Journal of Cell Science N- nuclear depleting by activity Wnt rnfcino yolcsltdEcdei uat 1,btntfully not but V13, mutant, E-cadherin hypoglycosylated of Transfection opooy aty epeeteiec that evidence present we Lastly, morphology. increased in resulted euao fprotein key A conserved 2008). of al., et Zhao 2001; regulator Aebi, and (Helenius and adhesion signaling cell intracellular secretion, clearance, targeting, folding, of Modification with unappreciated. various relatively proteins regulating been in has significance functions its cell but evolution, in conserved adhesion. E-cadherin active transcriptionally in changes pathway. glycosylation of levels increased o:10.1242/jcs.113035 doi: 484–496 126, ß Science Cell of Journal 2012 November 7 Accepted 00 egpae l,21) hssgetdreciprocal suggested This 2010). protein al., Wnt, al., canonical et of et among Nita-Lazar target interactions 2006; a Sengupta al., be et tissues to 2010; 2010). (Liwosz and signaling adhesion Birchmeier, epithelial Wnt E-cadherin canonical affect and to protein in shown Heuberger of been pathway 2006; cell survival metabolic the of al., Recently, and regulator et fate key be (Brembeck proliferation a to cell 2009). and adhesion, regulate, Nusse, polarity, and E-cadherin to and shown by, Amerongen been proliferation antagonized has a van signaling plays regulating 2009; Wnt Canonical pathway al., in et Wnt (MacDonald canonical role the prominent them, cell Among and metabolism core cellular adhesion. of with networks interact conserved that highly pathways signaling by controlled is behavior Cell Introduction words: Key AJs. to recruitment with extensively modified the that is report now E-cadherin We promoter. cells, sparse In (AJs). junctions adherens or complexes, protein complex E-cadherin protein of of association pathway metabolic The Summary ( correspondence for *Author 2 1 Sengupta K. Pritam of regulation Coordinate 484 adhesion DPAGT1 eateto irbooyadImnlg,Uiest fMrln eia col 5 atmr tet atmr,M 10,USA 21201, MD USA Baltimore, 02118, Street, MA Baltimore Boston, W EVANS-E438, 655 Street, School, Concord Medical East Maryland 72 of Center, University Medical Immunology, University and Boston Microbiology Biology, of Cell Department and Molecular of Department 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. lcslto ihcnnclWtsgaigadEcdei deinvapstv n eaiefebc mechanisms. feedback negative and positive via adhesion E-cadherin and signaling Wnt canonical with glycosylation Protein DPAGT1 N- N- DPAGT1 lcn n om acn J,wiei es utrs yolcsltdEcdei rvsteasml fmtr J with AJs mature of assembly the drives E-cadherin hypoglycosylated cultures, dense in while AJs, nascent forms and glycans PG1 -ahrnahso,Ngyoyain n signaling, Wnt N-glycosylation, adhesion, E-cadherin DPAGT1, lcslto sesnilfrvaiiyadhighly and viability for essential is glycosylation rmtrcreae ihdwrglto fisclua bnac,wiels fnuclear of loss while abundance, cellular its of downregulation with correlated promoter N- lcn a cnwegdrlsi protein in roles acknowledged has glycans DPAGT1 c aoia n inln n E-cadherin and signaling Wnt canonical , and - [email protected] gene. N- DPAGT1 1 N- lcslto n eue ebaelclzto fEcdei,cicdn ihdaai hne ncell in changes dramatic with coincident E-cadherin, of localization membrane reduced and glycosylation ehnP Bouchie P. Meghan , lcslto steevolutionarily the is glycosylation a DPAGT1 -catenins. tefafce aoia n inln,wt ocdcagsi t xrsinrsligi corresponding in resulting expression its in changes forced with signaling, Wnt canonical affected itself DPAGT1 b satre ftecnnclWtsgaigptwy ihboth with pathway, signaling Wnt canonical the of target a is b and - ) ctnnadcnnclWtatvt.Rmral,a24fl nraei the in increase 2.4-fold a Remarkably, activity. Wnt canonical and -catenin N- lcslto nlecsitrellrahso yafcigtecmoiinadcytoskeletal and composition the affecting by adhesion intercellular influences glycosylation N- noe h dolichol-P- the encodes esscl est hog aoia n inln.I es el,dpeinof depletion cells, dense In signaling. Wnt canonical through density cell senses c ctnn.Cletvl,orsuisso htclscoordinate cells that show studies our Collectively, -catenins. lcslto fEcdei scnrle ythe by controlled is E-cadherin of glycosylation N- N- N- lcslto and glycosylation lcslto has glycosylation lcslto ttso -ahrncnrl t naoimo aoia n signaling. Wnt canonical of antagonism its controls E-cadherin of status glycosylation 1 ia Nita-Lazar Mihai , N- lcslto gene glycosylation ta. 09 iaLzre l,21) ncnrs,downregulation in Nita-Lazar contrast, In 2006; AJs 2010). al., al., nascent et et Nita-Lazar of (Liwosz 2009; al., cells the formation et cancer with the and and promotes proliferating proteins stabilizing and with cytoskeleton interaction Increased its 2009; precludes al., 2010). extensive et with Nita-Lazar al., associated 2006; al., et et (AJs) Liwosz E- Nita-Lazar junctions 2009; of al., adherens The et as association regulate 2002; (Jamal known cytoskeletal 2003). to complexes, and protein shown Fuchs, Johnson, cadherin been organization has molecular and tumor and E-cadherin the of and Jamora Wheelock status receptor glycosylation 1995; 2005; adhesion Takeichi, cell-cell (Gumbiner, epithelial suppressor major the egpae l,21;Wll ta. 1985). al., 2005; et al., Welply et 2010; Mendelsohn al., 1999; et al., Sengupta et Meissner 1983; Lucas, and the in changes and robust to and lead Kukuruzinska 2001; N- Aebi, and 1998). oligosaccharide Lennon, (Helenius lipid-linked (ER) the reticulum protein of for synthesis precursor (LLO) the initiates that dependent b N- -catenin, mn ueospoen fetdby affected proteins numerous Among expression its in changes modest and pathway, glycosylation 2 lcsltdEcdei,it preclsihbtdcanonical inhibited cells sparse into E-cadherin, glycosylated N- sa-igYang Hsiao-Ying , lcslto ttso rtis(lr ta. 93 Hayes 1983; al., et (Clark proteins of status glycosylation c -catenin N- ctllcsmn--hsht-rnfrs (GPT) acetylglucosamine-1-phosphate-transferase DPAGT1 DPAGT1 ucin ttert iiigse nthe in step limiting rate the at functions b N- 1 and - n ai .Kukuruzinska A. Maria and N- lcslto fEcdei,which E-cadherin, of glycosylation N- lcslto nteendoplasmic the in glycosylation ee e euao fthe of regulator key a gene, DPAGT1 lcslto aaiyo cells of capacity glycosylation c ctnn idn oTfa its at Tcf to binding -catenins c ctnnrfetdisgreater its reflected -catenin DPAGT1 DPAGT1 DPAGT1 xrsinadprotein and expression eerhArticle Research b xrsinis expression sE-cadherin, is ctnnfrom -catenin RAlevel mRNA 1, N- N- * Journal of Cell Science ihicessin increases in with provide upregulation We that maturity. that report AJ and evidence we signaling Wnt cells, conditions, canonical MDCK via physiological density using 1994; 1999; normal al., Here, al., et 1985). Mota under et 1999; al., al., Fernandes et et 1983; Meissner Welply 1983; al., Lucas, and et have Hayes mechanisms (Clark underlying obscure the response but remained in information, density and cell differentiation, to and development with regulated Golgi complex 2010; and with ER al., that the modification suggested with et this regulated Since Golgi, the Nita-Lazar in 2010). occurs 2009; glycans al., al., et et Sengupta (Nita-Lazar structures complex of downregulation enrpre ob eurdfrteatvt faWtligand, Wnt a co-receptor, Wnt of canonical activity the of the maturation for the for required and be 2012). Wnt3a, to al., reported et been (Jamal adhesion E-cadherin tumors oral of Wnt-dependent feature canonical The of 2010). activation al., et (Sengupta promoter oiiaino -ahrnwt complex with E-cadherin to of sensitivity that of modification reported criteria we the however, increased on enzymes, Based de-glycosylation 2010). different al., et (Sengupta MGAT5 the on the effects its activity. Wnt through al., canonical components, et the Wnt that Komekado of 2007; status suggested al., glycosylation et This Khan 2011; 2007). al., et (Jung LRP5/6 xrsindrcl nlecdclua eeso transcriptionally of of amplification levels active cellular and influenced directly attenuation expression both Importantly, ahrn hc raie aueAs ncne cells, cancer In AJs. E- mature hypoglycosylated of organizes of production downregulation which the of in cadherin, inhibition results 2010; partial al., siRNA in Accordingly, et AJs with 2008). (Nita-Lazar mature al., cells of et differentiated formation Vagin and the for cultures required dense is which cadherin, of inln nhmn aieadhmtrcl ie e oan to led Wnt lines of of cell abundance increased Activation hamster with and pathway. canine of upregulation signaling human, in Wnt signaling canonical Nita-Lazar the 2006; al., et 2010). (Liwosz al., et adhesion and AJs mature intercellular E- organized Madin-Darby in also drove the endogenous in V13 AJs cells, expressed (MDCK) lacking When mature kidney Likewise, 2006). canine cells form al., et (CHO) to mannose/hybrid (Liwosz 2009). shown cadherin Ovary high been Hamster and al., has the Chinese complex sites, by et major addition generated glycan the Nita-Lazar V13, of (Jamal mutant, deletion 2012; morphology E-cadherin epithelial hypoglycosylated al., an to et phenotype mesenchymal eue ebaelclzto,cicdn ihdramatic with coincident localization, membrane reduced the in increase in increase 2.4-fold modest DPAGT1 ncnrs to contrast In u eetsuisdmntae that demonstrated studies recent Our DPAGT1 N- lcslto aha nteER, the in pathway glycosylation b eentdrc agt fcnnclWtsignaling Wnt canonical of targets direct not were , ctnnadcnnclWtatvt.Rmral,a Remarkably, activity. Wnt canonical and -catenin N- DPAGT1 n protein and xrsinlast reduced to leads expression DPAGT1 lcn n nrae high-mannose/hybrid increased and glycans DPAGT1 N- DPAGT1 lcslto ttso -ahrnadt its to and E-cadherin of status glycosylation DPAGT1 DPAGT1 nvivo in ALG1 xrsincreae ihagreater a with correlated expression xrsinwsrcnl hw ob a be to shown recently was expression N- h ee htfnto ontemin downstream function that genes the , rncitlvl,wihwsassociated was which levels, transcript lcslto aebe hw obe to shown been have glycosylation DPAGT1 n ob soitdwt h osof loss the with associated be to and b a ensont ees their reverse to shown been has and a soitdwt diminished with associated was DPAGT1 and - N- lcslto genes. glycosylation MGAT5 c RAldt substantial a to led mRNA ctnn tthe at -catenins DPAGT1 ALG1 RAwsassociated was mRNA DPAGT1 N- DPAGT1 N- lcslto fE- of glycosylation n nteGolgi, the in and , rncitlevels. transcript N- lcslto has glycosylation DPAGT1 lcn,while glycans, a agtof target a was loaffected also esscell senses DPAGT1 DPAGT1 DPAGT1 a co- was N- N- N- DPAGT1 el oprdt preclue Fg 1A, (Fig. dense cultures in the sparse reduction of 50% to abundance a compared revealed PCR cells quantitative by levels g oto,dneclue ipae .-odrdcini the in reduction 4.3-fold a the of displayed amount to cultures relative dense that control, IgG revealed 1B, (Fig. assays (ChIP) immunoprecipitation cells dense 1B, of (Fig. control levels actin cellular the of to reduction normalized the in decrease with This correlated GPT). 1B, (Fig. cells dense n -ahrnahso i oiieadngtv feedback Results negative and positive via loops. adhesion E-cadherin and 99,w xmndwehrti a ietcneuneof consequence direct of a Analyses al., activity. was et cells Wnt this (Fernandes canonical whether cells reduced proliferating arrested examined growth we to in 1999), downregulated Since compared be 2001). to endogenous al., signaling decreased et exhibit (Stockinger Wnt cells MDCK canonical of cultures Dense signaling Wnt canonical DPAGT1 cuac fthe of occupancy the itntmcaim.Orsuisietf h first the identify studies V13, protein integrates Our gene, mutant, glycosylation mechanisms. E- E-cadherin distinct nuclear of and depleted ability Hypoglycosylated signaling effectively the Wnt the canonical affects that expression. antagonize E-cadherin show to we of cadherin Moreover, status morphology. glycosylation cell in changes eueteclua olo B W ta. 01.Transfection 2011). al., et (Wu to ABC and factor of transcription pool E2F1 cellular the the of shown reduce target junctions been downstream has a E-cadherin ICAT be to Recently, affecting 2004). Gumbiner, substantially and (Gottardi without cells. Tcf inhibits sparse with that in polypeptide binding activity by 9-kDa signaling a FOP-DPAGT1 is on of ICAT inhibitor Tcf-4, an ICAT, and of effects catenin cells the examined we sparse activity, Wnt in levels 1F). Thr41, (Fig. ABC cultures or dense Ser37 higher to on compared substantially dephosphorylated active is recognizes revealed which that ABC, antibody an catenin, reduced with immunoblot its inhibition Indeed, by to about GSK-3 brought due Thr41, of and active Ser37 in at construct activity transcriptionally phosphorylation Wnt be reporter canonical of to high Wnt pool luciferase substantial of canonical a cultures, conditions TOP-Flash of sparse Under inhibition the 1E). 93% (Fig. a using with the activity associated of was repeats This the tandem from three activity DPAGT1 containing reporter luciferase promoter vector, the lower FOP-DPAGT1 by 60% reflected with as correlated activity, cultures dense in promoter of the that that suggested from this density, of cell with depletion altered not were catenin odcmn htdniydpnetcagsin changes density-dependent that document To erae bnac of abundance Decreased DPAGT1 b c idn ein(i.1)(egpae l,2010). al., et (Sengupta 1D) (Fig. region binding Tcf esscl est nomto through information density cell senses b neat ihWtadEcdei 485 E-cadherin and Wnt with interacts c Kmla n u 06 aDnl ta. 2009). al., et MacDonald 2006; Xu, and (Kimelman ctnnada4fl eraein decrease 4-fold a and -catenin b ctnnwr nhne ewe preand sparse between unchanged were -catenin c -catenin. ctnnocre hog ehns distinct mechanism a through occurred -catenin rmtr(i.1) ic ellrlvl of levels cellular Since 1C). (Fig. promoter DPAGT1 N- DPAGT1 lcslto ihcnnclWtsignaling Wnt canonical with glycosylation DPAGT1 b ctnnaditreigwt t interaction its with interfering and -catenin c rmtrwr eitdb canonical by mediated were promoter ctnn.Frhroe chromatin Furthermore, -catenin). b rti,GT a lordcdin reduced also was GPT, protein, b samse oto wththat switch control master a as , and - and - DPAGT1 b c ctnnwudb expected be would -catenin c ctnn tthe at -catenins ctnn,abi through albeit -catenins, b b ctnn.I contrast, In -catenin). a lobe shown been also has ctnnlvl when levels -catenin DPAGT1 b DPAGT1 c ctnnsnuclear -catenin’s ctnnlvl at levels -catenin DPAGT1 b N- expression -catenin’s transcript DPAGT1 DPAGT1 terminal .The ). N- N- b b c - - - Journal of Cell Science nciefr fteezm sn natbd ophospho-GSK- to antibody an using 3 enzyme the of form GSK-3 inactive of 1H). activity (Fig. increased to 40% by 1I,J). cells (Fig. sparse were ICAT activities by in TOP-Flash inhibited and ABC FOP-DPAGT1 of ICAT both control, of Accordingly, pool the overexpression Such the to 1G). reduced compared (Fig. cells abundance a expressing its showed vector promoter in CMV the increase by driven significant ICAT with cells sparse of 486 nta,c-muorcptto tde hwdgreater 1B). showed (Fig. density studies cell of in co-immunoprecipitation abundance changes In 1L). by Instead, (Fig. cells affected No dense of 2010). significantly and to association al., sparse the between et contrast AJs in AJs Nita-Lazar with detected 2006; catenin E-cadherin-containing were al., differences interaction et significant hypoglycosylated increased (Liwosz 1L) an (Fig. of with and maturity associated E-cadherin also density-dependent between Cell was 1K). activity (Fig. of cells dense downregulation in level GSK- enzyme of amount total the while 3 cultures, dense to compared cells rvosyrpre Sele l,20) hsi h first the is been this has 2005), activity al., Wnt us et canonical by (Steel on reported density reported inhibitory as the cell previously While cells, 2006). of al., sparse et effect (Liwosz to 1M) (Fig. compared previously culture dense b b odtriei oneuaino B ndneclswsdue was cells dense in ABC of downregulation if determine To eut hwdgetraonso ncieGSK-3 inactive of amounts greater showed Results . eanducagd ugsiga nraei h active the in increase an suggesting unchanged, remained ora fCl cec 2 (2) 126 Science Cell of Journal b ctnn h eesof levels the -catenin, c ctnni -ahrnpoencmlxsin complexes protein E-cadherin in -catenin DPAGT1 a ctnn ossetwt greater with consistent -catenin, b xrsinadcnnclWnt canonical and expression emaue h muto the of amount the measured we , c ctnnwr not were -catenin b nsparse in b - tblzdAs(iaLzre l,20;Nt-aa ta. 2010). al., et of Nita-Lazar effects 2009; the determine al., To et cells (Nita-Lazar A253 AJs adenocarcinoma stabilized gland salivary in reduced and cells MDCK nyasalpo fGSK-3 Since of 2F). pool (Fig. small detected a were only GSK-3 form of inactive abundance phosphorylated, the its in of changes levels significant no cellular Likewise, in immunoblot changes no an contrast, c In 2D). on cellular (Fig. in particular modest diminished reduction E-cadherin a addition, This with of associated In the 2A,B). size (Fig. 2C). in (Fig. molecular levels resulted (S) protein smaller of siRNA GPT downregulation nM lower 125 with with of cells downregulation MDCK of levels of the affected inhibition partial b its whether examined we of inhibition partial that showed we Previously, DPAGT1 aha Lee l,20) tmyntb osbet detect to of inhibition possible cellular in be total not levels both of may GSK-3 abundance it diminished in 2003), al., changes et (Lee pathway xrsinaemdae ytecnnclWtpathway. Wnt canonical the by in mediated changes are density-dependent expression cell that demonstration ctnnwr eetdbtenN n el Fg 2E). (Fig. cells S and NS between detected were -catenin ctnnadistasrpinlyatv ol B.Treatment ABC. pool, active transcriptionally its and -catenin N- euae aoia n signaling Wnt canonical regulates DPAGT1 lcslto ftesraepo fEcdei and E-cadherin of pool surface the of glycosylation preaddneclue n hi soito with association their and cultures dense and sparse muolt ( immunoblot. their and cultures with dense association and sparse from immunoprecipitated ( GAPDH. to normalization a rp:fl hnei pGSK3 in change fold graph: Bar pGSK-3 CVcnrlvco rIA (* ICAT the or either vector with control transfected pCMV cells sparse in vector TOP-DPAGT1 preclstasetdwt ihrtepM oto etror vector control pCMV (* the ICAT either with transfected cells sparse GAPDH. to fold normalization graph: after ( Bar levels ICAT. ABC with in vector change or vector control pCMV the promoter. CMV the pCMV, under ( vector, ICAT control with with vector transfection and after cells ( sparse cells. in dense and sparse in expression preaddnecls(*** cells dense and sparse ( PG1vco nsas n es el (* cells dense and sparse in vector DPAGT1 preaddneclsatrnraiaint h g control IgG the to normalization after (** cells dense and sparse preaddneclue.Brgah:fl hnei GPT, of in analyses change fold graphs: Bar and cultures. dense and sparse nsas n es DKcls(*** cells MDCK ( dense and sparse in signaling. a sesdb immunoblot. by assessed was i.1 PG1sne eldniyvaWnt/ via density cell senses DPAGT1 1. Fig. I H E B DPAGT1 uieaerpre ciiyfo h O-ls etrin vector FOP-Flash the from activity reporter Luciferase ) uieaerpre ciiyfo h O-ls etrin vector TOP-Flash the from activity reporter Luciferase ) muolto GPT, of Immunoblot ) muolto B nsas el rnfce iheither with transfected cells sparse in ABC of Immunoblot ) P c , ctnnlvl fe omlzto oGPH ( GAPDH. to normalization after levels -catenin .0) ( 0.005). b P , n GSK-3 and DPAGT1 iN-rae el ugse htpartial that suggested cells siRNA-treated ( b DPAGT1 b A .5.( 0.05). ctnnand -catenin e odcesdcnnclWtsignaling. Wnt canonical decreased to led uniaiePRof PCR Quantitative ) M ne hs odtos Nonetheless, conditions. these under D -ahrn eeimnpeiiae from immunoprecipitated were E-cadherins ) b uieaerpre ciiyfo h FOP- the from activity reporter Luciferase ) ctnnand -catenin DPAGT1 J b uieaerpre ciiyfo the from activity reporter Luciferase ) b atcptsi h aoia Wnt canonical the in participates RAb 0 htcorrelated that 50% by mRNA xrsini preaddnecultures. dense and sparse in expression xrsinwsrfetdi a in reflected was expression b c ctnnand -catenin ctnna the at -catenin P L , -ahrn were E-cadherins ) ncnnclWtsignaling, Wnt canonical on .0) ( 0.001). DPAGT1 a b ctnnwsasse by assessed was -catenin P b ctnnadi B,in ABC, in and -catenin , /GSK3 DPAGT1 .5.( 0.05). G P F b c muolto ICAT of Immunoblot ) , muolto ABC of Immunoblot ) ctnnepeso in expression -catenin ctnnadABC and -catenin DPAGT1 0.001). b xrsinwas expression eesafter levels K P rncitlevels transcript muoltof Immunoblot ) , b DPAGT1 0.05). -catenin rmtrin promoter DPAGT1 c C -catenin ChIP ) b or in b - Journal of Cell Science nScls osgiiatcagswr eetdi hi junctional their ABC, in 2K, detected (Fig. were changes localization significant no cells, S in the confirmed of further by occupancy assays activity diminished ChIP lower TOP- 2H). the the (Fig. from cells that activity S Wnt in canonical vector overall Flash attenuation the Similar for 2G). found (Fig. reduction was 60% a the than from more showed driven activity reporter DPAGT1 luciferase the of Measurement nScls ugsigta oneuainof downregulation that 2007), suggesting al., cells, cytoplasm et the S in Khan localized in 2011; diffusely and al., abundant more and et appeared (Jung contacts require localization cell-cell membrane to 2K, to (Fig. shown localization F-actin LRP5/6, focused with more colocalization of its of formation with presence the with nuclear interacted driving diminished preferentially that by AJs have adhesion mature we intercellular diminished hand, that enhanced other some the with before borders On shown cell-cell localization. at found cytoplasmic were diffuse, ABC, form, active its ept iiihdclua eeso B n total and ABC of levels cellular diminished Despite rmtri el sn h O-PG1vector FOP-DPAGT1 the using cells S in promoter b and - b N- ctnn.Bt total Both -catenin). lcslto o erto and secretion for glycosylation DPAGT1 N- c c ctnn nScls(i.2I,J). (Fig. cells S in -catenins ctnni el correlated cells S in -catenin lcslto fE-cadherin of glycosylation c ctnn.Importantly, -catenin). rmtrrfetdits reflected promoter c ctnn Indeed, -catenin. N- b glycosylation ctnnand -catenin b -catenin DPAGT1 MGAT5 ees(i.3) nadto,bt rnfcat exhibited of transfectants levels both steady-state the addition, in In increases significant 3A). (Fig. levels hl hs ihTLhda24fl nraein increase 2.4-fold a had increase TFL 2.8-fold with a those exhibited while TV2 and with transfectants tags cells, control DDK promoter. and CMV Myc the of to control fused the transcripts under of (TFL) length effects recombinant full with the cells test MDCK DPAGT1 of To transfectants 1998). stable the generated al., of lengths et different increased (Huang with isoforms transcripts region GPT these al., terminal two that mRNAs et predicted to its We rise (Huang 1999). gave of al., initiation two et transcription Meissner with 1998; alternative pattern, by that transcription reported produced of canonical complex others drive a and amplification and we had effect Previously, opposite that activity. the Wnt have suggested would expression this signaling, LRP5/ 2K, (Fig. surface cell the 6). to transport efficient its affected uniaiePRaaye hwdta oprdt the to compared that showed analyses PCR Quantitative of downregulation Since niaigta oeturglto in upregulation modest a that indicating , DA,pouigtesotvrat2(V)adthe and (TV2) 2 variant short the producing cDNAs, DPAGT1 neat ihWtadEcdei 487 E-cadherin and Wnt with interacts xrsino aoia n inln,we signaling, Wnt canonical on expression el,cutrtie o -ci n nuclei. 10 and bars, F-actin Scale for counterstained cells, S ABC, catenin, (** control ( IgG the to normalization DPAGT1 omlzto oteIGcnrl(** control ( IgG the to normalization DPAGT1 ( ls etri SadScls(*** cells S and NS in vector Flash ( nN n el (*** cells S and NS vector in FOP-DPAGT1 the from activity reporter omlzto oGPH ( GAPDH. to normalization rti eesi SadScls a rp:fold graph: pGSK3 Bar in cells. S change and NS in levels protein ( c omlzto oGPH ( GAPDH. to fold normalization graphs: Bar cells. in S change and NS in levels ( cells. GPT actin. ( in to change normalization fold after graph: levels Bar cells. S and N)o PG1slne S cells (S) (*** silenced DPAGT1 or (NS) of inhibits activity. DPAGT1 Wnt of canonical silencing Partial 2. Fig. K J I H F C ctnnepeso nN n cells. S and NS in expression -catenin hPaaye of analyses ChIP ) hPaaye of analyses ChIP ) muolto pGSK-3 of Immunoblot ) muolto -ahrnfo SadS and NS from E-cadherin of Immunoblot ) muoloecnelclzto of localization Immunofluorescence ) uieaerpre ciiyfo h TOP- the from activity reporter Luciferase ) DPAGT1 DPAGT1 P , D .0) ( 0.001). muoltof Immunoblot ) rmtri SadSclsafter cells S and NS in promoter rmtri SadSclsafter cells S and NS in promoter b ctnnadAClvl after levels ABC and -catenin rncitlvl nnon-silenced in levels transcript c m ctnnadLP/,i Sand NS in LRP5/6, and -catenin m. teutdcnnclWnt canonical attenuated B b muolto P nNS in GPT of Immunoblot ) /GSK3 b c ctnnadTfa the at Tcf and -catenin ctnnadTfa the at Tcf and -catenin P , ( b b A 0.001). DPAGT1 ctnnadABC and -catenin G E b uniaiePCR Quantitative ) eesafter levels muoltof Immunoblot ) Luciferase ) n GSK-3 and ALG1 P DPAGT1 DPAGT1 DPAGT1 P P , , , mRNA 0.001). 0.005). 0.005). b b - and N- Journal of Cell Science oto el C n V n F rnfcat onesandfrFatn cl as 10 bars, Scale F-actin. for counterstained transfectants ( TFL determinations. and experiments. independent TV2 independent three and two of (C) of one cells one of control of ( representative experiments. representative are two are of Results Results one transfectants. of GAPDH. representative to are Results normalization GAPDH. after to levels ABC in change ( fold graph: ( Bar experiments. transfectants. independent three of representative aigamr outefc Fg E.Ti niae that indicated This 3E). (Fig. were effect cells TFL robust TFL and more with DPAGT1 activity, TV2 a TOP-Flash in higher having significantly levels a in ABC reflected Greater 3D). (Fig. of those of levels cellular the active Also, of abundance greater displayed eemntos ( determinations. lcn rmteaprgn eiuson residues 3B). most (Fig. asparagine removes shifts mobility that the E-cadherin’s reversed amidase from an glycans PNGaseF, with treatment and F el xiie nee rae nraei ie(i.3B). (Fig. greater size due in were increase size greater in even increases an These from E-cadherin exhibited while cells E-cadherin, TFL size endogenous GPT molecular the higher cells a that of to TFL with compared revealed migrated and region cells analyses TV2 TV2 immunoblot C-terminal from in E-cadherin However, 3-fold, the shown). to not 2- GPT to (data increase, recombinant modest antibody 3C, mobility a and an (Fig. revealed endogenous detected no using of were levels Comparison conditions, isoforms tag). two experimental Myc its GPT, our between recombinant differences of under levels similar produced although TFL and TV2 that 3A). (Fig. downstream of amplification the N- with associated was expression recombinant of Expression 3. Fig. 488 D muoltof Immunoblot ) motnl,tasetnswt increased with transfectants Importantly, muoltaaye sn natbd oMctgrevealed tag Myc to antibody Golgi an the using and analyses ER Immunoblot the in functioned that genes glycosylation MGAT5 ora fCl cec 2 (2) 126 Science Cell of Journal rncit rmclstasetdwt h ullnt TL n ain (TV2) 2 variant and (TFL) length full the with transfected cells from transcripts c ietyafce aoia n inln.To signaling. Wnt canonical affected directly ctnnehbtdamr rnucdincrease pronounced more a exhibited -catenin B ) b N- and - lcslto fEcdei ncnrlcls()adT2adTLtasetnsbfr n fe Nae ramn.Rslsare Results treatment. PNGaseF after and before transfectants TFL and TV2 and (C) cells control in E-cadherin of glycosylation c ctnn rmcnrlcls()adT2adTLtasetns a rp:fl hnein change fold graph: Bar transfectants. TFL and TV2 and (C) cells control from -catenins b ctnnwr lgtyeeae,while elevated, slightly were -catenin DPAGT1 b rvscnnclWtsgaigand signaling Wnt canonical drives ctnn B Fg 3C). (Fig. ABC -catenin, N- C muolto eobnn P sfrs(y a)adACfo oto el C n V n TFL and TV2 and (C) cells control from ABC and tag) (Myc isoforms GPT recombinant of Immunoblot ) DPAGT1 lcslto,since glycosylation, N- glycoproteins, expression E uieaerpre ciiyfo h O-ls etri oto C el n V n TFL and TV2 and cells (C) control in vector TOP-Flash the from activity reporter Luciferase ) N- aedaai osqecso aoia n ciiy E- activity, Wnt canonical morphology. cell expression on and its localization fibers. in consequences cadherin increases stress dramatic modest in even included have that increase and which significant signaling, cells, Wnt a that show TFL results and these and Collectively, size greatly TV2 cell a of enlarged revealed F-actin morphology E- for 3F, altered counterstaining (Fig. in membrane adhesion cytoplasmic Strikingly, diminished primarily suggesting cad). was cells, well-organized TFL it TFL). and cells, TV2, TV2 control displayed the tag, in Myc localization E-cadherin using 3F, more (Fig. GPT a some Whereas exhibiting immunostaining with recombinant cells GPT TFL distribution few of intense diffuse a with revealed Analysis localization, tag perinuclear cells. Myc to TFL antibodies in and E-cadherin the of TV2 in immunolocalization examined and junctional we E-cadherin activity organization, affected Wnt E-cadherin of canonical status in glycosylation increases if determine naoiigcnnclWtsgaig rvossuishave studies Previous signaling. Wnt AJs canonical mature antagonizing produce the cultures that likely N- dense 2006; seemed it al., Since E-cadherin, et hypoglycosylated 2008). containing (Liwosz al., cultures et dense Vagin in the attenuated that was shown cadherin have others and We and signaling Wnt inhibits canonical V13, mutant, E-cadherin Hypoglycosylated N- F lcslto ttso -ahrnpae oein role a played E-cadherin of status glycosylation muoloecnelclzto fGT(y a)adEcdei in E-cadherin and tag) (Myc GPT of localization Immunofluorescence ) lcslto fE-cadherin. of glycosylation m m. DPAGT1 DAcoe.Rslsrpeetoeo w independent two of one represent Results clones. cDNA b ( A and - uniaiePRof PCR Quantitative ) DPAGT1 c DPAGT1 ctnnlvl fe normalization after levels -catenin N- lcslto ttso E- of status glycosylation expression euae canonical regulates DPAGT1 , ALG1 N- Journal of Cell Science ahrnwssont elc t blt oices h turnover the increase to ability E- its of reflect effect of to suppressive shown this 2009; was Moreover, al., cadherin 2001). et al., Maher 2001; et al., Stockinger interfered et (Gottardi inhibiting E-cadherin activity by transcriptional exogenous transformation and of proliferation cell expression with the that shown noeoshpgyoyae -ahrni es utrs In cultures. dense in E-cadherin by hypoglycosylated formed V13 those with endogenous resembling transfected junctions E-cadherin cells dense organize actin that from would reasoned E-cadherin V13 we to 4A, and size Therefore, Fig. molecular cultures. in similar stabilizing shown a as with Indeed, migrated 2010). of al., et Nita-Lazar levels 2009; included E-cadherin that increased remodeling proteins by interacting with AJs cultures, mature dense of scaffolds, in E-cadherin formation like the behaved driving 3, and 1 demonstrated sites lacking also addition V13, studies mutant, earlier E-cadherin Our hypoglycosylated minor 2006). that a al., with et EC5, (Liwosz in EC4 3 site mannose/hybrid at high are while E-cadherin, structures of (EC4) 4 ectodomain in 2009). al., et (Maher ehv eotdta ope lgschrdsmdf ie1 site modify oligosaccharides complex that reported have We b ctnni ucinlclzdpopoetuto complex phosphodestruction junction-localized a in -catenin c and - a ctnn Jmle al., et (Jamal -catenins N- lcna ie2in 2 site at glycan b N- -catenin glycan DPAGT1 (t rncithl-iefo 2hust 9hus(i.4E, the (Fig. hours in 19 decrease to (14%) hours 22 small from structural a half-life transcript to and Transfection 2000). led metabolic al., E-cadherin et of Stefanovic with 2009; typical al., et transcripts, (Sharova genes stable of class ae olwn niiino rncito ihatnmcnD In D. the actinomycin cells, with untransfected transcription the of inhibition examined following rates we stability, transcript Fg 4D). (Fig. expressing of cells abundance control the to the Accordingly, and 4C). (Fig. cells E-cadherin E-cad endogenous reduced to compared 4B). at 50% (Fig. present by reduced E-cadherin exhibited glycosylated was however, fully cells, V13 V13 the that to compared showed levels or (V13), (E-cad) mutant E-cadherin V13 wild-type either expressing on transfectants, the examining junctions for E-cadherin tool and activity mature useful Wnt a hypoglycosylated, canonical as of serve would effects V13 way, this 1/2 oeiiaetepsiiiyta 1 affected V13 that possibility the eliminate To stable sparse in abundance E-cadherin of Comparison f2 or Fg 4E, (Fig. hours 22 of ) DPAGT1 neat ihWtadEcdei 489 E-cadherin and Wnt with interacts rti rdc,GT a erae nV3cells V13 in decreased was GPT, product, protein DPAGT1 n3 rWta(*** Wnt5a or either overexpressing Wnt3a cells from or (CM) medium alone conditioned cells either V13 with in stimulated vector TOP-Flash the from el vrxrsigete n3 rWnt5a or (*** Wnt3a either overexpressing from cells or (CM) with alone medium stimulated conditioned cells either E-cad in vector Flash ( -a n 1 el (** cells V13 in and vector TOP-Flash E-cad the from activity reporter rmteFPDAT etri -a and (*** E-cad cells in V13 vector FOP-DPAGT1 the from control (*** IgG after the cells to V13 normalization and E-cad in promoter b the in 5 grown of cells presence from Total isolated V13. were or RNAs E-cad either cells with and transfected cells untransfected in rates cells. V13 ( and E-cad (C), control cells. V13 ( and E-cad (C), control DPAGT1 ,1 n 4hus eut r rmthree from are ( Results experiments. hours. independent 24 and 12 8, (*** (V13) its mutant or hypoglycosylated (E-cad) E-cadherin with wild-type transfected either cells in E-cadherins, tagged cells. dense ( and E- sparse with from V13 cadherin and E-cadherin of mobilities transcription. DPAGT1 inhibits V13, E-cadherin mutant, hypoglycosylated The 4. Fig. I E D B -catenin, uieaerpre ciiyfo h TOP- the from activity reporter Luciferase ) oprsnof Comparison ) muoltcmaigeoeosFLAG- exogenous comparing Immunoblot ) muolto P rti eesin levels protein GPT of Immunoblot ) DPAGT1 C P P P ,idctn hti eogdt a to belonged it that indicating ), , , , .0) ( 0.001). .0) ( 0.001). .0) ( 0.001). RAdcydwt half-life a with decayed mRNA rncitlvl nuntransfected in levels transcript c ctnnadTfa the at Tcf and -catenin m expression. P ( /latnmcnDfr0 ,6, 4, 0, for D actinomycin g/ml A DPAGT1 , G J C DPAGT1 muoltcmaio of comparison Immunoblot ) uieaerpre activity reporter Luciferase ) uieaerpre activity reporter Luciferase ) uniaiePRof PCR Quantitative ) .0) ( 0.001). DPAGT1 P , P 0.001). , F H rncitlevels transcript 0.005). hPaaye of analyses ChIP ) Luciferase ) RAdecay mRNA rncitdecay transcript E-cad DPAGT1 DPAGT1 DPAGT1 .In ). Journal of Cell Science ipae nrae soito with association increased cellular displayed total of amounts (Kuroda similar 5E) (Fig. destabilizer junction 1998). al., a et diminished of IQGAP1, their maturity of by The emphasized binding 5D). further (Fig. was with E-cadherin AJs V13-containing to interacted compared more organized preferentially AJs V13 with that mature V13 reports association previous our contrast, confirming their catenin, In in 5C). showed difference (Fig. V13 and significant E-cad FLAG-tagged no of pull-down a hand, other E- of of recruitment is maturation increased cytodifferentiation an Likewise, gland by salivary 2010). accompanied during al., junctions et cadherin with Nita-Lazar interacted preferentially 2006; with V13. V13 not by but that catenin, signaling earlier Wnt reported canonical We of antagonism the active underlying transcriptionally of levels diminished b had cells V13 Since mechanisms of distinct pools nuclear reduces V13 of interaction the the with affecting by 4E, the (Fig. transcription hours on 22 effect at detectable remained a which have half-life, not mRNA did V13 contrast, 490 h rmtr fWtrsosv ee yisincreased its reduction by a detected genes we hand, responsive other the cellular Wnt in On AJs. depleted of to V13 recruitment that promoters suggested the this 5B), (Fig. cad fully Myc containing to more antibody pull- revealed an immunoprecipitation FLAG with tag Indeed, representative E-cadherins 5A). Myc-tagged a (Fig. transfected in V13 of and shown E-cad as input to of interest, antibody down included to primary of a controls of protein fused instead IP, a IgG V13 specificity, each for for and and samples, Routinely, by E-cad tags. junctions using E-cadherin different of (IP) components E- of with co-immunoprecipitation interactions V13 compared and we Therefore, cadherin 2008). al., et (Walker in reduction the This in decrease 4F). 20-fold (Fig. a of caused V13 control, amount IgG the to relative by occupancy inln ciiyt rae xetta -a.Taken E-cad. than Wnt signaling. extent Wnt endogenous canonical greater endogenous the affected the that a E-cadherin showed results suppressed to these together, V13 activity activity that TOP-Flash signaling cells. their E-cad suggested in in than greater This increase was Wnt3a fold with Interestingly, stimulation the following activity 4I,J). cells, TOP-Flash (Fig. of E-cad level was non- basal signaling than lower V13 exhibited a Wnt of cells V13 not effect canonical while the but to that Wnt3a, indicating specific medium ligand, Wnt5a, conditioned Wnt ligand, by canonical stimulated canonical was the cells containing V13 and activity construct E-cad Wnt reporter canonical in endogenous TOP-Flash the the Furthermore, 4G,H). with (Fig. assessed canonical of as downregulation activity, In 50% Wnt a vector. exhibited FOP-DPAGT1 cells the V13 addition, using measured activity, promoter DPAGT1 and - muoltaaye eeldta -a n 1 el had cells V13 and E-cad that revealed analyses Immunoblot enx xmndwehrV3inhibited V13 whether examined next We DPAGT1 c rmtrb 1 orltdwt 0 niiino its of inhibition 40% a with correlated V13 by promoter ora fCl cec 2 (2) 126 Science Cell of Journal ctnn,w etivsiae h mechanism(s) the investigated next we -catenins, b ctnni 1 el Fg G,wihcorresponded which 5G), (Fig. cells V13 in -catenin b ctnnada5-odrdcinin reduction 50-fold a and -catenin b and - N- rmtr nlsso the of Analyses promoter. c lcsltdEcdei Fg B.O the On 5B). (Fig. E-cadherin glycosylated b ctnni 1 opee hni those in than complexes V13 in -catenin c ctnn(aa ta. 09 ioze al., et Liwosz 2009; al., et (Jamal -catenin ctnn sn hPasy eeldthat, revealed assays ChIP using -catenins b and - c b ctnn(i.5) ic V13 Since 5F). (Fig. -catenin and - c ctnncmae oE- to compared -catenin N- c c ctnnlvl tthe at levels -catenin lcslto ttsof status glycosylation ctnn through -catenins DPAGT1 b c and - ctnnt AJs to -catenin c ctnnfrom -catenin c b c DPAGT1 DPAGT1 promoter -catenins V13 -catenin -catenin ). a c - - 1 el Fg A,wihrfetdasaitclysignificant statistically a ( reflected experiments four which on based 6A), change (Fig. cells V13 eelaysgiiatdfeecsbtenEcdadV3cells and V13 and ABC E-cad not between 5M, (Fig. differences did significant microscopy any confocal reveal and immunofluorescence function. indirect signaling its reflected vectors, cells E-cad levels FOP-DPAGT1 high in that ABC and confirmed of results These TOP-Flash 5K,L). gene (Fig. reporter the respectively luciferase from the by and expression measured E-cad Wnt As in as canonical ABC activities, ICAT. inhibited of promoter ICAT levels with cellular expected, reduced cells As ICAT cells. E-cad 5J, cells Fig. transfecting E-cad in less shown in by became levels signaling active ABC they nuclear high transcriptionally which that after reflected validate confluence, To densities, 30–40% pronounced. cell sparse at about prominent most or were We cells 5I). V13 cellular and (Fig. total E-cad its in receptor differences B in and the lamin decrease that ABC to a note normalized with in when correlated attenuation pool transcriptionally cells nuclear This its V13 in of 5H). abundance (Fig. pool catenin ABC the in form, attenuation active pronounced a to of rmnn tcl-elbresi 1 el Fg M IQGAP1). 5M, (Fig. cells V13 in borders cell-cell cells at V13 in prominent sites contact 5M, cell-cell at (Fig. focused more were catenins ciiyo the of E- activity mature forming tag). cells Myc for 5M, predicted (Fig. F- junctions as with cadherin cells, co-localization E-cad more than displayed cells actin V13 hand, E-cadherin other of the its recycling on the depend in that not p120 suggesting did of cells, distribution V13 the and in E-cad detected were differences major No ees efudadcesdrtoo nciet oa GSK-3 total to inactive of ratio decreased a found GAPDH we to normalization levels, After form. phosphorylated inactive, its GSK-3 of activity the active transcriptionally eut hwdta nV3cls E-cadherin, cells, V13 in that showed Results E-cad/ V13/ of interaction and the examined we Therefore, 2010). active transcriptionally of pools b described cellular recently reducing a for extrusion, mechanism exosomal the involve could contacts cells of V13 cell-cell activity of sites 2009). enhanced al., the et with (Maher at complex associated phosphodestruction GSK-3 was 6I, increased (Fig. an that E-cadherin cells report to V13 recent in the due supporting contacts part, cell-cell to GSK-3 in distributed least of GSK-3 at active localization be, of could pool increased activity Wnt canonical ewe 1 n D2wsdet h xrso fCD82/ of extrusion association the diminished to due if was determine CD82 V13/ tetraspanin To and CD9 V13 shown). with between V13 Similar not and 6B). (Fig. E-cad cells (data for E-cad found in was than interaction CD82 with less interacted pigmei-niie -a rV3cls niaigthat indicating cells, V13 or significant total E-cad No or ABC sphingomyelin-inhibited GW4869. either of inhibitor, accumulation synthesis sphingomyelin ctnni GSK-3 a in -catenin xmnto ftotal of Examination u eut ofrhv hw htV3dwrgltsthe downregulates V13 that shown have far so results Our nte oeta ehns o h elto of depletion the for mechanism potential Another b b ctnnfo the from -catenin ctnnfo 1 el,w niie el iha with cells inhibited we cells, V13 from -catenin b ctnncmlxswt D2adC9tetraspanins. CD9 and CD82 with complexes -catenin c and - DPAGT1 a ctnn) sepce,IGP a less was IQGAP1 expected, As -catenins). b b N- idpnetmne Carugu tal., et (Chairoungdua manner -independent b ecmae t ellraudnewith abundance cellular its compared we , b ctnn.I otat both contrast, In -catenin). lcslto tts(i.5,p2) On p120). 5M, (Fig. status glycosylation b ctnn oeaiei 1 influenced V13 if examine To -catenin. b DPAGT1 hwdta twspreferentially was it that showed rmtrb euigtepo of pool the reducing by promoter ctnnadAClclzto by localization ABC and -catenin b ned immunofluorescence Indeed, . P b , ctnn eihbtdits inhibited we -catenin, rmtraddiminished and promoter b .5.Tu,tedepletion the Thus, 0.05). ctnnwsdtce in detected was -catenin b ctnnlvl between levels -catenin b ctnntroe by turnover -catenin b and - b c ctnnin -catenin c and - b DPAGT1 -catenins -catenin b b b a in ), - - Journal of Cell Science euaecnnclWtsgaigb neatn ihLP and negatively LRP5 of with degradation to promoting interacting shown and by axin signaling been Wnt classical has another canonical Since regulate N-cadherin shown). not neuronal (data LRP6 its cells cadherin, of V13 to status and phosphorylation due E-cad the in was in detected it were that differences reversed indicating was PNGaseF, migration increased slower with this in treatment and size cells, by molecular V13 higher the in (Fig. a than DKK3 with in E-cad and migrated LRP6 changes DKK1 However, inhibitors, no 6E,F). Wnt canonical cell showed the of at analyses expression signaling Wnt Immunoblot canonical of membrane. attenuation the to due of arise mechanism likely 6C,D). (Fig. a V13 not by depletion was extrusion exosome ihLP/,teV3cmlxshdicesdlvl fthe of levels increased had interacted complexes V13 E-cadherins the co- both LRP5/6, by LRP5/6 with with Although V13 and E-cad immunoprecipitation. of interactions examined we h bevddmnse ol fACi 1 el ol also could cells V13 in ABC of pools diminished observed The N- lcslto ttsi -a el Fg G.No 6G). (Fig. cells E-cad in status glycosylation b ctnn(Hay -catenin ta. 2009), al., et ¨ b -catenin DPAGT1 n -ahrnmdae dein eso httefirst the that show We adhesion. N- E-cadherin-mediated metabolic and negative protein the of and of activities positive the pathway utilize integrate to cells mechanisms that feedback demonstrates work Our Discussion 6I, (Fig. cytoplasm the in suggesting retained Wnt3a, more was Wnt3a). of it staining LRP5/6, like cytoplasmic that its increased evaluate had to cells endogenous low This with of too were levels interfering LRP5/6). Wnt3a Although membrane also localization. while 6I, membrane interaction, (Fig. its diffuse LRP5/6 their cells diminished promoted pronounced to LRP5/6 V13 that more immunofluorescence addition in a suggested staining in exhibited Moreover, cytoplasmic that LRP5/6 association, showed 6H). (Fig. localization co-receptor lcslto eeadakyrgltro protein of regulator key a and gene glycosylation neat ihWtadEcdei 491 E-cadherin and Wnt with interacts n 1 el onesandfrFatn cl as 10 bars, Scale F-actin. for counterstained cells V13 and c ( etri -a el rnfce ihete h pCMV (*** the ICAT either or with vector transfected control cells E-cad in vector ( CVcnrlvco rIA (** the ICAT either or with vector transfected control cells pCMV E-cad in vector to Flash normalization after levels ( ABC GAPDH. in change pCMV fold the active graph: either an with or transfected vector cells control E-cad in ( ABC cells. of V13 and E-cad from extracts nuclear ( cells. ( fold graph: Bar cells. in V13 change and E-cad in expression catenin xrsini -a n 1 el.( cells. V13 and E-cad in expression muorcpttdwt natbd oGTfo E-cad from GST to antibody an with immunoprecipitated ( with immunoblot. association by their analyzed and cells V13 and ( immunoblot. with association their and their and ( cells V13 and with E-cad from association tag Myc to antibody an n 1 el n hi soito ihIGP was IQGAP1 ( with immunoblot. association by their assessed and cells V13 and otos ( IgG controls. included all routinely specificity, studies assure immunoprecipitation was To FLAG their immunoblot. or and by isotypes cells analyzed IgG V13 control and either E-cad with from association FLAG to antibody with an immunoprecipitated were E-cadherins experiments. mechanisms. ( different inhibits through signaling V13, Wnt E-cadherin, canonical hypoglycosylated The 5. Fig. M L H C A -catenin, uieaerpre ciiyfo h FOP-DPAGT1 the from activity reporter Luciferase ) LGpl-onsmlsfo -a n 1 cells V13 and E-cad from samples pull-down FLAG ) ersnaiecnrlfrimmunoprecipitation for control Representative ) muolto B rti eesi -a n V13 and E-cad in levels protein ABC of Immunoblot ) muoloecnelclzto of localization Immunofluorescence ) I N- muolto B and ABC of Immunoblot ) lcslto,cnnclWtsignaling Wnt canonical glycosylation, B b a K ctnnlvl fe omlzto oGAPDH. to normalization after levels -catenin -ahrn eeimnpeiiae with immunoprecipitated were E-cadherins ) ctnn QA1 10adMctgi E-cad in tag Myc and p120 IQGAP1, -catenin, uieaerpre ciiyfo h TOP- the from activity reporter Luciferase ) D LGpl-onsmlsfo E-cad from samples pull-down FLAG ) c N- ctnnwsasse yimmunoblot. by assessed was -catenin lcslto fV3and/or V13 of glycosylation N- b F E b lcslto tts V13 status, glycosylation ctnnwseaie by examined was -catenin muoltof Immunoblot ) P -ahrn were E-cadherins ) ctnnihbtr CT Bar ICAT. inhibitor, -catenin , 0.001). P b , G ctnnlvl in levels -catenin muoltof Immunoblot ) 0.005). a b ctnnwas -catenin ctnn ABC, -catenin, J Immunoblot ) c -catenin m m. b - Journal of Cell Science Lws ta. 06 iaLzre l,21) utemr,the Furthermore, 2010). al., et of Nita-Lazar depletion 2006; al., et (Liwosz interaction greater exhibited cultures that cells with dense dense suggest from in complexes results of protein junctions Our reduction E-cadherin the 2009). promoted of phosphodestruction al., maturity abundance et the increased increased (Maher with of and E-cadherin was sites density of localization contact cell cell-cell to the with complex ABC with of attenuation associated that showing first report cellular the total of provide Wnt of studies in Downregulation changes our and density-dependent 2005), regulate cell al., activity that et demonstration al., Steel et Maher 2006; 2009; (Clevers, reported previously been 7. has activity Fig. in shown is interactions these nuclear of depleting schematic by to signaling E-cadherin Wnt and of canonical ability LRP5/6. the with co-receptor, that is that interfere its evidence illustrate of turn, provide then retention we Moreover, cellular in We the AJs. controlling which, by of pathway, maturity DPAGT1 signaling the with Wnt associated canonical the N- 492 hl h niioyefc fcl est ncnnclWnt canonical on density cell of effect inhibitory the While glycosylation, c c a ctnn rmteTFLFst nispromoter. its in site TCF/LEF the from -catenins ctnn eed nits on depends -catenins ctnncmae oAsfo precls(i.1L) (Fig. cells sparse from AJs to compared -catenin ora fCl cec 2 (2) 126 Science Cell of Journal tefdrcl fet aoia n inln,i part, in signaling, Wnt canonical affects directly itself c ctnnfo the from -catenin b DPAGT1 DPAGT1 ctnnadAC ossetwt recent a with consistent ABC, and -catenin b ctnnwscicdn ihtereduction the with coincident was -catenin esscl est nomto via information density cell senses , b xrsinb h elto of depletion the by expression ctnnlvl.Ide,E-cadherin Indeed, levels. -catenin DPAGT1 N- lcslto tts A status. glycosylation rmtri dense in promoter b b - - xrsin rnfcino preMC el ihV13 with cells of MDCK activities and transcriptional sparse signaling of Wnt inhibited Transfection canonical antagonize expression. to ability active transcriptionally is of maturity levels AJ cells, reduced dense the in to that suggest linked Leonard studies 2004; our 2008), Fuchs, al., and et Kobielak 2008; Nelson, and (Hartsock that AJs and at abundance more increased contained its also with associated was cultures ieyt rmt h unvro active of turnover the promote to likely es utrs B a eltdvadwrglto of downregulation in via scenario depleted while the was abundance, catenin’s resembled ABC transfection cultures: dense V13 of consequences the that showing active of levels oaiaino h hshdsrcincmlxt cell-cell and to phosphorylation N-terminal complex for phosphodestruction responsible being the contacts of localization GSK-3 localized oAs hsslciedpeinof depletion selective This AJs. to hs aue yolcsltdEcdei-otiigAsare AJs E-cadherin-containing hypoglycosylated mature, increased Thus, detected GSK-3 we 2003), of al., localization et (Lee complex destruction regulating the in involved pool small relatively GSK-3 GSK-3 to h ointa -ahrnjntoa auiyinfluences maturity junctional E-cadherin that notion The a ctnn ihAshsbe ikdt hi stabilization their to linked been has AJs with -catenins b b ciiyafcsnmru ellrfntos iha with functions, cellular numerous affects activity die nrae erdto of degradation increased -driven DPAGT1 rti eesatrihbto fshnoylnsnhssby synthesis sphingomyelin of inhibition after levels protein 1 el onesandfrFatn cl as 10 bars, Scale F-actin. for counterstained cells V13 GSK-3 after of levels localization LRP ( in FLAG. change to association fold normalization their graph: and Bar cells LRP5/6. V13 with and E-cad from cadherins E-cad ( from cells. PNGaseF V13 with and treatment after and ( before cells. LRP6 V13 ( and cells. E-cad in V13 expression and Dkk3 E-cad in ( levels cells. protein V13 and E-cad in GW4869 W89i -a n 1 el.( cells. V13 and by E-cad synthesis in sphingomyelin GW4869 of inhibition after ( expression cells. V13 and E-cad E-cadherin, with tetraspanins pGSK-3 the ( in change fold graph: GSK-3 Bar cells. V13 and cad action. V13 of ( mechanism Potential 6. Fig. B A muolto oimnpeiiaino CD82 of co-immunoprecipitation of Immunoblot ) b muolto pGSK-3 of Immunoblot ) b hsi ossetwt h eetyreported recently the with consistent is This . ctnni ute upre yorresults our by supported further is -catenin N- b a lcslto ttscnrl E-cadherin’s controls status glycosylation ai fe omlzto oGAPDH. to normalization after ratio ctnn ic nrae neato of interaction increased Since -catenin. b xrsinb nefrn ihthe with interfering by expression ocl-elcnatstsi 1 cells. V13 in sites contact cell-cell to c b H ctnnwspeeetal recruited preferentially was -catenin and - muolto LGpl-ono E- of pull-down FLAG of Immunoblot ) b C b R56adWtai -a and E-cad in Wnt3a and LRP5/6 , c muoltof Immunoblot ) ctnnb 1 ol edue be could V13 by -catenin I ctnn.I ohcss the cases, both In -catenins. Immunofluorescence ) b b b GSK-3 and ctnnand -catenin ctnnvamembrane- via -catenin b E D b ctnntroe in turnover -catenin muolto Dkk1 of Immunoblot ) muolto ABC of Immunoblot ) ctnn Although -catenin. F b G of Immunoblot ) b xrsini E- in expression muoltof Immunoblot ) -catenin c ctnnfrom -catenin b DPAGT1 -catenin. m m. b c b - - / Journal of Cell Science ernlP1 el hwdta n1dpnetincreased Wnt1-dependent with that studies showed Previous between cells interactions AJs. PC12 V13-containing neuronal of to depletion the sequestration of Thus, cells. regulation the V13 from and negative E-cad in its similar for account (Hay also signaling Wnt could N-cadherin-dependent canonical LRP5/6 with axin to V13 of similar and cannot interaction function, we that, osteoblast LRP5/6, of possibility regulation with more the associate exclude to appeared V13 since of turnover and signaling Wnt promotes DPAGT1/ canonical signaling, E-cadherin, Wnt among canonical loops among Interactions 7. Fig. hc,i un niisEcdei dein ne odtoso iiihdcnnclWtsignaling, Wnt canonical diminished the of including conditions Under adhesion. E-cadherin inhibits turn, in which, ihihigteiprac fti aei nE-cadherin in to cells, addition catenin In these this 1993). with interacted in al., preferentially of et phenotype (Bradley importance adhesion epithelial the and highlighting adhesion cell-cell yolcslto fEcdei.Hpgyoyae -ahrnihbt aoia n inln ydepleting by signaling Wnt canonical inhibits E-cadherin Hypoglycosylated E-cadherin. of hypoglycosylation eltps nldn omladcne el Jmle l,2012). al., et (Jamal cells different cancer by and between shared normal including feature signaling, types, regulation a cell represents Wnt signaling positive Wnt canonical canonical that attenuated cells, indicating findings recent A253 our carcinoma, confirm both of studies of downregulation These distribution that Wnt3a. cytoplasmic and detect increased LRP5/6 consistently displayed also not that V13 Wnt could the we in signaling of Wnt3a While localization Wnt LRP5/6. membrane co-receptor, diminished canonical with correlated 2007). endogenous al., of et inhibition partial Komekado downregulated that 2007; demonstrate al., results our et Indeed, (Khan including LRP5/6 components, and Wnt and Wnt3a canonical secretion of activity, localization the surface affect inhibit cell to shown to been has ability glycosylation their and signaling. junctions Wnt E-cadherin canonical of maturity V13 destabilize Accordingly, to shown with 2004). competing IQGAP1, by junctional with Fuchs, junctions E-cadherin E-cadherin interaction and of less enhancer exhibited (Kobielak an and maturity organization actin ihih h motneof importance the highlight b ctnn(uoae l,19) hrfr,orrslsfurther results our Therefore, 1998). al., et (Kuroda -catenin ncnrs to contrast In nadto ocnrligEcdei’ deiefunction, adhesive E-cadherin’s controlling to addition In N- DPAGT1 lcslto fWtcmoet ofrhrehneWtsgaig High signaling. Wnt enhance further to components Wnt of glycosylation DPAGT1 DPAGT1 b ctnn(ae ta. 09.A h aetime, same the At 2009). al., et (Maher -catenin b ctnn h eeso cellular of levels the -catenin, rmtr hsmitiiglwcnnclWtactivity, Wnt canonical low maintaining thus promoter, rmtrcnb xlie yisincreased its by explained be can promoter iN-rae el,clstasetdwith transfected cells cells, siRNA-treated c ctnnadEcdei eeal odrive to able were E-cadherin and -catenin DPAGT1 N- ta. 2009). al., et ¨ a ctnn nipratrgltrof regulator important an -catenin, lcslto ndtriigthe determining in glycosylation nha n eksumu cell squamous neck and head in a ctnnfrbnigto binding for -catenin DPAGT1 c c DPAGT1 ctnn V13 -catenin, ctnnwere -catenin / N- c DPAGT1 N- -catenin lcslto.CnnclWtsgaigactivates signaling Wnt Canonical glycosylation. lcslto n E-cadherin. and glycosylation and N- DPAGT1 DPAGT1 ihicesdmN eesof levels mRNA increased with rmtcefcso aoia n ciiy E-cadherin’s activity, Wnt canonical on effects dramatic ifrn egyoyainezmsascae ihcagsin of observations changes with previous sensitivities DPAGT1 associated our enzymes the de-glycosylation supports in different This changes Golgi. showing and ER of the regulation coordinate suggesting these to increased leading of events phenotype. cellular signaling effects in downstream changes the on characterize in expression are to Studies phenotype. mesenchymal progress a TV2 acquired suggesting have fibers, increased stress they of that and with abundance increased cells and membrane size TFL of enlarged reduced feature its in striking DPAGT1 with most increased correlated The localization. this that significantly and confirmed transfectants, was further the cadherin results Furthermore, loop. these feedback isoforms, GPT DPAGT1 inducing differences the in functional to underlying effective needed of details are more molecular studies the was further elucidate Although isoform signaling. GPT Wnt canonical longer latter the suggesting the activity, cells, TOP-Flash TFL that greater significant to 2-fold almost compared to an levels TV2 exhibited led mRNA although higher Interestingly, which had activity. cells GPT, Wnt produced canonical transcript recombinant in either increases of of levels expression studies, similar observations). in present unpublished abundant K., variant our more (M. In TV2 was tissues studies TFL tumor shorter and length initial the embryonic full Our cells, the 1999). while differentiated al., predominated, significance in et functional Meissner that their 1998; suggested al., about et known Although (Huang is for transcripts. reported nothing corresponding been virtually have of patterns 2.8-fold levels transcription and complex 2.4- the displayed in cDNAs (TFL) (TV2) morphology. length increases 2 full cell variant the on truncated either with or as transfectants well cell MDCK as Stable distribution, and glycosylation lcn cusi h og,i slkl hti diinto addition in that likely is it Golgi, the in occurs glycans peuainof Upregulation eas hwta nrae xrsinof expression increased that show also We DPAGT1 xrsinadtehpgyoyae ttso -ahrni aueAJs. mature in E-cadherin of status hypoglycosylated the and expression n aoia n inln ucindi positive a in functioned signaling Wnt canonical and xrsinwsteratrdpeoyeta included that phenotype altered their was expression xrsin ic oiiainwt complex with modification Since expression. neat ihWtadEcdei 493 E-cadherin and Wnt with interacts xrsincue extensive causes expression ceai lutaigtepstv n eaiefeedback negative and positive the illustrating Schematic DPAGT1 DPAGT1 b and - xrsini eue,laigto leading reduced, is expression c DPAGT1 ctnn rmpooeso agtgenes, target of promoters from -catenins xrsinwsas associated also was expression N- N- ALG1 rncito,and transcription, lcslto ttso E- of status glycosylation lcslto fE-cadherin, of glycosylation N- lcslto ee in genes glycosylation and N- lcpoen to glycoproteins MGAT5 DPAGT1 DPAGT1 DPAGT1 DPAGT1 genes, had N- N- , Journal of Cell Science n inln and canonical antagonize signaling to ability Wnt its determines E-cadherin of status dein hs neatosaelkl obln oacore whose and a cells, to E-cadherin-mediated states. protein hardwire disease belong with that to associated of and processes is likely dysregulation cellular activities are of signaling interactions network the These coordinate Wnt adhesion. mechanisms cells molecular glycosylation, novel which reveal while via studies loop, our feedback positive Collectively, a Thus, in genes. function DPAGT1 target Wnt Wnt canonical canonical and the from catenins the Moreover, the components. its part, of localization in least Likewise, pathway. signaling Wnt DPAGT1 canonical the through density nioyt ase P a rprdcmecal CvneResearch (Covance commercially polyclonal prepared Rabbit Abcam. was from GPT purchased Cruz hamster were Santa to from antibodies Polyclonal was Dkk3 Invitrogen. antibody from ICAT purchased and to to was antibody GST Dkk1 antibody to polyclonal antibody Polyclonal an while and Sigma. NeoMarkers Biotechnology from from was was Monoclonal Ab-5 respectively. GAPDH Millipore, pan-actin and to Biologicals Exalpha antibody from were ABC and rdcs Inc.). Products, n3 eefo ba n R56wsfo hroFse Scientific. BD Fisher Thermo from and from obtained receptor was were LRP5/6 B GSK-3 and controls pGSK-3 tag, Lamin Myc Abcam to to isotype antibodies from Monoclonal antibodies IgG were Polyclonal and Wnt3a Laboratories. CD9 IQGAP1, Transduction p120, CD82, E-cadherin, catenin, to antibodies Monoclonal Reagents Methods and Materials positive via loops. adhesion feedback E-cadherin negative and and signaling Wnt canonical that current suggest and studies published co-immunoprecipitation Our understood. well not is strength adhesive with MGAT5 494 h eaoi aha fprotein of pathway metabolic the of function the in changes major abundance. this of increased absence E-cadherin cells, the in MDCK in occur in to have result least would compaction at changes although, E-cadherin, conformational of compaction such is It 2010). that al., et Nita-Lazar possible cytoskeleton 2006; al., actin et Liwosz the 2009; al., with et (Jamal and proteins its crosslinking and of binding changes in conformational tail cytoplasmic promotes ectodomains cadherin estv oeua ik htainA auiywt protein signaling. with studies Wnt maturity canonical AJ our and align glycosylation not that together, links is molecular it sensitive Taken 2002), activities. al., identify with et transcriptional interfere to (Miravet mechanisms their distinct sites utilized V13 different that surprising at with occurs interaction their and Tcf mechanisms, different involve to of shown of accumulation function cytoplasmic precise Since The 2000a). the al., at et catenin (Maeda Zhurinsky factor 2004; transcription al., Wnt-dependent context, et a as cell itself on function by activation or Depending transcriptional facilitate 2000b). either can al., catenin et Zhurinsky 2008; h ehns i which via mechanism The hl h oeof role the While nsmay h okpeetdhr hw that shows here presented work the summary, In DPAGT1 b eefo elSgaigTcnlg.Mncoa nioist Tcf3/4 to antibodies Monoclonal Technology. Signaling Cell from were te Golgi other , b ora fCl cec 2 (2) 126 Science Cell of Journal tefafcscnnclWtsgaigb fetn,at affecting, by signaling Wnt canonical affects itself and - n -ahrnahso r nesl related. inversely are adhesion E-cadherin and . DPAGT1 c ctnnhsbe otoesa Siiue al., et (Shimizu controversial been has -catenin c ctnn steE-cadherin the as -catenins cis DPAGT1 b htla oicesditrcinwt actin with interaction increased to lead that ctnni n inln swl defined, well is signaling Wnt in -catenin N- N- rmtrrqie ute investigation. further requires promoter lcslto ttsadmembrane and status glycosylation lcslto ee r co-regulated are genes glycosylation xrsinb depleting by expression N- DPAGT1 lcslto fet E-cadherin affects glycosylation b N- n R6adplcoa nioyto antibody polyclonal and LRP6 and b lcslto neatwith interact glycosylation and - srgltdwt cell with regulated is N- c b ctnn a been has -catenins lcslto fE- of glycosylation -catenin, N- N- glycosylation- DPAGT1 glycosylation c b -catenin, b DPAGT1 and - -catenin and N- N- c c c a - - - - eltm C,a ecie eoe(egpae l,2010). al., et (Sengupta before described as PCR, real-time 4 at h 2 for incubated beads, Agarose A-coupled protein preclue,clswr ltda 5 For at in streptomycin. plated and maintained were penicillin were cells FBS, Collection) 10% cultures, Culture with sparse Type supplemented (Gibco), American DMEM (NBL-2, cells lysates cell MDCK and transfections culture, Cell a rs-ikdwt %fradhd n rprdfrCI nlssas analyses ChIP for prepared and formaldehyde cells V13-transfected 1% and E-cadherin- with or S cross-linked and NS was dense, and sparse in Chromatin (ChIP) immunoprecipitation Chromatin V13-transfected 5 or of E-cadherin- presence the untransfected, in from grown cells extracted MDCK were RNAs Total stability mRNA were assess construct, TFL to and synthesis TV2 with with cDNA transfected transfected cells for cells or and used cells, V13, MDCK or dense E-cadherin and either sparse from isolated RNAs, Total RT-PCR Quantitative SMART-pool interference RNA (200 30 TCL and of antibodies amounts Equal published pull-down FLAG a and to Immunoprecipitation according cells 1983). MDCK al., et V13-transfected prepared (Dignam were procedure and extract Nuclear membranes 2010). E-cadherin- PVDF al., et onto from (Nita-Lazar transferred described SDS-PAGE, as processed 7.5% and on fractionated were TCLs Immunoblots rnfce t8–0 ofunewt 2 Mo ihrN rSusing S or NS either of nM h. 125 72 for with cultured and were confluence cells (Invitrogen) MDCK 2000 80–90% Qiagen. Lipofectamine from at was siRNA transfected control negative (NS) Non-silencing ,1 n 4husuiga NayRAioainkt(ign.Sed state Steady 18S (Qiagen). above. kit described control. as isolation endogenous RT-PCR, RNA an quantitative RNeasy as by used an measured was using were hours levels 24 mRNA and 12 8, osrcswr rprdi IAbfe.EoeosEcdeiswr pulled were tagged E-cadherins V13-FLAG- Exogenous or buffer. (300 E-cad- TCLs RIPA treating either in by with down prepared transfected were cells constructs MDCK from TCLs es utrsclswr ltda 5 at plated were cells cultures dense rmCr otri otwsenUiest)adteTPFaho FOP- or TOP-Flash of the discharge exosomal and the investigate University) to (gift order Northwestern pFLAG-CMV-2-ICAT In constructs. or Gottardi, DPAGT1 In were vector Cara cells h. E-cadherin control 24 and from cells pFLAG-CMV-2 for MDCK (ATCC) sparse with ICAT, cDNA of transfected Wnt5a effect L-mouse the or or examine presence Wnt3a to fibroblasts the order either L-mouse in grown expressing either then from stably and isolated fibroblasts h medium 24 conditioned for 50% starved of serum were cells confluence, 90% 2010). al., et -a-adV3tasetdMC el eetetdwt sphingomyelinase a with treated were (5 cells GW4869 MDCK inhibitor, V13-transfected and E-cad- rcse o N slto n rprto fttlcl yae TL) For chamber (TCLs). in lysates plated cell 5–6 were of total density cells a of at transfectant using preparation slides stable were and were Media cells analyses, isolation weeks, G418. confluence two immunofluorescence of RNA After presence G418. for the with 80–90% supplemented in processed cells and grown and days changed, and 2–3 were every plates at media changed transfected several the cells h, into 14 divided and (Origene) After were cells vector. pCMV6-Entry with untransfected control a cells included clones with MDCK Controls 2 2000. cDNA passage Lipofectamine of transfection NM_203316) by using obtained were confluence DPAGT1 (TV2), 80–90% 2 variant at recombinant of expressing V13, presence Transfectants the 2010). in version, weeks wild (0.8 two mutated for either G418 enriched encoding were its Transfectants cDNAs 2000. or Lipofectamine containing vectors E-cadherin pCMV5B type with transfection by nuainwt rti rAbas oasr pcfct,all specificity, assure 100 EDTA, in To mM resuspended 1 were beads. 7.5, samples pH X-100), Tris–HCl, Triton were A mM 0.5% beads (10 and 2 buffer The or EGTA lysis controls. mM with by 1 IgG G times followed included three CD82, washed routinely protein or studies GST FLAG, immunoprecipitation with Myc, E-cadherin, incubation either against antibodies rtiswr ltduig2 using eluted were Proteins eedtrie sn C sa (Pierce). assay BCA using determined were 6 ocmaeteefcso n3 n n5,MC el eegont 80– to grown were cells MDCK Wnt5a, and Wnt3a of effects the compare To DKtasetnsepesn xgnu -a n 1 eegenerated were V13 and E-cad exogenous expressing transfectants MDCK D apebfe,bie o i t95 at min 5 for boiled buffer, sample SDS ullnt Rfe M018)adtasrp ain (Refseq variant transcript and NM_001382) (Refseq length full m /l n rcse o nlss sdsrbd(iaLzre al., et (Nita-Lazar described as analyses, for processed and g/ml) TM fsRA targeting siRNAs of m fpoenGculdSpaoebas(EHatcr)or Healthcare) (GE beads Sepharose G-coupled protein of l m )(M hmcl) o 6h rti concentrations Protein h. 16 for Chemicals), (EMD M) 6 10 6 3 m /cm D apebfe n nlzdb immunoblot. by analyzed and buffer sample SDS )wt LGM grs Sga t4 at (Sigma) agarose FLAG-M2 with g) m )wr rcerdwt g stp control isotype IgG with precleared were g) 2 n rcse sdsrbdbfr (Nita-Lazar before described as processed and 6 DPAGT1 DPAGT1 10 6 m 4 10 /cm /latnmcnD(im)fr0 ,6, 4, 0, for (Sigma) D actinomycin g/ml 3 /cm DPAGT1 2 , n rw o 2h. 72 for grown and S a bandfo Dharmacon. from obtained was (S) MGAT5 ˚ 2 n nlzdb immunoblot. by analyzed and C n rw o 4hus while hours, 24 for grown and ihrfl egh(F)or (TFL) length full either , and ALG1 ˚ ih2.5 with C xrsinby expression ˚ o h. 2 for C b -catenin, m m gof lof Journal of Cell Science un,G . enn .adKkrznk,M A. M. Kukuruzinska, and K. Lennon, T., G. Huang, ebre,J n icmir W. Birchmeier, and J. Heuberger, eeis .adAb,M. Aebi, and A. Helenius, ae,G .adLcs .J. J. Lucas, and R. G. Hayes, Hay atok .adNlo,W J. W. Nelson, and A. Hartsock, M. B. Gumbiner, M. B. Gumbiner, and J. C. Gottardi, otri .J,Wn,E n ubnr .M. B. Gumbiner, and E. Wong, J., C. Gottardi, S. A. Menko, F., Erkan, K., Lennon-Hopkins, A., D. Cotanche, P., G. R. R. Fernandes, Roeder, and M. R. Lebovitz, D., J. Dignam, H. Clevers, lsi Ns(2 DNAs Plasmid assays Luciferase Wnt the surrounding primers The 5 2010). 5 primer primer al., reverse forward were: et element (Sengupta responsive before described lr,G . ilr .R n mt,P B. P. Smith, and R. J. K. Miller, M. F., Caplan, G. Clark, and M. Hull, P., Pochard, L., D. Smith, A., Chairoungdua, Rosa H., F. Brembeck, M. A. Brown, and P. Cowin, S., R. Bradley, References 12 after release for and PMC Dental in number of Deposited [grant months. M.A.K.]. Institute Health to of National DE015304 Institutes the RO1 National by Research, supported Craniofacial was work This Funding Probes). anti-rabbit (Molecular (FITC) or from isothiocyanate anti-mouse obtained fluorescein goat Negative with was included 2009). derivatized al., antibodies IgG Rhodamine-phalloidin et Secondary M antibodies. (Nita-Lazar Probes. 200 settings Molecular primary all Axiovert those and lacked sample at Zeiss stained acquired controls highly a were most the with images to other fixed out were settings carried microscope; confocal were analyses Immunofluorescence imaging Immunofluorescence ern ihrwl yeEcdei rV3adclsharboring cells and V13 or E-cadherin type wild either bearing 3 containing AGMGBFNQ. 6FAMACACGGTGTTAGCAA was: probe auswr eemnd hs auswr hnsbrce rmexperimental from subtracted activities. luciferase then normalized were obtain reporter values to luciferase readouts These its reporter and determined. transfected were separately was values vector FOP-Flash the assays, PSV-beta- to while plasmid, normalized reference a empty and An control (0.1 described. a gal as as activity used luciferase was for vector processed pGL3-Basic and TFL) and (TV2 clones cultures, dense and deinadcnnclWtsignaling. Wnt canonical and adhesion 291 sebydrn vdc differentiation. oviduct during assembly formation. bone and 953-964. function, osteoblast signaling, beta-catenin J. P. 669. ucinadcnetost h ci cytoskeleton. actin the to connections and function Biol. Cell Mol. Rev. Nat. .Cl Biol. Cell J. inhibiting by transformation functions. cadherin hamster C756. and the signaling of nuclear development postnatal during proteins gland. submandibular adhesive A. and M. cytoskeletal, Kukuruzinska, and nuclei. mammalian isolated from extract soluble Res. a Acids in Nucleic II polymerase RNA by initiation 469-480. nemdae uigtepsntldvlpeto kltlmuscle. skeletal of development postnatal 258 the during intermediates utpetasrpso h ase oihlPdpnetN-acetylglucosamine-1-P expression. dolichol-P-dependent 106. complex hamster functionally suggests the transferase of transcripts multiple .Cl Biol. Cell J. of release beta-catenin. Exosome of role key the signaling, Wnt and adhesion. cellular increased and E-cadherin Biol. and Cell plakoglobin J. of modulation in results ,E,Lpatn,E,Gofo,V,Fan . olr . Mu T., Kohler, M., Frain, V., Geoffroy, E., Laplantine, E., ¨, 2364-2369. , 14263-14270. , 20) -ahrnitrcswt xnadLP ongtvl euaeWnt/ regulate negatively to LRP5 and axin with interacts N-cadherin (2009). m ,Poea a sdt omlz rnfcinefcec.Vle were Values efficiency. transfection normalize to used was Promega) g, 20) n/eactnnsgaigi eeomn n disease. and development in signaling Wnt/beta-catenin (2006). 6 human 153 190 123 b 9 glcoiaeatvt.I l O-ls n FOP-DPAGT1 and TOP-Flash all In activity. -galactosidase 20) euaino ahrnmdae deini morphogenesis. in adhesion cadherin-mediated of Regulation (2005). AATTAAAGACAGACCAACCAAAACG3 1049-1060. , 1079-1091. , 1857-1865. , m 11 ) O-ls,FPFahadFPDAT (FOP-Flash FOP-DPAGT1 and FOP-Flash TOP-Flash, g), DPAGT1 DPAGT1 ro .adBrhee,W. Birchmeier, and M. ´rio, b 1475-1489. , ctnn oe ehns htatgnzsWtsignaling. Wnt antagonizes that mechanism novel a -catenin: itce.Cl Biol. Cell Histochem. 20) nrclua ucin fNlne glycans. N-linked of functions Intracellular (2001). 6 622-634. , b ctnnsgaigi nahso-needn manner. adhesion-independent an in signaling -catenin iecdadnnslne DKclso cells or cells MDCK non-silenced and silenced eune,wr rnfce noutetdsparse untreated into transfected were sequence), 18) tmlto flpdlne oligosaccharide lipid-linked of Stimulation (1983). 19) ifrnilexpre Differential (1999). 20) deesadtgtjntos structure, junctions: tight and Adherens (2008). 20) oefrIA nbeta-catenin-dependent in ICAT for Role (2004). 21) nepa fcdei-eitdcell cadherin-mediated of Interplay (2010). odSrn ab eset Biol. Perspect. Harb. Spring Cold .Bo.Chem. Biol. J. 18) omto fdlco-ikdsugar dolichol-linked of Formation (1983). m .Pyil elPhysiol. Cell Physiol. J. Am. 19) xrsino n- nP1 cells PC12 in Wnt-1 of Expression (1993). 9 111 TTTTCCGCTTTGGGCTATACA3 20) -ahrnsprse cellular suppresses E-cadherin (2001). 153-162. , ur pn ee.Dev. Genet. Opin. Curr. ici.Bohs Acta Biophys. Biochim. 20) aacn eladhesion cell Balancing (2006). 18) cuaetranscription Accurate (1983). o.Cl.Biochem. Cell. Mol. 258 19) hrceiainof Characterization (1998). 15095-15100. , so fproli of ssion 9 le,R n Marie, and R. ¨ller, n h Taqman the and , o.Cl.Biol. Cell. Mol. DPAGT1 .Bo.Chem. Biol. J. 2 286 1778 16 a002915. , Cell 181 ferative, 51-59. , C747- , Science (2010). cDNA 660- , 97- , 127 29 9 , , , DPAGT1 ioz . e,T n uuuisa .A. M. Kukuruzinska, and T. Lei, A., Liwosz, S. A. Menko, and Y. Chan, M., Leonard, e,E,Slc . Kru A., Salic, E., Lee, Izawa, T., Ookubo, T., Nakamura, K., Fujii, M., Nakagawa, M., Fukata, S., K. Kuroda, Lennon, and A. M. Kukuruzinska, A. Kikuchi, and T. Chiba, H., Yamamoto, H., Komekado, oilk .adFcs E. Fuchs, and A. Kobielak, Jamora,C.andFuchs,E. iemn .adX,W. A. Bafico, Xu, and and S. D. Rotolo, Kimelman, V., T. Torre, la de S., Vijayakumar, Z., Khan, H. E. Jho, and K. S. Lee, H., Jung, Bouchie, S., Jalisi, B., Amin, M., Nita-Lazar, N., Z. Gao, K., P. Sengupta, B., Jamal, tfnvc . idus,J n rne,D A. D. Brenner, and J. Lindquist, B., Stefanovic, W., J. Holloway, M., R. Powell, M., L. Hamilton, M., S. Puddicombe, D., M. Steel, A. M. Kukuruzinska, and and J. S. Walker, A. I., Menko, Rebustini, M., J., Nita-Lazar, Walker, I., Rebustini, V., Noonan, M., A. M. Nita-Lazar, Kukuruzinska, and T. G. Huang, M., O. Mota, Miro J., Piedra, S., Miravet, J. R. Scheibe, and H. W. Mueller, A., J. Naumann, C. D., Gottardi, J. and Meissner, A. Chenn, M., A. Stocker, S., A. Flozak, T., M. Maher, X. He, and K. Tamai, T., B. MacDonald, aa,B . iaLzr . a,Z,Ai,B,Wle,J n Kukuruzinska, and J. Walker, B., Amin, Z., Gao, M., Nita-Lazar, T., B. Jamal, hmz,M,Fkng,Y,Ieoci .adNgfci A. Nagafuchi, and J. Ikenouchi, S. Y., M. Fukunaga, Ko, M., and Shimizu, N. Shaik, Y., Piao, T., Nedorezov, A., A. Sharov, V., L. Sharova, A. M. Kukuruzinska, and P. M. Bouchie, K., P. Sengupta, A. M. Kukuruzinska, and F. J. Cipollo, J., E. Helmerhorst, D., R. Mendelsohn, K., Shimokata, H., Goto, M., Takahashi, M., Kondo, N., Usami, O., Maeda, 23138-23149. cells. fiber lens differentiated of of establishment the cytoarchitecture in the involved complex N-cadherin/gamma-catenin filament-linked P n xndrvdfo xeietladtertclaayi fteWnt the of analysis theoretical and experimental from derived cell-cell pathway. Axin E-cadherin-mediated and of APC regulation in Rac1, and al. adhesion. Cdc42 et H. GTPases Tani, N., small Nomura, T., Nagase, I., significance. Wnt-3a. functional and of genetics form active an produce to coupled Cells are Wnt-3a of palmitoylation oeua raiainadsaiiyo -ahrnjunctions. E-cadherin of stability and organization molecular deinadatndynamics. actin and adhesion usin rmasrcua perspective. structural a from questions cytoskeleton. oral promotes DPAGT1 gene N-glycosylation and cancer. A. signaling Wnt M. canonical Kukuruzinska, between and P. M. xrsino olgnapa()mN nmuefbolssclue nathree- a in cultured fibroblasts mouse in mRNA matrix. alpha1(I) dimensional epithelial collagen bronchial of human expression in density cell E. by J. modulated Collins, cells. and is E. transcription D. mediated Davies, T., S. Holgate, cancer. oral in discohesion cellular 5673-5680. and E-cadherin of glycosylation A. N- M. Kukuruzinska, dolichol-P-dependent hamster of 284-291. expression (GPT). transferase tissue-specific beta- acetylglucosamine-1-P for and sites regulation binding different contains Tcf-4 plakoglobin. and factor catenin transcriptional The (2002). nlsso noeosLP ucinrvasanvlfebc ehns by mechanism feedback novel a receptor. reveals its regulates function negatively LRP6 Wnt which endogenous of Analysis glycosylation. LRP6 of regulation distinct Cytoskelet of Health organization the through A. M. oe fbt-aei n lkgoi nLFTcl atrdpnettranscription factor-dependent LEF/T-cell in cells. F9 plakoglobin beta-catenin/plakoglobin-null and using beta-catenin of roles microarray DNA cells. by stem obtained embryonic genes mouse 977 45-58. differentiating 19 and pluripotent of of half-life analysis mRNA for Database (2009). the through junctions. junctions adherens tight to of PP2A assembly of the recruitment promotes E-cadherin Hypoglycosylated causes ALG7, gene, N-glycosylation first the of yeast. in allele defects mitochondrial hypomorphic A (2005). cells. P19 in acid retinoic is by N-acetylglucosamine-1-phosphate transferase contacts UDP-N-acetylglucosamine:dolichyl-phosphate cell-cell of at complex phosphodestruction adhesion. cadherin-based beta-catenin by enhanced the of Activity line. cell 23 beta-catenin-deficient in activity Y. transcriptional family-dependent Sekido, and K. Kusugami, diseases. and mechanisms, components, eeDAT satre fteWtbt-aei inln pathway. signaling Wnt/beta-catenin the of target 285 a is DPAGT1 gene 964-972. , 31164-31173. , 12 n.J ice.Cl Biol. Cell Biochem. J. Int. 20) -lcslto ttso -ahrncnrl yokltldynamics cytoskeletal controls E-cadherin of status N-glycosylation (2009). rlOncol. Oral 521-534. , LSBiol. PLoS Science neat ihWtadEcdei 495 E-cadherin and Wnt with interacts a.Cl Biol. Cell Nat. . 281 gr . enih .adKrcnr .W. M. Kirschner, and R. Heinrich, R., ¨ger, 2009 uli cd Res. Acids Nucleic 48 1 832-835. , E10. , 523-529. , 67-80. , 20) vrxrsino PG1last bratN- aberrant to leads DPAGT1 of Overexpression (2009). .Bo.Chem. Biol. J. ,F,Iat,E,Garcı E., Itarte, F., ´, 20) eactnndsrcincmlx nihsand insights complex: destruction beta-catenin (2006). 20) lh-aei:a h ucino intercellular of junction the at Alpha-catenin: (2004). 4 20) neclua dein inligadthe and signalling adhesion, Intercellular (2002). a.Rv o.Cl Biol. Cell Mol. Rev. Nat. E101-E108. , ici.Bohs Acta Biophys. Biochim. 20) lkgoi gmactnn a TCF/LEF has (gamma-catenin) Plakoglobin (2004). 37 21) etPg niisWtsgaln through signalling Wnt inhibits Mest/Peg1 (2011). ice.J. Biochem. 1281-1295. , 21) bratapiiaino h crosstalk the of amplification Aberrant (2012). rt e.Oa il Med. Biol. Oral Rev. Crit. b ctnn and -catenin- .Cl Biol. Cell J. 20) dniiaino oe intermediate novel a of Identification (2008). 28 Oncogene 19) rti -lcslto:molecular N-glycosylation: Protein (1998). 277 e.Cell Dev. ice.J. Biochem. 641-647. , ice.Bohs e.Commun. Res. Biophys. Biochem. x.Cl Res. Cell Exp. 1884-1891. , 19) oeo QA1 agto the of target a IQGAP1, of Role (1998). o.Cl.Biol. Cell. Mol. o.Cl.Biol. Cell. Mol. 436 20) n/eactnnsignaling: Wnt/beta-catenin (2009). ad errs .adDun and A. Herreros, de ´a 20) -lcslto fet the affects N-glycosylation (2006). 20) h 5 The (2000). 20) eactnnTcl factor- Beta-catenin/T-cell (2005). 17 25 263-269. , 186 9-26. , 7482-7491. , c e.Biol. Dev. 338 ctnncnann AJs. -catenin-containing 219-228. , 1723 5 561-568. , 614-625. , 20) lcslto and Glycosylation (2007). 316 21) N-glycosylation (2010). 33-44. , 19) Developmental (1994). 27 28 1871-1884. , 9 20) eiigthe Defining (2008). .Bo.Chem. Biol. J. 7291-7301. , 825-835. , 319 9 tmlo regulates stem-loop 20) h oe of roles The (2003). 415-448. , 19) Regulation (1999). 298-308. , acrRes. Cancer .Bo.Chem. Biol. J. N Res. DNA Oncogene ah M. ˜ach, (2007). (2010). (2009). Genes 281 204 Cell 69 16 , , , , Journal of Cell Science akr .L,Mno .S,Kai,S,Rbsii . ofa,M . Kreidberg, P., M. Hoffman, I., Rebustini, S., Khalil, S., A. Menko, L., R. J. Walker, Nusse, and R. Amerongen, van G. Sachs, and E. Shevchenko, I., Yakubov, E., Tokhtaeva, O., Vagin, M. Takeichi, R. Foisner, and H. Beug, J., Wolf, A., Eger, A., Stockinger, 496 opoeei ftesbadblrgad nihsit h omto faia and acinar of formation the A. into insights structures. M. gland: ductal submandibular Kukuruzinska, the of and morphogenesis A. J. development. in signaling in adhesion intercellular subunit. and beta1 branching Na,K-ATPase 2202. the N-glycan of of Contribution extent epithelia. the between correlation 7 .Cl Biol. Cell activity. J. transcriptional beta-catenin proliferation-dependent modulating by growth cell 619-627. , ora fCl cec 2 (2) 126 Science Cell of Journal 19) opoeei oe fcasclcadherins. classical of roles Morphogenetic (1995). 154 1185-1196. , e.Dyn. Dev. Development 237 3128-3141. , 20) oad nitgae iwo Wnt of view integrated an Towards (2009). 20) ies oe fEcdei nthe in E-cadherin of roles Diverse (2008). 136 3205-3214. , 20) -ahrnregulates E-cadherin (2001). .Bo.Chem. Biol. J. ur pn elBiol. Cell Opin. Curr. 20) Inverse (2008). 283 2192- , hrnk,J,Stta,M n e-ee,A. Ben-Ze’ev, S. and Kitazume, M. Shtutman, A., J., Matsumoto, Zhurinsky, E., Miyoshi, G., J. Gu, M., Takahashi, Y., Y. Zhao, hrnk,J,Stta,M n e-ee,A. Ben-Ze’ev, and M. Shtutman, J., Zhurinsky, J. W. Lennarz, and T. J. Lau, K., J. Welply, heok .J n ono,K R. K. Wu,Z.,Zheng,S.,Li,Z.,Tan,J.andYu,Q. Johnson, and J. M. Wheelock, deini cancer. in adhesion N. Taniguchi, and rti neatos euainadbooia roles. biological and regulation interactions, protein Biol. plakoglobin. Cell. and Mol. beta-catenin by activation transcriptional family-dependent LEF/TCF hog rnatvto of transactivation through urchin sea in glycoproteins N-linked of synthesis embryos. in involved glycosyltransferases phenotype. e.Biol. Dev. nu e.Cl e.Biol. Dev. Cell Rev. Annu. 20 4238-4252. , acrSci. Cancer 20) ucinlrlso -lcn ncl inln n cell and signaling cell in N-glycans of roles Functional (2008). 107 252-258. , b ctnnitrcigpoenICAT. protein interacting -catenin 99 1304-1310. , 20) ahrn smdltr fcellular of modulators as Cadherins (2003). 19 21) 21sprse Wnt/ suppresses E2F1 (2011). 207-235. , 20b.Paolbnadbeta-catenin: and Plakoglobin (2000b). 18) eeomna euainof regulation Developmental (1985). 20a.Dfeeta ehnssof mechanisms Differential (2000a). .Cl Sci. Cell J. Oncogene 113 3127-3139. , b 30 ctnnactivity -catenin 3979-3984. ,