Journal of Wildlife Diseases, 47(4), 2011, pp. 945–957 # Wildlife Disease Association 2011

RABIES IN THE POPULATION, ,

Torill Mørk,1,5 Jon Bohlin,3 Eva Fuglei,4 Kjetil A˚ sbakk,2 and Morten Tryland2 1 National Veterinary Institute, Stakkevollveien 23, N-9010 Tromsø, Norway 2 Norwegian School of Veterinary Science, Department of Food Safety and Biology, Section of Arctic Veterinary Medicine, Stakkevollveien 23, N-9010 Tromsø, Norway 3 Norwegian School of Veterinary Science, Department of Food Safety and Infection Biology, Centre for Epidemiology and Biostatistics, Oslo, Norway 4 Norwegian Polar Institute, FRAM Centre, N-9296 Tromsø, Norway 5 Corresponding author (email: [email protected]) Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 ABSTRACT: Arctic foxes, 620 that were trapped and 22 found dead on Svalbard, Norway (1996– 2004), as well as 10 foxes trapped in Nenets, North-West Russia (1999), were tested for antigen in brain tissue by standard direct fluorescent antibody test. Rabies antigen was found in two foxes from Svalbard and in three from Russia. Blood samples from 515 of the fox carcasses were screened for rabies antibodies with negative result. Our results, together with a previous screening (1980–1989, n5817) indicate that the prevalence of rabies in Svalbard has remained low or that the virus has not been enzootic in the arctic fox population since the first reported outbreak in 1980. Brain tissues from four arctic foxes (one from Svalbard, three from Russia) in which antigen was detected were further analyzed by reverse-transcriptase polymerase chain reaction direct amplicon sequencing and phylogenetic analysis. Sequences were compared to corresponding sequences from rabies virus isolates from other arctic regions. The Svalbard isolate and two of the Russian isolates were identical (310 nucleotides), whereas the third Russian isolate differed in six nucleotide positions. However, when translated into amino acid sequences, none of these substitutions produced changes in the amino acid sequence. These findings suggest that the spread of rabies virus to Svalbard was likely due to migration of arctic foxes over sea ice from Russia to Svalbard. Furthermore, when compared to other Arctic rabies virus isolates, a high degree of homology was found, suggesting a high contact rate between arctic fox populations from different arctic regions. The high degree of homology also indicates that other, and more variable, regions of the genome than this part of the nucleoprotein gene should be used to distinguish Arctic rabies virus isolates for epidemiologic purposes. Key words: Arctic fox, phylogeny, rabies virus, Russia, Svalbard.

INTRODUCTION Rabies virus in the Arctic was, for the first time, identified and reported in Rabies has a broad distribution through- Alaska by Williams (1949). Characteriza- out the Arctic, and outbreaks among tion of arctic rabies virus isolates with arctic foxes (Vulpes lagopus) and dogs monoclonal antibodies indicated the cir- (Canis lupus familiaris) have been report- culation of a specific arctic rabies virus ed since the late 19th century (Rausch, variant (Schneider et al., 1985) with the 1958; Kantorovich, 1964; Ødegaard and arctic fox as the main host (Johnston and Krogsrud, 1981; Ritter, 1981; Holck, Fong, 1992). Recent phylogenetic studies 1989). Pre-European folklore from the have identified similar rabies virus strains Canadian Inuits indicates a long history in coastal areas of North America, arctic of rabies, or a rabies-like disease, trans- Russia, and , indicating that mitted from arctic foxes to dogs and rabies in the arctic fox share humans (Singleton, 1969). Until dog common characteristics and have a cir- vaccination began in Greenland in the cumpolar distribution (Mansfield et al., 1960s, epidemics of rabies among sledge 2006; Kuzmin et al., 2008). dogs caused severe problems for the local In Svalbard, rabies was first diagnosed Inuit who were dependent on dogs for during an outbreak in 1980 in which 12 hunting and transport (Wamberg, 1960). arctic foxes, three Svalbard reindeer In recent years, there have been no (Rangifer tarandus platyrhynchus), and reports of larger outbreaks in dogs in one ringed seal (Pusa hispida)where arctic regions. diagnosed with rabies (Ødegaard and

945 946 JOURNAL OF WILDLIFE DISEASES, VOL. 47, NO. 4, OCTOBER 2011

Krogsrud, 1981). However, Prestrud et al. The Nenets autonomous district is (1992) reported no positives in a survey for northernmost European Russia and con- rabies virus by fluorescence antibody test sists of huge tundra areas that are scarcely (FAT) in trapped arctic foxes (n5817) populated (0.2 persons per km2). Most of collected during 1980–1989. With the the people live in the city of Narjan-Mar exception of a few isolated rabies cases and some in small villages. Arctic foxes of in the arctic fox and one case in reindeer, this region belong to the inland ecotype there have been no reports of new rabies and prey on lemmings and migratory birds outbreaks, and there has been speculation in coastal areas. that the virus is no longer enzootic in the Our aim was to investigate the prevalence Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 arctic fox population. of rabies virus infection in the population of The high Arctic Svalbard archipelago is arctic foxes in Svalbard by analyzing samples located in the North Atlantic Ocean and from foxes trapped or found dead from 1996 the Barents Sea. The polar sea ice reaches to 2004. Any rabies virus detected in Svalbard the archipelago for most of the year and arctic foxes was characterized and compared normally only August and September are with other arctic regions, including three ice-free (Prestrud et al., 1992). However, arctic foxes from the Nenets region, Russia, sea ice has been more variable in recent collected during the winter season 1998– years due to the warming climate (Comiso 1999. Finally, we compared these findings et al., 2008). The largest island, Spitsber- with corresponding viral gene sequences of gen, is the most-densely populated with isolates obtained throughout the arctic region five resident settlements and approximate- (GenBank). A phylogenetic tree was created ly 3,000 inhabitants. to aid the spatial identification of the new Arctic foxes live in two main tundra isolates and to enhance understanding of the types, ‘‘coastal’’ or ‘‘inland tundra,’’ de- epidemiology of rabies in the Arctic. pending on the availability of food resourc- es (Braestrup, 1941). Inland foxes are MATERIALS AND METHODS dietary specialists relying on cyclic popula- Animals and samples tions of lemmings or other small rodents that fluctuate with a 3–5-yr periodicity. We collected 620 arctic foxes trapped in This dependency on prey availability causes Svalbard (74–80uN, 10–30uE) between 1996 and 2004 (Table 1). Arctic foxes are legally a wide yearly variation in arctic fox litter trapped for fur by professional and recrea- sizes and population densities. Coastal tional trappers and are captured in lethal- foxes living on islands or near the sea close baited traps during the harvest period, No- to bird cliffs, in areas without lemmings, vember–March. Carcasses of trapped foxes are dietary generalists, taking prey from were kept frozen, outdoors or in freezers, until they were skinned in April. Before skinning, both marine and terrestrial food webs; this carcasses were held for 7 days at 280 C to kill provides a more-stable food supply and the any eggs of the zoonotic cestode Echinococcus foxes produce cubs every year, although multilocularis (Veit et al., 1995). After skin- relatively few. Arctic foxes in Svalbard ning, they were held at 220 C until the belong to the coastal ecotype with a initiation of a research project in 2002. We also relatively stable population size (Fuglei et included 22 foxes found dead in the same period as well as samples from 10 arctic foxes al., 2003). Due to the absence of small trapped during the winter of 1998–1999 from rodents, except for a very limited number Amderma (69u459480N, 61u339480E; n55) and of sibling voles (Microtus levis, formerly Nizh Pesha (66u46900N, 47u469600E; n55) in Microtus rossiaemeridionalis) in a restrict- the Nenets region of northwest Russia close to ed area, they prey mainly on migratory the coast of the Barents Sea (Fig. 1). Age was determined for 540 of the 652 foxes birds during summer and scavenge car- by counting the annuli in the cementum of a casses of reindeer and seals during winter sectioned canine tooth (Grue and Jensen, (Frafjord, 1993; Eide et al., 2005). 1976). Sex and body condition were recorded MØRK ET AL.—RABIES IN ARCTIC FOXES IN NORWAY 947

TABLE 1. Numbers of Arctic foxes (Vulpes lagopus) from Svalbard (found dead and trapped) and Russia (trapped) for each year (1995–2004).

Found dead Trapped

Trapping season Svalbard Svalbard Russia Total

1995–1996 3 1 0 4 1996–1997 1 9 0 10 1997–1998 1 113 0 114 1998–1999 1 92 10 103 1999–2000 2 74 0 76 2000–2001 3 21 0 24 Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 2001–2002 0 125 0 125 2002–2003 10 108 0 118 2003–2004 1 77 0 78 Total 22 620 10 652 for all foxes. Body condition was determined Rabies virus detection—FAT by visual inspection of the amount of body fat Brain tissue from each fox was examined for on skinned carcasses and foxes were classified rabies virus by standard FAT (Meslin et al., with a fat index on a scale from 0 (no fat) to 4 1996) using rabies virus nucleocapsid-specific (extensive fat; Prestrud and Nilssen, 1992). antibodies labeled with fluorescein isothiocy- The brain was removed and sampled from anate (Sanofi Diagnostics Pasteur, Marne-La- all 652 fox carcasses. Hemolyzed blood or Coquette, France). tissue fluid was collected from heart cham- bers, large blood vessels, and the thoracic Enzyme-linked immunosorbent assay (ELISA) cavity of foxes during autopsy, except for 137 carcasses which were totally bled out or had Antibodies against rabies virus were detect- dried during storage. Blood and tissue fluid ed using the Platelia Rabies kit (Bio-Rad, samples were centrifuged (1,000 3 G, 10 min) Marnes La Coquette, France) for detection of to remove debris and the supernatant was antiglycoprotein antibodies involving peroxi- stored at 220 C for subsequent analysis. dase-conjugated protein A; the procedure was

FIGURE 1. Map showing Svalbard and the north-west Russian mainland. Limits of winter sea ice; maximum (outer dotted line), median (whole line), and minimum (inner dotted line). 948 JOURNAL OF WILDLIFE DISEASES, VOL. 47, NO. 4, OCTOBER 2011 done according to manufacturer’s instructions. cycle sequencing extension products was Samples were assayed at 1:100 dilutions in conductedinanABIPrismH 377 DNA duplicate wells. Serum from a ‘‘bluefox’’ Analyzer (Applied Biosystems). (farmed Vulpes lagopus) was used as positive The cDNA sequences were trimmed to control (vaccinated against rabies) (Rabisin equal length (308 nucleotides). For alignment vet., Merial, Lyon, France); dosage and time and comparison, corresponding gene sequenc- schedule were according to the manufacturer’s es from the nucleoprotein gene of previously instructions. Serum from an arctic fox held in reported (Mansfield et al., 2006; Johnson captivity for more than 2 yr was used as et al., 2007; Kuzmin et al., 2008) arctic rabies negative control. In the ELISA, the optical virus isolates were retrieved from GenBank density492 scores were approximately 2.6 and (National Center for Biotechnology Informa- were 0.06 for the positive and negative tion [NCBI]; Table 2). All sequences were Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 controls, respectively. Results were expressed aligned using two algorithms for comparison, as an ELISA-percentage relative to the namely Clustal V2 (Larkin et al., 2007) and controls (100% for positive control, 0% for Muscle 3.6 (Edgar, 2004). To examine these negative control; Guan et al., 2005). closely related gene sequences and the mini- mal distance between them, a phylogenetic Polymerase chain reaction and phylogeny tree, using the unweighted pair group method with arithmetic mean (UPGMA), was created Brain tissues from four arctic foxes, in which using MEGA4 software (Tamura et al., 2007). rabies virus antigen had been previously The reliability of the tree was assessed by detected by FAT, were included in the study bootstrapping (1,000 random data set repeats). for PCR, direct amplicon sequencing, and The DNA sequences (amplicons) were phylogeny. One of these, marked ‘‘Svalbard converted into amino acid sequences. Align- 1998,’’ originated from Svalbard whereas three ment of the amino acid sequences was carried animals, ‘‘Russia 1999’’ (number 6, 7, and 10), out using Clustal V2 (Larkin et al., 2007) and a were caught in Amderma, Nenets, northwest phylogenetic tree was created based on the Russia in 1999. Brain tissue from a rabies UPGMA method. All steps were carried out virus-positive (FAT) fox from Svalbard from using MEGA4 software (Tamura et al., 2007). 1999 was used as positive control. The reliability of the tree was assessed by A subsample of brain tissue of approximate- bootstrapping (1,000 random data set repeats). ly 100 mg was obtained from each arctic fox. The tissue was homogenized in eppendorf tubes in 1 ml TrizolH (Life Technologies, Inc., RESULTS Gaithersburg, Maryland, USA) and RNA extraction was performed according to the Age for 540 of the arctic foxes from manufacturer’s instructions. RNA was resus- Svalbard ranged from pups of the year pended in diethyl pyrocarbonate-treated wa- (classified as 1 yr old) to 13 yr old (mean ter. The cDNA synthesis and the reverse- 2.2, SD 1.9 yr). The proportion of females transcriptase PCR (RT-PCR) was performed as described (Heaton et al., 1997) with the was 45.6%. forward primer JW12 and the reverse primers JW6 (DPL), JW6 (E), and JW6 (M) targeting Rabies virus detection—FAT the nucleoprotein gene and generating ampli- Rabies virus antigen (nucleocapsid pro- cons of 605 base pairs (bp). PCR products were separated in a 2% agarose gel with tein) was detected by FAT in brain tissue CYBRH Greene (Roche Applied Biosciences, from two foxes from Svalbard. One fox was Basel, Switzerland) for DNA staining. found dead near Longyearbyen airport in Primers and dNTP were removed from May 1999, a female of approximately 1– amplicons using ExoSapIT reagent (Amer- 2 yr (included in previous phylogenetic sham Pharmacia, Uppsala, ), adding 1 ml/5 ml PCR product, and incubating 45 min study; Johnson et al., 2007). The other fox at 37 C followed by 20 min enzyme inactiva- was a 1-yr-old female, trapped at Aust- tion at 80 C. Cycle sequencing was conducted fjordnes during the trapping season 1998– in both directions using Big Dye 3.1 reagents 1999 and kept frozen until 2002. Both (ABI BigDyeH Terminator Version 3.1, Ap- were in poor body condition with barely plied Biosystems, Oslo, Norway). Two ml 125 mM EDTA, 2 ml 3 M sodium acetate, measurable subcutaneous fat (fat in- and 50 ml ethanol were added to the 20-ml dex51). All other foxes from Svalbard sequencing product. Electrophoresis of the were FAT-negative. MØRK ET AL.—RABIES IN ARCTIC FOXES IN NORWAY 949

TABLE 2. Rabies virus isolates (previously published and this study) included in phylogenetic analysis.

GenBank Sample Species Location Yeara Reference accession no. RABN1578 Arctic fox (Ontario) 1991 Mansfield et al., 2006 L20673 RABN0738 Arctic fox Canada (Ontario) 1991 Mansfield et al., 2006 L20675 RABN9196 Arctic fox Canada (Ontario) 1990 Mansfield et al., 2006 L20676 9105CAN Red fox Canada (Ontario) 1990 Mansfield et al., 2006 U22655 8480FX Red fox Canada (Ontario) 1993 Mansfield et al., 2006 U03768 4055DG Dog Canada, Hudson Bay 1992 Mansfield et al., 2006 U03770

1090DG Dog Canada, Arctic 1993 Mansfield et al., 2006 U03769 Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 RV163 Arctic fox Canada, Arctic 1989 Mansfield et al., 2006 DQ010124 6199 Red fox Canada (Ontario) 1991 Mansfield et al., 2006 U11734 2244 Red fox Canada (Ontario) 1993 Mansfield et al., 2006 U11735 RV53 Fox USA, Maine NA Mansfield et al., 2006 DQ010123 RV294 Arctic fox Russia, Yakutia 1990 Mansfield et al., 2006 AY352514 RV443 Horse Russia, Yakutia 1990 Mansfield et al., 2006 DQ010127 RV1336 Arctic fox Russia, Yakuti 2002 Mansfield et al., 2006 DQ010129 RVHK Human Russia, Norilsk 1998 Mansfield et al., 2006 AY352462 1420 Red fox USA, Alaska NA Mansfield et al., 2006 AY352499 1422 Arctic fox USA, Alaska NA Mansfield et al., 2006 AY352501 1421 Red fox USA, Alaska NA Mansfield et al., 2006 AY352500 RV441 Fox Belarus NA Mansfield et al., 2006 DQ010126 8684GRO Arctic fox Greenland 1981 Mansfield et al., 2006 U22654 RV1420 Arctic fox Greenland 2002 Mansfield et al., 2006 DQ010148 RV1391 Arctic fox Greenland 1990 Mansfield et al., 2006 DQ010132 RV1419 Arctic fox Greenland 2002 Mansfield et al., 2006 DQ010147 RV1413 Arctic fox Greenland 1997 Mansfield et al., 2006 DQ010143 RV1407 Arctic fox Greenland 1994 Mansfield et al., 2006 DQ010141 RV1396 Arctic fox Greenland 1991 Mansfield et al., 2006 DQ010136 sg92 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611835 sg15 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611840 sg91 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611834 sg12 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611837 sg3 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611832 sg1 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611839 sg10 Arctic fox Russia, Yakutia 1950–1960 Kuzmin et al., 2008 EF611838 sg23 Arctic fox Russia, Yakutia 1988 Kuzmin et al., 2008 EF611833 743a Arctic fox Russia, Yakutia 1988 Kuzmin et al., 2008 AY352488 sg22 Arctic fox Russia, Yakutia 1987 Kuzmin et al., 2008 EF611831 sg20 Arctic fox Russia, Yakutia 1987 Kuzmin et al., 2008 EF611830 sg19 Arctic fox Russia, Yakutia 1987 Kuzmin et al., 2008 EF611829 483a Arctic fox Russia, Yakutia 1986 Kuzmin et al., 2008 AY352487 sg21 Arctic fox Russia, Yakutia 1987 Kuzmin et al., 2008 EF611828 RV255 Arctic fox Russia, Yakutia 1988 Kuzmin et al., 2008 DQ010125 A4795 Dog USA, Alaska 1988 Kuzmin et al., 2008 AY352498 A6091 Red fox USA, Alaska 2006 Kuzmin et al., 2008 EF611849 A7026 Arctic fox USA, Alaska 2006 Kuzmin et al., 2008 EF611852 A7031 Arctic fox USA, Alaska 2006 Kuzmin et al., 2008 EF611851 A7032 Red fox USA, Alaska 2007 Kuzmin et al., 2008 EF611850 A7033 Red fox USA, Alaska 2007 Kuzmin et al., 2008 EF611845 A0905 Dog USA, Alaska 2006 Kuzmin et al., 2008 EF611853 A0903 Dog USA, Alaska 2006 Kuzmin et al., 2008 EF611855 A7007 Red fox USA, Alaska 2007 Kuzmin et al., 2008 EF611841 A6053 Red fox USA, Alaska 2006 Kuzmin et al., 2008 EF611847 A6086 Red fox USA, Alaska 2006 Kuzmin et al., 2008 EF611842 A0906 Arctic fox USA, Alaska 2006 Kuzmin et al., 2008 EF611856 A0904 Red fox USA, Alaska 2006 Kuzmin et al., 2008 EF611854 A6013 Red fox USA, Alaska 2006 Kuzmin et al., 2008 EF611848 950 JOURNAL OF WILDLIFE DISEASES, VOL. 47, NO. 4, OCTOBER 2011

TABLE 2. Continued.

GenBank Sample Species Location Yeara Reference accession no. A6054 Red fox USA, Alaska 2006 Kuzmin et al., 2008 EF611846 A7027 Red fox USA, Alaska 2007 Kuzmin et al., 2008 EF611843 Russia Arctic fox Russia, Nenets 1999 This study HM543741 1999-10 Russia Arctic fox Russia, Nenets 1999 This study HM543740 1999-7 Russia Arctic fox Russia, Nenets 1999 This study HM543739 1999-6 Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 1980 Arctic fox Norway, Svalbard 1980 Johnson et al., 2007 DQ397819 1981 Arctic fox Norway, Svalbard 1981 Johnson et al., 2007 DQ397820 1987 Arctic fox Norway, Svalbard 1987 Johnson et al., 2007 EF460817 Svalbard Arctic fox Norway, Svalbard 1998 This study HM543738 1998 1999 Arctic fox Norway, Svalbard 1999 Johnson et al., 2007 EF460818 2011 Arctic fox Norway, Svalbard 2011 Ørpetveit et al., 2011 FR798947 a NA 5 year not available.

Of the 10 Russian arctic foxes, three were from Nenets (Russia). When comparing positive for rabies virus by FAT, all from the these sequences with previously reported village of Amderma in the Nenets autono- rabies virus nucleoprotein sequences mous district. Two of the positive foxes were (gene basic local alignment search tool; males, estimated to be 2–3 yr old by tooth NCBI), they showed 100% homology to wear and having a low to medium body several rabies virus isolates (data not condition (fat index of 1 and 2). The third shown). Table 3 shows the alignment of FAT-positive fox was of unknown sex, the four sequences, demonstrating that approximately 1–2 yr old (fat index51). the four isolates from this study were identical in 310 nucleotides of the nucle- Antibodies against rabies virus glycoprotein oprotein gene, except for one of the Blood or tissue fluid samples from 515 animals (Russia 1999-6), which had six arctic foxes were assayed by ELISA; this mutations when compared to the three number included the single FAT-positive others reported here. fox that had been trapped on Svalbard, The phylogenetic tree based on nucle- two of the foxes found dead on Svalbard otide sequences of the nucleoprotein gene (one FAT-positive and one FAT-negative), (Fig. 2) revealed a very close phylogenetic and five of the 10 Russian foxes (three relationship between the isolates charac- FAT-positive and two FAT-negative). terized in this study (Svalbard, Norway Mean ELISA-percentage for the 515 foxes and Nenets, Russia) as well as with most of was 0.2 (SD50.3). The ELISA-percentage the corresponding gene sequences from was #1.8 for all the animals (#1.5 for the previously reported arctic rabies virus four FAT-positive foxes assayed), demon- isolates. strating an absence of antiglycoprotein Although distinct clusters were formed antibodies. (Fig. 2), they were closely related (high sequence homology). Group 1 contained PCR and phylogeny mainly isolates from Alaska, Svalbard, and Amplicons of the expected size (606 bp) Russia, including two of the new isolates were produced from brain tissue from all from Nenets in this study. Group 2 of the four rabies FAT-positive animals, consisted of isolates mainly from Ontario one from Svalbard (Norway) and three (Canada), one from Maine (United MØRK ET AL.—RABIES IN ARCTIC FOXES IN NORWAY 951

TABLE 3. Alignment of four gene sequences of 310 nucleotides, obtained by reverse-transcriptase–PCR, targeting the nucleoprotein gene of rabies virus; conducted on brain tissue of Arctic foxes (Vulpes lagopus) from Svalbard, Norway (n51) and Nenets, Russia (n53). The absence of an asterisk (rows below each grouping) indicates a difference in one or more of the sequences reported in this study.

Sample identification Sequence

Svalbard 1998 CCTGCTATTAAGGACTTGAAGAAGCCCAGTATCACCCTAGGGAAGGCCCCCGATTTGAAC Russia 1999-7 CCTGCTATTAAGGACTTGAAGAAGCCCAGTATCACCCTAGGGAAGGCCCCCGATTTGAAC Russia 1999-10 CCTGCTATTAAGGACTTGAAGAAGCCCAGTATCACCCTAGGGAAGGCCCCCGATTTGAAC Russia 1999-6 CCTGCTATTAAGGACTTGAAGAAGCCCAGTATCACCCTAGGGAAAGCCCCCGATTTGAAC

******************************************** *************** Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 Svalbard 1998 AAGGCATACAAGTCAGTTTTATCAGGCTTGAATGCTGCCAAGCTTGATCCTGATGACGTA Russia 1999-7 AAGGCATACAAGTCAGTTTTATCAGGCTTGAATGCTGCCAAGCTTGATCCTGATGACGTA Russia 1999-10 AAGGCATACAAGTCAGTTTTATCAGGCTTGAATGCTGCCAAGCTTGATCCTGATGACGTA Russia 1999-6 AAGGCATACAAGTCAGTTTTATCAGGCTTGAATGCTGCCAAGCTTGATCCTGATGACGTA ************************************************************ Svalbard 1998 TGTTCCTACTTAGCAGCTGCAATGCAGTTCTTCGAGGGGACGTGTCCCGAAGACTGGACC Russia 1999-7 TGTTCCTACTTAGCAGCTGCAATGCAGTTCTTCGAGGGGACGTGTCCCGAAGACTGGACC Russia 1999-10 TGTTCCTACTTAGCAGCTGCAATGCAGTTCTTCGAGGGGACGTGTCCCGAAGACTGGACC Russia 1999-6 TGTTCCTATTTAGCAGCCGCAATGCAGTTCTTCGAGGGGACGTGTCCCGAAGACTGGACC ******** *************************************************** Svalbard 1998 AGCTATGGGATCCTGATTGCACGGAAAGGAGATAAGATCACCCCAGATTCTCTGGTGGAG Russia 1999-7 AGCTATGGGATCCTGATTGCACGGAAAGGAGATAAGATCACCCCAGATTCTCTGGTGGAG Russia 1999-10 AGCTATGGGATCCTGATTGCACGGAAAGGAGATAAGATCACCCCAGATTCTCTGGTGGAG Russia 1999-6 AGCTATGGGATCCTGATTGCGCGGAAAGGAGATAAGATCACCCCAGATTCTCTGGTGGAG ******************** *************************************** Svalbard 1998 ATAAAGCGTACCGGTGTAGAAGGGAATTGGGCTTTGACGGGAGGGATGGAACTGACGAGG Russia 1999-7 ATAAAGCGTACCGGTGTAGAAGGGAATTGGGCTTTGACGGGAGGGATGGAACTGACGAGG Russia 1999-10 ATAAAGCGTACCGGTGTAGAAGGGAATTGGGCTTTGACGGGAGGGATGGAACTGACGAGG Russia 1999-6 ATAAAGCGTACTGGTGTAGAAGGGAATTGGGCTTTGACGGGAGGGATGGAACTGACTAGG *********** ************************************************ Svalbard 1998 GACCCCACTG Russia 1999-7 GACCCCACTG Russia 1999-10 GACCCCACTG Russia 1999-6 GACCCCACTG **********

States), and one from Greenland. Group 3 DISCUSSION has a circumpolar distribution and consists of isolates from Alaska, Greenland, arctic Virus antigen was detected in brain Canada, and Russia, including one new tissue from only two of 642 foxes from isolate from Nenets and one recent isolate Svalbard (0.3%; 1997–2004), one fox from Svalbard (2011). Group 4 consisted found dead and one trapped. Rabies was of isolates from Alaska (2006). These detected for the first time in Svalbard in clusters were mainly in accordance with 1980 and, during the following decade previously described phylogenetic groups (1980–1989), the prevalence of infection (Mansfield et al., 2006; Kuzmin et al., was estimated to be #1% based on FAT 2008). At the amino acid level, the (Prestrud et al., 1992). homology between the rabies virus iso- There are relatively few studies of lates in this comparison was even greater; rabies virus infection in trapped arctic all except one isolate had 100% homol- foxes, and the prevalence of infection ogy (data not shown). All sequences we seems to vary (Kantorovich, 1964; Secord report have been deposited in GenBank et al., 1980; Prestrud et al., 1992). In the (Table 2). Canadian Arctic, rabies virus was detected 952 JOURNAL OF WILDLIFE DISEASES, VOL. 47, NO. 4, OCTOBER 2011 Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021

FIGURE 2. Phylogenetic tree (UPGMA) comparing the phylogenetic relationship between nucleoprotein gene sequences from our isolates from Svalbard (Svalbard 1998, HM543738) and Russia (Russia 1999–6, HM543739; Russia 1999–7, HM543740; Russia 1999–10, HM543741) with corresponding sequences from previously reported rabies virus isolates (GenBank). The Svalbard isolate is depicted in italic typeface, MØRK ET AL.—RABIES IN ARCTIC FOXES IN NORWAY 953 by FAT in 21.9% of trapped foxes 1999) from the Nenets region were found (n5201)fromaregionwithendemic positive for rabies virus antigen. Although rabies, while foxes from three other the number of foxes from Russia included in endemic regions were all negative the present study is low and gives no valid (n5127, n5100, and n593, respectively; prevalence, it seems likely that these Secord et al., 1980). The low prevalence of findings reflect a considerably higher prev- rabies virus infection in the trapped arctic alence in Nenets compared to Svalbard, a foxes reported in this study may be due to possibility that is also supported by the the hypothesis that animals with clinical reported outbreaks in this region during the rabies, showing altered behavior, are less year of sampling (1999; WHO, 1999a, b). Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 likely to be caught using baited traps We found no antibody-positive arctic (Secord et al., 1980). However, the clinical foxes in our study. In a previous study of phase of rabid arctic foxes has been arctic foxes in Alaska, rabies virus anti- reported to be as short as 1 or 2 days bodies were detected in four of 92 animals (Crandell, 1991), which indicates that (4%), yet virus could not be detected in being infected with rabies virus may central nervous tissues from the antibody- represent only a restricted possible bias positive animals. The authors concluded to the trapping. The relatively high that the foxes had been exposed to rabies, prevalence of rabies in some studies produced an immunological response, and (21.9%) has been explained with the survived the infection (Ballard et al., presumption that the foxes were in the 2001). Low rabies antibody titers (0.05– prodromal stage of the disease when 0.09 IU/ml) have also been demonstrated caught (i.e., infected but not showing among Canadian Inuits that showed no clinical signs; Secord et al., 1980). Even indication of clinical rabies (Orr et al., if the probability of trapping animals 1988), indicating that exposure to rabies with clinical rabies is low, it is likely that virus without developing disease is also the rabies prevalence in Svalbard has possible for humans. This is further remained low since 1980 because very supported by the finding of a high titer few, and only sporadic, cases have been of antirabies antibodies in the blood of reported. a nonvaccinated and apparently healthy A very high prevalence of rabies virus arctic fox trapper in Alaska (Follmann infection (69–75%) was found among et al., 1994). The fact that none of the trapped foxes during epizootics in the arctic foxes in our study were antibody- Nenets region in Russia in the 1950s, and positive is in concordance with the low a low prevalence (3–10%) was found during frequency of foxes with rabies virus periods between the outbreaks (Kantoro- antigen in brain tissue (FAT). vich, 1964). An outbreak of rabies was Because arctic foxes may follow polar reported from this region during the first bears (Ursus maritimus) onto the sea ice 6 mo of 1999, when 55 reindeer, five arctic to feed on remains of killed seals (Hiruki foxes, and four dogs were diagnosed as and Stirling, 1989), the chance for these rabies virus infected (WHO, 1999a, b). In two species to have physical contact is our study, three of 10 trapped foxes (all from high. Polar bears may also be occasionally r while isolates in bold italic typeface designate the Russian isolates. Group 1 contains mainly isolates from Alaska, Svalbard, and Russia. Group 2 consists of isolates mainly from Ontario (Canada) as well as one isolate from Maine (United States) and one isolate from Greenland. Group 3 has a circumpolar distribution and consists of isolates from Alaska, Greenland, Canada, Russia, and the most recent isolate from Svalbard. Group 4 consists of isolates from Alaska (2006). 954 JOURNAL OF WILDLIFE DISEASES, VOL. 47, NO. 4, OCTOBER 2011 exposed to rabies virus, as reported from arctic fox populations in Alaska have been Canada (Taylor et al., 1991). An investi- described as occurring every 3–4 yr (Foll- gation of brain tissue from 23 polar bears mann et al., 1992). High population from Svalbard was negative for rabies densities of arctic foxes, as a result of a virus antigen (Prestrud et al., 1992), and peak in prey abundance, will lead to stress a serologic screening of 266 polar bears when the prey population crashes, leading from different regions of Svalbard and to congregation around carcasses and from the pack ice of the central Barents increased migration that will favor rabies Sea (1990–1998) classified all the animals virus transmission (Johnston and Fong, as antibody-negative (Tryland et al., 2005). 1992). The arctic foxes in west Greenland Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 The low prevalence of rabies virus belong to the coastal ecotype, but the infection in the arctic fox population in population still seems to fluctuate annually, Svalbard since the outbreak in 1980 begs possibly due to immigration of foxes from the question of whether the virus has been Canada (Pagh and Hersteinsson, 2008), enzootic in this population or if it is more and rabies is reported almost annually in likely that the virus has been introduced the western part of the country (Mansfield occasionally, possibly by migrating foxes. et al., 2006). Arctic foxes in Svalbard also Arctic foxes are able to migrate extremely belong to the coastal ecotype. Even if the long distances (Tarroux et al., 2010). number of arctic foxes has also been shown Genetic studies show that a high gene to vary on a local scale in Svalbard (Fuglei flow, due to frequent long-distance forag- et al., 2003), the variation is far less than in ing movements, has resulted in a panmitic inland tundra areas. The fox density in one circumpolar population of arctic foxes area of Svalbard, in Adventdalen and (Dale´n et al., 2005; Charmichael et al., Sassendalen (900 km2), has been estimated 2007; Geffen et al., 2007) and that the to 0.1–0.15 animals per km2 (Eide, 2002), occurrence of sea ice is likely the most considerably lower than in other arctic important factor in explaining the genetic regions with arctic foxes of the inland variation of Arctic fox populations in high ecotype. In Sweden, the density of red Arctic islands (Geffen et al., 2007). The foxes (Vulpes vulpes) is estimated to be archipelago of Svalbard may be a closed 0.2–0.4 foxes per km2, which is regarded as entity for the arctic fox during summer too low for the generation of rabies but, during winter, these islands are epizootics (Holmala and Kauhala, 2006). normally surrounded by pack ice, enabling Thus, the even-lower and more-stable fox foxes to migrate between Svalbard and, for population density in Svalbard can explain example, Novaja Semlja, Russia (Fuglei the lack of reported epizootics. It is also and Øritsland, 2003) or other Arctic possible that rabies virus has been enzootic tundra areas in Russia (Nore´netal., in Svalbard since 1980 but has remained 2011). As is suggested for the introduction undiscovered within the arctic fox popula- of the parasite Echinococcus multilocularis tion on these remote islands. to Svalbard (Henttonen et al., 2001), it is We generated a phylogenetic tree using likely that rabies was first introduced, and UPGMA (Fig. 2) and similar trees using perhaps repeatedly reintroduced, through neighbor-joining and maximum parsimony migration of foxes over sea ice (Prestrud models (data not shown). All three models et al., 1992; Johnson et al., 2007). produced similar results, sharing the same Rabies epizootics among arctic foxes of distinct clusters with good bootstrap the inland ecotype are known to be cyclic support, but we present the UPGMA and most often occur during high popula- method because it is based on the tion densities when the population increas- minimum distance between sequences es along with populations of small rodents and because our aim was to examine (Ballard et al., 2001). Rabies epizootics in closely related rabies virus strains. MØRK ET AL.—RABIES IN ARCTIC FOXES IN NORWAY 955

In previous phylogenetic studies, Arctic nucleoprotein gene are useful for detec- rabies virus isolates have been divided tion of rabies virus variants, but other into groups. Mansfield and coworkers regions of the genome should be used to (2006) described isolates from mainly distinguish rabies virus isolates for epide- Ontario, Canada as one group, indicating miologic purposes. a southward spread of rabies virus from Results from the screening for rabies the Canadian Arctic during an epizootic virus antigen and antibodies indicate that in the 1950s (Nadin-Davis et al., 2006). A the incidence of rabies has remained low second group consisted of isolates from since the outbreak in 1980 or that rabies

Russia and Alaska, and a third circumpo- has possibly not remained enzootic in the Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 lar group consisted of isolates from arctic fox population in Svalbard. The coastal areas of Greenland, Russia, Can- phylogenetic comparison of the rabies ada, and Alaska. This latter group was virus isolates from Svalbard with isolates suggested to be a result of spread from other Arctic regions, as well as throughout the polar sea ice. Kuzmin genetic studies, show consistent contact and coworkers (2008) included more between fox populations among Arctic isolates from Alaska and Russia and regions and supports the likelihood that concluded with a similar set of three rabies virus is repeatedly introduced through groups, with one additional group con- migration, presumably from Russia. Climate sisting of recent (2006) Alaskan isolates. change and a reduction in the extent of the According to Johnson et al. (2007), polar sea ice could reduce the spread of Svalbard isolates (1980, 1981, 1987, and rabies and other diseases to Svalbard due to 1999) clustered with Russian isolates from less migration over pack ice. Due to the high northeast Siberia and less with Greenland degree of homology between sequences of isolates, which was taken as support for this part of the nucleoprotein gene between the theory that rabies was introduced to Arctic rabies virus isolates, other and more Svalbard by migrating arctic foxes from variable regions of the genome should be the Russian mainland. We report the used to distinguish rabies virus isolates for corresponding nucleotide sequences from epidemiologic purposes. a new isolate from Svalbard and from three isolates from Nenets region, Russia, ACKNOWLEDGMENTS an area further west and much closer to We thank Eva-Marie Breines for excellent Svalbard than the previous Russian iso- assistance in the laboratory. We also thank the lates (Johnson et al., 2007). The UPGMA trappers for providing carcasses of arctic foxes from Svalbard and A. Bambulyak for providing phylogenetic tree (Fig. 2) demonstrated carcasses of arctic foxes from Amderma and that our, and previous, isolates from Nizh Pesha, Russia. We also acknowledge the Svalbard, and two of the three isolates cooperation with the Governor of Svalbard. from Nenets, clustered with a group dominated by isolates from Alaska and LITERATURE CITED Russia (Fig. 2, group 1) and not, as could BALLARD, W. B., E. H. FOLLMANN,D.G.RITTER, be expected, with the circumpolar group M. D. ROBARDS, AND M. A. CRONIN. 2001. Rabies (Fig. 2, group 3). The third isolate from and canine distemper in an arctic fox population in Alaska. Journal of Wildlife Diseases 37: 133–137. Nenets that differed from the two others BRAESTRUP, F. W. 1941. A study of the arctic fox in had an identical nucleoprotein sequence Greenland—Immigrations, fluctuations in num- in all but one nucleotide, as compared to bers based mainly on trading statistics. Medde- the corresponding sequence from the lelser om Grønland 131: 1–101. most recent rabies virus isolate from CHARMICHAEL, L. E., J. KRIZAN,A.NAGY,E.FUGLEI,M. DUMOND,D.JOHNSON,A.VEITCH,D.BERTEAUX, Svalbard (Ørpetveit et al., 2011), and AND C. STROBECK. 2007. Historical and ecological clustered with group 3 (Fig. 2). These determinants of genetic structure in arctic canids. data suggest that the primers targeting the Molecular Ecology 16: 3466–3483. 956 JOURNAL OF WILDLIFE DISEASES, VOL. 47, NO. 4, OCTOBER 2011

COMISO, J. C., C. L. PARKINSON,R.GERSTEN, AND L. genotypes of rabies and rabies-related viruses. STOCK. 2008. Accelerated decline in the Arctic Journal of Clinical Microbiology 35: 2762–2766. sea ice cover. Geophysical Research Letters 35: HENTTONEN,H.,E.FUGLEI,C.N.GOWER,V.HAUKI- L01703. doi:10.1029/2007GL031972. SALMI,R.A.IMS,J.NIEMIAA, AND N. G. YOCCOZ. CRANDELL, R. A. 1991. Arctic fox rabies. In The natural 2001. Echinococcus multilocularis on Svalbard: history of rabies, Vol. II, G. M. Baer (ed.). CRC Introduction of an intermediate host has enabled Press Inc., Boca Raton, Florida, pp. 291–306. the local life-cycle. Parasitology 123: 547–552. ´ DALEN, L., E. FUGLEI,P.HERSTEINSSON,C.KAPEL,J. HIURKI, L. M., AND I. STIRLING. 1989. Population ROTH,G.SAMELIUS,M.TANNERFELDT, AND A. dynamics of the arctic fox (Alopex lagopus), on ANGERBJØRN. 2005. Population history and ge- Banks Island, Northwest territories. Canadian netic structure of a circumpolar species: The Field-Naturalist 103: 380–387. arctic fox. Biological Journal of the Linnean HOLCK, S. N. 1989. Rabiesforekomst i Grønland før Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 Society 84: 79–89. og nu. Dansk Veterinær Tidsskrift 72: 22–30. EDGAR, R. C. 2004. MUSCLE: A multiple sequence HOLMALA,K.,AND K. KAUHALA. 2006. Ecology of wildlife alignment method with reduced time and space rabies in Europe. Mammal Review 36: 17–36. complexity. BMC Bioinformatics 5: 113. JOHNSTON, D. H., AND D. W. FONG. 1992. Epidemi- EIDE, N. E. 2002. Spatial ecology of arctic foxes. ology of arctic fox rabies. In Wildlife rabies Relations to resource distribution, and spatio- control, K. Bogel, F.-X. Meslin and M. Kaplan temporal dynamics in prey abundance. Doctor (eds.). Wells Medical Ltd., Kent, UK, pp. 45–49. Scientiarum Thesis, Agricultural University of JOHNSON, N., A. DICKER,T.MØRK,D.A.MARSTON, Norway, A˚ s, Norway, 82 pp. A. R. FOOKS,M.TRYLAND,E.FUGLEI, AND T. ———, P. M. EID,P.PRESTRUD, AND J. E. SWENSON. MU¨ LLER. 2007. Phylogenetic comparison of 2005. Dietary responses of arctic foxes Alopex rabies viruses from disease outbreaks on the lagopus to changing prey availability across an Svalbard Island. Vector-Borne and Zoonotic Arctic landscape. Wildlife Biology 11: 109–121. Diseases 7: 457–460. FOLLMANN, E. H., D. G. RITTER, AND G. M. BAER. KANTOROVICH, R. A. 1964. Natural foci of a rabies-like 1992. Oral vaccination of arctic foxes (Alopex infection in the far north. Journal of Hygiene, lagopus) with an attenuated vaccine. Vaccine 10: Epidemiology, Microbiology and Immunology 8: 305–308. 100–110. ———, ———, AND M. BELLER. 1994. Survey of fox KUZMIN, I. V., G. J. HUGHES,A.D.BOTVINKIN,S.G. trappers in northern Alaska for rabies antibodies. GRIBENCHA, AND C. E. RUPPRECHT. 2008. Arctic Epidemiology and Infection 113: 137–141. and Arctic-like rabies viruses: Distribution, FRAFJORD, K. 1993. Food habits of arctic foxes phylogeny and evolutionary history. Epidemiol- (Alopex lagopus) on the western coast of ogy and Infection 136: 509–519. Svalbard. Arctic 46: 49–54. LARKIN, M. A., G. BLACKSHIELDS,N.P.BROWN,R. FUGLEI, E., AND N. A. ØRITSLAND. 2003. Energy cost of running in an arctic fox, Alopex lagopus. CHENNA,P.A.MCGETTIGAN,H.MCWILLIAM,F. Canadian Field-Naturalist 117: 430–435. VALENTIN,I.M.WALLACE,A.WILM,R.LOPEZ, J. D. THOMPSON,T.J.GIBSON, AND D. G. ———, ———, AND P. PRESTRUD. 2003. Local variation in arctic fox abundance on Svalbard, HIGGINS. 2007. Clustal W and Clustal X version Norway. Polar Biology 26: 93–98. 2.0. Bioinformatics 23: 2947–2948. ANSFIELD ACLOZ C LHINNEY GEFFEN, E., S. WAIDYARTNE,L.DALE´ N,A.ANGER- M , K. L., V. R ,L.M.ME , ARSTON OHNSON NSHOLT BJO¨ RN,C.VILA,P.HERSTEINSSON,E.FUGLEI,P.A. D. A. M ,N.J ,L.Rø ,L.S. WHITE,M.GOLTSMAN,C.M.KAPELL, AND K. CHRISTENSEN,E.NEUVONEN,A.D.BOTVINKIN, WAYNE. 2007. Sea ice occurrence predicts C. E. RUPPRECHT, AND A. R. FOOKS. 2006. genetic isolation in the Arctic fox. Molecular Molecular epidemiological study of Arctic rabies Ecology 16: 4241–4255. virus isolates from Greenland and comparison GRUE, H., AND B. JENSEN. 1976. Annual cementum with isolates from throughout the Arctic and structures in canine teeth in arctic foxes (Alopex Baltic regions. Virus Research 116: 1–10. lagopus L.) from Greenland and Denmark. MESLIN, F. X., M. M. KAPLAN, AND H. KOPROWSKI. Danish Review of Game Biology 10: 1–12. 1996. Laboratory techniques in rabies, 4th GUAN, G., J. LUO,M.MA,D.YANG,Y.WANG,J.GAO, Edition. World Health Organization, Geneva, H. SUN,Z.LIU,A.LIU,Z.DANG,C.BOULARD, Switzerland, 476 pp. AND H. YIN. 2005. Sero-epidemiological surveil- NADIN-DAVIS, S. A., F. MULDOON, AND A. I. WANDE- lance of hypodermosis in yaks and cattle in north LER. 2006. Persistence of arctic fox strain of China by ELISA. Veterinary Parasitology 129: Rabies virus in southern Ontario. Canadian 133–137. Journal of Veterinary Research 70: 11–19. HEATON, P. R., P. JOHNSTONE,L.M.MCELHINNEY,R. NORE´ N, K., L. CHARMICHAEL,E.FUGLEI,N.EIDE,P. COWLEY, E. O’SULLIVAN, AND J. E. WHITBY. 1997. HERSTEINSSON, AND A. ANGERBJO¨ RN. 2011. Pulses Heminested PCR assay for detection of six of movements across the sea ice: Population MØRK ET AL.—RABIES IN ARCTIC FOXES IN NORWAY 957

connection and temporal genetic structure in the foxes trapped in the Canadian arctic. Canadian arctic fox. Oecologia 166: 973–984. Veterinary Journal 21: 297–300. ØDEGAARD,Ø.A.,AND J. KROGSRUD. 1981. Rabies in SINGLETON, R. J. 1969. The history of rabies in Canada. Svalbard: Infection diagnosed in arctic fox, rein- Canadian State Veterinary Journal 24: 205–209. deer and seal. Veterinary Record 109: 141–142. TAMURA, K., J. DUDLEY,M.NEI, AND S. KUMAR. 2007. ØRPETVEIT, I., B. YTREHUS,T.VIKØREN,K.HANDE- MEGA4: Molecular evolutionary genetics anal- LAND,A.MJØS,S.NISSEN,H.BLYSTAD, AND A. ysis (MEGA) software version 4.0. Molecular LUND. 2011. Rabies in an arctic fox on the Biology and Evolution 24: 1596–1599. Svalbard archipelago, Norway, January 2011. TARROUX,A.,D.BERTEAUX, AND J. BETY. 2010. Northern Eurosurveillance 16: 17 February. nomads: Ability for extensive movements in adult ORR, P. H., M. R. RUBIN, AND F. Y. AOIK. 1988. arctic foxes. Polar Biology 33: 1021–1026. Downloaded from http://meridian.allenpress.com/jwd/article-pdf/47/4/945/2239687/0090-3558-47_4_945.pdf by guest on 25 September 2021 Naturally acquired serum rabies neutralizing TAYLOR, M., B. ELKIN,N.MAIER, AND M. BRADLEY. antibody in a Canadian Inuit population. Arctic 1991. Observation of a polar bear with rabies. Medical Research 47: 699–700. Journal of Wildlife Diseases 27: 337–339. PAGH, S., AND P. HERSTEINSSON. 2008. Difference in TRYLAND, M., E. NEUVONEN,A.HUOVILAINEN,H. diet and age structure of blue and white arctic TAPIOVAARA,A.OSTERHAUS,Ø.WIIG, AND A. E. foxes (Vulpes lagopus) in the Disko Bay area, DEROCHER. 2005. Serologic survey for selected West Greenland. Polar Research 27: 1–8. virus in polar bears at Svalbard. PRESTRUD, P., AND K. NILSSEN. 1992. Fat deposition Journal of Wildlife Diseases 41: 310–316. and seasonal variation in body composition of VEIT, P., B. BILGER,V.SCHAD,J.SCHA¨ FER,W.FRANK, arctic foxes in Svalbard. Journal of Wildlife AND R. LUCIUS. 1995. Influence of environmental Management 56: 221–233. factors on the infectivity of Echinococcus multi- ———, J. KROGSRUD, AND I. GJERTZ. 1992. The locularis eggs. Parasitology 110: 79–86. occurrence of rabies in the Svalbard island of WAMBERG, K. 1960. Rabies i Grønland. Nordisk Norway. Journal of Wildlife Diseases 28: 57–63. Veterinær Medisin 12: 769–796. RAUSCH, R. 1958. Some observation on rabies in Alaska, with special reference to wild canidae. WILLIAMS, R. B. 1949. Epizootic of rabies in interior Journal of Wildlife Management 22: 246–260. Alaska. Canadian Journal of Comparative Med- icine 13: 136–143. RITTER, D. 1981. Rabies. In Alaskan wildlife diseases, R. A. Dieterich (ed.). Institute of Arctic Biology, WORLD HEALTH ORGANIZATION (WHO). 1999a. Rabies University of Alaska, Fairbanks, Alaska, pp. 6–12. cases. Rabies Bulletin Europe 23 /No 1: 17–23. SCHNEIDER, L. G., Ø. A. ØDEGAARD,J.MUELLER, AND http://www.who-rabies-bulletin.org/Journal/Archive/ M. SELIMOV. 1985. Application of monoclonal Bulletin_1999_1.pdf. Accessed August 2011. antibodies for epidemiological investigation and ——— . 1990b. Rabies cases. Rabies Bulletin Europe oral vaccination studies. II. Arctic viruses. In 23 /No 2: 17–24. http://www.who-rabies-bulletin. Rabies in the Tropics, E. Kuwert, C. Merieux, org/Journal/Archive/Bulletin_1999_2.pdf. Accessed H. Koprowski and K. Bo¨gel (eds.). Springer– August 2011. Verlag, Berlin, Germany, pp. 47–59. SECORD, D. C., J. A. BRADLEY,R.D.EATON, AND D. Submitted for publication 28 September 2010. MITCHELL. 1980. Prevalence of rabies virus in Accepted 9 April 2011.