Amino Acid-Based Diet Prevents Lethal Infectious Diarrhea by Maintaining Body Water Balance in a Murine Citrobacter Rodentium Infection Model

nutrients

Article Amino Acid-Based Diet Prevents Lethal Infectious Diarrhea by Maintaining Body Water Balance in a Murine Citrobacter rodentium Infection Model

Tatsuki Kimizuka 1,2, Natsumi Seki 1,2, Genki Yamaguchi 1,2, Masahiro Akiyama 1, Seiichiro Higashi 3, Koji Hase 2 and Yun-Gi Kim 1,*

1 Research Center for Drug Discovery, Faculty of Pharmacy and Graduate School of Pharmaceutical Sciences, Keio University, Tokyo 105-8512, Japan; [email protected] (T.K.); [email protected] (N.S.); [email protected] (G.Y.); [email protected] (M.A.) 2 Division of Biochemistry, Faculty of Pharmacy and Graduate School of Pharmaceutical Sciences, Keio University, Tokyo 105-8512, Japan; [email protected] 3 Co-Creation Center, Meiji Holdings Co., Ltd., Tokyo 192-0919, Japan; [email protected] * Correspondence: [email protected]

Abstract: Infectious diarrhea is one of the most important health problems worldwide. Although nutritional status inﬂuences the clinical manifestation of various enteric pathogen infections, the effect of diet on enteric infectious diseases remains unclear. Using a fatal infectious diarrheal model, we found that an amino acid-based diet (AD) protected susceptible mice infected with the enteric pathogen Citrobacter rodentium. While the mice fed other diets, including a regular diet, were highly Citation: Kimizuka, T.; Seki, N.; susceptible to C. rodentium infection, AD-fed mice had an increased survival rate. An AD did not Yamaguchi, G.; Akiyama, M.; Higashi, suppress C. rodentium colonization or intestinal damage; instead, it prevented diarrhea-induced S.; Hase, K.; Kim, Y.-G. Amino Acid-Based Diet Prevents Lethal dehydration by increasing water intake. An AD altered the plasma and fecal amino acid levels and Infectious Diarrhea by Maintaining changed the gut microbiota composition. Treatment with glutamate, whose level was increased in the Body Water Balance in a Murine plasma and feces of AD-fed mice, promoted water intake and improved the survival of C. rodentium- Citrobacter rodentium Infection Model. infected mice. Thus, an AD changes the systemic amino acid balance and protects against lethal Nutrients 2021, 13, 1896. infectious diarrhea by maintaining total body water content. https://doi.org/10.3390/nu13061896 Keywords: amino acid-based diet; Citrobacter rodentium; dehydration; diarrhea; enteric infection Academic Editors: Evasio Pasini, Francesco S. Dioguardi and Giovanni Corsetti 1. Introduction Received: 12 May 2021 The World Health Organization deﬁnes diarrhea as the passage of three or more Accepted: 27 May 2021 Published: 31 May 2021 loose or liquid stools per day (or more frequent passage than is normal for the individual). Acute diarrheal illness is presently one of the most important health problems worldwide,

Publisher’s Note: MDPI stays neutral particularly in young children in developing countries. Bacterial infectious diarrhea is the with regard to jurisdictional claims in most prevalent diarrheal disease worldwide [1–4]. Commonly reported enteric bacterial published maps and institutional afﬁl- diarrhea and causative agents include Escherichia coli gastroenteritis, Salmonellosis (various iations. Salmonella serovars), Shigellosis (Shigella spp.), Campylobacter gastroenteritis (Campylobac- ter jejuni), cholera (Vibrio cholerae), staphylococcal food poisoning (Staphylococcus aureus enterotoxins), and botulism (Clostridium botulinum)[5,6]. Enteropathogenic and enterohemorrhagic E. coli (EPEC and EHEC, respectively) are among the most important bacterial causes of diarrhea worldwide [7–9]. These pathogens employ a type-III secretion system Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. (T3SS) and induce ultrastructural changes characterized by intimate bacterial adhesion to This article is an open access article the apical surface of enterocytes, microvilli effacement, and pedestal formation, which are distributed under the terms and called “attaching and effacing” (A/E) lesions [10]. conditions of the Creative Commons Citrobacter rodentium, a mouse pathogen that harbors a homologous T3SS and induces Attribution (CC BY) license (https:// A/E lesions, has been extensively used as a model for studying human EPEC and EHEC creativecommons.org/licenses/by/ infection [11,12]. C. rodentium typically causes self-limiting epithelial hyperplasia with a 4.0/). variable degree of inﬂammation in the distal colon of most laboratory mouse lines [13,14].

Nutrients 2021, 13, 1896. https://doi.org/10.3390/nu13061896 https://www.mdpi.com/journal/nutrients Nutrients 2021, 13, 1896 2 of 15

In contrast, suckling animals or C3H strains demonstrate severe colonic inflammation, diarrhea, and high mortality after infection with C. rodentium [15–17]. Nutritional status influences morbidity and mortality in diarrheal and enteric diseases [18,19]. For example, the nutritional management of dietary protein is effective for persistent diarrhea and the reduction of stool output [20,21]. In addition, an increasing number of studies indicate that dietary amino acids play important roles in suppressing intestinal inflammation [22,23]. Furthermore, several dietary factors have been shown to regulate C. rodentium colonization and infection-induced intestinal inflammation. Dietary quercetin and chitosan increase gut microbial diversity and attenuate colitis severity in C. rodentium-infected mice [24,25]. Diet-derived galacturonic acid suppresses virulence factor expression and inhibits intestinal C. rodentium colonization [26]. In contrast, a Western-style diet and insufficient dietary choline induce gut dysbiosis and severe pathology in response to C. rodentium infection [27,28]. However, only a few dietary factors that improve mortality in bacterial infectious diarrhea have been identified. In this study, we identified a diet that can impact mortality in susceptible mice infected with C. rodentium.

2. Materials and Methods 2.1. Mice Four-week-old female C3H/HeN mice were purchased from CLEA Japan Inc. (Tokyo, Japan). After a 2 week acclimatization period, the mice were given ad libitum access. to one of four diets: regular natural diet (RD; CE2, CLEA Japan Inc.), regular purified diet (PD; AIN93G, Research Diets; New Brunswick, NJ, USA), amino acid-based purified diet (AD; an original diet A07060801, Research Diets), and purified high-fat diet (FD; D12492, Research Diets) (Table1). All mice were housed at the Keio University Faculty of Pharmacy, Tokyo.

2.2. C. rodentium Infection The kanamycin-resistant WT C. rodentium strain DBS120 (pCRP1:: Tn5) was used [29]. For inoculation, bacteria were grown overnight in 50 µg/mL kanamycin-supplemented Luria–Bertani (LB) broth with shaking at 37 ◦C. Mice were infected by oral gavage with 0.2 mL phosphate-buffered saline (PBS) containing approximately 1 × 109 colony-forming unit (CFU) C. rodentium. To determine the bacterial load in the feces or tissues, fecal pellets were collected from individual mice, homogenized in cold PBS, plated at serial dilutions on McConkey agar containing 50 µg/mL Kan, and the CFUs was determined after overnight incubation at 37 ◦C. The mice were sacriﬁced at various time points post-infection.

2.3. Hematoxylin and Eosin Staining of the Colonic Tissue Colonic tissue samples were fixed in 10% formalin neutral buffer solution (Mild- form 10N, Wako Pure Chemical Industries, Osaka, Japan) overnight. After fixation, the samples were embedded in paraffin and then cut into 3 µm sections. The sections were deparaffinized, rehydrated, and stained with hematoxylin (Agilent Technologies, Inc.; Santa Clara, CA, USA) and eosin (Wako Pure Chemical Industries) and then mounted with Mount-Quick (Daido Sangyo Co., Ltd., Saitama, Japan).

2.4. Glutamate Administration Elix water was used to dissolve sodium L-glutamate monohydrate (1% solution; TCI; Tokyo, Japan) and sterilized through a 0.22 µm ﬁlter. PD-fed mice were treated with or without glutamate in drinking water from 10 days prior to C. rodentium infection until the end of the study. Nutrients 2021, 13, 1896 3 of 15

Table 1. Nutrient composition of experimental diets.

Diet PD AD FD RD * g% g% g% g% Protein 20 18 26.2 24.8 ** Carbohydrate 64 66 26.3 54.55 *** Fat 7 7 34.9 4.6 **** (kcal/gm) 4 4 5.2 3.4 Ingredient g g g g Casein 200 0 258.4 - L-Cystine 3 4.3 3.9 - L-Arginine - 6.1 - - L-Histidine-HCl- - 4.7 - - H2O L-Isoleucine - 7.7 - - L-Leucine - 16.0 - - L-Lysine-HCl - 13.4 - - L-Methionine - 5.2 - - L-Phenylalanine - 8.5 - - L-Threonine - 7.3 - - L-Tryptophan - 2.1 - - L-Valine - 9.4 - - L-Alanine - 5.2 - - L-Asparagine- - 6.8 - - H2O L-Aspartate - 5.5 - - L-Glutamic Acid - 22.0 - - L-Glutamine - 16.7 - - Glycine - 3 - - L-Proline - 18.1 - - L-Serine - 10.1 - - L-Tyrosine - 9.3 - - Corn Starch 397.5 403.4 0 - Maltodextrin 132 134 162 - Sucrose 100 108.7 88.9 - Cellulose, 50 51 65 - BW200 Corn Oil 0 0 0 - Soybean Oil 70 71 32 - Lard 0 0 317 - t- 0 0 0 - butylhydroquinone Vitamins mg mg mg mg Vitamin A 6.6 6.7 8.5 8.1 Vitamin B1 5.3 5.4 6.8 18 Vitamin B2 6 6.1 7.8 14 Vitamin B6 5.8 5.9 7.5 13 Vitamin B12 2.5 2.5 1.3 0 Vitamin D3 10 10.1 12.9 0.1 Vitamin E 131.7 133.7 113.5 71 Pantothenic acid 13.5 13.7 17.4 30 Biotin 20 2 2.6 0.5 Folic Acid 2 6.7 8.5 8.1 Total (g) 1000 1000 1000 1000 * RD; regular natural diet, PD; regular purified diet, AD; amino acid-based purified diet, FD; purified high-fat diet. Average of periodic analysis in 2020. ** Protein source: soybean waste, whitefish meal, yeast. *** Carbohydrate source: wheat flour, corn, Milo (fiber source: wheat bran, defatted rice bran, alfalfa meal). **** Fat source: cereal germ, soybean oil. All diets contain appropriate minerals. Nutrients 2021, 13, 1896 4 of 15

2.5. Amino Acid Concentration Plasma and fecal free amino acids were determined using an LC/MS system (TQD, Waters Corporation; Milford, MA, USA), with pre-column 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate derivatization [30]. The analytes were initially deproteinized with 5% trichloroacetic acid. After mixing, the samples were centrifuged at 12,000 rpm for 10 min at 4 ◦C. The supernatant from each sample was assayed for free amino acids. Data were analyzed using the Waters TargetLinksTM software.

2.6. Fecal Lipocalin-2 We measured the fecal lipocalin-2 level as a non-invasive intestinal inﬂammation biomarker [31]. Mouse fecal pellets were collected in sterile 1.5 mL microcentrifuge tubes, and 100 mg/mL suspensions in sterile 0.1% Tween-20/D-PBS (–) were prepared. Samples were shaken using a vortex mixer at maximum speed for 20 min, followed by centrifugation. The supernatants were assayed for lipocalin-2 using mouse Lipocalin-2/NGAL DuoSet ELISA (R&D Systems; Minneapolis, MN, USA).

2.7. Reverse Transcription and Quantitative PCR Total RNA from mouse tissue was extracted using the PureLink RNA Mini Kit (Thermo Fisher Scientiﬁc; Waltham, MA, USA) according to the manufacturer’s instructions. RNA was reverse-transcribed to obtain cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO; Osaka, Japan). RT-qPCR was performed using StepOnePlus (Thermo Fisher Scientiﬁc) with THUNDERBIRD SYBR qPCR Mix (TOYOBO). Oligonu- cleotide primers were purchased from Integrated DNA Technologies (IA, USA). Primer sequences for Ctnnb1 and Mmp7 are listed in Table2.

Table 2. Primer sequences.

Genes Primer Sequence Forward ATG GAG CCG GAC AGA AAA GC Ctnnb1 Reverse TGG GAG GTG TCA ACA TCT TCT T Forward GCA TTT CCT TGA GGT TGT CC Mmp7 Reverse CAC ATC AGT GGG AAC AGG C Forward GAA ATG CCA CCT TTT GAC AGT G Il1b Reverse TGG ATG CTC TCA TCA GGA CAG Forward TGA TGC ACT TGC AGA AAA CA Il6 Reverse ACC AGA GGA AAT TTT CAA TAG GC Forward TCAGCGTGTCCAAACACTGAG Il17a Reverse CGCCAAGGGAGTTAAAGACTT Forward GTG CTC AAC TTC ACC CTG GA Il22 Reverse TGG ATG TTC TGG TCG TCA CC Forward AACATCCCTCCAGCCTACG Slc26a3 Reverse TGGACCCACAGATATGTGTCT Forward TAC CGG GAA TCC AAG AAG ATT GA Rpl19 Reverse AGG ATG CGC TTG TTT TTG AAC

2.8. Colonic Epithelial Barrier Permeability Fluorescein isothiocyanate (FITC)-dextran (4 kDa; Sigma-Aldrich; St. Louis, MO, USA) was dissolved in PBS at a concentration of 50 mg/mL. Mice were fasted for 4 h prior to gavage with 60 mg FITC-dextran/100 g body weight. Mice were anesthetized 4 h after gavage, and blood was taken from the heart and centrifuged at 1100× g for 15 min at 4 ◦C. Plasma was collected and the ﬂuorescence at an 485 nm excitation wavelength and 528 nm emission wavelength was quantiﬁed. Nutrients 2021, 13, 1896 5 of 15

2.9. Plasma IgA ELISA The plasma samples were subjected to IgA ELISA using a mouse IgA ELISA Quantitation Set (Bethyl Laboratories, Inc.; Montgomery,TX, USA), following the manufacturer’s instructions.

2.10. Fecal Pellet DNA Extraction and 16S rRNA Gene Sequencing and Analysis Bacterial DNA was extracted from the feces using an E.Z.N.A® Stool DNA kit (Omega Bio-Tek, Inc.; Norcross, GA, USA) and purified using magLEAD 12gc (Precision Sys- tem Science Co., Ltd.; Chiba, Japan). PCR was performed using KAPA HiFi HotStart ReadyMix (Nippon Genetics Co.,Ltd.; Tokyo, Japan) and the primer set (forward: 50- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-30, and reverse: 50-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCT AATCC-30) for the V3–V4 regions of 16S rRNA. The amplicons were purified using AMPure XP (Beckman Coulter; Brea, CA, USA). DNA from each sample was added to different index sequences using the Nextera XT index kit (Illumina; San Diego, CA, USA). Mixed samples were prepared by pooling approximately equal amounts of each amplified DNA and sequenced using Miseq Reagent Kit V3 (600 cycle) and a MiSeq sequencer (Illumina), in accordance with the manufacturer’s instructions. The sequencing data were analyzed using Qiime2 (version 2020.11) [32]. To trim the primer region from the raw sequences, Cutadapt in the Qiime2 plugin was used (https://doi.org/10.14806/ej.17.1.200, accessed on 27 May 2021). The sequences without primer regions were processed for quality control, paired-end read joining, chimera filtering, and amplicon sequence varient (ASV) table construction using the DADA2 algorithm [33]. For each ASV-representative sequence, BLAST [34] was used to assign the taxonomy based on the SILVA database (version 138) [35]. After randomly sampling 4100 reads using a feature table [36], the compositional data were converted, and diversity analysis was performed.

2.11. Statistical Analyses Statistical analyses were performed using GraphPad Prism software (version 9.0.2; GraphPad Software Inc.; San Diego, CA, USA). Differences between two groups were evaluated using the D’Agostino and Pearson test and F-test followed by the Student’s t-test, Welch’s t-test, or Mann–Whitney U test. Differences were considered signiﬁcant at p < 0.05.

3. Results 3.1. AD Protects the Mice from Lethal C. rodentium Infection To assess the impact of diets on lethal infectious diarrhea, AD, FD, PD, and RD-fed mice were infected with C. rodentium, and their survival was monitored over time. More than 90% of RD, PD, and FD-fed mice succumbed to infection, compared to only 20% of AD-fed mice (Figure1A). Since only the protein sources of the PD and AD differed (casein vs. amino acids), we next focused on PD and AD-fed mice. Body weight loss was signiﬁcantly greater in PD-fed mice than in AD-fed mice throughout the duration of infection (Figure1B). Wnt signaling activation is one of the hallmarks of diarrheal C. rodentium infection susceptibility [37]. Therefore, we compared the expressions of β- catenin (Ctnnb1), the principal canonical Wnt signaling downstream mediator, and MMP-7 (Mmp7), which is transcriptionally regulated by β-catenin. The expression of Wnt target genes Ctnnb1 and Mmp7 was signiﬁcantly lower in the AD-fed mice colon than that in PD-fed mice colon (Figure1C). These results indicate that an AD protects mice from lethal C. rodentium infection. Nutrients 2021, 13, x FOR PEER REVIEW 6 of 15

the principal canonical Wnt signaling downstream mediator, and MMP-7 (Mmp7), which is transcriptionally regulated by β-catenin. The expression of Wnt target genes Ctnnb1 and Mmp7 was significantly lower in the AD-fed mice colon than that in PD-fed mice colon Nutrients 2021, 13, 1896 (Figure 1C). These results indicate that an AD protects mice from lethal C. rodentium6 in- of 15 fection.

A 100 ✱✱

) 80

(

l 60

i v

r 40 u

S PD N.S. N.S. 20 AD 0 0 3 6 9 12 15 18 21 Days after infection B C

) Ctnnb1 Mmp7

(

110 n 2.0 ✱✱✱ 2.0

g s

s ✱

n s

✱✱✱ s

a e

✱ e 1.5 1.5

r r

h 105

e e

h 1.0

1.0

i v

100 v

i t

PD t w

0.5 a

a 0.5

e e

d AD

R R o 95 0.0 0.0 B 0 2 4 6 8 10 PD AD PD AD Days after infection

FigureFigure 1. 1. AnAn amino amino acid acid-based-based diet diet protects protects mice mice from from lethal lethal infection infection with with CitrobacterCitrobacter rodentium rodentium. . MiceMice fed fed each each diet diet (RD: (RD: regular regular natural natural diet diet (n ( n= =10), 10), PD: PD: regular regular purified purified diet diet (n (n == 10), 10), AD: AD: amino amino acidacid-based-based purified purified diet diet (n ( n= =10), 10), FD: FD: purified purified high high-fat-fat diet diet (n ( n= =10)) 10)) were were orally orally administered administered C.C. rodentiumrodentium. (.(A)A Mouse) Mouse survival survival and and (B) body (B) body weight weight change change 3, 6, 9, 3, and 6, 9, 10 and days 10 post days-infection post-infection com- paredcompared to that to on that day on0. Data day 0.are Data expressed are expressed as mean ± as SEM. mean (C±) GeneSEM. expression (C) Gene of expression Ctnnb1 and of Mmp7Ctnnb1 inand the Mmp7colon 9in days the post colon-infection 9 days post-infection by real-time RT by-PCR. real-time mRNA RT-PCR. expression mRNA of each expression gene was of each normal- gene izedwas to normalized that of Rpl19 to. thatEach of dotRpl19 represents. Each dotan individual represents mouse, an individual and horizontal mouse, bars and horizontalindicate mean bars values. Statistical significance was assessed by the (A) log-rank test, compared to RD group, (B) two- indicate mean values. Statistical significance was assessed by the (A) log-rank test, compared to RD way ANOVA with Šídák’s multiple comparisons test, or (C) unpaired Student’s t-test. * p < 0.05; ** group, (B) two-way ANOVA with Šídák’s multiple comparisons test, or (C) unpaired Student’s t-test. p < 0.01; *** p < 0.001; N.S., not significant. * p < 0.05; ** p < 0.01; *** p < 0.001; N.S., not significant.

3.2.3.2. AD AD neither neither Promotes Promotes Pathogen Pathogen Clearance Clearance nor nor Suppre Suppressessses Intestinal Intestinal Damage Damage Next,Next, we we examined examined whether whether an an AD AD influences influences pathogen pathogen clearance clearance and and gut gut barrier barrier function.function. Fecal Fecal C.C. rodentium rodentium shedding waswas detecteddetected as as early early as as 1 day1 day post-infection post-infection and and was wasnot not significantly significantly different different between between PD PD and and AD-fed AD-fed mice mice 9 days 9 days post-infection post-infection (Figure (Figure2A ). 2A).The The bacterial bacterial burden burden in the in the liver liver and and spleen spleen of PD of PD and and AD-fed AD-fed mice mice was was also also similar similar (Fig- (Figureure2B). 2B). After After the theC. rodentiumC. rodentiuminfection, infection, severe severe epithelial epithelial hyperplasia hyperplasia and and a loss a ofloss crypt of cryptmorphology morphology were were observed, observed, but the but histological the histological changes changes of the of colon the colon were notwere apparently not ap- parentlydifferent different between between the mice the fed mice a PD fed and a PD AD and (Figure AD (Figure2C). Consistently, 2C). Consistently, the fecal the level fecal of levellipocalin-2, of lipocalin an inflammatory-2, an inflammatory marker, marker, was comparable was comparable in both in groups both groups 9 days post-infection9 days post- infection(Figure2 (FigureD). Wethen 2D).assessed We then the assessed intestinal the barrier intestinal function barrier in PDfunction and AD-fed in PD and mice AD by- mea-fed micesuring by measuring the plasma the level plasma of the level orally of administered the orally administered permeability permeability marker FITC-dextran. marker FITC The- dextran.plasma The level plasma of FITC-dextran level of FITC was-dextran not different was not between different the groupsbetween 7 the days groups post-infection 7 days post(Figure-infection2E) . In (Figure addition, 2E). the In addition, colonic expression the colonic of expression inflammatory of inflammatory cytokines, Il1b cytokines,, Il6, Il17a , − − − − Il1bIl22, Il6, and, Il17Slc26a3a, Il22,, and which Slc26a3 encode, which the majorencode Cl the/HCO major3 Clexchanger/HCO3 exchanger that drives that water drives ab- watersorption absorption [38], was [38] comparable, was comparable between between the infected the infected mice fedmice a PDfed anda PD AD and ( FigureAD (Fig-2F). ureFurthermore, 2F). Furthermore, the levels the levels of fecal of (intestinal)fecal (intestinal) IgA, whichIgA, which prevents prevents enteric enteric pathogen pathogen invasion [39], and plasma IgA, which protects against polymicrobial sepsis [40], were not significantly different between PD and AD-fed mice prior to the infection (Figure2G,H). Collectively, we concluded that an AD neither promotes pathogen elimination nor suppresses C. rodentium-induced intestinal damage, inflammation, and sepsis. Nutrients 2021, 13, x FOR PEER REVIEW 7 of 15

invasion [39], and plasma IgA, which protects against polymicrobial sepsis [40], were not significantly different between PD and AD-fed mice prior to the infection (Figure 2G,H). Nutrients 2021, 13, 1896 7 of 15 Collectively, we concluded that an AD neither promotes pathogen elimination nor suppresses C. rodentium-induced intestinal damage, inflammation, and sepsis.

A B C PD AD N.S. N.S. N.S. N.S. N.S. N.S. ) 8

) 14 e

s PD u

e 12

s c

s AD i

e 6 t

f 10

g /

/ 8 U

U 4 F

F 6

(

( 0

0 4 2

g o

o 2

l l 0 0 1 3 5 9 Liver Spleen Days after infection D E G H

) N.S.

) s

N.S. ) N.S. s 25 3000 ) 150

e 100

L N.S.

/ f

20 g 80

µ (

/ 2000 100

(

g n

n 15 60

(

A -

10 40 a

n I

i 1000 50

c a

5 c

20 l

i F F 0 L 0 0 0 PD AD PD AD PD AD PD AD

F Il1b Il6 Il17a Il22 Slc26a3 N.S.

4 N.S. 6 N.S. 4 3 N.S. 10 n

n N.S.

s s

s 8

s s

3 3 s

r r

4 r 2

p x

x 6

e e 2 e

v v

v 4

t t

t 2 t

t 1

l l

1 l 1

e e

e 2

R R 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD

Figure 2. A F Figure 2An. An amino amino acid-based acid-based diet diet neither neither promotes promotes pathogen pathogen clearance clearance nornor suppresses suppresses intestinalintestinaldamage. damage. ((A––F)) MiceMice fed eachfed dieteach (PD;diet (PD; regular regular purified purified diet, diet, AD; AD; amino amino acid-based acid-based purified purified diet) diet) were were orally orally infected infected with withC. C. rodentium rodentium(n (=n = 9–10 9– in each10 in group). each group). (A,B) Fecal(A,B) pathogenFecal pathogen load on load 1, 3,on 5, 1, and 3, 5, 9 daysand 9 post-infection days post-infection (A) and (A in) and the in tissues the tiss 10ues days 10 post-infectiondays post- (Binfection). (C) H&E (B). staining(C) H&E ofstaining colon of slides colon from slides representative from representative infected infected mice mice fed PD fed orPD AD or AD 10 days10 days post-infection. post-infection. scale scale bar, 200bar,µ m200 (D μm) Fecal (D) Fecal lipocalin-2 lipocalin concentration-2 concentration 9 days 9 days post-infection. post-infection. (E )(E Plasma) Plasma concentration concentration of of fluorescein fluorescein isothiocyanate isothiocya- (FITC)-dextrannate (FITC)-dextran 7 days 7 post-infection. days post-infection. (F) Gene (F) expressionGene expression of Il1b of, Il6 Il1b, Il17a, Il6, Il17Il22a,, and Il22Slc26a3, and Slc26a3in the i colonn the colon 9 days 9 post-infectiondays post- infection by real-time RT-PCR. mRNA expression of each gene was normalized to that of Rpl19 (G–H) Mice fed PD or AD by real-time RT-PCR. mRNA expression of each gene was normalized to that of Rpl19 (G–H) Mice fed PD or AD for 2 for 2 weeks (n = 10 in each group). IgA levels in (G) feces or (H) plasma. Each dot represents an individual mouse, and the weekshorizontal (n = 10bars in indicate each group). mean values. IgA levels Statistical in (G )significance feces or (H was) plasma. assessed Each by two dot- representsway ANOVA an with individual (A,B) Šídák’s mouse, multi- and the horizontalple comparisons bars indicate test, (D mean,F (Il1b values., Il6, Il17 Statisticala, Slc26a3 significance), H) Mann– wasWhitney assessed test, by (E, two-wayF (Il22)) unpaired ANOVA Welch’s with (A ,tB-test,)Šíd orák’s (G multiple) un- comparisonspaired Student’s test, (tD-test.,F ( Il1bN.S.,, Il6 not, Il17a significant., Slc26a3 ), H) Mann–Whitney test, (E,F (Il22)) unpaired Welch’s t-test, or (G) unpaired Student’s t-test. N.S., not significant. 3.3. AD Promotes Water Intake, Thereby Protecting from Lethal Infectious Diarrhea 3.3. ADMortality Promotes in WaterC. rodent Intake,ium-infected Thereby Protectingmice is associated from Lethal with Infectious fatal fluid Diarrhea loss and dehy- drationMortality [16]. Therefore, in C. rodentium we assessed-infected whether mice a is PD associated prevents withC. rodentium fatal fluid infection loss and-induced dehydra- tiondehydration. [16]. Therefore, We found we that assessed the level whether of blood a PDurea prevents nitrogenC. (BUN), rodentium a dehydrationinfection-induced status dehydration.marker, was sign Weificantly found that lower the in level AD of-fed blood mice urea than nitrogen that in (BUN),PD-fed amice dehydration (Figure 3A). status marker,Moreover, was peritoneal significantly saline lower treatment in AD-fed protected mice thanthe PD that-fed in mice PD-fed from mice C. rodentium (Figure3A). infec- More- over,tion, and peritoneal the survival saline rate treatment was comparable protected to the that PD-fed of AD mice-fed mice from (FigureC. rodentium 3B). Notably,infection, and the survival rate was comparable to that of AD-fed mice (Figure3B). Notably, AD-fed mice had a higher water intake than PD-fed mice, although the amount of food consumed was not different (Figure3C,D). These results indicate that an AD promotes water intake, which protects the mice from C. rodentium infection-induced dehydration and death. Nutrients 2021, 13, x FOR PEER REVIEW 8 of 15

AD-fed mice had a higher water intake than PD-fed mice, although the amount of food consumed was not different (Figure 3C,D). These results indicate that an AD promotes Nutrients 2021, 13, 1896 water intake, which protects the mice from C. rodentium infection-induced dehydration8 of 15 and death.

A B 50 100

N.S. ✱✱ PD )

l 40 )

d 75 N.S. AD

(

30 l

(

v i

v r

N 20

U S B 10 25 0 0 Day0 Day6 0 3 6 9 12 15 18 21 Days after infection C D N.S.

5 2.5

)

e )

s ✱✱✱

e e

u 2.0

k 4

n i

/ 3 1.5

d a

2 o 1.0

g m

1 ( 0.5 ( 0 0.0 PD AD PD AD

FigureFigure 3. 3.AnAn amino amino acid acid-based-based diet dietpromotes promotes water water intake intake and protects and protects from lethal from infectious lethal infectious diarrhea.diarrhea. (A,B) Mice (A,B )fed Mice each fed diet each (PD; diet regular (PD; regular purified purified diet, AD; diet, amino AD; acid amino-based acid-based purified purified diet) were diet) infectedwere infected orally with orally Citrobacter with Citrobacter rodentium rodentium (n = 9–10(n in= eac 9–10h group). in each ( group).A) Blood (A urea) Blood nitrogen urea nitrogen(BUN) level.(BUN) Each level. dotEach represents dot represents an individual an individual mouse and mouse the and horizontal the horizontal bars indicate bars indicate mean meanvalues. values. (B) Mouse(B) Mouse survival survival after afterperitoneal peritoneal saline saline treatment treatment once once a day a day after after 6 days. 6 days. (C, (DC),D Mice) Mice fed fed PD PD or or AD AD forfor 2 2weeks weeks (n (n == 9 9–10–10 in in each each group). group). ( (C)) Water andand ((DD)) food food intake. intake. Data Data are are expressed expressed as as mean mean± SD.± SD.Statistical Statistical significance significance was was assessed assessed by two-wayby two-way ANOVA ANOVA with with (A)Š í(dAá)k’s Šídák’s multiple multiple comparisons compari- test, sons test, (B) log-rank test, (C) unpaired Student’s t-test, or (D) Mann–Whitney test. ** p < 0.01; *** p (B) log-rank test, (C) unpaired Student’s t-test, or (D) Mann–Whitney test. ** p < 0.01; *** p < 0.001; < 0.001; N.S., not significant. N.S., not significant.

3.4.3.4. AD AD Changes Changes Plasma Plasma and and Fecal Fecal Amino Amino Acid Acid Levels Levels DietaryDietary protein protein composition composition and plasma plasma amino amino acid acid concentration concentration are are associated associated with withwater water intake intake [41, 42[41,42]]. Therefore,. Therefore, we comparedwe compared plasma plasma amino amino acid acid concentrations concentrations between be- tweenPD and PD AD-fedand AD- mice.fed mice. Plasma Plasma glutamate glutamate levels levels were were higher higher and and the the levels levels of of isoleucine, isoleucine,leucine, leucine, valine, valine, and and phenylalanine phenylalanine were were lower lower in the in AD-fed the AD mice-fed thanmice thosethan those in the in PD-fed the PDmice-fed (Figuremice (Figure4). Dietary 4). Dietary protein protein composition composition is one is of one the primaryof the primary factors factors contributing contrib- to utingthe composition,to the composition, structure, structure, and function and function of gut microbes, of gut microbes, which can which in turn can provide in turn aminopro- videacids amino to the acids host to [43 the,44 ].host Thus, [43,44] we. examined Thus, we whetherexamined an whether AD inﬂuences an AD theinfluences composition the compositionof the gut microbialof the gut communities. microbial communities. Although itAlthough did not affectit did not the totalaffect bacterial the total numberbacte- rial(Figure number5A), (Figure an AD 5A), changed an AD the changed gut microbiota the gut compositionmicrobiota composition (Figure5B) by(Figure signiﬁcantly 5B) by significantlyincreasing andincreasing decreasing and decreasing the abundance the abundance of Erysipelotrichaceae of Erysipelotrichaceae and Streptococcaceae and Strep- tococcaceaefamilies, respectively families, respectively (Figure5C). (Figure Furthermore, 5C). Furthermore, the fecal histidine, the fecal arginine,histidine, glutamate,arginine, glutamate,tyrosine, andtyrosine, phenylalanine and phenylalanine concentrations concentrations were higher were in higher AD-fed in miceAD-fed than mice in PD-fed than inmice PD-fed (Figure mice5 D).(Figure Collectively, 5D). Collectively, these results these indicate results thatindicate an AD that alters an AD plasma alters and plasma fecal andamino fecal acid amino levels, acid which levels, may which maintain may maintain the total bodythe total water body content, water therebycontent, protecting thereby protectingthe mice fromthe mice lethal from diarrheal lethal diarrhealC. rodentium C. rodentiuminfection. infection.

NutrientsNutrients 20212021, 13, 13, x, FOR 1896 PEER REVIEW 9 of 159of 15

His Asn Ser Gln Gly Arg

250 200 N.S. 600 5000 1000 N.S. 400 N.S. N.S. N.S.

200 150 4000 750 300 N.S.

L L

L 400

m m

/ /

150 / 3000

l l

o o

100 o 500 200

m m

100 m 2000

n n n n n 200 50 50 1000 250 100 0 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD PD AD Asp Glu Thr Ala Pro Lys

40 150 800 N.S. 1500 400 2000 N.S. N.S. N.S. N.S. ✱

30 600 300 1500

L L

L 100 1000

o o

o 20 400 200 1000

n n

n n n 50 500 10 200 100 500

0 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD PD AD

Cys Tyr Met Ile Val Leu

150 250 200 400 800 ✱ 500 N.S. N.S. ✱ N.S.

200 150 300 ✱ 600 400

L L L L

L 100

m m m m m

/ / / /

/ 150 300

l l l l l

o o o o

o 100 200 400

m m m m

m 100 200

n n n n n n 50 50 50 100 200 100 0 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD PD AD Phe Trp

250 ✱ 400 N.S.

200 300

m /

/ 150

l o

o 200 m

m 100

n n 50 100 0 0 PD AD PD AD FigureFigure 4. 4.AnAn amino amino acid acid-based-based diet diet alters alters plasma plasma amino amino acid acid levels. levels. Plasma Plasma levels levels of each of each amino amino acid acid in the in mice the mice fed each fed each dietdiet (PD: (PD: regular regular purified purified diet, diet, AD: AD: amino amino acid acid-based-based purified purified diet) diet) for for2 weeks 2 weeks (n = ( n6 =in 6 each in each group). group). Each Each dot represents dot represents anan individual individual mouse, mouse, and and horizontal horizontal bars bars indicate indicate mean mean values. values. Statistical Statistical significance significance was was assessed assessed using using the un thepaired unpaired Welch’s t-test. * p < 0.05; N.S., not significant. Welch’s t-test. * p < 0.05; N.S., not significant.

NutrientsNutrients 20212021, 13, ,13 x ,FOR 1896 PEER REVIEW 10 of 1015 of 15

A B C Erysipelotrichaceae Streptococcaceae

)

) % Bacteroidaceae 80 %

% 6 ✱✱ (

100 ( ( 12

✱✱

Muribaculaceae e

N.S. e

c c

e Prevotellaceae 5

n n

n Erysipelatoclostridiaceae 60

75 a e

11 a

a d g 4

Erysipelotrichaceae d

n n

S Lactobacillaceae

u u 6 40 3

50 b

10 Streptococcaceae b

a l

Lachnospiraceae

e 2

e t

e Oscillospiraceae

v o

i 20 i

9 i 25

t t

t Ruminococcaceae T

a 1

l l

l Peptostreptococcaceae

e e e Enterobacteriaceae

R 0

R 0 8 R 0 Others PD AD PD AD PD AD PD AD

D His Asn Ser Gln Gly Arg

1500 1500 4000 5000 8000 4000 ✱ ✱ N.S. N.S. N.S. N.S.

3000 4000 6000 3000

g g

1000 1000 g

l l

3000 l

o o

2000 o 4000 2000

n n n

n n 2000 n 500 500 1000 1000 2000 1000 0 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD PD AD Asp Glu Thr Ala Pro Lys N.S. 40000 15000 4000 8000 6000 8000 N.S. ✱✱✱ N.S. N.S. 5000

30000 N.S. 3000 6000 6000

g g

10000 g 4000

/ /

l l

o o

20000 o 2000 4000 3000 4000

m m

n n n n n n 5000 2000 10000 1000 2000 2000 1000 0 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD PD AD Cys Tyr Met Ile Val Leu 600 4000 1500 4000 6000 6000 N.S. N.S. N.S. N.S. N.S. 500 ✱ 5000 5000

3000 3000

g g

400 g 1000 4000 4000

o o

300 o 2000 2000 3000 3000

n n

n n 200 n 500 2000 2000 1000 1000 100 1000 1000 0 0 0 0 0 0 PD AD PD AD PD AD PD AD PD AD PD AD Phe Trp

4000 1000 N.S.

3000 ✱ 750

l o

o 2000 500

n n 1000 250

0 0 PD AD PD AD

FigureFigure 5. 5.AnAn amino amino acid acid-based-based diet diet changes changes gut gut microbiota microbiota composition composition and and fecal fecal amino amino acid acid levels levels.. Mice fed each diet (PD, (PD,regular regular purified purified diet; diet; AD, AD, amino amino acid-based acid-based purified purified diet) diet) for for 2 weeks 2 weeks (n (=n 6= in6 in each each group). group). (A (A) Total) Total bacterial bacterial number number in the in the feces. (B) Relative abundance of operational taxonomic units (OTUs) in fecal samples from each group. The various feces. (B) Relative abundance of operational taxonomic units (OTUs) in fecal samples from each group. The various colors colors correspond to each bacterial order. (C) Relative abundance of OTUs assigned to Erysipelotrichaceae and Strepto- correspond to each bacterial order. (C) Relative abundance of OTUs assigned to Erysipelotrichaceae and Streptococcaceae coccaceae families. (D) Fecal levels of each amino acid. Each dot represents an individual mouse, and horizontal bars indicatefamilies. mean (D )values. Fecal levels Statistical of each significance amino acid. was Each assessed dot representsby (A) unpaired an individual Student’s mouse, t-test, ( andC) Mann horizontal–Whitne barsy test, indicate or (D mean) unpairedvalues. Welch’s Statistical t-test. significance * p < 0.05; was** p < assessed 0.01; *** p by < (0.001;A) unpaired N.S., not Student’s significant.t-test, (C) Mann–Whitney test, or (D) unpaired Welch’s t-test. * p < 0.05; ** p < 0.01; *** p < 0.001; N.S., not significant.

Nutrients 2021, 13, x FOR PEER REVIEW 11 of 15 Nutrients 2021, 13, 1896 11 of 15

3.5. Oral Glutamate Treatment Protects Mice from Lethal Diarrheal C. rodentium Infection 3.5. OralSince Glutamate an AD increased Treatment Protectsboth plasma Mice and from fecal Lethal glutamate Diarrheal levels, C. rodentium we hypothesized Infection that glutamateSince an influences AD increased water bothintake plasma and protects and fecal the glutamatemice from diarrheal levels, we C. hypothesized rodentium in- thatfection glutamate-induced inﬂuences dehydration. water Therefore, intake and we protectsassessed thewhether mice glutamate from diarrheal treatmentC. roden- pre- tiumventinfection-induceds C. rodentium infection dehydration.-induced lethal Therefore, diarrhea. we Water assessed intake whether increased glutamate in glutamate treat-- menttreated prevents mice comparedC. rodentium to infection-inducedthat in the untreated lethal mice diarrhea. (Figure Water6A). Although intake increased glutamate in glutamate-treatedtreatment did not mice suppress compared C. rodentium to thatin colonization the untreated (Figure mice 6B), (Figure it prevented6A). Although C. ro- glutamatedentium-induced treatment dehydration, did not suppress as assessedC. rodentium by BUN colonizationlevels (Figure (Figure 6C). Consistently,6B), it prevented gluta- C.mate rodentium administration-induced dehydration, significantly asimproved assessed the by survival BUN levels of C. (Figure rodentium6C).- Consistently,infected mice glutamate(Figure 6D). administration These results signiﬁcantly indicate that improved glutamate the treatment survival of promotesC. rodentium water-infected intake, mice pre- (Figurevents 6 diarrhealD ). These C. results rodentium indicate infection that- glutamateinduced dehydration, treatment promotes and improves water intake, mouse pre- sur- ventsvival. diarrheal C. rodentium infection-induced dehydration, and improves mouse survival.

✱✱ A B C N.S. ✱✱ D

5 ) 14 40 100 s

) Cont

e 12 N.S.

) )

l 80 s e ✱✱✱

4 e

d %

k 30 Glu

10 /

(

l t

/ 60

a n m 3

i 8

(

r y

e a

6 r N

t 40 C

d 2

(

S L

0 4 B

W Cont 1 10 20

m 1 g

( 2 o

l Glu 0 0 0 0 Cont Glu Cont Glu Day0 Day6 0 3 6 9 12 15 18 21 Days after infection

FigureFigure 6. Oral 6. Oral glutamate glutamate treatment treatment protects protects mice mice from from lethal lethal diarrheal diarrhealCitrobacter Citrobacter rodentium rodentiuminfection. infection (A) Mice. (A were) Mice treated were withtreated or without with or 1% without glutamate 1% glutamate for 10 days. for Water10 days. intake Water of intake each group.of each Datagroup. are Data expressed are expressed as mean as± meanSD. (±B SD.–D) ( MiceB–D) treatedMice withtreated or with without or without 1% glutamate 1% glutamate were infectedwere infected orally orally with withC. rodentium C. rodentium(n = (n 8 = in 8 eachin each group). group). (B (B)) Fecal Fecal pathogen pathogen loadload 6 days 6 days post-infection. post-infection. (C ()C Blood) Blood urea urea nitrogen nitrogen (BUN) (BUN) level level 0 and0 and 6 6 days days post-infection. post-infection. ( D(D)) Mouse Mouse survival. survival. EachEach dotdot representsrepresents an an individual individual mouse mouse and and the the horizontal horizontal bars bars indicate indicate mean mean values. values. Statistical Statistical significance significance was wasassessed assessed byby ((AA,,BB)) unpaired Student’s t-test or (C) two-way ANOVA with Šídák’s multiple comparisons test. ** p < 0.01; *** p < 0.001; N.S., unpaired Student’s t-test or (C) two-way ANOVA with Šídák’s multiple comparisons test. ** p < 0.01; *** p < 0.001; N.S., not significant. not significant. 4. Discussion 4. Discussion Murine C. rodentium infection is an excellent model for studying important disease processes,Murine includingC. rodentium infectiousinfection diarrhea. is an excellent This infection model model for studying is characterized important by diseasecolonic processes,hyperplasia, including inflammation, infectious and diarrhea. diarrhea, This depending infection on model the age, is characterizeddiet, microbiological by colonic sta- hyperplasia,tus, and genetic inflammation, background and of diarrhea, the host. depending Using the onC. therodentium age, diet, infection microbiological model, we status, have andshown genetic that background an AD protects of the mice host. from Using fatal the infectiousC. rodentium diarrheainfection by promoting model, we wate haver shownintake. that anA AD previous protects report mice fromhas shown fatal infectious that chronic diarrhea monosodium by promoting glutamate water administration intake. increasesA previous water reportintake has[45] shown. In addition, that chronic glutamine monosodium stimulates glutamatewater and sodium administration absorp- increasestion in enterocytes water intake [46] [45. ].Oral In addition, glutamate glutamine treatment stimulates also increased water water and sodium intake, absorption prevented indehydration, enterocytes and [46]. improved Oral glutamate the survival treatment of C. rodentium also increased-infected water mice. intake, Therefore, prevented an AD dehydration,may protect andagainst improved C. rodentium the survival infection of-C.induced rodentium dehydration,-infected mice.partly Therefore, by increasing an AD the mayplasma protect and against intestinalC. rodentiumglutamateinfection-induced levels. We used a glutamic dehydration, acid partlysodium by sa increasinglt for oral glu- the plasmatamate and treatment. intestinal Water glutamate ionizes levels.sodium We glutamate used a glutamicinto free sodium acid sodium ions and salt glutamic for oral glutamateacids. Therefore, treatment. sodium Water may ionizes increase sodium water glutamate intake. into However, free sodium sodium ions solution and glutamic intake acids.was Therefore,decreased in sodium C3H mice may compared increase water to water intake. intake However, [47]. Thus, sodium the solutionincreased intake water was in- decreasedtake was incaused C3H by mice glutamic compared acid,to and water not sodium. intake [47 In]. contrast, Thus, the the increased plasma concentrations water intake wasof branched caused by-chain glutamic amino acid, acids and (BCAAs; not sodium. isoleucine, In contrast, leucine, theand plasma valine) concentrationswere higher in ofPD branched-chain-fed mice than aminothose in acids AD-fed (BCAAs; mice. The isoleucine, BCAA-enriched leucine, diet and reduced valine) werewater higherintake in[48] PD-fed. Furthermore, mice than severe those dehydration in AD-fed mice.due to Thegastroenteritis BCAA-enriched often causes diet reduced metabolic water aci- intakedosis, [48 which]. Furthermore, increases plasma severe BCAA dehydration concentrations due to gastroenteritis due to the hypermetabolic often causes metabolic states of acidosis,proteolysis which [49] increases. Therefore, plasma increased BCAA plasma concentrations BCAAs may due be to detrimental the hypermetabolic to diarrhea states-re- oflated proteolysis dehydration. [49]. Therefore, increased plasma BCAAs may be detrimental to diarrhea- related dehydration.

Nutrients 2021, 13, 1896 12 of 15

Wnt/β-catenin signaling promotes intestinal epithelial proliferation and the genera- tion of a poorly differentiated epithelium, leading to the downregulation of ion transporters such as Slc26a3, which is exclusively expressed in differentiated enterocytes, thereby re- ducing water absorption and inducing dehydration [37]. The expression of Ctnnb1 and Mmp7 was significantly lower in the colon of the mice fed an AD than the mice fed a PD, suggesting that the activation of Wnt signaling pathways is suppressed by an AD. However, the expression of Slc26a3 was comparable in the infected mice fed a PD and AD. Thus, an AD may protect the mice from lethal infection diarrhea by promoting water intake rather than improving water absorption. Further work will reveal the mechanism by which an AD promotes water intake. An AD increased the fecal concentration of several amino acids. The distribution of free amino acids in the intestine, brain, and serum of germ-free mice was different from that in conventionalized mice [50,51], suggesting that gut microbiota contributes to host amino acid balance. Clostridia, Peptostreptococci, Bacillus–Lactobacillus–Streptococcus groups, and Proteobacteria are the most prevalent species involved in amino acid fermentation in the human intestine [52–54]. Such bacteria are likely to influence the amino acid pools in the gut. Accordingly, the abundance of Streptococcaceae, which contains Streptococcus, decreased in the gut of AD-fed mice. Therefore, changes in gut microbiota composition due to an AD may also affect fecal and plasma amino acid levels. An AD increased the abundance of Erysipelotrichaceae, which belongs to Clostridium Cluster XVI, which includes Gram- positive filamentous rods and both facultative and obligate anaerobes. High-protein diets increase Erysipelotrichaceae abundance and upregulate the genes involved in amino acid metabolism and transport, as well as proteolysis [55]. Therefore, an AD may supply the free amino acids utilized by Erysipelotrichaceae for growth. In conclusion, we observed that an AD prevents fatal infectious diarrhea by regulating body water balance. Our findings provide new insight into current oral rehydration therapy by providing glucose and electrolyte solutions to prevent and/or correct diarrhea- induced dehydration.

Author Contributions: T.K. and Y.-G.K. conceived the study and designed the experiments; T.K., N.S., G.Y., M.A., S.H. and Y.-G.K. collected samples and conducted the experiments; T.K., N.S., G.Y., M.A., S.H., K.H. and Y.-G.K. analyzed the data; T.K., N.S., G.Y., M.A. and Y.-G.K. prepared the manuscript; and Y.-G.K. supervised the project. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by research grants from JSPS KAKENHI (JP17H05068 and JP20H03490 to Y.-G.K.), AMED (JP18gm6010004h0003 to Y.-G.K.), and Yakult Bio-Science Foundation (to Y.-G.K.). Institutional Review Board Statement: The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the ethics committee of the Keio University (approved number: 17014). Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available on request from the corresponding author. Acknowledgments: We thank our laboratory members for helpful discussions. Graphical abstract was created using www.biorender.io (accessed on 27 May 2021). Conﬂicts of Interest: Seiichiro Higashi is an employee of Co-Creation Center, Meiji Holdings Co., Ltd.,Tokyo, Japan. This study was funded by Meiji Holdings Co. Nutrients 2021, 13, 1896 13 of 15

References 1. Kotloff, K.L.; Nataro, J.P.; Blackwelder, W.C.; Nasrin, D.; Farag, T.H.; Panchalingam, S.; Wu, Y.; Sow, S.O.; Sur, D.; Breiman, R.F.; et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): A prospective, case-control study. Lancet 2013, 382, 209–222. [CrossRef] 2. Liu, J.; Kabir, F.; Manneh, J.; Lertsethtakarn, P.; Begum, S.; Gratz, J.; Becker, S.M.; Operario, D.J.; Taniuchi, M.; Janaki, L.; et al. Development and assessment of molecular diagnostic tests for 15 enteropathogens causing childhood diarrhoea: A multicentre study. Lancet Infect. Dis. 2014, 14, 716–724. [CrossRef] 3. Platts-Mills, J.A.; Babji, S.; Bodhidatta, L.; Gratz, J.; Haque, R.; Havt, A.; McCormick, B.J.; McGrath, M.; Olortegui, M.P.; Samie, A.; et al. Pathogen-specific burdens of community diarrhoea in developing countries: A multisite birth cohort study (MAL-ED). Lancet Glob. Health 2015, 3, e564–e575. [CrossRef] 4. Ugboko, H.U.; Nwinyi, O.C.; Oranusi, S.U.; Oyewale, J.O. Childhood diarrhoeal diseases in developing countries. Heliyon 2020, 6, e03690. [CrossRef] 5. Humphries, R.M.; Linscott, A.J. Practical guidance for clinical microbiology laboratories: Diagnosis of bacterial gastroenteritis. Clin. Microbiol. Rev. 2015, 28, 3–31. [CrossRef][PubMed] 6. Tarr, G.A.M.; Chui, L.; Lee, B.E.; Pang, X.L.; Ali, S.; Nettel-Aguirre, A.; Vanderkooi, O.G.; Berenger, B.M.; Dickinson, J.; Tarr, P.I.; et al. Performance of stool-testing recommendations for acute gastroenteritis when used to identify children with 9 potential bacterial enteropathogens. Clin. Infect. Dis. 2019, 69, 1173–1182. [CrossRef] 7. Croxen, M.A.; Law, R.J.; Scholz, R.; Keeney, K.M.; Wlodarska, M.; Finlay, B.B. Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev. 2013, 26, 822–880. [CrossRef] 8. Hartland, E.L.; Leong, J.M. Enteropathogenic and enterohemorrhagic E. coli: Ecology, pathogenesis, and evolution. Front. Cell Infect. Microbiol. 2013, 3, 15. [CrossRef][PubMed] 9. Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [CrossRef][PubMed] 10. Gaytan, M.O.; Martinez-Santos, V.I.; Soto, E.; Gonzalez-Pedrajo, B. Type three secretion system in attaching and effacing pathogens. Front. Cell Infect. Microbiol. 2016, 6, 129. [CrossRef] 11. Collins, J.W.; Keeney, K.M.; Crepin, V.F.; Rathinam, V.A.; Fitzgerald, K.A.; Finlay, B.B.; Frankel, G. Citrobacter rodentium: Infection, inflammation and the microbiota. Nat. Rev. Microbiol. 2014, 12, 612–623. [CrossRef][PubMed] 12. Mullineaux-Sanders, C.; Sanchez-Garrido, J.; Hopkins, E.G.D.; Shenoy, A.R.; Barry, R.; Frankel, G. Citrobacter rodentium- host-microbiota interactions: Immunity, bioenergetics and metabolism. Nat. Rev. Microbiol. 2019, 17, 701–715. [CrossRef] [PubMed] 13. Barthold, S.W.; Coleman, G.L.; Jacoby, R.O.; Livestone, E.M.; Jonas, A.M. Transmissible murine colonic hyperplasia. Vet. Pathol. 1978, 15, 223–236. [CrossRef][PubMed] 14. Mundy, R.; MacDonald, T.T.; Dougan, G.; Frankel, G.; Wiles, S. Citrobacter rodentium of mice and man. Cell Microbiol. 2005, 7, 1697–1706. [CrossRef] 15. Barthold, S.W.; Osbaldiston, G.W.; Jonas, A.M. Dietary, bacterial, and host genetic interactions in the pathogenesis of transmissible murine colonic hyperplasia. Lab. Anim. Sci. 1977, 27, 938–945. 16. Borenshtein, D.; Fry, R.C.; Groff, E.B.; Nambiar, P.R.; Carey, V.J.; Fox, J.G.; Schauer, D.B. Diarrhea as a cause of mortality in a mouse model of infectious colitis. Genome Biol. 2008, 9, R122. [CrossRef] 17. Borenshtein, D.; Nambiar, P.R.; Groff, E.B.; Fox, J.G.; Schauer, D.B. Development of fatal colitis in FVB mice infected with Citrobacter rodentium. Infect. Immun. 2007, 75, 3271–3281. [CrossRef] 18. Brown, K.H. Diarrhea and malnutrition. J. Nutr. 2003, 133, 328S–332S. [CrossRef] 19. Petri, W.A., Jr.; Miller, M.; Binder, H.J.; Levine, M.M.; Dillingham, R.; Guerrant, R.L. Enteric infections, diarrhea, and their impact on function and development. J. Clin. Investig. 2008, 118, 1277–1290. [CrossRef] 20. Bhutta, Z.A.; Hendricks, K.M. Nutritional management of persistent diarrhea in childhood: A perspective from the developing world. J. Pediatr. Gastroenterol. Nutr. 1996, 22, 17–37. [CrossRef] 21. de Mattos, A.P.; Ribeiro, T.C.; Mendes, P.S.; Valois, S.S.; Mendes, C.M.; Ribeiro, H.C., Jr. Comparison of yogurt, soybean, casein, and amino acid-based diets in children with persistent diarrhea. Nutr. Res. 2009, 29, 462–469. [CrossRef] 22. He, F.; Wu, C.; Li, P.; Li, N.; Zhang, D.; Zhu, Q.; Ren, W.; Peng, Y. Functions and signaling pathways of amino acids in intestinal inflammation. BioMed Res. Int. 2018, 2018, 9171905. [CrossRef] 23. Liu, Y.; Wang, X.; Hu, C.A. Therapeutic potential of amino acids in inflammatory bowel disease. Nutrients 2017, 9, 920. [CrossRef] [PubMed] 24. Guan, G.; Wang, H.; Chen, S.; Liu, G.; Xiong, X.; Tan, B.; Duraipandiyan, V.; Al-Dhabi, N.A.; Fang, J. Dietary chitosan supplementation increases microbial diversity and attenuates the severity of citrobacter rodentium infection in mice. Mediat. Inflamm. 2016, 2016, 9236196. [CrossRef] 25. Lin, R.; Piao, M.; Song, Y. Dietary quercetin increases colonic microbial diversity and attenuates colitis severity in citrobacter rodentium-infected mice. Front. Microbiol. 2019, 10, 1092. [CrossRef][PubMed] 26. Jimenez, A.G.; Ellermann, M.; Abbott, W.; Sperandio, V. Diet-derived galacturonic acid regulates virulence and intestinal colonization in enterohaemorrhagic Escherichia coli and Citrobacter rodentium. Nat. Microbiol. 2020, 5, 368–378. [CrossRef] [PubMed] Nutrients 2021, 13, 1896 14 of 15

27. Ju, T.; Kennelly, J.P.; Jacobs, R.L.; Willing, B.P. Insufficient dietary choline aggravates disease severity in a mouse model of Citrobacter rodentium-induced colitis. Br. J. Nutr. 2021, 125, 50–61. [CrossRef] 28. Maattanen, P.; Lurz, E.; Botts, S.R.; Wu, R.Y.; Yeung, C.W.; Li, B.; Abiff, S.; Johnson-Henry, K.C.; Lepp, D.; Power, K.A.; et al. Ground flaxseed reverses protection of a reduced-fat diet against Citrobacter rodentium-induced colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 315, G788–G798. [CrossRef] 29. Kim, Y.G.; Sakamoto, K.; Seo, S.U.; Pickard, J.M.; Gillilland, M.G., 3rd; Pudlo, N.A.; Hoostal, M.; Li, X.; Wang, T.D.; Feehley, T.; et al. Neonatal acquisition of clostridia species protects against colonization by bacterial pathogens. Science 2017, 356, 315–319. [CrossRef][PubMed] 30. Armenta, J.M.; Cortes, D.F.; Pisciotta, J.M.; Shuman, J.L.; Blakeslee, K.; Rasoloson, D.; Ogunbiyi, O.; Sullivan, D.J., Jr.; Shulaev, V. Sensitive and rapid method for amino acid quantitation in malaria biological samples using AccQ.Tag ultra performance liquid chromatography-electrospray ionization-MS/MS with multiple reaction monitoring. Anal. Chem. 2010, 82, 548–558. [CrossRef] 31. Chassaing, B.; Srinivasan, G.; Delgado, M.A.; Young, A.N.; Gewirtz, A.T.; Vijay-Kumar, M. Fecal lipocalin 2, a sensitive and broadly dynamic non-invasive biomarker for intestinal inflammation. PLoS ONE 2012, 7, e44328. [CrossRef] 32. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [CrossRef] 33. Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [CrossRef][PubMed] 34. Pruesse, E.; Quast, C.; Knittel, K.; Fuchs, B.M.; Ludwig, W.; Peplies, J.; Glockner, F.O. SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 2007, 35, 7188–7196. [CrossRef][PubMed] 35. Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [CrossRef] 36. Weiss, S.; Xu, Z.Z.; Peddada, S.; Amir, A.; Bittinger, K.; Gonzalez, A.; Lozupone, C.; Zaneveld, J.R.; Vazquez-Baeza, Y.; Birmingham, A.; et al. Normalization and microbial differential abundance strategies depend upon data characteristics. Microbiome 2017, 5, 27. [CrossRef][PubMed] 37. Papapietro, O.; Teatero, S.; Thanabalasuriar, A.; Yuki, K.E.; Diez, E.; Zhu, L.; Kang, E.; Dhillon, S.; Muise, A.M.; Durocher, Y.; et al. R-spondin 2 signalling mediates susceptibility to fatal infectious diarrhoea. Nat. Commun. 2013, 4, 1898. [CrossRef][PubMed] 38. Schweinfest, C.W.; Spyropoulos, D.D.; Henderson, K.W.; Kim, J.H.; Chapman, J.M.; Barone, S.; Worrell, R.T.; Wang, Z.; Soleimani, M. Slc26a3 (dra)-deficient mice display chloride-losing diarrhea, enhanced colonic proliferation, and distinct up-regulation of ion transporters in the colon. J. Biol. Chem. 2006, 281, 37962–37971. [CrossRef] 39. Cerutti, A.; Rescigno, M. The biology of intestinal immunoglobulin A responses. Immunity 2008, 28, 740–750. [CrossRef] 40. Wilmore, J.R.; Gaudette, B.T.; Atria, D.G.; Hashemi, T.; Jones, D.D.; Gardner, C.A.; Cole, S.D.; Misic, A.M.; Beiting, D.P.; Allman, D. Commensal microbes induce serum IgA responses that protect against polymicrobial sepsis. Cell Host Microbe 2018, 23, 302–311. [CrossRef] 41. Pitkanen, H.T.; Oja, S.S.; Kemppainen, K.; Seppa, J.M.; Mero, A.A. Serum amino acid concentrations in aging men and women. Amino Acids 2003, 24, 413–421. [CrossRef] 42. Romano, C.; Corsetti, G.; Flati, V.; Pasini, E.; Picca, A.; Calvani, R.; Marzetti, E.; Dioguardi, F.S. Influence of Diets with varying essential/nonessential amino acid ratios on mouse lifespan. Nutrients 2019, 11, 1367. [CrossRef] 43. Neis, E.P.; Dejong, C.H.; Rensen, S.S. The role of microbial amino acid metabolism in host metabolism. Nutrients 2015, 7, 2930–2946. [CrossRef] 44. Zhao, J.; Zhang, X.; Liu, H.; Brown, M.A.; Qiao, S. Dietary protein and gut microbiota composition and function. Curr. Protein Pept. Sci. 2019, 20, 145–154. [CrossRef][PubMed] 45. Lopez-Miranda, V.; Soto-Montenegro, M.L.; Uranga-Ocio, J.A.; Vera, G.; Herradon, E.; Gonzalez, C.; Blas, C.; Martinez-Villaluenga, M.; Lopez-Perez, A.E.; Desco, M.; et al. Effects of chronic dietary exposure to monosodium glutamate on feeding behavior, adiposity, gastrointestinal motility, and cardiovascular function in healthy adult rats. Neurogastroenterol. Motil. 2015, 27, 1559–1570. [CrossRef][PubMed] 46. Rhoads, J.M.; Keku, E.O.; Quinn, J.; Woosely, J.; Lecce, J.G. L-glutamine stimulates jejunal sodium and chloride absorption in pig rotavirus enteritis. Gastroenterology 1991, 100, 683–691. [CrossRef] 47. Tordoff, M.G.; Bachmanov, A.A.; Reed, D.R. Forty mouse strain survey of water and sodium intake. Physiol. Behav. 2007, 91, 620–631. [CrossRef][PubMed] 48. Eizirik, D.L.; Germano, C.M.; Migliorini, R.H. Dietetic supplementation with branched chain amino acids attenuates the severity of streptozotocin-induced diabetes in rats. Acta Diabetol. Lat. 1988, 25, 117–126. [CrossRef][PubMed] 49. Tsukano, K.; Inoue, H.; Suzuki, K. Increase in branched-chain amino acids due to acidemia in neonatal calves with diarrhoea. Vet. Rec. Open 2017, 4, e000234. [CrossRef][PubMed] 50. Kawase, T.; Nagasawa, M.; Ikeda, H.; Yasuo, S.; Koga, Y.; Furuse, M. Gut microbiota of mice putatively modifies amino acid metabolism in the host brain. Br. J. Nutr. 2017, 117, 775–783. [CrossRef] 51. Whitt, D.D.; Demoss, R.D. Effect of microflora on the free amino acid distribution in various regions of the mouse gastrointestinal tract. Appl. Microbiol. 1975, 30, 609–615. [CrossRef] Nutrients 2021, 13, 1896 15 of 15

52. Allison, C.; Macfarlane, G.T. Inﬂuence of pH, nutrient availability, and growth rate on amine production by Bacteroides fragilis and Clostridium perfringens. Appl. Environ. Microbiol. 1989, 55, 2894–2898. [CrossRef][PubMed] 53. Dai, Z.L.; Wu, G.; Zhu, W.Y. Amino acid metabolism in intestinal bacteria: Links between gut ecology and host health. Front. Biosci. 2011, 16, 1768–1786. [CrossRef] 54. Davila, A.M.; Blachier, F.; Gotteland, M.; Andriamihaja, M.; Benetti, P.H.; Sanz, Y.; Tome, D. Re-print of “Intestinal luminal nitrogen metabolism: Role of the gut microbiota and consequences for the host”. Pharmacol. Res. 2013, 69, 114–126. [CrossRef] 55. Hugenholtz, F.; Davids, M.; Schwarz, J.; Muller, M.; Tome, D.; Schaap, P.; Hooiveld, G.; Smidt, H.; Kleerebezem, M. Metatranscrip- tome analysis of the microbial fermentation of dietary milk proteins in the murine gut. PLoS ONE 2018, 13, e0194066. [CrossRef] [PubMed]