Osmanthus Fragrans) Based on Transcriptomic Sequence Data

RESEARCH ARTICLE

Identiﬁcation and validation of reference genes for gene expression studies in sweet osmanthus (Osmanthus fragrans) based on transcriptomic sequence data

HONGNA MU1,2, TAOZE SUN2, CHEN XU1, LIANGGUI WANG1∗ , YUANZHENG YUE1, HUOGEN LI3 and XIULIAN YANG1

1College of Landscape Architecture, Nanjing Forestry University, No. 159, Longpan Road, Nanjing, Jiangsu 210037, People’s Republic of China 2College of Horticulture and Gardening, Yangtze University, No. 88 Jingmi Road, Jingzhou 434025, Hubei, People’s Republic of China 3The Key Laboratory of Forest Genetics and Gene Engineering, Nanjing Forestry University, No. 159, Longpan Road, Nanjing, Jiangsu 210037, People’s Republic of China

Abstract Accurate normalized data is a primary requisite for quantifying gene expression using RT-qPCR technology. Despite this importance, however, suitable reference genes in Osmanthus fragrans are not available. In this study, seven potential candidate reference genes (OfL25-1, OfL25-10, OfRP2, OfTUA, OfTUB3, OfUBQ2andOf18S) were evaluated to determine which one would be the most reliable reference genes. The expression levels of the candidate reference genes were analysed by RT-qPCR in flower, leaf, pedicel, blossom bud tissues, as well as in floral organs at different developmental stages. GeNorm and NormFinder were used to statistically analyse transcript variation. Results indicated that OfRP2 and OfL25-10 were the optimal reference genes for use in RT-qPCR when analysing different stages of floral development; while OfTUB3 and OfL25-1 were optimal across tissues. The selected reference genes were used to examine OfMYB1 expression. The results appeared to be useful for future gene expression analyses aiming to characterize developmental stages and tissues of O. fragrans.

[Mu H., Sun T., Xu C., Wang L., Yue Y., Li H. and Yang X. 2017 Identiﬁcation and validation of reference genes for gene expression studies in sweet osmanthus (Osmanthus fragrans) based on transcriptomic sequence data. J. Genet. 96, 273–281]

Introduction data from Osmanthus was utilized to analyse secondary metabolism at the transcript level (Mu et al. 2014). Osmanthus fragrans is a widely cultivated ornamental plant Gene expression analysis has provided crucial informa- in China and a total of 189 cultivars have been reported tion for understanding gene function. Among the different to date (Zang et al. 2006, 2014; Hu et al. 2014; Xiang expression analysis techniques, real time quantitative poly- et al. 2014a, b). Fragrance (aroma) is regarded as the most merase chain reaction (RT-qPCR) has been widely used important trait in Osmanthus. However, at present, the due to its high accuracy, efﬁciency and low cost (Bustin genes and metabolic pathways that regulate the biosynthe- 2002; Artico et al. 2010). The most common method sis of fragrance compounds in Osmanthus remain largely used to ensure the accuracy of the obtained gene expres- uncharacterized. In our previous research, transcriptome sion data utilizes endogenous genes as reference genes to normalize the expression level of other genes of inter- *For correspondence. E-mail: [email protected]. est (Vandesompele et al. 2009). The ideal reference gene HNM, LGW and HGL participated in the design of the study.HNM, CX should exhibit a stable expression level in different tissues and TZS performed the experimental work and drafted the manuscript. and cell types under various developmental, environmen- HNM and XLY contributed to the data analysis. HNM, LGW, YZY and HGL contributed to the revisions of the manuscript. All authors tal and experimental conditions (Nolan et al. 2006, Wan have read and approved the ﬁnal manuscript. et al. 2010).

Keywords. reference gene selection; validation; OfTUB; OfRP2; Osmanthus fragrans.

Journal of Genetics, DOI 10.1007/s12041-017-0769-8, Vol. 96, No. 2, June 2017 273 Hongna Mu et al.

Recently, several studies on the validation of reference within a 1-h time period in the morning from 9 to 10 am. genes in different plant species have been reported, includ- All samples were frozen in liquid nitrogen after being har- ing O. fragrans (Zhang et al. 2015), Polygonum convolvulus vested and were subsequently stored at −80◦C until total (Demidenko et al. 2011), Vitis vinifera (Ferrandino and RNA extraction. All seven candidate reference genes were Lovisolo 2014), Atropa belladonna (Li et al. 2014), Malus used in the RT-qPCR analysis for all the collected sam- × domestica (Bowen et al. 2014), Petunia hybrida (Mal- ples (see ‘Reference gene detailed information’ in electronic lona et al. 2010)andRosa hybrida (Meng et al. 2013). supplementary material at http://www.ias.ac.in/jgenet/). Most of these studies used a list of reference genes from other plant species and tested them under their own Extraction of total RNA and cDNA synthesis experimental conditions. RT-qPCR data were subjected Total RNA was extracted from the bud, petal, leaf, pedicel to analyses using software geNorm (Vandesompele et al. and root samples using a Tiangen Plus plant total RNA 2002), NormFinder (Andersen et al. 2004), or BestKeeper extraction kit (Tiangen, Beijing, China). The integrity (Pfaffl et al. 2004) to statistically identify the most sta- of the RNA samples was assessed by gel electrophoresis ble reference gene among a group of candidate genes in on 1.5% agarose gel. Approximately 1 μg of total RNA a defined set of biological samples. Typical genes exam- was reverse-transcribed into first strand cDNA using a ined as potential candidates include ubiquitin and tubulin TransScript First-Strand cDNA Synthesis SuperMix kit genes. Ubiquitin directs the localization of various proteins (Transgene, Beijing, China) according to the manufac- to specific cellular compartments, including proteasomes turer’s instructions. that breakdown and recycle proteins (Callis et al. 1995). Tubulin proteins are composed of α-tubulin and β-tubulin, Identification and validation of candidate reference genes which play important roles in plant growth and develop- The expression stability of candidate reference genes was ment (Chuong et al. 2004). In this study, seven potential calculated using two different software packages (geNorm housekeeping genes, belonging to the tubulin and ubiquitin and NormFinder) that utilize two different methods to gene families, were selected from the O. fragrans transcrip- calculate stability. The first software package (geNorm) is tome. The objective was to identify and validate optimal a visual application tool for Microsoft Excel that oper- reference genes that could be used in RT-qPCR analysis ates on the assumption that the expression ratio of two in different vegetative tissues and floral tissues at different ideal reference genes is constant in the different groups developmental stages in sweet osmanthus (O. fragrans). of templates. A gene expression stability value (M) was calculated for all the candidate reference genes that were < . Materials and methods examined. In a previous report, a M value 1 5 was rec- ommended by Vandesompele et al. (2002). To identify Plant material suitable Osmanthus reference genes, unigenes of tradi- tional housekeeping genes were selected from three O. Cultivated plants of O. fragrans (‘Zaoyingui’ and ‘Cheng- fragrans transcriptome datasets; including one α-tubulin hongdangui’) located at the campus of Nanjing Forestry gene (OfTUA), one β-tubulin gene (OfTUB3), one ubiq- University, aged ∼18 years were used for all the analyses. uitin gene (OfUBQ), two large subunit ribosomal protein Stages of floral development are defined as described by genes (OfL25-1 and OfL25-10) and one RNA polymerase Han et al. (2013)andDong et al. (2014). All samples were II subunit gene (OfRP2). However, the validity of the 18S collected in September 2013. gene as a reference gene was not assessed in a previous The collection of samples was designed to be able to study of O. fragrans by Han et al. (2013). Therefore, Of18S identify potential reference genes that could be used in a was also assessed as one of the seven potential candi- variety of tissues and flowers at different developmental date reference genes in the current study. Each reference stages. Therefore, leaves, buds, flowers (initial flowering gene was used to normalize the expression profile of the stage), pedicels and roots were collected. In addition, OfMYB1 gene, which was cloned in our research lab from samples from various stages of blooms were also col- O. fragrans ‘Chenghongdangui’ petals. The resulting RT- lected. These were classified as: stage 1 (the Dingke stage) qPCR data was then further analysed to determine which with unfolded bud scales and protruded inflorescence (fig- candidate reference genes provided the best assessment of ure 1a); stage 2 (the Xiangyan stage), with petals which still OfMYB1 expression. remain folded (figure 1b); stage 3 (the Linggeng stage), with elongated pedicels and petals which remain unopened (fig- Expression profiles of reference genes ure 1c); stage 4, initial flowering stage (figure 1d); stage 5, peak flowering stage 1 (figure 1e), stage 6, peak flowering After verifying the size of the product amplified by stage 2 (figure 1f); stage 7, peak flowering stage 3 (figure 1g) the designed primer pairs using semiquantititative PCR and stage 8 (the Mohua stage) with the initiation of floral (sqRT-PCR) and gel electrophoresis, the samples were organ senescence (figure 1h). For the RT-qPCR analyses, analysed by RT-qPCR using an ABI 7500 real-time PCR eight sets of petal samples (stages 1–8) were collected daily system (Applied Biosystems, Alameda, USA). The RT-

274 Journal of Genetics, Vol. 96, No. 2, June 2017 Reference gene selection and validation in sweet osmanthus

Figure 1. Classification of eight flowering stages in O. fragrans as described by Dong et al. (2014). qPCR reactions were carried out in a total volume of ence genes (figure 1 in electronic supplementary material). 20 μL liquid containing: 2 μL cDNA template (10-fold Therefore, the same primers were used to evaluate the dilution), 0.4 μL(10 μmol) of each primer, 10 μLFast- expression stability of the seven candidate reference genes Start Universal SYBR Green Master (ROX) and 7.6 μLof by RT-qPCR. The PCR amplification efficiency of the sterile distilled water. The RT-qPCR programme utilized seven reference genes ranged from 97.7 to 104.9% (table 1). was 95◦C for 10 min (denaturation), followed by 40 cycles The Ct values of the seven genes in 10 different sample of 95◦C for 30 s and 60◦C for 60 s, then 95◦C for 15 s, 60◦C sets of floral organs were used to estimate the expression for 60 s, 95◦C for 30 s and 60◦C for 15 s for constructing the level the candidate reference genes. The highest Ct value melting curve. Each RT-qPCR analysis was performed in (36.56) was obtained with the UBQ2 gene in ‘Chenghong- triplicate. Two different statistical packages, geNorm (Van- dangui’ petal samples and the lowest Ct value (27.90) was desompele et al. 2002) and NormFinder (Andersen et al. also obtained with the UBQ2 gene in ‘Zaoyingui’ petal 2004) were used to evaluate the expression stability of the samples (figure 2). Most of the Ct values among all of the candidate reference genes. candidate reference genes varied between 20 and 28. In the current analysis, the 18S gene that was previously used by Results Han et al. (2013) exhibited unstable expression patterns. Importantly, however, none of the seven candidate refer- Amplification efficiency and specificity of primers for the ence genes that were examined had an invariant, stable candidate reference genes expression level. Ct values varied among tissue types and The sqRT-PCR data verified the accuracy and specificity in the different stages of floral development. These results of the primer pairs used to amplify the candidate refer- indicate that it is critical to select a reference gene(s) for

Journal of Genetics, Vol. 96, No. 2, June 2017 275 Hongna Mu et al.

Table 1. Gene-speciﬁc primers utilized in RT-qPCR analyses.

Ampliﬁcation ◦ Name Primer sequences (forward/reverse) 5 –3 Ta ( C) Product size efﬁciency

TUA AGGGAAGCAGTGATGGAAGACA 61.1 206 97.9 TCTCTGTGGATTACGGAAAGAAGTC 61.2 TUB CCAGCACCAGACTGACCGAAGA 64.7 216 104.1 TGAGCACGGCATAGACCCAACT 64.3 L25-1 ACCAGGGCAAACATCTACTCCA 61.1 244 97.7 GATTAAGGCGATCCTCAAGCA 59.7 L25-10 ATACACGGTTTCAACGACTCCCA 63.3 224 100.5 GATGCCATAACCAGGACCAAGAA 62.9 RP2 CACCAAGCAAAGGACCAGCAAG 64.5 216 101.7 TCACCAGGGAGAAGAGGATCAAGTA 63.4 UBQ GCTTCAATCCTCAACTTCGTGGTA 62.6 206 98.3 CACAGATCGTCCAGGAGGCTAA 61.7 18S AGCCTGAGAAACGGCTACCAC 61.0 200 104.9 ATACGCTATTGGAGCTGGAA 62.6

O. fragrans that are stable for the tissue type, environmen- and L25-10 completely changed the expression profile of tal, or experimental conditions in which gene expression MYB1.The18S reference gene also provided an inaccu- analyses are to be conducted. rate expression profile for MYB1 (figure 5).

Expression stability of candidate reference genes Discussion In the present study, the M values of TUB and TUA were <1.5, which were the lowest values obtained in the gene Candidate reference genes were identified for different expression analyses in the different tissue types (figure 3). tissues and flowering stages of O. fragrans from transcrip- In contrast, OfL25-10 and OfRP2 were the most stable tome datasets (table 2). In the present study,we focussed on genes (lowest M values) in samples representing differ- the spatio-temporal expression stability of six housekeep- ent stages of floral development (figure 4). Data from the ing genes and one reported 18S reference gene (Han et al. floral stage analyses revealed that cut-off values ranged 2013) in two varieties of O. fragrans. Our data indicated from 0.133 to 1.02, and only the V3/4 value (0.133) with that 18S was unsuitable as a reference gene, which was also different stages was lower than the ideal value (0.15) (fig- indicated by Zhang et al. (2015). In contrast, 18S has been ure 3). These data indicate that the three reference genes reported to be a suitable reference gene in other species, (OfL25-10, OfRP2 and OfL25-1) would be suitable for including Panicum virgatum (Jiang et al. 2014), Nila- normalizing gene expression in the different stages of O. parvata lugens (Wang et al. 2014), Oryza sativa (Kim et al. fragrans flower opening. 2003), and Cichorium intybus (Maroufi et al. 2010). How- NormFinder software utilizes a different model-based ever, in the present study, Of18S exhibited considerable algorithm to identify optimal reference genes. In this anal- variability in expression in different tissues and flower- ysis, the candidate reference genes were grouped into five ing stages. These results differ from the results obtained groups based on sample types (leaves, buds, flower,pedicels by Han et al. (2013) in the same species. Other recent and roots), then NormFinder calculated intragroup and studies have also shown that 18S is unstable in Fragaria intergroup variations. Genes which had the lowest vari- × ananassa (Galli et al. 2015), Buglossoides arvensis (Gad- ations were considered as the most stable. NormFinder kar and Filion 2015), Cymbidium kanran (Luo et al. indicated that OfRP2 and OfTUB were the most stable 2014), Chlamydomonas (Mou et al. 2014), Setaria ital- reference genes also for the different tissue types (leaves, ica (Kumar et al. 2013), Nicotiana tabacum (Cortleven buds, unopened flowers, pedicels and roots). OfL25-10 and et al. 2009), Prunus persica (Tong et al. 2009) and other OfRP2 were the most stable reference genes in samples plants. representing the different stages of flower opening and OfTUA and OfTUB were the two most stable reference senescence (table 2; figure 2 in electronic supplementary genes in the different tissue types that were examined. In all material). the three O. fragrans varieties (Zaoyingui, Chenghongdan- The utilization of reference genes, TUA and TUB3 to gui and Boyejingui), OfTUB3 exhibited stable expression normalize MYB1 expression provided the most accurate and thus appeared as a good reference for gene expres- expression profile. L25-1 and UBQ, both overestimated the sion studies in this species. These results are similar to transcript level of MYB1 in petals and pedicel samples. reported reference gene studies in Citrus grandis (Wang RP2 also underestimated the expression level of MYB1 et al. 2013), Nerviliao Fordii Folium (Huang et al. 2013)

276 Journal of Genetics, Vol. 96, No. 2, June 2017 Reference gene selection and validation in sweet osmanthus

Figure 2. Amplification efficiency and specificity of the seven candidate reference genes.

Journal of Genetics, Vol. 96, No. 2, June 2017 277 Hongna Mu et al.

(Migocka and Papierniak 2010). However, TUA has also been reported to be a suitable internal control gene in Cucumis sativus (Wan et al. 2010), Linum usitatissimum (Huis et al. 2010)andPopulus trichocarpa × P. deltoids (Brunner et al. 2004). In this study, the RP2 candidate reference gene exhibited the most stable expression in samples obtained from the different stages of flowering. A similar result was also reported in Prunus persica (Tong et al. 2009). OfACT has been previously reported as an optimal reference gene in sweet osmanthus for samples from different floral stages (Zhang et al. 2015). In contrast to Zhang et al. (2015), OfACT exhibited the least expression stability in our study of samples from different tissues and floral development stages. Actually, OfACT was eliminated as a potential candidate reference gene during the preliminary sqRT-PCR analysis (see figure 1 in electronic supplementary material) . It is plausible that conflicting results were obtained by Zhang et al. (2015) and the present study as the two studies utilized different ACT gene family members for their analyses. Figure 3. Stability analysis of seven candidate reference genes in Unstable expression levels were observed for UBQ in different tissues of O. fragrans using geNorm software. samples from different tissues as well, when samples were * The optimal number of reference genes in this test. taken from different floral development stages. These results are similar to the results reported for Quercus suber,whereUBQ was ranked as the fourth most reliable reference gene (Marum et al. 2012). In contrast, UBQ exhibited the most stable expression in Arabidopsis thaliana (Czechowski et al. 2005). The UBQ gene family contains members which exhibit very stable patterns of expression (Smalle and Vierstra 2004). Therefore, further studies in O. fragrans may reveal additional members of the UBQ gene family that can serve as suitable reference genes. A previous study identified the reference genes in four groups (Luteus, Albus, Aurantiacus and Asiaticus) within O. fragrans, representing 16 varieties (Zhang et al. 2015). Han et al. (2013, 2014) previously reported the expression of genes related to carotenoid metabolism using 18S as an internal control. Despite their importance when con- ducting RT-qPCR analyses, very little is known regarding suitable reference genes for O. fragrans. At present, our results and those obtained from previous studies, clearly indicate that a single universal reference gene for all tissues and conditions does not exist for O. fragrans. Instead, the specific tissues and experimental conditions need to Figure 4. Stability analysis of seven candidate reference genes in be analysed before a suitable reference gene is selected for floral stages of O. fragrans using geNorm software. use in RT-qPCR analyses. However, this conclusion does * The optimal number of reference genes in this experiment. not imply that future studies may be able to identify such a universal reference gene for use in O. fragrans under all experimental conditions. and Quercus suber (Soler et al. 2008; Marum et al. 2012). In conclusion, in the present study, OfTUA, OfTUB, TUA exhibited the least stability in gene expression among OfL25-1, OfL25-10, OfRP2, OfUBQ and Of18S genes the different flowering stages of O. fragrans. This finding were selected as candidate reference genes based on O. fra- is also consistent with the results of experiments reported grans transcriptome data and previous reports in other in Cucurbita pepo (Obrero et al. 2011)andCucumis sativus species. The expression stability of these seven candidate

278 Journal of Genetics, Vol. 96, No. 2, June 2017 Reference gene selection and validation in sweet osmanthus

Table 2. Overall ranking of O. fragrans reference genes based on NormFinder analysis.

OfUBQ OfTUA OfL25-1 OfL25-10 OfTUB OfRP2 Of18S

Different tissues 1.627 0.257 0.219 0.768 0.122 0.311 1.23 Different stages 0.089 2.472 0.046 0.045 0.142 0.045 0.991

Figure 5. Different results obtained on the RT-qPCR analysis of OfMYB expression in different tissues of sweet osmanthus (O. fragrans) based on the use of seven different reference genes for the normalization of gene expression.

Journal of Genetics, Vol. 96, No. 2, June 2017 279 Hongna Mu et al. reference genes was examined in different tissues and Demidenko N. V.,Logacheva M. D. and Penin A. A. 2011 Selec- stages of floral opening. Results indicated that OfTUB and tion and validation of reference genes for quantitative real-time OfTUA were the most reliable reference genes in different PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data. PLoS One 6, e19434. tissues of O. fragrans, while OfRP2 and OfL25-10 in sam- Dong L. G., Wang X. R. and Ding Y. L. 2014 Study on the ples obtained from different flowering stages. Among all Osmanthus fragrans blooming season phenology. J. Nanjing candidate reference genes, OfTUB and OfTUA provided For. Univ. 38, 51–56. the most accurate data on OfMYB1 expression in different Ferrandino A. and Lovisolo C. 2014 Abiotic stress effects on tissues. It is concluded that OfTUB and OfTUA, OfRP2 grapevine (Vitis vinifera L.): focus on abscisic acid-mediated consequences on secondary metabolism and berry quality. and OfL25-10 are the most suitable reference genes for the Environ. Exp. Bot. 103, 138–147. normalization of gene expression in different tissues and Gadkar V. J. and Filion M. 2015 Validation of endogenous floral development stages, respectively. reference genes in Buglossoides arvensis for normalizing RT- qPCR-based gene expression data. SpringerPlus 4, 1–12. Acknowledgements Galli V., Borowski J. M., Perin E. C., Messias R. S., Labonde J., Pereira I. S. et al. 2015 Validation of reference genes This work was financially supported by the Agriculture–Forestry for accurate normalization of gene expression for real time- Plant Germplasm Resources Exploration, Innovation and Uti- quantitative PCR in strawberry fruits using different cultivars lization Project of the National Twelve-Five Science and Technol- and osmotic stresses. Gene 554, 205–214. ogy Support Programme (2013BAD01B06-4), and the Advan- Han Y.J., Li L., Dong M., Yuan W.and Shang F. D. 2013 cDNA tages Discipline Construction Engineering Project of Colleges cloning of the phytoene synthase (PSY) and expression anal- and Universities in the Jiangsu Province (PAPD). ysis of PSY and carotenoid cleavage dioxygenase genes in Osmanthus fragrans. Biologia 68, 258–263. Han Y. J., Wang X. H., Chen W. C., Dong M. F., Yuan W. J., Liu X. and Shang F. D. 2014 Differential expression References of carotenoid-related genes determines diversified carotenoid coloration in flower petal of Osmanthus fragrans. Tree Genet. Artico S., Nardeli S. M., Brilhante O., Grossi-de-Sa M. F. and Genomes 10:329–338. Alves-Ferreira M. 2010 Identification and evaluation of new Hu S. Q., Xiang Q. B. and Liu Y. L. 2014 Three new cultivars reference genes in Gossypium hirsutum for accurate normaliza- of Osmanthus fragrans in Zhejiang. J. Nanjing For. Univ. 38, tion of real-time quantitative RT-PCR data. BMC Plant Biol. 185. 10, 49. Huis R., Hawkins S. and Neutelings G. 2010 Selection of refer- Andersen C. L., Jensen J. L., Ørntoft T. F., Aacr C. T., Andersen ence genes for quantitative gene expression normalization in C. L., Jensen J. L. et al. 2004 normalization of real-time quanti- flax (Linum usitatissimum L.). BMC Plant Biol. 10, 1–14. tative reverse transcription-PCR data: a model-based variance Huang Q. L., He R., Zhan R. T. and Chen W. W. 2013 Selection estimation approach to identify genes suited for normalization, of reference genes for real-time fluorescence quantitative PCR applied to bladder and colon cancer data sets. Cancer Res. 64, in Nerviliao Fordii Folium. Chinese Tradi. Herb. Drugs 43, 5245–5210. 1979–1983. BowenJ.,IrelandH.S.,CrowhurstR.,LuoZ.,WatsonA.E., Jiang X. M., Zhang X. Q., Yan H. D., Zhang Y., Yang S. T. and Foster T. et al. 2014 Selection of low-variance expressed Huang L. K. 2014 Reference gene selection for real-time quan- Malus×domestica (apple) genes for use as quantitative PCR titative PCR normalization in switchgrass (Panicum virgatum reference genes (housekeepers). Tree Genet. Genomes 10, 751– L.) root tissue. J. Agr. Biotech.22, 55–63. 759. Kim B. R., Nam H. Y., Kim S. U., Kim S. I. and Chang Y. 2003 Brunner A. M., Yakovlev I. A. and Strauss S. H. 2004 Validating Normalization of reverse transcription quantitative-PCR with internal controls for quantitative plant gene expression studies. housekeeping genes in rice. Biotechnol. Lett. 25, 1869–1872. BMC Plant Biol. 18, 4–14. Kumar K., Muthamilarasan M. and Prasad M. 2013 Reference Bustin S. A. 2002 Quantification of mRNA using real-time genes for quantitative real-time PCR analysis in the model reverse transcription PCR (RT-PCR): trends and problems. plant foxtail millet (Setaria italica L.) subjected to abiotic stress J. Mol. Endocrinol. 29, 4021–4022. conditions. Plant Cell Tiss. Org. 115, 13–22. Chuong S. D., Good A. G., Taylor G. J., Freeman M. C., Moor- Li J., Chen M., Qiu F.,Qin B., Liu W.,Wu N. et al. 2014 Reference head G. B. and Muench D. G. 2004 Large-scale identification of gene selection for gene expression studies using quantitative tubulin-binding proteins provides insight on subcellular traf- real-time PCR normalization in Atropa belladonna. Plant Mol. ficking, metabolic channeling, and signaling in plant cells. Mol. Biol. Rep. 32, 1002–1014. Cell. Proteomics 3, 970–983. Luo H., Luo K., Luo L., Li E. X., Guan B., Xiong D. et al. 2014 Callis J., Carpenter T., Sun C. W. and Vierstra R. D. 1995 Evaluation of candidate reference genes for gene expression Structure and evolution of genes encoding polyubiquitin studies in Cymbidium kanran. Sci. Hortic. 167, 43–48. and ubiquitin-like proteins in Arabidopsis thaliana ecotype Mallona I., Lischewski S., Weiss J., Hause B. and Egea-Cortines Columbia. Genetics 139, 921–939. M. 2010 Validation of reference genes for quantitative real- Cortleven A., Remans T., Brenner W. G. and Valcke R. 2009 time PCR during leaf and flower development in Petunia Selection of plastid- and nuclear-encoded reference genes to hybrida. BMC Plant Biol. 10, 4. doi:10.1186/1471-2229-10-4 study the effect of altered endogenous cytokinin content on Maroufi A., Bockstaele E. V.and Loose M. D. 2010 Validation of photosynthesis genes in Nicotiana tabacum. Photosynth. Res. reference genes for gene expression analysis in chicory (Cicho- 102, 21–29. rium intybus) using quantitative real-time PCR. BMC Mol. Czechowski T.,Stitt M., Altmann T.,Udvardi M. K. and Scheible Biol. 11, 397. W.R. 2005 Genome-wide identification and testing of superior Marum L., Miguel A., Ricardo C. P. and Miguel C. 2012 reference genes for transcript normalization in Arabidopsis. Reference gene selection for quantitative real-time PCR nor- Plant Physiol. 139, 5–17. malization in Quercus suber. PLoS One 7, e35113.

280 Journal of Genetics, Vol. 96, No. 2, June 2017 Reference gene selection and validation in sweet osmanthus

Meng Y., Li N., Tian J., Gao J. and Zhang C. 2013 Identification Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy and validation of reference genes for gene expression stud- N., De Paepe A. et al. 2002 Accurate normalization of real- ies in postharvest rose flower (Rosa hybrida). Sci. Hortic. 158, time quantitative RT-PCR data by geometric averaging of 16-21. multiple internal control genes. Genome Biol. (doi:10.1186/ Migocka M. and Papierniak A. 2010 Identification of suitable ref- gb-2002-3-7-research0034). erence genes for studying gene expression in cucumber plants Vandesompele J., Pfaffl M. W. and Kubista M. 2009 Reference subjected to abiotic stress and growth regulators. Mol. Breed gene validation software for improved normalization. In Real 28, 343–357. time PCR: current technology and application (ed. J. Logan, Mou S., Zhang X., Miao J., Zheng Z., Xu D. and Ye N. 2014 K. Edwards and N. Saunder), pp. 47–64. Caister Academic Reference genes for gene expression normalization in Chlamy- Press, London, UK. domonas sp. ICE-L by quantitative real-time RT-PCR. J. Plant Wan H., Zhao Z., Qian C., Sui Y., Malik A. A. and Chen J. 2010 Biochem. Biotechnol. 24, 1–7. Selection of appropriate reference genes for gene expression Mu H. N., Li H. G., Wang L. G., Yang X. L., Sun T. Z. and studies by quantitative real-time polymerase chain reaction in Xu C. 2014 Transcriptome sequencing and analysis of sweet cucumber. Analyt. Biochem. 399, 257–261. osmanthus (Osmanthus fragrans Lour.). Gene Genome 36, 777– Wang L. H., Peng Y.J., Yang L., Cai S. H. and Huang X. Z. 2013 788. Validation of internal reference genes for qRT-PCR normal- Nolan T., Hands R. E. and Bustin S. A. 2006 Quantifica- ization in ’Guanxi Sweet Pummelo’ (Citrus grandis). J. Fruit tion of mRNA using real-time RT-PCR. Nat. Protoc. 26, Sci. 30, 48–54. 1559–1582. Wang W.X., Lai F. X., Li K. L. and Fu Q. 2014 Selection of ref- Obrero A., Die J. V., Roman B., Gomez P., Nadal S. and erence genes for gene expression analysis in nilaparvata lugens Gonzalez-Verdejo C. I. 2011 Selection of reference genes for with different levels of virulence on rice by quantitative real- gene expression studies in zucchini (Cucurbita pepo)using time PCR. Rice Sci. 21, 305–311. qPCR. J. Agic. Food Chem. 59, 5402–5411. Xiang M., Duan Y. F. and Xiang Q. B. 2014a Establishment of Pfaffl M. W., Tichopad A., Prgomet C. and Neuvians T. P. a new group: Osmanthus fragrans color group. J. Nanjing For. 2004 Determination of stable housekeeping genes, differen- Univ. 38, 11–12. tially regulated target genes and sample integrity: BestKeeper Xiang Q. B., Wang X. R. and Liu Y.L. 2014b Three new cultivars — Excel-based tool using pair-wise correlations. Biotechnol. of Osmanthus fragrans from east China. J. Nanjing For. Univ. Lett. 26, 509–515. 38, 181. Smalle J. and Vierstra R. D. 2004 The ubiquitin 26S proteasome Zang D. K., Xiang X. Q. and Liu Y. L. 2006 Notes on cultivar proteolytic pathway. Annu. Rev. Plant Biol. 55, 555–590. classification in osmanthus. Sci. Silvae Sinicae 42, 17–23. Soler M., Serra O., Molinas M., García-Berthou E., Caritat A. Zang D. K., Sun M. P., Dong B. R., Xiang Q. B. and Liu Y. and Figueras M. 2008 Seasonal variation in transcript abun- L. 2014 Three new cultivars of Osmanthus fragrans from east dance in cork tissue analyzed by real time RT-PCR. Tree China. J. Nanjing For. Univ. 38, 181. Physiol. 28, 743–751. Zhang C., Fu J. X., Wang Y. G., Bao Z. Y. and Zhao H. B. 2015 Tong Z., Gao Z., Wang F., Zhou J. and Zhang Z. 2009 Selec- Identification of suitable reference genes for gene expression tion of reliable reference genes for gene expression studies normalization in the quantitative real-time PCR analysis of in peach using real-time PCR. BMC Mol. Biol. doi:10.1186/ sweet osmanthus (Osmanthus fragrans Lour.). PLoS One 10, 1471-2199-10-71. e0136355.

Received 18 December 2015, in ﬁnal revised form 26 July 2016; accepted 22 August 2016 Unedited version published online: 25 August 2016 Final version published online: 19 June 2017

Corresponding editor: Arun Joshi

Journal of Genetics, Vol. 96, No. 2, June 2017 281