Characterization and Ligand Interactions Nonhuman Primate

IgG Fc Receptor III Homologues in Nonhuman Primate Species: Genetic Characterization and Ligand Interactions

This information is current as Kenneth A. Rogers, Franco Scinicariello and Roberta of September 23, 2021. Attanasio J Immunol 2006; 177:3848-3856; ; doi: 10.4049/jimmunol.177.6.3848 http://www.jimmunol.org/content/177/6/3848 Downloaded from

References This article cites 61 articles, 24 of which you can access for free at: http://www.jimmunol.org/content/177/6/3848.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 23, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

IgG Fc Receptor III Homologues in Nonhuman Primate Species: Genetic Characterization and Ligand Interactions1,2

Kenneth A. Rogers,* Franco Scinicariello,† and Roberta Attanasio3*

Ig Fc receptors bind to immune complexes through interactions with the Fc regions of specific Ab subclasses to initiate or inhibit the defense mechanisms of the leukocytes on which they are expressed. The mechanism of action of IgG-based therapeutic molecules, which are routinely evaluated in nonhuman primate models, involves binding to the low-affinity FcRIII (CD16). The premise that IgG/CD16 interactions in nonhuman primates mimic those present in humans has not been evaluated. Therefore, we have identified and characterized CD16 and associated TCR ␨-chain homologues in rhesus macaques, cynomolgus macaques, baboons, and sooty mangabeys. Similar to humans, CD16 expression was detected on a lymphocyte subpopulation, on monocytes, and on neutrophils of sooty mangabeys. However, CD16 was detected only on a lymphocyte subpopulation and on monocytes in

macaques and baboons. A nonhuman primate rCD16 generated in HeLa cells interacted with human IgG1 and IgG2. By contrast, Downloaded from human CD16 binds to IgG1 and IgG3. As shown for humans, the mAb 3G8 was able to block IgG binding to nonhuman primate CD16 and inhibition of nonhuman primate CD16 N-glycosylation enhanced IgG binding. Clearly, differences in interaction with IgG subclasses and in cell-type expression should be considered when using these models for in vivo evaluation of therapeutic Abs. The Journal of Immunology, 2006, 177: 3848–3856.

c receptors are plasma membrane glycoproteins that bind on glomerular mesangial cells (6–8). Because CD16a is the only http://www.jimmunol.org/ to the Fc region of one or a few classes of Abs. Cross- Fc receptor expressed on NK cells and is responsible for IgG- F linking of Ab Fc receptors by Ab-opsonized Ag com- initiated ADCC, it has been called the ADCC receptor (9, 10). The plexes initiates cellular immune responses, including phagocyto- CD16a complex consists of three polypeptide chains: one unique sis, Ab-dependent cell-mediated cytotoxicity (ADCC),4 ligand-binding chain and two signaling chains. The ligand-binding respiratory burst, release of cytokines and inflammatory mediators, chain (CD16a or Fc␥RIIIa) spans the plasma membrane and has a and Ag presentation (1). Fc receptors are therefore crucial for the short cytoplasmic tail. In humans, the signaling chains of the com- destruction and clearance of pathogens and tumors. Different Fc plex are composed of either a homodimer or a heterodimer of receptors with specificity for each of the five classes of Abs (IgM, FcR␥ and TCR ␨ that are required for efficient assembly, transport

IgD, IgA, IgE, and IgG) have been identified in mammals. Human of the receptor from the endoplasmic reticulum to the plasma by guest on September 23, 2021 IgG Fc receptors include Fc␥RI, Fc␥RII, and Fc␥RIII, which differ membrane, and retention on the plasma membrane (4, 11, 12). for cell-type distributions and affinity for the four subclasses of FcR␥ is also a necessary component of the Fc␧RI and Fc␥RI com- human IgG (1). Human Fc␥RIII, also known as CD16, is specific plexes (1, 13). TCR ␨, expressed in T cells and NK cells, is also a for IgG1 and IgG3 (2). component of the TCR complex (14). In contrast to CD16a, Humans express two 97% identical Fc␥RIII isoforms, CD16a CD16b is not associated with signaling chains. The CD16b iso- and CD16b, encoded by separate genes consisting of two Ig-like form, exclusively expressed on neutrophils and eosinophils that domains and a tail region linking the protein to the plasma mem- have been exposed to IFN-␥ (1, 15), is linked to the outer plasma brane (3–5). CD16a is expressed on monocyte subpopulations, membrane by a GPI link, and modulates cellular responses through macrophages, NK cells, and select ␥␦ T cells, and can be induced interactions with the other neutrophil Fc receptors (16, 17). Associa- tion of the FcR␥-signaling chain dimer with CD16a may contribute to a higher ligand affinity of CD16a compared with CD16b (18). *Department of Biology, Georgia State University, Atlanta, GA 30303; and †Division Nonhuman primates are widely used in biomedical research. of Toxicology Environmental Medicine, Centers for Disease Control and Prevention, The complex mechanisms of action and pharmacokinetics of ther- Agency for Toxic Substances and Disease Registry, Atlanta, GA 30341 apeutic Abs, usually IgG1 or IgG2 molecules, are routinely eval- Received for publication March 29, 2006. Accepted for publication June 26, 2006. uated in these species (19–22). Potential therapeutic cytokines and The costs of publication of this article were defrayed in part by the payment of page cytokine receptors are tested in nonhuman primates, and there is charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. interest in extending these studies to Ig-cytokine fusion proteins, as 1 This work was supported in part by National Institutes of Health Grants RR10755 has been done in mice (23–25). Macaques represent the accepted and RR00165, by the Research Program Enhancement from the Georgia State Uni- model for HIV vaccine development and AIDS pathogenesis (26). versity Office of Research and Sponsored Programs, and by the Georgia Research CD16a is critical for NK cell-targeted destruction of HIV-infected Alliance. Support for K.A.R. was provided by the Molecular Basis of Disease program at Georgia State University. cells through ADCC, although the relative importance of this 2 Disclaimer: The findings and conclusions in this report are those of the author and mechanism in vivo is debated (9). Recently, a small study in SIV- do not necessarily represent the views of the Agency for Toxic Substances and Dis- infected macaques indicated that sustained ADCC correlates with ease Registry. delayed onset of AIDS pathogenesis (27). Xenograft rejection, 3 Address correspondence and reprint requests to Dr. Roberta Attanasio, Department which is also studied in nonhuman primates, is in part mediated of Biology, Georgia State University, P.O. Box 4010, Atlanta, GA 30302. E-mail address: [email protected] through IgG-directed ADCC via CD16 (28–31). In addition, these 4 Abbreviations used in this paper: ADCC, Ab-dependent cell-mediated cytotoxicity; species are used in testing mAbs designed to prevent allograft MFI, mean fluorescence intensity. rejection (32–37). Hence, there is the need to characterize CD16

homologues and the interactions with their ligands in nonhuman TTCGCGTT-3Ј). The resulting fragment was then digested with HpaI and primate models. SalI and pLXSN digested with HpaI and XhoI. The two fragments were then ligated together to form pLXSN-CD16.

Materials and Methods Generation of HeLa cell clone expressing nonhuman primate Samples rCD16 Heparinized blood samples were collected from healthy animals of each of Large quantities of vector for transfection were prepared using EndoFree the following species: rhesus macaque (Macaca mulatta), cynomolgus ma- Plasmid Maxi kits (Qiagen). A total of 20 ␮g of expression vector was caque (Macaca fascicularis), baboon (Papio hamadryas anubis), and sooty electroporated into HeLa cells using methods previously described (38). mangabey (Cercocebus torquatus). Rhesus macaque and baboon samples Cells were then grown in DMEM 10% FCS in 5% CO2 at 37°C, and the were from animals housed at the Southwest National Primate Research antibiotic G418 (400 ␮g/ml) was added to cell 72 h posttransfection to Center (San Antonio, TX). The samples from cynomolgus macaque and obtain stable transfectants. sooty mangabey were from animals housed at the Yerkes National Primate Selection and expansion of clones were performed following identifi- Research Center, Emory University (Atlanta, GA). Animal blood was col- cation of successful transfections, as indicated by positive stain for CD16 lected under approval of the appropriate institutional review committees. and a positive RT-PCR for CD16. To isolate single clones, cells were Determination of CD16 expression on blood leukocytes diluted serially into 96-well microtiter plates. Cells were grown in 100 ␮l of DMEM 10% FCS with G418 400 ␮g/ml, which was 50% fresh medium Blood from four rhesus macaques, seven cynomolgus macaques, four ba- and 50% conditioned medium collected from flasks of untransfected HeLa boons, and four sooty mangabeys was collected in EDTA Vacutainer tubes cells and filtered with a 0.2-␮m filter. Each well was examined by micros- (BD Biosciences) by venipuncture under anesthesia. Leukocyte expression copy to identify wells with a single cell. Clones were subsequently ex- of CD16 on macaque cells was analyzed by three-color flow cytometry panded in wells of increasing size until cell numbers were sufficient to

analysis using CyChrome-conjugated anti-human CD16 (clone 3G8), PE- screen for CD16 expression. Downloaded from conjugated anti-human CD89 (clone A59), and FITC-conjugated anti- ␥ ␥ human CD3 (clone SP34) (BD Biosciences). Simultest Control 1/ 2 (BD Purification of nonhuman primate IgG Biosciences) was used to detect nonspecific binding of mouse IgG to cells. Baboon and sooty mangabey leukocytes were analyzed by staining with Nonhuman primate IgG was purified from serum from each species. ␮ PE-conjugated anti-human CD16 and FITC-conjugated anti-human CD3. Ad- Briefly, 200 l of serum diluted 1/1 in Pierce ImmunoPure IgG-binding ␮ ditionally, sooty mangabey leukocytes were stained with CD89 PE and CD16 buffer was incubated with 200 l of ImmunoPure Plus immobilized protein FITC. Staining of whole blood was done using a standard procedure (38). G for 30 min at room temperature (Pierce Biotechnology). The mix was then transferred to a 0.45-␮m filter tube and centrifuged for 2 min at 6 ϫ http://www.jimmunol.org/ Amplification, cloning, and sequence analysis of nonhuman g, and the filtrate was discarded. Following four washes with PBS (pH 7.2) primate CD16, TCR ␨, and FcR␥ cDNA and a 10-min incubation at room temperature with Pierce ImmunoPure IgG elution buffer, the tube was spun for 2 min and the filtrate was collected. Total RNA was extracted from whole blood using the QIAamp RNA Blood Finally, the filtrate was dialyzed against water using Spectral/Por cellulose Mini Kit (Qiagen), and reverse transcribed into cDNA using oligo(dT)17 ester MWCO 50,000 (Spectrum Laboratories), first with two incubations at primers, followed by primer extension with the AMV reverse transcriptase room temperature for 1 h each and then overnight at 4°C with the buffer (Roche Diagnostic Systems). PCR amplification of the cDNA was per- being changed each time. Purity of IgG was verified by a reducing SDS- formed with Expand High Fidelity polymerase (Roche Diagnostic Sys- PAGE, and the concentration was checked by spectrophotometry at 280 tems) with the appropriate primer pair. Primer pairs were FCG3aF (5Ј- nm. IgG was frozen at Ϫ80°C before use. ATGTGGCAGCTGCTCCTCCCA-3Ј) and FCG3aR (5Ј-TCATTTGTCT by guest on September 23, 2021 TGAGGGTCCTT-3Ј) for CD16, TCRZ3F (5ЈATGAAGTGGAAGGC IgG subclass ELISA GCTTTTCAC-3Ј) and TCRZ4R (5Ј-TTAGCGAGGGGGCA-3Ј) for TCR ␨, and FcRgamF (5Ј-ATGATTCCAGCAGTGGTCTTGCT-3Ј) and ELISA was used to verify the purity and identity of the human IgG my- FcRgam4 (5Ј-CTACTGTGGTGGTTTCTCATGCTTC-3Ј) for FcR␥. Af- eloma proteins used in the CD16-binding assays. Microtiter plates were ter initial denaturation at 95°C for 10 min, the cDNAs were amplified for coated with human myeloma proteins (IgG1, IgG2, IgG3, or IgG4) (The 40 cycles, with each cycle consisting of 94°C for 1 min, 56°C for 1 min, Binding Site) or purified total nonhuman primate IgG from the four spe- and 72°C for 1 min and 30 s. A final step at 72°C for 10 min was used to cies, incubated at 4°C overnight, and blocked with 5% FCS diluted in PBS ensure complete extension. For amplification of the signaling chains, the at 37°C for 30 min. After washing, anti-human IgG1 (clone SG-16), IgG2 step at 72°C was reduced to 30 s. All reactions were performed in at least (clone HP-6014), IgG3 (clone HP-6050), or IgG4 (clone SK-44) was added two independent RT-PCRs to verify product sequences. For CD16 of each to the plate and incubated for1hat37°C (Sigma-Aldrich). Following ϩ nonhuman primate species, 10 clones were sequenced from each of two washing to remove unbound Ab, HRP-labeled goat anti-mouse IgG (H independent PCR. Cloning, sequencing, and sequence analysis were per- L) was added to the plate and incubated for1hat37°C (Kirkegaard & formed using methods previously described (39). Perry Laboratories). The washed plate was developed by the addition of first ABTS/H2O2 and then stop solution, and its absorbance was measured Construction of nonhuman primate CD16 expression vectors at 405 nm using an automated Benchmark microplate reader (Bio-Rad). Full-length nonhuman primate CD16 genes were first PCR amplified from Ig-binding assay cDNAs ligated into the pCR2.1 vector using forward and reverse primers FCG3FHinb (5Ј-AGATAAGCTTGATATGTGGCAGCTGCTCCTCC Binding of Ig to CD16 was assessed by flow cytometry using Abs that were CA-3Ј) and FCG3Rbam (5Ј-TCTAGGATCCTCATTTGTCTTGAGGGT heat aggregated at 63°C for 1 h. Human myeloma proteins IgG1, IgG2, CCTT-3Ј), which add HindIII and BamHI restriction sites 5Ј and 3Ј of IgG3, IgG4, IgA1, IgA2, IgM (The Binding Site), or IgE (Serotec) with Ig␬ the full-length cDNA, respectively. CD16 fragments from clones with the L chain as well as purified nonhuman primate IgG from different species correct sequence were released from vector by sequential digestion with were added to 0.5 ϫ 106 cells at 20 ␮g/ml and incubated for1hat4°C. HindIII and BamHI, cleaned up on a 1% agarose gel, and ligated into the PBS-washed cells were then stained with 5 ␮l of either FITC-conjugated HindIII- and BamHI-digested expression vector pcDNA3.1ϩ (Invitrogen mouse anti-human ␬ or FITC-conjugated mouse IgG3 control for 30 min at Life Technologies) to create pcCD16 vectors. CD16 expression vectors 4°C (Invitrogen Life Technologies). In addition, in some experiments, cells were then cloned into Top10 Escherichia coli, and colonies were screened were stained using FITC goat anti-human IgG (Invitrogen Life Technolo- by sequencing with primers T7 and T7 reverse. gies). For dual labeling experiments, mouse anti-human CD16 PE was To improve the stability of the expression vectors in transfected cells, added as well. Cells were washed and analyzed by flow cytometry, as part of the pcDNA3.1 constructs was amplified (containing cDNA of non- described above. The ability of mouse mAb 3G8 to block IgG binding was human primate Fc␥IIIRa, a CMV promoter, a bovine growth hormone performed by first incubating harvested HeLa cells and mangabey CD16- polyadenylation signal, and an f1 origin) and inserted into the vector expressing cells (0.5 ϫ 106 cells/tube) with 20 ␮l of 3G8 or control mouse pLSXN (BD Biosciences), which contains long terminal repeats for inte- myeloma IgG1 at different concentrations (0.5, 0.25, 0.125, and 0 mg/ml) gration into chromosomes. pLSXN contains a neomycin resistance gene, for 30 min at 4°C. Afterward, cells were washed three times with PBS and which allows for transfectant selection. Insertion of a pcDNA-CD16 frag- IgG-binding tests were conducted, as described above, except that human ment into pLXSN was conducted by amplifying with primers PcHp (5Ј- myeloma Abs were added at 40 ␮g/ml. For N-glycosylation-blocking ex- CTGCTGTTAACCGTTAGGGTTAGGCGTTTTGCG-3Ј) and PcSa (5Ј- periments, tunicamycin was added to half of the cell cultures at 1 ␮g/ml ACTTTGTCGACGCTCAGCGGCCGGCCATCGATCCACAGAATTAA 30 h before harvesting cells. 3850 Ig FcRIII HOMOLOGUES IN NONHUMAN PRIMATE SPECIES

Results and sequenced. All sequences from clones amplified using total CD16 expression on nonhuman primate leukocytes RNA from human whole blood matched the CD16b isoform allele CD16 is known to be expressed on nonhuman primate NK cells FCGR3B*02 (GenBank accession no. AJ581669), probably a re- and monocytes (40–42). Our results show that CD16 is present on sult of CD16b transcripts outnumbering CD16a transcripts. There- monocytes (mean Ϯ SD, 14.67 Ϯ 4.66% rhesus, 28.40 Ϯ 14.00% fore, we stimulated THP-1 monocytic cells with PMA in the ab- cynomolgus, 21.38 Ϯ 13.71 baboon, and 25.61 Ϯ 13.43% manga- sence of estrogen to induce expression of CD16a. Amplification of bey; Fig. 1, E, H, K, and N) and CD3Ϫ lymphocytes (11.75 Ϯ 4.28% cDNA from these cells yielded clones all matching a reported rhesus, 15.31 Ϯ 7.64% cynomolgus, 11.92 Ϯ 6.95% baboon, and CD16a sequence (GenBank accession no. X52645), thus validat- 6.70 Ϯ 1.97% mangabey; Fig. 1, D, G, J, and M), corresponding to ing our strategy to amplify both human CD16 isoforms. This strat- NK cells (41), as well as on the majority of granulocytes of sooty egy was then used to amplify CD16 from a single animal of each mangabeys (72.51 Ϯ 14.29% of CD89ϩCD16ϩ cells; Fig. 1L), but of four nonhuman primate species. not granulocytes of macaque and baboons (Fig. 1, C, F, and I). All nonhuman primate CD16 clones bore greater sequence homology to human CD16a than CD16b. In nonhuman primates, Cloning and sequencing of nonhuman primate CD16 genes residues at positions that differ between human CD16a and CD16b To verify that both human CD16 genes could be amplified with the were conserved with human CD16a, including Gly147, Tyr158, and primers we designed, human CD16 cDNA was amplified, cloned, Phe203 (Fig. 2). Phe203 is substituted by a Ser in CD16b and is Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021

FIGURE 1. Representative two-color dot plots of whole blood leukocytes from nonhuman primates stained for CD16 expression. A, Forward scatter vs side scatter plot with leukocyte gate indicated; B, staining with mouse isotype controls; C–N, gated leukocyte populations (C, F, I, and L, granulocytes; D, G, J, and M, lymphocytes; E, H, K, and N, monocytes) stained for CD16 and either CD89 or CD3. CD16 expression was examined for rhesus macaques (C–E), cynomolgus macaques (F–H), baboons (I–K), and sooty mangabeys (L–N). At least 10,000 cells were counted for all plots. The Journal of Immunology 3851 Downloaded from http://www.jimmunol.org/

FIGURE 2. Alignment of CD16-derived amino acid sequences obtained by cloning and sequencing rhesus macaque, cynomolgus macaque, baboon, and sooty mangabey cDNA from whole blood and human CD16a and CD16b (GenBank accession nos. CAA34753 and J04162). Amino acid differences between human CD16a and nonhuman primate sequences are underlined. The mature peptide begins at residue 18, as indicated by the arrow. Two vertical arrows indicate the boundaries of exon S2, which is spliced out of one isolated rhesus macaque transcript. Potential N-glycosylation sites and cysteines involved in disulﬁde bonds are bolded. Shaded amino acids indicate amino acids in human CD16 that interact with human IgG1 (46). Domains of the protein are indicated by arrows. The sequence of MafaCD16.2 was found to match an unpublished GenBank sequence (accession no. AF485815). MafaCD16.1 is an experimentally isolated variant of CD16 differing at residue position 25. Hu, human; Soma, sooty mangabey; Paca, baboon; Mamu, rhesus macaque; Mafa, cynomolgus macaque; S1 and S2, signal peptide; Tm, transmembrane. Star indicates the amino acid critical for binding to mAb 3G8. by guest on September 23, 2021

critical to the expression of CD16b as a GPI-linked protein on (46). Numbering from the start of the preprotein, the CD16 resi- human neutrophils (43). Single sequences were obtained for rhesus dues forming contact with IgG1 are Ile106-Trp108, Trp131-Ala135, macaque, baboon, and sooty mangabey CD16, whereas two se- His137-Thr140, Asp147-His153, Arg173, and Val176-Lys179 (46). The quences differing by a single amino acid (Lys25 or Arg25) were majority of the human CD16 residues important for binding IgG obtained for cynomolgus macaque CD16 (GenBank accession nos. are conserved in nonhuman primate CD16 molecules (Fig. 2). In DQ423376-DQ423380). All cysteines involved in forming intra- all four nonhuman primate species, Ala135, His153, and Val176 are chain disulfide bonds in human CD16 are conserved in nonhuman substituted with Leu, Glu, and Ile, respectively. In addition, Asp147 primates (C47, C89, C128, and C172). Human CD16 (GenBank is Gly in all nonhuman primate CD16 molecules as is found in accession no. CAA34755) has N-glycosylation motifs at Asn56, human CD16a. Asn63, Asn92, Asn180, and Asn187. These motifs are conserved in nonhuman primate CD16 molecules, with the exception of Asn92. Expression of sooty mangabey/baboon CD16 and identification ␨ An additional motif is present in nonhuman primates at Asn82. of nonhuman primate TCR -chains Rhesus macaque and cynomolgus macaque CD16 amino acid se- To characterize the ligand interactions of nonhuman primate quences exhibit 91.7 and 91.3% identity to the human CD16a, CD16, the sooty mangabey gene was selected for expression in respectively. The rhesus macaque CD16 amino acid sequence HeLa cells. One clone resulted in high CD16 expression as deter- shows 99.6% identity to the corresponding cynomolgus macaque mined by flow cytometry (mean fluorescence intensity (MFI) ϭ sequence. Baboon and sooty mangabey CD16 have identical 1445.22). Anti-CD16 staining was specific, because staining of amino acid sequences and share 92.5% identity with human untransfected HeLa cells (MFI ϭ 8.12) and staining of the clone CD16a, 98.4% identity with rhesus macaque, and 98.0% identity with a mouse isotype control (MFI ϭ 11.91) were low (data not with cynomolgus macaque. Therefore, CD16 sequences are highly shown). conserved in nonhuman primates with only three residues distin- CD16-associated signaling chains FcR␥ or TCR ␨, which are guishing the African species (baboons and mangabeys) from the required for efficient expression of human CD16 (11, 47, 48), have Asian species (macaques) (an Asp/Glu substitution at position 122, not been reported in HeLa cells. TCR ␨ is normally only expressed a Val/Met substitution at position 229, and a Ser/Arg substitution in T cells and NK cells, because its gene is controlled by a tissue- at position 238). restricted promoter (49). However, we were able to amplify and The CD16 membrane-proximal Ig-like domain interacts with sequence TCR ␨ cDNA from HeLa cells. Real time RT-PCR con- ␨ the lower hinge and CH2 domain of the IgG Fc region (43–45). firmed that TCR is transcribed in HeLa cells, albeit at levels The crystal structure of CD16 reveals that a single Fc␥RIII binds lower than those found in Hut-78 cells, a T cell line. By contrast, asymmetrically to the two chains of a single IgG1 Fc fragment FcR␥ transcripts were amplified successfully using RNA isolated 3852 Ig FcRIII HOMOLOGUES IN NONHUMAN PRIMATE SPECIES Downloaded from http://www.jimmunol.org/ FIGURE 3. Alignment of TCR ␨-deduced amino acid sequences. ITAM: italics with conserved tyrosine and leucine/isoleucines bolded. Other features are underlined and indicated by symbols that appear below the position of the feature: #, cysteine involved in TCR ␨ dimerization; $, aspartic acid that pairs glutamine ,ء ;(with a charged residue of associated ligand-binding chain (48); ϩ, lysine and glycine residues in human peptide that bind GTP and GDP (52 spliced into a variant that disrupts a G-coupled protein-binding motif, which includes two prolines prior and one after the glutamine (53). !, Position 46 of leucine critical for human CD16 association (50). GenBank accession numbers for humans and mice are AL031733 and BC052824, respectively. from THP-1 cells (positive control), but not RNA isolated from 164-aa TCR ␨ polypeptide, humans also produce a 163-aa HeLa cells. These results indicate that high levels of CD16 in polypeptide that results from the splicing out of the codon encod- by guest on September 23, 2021 HeLa cells may be permissible as a result of endogenous TCR ␨ ing Gln101 (53). Splice variants were isolated for all four nonhu- expression. man primate species that were 165 aa long as a result of the same In contrast to human TCR ␨, mouse TCR ␨ acts to down-regulate splicing event (GenBank accession nos. DQ437668, DQ437670, 46 46 CD16 as a result of a substitution of Leu with Ile in the trans- DQ437664, and DQ437666). membrane domain (50, 51). Therefore, TCR ␨ cDNA from rhesus macaque, cynomolgus macaque, baboon, and sooty mangabey was cloned and sequenced (Fig. 3) (GenBank accession nos. DQ437667, DQ437669, DQ437663, and DQ437665). Importantly, Leu46 is conserved in monkey TCR ␨. In baboons and sooty mangabeys, the transmembrane domain and surrounding residues are completely conserved, whereas two substitutions (Ile41Leu and Val53Ala) are present in macaques, which may influence interactions with CD16. For transient transfection, mangabey and cynomolgus macaque CD16 expression was greater in Hut-78 cells than that achieved in HeLa cells (results not shown). Thus, nonhuman primate CD16 may be positively regulated by TCR ␨, similar to human CD16. The percentages of identities of the deduced amino acid sequences compared with the human TCR ␨ sequence for rhesus macaque, cynomolgus macaque, baboon, and mangabey are 92.7, 95.1, 96.3, and 96.3%. The amino acid identity between the two macaque species is 98.2%. Baboon- and mangabey-deduced amino acid sequences are 100% identical, although there are differences at the nucleotide level. The baboon/mangabey amino acid se- FIGURE 4. Binding of human IgG subclasses to mangabey rCD16 expressed on HeLa cells. Human myeloma Igs of different subclasses all with quence shares 97.0% identity with rhesus macaque and 98.8% ␬ ␨ Ig L chain were incubated with HeLa cells expressing mangabey CD16; identity with cynomolgus macaque. All TCR -chains from the bound Igs were detected with anti-human Ig␬ FITC (IgG1, solid line nonhuman primates have Asn and Gln inserts between residues MFI ϭ 75.98; IgG2, filled MFI ϭ 131.78; IgG3, dashed line MFI ϭ 17.68; 131E and 132R of the corresponding human TCR ␨. As a result, IgG4, thin line MFI ϭ 10.05). As negative control, cells were stained with nonhuman primate TCR ␨-chains are 2 aa longer than their human a mouse FITC isotype control (dotted line MFI ϭ 12.73). Ten thousand counterpart (166 aa as compared with 164). In addition to the cells were counted per sample. The Journal of Immunology 3853 Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021

FIGURE 5. Binding of sooty mangabey (A and B) and baboon (C and D) IgG to HeLa cells expressing mangabey rCD16. A and C, Detection of bound IgG with goat anti-human IgG FITC to mangabey CD16: ﬁlled (baboon MFI ϭ 992.63, sooty mangabey MFI ϭ 325.87); control HeLa cells: dotted line (baboon IgG MFI ϭ 29.44, sooty mangabey IgG MFI ϭ 37.17); and goat anti-human IgG bound in the absence of IgG to mangabey CD16: solid line (baboon MFI ϭ 61.20, sooty mangabey MFI ϭ 24.93). B and D, Detection of bound IgG with anti-human Ig␬ FITC to mangabey CD16: ﬁlled (baboon IgG MFI ϭ 62.04, sooty mangabey MFI ϭ 24.46) and in the absence of IgG (baboon MFI ϭ 7.67, sooty mangabey MFI ϭ 7.69). Ten thousand events were counted per sample.

Mangabey/baboon CD16 binding to Igs Binding assays were performed to determine the ability of mangabey CD16 to bind the different human and Ab subclasses and polyclonal nonhuman IgG. Heat-aggregated myeloma proteins with an Ig␬ L chain or polyclonal Ig were incubated with control HeLa cells or mangabey CD16-expressing cells, followed by staining against bound Ab and analysis by flow cytometry. All tested subclass-specific Abs did not cross-react with purified nonhuman primate species’ IgG. The staining for human IgG subclasses on mangabey CD16-expressing cells as measured by MFI was: IgG2 (131.78) and IgG1 (75.98) ϾϾ IgG3 (17.68) Ͼ IgG4 FIGURE 6. Antagonist anti-human CD16 (mouse mAb 3G8) blocks (10.05) (Fig. 4). Staining of control HeLa cell for each subclass binding of human IgG1 and IgG2 to mangabey rCD16 expressed on HeLa was as follows: IgG2 (10.75), IgG1 (10.16), IgG3 (14.08), and cells. Different concentrations of antagonistic anti-human CD16 (diamonds and squares) or control mouse Ab (triangles) were preincubated with con- IgG4 (9.73). Staining of mangabey CD16-expressing cells using a trol HeLa cells (squares) or HeLa cells expressing mangabey CD16 (dia- FITC-conjugated mouse Ab isotype control was negative (12.73). monds and triangles). Next, cells were washed of unbound Ab and incu- These results indicate that mangabey CD16 binds human IgG2 and bated with either human IgG1 (filled symbols) or human IgG2 (empty IgG1 and only slightly binds IgG3, but not IgG4. These results symbols). Finally, cells were stained with FITC-labeled anti-human Ig␬ to were independently verified using FITC-conjugated goat anti- detect bound human IgG and analyzed by flow cytometry (10,000 cells for human Ig␥ (data not shown). No staining for heat-aggregated each condition). 3854 Ig FcRIII HOMOLOGUES IN NONHUMAN PRIMATE SPECIES human IgA1 (11.53), IgM (13.34), or IgE (7.75) was detected, nor human CD16a because its extracellular region, responsible for for heat-aggregated polyclonal mouse IgG (10.31). Polyclonal IgG binding to IgG, is more conserved with mouse Fc␥RII (55). In from sooty mangabey and baboon bound to CD16, as detected by addition, mouse Fc␥RIII is expressed on mast cells, whereas hu- both FITC-conjugated mouse anti-human Ig␬ and FITC-conju- man mast cells do not express this receptor (56). A second, not gated goat anti-human Ig␥ (Fig. 5). Binding was observed also for fully characterized mouse receptor (CD16-2), which may be more purified polyclonal IgG of rhesus macaques (anti-human Ig␬, homologous to human CD16a, has been identified recently (57). In MFI ϭ 78.71; anti-human Ig␥, MFI ϭ 284.56) and cynomolgus contrast, nonhuman primates represent the currently accepted macaques (anti-human Ig␬, MFI ϭ 67.65; anti-human Ig␥, MFI ϭ model to evaluate human therapeutics that may bind CD16. Be- 251.66). cause the premise that IgG/CD16 interactions in these species mimic those in humans has not been evaluated, we identified CD16 IgG binding correlates with expression of sooty mangabey as well as TCR ␨-chain genes in four nonhuman primate species. CD16 and is blocked by mAb 3G8 In addition, we generated sooty mangabey rCD16 in HeLa cells, as Taking advantage of the variation in CD16 expression levels we demonstrated that these cells transcribe the TCR ␨-chain that in among different cells of the clone, IgG binding was correlated to humans is necessary for CD16 expression. Our results show that CD16 expression. This was done by incubating HeLa cells ex- only one CD16 gene, homologous to the human CD16a, is present pressing rCD16 as well as untransfected HeLa cells with each of in nonhuman primates and that the nonhuman primate TCR the four human IgG subclasses, followed by staining with PE- ␨-chain genes are highly conserved with the human counterpart. In conjugated anti-human CD16 clone 3G8 and FITC anti-human all four species, CD16a is expressed on NK cells and monocytes

Ig␬. The 3G8 is an antagonist of IgG binding to human CD16 (44). and in sooty mangabeys, is also expressed on granulocytes. We Downloaded from As observed on dot plots of MFI for anti-human Ig␬ vs MFI for generated sooty mangabey rCD16 in HeLa cells. The sooty manga- anti-human CD16, there was a positive correlation between bound bey rCD16 was capable of binding to human IgG1 and IgG2, but IgG and receptor level for the human subclasses IgG2 and IgG1 not human IgG3 and IgG4. Thus, despite the strong conservation (data not shown). As expected, no correlation was observed when of the mangabey CD16 sequence with the human CD16 sequence, using IgG3, IgG4, and IgA1. To ascertain whether or not a similar mangabey and human CD16 differ in their ability to bind human antagonist effect might exist for mangabey CD16, regression anal- IgG subclasses. Human CD16 binds to IgG1 and IgG3, but only http://www.jimmunol.org/ ysis was performed plotting anti-human Ig␬ MFI vs anti-human weakly to IgG2 and IgG4 (2). Mangabey CD16/IgG interactions CD16 MFI using different Ig subclasses. A significant negative are specific, as indicated by the positive correlation of cells labeled correlation (r2 ϭϪ0.97; p ϭ 0.006) was present, thus indicating for both CD16 and bound IgG. Similarly, mAb 3G8, an antagonist that IgG competes with the anti-human CD16 clone 3G8 for bind- of IgG binding to human CD16, blocks binding to mangabey ing to mangabey CD16. These results also suggest that IgG did not CD16 (Fig. 6). These results indicate that the IgG binding site for completely saturate receptor binding sites at the concentration mangabey CD16 is most likely conserved with the human CD16 used. To verify that 3G8 blocks mangabey CD16, preventing bind- binding site as the sequence homology suggests. The few amino ing of IgG, IgG-binding experiments were repeated with cells that acid substitutions may be sufficient to allow for binding to IgG2. were first incubated with unlabeled 3G8 at different concentra- The IgG1 motif LLGGP located in the lower hinge is particu- by guest on September 23, 2021 tions. Incubation of cells with 3G8 before addition of human IgG larly important for binding to CD16 (2, 58). In IgG2, this motif is resulted in reduced binding of human IgG1 and IgG2 to mangabey replaced by VAGP. The motif LLGGP is encoded by all four IgG CD16 (Fig. 6). By contrast, incubation with a mouse Ab of irrel- subclass genes in baboons, rhesus macaques, cynomolgus ma- evant specificity before addition of human IgG did not alter the caques, pigtail macaques, and sooty mangabeys with the exception ability of mangabey CD16 to bind to human IgG1 and IgG2. of baboon IgG2 and pigtail macaque IgG4 (59, 60 and our unpublished results). In this study, we have shown that mangabey rCD16 Effects of blocking N-glycosylation on the expression and ligand is capable of binding to rhesus macaque, cynomolgus macaque, binding of CD16 baboon, and sooty mangabey IgG. Based on the conservation of Human and mangabey CD16 have conserved glycosylation motifs. the motif LLGGP in most of the nonhuman primate IgG mole- Therefore, N-glycosylation of mangabey CD16 was blocked to as- cules, it is expected that all four subclasses bind CD16. However, sess the effects on IgG binding. Anti-human CD16 staining with IgG/CD16 interactions have been shown to be complex and in- mAb 3G8 of tunicamycin-treated cells decreased 15.43–17.47% volve residues outside of the IgG lower hinge (45). Radaev and compared with untreated cells. Previously, it has been shown that Sun (61) found that small peptides with the sequences matching 3G8 binding to human CD16 is unaltered by glycosylation and that those of the lower hinge of human IgG1, IgG2, and IgG4 all have blocking N-glycosylation of human CD16 results in a modest de- similar affinities for human CD16, and concluded that additional crease in its expression (54). Thus, the decrease in staining for IgG features, such as hinge length, are important. Human IgG3 mangabey CD16 most likely represents a similar decrease in re- contains the LLGGP motif, yet we did not detect its binding to ceptor expression. By contrast, staining for bound IgG increased mangabey CD16. Therefore, mangabey CD16/IgG interactions are for both IgG1 and IgG2 when N-glycosylation was blocked. Ad- likely to also involve additional IgG subclass differences. justing for the decrease in receptor expression, the increase in The N-glycan of human CD16 at Asn180 is in close proximity of bound IgG1 and IgG2 ranged from 110 to 129.5% between dif- other residues that interact with the Fc fragment of IgG1 (46). ferent experiments. The increase in IgG binding did not favor ei- Glycosylation inhibition and mutation of Asn180 to Glu result in ther isotype over the other. Staining for bound IgG3 and IgG4 was increased affinity of CD16 for monomeric IgG, whereas mutations not significant regardless of N-glycosylation (data not shown). at other CD16 N-glycan sites have no effect (54). CD16a of monocytes, macrophages, and NK cells have different affinities for IgG Discussion as a result of differential glycosylation (62). Hence, cells can mod- Although mice have been used extensively to study FcR/Ab inter- ulate binding to IgG through modification of the Asn180 N-glycan. actions, they are unsuitable models to evaluate Ab-based thera- CD16 of nonhuman primates has the Asn180 glycosylation motif. peutics for human conditions. Mice have no homologue of CD16b Inhibition of N-glycosylation with tunicamycin resulted in a mod- (4). Mouse CD16a does not appear to be a true orthologue of est increase of human IgG binding to mangabey CD16, just as is The Journal of Immunology 3855 reported for human CD16 (54). CD16 glycosylation may be altered 20. Yang, X. D., X. C. Jia, J. R. Corvalan, P. Wang, C. G. Davis, and A. Jakobovits. during inflammation to modulate affinity of binding to IgG, and 1999. Eradication of established tumors by a fully human monoclonal antibody to the epidermal growth factor receptor without concomitant chemotherapy. Cancer hence activation through CD16 (54). Our data support the presence Res. 59: 1236–1243. of such a mechanism in nonhuman primates. 21. Hinton, P. R., M. G. Johlfs, J. M. Xiong, K. Hanestad, K. C. Ong, C. Bullock, In conclusion, our results show that there are extensive similar- S. Keller, M. T. Tang, J. Y. Tso, M. Vasquez, and N. Tsurushita. 2004. Engi- neered human IgG antibodies with longer serum half-lives in primates. J. Biol. ities shared by human and nonhuman primate CD16 molecules. Chem. 279: 6213–6216. However, differences in interactions with IgG subclasses as well as 22. Hahn, C. S., O. G. French, P. Foley, E. N. Martin, and R. P. Taylor. 2001. in cell-type expression are clearly recognizable. These differences Bispecific monoclonal antibodies mediate binding of dengue virus to erythrocytes in a monkey model of passive viremia. J. Immunol. 166: 1057–1065. should be carefully considered when using nonhuman primates for 23. He´rodin, F., P. Thullier, D. Garin, and M. Drouet. 2005. Nonhuman primates are the evaluation of therapeutic Abs. Further studies will clarify the relevant models for research in hematology, immunology and virology. Eur. Cy- extent of these differences and the role that these differences could tokine Network 16: 104–116. 24. Munn, D. H., A. G. Bree, A. C. Beall, M. D. Kaviani, H. Sabio, R. G. Schaub, play in the interpretation of results obtained from in vivo studies R. K. Alphaugh, L. M. Weiner, and S. J. Goldman. 1996. Recombinant human conducted in nonhuman primate models. macrophage colony-stimulating factor in nonhuman primates: selective expansion of a CD16ϩ monocytic subset with phenotypic similarity to primate natural killer cells. Blood 88: 1215–1224. Acknowledgments 25. Evans, T. J., D. Moyes, A. Carpenter, R. Martin, H. Loetscher, W. Lesslauer, and We thank Dr. Frank Novembre and the late Dr. Harold McClure (Yerkes J. Cohen. 1994. Protective effect of 55- but not 75-kD soluble tumor necrosis factor receptor-immunoglobulin G fusion proteins in an animal model of Gram- National Primate Research Center) for providing rhesus macaque and sooty negative sepsis. J. Exp. Med. 180: 2173–2179. mangabey blood samples, and Dr. Jerilyn Pecotte and Dr. Kathy Brasky 26. Hirsch, V. M., and J. D. Lifson. 2000. Simian immunodeficiency virus infection

(Southwest National Primate Research Center) for providing cynomolgus of monkeys as a model system for the study of AIDS pathogenesis, treatment, and Downloaded from macaque and baboon blood samples. prevention. Adv. Pharmacol. 49: 437–477. 27. Banks, N. D., N. Kinsey, J. Clements, and J. E. Hildreth. 2002. Sustained antibody-dependent cell-mediated cytotoxicity (ADCC) in SIV-infected macaques Disclosures correlates with delayed progression to AIDS. AIDS Res. Hum. Retroviruses 18: The authors have no ﬁnancial conﬂict of interest. 1197–1205. 28. Schaapherder, A. F., M. R. Daha, M. T. te Bulte, F. J. van der Woude, and H. G. Gooszen. 1994. Antibody-dependent cell-mediated cytotoxicity against

References porcine endothelium induced by a majority of human sera. Transplantation 57: http://www.jimmunol.org/ 1. Ravetch, J. V., and S. Bolland. 2001. IgG Fc receptors. Annu. Rev. Immunol. 19: 1376–1382. 275–290. 29. Rood, P. P., J. Hara, J. L. Busch, M. Ezzelarab, X. Zhu, S. Ball, D. Ayares, 2. Tamm, A., and R. E. Schimdt. 1997. IgG binding sites on human Fc␥ receptors. M. Awwad, and D. K. Cooper. 2006. Incidence and cytotoxicity of antibodies in Int. Rev. Immunol. 16: 57–85. cynomolgus monkeys directed to nonGal antigens, and their relevance for ex- 3. Ravetch, J. V., and B. Perussia. 1989. Alternative membrane forms of Fc␥RIII perimental models. Transpl. Int. 19: 158–165. (CD16) on human natural killer cells and neutrophils. J. Exp. Med. 170: 481–497. 30. Waiter, H., J. M. Guillaumin, F. Piller, M. Lacord, G. Thibault, Y. Lebranchu, 4. Gessner, J. E., H. Heiken, A. Tamm, and R. E. Schmidt. 1998. The IgG Fc M. Monsigny, and P. Bardos. 1996. Removal of terminal ␣-galactosyl residues receptor family. Ann. Hematol. 76: 231–248. from xenogeneic porcine endothelial cells: decrease in complement-mediated cy- 5. Ravetch, J. V., and J.-P. Kinet. 1991. Fc receptors. Annu. Rev. Immunol. 9: totoxicity but persistence of IgG1-mediated antibody-dependent cell-mediated 457–492. cytotoxicity. Transplantation 62: 105–113. 6. LaFont, V., J. Liautard, J. P. Liautard, and J. Favero. 2001. Production of TNF-␣ 31. Cozzi, E., M. Severo, E. Bosio, F. Besenzon, and E. Ancona. 2005. Antibody by human V␥9V␦2 T cells via engagement of Fc␥RIIIA, the low affinity type 3 mediated rejection in pig-to-nonhuman primate xenotransplantation models. by guest on September 23, 2021 receptor for the Fc portion of IgG, expressed upon TCR activation by nonpeptidic Curr. Drug Targets Cardiovasc. Haematol. Disord. 5: 233–253. antigen. J. Immunol. 166: 7190–7199. 32. Kanmaz, T., J. J. Fechner, Jr., J. Torrealba, H. T. Kim, Y. Dong, T. D. Oberley, 7. Lanier, L. L., T. J. Kipps, and J. H. Phillips. 1985. Functional properties of a J. M. Schultz, D. D. Bloom, M. Katayama, W. Dar, et al. 2004. Monotherapy with ϩ unique subset of cytotoxic CD3 T lymphocytes that express Fc receptors for the novel human anti-CD154 monoclonal antibody AB1793 in rhesus monkey IgG (CD16/Leu-11 antigen). J. Exp. Med. 162: 2089–2106. renal transplantation model. Transplantation 77: 914–920. 8. Radeke, H. H., J. E. Gessner, P. Uciechowski, H.-J. Ma¨gert, R. E. Schmidt, and 33. Kawai, T., H. Sogawa, S. Boskovic, G. Abrahamian, R. N. Smith, S. L. Wee, K. Resch. 1994. Intrinsic human glomerular mesangial cells can express receptors D. Andrews, O. Nadazdin, I. Koyama, M. Sykes, et al. 2004. CD154 blockade for for IgG complexes (hFc␥RIII-A) and the associated Fc␧RI ␥-chain. J. Immunol. induction of mixed chimerism and prolonged renal allograft survival in nonhu- 153: 1281–1292. man primates. Am. J. Transplant. 4: 1391–1398. 9. Ahmad, A., and J. Menezes. 1996. Antibody-dependent cellular cytotoxicity in 34. Kirk, A. D., L. C. Burkly, D. S. Batty, R. E. Baumgartner, J. D. Berning, HIV infections. FASEB J. 10: 258–266. K. Buchanan, J. H. Fechner, Jr., R. L. Germond, R. L. Kampen, N. B. Patterson, 10. Mandelboim, O., P. Malik, D. M. Davis, C. H. Jo, J. E. Boysen, and et al. 1999. Treatment with humanized monoclonal antibody against CD154 pre- J. L. Strominger. 1999. Human CD16 as a lysis receptor mediating direct natural vents acute renal allograft rejection in nonhuman primates. Nat. Med. 5: killer cell cytotoxicity. Proc. Natl. Acad. Sci. USA 96: 5640–5644. 686–693. 11. Anderson, P., M. Caligiuri, C. O’Brien, T. Manley, J. Ritz, and S. F. Schlossman. ␥ ␨ 35. Koyama, I., T. Kawai, D. Andrews, S. Boskovic, O. Nadazdin, S. L. Wee, 1990. Fc receptor type III (CD16) is included in the NK receptor complex H. Sogawa, D. L. Wu, R. N. Smith, R. B. Colvin, et al. 2004. Thrombophilia expressed by human natural killer cells. Proc. Natl. Acad. Sci. USA 87: associated with anti-CD154 monoclonal antibody treatment and its prophylaxis in 2274–2278. nonhuman primates. Transplantation 77: 460–462. 12. Lanier, L. L., G. Yu, and J. H. Phillips. 1989. Co-association of CD3␨ with a 36. Cosimi, A. B., D. Conti, F. L. Delmonico, F. I. Preffer, S. L. Wee, R. Rothlein, receptor (CD16) for IgG Fc on human natural killer cells. Nature 342: 803–805. R. Faanes, and R. B. Colvin. 1990. In vivo effects of monoclonal antibody to 13. Ra, C., M. H. E. Jouvin, U. Blank, and J. P. Kinet. 1989. A macrophage Fc␥ ICAM-1 (CD54) in nonhuman primates with renal allografts. J. Immunol. 144: receptor and the mast cell receptor for IgE share an identical subunit. Nature 341: 4604–4612. 752–754. 14. Weissman, A. M., S. J. Frank, D. G. Orloff, M. Mercep, J. D. Ashwell, and 37. Schuler, W., M. Bigaud, V. Brinkmann, F. Di Padova, S. Geisse, J. Gram, R. D. Klausner. 1989. Role of the ␨ chain in the expression of the T cell antigen V. Jungerford, B. Kleuser, C. Kristofic, K. Menniger, et al. 2004. Efficacy and receptor: genetic reconstitution studies. EMBO J. 8: 3651–3655. safety of AB1793, a novel human anti-human CD154 monoclonal antibody, in cynomolgus monkey renal allotransplantation. Transplantation 77: 717–726. 15. Hartnell, A., A. B. Kay, and A. J. Wardlaw. 1992. IFN-␥ induces expression of Fc␥RIII (CD16) on human eosinophils. J. Immunol. 148: 1471–1478. 38. Rogers, K. A., F. Scinicariello, and R. Attanasio. 2005. Identification and char- 16. Scallon, B. J., E. Scigliano, V. H. Freedman, M. C. Miedel, Y. C. E. Pan, acterization of macaque CD89 (immunoglobulin A Fc receptor). Immunology J. C. Unkeless, and J. P. Kochan. 1989. A human immunoglobulin G receptor 113: 178–186. exists in both polypeptide-anchored and phosphatidylinositol-glycan-anchored 39. Rogers, K. A., J. P. Richardson, F. Scinicariello, and R. Attanasio. 2006. Mo- forms. Proc. Natl. Acad. Sci. USA 86: 5079–5083. lecular characterization of IgD in mammals: immunoglobulin heavy constant ␦ 17. Jones, S. L., and E. J. Brown. 1996. Functional cooperation between Fc␥ recep- (IGHD) genes in dogs, chimpanzees and four Old World monkey species. Im- tors and complement receptors in phagocytes. In Human IgG Fc Receptors. munology 118: 88–100. J. G. J. van de Winkel and P. J. A. Capel, eds. Springer, New York, pp. 149–163. 40. Reimann, K. A., B. C. Waite, D. E. Lee-Parritz, W. Lin, B. Uchanska-Zeigler, 18. Miller, K. L., A.-M. Duchemin, and C. L. Anderson. 1996. A novel role for the M. J. O’Connell, and N. L. Letvin. 1994. Use of human leukocyte-specific mono- Fc receptor ␥ subunit: enhancement of Fc␥R ligand affinity. J. Exp. Med. 183: clonal antibodies for clinically immunophenotyping lymphocytes of rhesus mon- 2227–2233. keys. Cytometry 17: 102–108. 19. Yang, X. D., J. R. Corvalan, P. Wang, C. M. Roy, and C. G. Davis. 1999. Fully 41. Carter, D. L., T. M. Shieh, R. L. Blosser, K. R. Chadwick, J. B. Margolick, human anti-interleukin-8 monoclonal antibodies: potential therapeutics for the J. E. Hildreth, J. E. Clements, and M. C. Zink. 1999. CD56 identifies monocytes treatment of inflammatory disease states. J. Leukocyte Biol. 66: 401–410. and not natural killer cells in rhesus macaques. Cytometry 37: 41–50. 3856 Ig FcRIII HOMOLOGUES IN NONHUMAN PRIMATE SPECIES

42. Sopper, S., C. Stahl-Henning, M. Demuth, I. C. Johnston, D. Do¨rries, and 52. Franco, R., M. E. Peter, M. S. Choi, B. Malissen, J. Sancho, and C. Terhorst. V. ter Meulen. 1997. Lymphocyte subsets and expression of differentiation mark- 1994. Characterization of the GTP/GDP binding site in the murine CD3-␨ ers in blood and lymphoid organs of rhesus monkeys. Cytometry 29: 351–362. polypeptide chain. Immunol. Lett. 43: 167–175. 43. Kurosaki, T., and J. V. Ravetch. 1989. A single amino acid in the glycosyl 53. Atkinson, T. P., C. G. Hall, J. Goldsmith, and P. M. Kirkham. 2003. Splice phosphatidylinositol attachment domain determines the membrane topology of variant in TCR␨ links T cell receptor signaling to a G-protein-related signaling Fc␥RIII. Nature 342: 805–807. pathway. Biochem. Biophys. Res. Commun. 310: 761–766. 44. Hibbs, M. L., M. Tolvanen, and O. Carpeń. 1994. Membrane-proximal Ig-like 54. Drescher, B., T. Witte, and R. E. Schmidt. 2003. Glycosylation of Fc␥RIII in domain of Fc␥RIII (CD16) contains residues critical for ligand binding. J. Im- N163 as mechanism of regulation receptor affinity. Immunology 110: 335–340. munol. 152: 4466–4473. 55. Hughes, A. L. 1996. Gene duplication and recombination in the evolution of 45. Shields, R. L., A. L. Namenuk, K. Hong, Y. G. Meng, J. Rae, J. Briggs, D. Xie, mammalian Fc receptors. J. Mol. Evol. 43: 4–10. J. Lai, A. Stadlen, B. Li, et al. 2001. High resolution mapping of the binding site 56. Tkaczyk, C., Y. Okayama, D. D. Metcalfe, and A. M. Gilfillan. 2004. Fc␥ re- on human IgG1 for Fc␥RI, Fc␥RII, Fc␥RIII, and FcRn and design of IgG1 vari- ␥ ceptors on mast cells: activatory and inhibitory regulation of mediator release. Int. ants with improved binding to the Fc R. J. Biol. Chem. 276: 6591–6604. Arch. Allergy Immunol. 133: 305–315. 46. Sondermann, P., R. Huber, V. Oosthuizen, and U. Jacob. 2000. The 3.2-Å crystal 57. Mechetina, L., A. M. Najakshin, B. Y. Alabyev, N. A. Chikaev, and structure of the human IgG1 Fc fragment-Fc␥RIII complex. Nature 406: A. V. Taranin. 2002. Identification of CD16-2, a novel mouse receptor homol- 267–273. ogous to CD16/Fc␥RIII. Immunogenetics 54: 463–468. 47. Hibbs, M. L., P. Selvaraj, O. Carpeń, T. A. Springer, H. Kuster, M. H. Jouvin, and 58. Chappel, M. S., D. E. Isenman, M. Everett, Y. Y. Xu, K. J. Dorrington, and J. P. Kinet. 1989. Mechanisms for regulating expression of membrane isoforms ␥ of Fc␥RIII (CD16). Science 246: 1608–1611. M. H. Klein. 1991. Identification of the Fc receptor class I binding site in human 48. Lanier, L. L., G. Yu, and J. H. Phillips. 1991. Analysis of Fc␥RIII (CD16) IgG through the use of recombinant IgG1/IgG2 hybrid and point-mutated anti- membrane expression and association with CD3 ␨ and Fc␧RI-␥ by site-directed bodies. Proc. Natl. Acad. Sci. USA 88: 9036–9040. mutation. J. Immunol. 146: 1571–1576. 59. Scinicariello, F., C. N. Engleman, L. Jayashankar, H. M. McClure, and 49. Rellahan, B. L., J. P. Jensen, and A. M. Weissman. 1994. Transcriptional regu- R. Attanasio. 2004. Rhesus macaque antibody molecules: sequence and hetero- ␣ ␥ lation of the T cell antigen receptor ␨ subunit: identification of a tissue-restricted geneity of and constant regions. Immunology 111: 66–74. promoter. J. Exp. Med. 180: 1529–1534. 60. Attanasio, R., L. Jayashankar, C. N. Engleman, and F. Scinicariello. 2002. Ba- 50. Arase, H., T. Suenaga, N. Arase, Y. Kimura, K. Ito, R. Shiina, H. Ohno, and boon immunoglobulin constant region heavy chains: identification of four IGHG Downloaded from T. Saito. 2001. Negative regulation of expression and function of Fc␥RIII by genes. Immunogenetics 54: 556–561. CD3␨ in murine NK cells. J. Immunol. 166: 21–25. 61. Radaev, S., and P. Sun. 2001. Recognition of immunoglobulins by Fc␥ receptors. 51. Kurosaki, T., I. Gander, and J. V. Ravetch. 1991. A subunit common to an IgG Mol. Immunol. 38: 1073–1083. Fc receptor and the T-cell receptor mediates assembly through different interac- 62. Edberg, J. C., and R. P. Kimberly. 1997. Cell type-specific glycoforms of tions. Proc. Natl. Acad. Sci. USA 88: 3837–3841. Fc␥RIIIa (CD16): differential ligand binding. J. Immunol. 159: 3849–3857. http://www.jimmunol.org/ by guest on September 23, 2021