F10, Roche, Mannheim, Germany). The appropriate secondary antibodies were purchased from Sigma. The extracts from primary prostate carcinoma tissue were generated using Trizol (Invitrogen, Darmstadt, Germany). Briefly, snap frozen tissue was macrodissected to ensure that the tumor content was above 70% in the tumor samples and that cancer 6 John Wiley & Sons, Inc. Page 7 of 30 International Journal of Cancer
cells were absent in normal samples. The extraction of total RNA and protein was carried out according to the manufacturer’s instructions. Twenty micrograms of the protein extracts were denatured in sample buffer (62.5 mM Tris/HCL pH=6.8, 2% SDS, 5% Glycerol, 0.2 mM EDTA, 100 mM Dithiotreitol (DTT), 0.05% Bromophenol blue, and 0.05% Pyronin Y). The protein samples were separated by 10% SDS PAGE and transferred to nitrocellulose membranes (Whatman) by electroblotting. The membranes were incubated with the primary antibodies 8C11 and rabbit mAb anti GAPDH (14C10, NEB Cell signaling) and the appropriate secondary antibodies (Dianova, Hamburg, Germany). The bands were visualized by enhanced chemiluminescence (Roth, Karlsruhe, Germany) in a LAS 4000 chemiluminescence detection system (GE Healthcare).
Northern Blotting Total RNA was isolated using the peqGOLD TriFast reagent (Peqlab, Erlangen, Germany) according to the manufacturer’s manual, separated by 12% denaturating urea polyacrylamide gel and transferred to a nylon membrane Hybond N (Amersham, GE Healthcare) by semi dry electroblotting (30 min, 15 V). The RNA was chemically crosslinked for 2 h at 55°C and hybridized with radioactively labeled RNA probes overnight at 55°C. The antisense RNA probes were generated with the miRVana probe construction kit (Life Technologies, Darmstadt, Germany) according to the manufacturer’s instructions. After washing the membrane twice for 15 min with 5x SSC and 1% SDS and twice for 15 min with 1x SSC and 1% SDS, the membrane was exposed for at least 24 hours on a storage phosphor screen. The stripping of the nylon membrane was performed using stripping buffer (5 mM Tris pH 8, 0.2 mM EDTA, 0.05% NaPP, and 0.1% Denhardt’s solution) for 2 h at 80°C.
Quantitative real-time PCR (qRT-PCR) analysis of miRNA For miRNA analysis, 10 ng of total RNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit with the miRNA specific RT primers contained in the TaqMan MicroRNA Assays (Applied Biosystems, Darmstadt, Germany). Real time PCR was performed with the StepOnePlus Real Time PCR System (Applied Biosystems) using sequence specific primers and fluorescently labeled probes for miR-22 and miR-24 (Applied Biosystems). The PCR reactions were performed in triplicate in a final volume of 10 l containing 1x TaqMan Universal PCR Master Mix
7 John Wiley & Sons, Inc. International Journal of Cancer Page 8 of 30
(No Amperase UNG), 1x TaqMan miRNA assay and miRNA specific primed cDNA, corresponding to an input amount of 330 pg total RNA per real time PCR reaction. The thermal cycling conditions were as follows: 95°C for 20 s followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. To quantify the miRNA expression in the tumor tissues, we used the relative quantification (∆∆Ct) method 23 with RNU6b serving as an internal control. The calculated relative expression values were normalized against the RNA from PNF 08 cells. All calculations were performed with the StepOne software V 2.0 (Applied Biosystems).
Quantitative real-time PCR (qRT-PCR) analysis of mRNA expression cDNA synthesis was performed with the DyNAmo cDNA Synthesis Kit (Finnzymes Oy, Vantaa, Finland) using 200 ng of total RNA and random hexamer primers. The PCR primers for ZNF217 (fwd 5’ TTG TGT GCC TGC TGG TAG TC 3‘, rev 5’ CTC TTT TGT GCC ATG CTG TTA G 3’) and for GAPDH (fwd 5’ CAT GAG AAG TAT GAC AAC AGC CT 3’, rev 5’ AGT CCT TCC ACG ATA CCA AAG T 3’) were purchased from Biomers (biomers.net, Ulm, Germany). Real time PCRs were performed in triplicate with the StepOnePlus Real Time PCR System (Applied Biosystems) in a total volume of 10 l, which contained 1x TaqMan Fast SYBR Green Master Mix (Applied Biosystems), 250 nM forward primer, 100 nM reverse primer, and 5 ng of cDNA with the following conditions: 95°C for 5 min, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. TaqMan Assays: Sequence specific primers and fluorescently labeled probes for IPO7 (Hs00255188_m1) and GAPDH (Hs99999905_m1) were purchased from Applied Biosystems. Real time PCRs were performed in triplicate with the StepOnePlus Real Time PCR System (Applied Biosystems) in a final volume of 10 l containing 1x TaqMan Fast Universal Master Mix (Applied Biosystems), 1x Primer Assay and 2.5 ng of cDNA with the following conditions: 95°C for 20 s followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. mRNA expression was quantified using the Ct method 23 using GAPDH as the internal control mRNA.
Cell growth and migration determination DU145 cells (1x105) were seeded in 6 well plates and immediately transfected using jetPRIME (Peqlab) with 110 pmol of ON TARGETplus SMARTpool Human ZNF217 –or IPO7 or ON TARGETplus Non targeting Pool as a control (Dharmacon, Thermo
8 John Wiley & Sons, Inc. Page 9 of 30 International Journal of Cancer
Fisher Scientific, Karlsruhe, Germany) resulting in a final concentration of 50 nM. Cell proliferation was measured with the BrdU cell proliferation enzyme linked immunosorbent assay (ELISA) kit (Roche) according to the manufacturer's instructions using an automated microplate reader (Molecular Devices, Sunnyvale, CA) The mean absorbance of control cells represented 100% cell proliferation, and mean absorbance of treated cells was related to control values to determine sensitivity. Cell proliferation (% of control) was determined in triplicate. The migration of cells after inhibition of ZNF217 or IPO7 (see above) was determined by a wound healing assay exactly as decribed 6.
Data analysis and statistical methods Western blots were quantified by Quantity One analysis software (Bio Rad, München, Germany). A statistical evaluation of the luciferase assays was performed with SigmaPlot 10 (Systat, Chicago, IL, USA) using student’s t test statistics. The statistical analyses of the real time qRT PCR experiments (paired t test) were performed using GraphPad Prism 4.0 (Graph Pad software, La Jolla, CA, USA). All statistical tests were performed as two sided, and p values < 0.05 were considered as significant.
9 John Wiley & Sons, Inc. International Journal of Cancer Page 10 of 30
Results
The miRNAs miR-24, -205, -29b and -22 bind to the 3’ untranslated region of ZNF217, hnRNP-K, VEGF-A, and IPO7, respectively We had previously shown that the levels of several miRNAs are reduced in primary cases of prostate carcinoma; for instance, miR-24 and miR -22 were downregulated more than 1.5 fold in PCa 1. We performed a bioinformatic analysis in order to define target genes using TargetScan (http://www.targetscan.org/). ZNF217 and IPO7 were identified as high ranked potential targets for miR-24 and miR-22, respectively. As an alternative approach using the Oncomine database, we selected VEGF-A and hnRNP-K as two prominent genes that are reported to be overexpressed in PCa19, 20. An effort to find miRNAs that target VEGF-A or hnRNP-K resulted in the identification of miR-29b and miR-205. For instance, hnRNP K is a prime target for miR 205 when it is analyzed for the potential of miR 205 to bind to its 3’UTR using the TargetScan algorithm. We found a strong down regulation of miR-205 by miRNA profiling 1, and down regulation of miR-29b in androgen independent PCa cell lines was described by others 24. The 3’UTR regions of the target genes, including the predicted miRNA interaction sites, are schematically depicted in Figure 1. To test if these miRNAs indeed exert a regulatory effect on the target genes’ 3’UTR regions, we performed luciferase reporter gene analyses. The reporter gene activity of all the reporter gene constructs was significantly reduced when the respective miRNA was co expressed in 293T cells (Figure 2). Mutations in the binding sites of the 3’UTRs (depicted in Figure 1) resulted in a complete loss of responsiveness towards the targeting miRNA (Figure 2).
The ZNF217, hnRNP-K, VEGF-A, and IPO7 proteins are induced in PCa cell lines The expression level of the four proteins in non transformed prostate normal fibroblast (PNF 08) cells was compared with those in the LNCaP and DU145 PCa cell lines. To detect the ZNF217 protein in cell lines and tumor tissue, we developed novel mouse monoclonal antibodies. The specificity of the antibodies was determined using ectopically expressed, HA tagged ZNF217 (supplemental Figure 1). For the remaining proteins, commercially available antibodies were used. We showed an up
10 John Wiley & Sons, Inc. Page 11 of 30 International Journal of Cancer
regulation of all four proteins, ZNF217 (Figure 3A), hnRNP K (Figure 3B), VEGF A (Figure 3C), and IPO7 (Figure 3D), in the PCa cell lines compared with PNF 08 cells.
Inhibition of ZNF217, hnRNP-K, VEGF-A, and IPO7 proteins by miRNAs in the PCa cell lines To assess the regulative capabilities of the miRNAs towards endogenous proteins, we expressed the various miRNAs in both LNCaP and DU145 cell lines and analyzed the expression levels of each protein. As expected, the miRNAs were able to down regulate their corresponding targets in either cell line (Figure 4). We found the strongest response for miR-24, which inhibited the expression of ZNF217 by up to 80% in LNCaP and by approximately 60% in DU145 cells (Figure 4A). The relative down regulation of the other proteins ranged from 20 to 50% in the two cell lines after ectopic expression of miR-205, miR-29b and miR-22, which is shown below the blots depicted in Figures 4B, 4C and 4D. The ectopic expression of each miRNA was verified by qRT PCR analysis (supplemental Figure 2A).
MiR-22 and miR-24 expression is reduced and ZNF217 and IPO7 mRNA expression is induced in the PCa cell lines We assayed the expression levels of the four miRNAs, miR-24, miR-205, miR-29b and miR-22, in PNF 08, LNCaP and DU145 cells by Northern blotting (supplemental Figure 2B). The expression of miR-22, miR-24 and miR-29b was down regulated in the PCa cell lines when compared with PNF 08 cells, while no expression of miR-205 was detectable by Northern blotting. We could validate these results by qRT PCR, where we found reduced expression of miR-22 and miR-24 in DU145 and LNCaP cells compared with PNF 08 cells. The expression of IPO7 and ZNF217 mRNA was higher in both PCa cell lines than in PNF 08 cells. This inverse correlation between miRNA and their respective targets is shown in supplemental Figure 3A.
MiR-22 and miR-24 expression is reduced and ZNF217 and IPO7 mRNA expression is induced in primary prostate carcinoma tissues We compared the expression of the RNAs of IPO7 and miR-22 by qRT PCR as well as the RNA expression of ZNF217 and miR-24 in primary prostate carcinoma tissues. As shown in Figure 5A and 5B, both miR-22 and miR-24 were significantly down
11 John Wiley & Sons, Inc. International Journal of Cancer Page 12 of 30
regulated in the tumor compared with the non tumor prostate tissue from the same organ (p=0.0003 and p<0.0001, paired t test). We detected a significant increase in the expression of ZNF217 mRNA (p=0.0341, paired t test, Figure 5B), while IPO7 mRNA levels were not significantly changed (Figure 5A). In our previous profiling of the miRNA expression levels in primary tissue vs. prostate carcinoma tissue, we had found that miRNAs miR-205 was significantly down regulated in tumor tissue 1. We re analyzed primary tissue samples by qRT PCR and found that miR-205 was reduced by about 20 fold in tumor tissue (p<0.0001) and that miR-29a was reduced by about 5 fold (p=0.013) (supplemental Figure 3B).
ZNF217 and IPO7 protein levels are induced in primary prostate tissue Both ZNF217 and IPO7 protein expression was measured in a representative collection of primary PCa samples and corresponding normal tissue. ZNF217 displayed a 2 to 3 fold increase in 14 of 23 of the analyzed cases (Figure 5C and supplemental Figure 4). Likewise, the IPO7 protein level was elevated in 14 of 23 cases (Figure 5D and supplemental Figure 4). As VEGF A and hnRNP K have previously been shown to be up regulated in primary PCa 20, 25, the mRNA and protein expression for these genes was not further analyzed.
Alteration of ZNF217 and IPO7 expression impacts on the growth properties of DU145 and LNCaP PCa cells. We analyzed the effect of ZNF217 and IPO7 on the growth properties of DU145 and LNCaP cells. The two cell lines were transfected with siRNAs targeting ZNF217 and IPO7, and the growth properties were assessed by counting cell numbers. An siRNA mediated knockdown of both genes/proteins in the two cell lines resulted in a reduced growth rate, which was most pronounced at 72 h after the transfection (Figure 6A and 6B). Furthermore, we carried out a wound healing as described 6. For both ZNF217 and IPO7, we initially observed an increased wound healing at the early time points (6h and 24h) that was reduced, however, at the later time point (48h) as compared to the control. Considering the reduced proliferation in the case of ZNF217 or IPO7 knockdown, this result points towards an increased migratory potential of PCa cells under ZNF217 or IPO7 knockdown. Taken together, our results
12 John Wiley & Sons, Inc. Page 13 of 30 International Journal of Cancer
support the notion that ZNF217 may play a role in the growth of prostate carcinoma. For IPO7, a function in tumorigenesis needs to be explored in greater detail.
13 John Wiley & Sons, Inc. International Journal of Cancer Page 14 of 30
Discussion
The primary goal of this study was to identify and analyze novel potential targets of miRNAs that are deregulated in PCa. On the basis of our previous miRNA profiling, we concentrated on miRNAs miR-24 and miR-22, which were found to be down regulated in PCa 1. We reasoned that the potential targets ZNF217 and IPO7 should thus be up regulated at both the RNA and protein level. In addition, to uncover the miRNAs that regulate genes known to play a role in PCa, we selected and analyzed the up regulated genes hnRNP-K and VEGF-A 19, 20. We reasoned that the miRNAs that target these genes (miR-205 and miR-29b) should thus be down regulated in PCa. We discovered via luciferase assays that the miRNAs miR-24, miR-205, miR- 29b and miR-22 target the 3’UTR of ZNF217, hnRNP-K, VEGF-A, and IPO7, respectively. Accordingly, the ectopic expression of the miRNAs resulted in down regulation of the respective target protein in PCa cell lines.
In our previous study, using deep sequencing, we identified miR-205 as strongly downregulated in prostate cancer tissue compared to normal prostate tissue (1, Suppl. data). Our findings are in line with results showing that miR-205 is significantly down regulated in prostate cancer compared to normal tissue 26. Here, we identified miR-205 as potential regulator of hnRNP-K in silico. Our results indicate that miR-205 targets the 3’UTR of hnRNP-K and ectopic expression of miR-205 causes a 20 50 % reduction in hnRNP K protein expression in PCa cell lines. HnRNP K as an inhibitor of androgen receptor mRNA translation regulates androgen responsive gene expression and prostate cancer cell proliferation 27. Barboro et al. showed that hnRNP K levels within the nuclear matrix are higher in PCa compared with non tumour tissues and correlated with Gleason score and poor prognosis 20. A knockdown of hnRNP K expression causes a loss of the angiogenic and migratory phenotype of prostate carcinoma cells. Furthermore, the AKT/hnRNP K/AR/beta catenin pathway is critical for the neuroendocrine differentiation of PCa what is hypothesized to contribute to development and growth of androgen refractory prostate tumors (8 and references therein). In addition, it was demonstrated that miR- 205 together with miR-130a and miR-203 interfere with the mitogen activated protein kinase (MAPK) and androgen receptor (AR) signalling pathways in prostate cancer 28 .
14 John Wiley & Sons, Inc. Page 15 of 30 International Journal of Cancer
VEGF has been described as validated target of miR-205 29. We identified VEGFA as new target of miR-29b in silico. This prediction was confirmed in luciferase reporter gene analysis and ectopic expression of miR-29b resulted in a 40 50% reduced VEGFA protein expression in PCa cell lines. VEGFA, an angiogenesis promoter is overexpressed in prostate cancer and BPH on the mRNA and the protein level 30. Elevated levels of VEGF are also detectable in body fluids of PCa patients 31 . Noteworthy, elevated expression in the PCa tissue is significantly associated with poor differentiation, lymph node metastasis and higher pathologic stage and in addition it is an independent prognostic factor for tumor specific survival 32. Inhibition of angiogenesis by suppression of VEGF by a decapeptide of the KISS1 protein can inhibit tumor growth in SCID mice xenografted with PC 3 prostate cancer cells 33.
We observed elevated expression of the IPO7 protein in PCa cell lines and primary cases of PCa. We could not detect a statistically significant up regulation of the IPO7 mRNA in primary prostate carcinoma tissue, which could be the result of dominant post transcriptional regulation of the protein expression 34. C MYC, which is one of the known proteins transported by IPO7 35, is up regulated in high grade metastasizing PCa 36. Furthermore, IPO7 and IPO4 are involved in transport of the hypoxia inducible factor HIF1α into the nucleus 37. Interestingly, HIF1α itself is a target of the down regulated miR-22 in colon cancer cells 38. However, the relevance of deregulated IPO7 expression in prostate cancer remains to be established.
The major findings of this report are that ZNF217 is a target of miR-24, and its protein levels are up regulated in PCa. The amplification of this proto oncogene was initially noted in a xenograft of an advanced stage PCa 39. ZNF217 is located on chromosome 20q13.2; this region is amplified in various tumors such as ovarian clear cell carcinoma 40 42, mammary carcinoma 43, head and neck squamous cell carcinoma 44, squamous cell cervical cancer 13, and esophageal adenocarcinoma 45. We now extend these observations to the overexpression of ZNF217 in prostate carcinoma. We found elevated expression of ZNF217 mRNA and protein in PCa cell lines and primary prostate cancer tissues. However, the copy number of ZNF217 genes in PCa was not investigated in the present study and could additionally affect the up regulation of ZNF217. Furthermore, we showed that an alteration in ZNF217
15 John Wiley & Sons, Inc. International Journal of Cancer Page 16 of 30
expression has an impact on the proliferation of DU145 PCa cells. It has been shown that silencing of ZNF217 in ovarian cancer cells can reduce cell growth and invasiveness 46. A role for ZNF217 in transformation was shown by the potential of ZNF217 to immortalize primary cells 47, 48. Interestingly, ZNF217 induces the expression of the ErbB3 receptor tyrosine kinase in breast cancer cells 9. ErbB3, in turn, has been associated with the progression of prostate cancer after androgen ablation 49 and is a novel therapeutic target in the treatment of PCa 50.
In summary, the down regulation of miR-24, miR-205, miR-29b and miR-22 in PCa corresponds to an up regulation of the predicted target proteins ZNF217, hnRNP-K, VEGF-A and IPO7, respectively. ZNF17 could be identified as an oncogene because it is overexpressed in PCa and affects the growth of PCa cell lines. Together with miR-24, ZNF217 and possibly IPO7 could be attractive targets for therapeutic intervention.
Acknowledgements This research was funded by a grant of the Wilhelm Sander Stiftung (grant No. 2007.025.01) to B. Wullich and F. Grässer. We would like to thank Ruth Nord for expert technical assistance and American Journal Experts (www.journalexperts.com) for providing language editing service.
16 John Wiley & Sons, Inc. Page 17 of 30 International Journal of Cancer
References
1. Szczyrba J, Loprich E, Wach S, Jung V, Unteregger G, Barth S, Grobholz R, Wieland W, Stohr R, Hartmann A, Wullich B, Grässer F. The MicroRNA Profile of Prostate Carcinoma Obtained by Deep Sequencing. Mol Cancer Res 2010;8:529 38. 2. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell;144:646 74. 3. Coppola V, De Maria R, Bonci D. MicroRNAs and prostate cancer. Endocrine related cancer 2010;17:F1 17. 4. Tay Y, Zhang J, Thomson AM, Lim B, Rigoutsos I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 2008;455:1124 8. 5. Meister G. miRNAs get an early start on translational silencing. Cell 2007;131:25 8. 6. Szczyrba J, Nolte E, Wach S, Kremmer E, Stohr R, Hartmann A, Wieland W, Wullich B, Grässer FA. Downregulation of Sec23A Protein by miRNA 375 in Prostate Carcinoma. Mol Cancer Res 2011;9:791 800. 7. Shweiki D, Itin A, Soffer D, Keshet E. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia initiated angiogenesis. Nature 1992;359:843 5. 8. Ciarlo M, Benelli R, Barbieri O, Minghelli S, Barboro P, Balbi C, Ferrari N. Regulation of neuroendocrine differentiation by AKT/hnRNPK/AR/beta catenin signaling in prostate cancer cells. International journal of cancer 2011;DOI: 10.1002/ijc.26402. 9. Krig SR, Miller JK, Frietze S, Beckett LA, Neve RM, Farnham PJ, Yaswen PI, Sweeney CA. ZNF217, a candidate breast cancer oncogene amplified at 20q13, regulates expression of the ErbB3 receptor tyrosine kinase in breast cancer cells. Oncogene 2010;29:5500 10. 10. Holzmann K, Kohlhammer H, Schwaenen C, Wessendorf S, Kestler HA, Schwoerer A, Rau B, Radlwimmer B, Dohner H, Lichter P, Gress T, Bentz M. Genomic DNA chip hybridization reveals a higher incidence of genomic amplifications in pancreatic cancer than conventional comparative genomic hybridization and leads to the identification of novel candidate genes. Cancer research 2004;64:4428 33.
17 John Wiley & Sons, Inc. International Journal of Cancer Page 18 of 30
11. Hidaka S, Yasutake T, Takeshita H, Kondo M, Tsuji T, Nanashima A, Sawai T, Yamaguchi H, Nakagoe T, Ayabe H, Tagawa Y. Differences in 20q13.2 copy number between colorectal cancers with and without liver metastasis. Clin Cancer Res 2000;6:2712 7. 12. Tanner MM, Grenman S, Koul A, Johannsson O, Meltzer P, Pejovic T, Borg A, Isola JJ. Frequent amplification of chromosomal region 20q12 q13 in ovarian cancer. Clin Cancer Res 2000;6:1833 9. 13. Zhu X, Lv J, Yu L, Zhu X, Wu J, Zou S, Jiang S. Proteomic identification of differentially expressed proteins in squamous cervical cancer. Gynecologic oncology 2009;112:248 56. 14. Rooney PH, Boonsong A, McFadyen MC, McLeod HL, Cassidy J, Curran S, Murray GI. The candidate oncogene ZNF217 is frequently amplified in colon cancer. The Journal of pathology 2004;204:282 8. 15. Mao XG, Yan M, Xue XY, Zhang X, Ren HG, Guo G, Wang P, Zhang W, Huo JL. Overexpression of ZNF217 in glioblastoma contributes to the maintenance of glioma stem cells regulated by hypoxia inducible factors. Laboratory investigation; a journal of technical methods and pathology 2011;91:1068 78. 16. Huang G, Krig S, Kowbel D, Xu H, Hyun B, Volik S, Feuerstein B, Mills GB, Stokoe D, Yaswen P, Collins C. ZNF217 suppresses cell death associated with chemotherapy and telomere dysfunction. Human molecular genetics 2005;14:3219 25. 17. Gorlich D, Dabrowski M, Bischoff FR, Kutay U, Bork P, Hartmann E, Prehn S, Izaurralde E. A novel class of RanGTP binding proteins. The Journal of cell biology 1997;138:65 80. 18. Li SR, Gyselman VG, Dorudi S, Bustin SA. Elevated levels of RanBP7 mRNA in colorectal carcinoma are associated with increased proliferation and are similar to the transcription pattern of the proto oncogene c myc. Biochemical and biophysical research communications 2000;271:537 43. 19. Kluetz PG, Figg WD, Dahut WL. Angiogenesis inhibitors in the treatment of prostate cancer. Expert opinion on pharmacotherapy 2010;11:233 47. 20. Barboro P, Repaci E, Rubagotti A, Salvi S, Boccardo S, Spina B, Truini M, Introini C, Puppo P, Ferrari N, Carmignani G, Boccardo F, et al. Heterogeneous nuclear ribonucleoprotein K: altered pattern of expression associated with diagnosis and prognosis of prostate cancer. British journal of cancer 2009;100:1608 16.
18 John Wiley & Sons, Inc. Page 19 of 30 International Journal of Cancer
21. Pfuhl T, Mamiani A, Durr M, Welter S, Stieber J, Ankara J, Liss M, Dobner T, Schmitt A, Falkai P, Kremmer E, Jung V, et al. The LARK/RBM4a protein is highly expressed in cerebellum as compared to cerebrum. Neuroscience letters 2008;444:11 5. 22. Imig J, Motsch N, Zhu JY, Barth S, Okoniewski M, Reineke T, Tinguely M, Faggioni A, Trivedi P, Meister G, Renner C, Grässer FA. microRNA profiling in Epstein Barr virus associated B cell lymphoma. Nucleic acids research 2011;39:1880 93. 23. Schmittgen TD, Livak KJ. Analyzing real time PCR data by the comparative C(T) method. Nature protocols 2008;3:1101 8. 24. Lin SL, Chiang A, Chang D, Ying SY. Loss of mir 146a function in hormone refractory prostate cancer. RNA (New York, N.Y 2008;14:417 24. 25. Delongchamps NB, Peyromaure M. The role of vascular endothelial growth factor in kidney and prostate cancer. The Canadian journal of urology 2007;14:3669 77. 26. Schaefer A, Jung M, Mollenkopf HJ, Wagner I, Stephan C, Jentzmik F, Miller K, Lein M, Kristiansen G, Jung K. Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma. International journal of cancer 2010;126:1166 76. 27. Mukhopadhyay NK, Kim J, Cinar B, Ramachandran A, Hager MH, Di Vizio D, Adam RM, Rubin MA, Raychaudhuri P, De Benedetti A, Freeman MR. Heterogeneous nuclear ribonucleoprotein K is a novel regulator of androgen receptor translation. Cancer research 2009;69:2210 8. 28. Boll K, Reiche K, Kasack K, Morbt N, Kretzschmar AK, Tomm JM, Verhaegh G, Schalken J, von Bergen M, Horn F, Hackermuller J. MiR 130a, miR 203 and miR 205 jointly repress key oncogenic pathways and are downregulated in prostate carcinoma. Oncogene 2012. 29. Wu H, Zhu S, Mo YY. Suppression of cell growth and invasion by miR 205 in breast cancer. Cell research 2009;19:439 48. 30. Jackson MW, Bentel JM, Tilley WD. Vascular endothelial growth factor (VEGF) expression in prostate cancer and benign prostatic hyperplasia. The Journal of urology 1997;157:2323 8.
19 John Wiley & Sons, Inc. International Journal of Cancer Page 20 of 30
31. Jamaspishvili T, Kral M, Khomeriki I, Student V, Kolar Z, Bouchal J. Urine markers in monitoring for prostate cancer. Prostate cancer and prostatic diseases 2010;13:12 9. 32. Wang Q, Diao X, Sun J, Chen Z. Stromal cell derived factor 1 and vascular endothelial growth factor as biomarkers for lymph node metastasis and poor cancer specific survival in prostate cancer patients after radical prostatectomy. Urologic oncology 2011. 33. Cho SG, Yi Z, Pang X, Yi T, Wang Y, Luo J, Wu Z, Li D, Liu M. Kisspeptin 10, a KISS1 derived decapeptide, inhibits tumor angiogenesis by suppressing Sp1 mediated VEGF expression and FAK/Rho GTPase activation. Cancer research 2009;69:7062 70. 34. Esquela Kerscher A, Slack FJ. Oncomirs microRNAs with a role in cancer. Nat Rev Cancer. 2006;6:259 69. 35. Koch HB, Zhang R, Verdoodt B, Bailey A, Zhang CD, Yates JR, 3rd, Menssen A, Hermeking H. Large scale identification of c MYC associated proteins using a combined TAP/MudPIT approach. Cell cycle (Georgetown, Tex 2007;6:205 17. 36. Jenkins RB, Qian J, Lieber MM, Bostwick DG. Detection of c myc oncogene amplification and chromosomal anomalies in metastatic prostatic carcinoma by fluorescence in situ hybridization. Cancer research 1997;57:524 31. 37. Chachami G, Paraskeva E, Mingot JM, Braliou GG, Gorlich D, Simos G. Transport of hypoxia inducible factor HIF 1alpha into the nucleus involves importins 4 and 7. Biochemical and biophysical research communications 2009;390:235 40. 38. Yamakuchi M, Yagi S, Ito T, Lowenstein CJ. MicroRNA 22 regulates hypoxia signaling in colon cancer cells. PloS one 2011;6:e20291. 39. Bar Shira A, Pinthus JH, Rozovsky U, Goldstein M, Sellers WR, Yaron Y, Eshhar Z, Orr Urtreger A. Multiple genes in human 20q13 chromosomal region are involved in an advanced prostate cancer xenograft. Cancer research 2002;62:6803 7. 40. Rahman MT, Nakayama K, Rahman M, Nakayama N, Ishikawa M, Katagiri A, Iida K, Nakayama S, Otsuki Y, Shih IM, Miyazaki K. Prognostic and therapeutic impact of the chromosome 20q13.2 ZNF217 locus amplification in ovarian clear cell carcinoma. Cancer 2011.
20 John Wiley & Sons, Inc. Page 21 of 30 International Journal of Cancer
41. Kuo KT, Mao TL, Chen X, Feng Y, Nakayama K, Wang Y, Glas R, Ma MJ, Kurman RJ, Shih Ie M, Wang TL. DNA copy numbers profiles in affinity purified ovarian clear cell carcinoma. Clin Cancer Res 2010;16:1997 2008. 42. Fejzo MS, Dering J, Ginther C, Anderson L, Ramos L, Walsh C, Karlan B, Slamon DJ. Comprehensive analysis of 20q13 genes in ovarian cancer identifies ADRM1 as amplification target. Genes, chromosomes & cancer 2008;47:873 83. 43. Ginestier C, Cervera N, Finetti P, Esteyries S, Esterni B, Adelaide J, Xerri L, Viens P, Jacquemier J, Charafe Jauffret E, Chaffanet M, Birnbaum D, et al. Prognosis and gene expression profiling of 20q13 amplified breast cancers. Clin Cancer Res 2006;12:4533 44. 44. Freier K, Joos S, Flechtenmacher C, Devens F, Benner A, Bosch FX, Lichter P, Hofele C. Tissue microarray analysis reveals site specific prevalence of oncogene amplifications in head and neck squamous cell carcinoma. Cancer research 2003;63:1179 82. 45. Nancarrow DJ, Handoko HY, Smithers BM, Gotley DC, Drew PA, Watson DI, Clouston AD, Hayward NK, Whiteman DC. Genome wide copy number analysis in esophageal adenocarcinoma using high density single nucleotide polymorphism arrays. Cancer research 2008;68:4163 72. 46. Sun G, Zhou J, Yin A, Ding Y, Zhong M. Silencing of ZNF217 gene influences the biological behavior of a human ovarian cancer cell line. International journal of oncology 2008;32:1065 71. 47. Nonet GH, Stampfer MR, Chin K, Gray JW, Collins CC, Yaswen P. The ZNF217 gene amplified in breast cancers promotes immortalization of human mammary epithelial cells. Cancer research 2001;61:1250 4. 48. Li P, Maines Bandiera S, Kuo WL, Guan Y, Sun Y, Hills M, Huang G, Collins CC, Leung PC, Gray JW, Auersperg N. Multiple roles of the candidate oncogene ZNF217 in ovarian epithelial neoplastic progression. International journal of cancer 2007;120:1863 73. 49. Jathal MK, Chen L, Mudryj M, Ghosh PM. Targeting ErbB3: the New RTK(id) on the Prostate Cancer Block. Immunology, endocrine & metabolic agents in medicinal chemistry 2011;11:131 49. 50. Chen L, Mooso BA, Jathal MK, Madhav A, Johnson SD, van Spyk E, Mikhailova M, Zierenberg Ripoll A, Xue L, Vinall RL, deVere White RW, Ghosh PM.
21 John Wiley & Sons, Inc. International Journal of Cancer Page 22 of 30
Dual EGFR/HER2 inhibition sensitizes prostate cancer cells to androgen withdrawal by suppressing ErbB3. Clin Cancer Res 2011;17:6218 28.
22 John Wiley & Sons, Inc. Page 23 of 30 International Journal of Cancer
Figure legends
Figure 1: Schematic representation of the reporter gene constructs and the miRNA binding sites. For each target gene, the 3’UTR that contains the predicted miRNA interaction site is shown. Additionally, for each miRNA, the seed sequences and the mutated seed sequences in the 3’ UTRs are shown. (A) ZNF217 and miR-24, (B) hnRNP-K and miR-205, (C) VEGF-A and miR-29b and (D) IPO7 and miR-22.
Figure 2: Luciferase reporter gene analyses. The reporter gene vectors without insert (pMIR), with the 3’UTR insert or with the mutated miRNA seed sequence were co transfected with a miRNA expression vector or a control vector in the indicated combinations. (A) ZNF217, (B) hnRNP-K, (C) VEGF-A, (D) IPO7. The reporter gene activity of the control vector experiment was set to 100% for every experiment. All values represent the mean of four independent experiments carried out in duplicate. Stars denote p<0.05.
Figure 3: Western blot analysis. The expression of (A) ZNF217, (B) hnRNP K, (C) VEGF A and (D) IPO7 was assessed in the cell lines LNCaP, DU145 and PNF 08 cells via Western blot. Staining of ß actin and GAPDH served as a loading control.
Figure 4: The regulation of protein expression by miRNAs. The prostate cancer cell lines LNCaP and DU145 were transfected with miRNA expression vectors or a control vector. Forty eight hours post transfection, the protein expression of (A) ZNF217, (B) hnRNP K, (C) VEGF A and (D) IPO7 was determined by Western blot using the GAPDH signal as loading control.
Figure 5: The correlation of miRNAs miR-24 and miR-22 and the target genes ZNF217 and IPO7 in primary prostate cancer. (A) The correlation of miR-22 and IPO7 at the RNA level. (B) The correlation of miR-24 and ZNF217 at the RNA level. (C) Western blot analysis of ZNF217 protein expression in pairs of primary prostate cancer and the corresponding normal tissue. (D) Western blot analysis of IPO7 protein expression in pairs of primary prostate cancer and the corresponding normal tissue.
23 John Wiley & Sons, Inc. International Journal of Cancer Page 24 of 30
Figure 6: Cell proliferation analysis. (A) DU145 and (B) LNCaP prostate cancer cells were transfected with siRNAs targeting ZNF217, IPO7 or a negative control siRNA. In a period of 72 hours, cell proliferation was determined by measuring BrDU incorporation. Proliferation was determined every 24 hours. The values represent a mean of triplicates.
Supplemental Figure 1: Characterization of the ZNF217-specific mouse monoclonal antibody 8C11. 293T cells that were transfected with a control vector or the ZNF217 HA expression construct were analyzed by Western blot using the HA specific 2F10 antibody or the ZNF217 specifc mouse mAb 8C11 as indicated.
Supplemental Figure 2: (A) Ectopic expression of miR-22, miR-24, miR-29b and miR- 205 in cell lines. The indicated miRNAs were ectopically expressed either in LNCaP cells (black bars) or in DU145 cells (open bars) and the levels of the miRNAs were compared by qRT PCR with cells transfected in parallel with empty pSG5 control vector. (B) Endogenous expression of miR-22, miR-24, miR-29b and miR-205 in cell lines. The expression of the indicated miRNAs was analyzed by Northern blot in PNF08, LNCaP and DU145 cells. tRNA served as a loading control. The expression levels in DU145 and LNCaP were determined setting the level in PNF 08 cells to 1.
Supplemental Figure 3: The expression of the miRNAs miR-24, miR-22, miR-205 and miR-29b and the target genes ZNF217 and IPO7. (A) The expression of the miR-22 and miR-24 and target RNAs was analyzed in PNF08, LNCaP and DU145 cells. (B) The expression of miR-205 and miR-29b was analyzed in 26 matched pairs of primary prostate cancer and corresponding normal tissue.
Supplemental Figure 4: Western blot analyses of protein expression. Western blot analysis of ZNF217 and IPO7 protein expression in pairs of primary prostate cancer and the corresponding normal tissue.
Supplemental Figure 5: Wound healing analysis. DU145 prostate cancer cells were transfected with siRNAs targeting ZNF217 or IPO7. The ability to heal a defined gap in the cell monolayer was determined over a 48 hour period.
24 John Wiley & Sons, Inc. Page 25 of 30 International Journal of Cancer
Figure 1 127x93mm (300 x 300 DPI)
John Wiley & Sons, Inc. International Journal of Cancer Page 26 of 30
177x163mm (300 x 300 DPI)
John Wiley & Sons, Inc. Page 27 of 30 International Journal of Cancer
133x108mm (300 x 300 DPI)
John Wiley & Sons, Inc. International Journal of Cancer Page 28 of 30
113x71mm (300 x 300 DPI)
John Wiley & Sons, Inc. Page 29 of 30 International Journal of Cancer
Figure 5 245x329mm (300 x 300 DPI)
John Wiley & Sons, Inc. International Journal of Cancer Page 30 of 30
Figure 6 247x461mm (300 x 300 DPI)
John Wiley & Sons, Inc. Supplemental Table 1 cloning primers
name sequence 5'-hnRNPK-SacI cgagctcgtgaagcagtatgcagatg 3'-hnRNPK-NaeI cagccggccaggtgtcaatcaacc 5'-IPO7-SpeI ggactagtcaattttggaggcccagcac 3'-IPO7-SacI cgagctcgtcctgtagcccatgccta 5’-VEGF-SacI cgagctcgcttctgagttgcccaggag 3’VEGF-NaeI cagccggcggaatatctcgaaaaactgc 5‘-znf217-SpeI gactagttggcatttgggtgaactgtgg 3‘-znf217-SacI cgagctcgaagtacaaagggctgtagga 5'-miR205-EcoRI ggaatccgggtaggagtattcaggtcc 3'-miR205-BamHI cgggatcctccctctgaagaagcacgca 5'-miR22-EcoRI cggaattccagccctgcattagaatctc 3'-miR22-BamHI cgggatccctactcctcaatccagcc 5'-miR24-EcoRI cgaattcTtgttctgggcgcggtgaactc 3'-miR24-BamHI cgggatcccatgcagatgactggcacc 5'-miR29b-EcoRI ggaattcccaaagctctgtttagacca 3'-miR29b-BamHI ttggatccgccagtgcagagacctg
mutagenesis primers (mutated sites are shown in capital letters)
name sequence 5’-hnRNPK-mut agactagtgaagaacGTCGACGgtcctgcatcttttt 3’-hnRNPK-mut aaaaagatgcaggacCGTCGACgttcttcactagtct 5'-IPO7-mut ggggatgtcatgaaCACGTGCtttctttttctgagg 3'-IPO7-mut cctcagaaaaagaaaGCACGTGttcatgacatcccc 5'-VEGFA-mut gttatcatttatttatGTCGACCCctgtttatccgtaat 3'-VEGFA-mut attacggataaacagGGGTCGACataaataaatgataac 5‘-ZNF217-mut cctgttcacaaCACACGTGGtatgtacataatctag 3’-ZNF217-mut ctagattatgtacatacCACGTGtgttgtgaacagg northern blot probes
name sequence miR-22 aagcugccaguugaagaacuguGGACAGAG miR-24 accgagucaagucguccuugucGGACAGAG miR-29b aucguggutttcuuuagucacaaGGACAGAG miR-205 aggaaguaagguggccucagacGGACAGAG