Host and Viral Determinants of Chikungunya

VIRAL AND HOST DETERMINANTS OF CHIKUNGUNYA VIRUS PERSISTENCE

DAVID W. HAWMAN

B.S., PENNSYLVANIA STATE UNIVERSITY, 2010

A thesis submitted to the Faculty of the

Graduate School of the University of Colorado

in partial fulfillment of the requirements for the

degree of Doctor of Philosophy

Microbiology Program

2016

This thesis for the Doctor of Philosophy degree by

David W. Hawman has been approved for the

Microbiology Program

David J. Barton, Chair

Thomas E. Morrison, Advisor

Mario L. Santiago

John D. Beckham

Raul M. Torres

Date: December 16, 2016

Hawman, David W. (PhD, Microbiology)

Viral and Host Determinants of Chikungunya Virus Persistence

Thesis directed by Associate Professor Thomas E. Morrison

ABSTRACT

Chikungunya virus (CHIKV) is a mosquito-transmitted arthritogenic alphavirus that is a global public health burden. In 2013, CHIKV spread from the Eastern

Hemisphere to the Americas where it has since spread to 45 countries and territories in the region and caused nearly two million cases. CHIKV disease in humans is debilitating, and characterized by a sudden onset of high fever, severe joint pain and inflammation. More severe outcomes, including death, occur in neonates, the elderly, and in those with underlying medical co-morbidities. In many patients, disease signs and symptoms, including joint pain, inflammation, swelling, and stiffness, as well as tenosynovitis, can last for months to years. Despite the global spread of CHIKV, the pathogenesis of chronic CHIKV disease is not well understood. A limited body of evidence suggests that CHIKV, and related arthritogenic alphaviruses, establish long- term persistent infections in musculoskeletal tissues. Therefore, critically unanswered questions are whether chronic CHIKV disease is due to chronic infection, and if so, how does CHIKV evade seemingly robust innate and adaptive antiviral immune responses.

To investigate persistent CHIKV infection, I used a mouse model that recapitulates many aspects of acute CHIKV disease and demonstrated that CHIKV infection persisted specifically in joint-associated tissue for at least 16 weeks, and that viral persistence was associated with chronic synovitis. By performing parallel infection studies in WT and immunodeficient mice, I showed that adaptive immune responses play a critical role in controlling rather than contributing to chronic disease pathogenesis.

iii

In additional studies, I identified two strains of CHIKV, that differ at only five amino acid positions, with distinct outcomes in immunocompetent mice; namely long term persistence versus acute clearance. In detailed mapping studies, I found that a highly conserved glycine residue at amino acid position 82 in the CHIKV E2 glycoprotein promotes viral persistence and diminishes the potency of viral neutralization by human and murine antibodies that specifically target the E2 B domain. In contrast, an arginine at this position promotes viral clearance in joints of WT but not B cell-deficient mice and enhances viral neutralization. Finally, to investigate if persistence of CHIKV is associated with the acquisition of adaptive mutations, I isolated and characterized a strain of CHIKV from the serum of persistently infected Rag1-/- mice, which have an intact innate immune response but lack mature T and B cells. I found that polymorphisms in the E2 glycoprotein and γ′ untranslated region of this strain enhanced early viral dissemination and viral virulence in naïve WT mice, suggesting that these mutations promote evasion of innate immune responses of mice. The research presented in this thesis expands our understanding of chronic CHIKV disease pathogenesis, describes new mechanisms by which pathogenic strains of CHIKV evade antiviral antibody responses to establish a persistent infection in joint-associated tissues, and identifies viral determinants selected during long-term persistence in mice. Collectively, this work provides new insights into the biological basis of chronic arthritis associated with CHIKV infection, mechanisms of chronic CHIKV infection, and will aid in the development of vaccines and antibody-based therapeutics against CHIKV.

The form and content of this abstract are approved. I recommend its publication.

Approved: Thomas E. Morrison

DEDICATION

To my wife, Marj and my dogs, Luke and Leia.

Thank you for putting up with the highs, lows and crazy schedule of grad school over the

years.

ACKNOWLEDGEMENTS

I would like to acknowledge all the amazing people I have had the pleasure to work with and who assisted me in my graduate studies over the years. First, I would like to acknowledge everyone in the Morrison lab. Former members Kristina Burrack, Henri

Jupille and Lauren Oko were instrumental in getting my feet wet with virology and animal work. I greatly appreciated their guidance and patience first as a rotation student and then when I joined the lab. I would also like to thank current members Mary Mccarthy,

Kelsey Haist, Nicholas May and Bennet Davenport. They are all exceptional scientists and made life in lab enjoyable. They were always willing to lend a hand and I greatly appreciated their help over the years. I will remember my misadventures on Bison Peak with Mary as one of the highlights of grad school. Several members of Raul Torres’ lab were also great colleagues and friends. Pamela Strauch and Amanda Agazio helped me out tremendously with all things B cells. Kristin Schroeder is a great friend to share the highs and lows of grad school with. I also had the great pleasure to interact with people outside of the University of Colorado. Julie Fox and Michael Diamond were amazing collaborators and I am very thankful for all their help. Their great collaboration was instrumental in moving my project forward.

Lastly, I would like to thank my excellent mentor Dr. Tem Morrison. He gave me the freedom to drive this project and learn how to be an independent scientist. He was also always there to provide excellent guidance and feedback to keep me moving forward. His drive and passion for science is an inspiration and I am truly fortunate to have been able to do my doctoral work in his lab. What I’ve learned under his mentorship over the years will be tremendously valuable as I move forward in my scientific career.

TABLE OF CONTENTS CHAPTER I. INTRODUCTION ...... 1

Chikungunya Virus Genome Organization and Replication ...... 1

Chikungunya Virus Epidemiology ...... 5

Chikungunya Virus Disease in Humans ...... 8

Therapies and Vaccines Against Chikungunya Virus ...... 9

Animal Models of Chikungunya Virus Pathogenesis ...... 10

Host Immune Response to Chikungunya Virus ...... 11

Chronic Chikungunya Virus Disease ...... 16

Thesis Summary ...... 22

II. MATERIALS AND METHODS...... 27

Mouse Experiments ...... 27

Viruses ...... 28

Plaque Purification of CHIKV Strain AF6811P2 ...... 29

Sequencing of Mouse Adapted CHIKV Strain AF6811P2 ...... 29

Construction of AF15561ΔUTR and AF15561Eβ Kβ00R ΔUTR ...... 31

Real-time RT-qPCR ...... 32

Plaque and Focus Forming Assays ...... 33

Plaque and Focus Reduction Neutralization Tests ...... 34

Histopathological Analysis ...... 34

Enzyme-Linked Immunosorbent Assay ...... 35

Neutralization Index Calculations ...... 35

Statistical Analysis ...... 35

III. CHRONIC JOINT DISEASE CAUSED BY PERSISTENT CHIKUNGUNYA VIRUS INFECTION IS CONTROLLED BY THE ADAPTIVE IMMUNE RESPONSE ...... 37

vii

Introduction ...... 37

Results ...... 39

Discussion ...... 46

IV. PATHOGENIC CHIKUNGUNYA VIRUS EVADES B CELL RESPONSES TO ESTABLISH PERSISTENCE ...... 62

Introduction ...... 62

Results ...... 64

Discussion ...... 72

V. CHIKUNGUNYA VIRUS PERSISTENCE IN RAG1-/- MICE IS ASSOCIATED WITH MUTATIONS IN THE E2 GLYCOPROTEIN AND γ′ UNTRANSLATED REGION THAT ENHANCE VIRAL PATHOGENECITY IN NAÏVE WT MICE .... 92

Introduction ...... 92

Results ...... 94

Discussion ...... 98

VI. DISCUSSION ...... 112

Project Rationale ...... 112

Chikungunya Virus Can Establish a Persistent Infection in Mice ...... 114

Host Immune Responses Control Persistent Chikungunya Infection ...... 118

Joint and Lymphoid Tissue as Sites of Chikungunya Virus Persistence ...... 121

Chikungunya Virus Strain 181/25 has Enhanced Susceptibility to Adaptive Immune Responses ...... 124

Chikungunya Virus Evades B Cell Responses to Establish Persistence ...... 129

Is Persistence of Chikungunya Virus Associated with Adaptive Mutations in the Virus ...... 141

Concluding Remarks ...... 149

REFERENCES ...... 152

viii

CHAPTER I

INTRODUCTION

Chikungunya Virus Genome Organization and Replication

Chikungunya virus (CHIKV) is an enveloped positive sense RNA virus in the genus Alphavirus in the Togaviridae family. The Alphavirus genus is classified broadly based on phylogenetic analysis and antigenic cross-reactivity that correlates well with geographic distribution and disease signs (1). CHIKV is in the Semliki Forest antigenic complex and at the time of its discovery in the 1950s (2) was restricted to circulation in

Africa and Asia. CHIKV shares this complex with the closely related o’nyong-nyong

(ONNV), Mayaro (MAYV), Ross River (RRV) and SF viruses (SFV) (1). Viruses in this complex typically cause a musculoskeletal type disease in humans. CHIKV also shares a relationship to other human disease causing alphaviruses including western equine,

Venezuelan equine, and eastern equine encephalitis viruses (WEEV, VEEV, EEEV respectively). These viruses circulate in the Americas and can cause a severe encephalitic type disease in humans with case fatalities approaching 30% (3). The prototypic alphavirus, Sindbis virus (SINV), is the causative agent of Pogosta disease in

Scandanavia, and although phylogenetically more closely related to the encephalitic alphaviruses, SINV infections in humans often present with musculoskeletal symptoms

(4).

Like all alphaviruses, CHIKV has a positive sense single-stranded RNA genome of 11.5 to 12 kilobases (kb) with a 5′ N-7-methylguanosine cap and γ′ poly-A tail (5, 6) that can serve as an mRNA in the host cell (Fig 1-1A). Alphavirus genomes are organized into two open reading frames (ORFs). The 5′ two-thirds of the genome contains an ORF encoding the four non-structural proteins (nsP1-4) while the remaining one-third encodes a subgenomic ORF containing the structural proteins capsid, E2 and

E1 along with accessory proteins E3 and 6K. Recently, an additional protein produced by a ribosomal frameshift during translation of the subgenomic mRNA, termed transframe (TF), has been discovered in SINV- and CHIKV-infected cells that is important for viral pathogenesis in mice (7, 8).

At the 5′ and γ′ ends of the genome and a junction region between the two ORFs are untranslated regions (UTRs) that have important functions in the viral life cycle. The

5′ and γ′ UTRs of alphaviruses are diverse in size and sequence (9, 10) while the junction UTR is more conserved (11). Sequence and structural elements in the 5′ and γ′

UTRs interact with the viral replicase machinery to promote efficient replication of the positive and negative sense RNAs (12, 13). The junction UTR between the two ORFs encodes a promoter in the negative sense that is recognized by the viral replicase machinery to drive transcription of the 26S subgenomic mRNA from negative sense

RNA templates (11). The 5′ genomic and subgenomic UTRs are also important in driving translation of their respective ORFs by recruiting host translation machinery (14, 15). In addition, there are important structural elements within the coding regions of the subgenomic RNA important for regulating translation of the subgenomic mRNA into the viral structural proteins despite host translational shutoff (16, 17). A stem-loop structure present in the 5′ UTR also has important functions in antagonizing innate immune restriction mediated by the interferon induced protein with tetratricopeptide repeats 1

(IFIT1) (18) and the subgenomic 5′ UTR may be involved in host translational shutoff

(19). The γ′ UTR of alphaviruses are diverse in both length and sequence except for a highly conserved 19nt element immediately preceding the poly-A tail that is essential for viral replication (10, 20). The γ′ UTR of most alphaviruses contains numerous repeat elements (10) that are likely important for recruiting host factors to stabilize the viral genome (21) such as the human antigen R protein (HuR) (22).

The alphavirus virion is an enveloped, spherical-shaped particle composed of a nucleocapsid containing the viral RNA genome surrounded by a host-derived lipid bilayer that is studded with 80 trimeric spikes. The E2 and E1 glycoproteins form a heterodimer (Fig 1-1B) and three heterodimers form a single spike (Fig 1-1C-D). E2 has several important ectodomains, domain A through C (Fig 1-1B) along with domains that span the viral envelope and interact with the nucleocapsid (not shown) (23). Domain A and B are predicted to be the location of host cell receptor binding (24), and while glycosaminoglycans may play a role in attachment (25), there likely exist additional undefined receptors necessary for viral entry. At a neutral pH, E2 domain B shields the

E1 protein, particularly the fusion loop domain of E1 (Fig 1-1B) to prevent premature fusion (26, 27). Upon interaction of E2 with a host cell receptor, CHIKV undergoes clathrin-dependent (28, 29) or clathrin-independent epidermal growth factor 15 (Eps15)- dependent endocytosis (30). Upon endosomal acidification, E2 and E1 undergo irreversible and dramatic structural rearrangements that expose the E1 fusion loop, alter the conformation of the spike and fuse the viral membrane with the endosomal membrane (26, 31, 32), releasing the encapsidated viral RNA into the host cell cytoplasm. The pH threshold of this rearrangement is dictated by interactions between residues of E2 and E1 (33, 34). This structural rearrangement of E2 and E1 is necessary for viral infectivity and lysosomotropic agents that interfere with endosomal acidification or antibodies that prevent E2/E1 rearrangement can block infection of the target cell (25,

35, 36). Capsid association with host ribosomes is then hypothesized to trigger dissociation of the capsid and viral RNA (37) releasing the viral RNA into the cytoplasm.

The viral RNA is then a template for the translation machinery of the host cell.

Upon delivery of the viral RNA into the cytoplasm, host translation machinery translates the non-structural open reading frame to produce a polyprotein consisting of

3 nsP123 or nsP1234 depending on read-through of an Opal stop codon near the end of the nsP3 coding sequence (5, 38). This polyprotein consists of proteins necessary for replication of the viral genome. NsP4 contains the RNA-dependent RNA-polymerase

(39, 40) and interactions between nsP4 and other non-structural proteins (41-46) form the viral replicase. NsP2 contains a protease domain necessary for processing of the polyprotein (47, 48). Processing of the early nsP123+4 replicase into nsP1+2+3+4 replicase by nsP2-mediated cleavage at nsP1/2 and nsP2/3 sites switches replicase activity from production of negative-sense RNA intermediates to production of full length positive sense genomes (5, 49-51). In addition to full length positive-sense genomes, the replicase produces positive sense transcripts from an internal promoter in the junction between the 5′ and γ′ open reading frame (Fig 1-1A) that encode the structural polyprotein (5, 11).

In addition to forming the replicase, the individual non-structural proteins have other important functions that facilitate viral replication. NsP1 contains methyltransferase and guanylyltransferase domains important for producing capped viral genomes (52,

53). NsP2 is a multifunctional protein and in addition to the C-terminal protease domain encodes for NTPase, 5′-triphosphatase and helicase functions (54-56). NsP2 is also the principal viral protein responsible for interfering with host antiviral signaling, discussed in more detail later in this chapter. NsP3 contains a conserved N-terminal domain that can bind ADP-ribose (57) while the C-terminal half of the protein exhibits significant variation

(58) and likely functions to interact with host factors (59, 60).

In the later stages of replication, the subgenomic mRNA is translated at the endoplasmic reticulum (ER) membrane to produce a structural polyprotein. Capsid cleaves itself from the polyprotein in cis and is released into the host cytoplasm to associate with newly synthesized viral genomes via packaging signals located in the

4 nsP1 or nsP2 region of the genome (61, 62). The accessory protein E3 is associated with E2 in the pE2 polyprotein and chaperones the glycoproteins as they traffic through the ER and Golgi to prevent premature conformational changes (63). Host proteases further process the polyprotein as the proteins traffic through the ER and Golgi to produce the mature E2 and E1 glycoproteins (64). Cleavage of the pE2 protein into mature E2 is essential as viruses retaining bound E3 are non-infectious (65). The accessory protein 6K and likely TF function to promote proper processing and formation of E2/E1 dimers (8, 66, 67). The cytoplasmic tail of E2 associates with encapsidated viral genomes at the cell membrane and progeny virions are then released by budding

(68).

Chikungunya Virus Epidemiology

CHIKV was first described in the 1950s in Africa during an outbreak of viral fever

(2). In the decades that followed, CHIKV caused sporadic outbreaks in Africa and Asia

(69). CHIKV is maintained in nature by an obligate mosquito to vertebrate to mosquito life cycle and is principally spread by Aedes species mosquitoes. Most major epidemics are sustained by an urban, or mosquito to human to mosquito life cycle (70). However, epidemics of CHIKV have occurred in spillover from the sylvatic cycle in which the vertebrate host is forest dwelling non-human primates (71, 72). Phylogenetic analysis has identified three distinct genotypes of CHIKV: related East Central South African

(ECSA) and Asian genotypes and a more divergent West African (WA) genotype (70).

The most recent common ancestor for all CHIKV genotypes is estimated to have existed within the last 500 years (73). Divergence of the Asian genotype from the ECSA genotype is predicted to have occurred within the last 150 years, possibly even as late as the 1950s (73, 74).

Although CHIKV was known to India and Southeast Asia, CHIKV of an ECSA genotype “re-emerged” into the Indian Ocean and Southeast Asian region beginning in

2004. In 2004 to 2005, CHIKV spread from mainland Africa following an outbreak in

Lamu Kenya, in which 75% of the population were infected (75), to islands in the Indian

Ocean (38, 76) and to mainland India and causing several million estimated cases (77).

The outbreak on La Reunion Island, a French territory, was particularly severe with one- third of the island (>240,000 cases) becoming infected and atypical manifestations such as neurological complications and death reported (78). Viremic travelers returning from

CHIKV epidemic regions initiated localized CHIKV epidemics in Italy (79, 80) and France

(81, 82). CHIKV continued to spread from the Indian Ocean region reaching Southeast

Asia with outbreaks in Sri Lanka (83), Thailand (84), Singapore (85), Malaysia (86) and

Papua New Guinea (87). The rapid re-emergence of CHIKV out of Africa into the Indian

Ocean region and beyond surprised public health experts and further studies indicated that this re-emergence was associated with adaptation to a new mosquito vector, Aedes albopictus, that likely facilitated rapid spread (88). Asian genotype CHIKV continued to circulate in these regions (89) and likely spread from Indonesia into the Pacific Ocean with outbreaks in New Caledonia and Yap Island (87, 90, 91).

Aggressive vector control was shown to be effective in limiting CHIKV epidemics in France, Italy and New Caledonia (79, 81, 91) and the Centers for Disease Control and

Prevention (CDC) and Pan American Health Organization (PAHO) released a guide in

2011 in preparation for the introduction of CHIKV in the Americas that stressed vector control as an important measure to contain any outbreaks (92). As anticipated, CHIKV emerged in the Americas in late 2013 and has since caused nearly two million cases throughout the Caribbean and North and South America (93, 94). The epidemic in the

Americas started with an outbreak on the Caribbean Island of St. Martin (95), likely from

6 a traveler from Indonesia, China or the Philippines based on phylogenetic analysis of early viral isolates (96), demonstrating the speed at which international travel can disseminate CHIKV. Demonstrating a failure of public health authorities to contain the isolated emergence, CHIKV then spread from St. Martin to other islands in the

Caribbean and rapidly reached mainland South America (97). Documented autochthonous transmission of CHIKV is now reported in 45 countries including limited outbreaks in the states of Florida and Texas (94, 98). The speed at which CHIKV spread in the Americas portended the introduction and spread of Zika virus (99) a flavivirus which is spread by similar Aedes mosquito vectors. The continued circulation and outbreaks of dengue virus in the Americas (100), another similarly vectored flavivirus, suggests CHIKV will continue to be a public health burden for years to come.

Interestingly, the circulating genotype in the Americas is Asian in contrast to the

ECSA genotype observed in the previous large scale epidemics of CHIKV in the Indian

Ocean region (95, 96, 101) demonstrating that both CHIKV lineages can cause explosive epidemics. It is also unknown whether a “re-emergence” of CHIKV into the

Americas and subsequent public health burden will be possible in the years to come, similar to what was observed in the Indian Ocean region when ECSA genotype CHIKV replaced Asian genotype CHIKV as the circulating strain. Indeed, ECSA genotype

CHIKV has been observed in the Americas already (101) and due to unique genetic flexibility, ECSA viruses seem uniquely poised to exploit the Aedes albopictus vector

(88, 102-104) which has a wider geographic distribution than Aedes aegypti, especially in the continental United States (105).

Chikungunya Virus Disease in Humans

Chikungunya derives from the Makonde language of Africa and translates to

“become contorted” or “that which bends up” (106), reflecting the severe musculoskeletal disease exhibited by humans. Patients often describe the pain inflicted by CHIKV as excruciating and the worst pain they have ever experienced (107) and the first description of chikungunya by Marion Robinson in the 1950s described the pain as

“frightening in its severity” (2). Following a bite from an infected mosquito, CHIKV disease in humans is characterized as an abrupt onset of fever and debilitating pain in the joints that typically lasts for one to two weeks but can last much longer (79, 107-

110). The majority of infected patients will become symptomatic (108, 111). These classical CHIKV symptoms have been consistent among geographically diverse outbreaks caused by CHIKV strains of all phylogenetic lineages (112-114). Joint pain typically afflicts the smaller peripheral joints (75, 115, 116) and inflammatory bone lesions can be observed by imaging of the joints in some patients (117, 118). In addition to these signs and symptoms, patients commonly report rash, headache, muscle pain, diarrhea and eye complications (78, 79, 85, 119). CHIKV may also be associated with increased neurological complications such as Guillain-Barré syndrome (120).

Cumulatively, these symptoms are debilitating and usually interfere with daily activities

(75, 121) and impose significant public health costs (122, 123). Related alphaviruses,

RRV, ONNV and MAYV cause similar disease signs and symptoms in humans (124-

128).

Atypical outcomes of CHIKV infection such as heart failure, encephalitis, hepatitis, kidney failure and death were reported in recent CHIKV outbreaks (78, 129-

131) though these were typically seen in children or adults with co-morbidities. CHIKV

8 infection in neonates is particularly severe with frequent complications including encephalitis with prolonged neurologic sequela and even death (78, 132-135).

It is becoming increasingly appreciated that these initial inflammatory musculoskeletal disease signs and symptoms following acute infection with CHIKV, or related alphaviruses can take weeks to resolve (116, 124, 126, 136-139) and can develop into a protracted musculoskeletal disease that lasts for months to years. This chronic phase of CHIKV disease is discussed in more detail later in this chapter.

Therapies and Vaccines Against Chikungunya Virus

Treatment of acute CHIKV disease typically consists of pain management through the use of pain killers and non-steroidal anti-inflammatory drugs. Management of chronic CHIKV musculoskeletal pain is based on the specific symptoms reported by the patient but can involve pain management along with corticosteroids or methotrexate

(117). There are no established CHIKV-specific antivirals and although ribavirin showed efficacy in a small study of 10 patients (140) further studies are needed.

Currently there are no approved vaccines for CHIKV. However, several vaccine candidates have shown efficacy and have reached various stages of pre-clinical and clinical trials. A formalin-inactivated CHIKV preparation was tested in the 1970s and showed efficacy in volunteers with an absence of side effects (141) although it was apparently not developed further. A live-attenuated CHIKV vaccine candidate was developed by serial tissue culture passaging of a virulent CHIKV isolate (142) and was found to be protective in volunteers (143). However, development of this vaccine was abandoned when it was found that a subset of these volunteers developed transient arthralgia suggesting insufficient attenuation. Indeed, it was found in subsequent studies that attenuation was due to only two amino acid changes in the vaccine virus (144).

Further studies with other vaccine platforms have shown promise. Virus like particles

(VLP) induce protective immunity in mice and non-human primates (NHPs) (145, 146) and a small clinical trial suggested efficacy in humans with no adverse events (147).

DNA-based vaccines induce strong humoral and cell-mediated immune responses (148) but have yet to reach human clinical trials. A live-attenuated CHIKV vaccine candidate, in which the promoter for the second open reading frame encoding the structural proteins was replaced with an internal ribosome entry site (IRES), showed significant attenuation and induced protective responses in mice (149-151). A measles virus-based

CHIKV vaccine candidate reached phase I human clinical trials but showed severe adverse events in 17% of patients (152). Nevertheless, phase II trials of this vaccine candidate have been scheduled. Consequently, treatment of CHIKV is limited to palliative care and outbreaks can only be contained via vector control.

Animal Models of Chikungunya Virus Pathogenesis

Animal models provide an invaluable tool for understanding CHIKV pathogenesis. NHPs can be successfully infected with CHIKV. Infection of rhesus and cynomolgous macaques with CHIKV results in viremia, fever, rash and joint pathology

(153-155) and administration of high doses can result in a fatal encephalitic disease

(153). In NHPs, joint-associated tissue, lymphoid tissue and the liver are major targets of infection (153, 155). In addition to NHPs, mice have been extensively used to study

CHIKV pathogenesis. WT mice from commonly used inbred lines, such as C57BL/6 and

129, exhibit an age-dependent outcome following CHIKV infection. Neonatal WT mice under 6 days of age uniformly succumb to infection while in 9 day old mice about one- third of mice succumb (156). In WT mice older than 12 to 14 days, CHIKV causes no mortality (156-159). This age-dependent lethality of CHIKV infection reflects the severe disease often seen in CHIKV-infected infants. There are likely also host genetic

10 determinants of CHIKV infection outcomes as neonatal outbred CD1 or ICR mice exhibit much less mortality following CHIKV infection than the inbred C57BL/6 mice used for most CHIKV studies (160). In addition to an age-dependent lethal infection, mice are also able to recapitulate the musculoskeletal disease reported in humans. Two to four week old mice infected with CHIKV develop a disseminated infection with significant viremia and viral burdens in lymphoid tissue and joint associated tissue at early time points (157, 158). Adult mice also develop a musculoskeletal disease with similar viremia and viral tropism as seen in the younger mice (159). Mouse models are also useful for studying the pathogenesis of related alphaviruses such as RRV (161) and

ONNV (162).

Host Immune Response to Chikungunya Virus

CHIKV infection is highly cytopathic in vitro (163) and humans and animal models mount a robust innate and adaptive immune responses to control infection. The primary early defense against CHIKV and related alphaviruses is the type I interferon

(IFN) response. CHIKV induces high levels of type I IFNs during the acute phase of infection in humans (164-167) and animal models (153, 159, 168, 169). Levels of type I

IFNs correlate well with viral loads and decline as viremia is controlled (153, 159, 165), however, patients with chronic symptoms can have persistent IFN production months after infection (170). Defects in type I IFN signaling or IFN-induced effector functions greatly exacerbate CHIKV disease in mice (167, 171), and a complete absence of type I

IFN signaling through deletion of the receptor for type I IFN leads to a rapidly fatal infection (165, 172). CHIKV exhibits a strong tropism for fibroblast type cells both in vivo

(165) and in vitro (163) and it is likely these non-hematopoetic cells are the major sources of type I IFNs in vivo following CHIKV infection (165). Infected macrophages may also contribute to the type I IFN response in vivo (153, 173).

Sensing of the double stranded RNA replication intermediates produced by positive-sense RNA viruses is a central mechanism in the induction of the type I IFN response. In vivo mitochondrial antiviral signaling protein (MAVS), the adaptor protein downstream of the RIG-I-like RNA helicases (RLRs), is critical in inducing type I IFN in response to CHIKV infection (174) suggesting an important role for the RLRs in sensing

CHIKV. Mice deficient in tir-domain-containing adapter-inducing interferon (TRIF), the adaptor protein for toll like receptor 3 (TLR3), or myeloid differentiation primary response gene 88 (MyD88), the adaptor protein for toll like receptor 7 (TLR7) and others, had diminished type I IFN responses (174) suggesting important roles for the TLRs in sensing CHIKV in vivo as well. However, multiple innate sensors and pathways likely converge to recognize CHIKV infection and induce a protective IFN response as mice singly deficient in an RLR, TLR3 or adaptor proteins TRIF, MAVS and MyD88, had a mild phenotype compared to complete type I IFN deficient mice (165, 174). The interferon regulatory factors (IRF) 3 and 7 are central coordinators of TLR and RLR signaling (175) and CHIKV-infected Irf3/7-/- mice fail to induce an IFN response and rapidly succumb to the infection (174). IFN signaling induces hundreds of interferon stimulated genes (ISGs) (176) and IFN-induced viperin, tetherin, ISG15, spermidine- spermine acetyltransferase (SAT1) and β’5′-Oligoadenylate synthetase (OAS) have been implicated as potential IFN-induced effectors that restrict CHIKV replication (167,

171, 177, 178).

Highlighting the importance of type I IFN in controlling the infection, CHIKV and related alphaviruses antagonize this process through a variety of mechanisms.

Principally, the CHIKV nsP2 protein blocks IFN signaling by interfering with JAK/STAT signaling (179) and inducing host transcriptional shutoff (180, 181) by degradation of the catalytic subunit of the host DNA-dependent RNA polymerase (182). NsP2 can also

12 induce host translational shutoff via protein kinase R (PKR)-dependent and -independent mechanisms (183-185) but viral proteins are still efficiently expressed (16, 17). The cumulative effect of these processes prevents the host cell from translating paracrine or autocrine IFN signaling into an antiviral state while still allowing the virus to efficiently replicate. Determinants of sensitivity to type I IFN are also present in nsP1 perhaps by influencing capping of the viral genome (186). Despite these viral countermeasures, type

I IFN remains essential in controlling early alphavirus infection.

In addition to inducing a robust type I IFN response, CHIKV and related alphaviruses induce a strong pro-inflammatory cytokine response. Pro-inflammatory cytokines and chemokines such as IL-6, TNFα, CCLβ (Monocyte chemotactic protein 1,

MCP1) and CxCL10 have been found to be upregulated in humans, NHPs and mice infected with CHIKV or related alphaviruses (153, 159, 166, 167, 169, 187-190). In response to these pro-inflammatory signals CHIKV- and RRV- infected tissues are heavily infiltrated with inflammatory monocytes, macrophages and activated NK cells within days after infection (153, 161, 169, 170, 191, 192). These cellular infiltrates contribute to the severe tissue damage and joint pathology. Infiltration of these tissues temporally correlates with RRV-induced musculoskeletal tissue destruction (161, 193), mice depleted of macrophages or NK cells show reduced disease (169, 193, 194), and blockade of monocyte infiltration ameliorated virally-induced disease in mice (195).

Infiltration of these tissues by macrophages and infection of osteoblasts can also disrupt bone homeostasis and trigger pathogenic bone loss (138, 195, 196). The severe tissue damage inflicted by these cellular infiltrates likely also requires complement activation via the mannose binding lectin pathway as mice deficient in this pathway have reduced tissue pathology despite similar cellular infiltrates (197, 198). However, disruption of monocyte and macrophage infiltration of these tissues by Ccr2 ablation leads to

13 exacerbated arthritic disease due to enhanced infiltration of the tissue by neutrophils

(191). Furthermore, blockade of TNF signaling also exacerbated RRV-induced disease

(199). In response to the severe tissue damage induced by these responses, macrophages engage a wound healing type response that suppresses antiviral T cell responses and delays viral clearance (159, 200). Together these results demonstrate that CHIKV infection induces a robust inflammatory immune response that is important both in resolving the infection while also promoting severe tissue destruction and delaying viral clearance.

A rapid and robust adaptive immune response is engaged to control CHIKV infection and this adaptive response acts to control the primary infection and likely prevents re-infection. In contrast to mice deficient in the type I IFN response, mice deficient in adaptive immune responses do not succumb to CHIKV infection (157, 168,

201). However, mice or aged NHPs with defects in adaptive immunity exhibit protracted viremia and elevated viral burdens in various tissues following infection with CHIKV or

RRV (154, 157, 168, 200) demonstrating the requirement of adaptive immune responses in controlling the primary CHIKV infection. My work presented in Chapter III and IV demonstrates that mice deficient in mature B and T cells exhibit elevated viral loads in musculoskeletal tissue in addition to persistent viremia for weeks post infection (157,

202).

Arthritogenic alphavirus infection induces a robust cell-mediated immune response. Musculoskeletal tissues are infiltrated by CD4 and CD8 T cells soon after infection with RRV or CHIKV (161, 169, 203), and CHIKV infection robustly activates circulating T cells in humans (164, 170). Activation of the T cell response contributes to control of CHIKV viremia (168) and RRV infection in muscle tissue (203). Suppression of this response by the highly inflammatory microenvironment of the infected tissue

14 contributes to delayed viral clearance (200) demonstrating a critical interplay between the innate and adaptive immune response to the infection. However, T cells are unable to control viral loads in joint tissue (203) and may even promote joint pathology (157,

168, 204). CHIKV-infected patients maintain virus specific T cells at 12 months post- infection (205) suggesting that the virus specific T cell response is sustained long term following CHIKV infection. However, the role of the T cell response in protecting against re-infection is unclear as adoptive transfer of vaccine-induced immune T cells did not confer protection in a lethal challenge model (206).

CHIKV infection induces a robust humoral immune response and the antibody response to CHIKV and related alphaviruses has been extensively characterized, likely due to the ease of sample collection and analysis. CHIKV infection rapidly induces an

IgM response with significant titers being detectable 4-5 days post infection in mice (201,

202). Interestingly, CHIKV-specific and RRV-specific IgM can persist for months in humans following acute infection (89, 110, 207-210). Likewise, CHIKV-infected NHPs had detectable CHIKV-specific IgM at 180 dpi (211) and mice had CHIKV-specific IgM at

402 dpi (201). In contrast, in my own studies I did not observe a protracted IgM response. Following inoculation of three week old WT mice with CHIKV I found that

CHIKV-specific IgM titers declined below the limit of detection by 28 dpi (202) although the differing results may reflect differences in assay sensitivities. IgG responses are also rapidly induced with significant CHIKV specific IgG titers detectable within 6-10 days post infection in both mice and humans (201, 202, 212, 213) and by 16 dpi in NHPs

(211). Induction of an optimal IgG response is T-dependent as mice deficient in CD4 T cells or MHC class II have diminished IgG responses (168, 201). The majority of antibody induced in humans, NHPs and mice targets the viral glycoprotein E2 (201, 211,

212, 214, 215), likely due to its highly exposed nature on the virion (Fig 1-1B and C).

Additional antibody epitopes are found on the other CHIKV structural proteins capsid, E3 and E1 in addition to epitopes in the non-structural protiens nsP1, nsP3 and nsP4 (201,

211, 214) though their role in control of CHIKV is unclear. Antibody responses to infection by a particular virus in the SF antigenic clade confer some protection to infection by another virus in the clade, at least in animal models. Previous RRV infection or RRV specific anti-sera ameliorated CHIKV infection (159) and antibody induced by a

CHIKV-based vaccine can protect against ONNV challenge (151). In contrast, pre- existing alphavirus immunity may interfere with development of a robust humoral response to a heterologous alphavirus (216).

Humoral immune responses are critical for controlling the primary infection and resolution of symptoms as B cell deficient mice sustain prolonged viremia for months post infection (157, 168, 201, 202) and early appearance of neutralizing antibody correlated with more rapid resolution of symptoms in CHIKV-infected humans (213).

Diminished neutralizing antibody responses due to defects in TLR3 or TLR7 signaling are also associated with exacerbated musculoskeletal disease in CHIKV- or RRV- infected mice (217, 218) and my work presented in Chapter IV demonstrates that poorly neutralizing antibody responses promote viral persistence (202). Administration of neutralizing CHIKV antibodies prior to or after infection can protect from development of musculoskeletal disease (36, 219), clear CHIKV from the circulation (157, 168) and even protect against lethal CHIKV infection in type I IFN deficient mice (206, 220, 221). In addition to neutralization of infectious virus, engagement of Fc receptors by antibody has been shown to be important for antibody mediated protection from disease (220).

Chronic Chikungunya Virus Disease

Since the first clinical description of CHIKV and in the decades that followed, a protracted course of musculoskeletal disease has been reported in patients following

CHIKV infection (2, 112, 222). In addition, protracted disease signs and symptoms have been reported to occur following RRV, MAYV and SINV infections (124, 126, 136, 189,

223-225) suggesting this is a common clinical feature of arthritogenic alphavirus infection. However, our understanding of this phase of disease was limited due to limited outbreaks and small study cohorts. The unprecedented scale of the re-emergence of

CHIKV in the mid-2000s brought public health awareness to chronic CHIKV disease and the large number of afflicted patients provided an opportunity to study the signs, symptoms, incidence and risk factors for developing chronic disease.

Chronic CHIKV disease is typically characterized by persistent joint pain, redness, and swelling lasting for months to years that can occur in a continuous or intermittent pattern and is often of sufficient severity to interfere with daily activities (110,

117, 226-228). Radiographical examination of joints of patients reporting chronic symptoms revealed pathologies such as joint effusion, bone erosion, synovial thickening, tendinitis, tenosynovitis, articular destruction, and cartilage destruction (117, 118, 138).

However, patients also reported joint pain in the absence of radiographical evidence of joint pathology (117, 170). Patients reporting chronic symptoms typically have elevated levels of pro-inflammatory cytokines such as IL-6, MCP-1 and granulocyte-macrophage colony stimulating factor (170, 229, 230) suggesting an ongoing inflammatory response.

Although symptoms reported by patients exhibiting persistent pain following CHIKV infection may be similar, chronic CHIKV disease may be a collection of distinct pathologies affecting distinct regions within musculoskeletal tissues (117). In addition to protracted joint pain, patients also report ongoing fatigue and neurological complications following CHIKV infection (231).

Although the incidence rate of chronic CHIKV disease varies between study cohorts and the time point of analysis, all studies undertaken to date have found a

17 significant portion of patients reporting chronic symptoms following acute infection (110,

226, 227, 231-234). In an early study of patients returning from the Reunion Island outbreak, 88%, 86% and 48% of patients reported symptoms at 1, 3 and 6 months post disease onset, respectively (226). Similarly, 63.8% of patients on Reunion Island had persistent symptoms at 18-months post disease onset (110). Early reports of chronic

CHIKV disease in the ongoing outbreak of CHIKV in the Americas suggest a similar pattern with the majority of patients reporting protracted symptoms for months post disease onset (235-237). Furthermore, these symptoms can persist for years. In a report of patients 36 months post CHIKV infection, 60% of patients continued to report ongoing arthralgia (208) and a recent retrospective study suggests the pain can last for 6 years or longer (117). The high prevalence of patients exhibiting symptoms months to years post infection challenge the notion that CHIKV infection is a self-limiting acute disease and rather suggests that CHIKV infection often develops into a protracted, chronic morbidity with significant disability imposed on patients. In areas where CHIKV circulates along with other viral causes of febrile illnesses, e.g., dengue, differential diagnoses of acute disease can be difficult (238). However, CHIKV, in contrast to dengue, seems to uniquely cause persistent, chronic musculoskeletal disease signs and symptoms which can be used to distinguish the infections (83, 239). Therapy is limited principally to analgesics although corticosteroids and the chemotherapeutic agent methotrexate have shown efficacy in reducing chronic symptoms (117, 121).

Several risk factors for development of protracted CHIKV disease have been identified. Most consistently, increasing age is positively correlated with the incidence of chronic CHIKV disease (170, 208, 227, 232-234, 239). Other risk factors include co- morbidities such as pre-existing joint pain (110, 227) and female gender (85, 234).

Contrastingly, initial disease severity has been found to both negatively (213, 240) and

18 positively correlate with development of chronic disease (110, 115, 227, 232).

Importantly, in regards to work in this thesis, delayed development of a neutralizing antibody response also predicted development of chronic disease (213).

Despite the large number of patients exhibiting persistent CHIKV disease, the underlying causes of the disease signs and symptoms remains unknown. One potential explanation is that CHIKV induces a rheumatoid arthritis (RA)-like immunopathology

(241). Virally induced autoimmunity can occur through a variety of mechanisms (242-

244) including molecular mimicry or continual activation of RNA sensing pathways.

Molecular mimicry between an SFV derived peptide and host myelin results in a fatal autoimmune disease in SFV-infected mice (245) demonstrating that a related alphavirus can induce an autoimmune disease via this mechanism.

However, evidence for a CHIKV induced autoimmune disease is lacking. Acute

CHIKV infection induces a pro-inflammatory cytokine response similar to what is induced during the early development of RA (166, 187, 241, 246). Patients exhibiting chronic

CHIKV disease have elevated levels of pro-inflammatory cytokines similar as to what has been observed in RA (170, 229, 230, 247-249) and inflammatory infiltrates of chronically-inflamed joints are similar between CHIKV- or RRV-infected patients (170,

250) and RA (251). Despite these many similarities with RA, chronic CHIKV disease has important distinctions from RA principally the reporting of chronic CHIKV disease symptoms in the absence of rheumatoid factor (RF) and anti-citrullinated peptide antibodies (112, 170, 209, 252-255), hallmarks of classical RA (256). Finally, my work presented in chapter III demonstrates that mice deficient in adaptive immune responses exhibit persistent joint pathology for weeks post infection (157) suggesting that chronic joint pathology can occur in the absence of adaptive immunity. Cumulatively, these data suggest that the protracted musculoskeletal disease induced following infection with

CHIKV or related alphaviruses is due to a sustained inflammatory response and, while sharing similarity to RA, is a distinct rheumatic manifestation unlikely to be due to virally- induced autoimmunity. However, why patients sustain a pro-inflammatory response for weeks to months after CHIKV infection is unclear.

A building body of evidence suggests that CHIKV and related alphaviruses establish long term chronic infection of joint-associated tissue. In humans, CHIKV RNA and antigen were found in synovial macrophages of inflamed joints 18 months post disease onset (170). CHIKV antigen was detected in muscle satellite cells from a muscle biopsy collected from a patient reporting persistent symptoms 3 months post disease onset (257). Similarly, RRV RNA was also detected in synovial biopsies of patients reporting persistent symptoms weeks post disease onset (250). Although limited, these data suggest that CHIKV and related alphaviruses can establish persistent infections in humans. Further supporting this hypothesis are studies from animal models of CHIKV infection. Infection of NHPs with CHIKV leads to detectable viral antigen and infectious virus in lymphoid and joint associated tissue for at least 6 weeks post infection (153-

155). Localization of CHIKV antigen within these tissues suggests that macrophages may serve as the cellular reservoir of persistent CHIKV infection in NHPs (153).

Furthermore, several studies have established that CHIKV infection persists in tissues of experimentally-infected mice. Mice infected with a recombinant CHIKV expressing luciferase had detectable luciferase activity in joint tissue for at least 60 dpi (204).

Infection of WT C57BL/6 mice with CHIKV resulted in detection of both positive and negative sense viral RNA, indicative of active viral replication, in joint associated tissue for at least 180 days post infection (168). My work presented here in chapter III and IV further supports the hypothesis that CHIKV infection can result in viral persistence and associated joint pathology (157, 202). Infection of three to four week old WT mice with

CHIKV results in detection of CHIKV in a variety of tissues such as the serum, joint- associated tissue, muscle, brain, liver and spleen. In contrast to early time points, at later time points I found that CHIKV was efficiently cleared from the majority of tissues with the exception of joint-associated tissue where CHIKV RNA persisted for at least 16 wpi.

Persistence of viral RNA in joint-associated tissue was correlated with evidence of ongoing synovitis in these tissues. Similar observations have been made following

MAYV infection of mice (Michael Diamond, personal communication).

Cumulatively these data suggest that chronic musculoskeletal inflammation and pain following acute CHIKV infection are common clinical outcomes and that these disease signs and symptoms may be due to persistent viral replication. However, our knowledge of the host and viral mechanisms that contribute to this chronic phase of disease is lacking. It is likely that early events in the viral infection dictate the outcome of infection, thus early therapeutic intervention may limit chronic morbidity. Furthermore, host immune responses appear to have pathogenic and protective components and may even contribute to viral persistence. Thus, an understanding of these responses is needed to inform potential therapeutic strategies to modulate the host immune response to suppress pathogenic responses while promoting responses that resolve the infection.

Finally, if indeed CHIKV and related alphaviruses establish long term persistence, the viral determinants that contribute to this are unknown. An understanding of how CHIKV establishes and maintains persistence for months to years despite robust adaptive immune responses will not only provide critical insight into CHIKV biology but also contribute to a growing body of evidence that RNA viruses can persist long term after resolution of acute disease and inform therapeutic strategies.

Thesis Summary

Despite the significant, global and continued public health burden imposed by

CHIKV infection, our understanding of viral determinants of acute and chronic CHIKV pathogenesis is clearly limited and many important questions are unanswered. My work presented here contributes new information towards several unanswered questions.

First, is chronic CHIKV disease due to persistent CHIKV infection? Secondly, if so, how does CHIKV evade adaptive immune responses to establish and maintain persistence?

Lastly, is persistence of CHIKV associated with accumulation of adaptive mutations in the viral genome that promote the establishment and/or maintenance of a persistent infection?

In chapter III, I show that CHIKV infection of immunocompetent mice results in persistence of viral RNA for up to 4 weeks in lymphoid tissue and at least 16 weeks post infection in joint-associated tissue. Furthermore, my studies show that persistence of viral RNA in joint-associated tissues is associated with ongoing joint pathology. Studies using immune deficient mice demonstrated that T and B cell responses are required to clear CHIKV from numerous tissues including the blood and skeletal muscle tissue. In joint-associated tissues adaptive immune responses significantly reduced viral burdens but were unable to effect clearance. Studies with monoclonal neutralizing antibodies showed that prophylactic administration of antibody could prevent development of persistence in mice. However, therapeutic administration of antibody showed tissue specific efficacy and was able to clear infectious virus from the serum but only modestly reduced viral burdens in joint-associated tissue.

Expanding on these findings, in chapter IV, I found that two highly related strains of CHIKV had differential capacity to establish persistence in mice. The CHIKV vaccine strain 181/25 was cleared from disseminated sites of infection at later time points,

22 despite replicating to high titers at early time points in these tissues. In contrast, CHIKV strain AF15561, the pathogenic parental virus of 181/25, established a persistent infection similar to other clinical isolates of CHIKV. However, 181/25-infected mice deficient in B cell and antibody responses had persistent viral RNA at equivalent levels to that of AF15561-infected mice suggesting that in the absence of antibody responses,

181/25 is able to establish a persistent infection. These findings raised the intriguing question of why antibody responses effectively controlled 181/25 but not AF15561 or other persistent strains of CHIKV. Neutralization studies with mouse and human immune serum and monoclonal antibodies revealed that a highly conserved residue in the CHIKV glycoprotein E2 influenced viral susceptibility to neutralizing antibody responses directed against a specific domain within the E2 glycoprotein. Cumulatively these findings demonstrate that antibody is a critical component of the host’s ability to control CHIKV and importantly demonstrate a mechanism by which CHIKV evades neutralization by antibody to establish persistence.

Finally, it is unclear if persistence of CHIKV requires or is associated with accumulation of mutations in the viral genome. Although limited sequencing of viral RNA was inconclusive, I isolated and characterized a strain of CHIKV from the serum of persistently infected Rag1-/- mice that had significantly enhanced virulence when re- inoculated into WT mice. Sequencing of this CHIKV strain revealed polymorphisms in the E2 glycoprotein and γ′ untranslated region that conferred enhanced musculoskeletal disease, expanded tissue tropism and increased viral burdens at early time points post infection. Further studies with this virus will provide novel insight into restriction factors that limit early CHIKV replication and dissemination within the mouse.

Together the findings of my thesis provide novel insight into viral determinants of acute and chronic CHIKV pathogenesis. I have shown that CHIKV must overcome

23 neutralizing antibody responses to establish long term persistence within joint associated tissue. I have further identified two novel virulence determinants that influence early viral dissemination and replication. These findings will facilitate further studies examining innate and adaptive immune responses to CHIKV and how the virus evades these responses to cause disease.

Figure 1-1: Chikungunya virus genome organization and glycoprotein structure.

Figure 1-1: Chikungunya virus genome organization and glycoprotein structure. (A) Chikungunya virus contains a single-stranded, positive sense RNA genome of approximately 11.5-12kb. It encodes 7 major proteins in two open reading frames (arrows). The 5′ open reading frame encodes non-structural proteins nsP1-nsP4 that form the viral replicase and alter the host cellular environment. The γ′ open reading frame encodes the structural proteins, capsid (C) and two glycoproteins E2 and E1. It also encodes 3 accessory proteins, E3, 6K and a -1 ribosomal frame shift in 6K produces transframe (TF). The RNA genome contains a 5′ cap and γ′ poly-A tail along with untranslated regions at both ends and in the junction region between the two ORFs. (B) A chikungunya virus E2/E1 dimer is shown. E1 is colored light grey, the E1 fusion loop is colored pink, E2 domain A is colored dark blue, E2 domain B is colored orange, E2 domain C is colored red, and the E2 arch regions are colored light blue (PDB: 3N42; Voss et al. 2010). (B and C). A single chikungunya virus trimeric spike composed of three E2/E1 dimers is shown. The apical surface is facing outward in (B) and facing up in (C). E2 and E1 also contain domains that extend through the viral membrane and interact with the nucleocapsid (not shown). E2 is responsible for engaging an unknown cellular receptor to trigger viral entry. Low pH-induced conformational changes alter this structure to expose the E1 fusion loop and trigger fusion between the viral and endosomal membranes. (PDB: 2XFC; Voss et al. 2010).

CHAPTER II

MATERIALS AND METHODS

Mouse Experiments

C57BL/6J WT mice (stock # 000664), congenic Rag1-/- mice (stock # 002216) and B cell deficient µMT mice (stock # 002288) were obtained from the Jackson

Laboratory and bred in specific pathogen free facilities at the University of Colorado.

Tg(IghelMD4)4Ccg/J (MD4tr) C57BL/6J mice, which encode a B cell receptor specific for hen egg lysozyme, were provided by John C. Cambier (University of Colorado School of

Medicine). Animal husbandry and experiments were performed in accordance and with approval of the University of Colorado School of Medicine Institutional Animal Care and

Use Committee guidelines. All mouse infection studies were performed in an animal biosafety level 3 laboratory. Three-week old mice were used for all studies. Mice were inoculated in the left rear footpad with 103 PFU of virus in diluent (PBS supplemented with 1% FBS) in a volume of 10 μl. Mock-infected animals received diluent alone. Mice were monitored for disease signs and weighed at 24-hour intervals. Mice that exhibited

>20% weight loss or were moribund were considered at the humane endpoint and euthanized. In some experiments mice were scored for musculoskeletal disease as previously described (258). 1 = very mild deficit in hind paw gripping ability of injected foot only; 2 = very mild deficit in bilateral hind paw gripping ability; 3 = bilateral loss of gripping ability, mild bilateral hind limb paresis; altered gait not readily observable; 4 =

Bilateral loss of gripping ability, moderate bilateral hind limb paresis, observable altered gait; difficulty righting self; 5 = bilateral loss of gripping ability, severe bilateral hind limb paresis, altered gait, unable to right self; 6 = moribund. On the termination day of each experiment, mice were sedated with isoflurane and euthanized by thoracotomy and exsanguination, blood was collected, and mice were perfused by intracardiac injection of

1x PBS or 4% paraformaldehyde, depending on the experiment. PBS-perfused tissues were removed by dissection and homogenized in TRIzol Reagent (Life Technologies) for

RNA isolation or PBS/1% FBS for tissue titers using a MagNA Lyser (Roche). For prophylaxis studies, MAbs (β00 μg each of CHIK-152 and CHK-166 (220)or 400 μg of

WNV E16 (28)) were administered by i.p. inoculation on days -1 and +3 as previously described(220). For therapeutic studies, MAbs were administered on days +21 and +25.

Viruses

The SL15649 strain of CHIKV (Genbank accession no. GU189061) was isolated from a serum sample collected from a febrile patient in Sri Lanka in 2006. This virus was passaged twice in Vero cells prior to generation of an infectious cDNA clone (23). CHIKV strain 181/25 was generated by serial tissue culture passage of CHIKV strain AF15561 in MRC-5 cells. An infectious clone of 181/25 was generated by cloning of synthesized viral genome fragments into pSinRep5 (259). CHIKV strain AF15561 (Genbank accession no. EF452493) was isolated from a human patient during a 1962 outbreak of

CHIKV in Thailand and passaged twice in Vero cells (141, 142). An infectious clone of

AF15561 was generated from the 181/25 vaccine infectious clone by reverting 5 non- synonymous coding changes between 181/25 and AF15561 using site directed mutagenesis (260). For mutant CHIKV strains, except for the 44 nt deletion in the γ′ UTR of AF15561, infectious clone plasmids were mutated using site directed mutagenesis to generate the indicated mutations. Restriction digest was performed to release a fragment containing the desired mutation and this fragment was ligated into an unmutagenized plasmid. The ligated fragment was sequenced to confirm only the desired mutation was present. Virus stocks were generated by electroporation of BHK-

21 cells with in vitro transcribed RNA. Infectious clone plasmids were linearized by restriction digest and used as template for an SP6 in vitro transcription reaction

(Ambion). RNA was then electroporated into BHK-21 cells and cells incubated for 24-30 hours. Cell culture supernatants from electroporated cells were collected, clarified by centrifugation and aliquoted. Stock virus titers were quantified by plaque assay on BHK-

21 or Vero cells as described below. CHIKV strains 37997 and PO731460 were gifts of

Ann Powers (Centers for Disease Control, Fort Collins, CO). The PO731460 strain

(Genbank accession no. HM45788) was isolated from a human patient in India in 1973 and passaged twice in Vero cells (6). The 37997 strain (Genbank accession no.

AY726732) was isolated from Aedes furcifer mosquitoes in Senegal in 1983. This virus was passaged once in Aedes pseudoscutellaris (AP-61) cells and twice in Vero cells

(26). Stocks of PO731460 and 37997 viruses were produced after a single passage in

BHK-21 cells as previously described (27).

Plaque Purification of CHIKV Strain AF6811P2

AF6811P2 was isolated by plaque purification from the serum of a viremic Rag1-/- mouse infected 28 days previously with WT AF15561. Serum was mixed with PBS + 1%

FBS and virus allowed to adsorb to Vero cells for 1 h. Following adsorption, the cells were overlaid with immunodiffusion agarose (MP Biomedical) + MEM-α + 10% FBS and incubated for ~40 hrs to allow plaque formation. From individual plaques, an agarose plug was removed and the virus was amplified by a single passage on Vero cells to generate viral stocks. Virus stocks were titered by plaque assay on BHK-21 and Vero cells.

Sequencing of Mouse Adapted CHIKV Strain AF6811P2

RNA was isolated from AF6811P2 stocks. 100μl of viral stock was mixed with

1ml of TRIzol reagent (Life Technologies) and RNA isolated according to the manufacturer’s protocol. To generate cDNA for use in consensus sequencing, a 1:1 mix

29 of oligo-dT and random hexamer primers were used with Super Script IV reverse transcriptase (Life Technologies). PCR was then performed with primers spanning the viral genome and Q5 high-fidelity polymerase (New England Biolabs). PCR products were purified using a PCR cleanup kit (Qiagen) and submitted for Sanger sequencing

(Eton Bioscience). Resulting sequences were mapped to the AF15561 genome using

Geneious software (Biomatters). No template controls were included in parallel. In parallel to consensus sequencing, the AF6811P2 was sequenced using Illumina based sequencing (Illumina). Five hundred nanograms (ng) of isolated viral RNA was reverse- transcribed using 500 ng of Random Primer 9 (NEB) and SuperScript II Reverse

Transcriptase (Thermo Fisher Scientific) according to the manufacturer’s directions.

Briefly, the reaction was equilibrated at 25C for 2 minutes, before the addition of 200 units of SuperScript II reverse transcriptase. The reverse transcription reaction was incubated at 25C for 10 minutes, 42C for 180 minutes, and then inactivated at 70C for

15 minutes. Double-stranded cDNA was prepared using the NEBNext mRNA Second

Strand Synthesis Module (NEB) according to the manufacturer’s directions. Sequencing libraries were prepared from the double stranded cDNA using the Nextera XT DNA

Library Preparation Kit (Illumina) following the standard protocol. Residual nucleotides were removed using Agencourt AMPure XP beads (BeckmanCoulter) at a DNA to bead ratio of 0.6:1. Library size and quality was measured using a 2100 Bioanalyzer (Agilent

Technologies) and quantified with a Qubit Flourometer using the Qubit dsDNA HS Assay

Kit (ThermoFisher Scientific). Sequencing reactions were performed on a MiSeq

Desktop Sequencer (Illumina). Reads were sorted, aligned, and mutations characterized by Bowtie2 (261) and Samtools (262) following standard protocols. Results were visualized using Integrative Genomics Viewer (263).

Construction of AF15561ΔUTR and AF15561E2 K200R ΔUTR

To insert the ΔUTR mutation into the AF15561 or AF15561Eβ Kβ00R backbone a multi-step cloning approach was used. cDNA from the AF6811P2 stock or WT

AF15561 was generated by isolation of viral RNA using TRIzol reagent (Lifetech) and cDNA generated by SuperScript IV reverse-transcriptase with a 1:1 mix of oligo-dT and random hexamer primers. cDNA was utilized as template for PCR using primers

CHIKV_10699F (5′- GCACCATCTGGCTTCAAGTA -γ′) and CHIKV_12036R (5′ –

GAAATATTAAAAACAAAATAACATCTCCTA -γ′) and Q5 high-fidelity polymerase (New

England Biolabs). This PCR reaction amplified a region from the γ′ end of E1 to the γ′

UTR immediately preceding the poly-A tail and contains restriction sites for SgrDI

(10864) and SspI (12032). The PCR product was then cloned into the TOPO-II Zero

Blunt Vector (Life Technologies) and transformed into DH5α max efficiency cells (Life

Technologies). Plasmids containing the E1-γ′UTR region from either WT AF15561 or

AF6811P2 were isolated (Qiagen). To insert the AF6811P2 γ′ UTR containing the 44nt deletion into AF15561 or AF15561 E2 K200R cDNA clones, the viral cDNA encoding plasmids and the TOPO vector containing the AF6811P2 γ′ UTR were subjected to digest by SgrDI (Thermo Fisher), cleaned up using PCR purification kit (Qiagen) and then digested with SspI (New England Biolabs). Fragments were isolated by gel extraction (Qiagen) and the plasmid backbones were subjected to treatment with

Antarctic phosphatase (Life Technologies). Fragments were ligated using T4 DNA ligase

(New England Biolabs) and transformed into DH5α max efficiency cells. Due to a second

SspI site in the pSinRep5 backbone plasmid 200 bp downstream of the CHIKV poly-A tail, this strategy resulted in loss of the poly-A tail and two hundred bp of the plasmid backbone. To restore the authentic poly-A tail and plasmid backbone sequence, an unmutagenized AF15561 cDNA plasmid was digested with SspI to produce an

31 approximately 200bp fragment containing the authentic γ′ UTR and plasmid backbone.

The 200bp fragment was isolated by gel extraction (Qiagen). The cDNA plasmids lacking the poly-A tail and 200 bp of the plasmid backbone were then linearized with

SspI and treated with Antarctic phosphatase to prevent self-ligation. The 200bp fragment was then ligated into the linearized truncated plasmids and transformed into DH5α max efficiency cells. Restoration of the poly-A tail and plasmid backbone was confirmed by sequencing. Viral stocks of the mutant viruses were then generated from cDNA clones following standard protocols.

Real-time RT-qPCR

RNA was isolated using a PureLink RNA Mini Kit (Life Technologies) and the amounts of CHIKV positive-strand RNA present in tissues was quantified as previously described (25). Briefly, a CHIKV-specific primer (CHIKV1036: 5′- ggcagtatcgtgaattcgatgcCGTGTCGGTAGTCTTGCACAT-γ′) was used to prime reverse transcription. CHIKV sequence-specific forward (CHIKV874: 5′-

AAAGGGCAAACTCAGCTTCAC-γ′) and reverse (CHIKV961: 5′-

GCCTGGGCTCATCGTTATTC-γ′) primers were used with an internal Taqman probe

(CHIKV899: 5′-[6FAM]-CGCTGTGATACAGTGGTTTCGTGTG-[MGB]-γ′) that amplified a region in the nsP1 gene for quantitative PCR on a LightCycler 480 (Roche). Samples from mock-infected mice served to ensure assay specificity. For absolute quantification of CHIKV RNA, a standard curve was generated: 10-fold dilutions from 108 to 100 copies of CHIKV positive-strand genomic RNA, synthesized in vitro, were spiked into RNA from

BHK-21 cells and reverse transcription and qPCR were performed in an identical manner. No template controls were run in parallel. To quantify CHIKV RNA from multiple

CHIKV genotypes, a modified RT-qPCR assay was designed. In this assay, the first- strand cDNA reaction was primed with 250 ng of random primers (Life Technologies). A

CHIKV sequence-specific forward primer (CHIKVβ411: 5′-

AGAGACCAGTCGACGTGTTGTAC-γ′) and CHIKV sequence-specific reverse primer

(CHIKV2676: 5′-GTGCGCATTTTGCCTTCGTA-γ′) were used in conjunction with a

CHIKV sequence-specific Taqman probe (CHIKV2579: 5′-[6FAM]-

ATCTGCACCCAAGTGTACCA-[MGB]-γ′). A random primed cDNA standard curve was generated as described above. To quantify the CHIKV subgenomic 26S mRNA, random primed cDNA was used as a template for CHIKV sequence-specific forward

(CHIKV10239: 5′- CGGCGTCTACCCATTTATGT-γ′) and CHIKV sequence-specific reverse (CHIKV10363: 5′- CCCTGTATGCTGATGCAAATTC-γ′) primers and a CHIKV sequence-specific Taqman probe (CHIKV10290: 5′-[6FAM]-

AAACACGCAGTTGAGCGAAGCAC-[MGB]-γ′) that amplified a region in the E1 gene.

The nsP1 copy number was determined in parallel with random primed cDNA and the primers/probe described above. The data was expressed as a ratio of E1 copy number divided by the nsP1 copy number.

Plaque and Focus Forming Assays

To quantify infectious virus in samples, either a plaque assay or focus forming assay was used. For plaque assays, BHK-21 cells were seeded into 6 well dishes.

Samples containing virus were serially diluted in PBS + 1% FBS + 1x Ca2+ + 1x Mg2+ and adsorbed onto the cells for 1 h at 37oC. Cells were overlaid with 1% immunodiffusion agarose (MP Biomedicals) and plaques allowed to form for 36 – 40 h at 37oC. Plaques were visualized with neutral red stain and titers enumerated as plaques per mL of serum or gram of tissue. For focus forming assays, Vero cells were seeded in 96-well plates.

Samples containing virus were serially diluted in DMEM/F12 + 2% FBS and allowed to adsorb onto the cells for 2 h at 37oC. At the end of 2 h, the sample was removed and cells overlaid with 0.5% methylcellulose in MEM-α + 10% FBS and incubated at γ7oC for

16-18 h. Cells were then fixed with 1% paraformaldehyde and cells probed with CHIKV- specific monoclonal antibody CHK-11 (220) at 500ng/mL in Perm Wash (1X PBS + 0.1%

Saponin + 0.1% BSA). Antibody was allowed to bind for 2 h at room temperature. Next cells were washed with Perm Wash and a secondary goat anti-mouse IgG conjugated to horse-radish peroxidase at 1:2000 in Perm Wash was applied and incubated for 2 h at room temperature. Cells were washed with Perm Wash and antigen positive cells visualized with TrueBlue substrate (Fisher). Foci were counted with a CTL Biospot analyzer and Biospot software (Cellular Technology). Titers were calculated as foci per ml of serum or gram of tissue.

Plaque and Focus Reduction Neutralization Tests

Neutralizing activity of murine and human serum was quantified using a plaque reduction neutralization test (PRNT). Serum was heat-inactivated and serially diluted.

Diluted serum samples were incubated with 50 PFU of challenge virus at 37°C for 1 h.

Following incubation, remaining infectious virus was quantified by plaque assay using

Vero cells as described above. The PRNT50 value was defined as the reciprocal of the last dilution to exhibit < 50% infectivity. MAbs were tested for the capacity to neutralize

CHIKV using a focus reduction neutralization test as described previously (220). MAbs were serially diluted in DMEM/F12 + 2% FBS and incubated with an equal volume of media containing 100 focus forming units of indicated virus and incubated for 1 h at 37C.

Afterwards, remaining infectious virus was measured by focus forming assay.

Histopathological Analysis

At specific times, mice were sacrificed, perfused by intracardiac injection of 4% paraformaldehyde, pH 7.3, and the indicated tissues were dissected and fixed in 4% paraformaldehyde, pH 7.3. Tissues were embedded in paraffin and 5-µm sections were

34 prepared. Tissue sections were stained with hematoxylin and eosin (H and E) and evaluated by light microscopy. Two anatomic pathologists blindly scored the presence, distribution, and severity of histological lesions. For all tissue changes, a scoring system was developed as follows: 0, absent; 1, minimal, less than 10% of tissue affected; 2, mild, 10-24% of tissue affected; 3, moderate, 25-39% of tissue affected; 4, marked, 40-

59% of tissue affected; 5, severe, greater than 60% of tissue affected.

Enzyme-Linked Immunosorbent Assay

CHIKV-binding antibodies in mouse sera were quantified using a virion-based enzyme-linked immunosorbent assay (ELISA). Concentrated virus was adsorbed to a

96-well Immulon 4HBX plate (Thermo Scientific) and then blocked with SuperBlock in

PBS (Thermo Scientific). Serial dilutions of serum were added to the plate, and bound antibody was detected using biotin-conjugated goat anti-mouse IgM or IgG antibodies diluted 1:4000 in PBS (Southern Biotech), followed by streptavidin conjugated to horseradish peroxidase diluted 1:4000 in PBS (Southern Biotech). Binding was detected using γ,γ′,5,5′-tetramethylbenzidine liquid substrate (Sigma). Endpoint titers were defined as the reciprocal of the last dilution to have an absorbance two times greater than background. Blank wells receiving no serum or serum from naive mice were used to quantify background signal.

Neutralization Index Calculations

To calculate the neutralization index the following calculation was performed:

Neutralization Index = (PRNT50 / (IgM ELISA endpoint + IgG ELISA endpoint)).

Statistical Analysis

All data were analyzed using GraphPad Prism v.5 or v.6 software. Data were evaluated for significant differences using either a two-tailed, unpaired t test with or

35 without Welch's correction, a Mann-Whitney test, a one-way analysis of variance

(ANOVA) followed by Tukey's multiple comparison test, or by a two-way ANOVA followed by Bonferroni post-test analysis. A P value < 0.05 was considered statistically significant. All differences not indicated as significant had P > 0.05.

CHAPTER III

CHRONIC JOINT DISEASE CAUSED BY PERSISTENT CHIKUNGUNYA VIRUS

INFECTION IS CONTROLLED BY THE ADAPTIVE IMMUNE RESPONSE1

Introduction

Chikungunya virus (CHIKV) is a mosquito-transmitted, positive-sense, single- stranded RNA virus in the Alphavirus genus of the Togaviridae family (125, 228, 264).

CHIKV was first isolated from a patient during an outbreak of febrile disease and acute crippling joint pains in the southern province of Tanzania in 1952-1953 (2). Until 2004,

CHIKV was known to cause debilitating rheumatologic disease in many parts of Sub-

Saharan Africa and Asia (69). However, since 2004, CHIKV has caused a series of epidemics, which began in Kenya, spread to islands in the Indian Ocean and India, and now occur in Southeast Asia and the Pacific Region (73). These more recent outbreaks have resulted in millions of disease cases, and imported CHIKV infections have been reported in nearly 40 countries including the United States, Brazil, Japan, and multiple

European countries (265). In addition, CHIKV has adapted to new mosquito vectors

(265), which has resulted in autochthonous transmission for the first time in several locations, including Italy, France, New Caledonia, Papua New Guinea, and Yemen (79,

82). This expanded epidemiology prompted the Pan American Health Organization and the Centers for Disease Control and Prevention to release a preparedness guide that anticipates CHIKV epidemics in the Americas (266).

The clinical manifestations following CHIKV infection include a sudden onset of fever, rash, intense pain in peripheral joints, myalgia, and impaired ambulation (267).

1 Portions of this chapter were previously published in the Journal of Virology. 2013. Volume 87. Issue 24. and are included with permission of the copyright holder.

This acute stage lasts for 1 to 2 weeks and is typically followed by defervescence and convalescence. However, in a subset of people infected with CHIKV, some disease signs and symptoms, such as joint swelling, joint stiffness, arthralgia, and tendonitis/tenosynovitis can last for months to years and often occur in a relapsing/fluctuating manner (110, 121, 170, 208, 226, 227). Chronic joint pain is not exclusive to CHIKV among alphavirus family members and also is caused by related viruses including Sindbis (SINV), Ross River, o'nyong-nyong, and Mayaro (125). Similar to CHIKV infections, the cause of persistent joint disease by these other alphaviruses is unclear; however, there is little evidence for the development of autoimmunity in individuals experiencing chronic disease (125, 267). Thus, an unresolved question in the field is whether chronic musculoskeletal disease is associated with or caused by persistent CHIKV infection. Several studies have detected persistence of CHIKV-specific immunoglobulin M (IgM) in humans, which is suggestive of, although by no means conclusive for, the persistence of viral antigens (110, 170, 207, 209, 268); however, the persistence of CHIKV-specific IgM has not yet been associated with persistent arthralgia or joint pathology (110). Additionally, immunohistochemical analysis of synovial and muscle tissues from patients with chronic disease revealed CHIKV antigen in perivascular macrophages and muscle satellite cells as well as extensive inflammation

(170, 257). More recently, CHIKV RNA and antigens were detected up to 90 days post- inoculation (dpi) in the spleen, lymph nodes, liver, and muscle tissue of infected macaques (153). Although CHIKV was detected in macaques inoculated with a range of virus doses, only those receiving the highest doses of virus developed musculoskeletal disease (153).

To investigate the basis of chronic CHIKV disease, we used a recently described mouse model in which the major disease signs (arthritis, synovitis, and tenosynovitis)

38 during the acute stage were consistent with acute CHIKV disease in humans (158).

Utilizing this model, we found that CHIKV RNA was cleared from visceral tissues of wild- type (WT) mice; however, CHIKV RNA persisted in joint-associated tissues to at least 16 weeks post-inoculation (wpi). Rag1-/- mice, which lack mature B and T lymphocytes, sustained elevated levels of CHIKV RNA in joint-associated tissues, persistence of

CHIKV RNA in muscle, and persistent viremia, suggesting that adaptive immune responses control persistent CHIKV infection. The persistence of CHIKV RNA in joint- associated tissues was associated with histopathological evidence of arthritis, synovitis, and tendonitis. Prophylactic administration of a combination of two highly neutralizing monoclonal antibodies (MAbs CHK-166 and CHK-152) (220) prevented Rag1-/- mice from developing persistent CHIKV infection. Therapeutic administration of these MAbs at late times post-infection had tissue-specific efficacy in clearing CHIKV. Taken together, our findings suggest that chronic CHIKV musculoskeletal damage may be due to joint tissue-specific persistence of CHIKV infection. Our findings with Rag1-/- mice suggest that while the adaptive immune system is necessary for CHIKV clearance from muscle tissue and the circulation, it cannot clear the virus from joint-associated tissues. This work establishes a small animal model of chronic CHIKV infection that can be utilized to investigate molecular mechanisms of chronic disease pathogenesis as well as evaluate candidate therapies to mitigate persistent infection and joint pathology.

Results

Persistence of CHIKV is tissue-specific. To evaluate the duration of CHIKV infection in tissues, we utilized a WT C57BL/6 mouse model in which the major pathological findings during the acute stage of infection (arthritis, myositis, and tenosynovitis) were consistent with the disease in infected humans (158, 159). WT mice were inoculated subcutaneously in the left rear footpad with virus diluent only (mock) or

103 plaque-forming units (PFU) of CHIKV strain SL15649. For many of the experiments, we monitored CHIKV infection in tissues using a highly sensitive and specific RT-qPCR assay. Following extensive intracardiac perfusion with PBS, positive-strand genomic

CHIKV RNA burdens in the ankles and spleen at 3 dpi (n = 7) and 1 (n = 11), 2 (n = 8), 4

(n = 11), 6 (n = 7), 12 (n = 8), and 16 (n = 3) weeks post-inoculation (wpi) was quantified by RT-qPCR with primers and probes complementary to sequences in the viral nsP1 coding region (Fig. 3-1A and Table 3-1). CHIKV RNA in tissues of mock-inoculated mice was below the limit of detection of this assay (data not shown), which confirmed the specificity of our measurements. The amount of CHIKV RNA in ankle-associated tissues of CHIKV-inoculated mice was highest at 3 dpi and declined during the first 2 to 4 weeks post-inoculation. CHIKV RNA was detected in the left ankles of all mice, which is near the site of inoculation, for at least 16 wpi. CHIKV RNA also was detected in the right ankles of nearly all mice, a tissue distal to the site of inoculation, for at least 16 wpi. In addition to ankle-associated tissues, CHIKV RNA was measured at a low level in the spleen of WT mice (Fig. 3-1A and Table 3-1); however, levels in the spleen waned such that after 6 wpi CHIKV RNA was undetectable. CHIKV RNA also persisted in the wrists of WT mice (Table 3-1), suggesting that CHIKV may establish persistent infections preferentially in joint-associated tissues.

To evaluate further the tissue specificity of CHIKV RNA persistence, we quantified viral RNA levels in the serum (Fig. 3-1B), quadriceps muscles (Fig. 3-1C and

D), liver (Fig. 3-1E), brain (Fig. 3-1F), and spinal cord (Fig. 3-1G) at 3, 14, and 28 dpi by

RT-qPCR. CHIKV RNA was readily detected in these tissues at 3 dpi, a time point during the acute stage of infection. Consistent with the musculoskeletal tissue tropism of CHIKV and related arthritogenic alphaviruses (156, 161), the highest CHIKV RNA burdens during the acute stage (3 dpi) were present in joint-associated and skeletal muscle

40 tissues (Fig. 3-1). In contrast to the ankles and spleen, CHIKV RNA was cleared rapidly from the serum, quadriceps muscles, liver, brain, and spinal cord of WT mice (Fig. 3-1 and Table 3-1). These findings indicate that persistence of CHIKV RNA following a subcutaneous inoculation is joint tissue-specific.

CHIKV RNA persists in mice inoculated with East/Central/South African,

West African, and Asian CHIKV strains. Phylogenetic analyses have identified three genotypes of CHIKV strains: East/Central/South African (ECSA), the West African, and

Asian (70, 73). To determine if persistence of viral RNA in joint-associated tissues was specific to CHIKV strain SL15649, a member of the ECSA genotype, we tested two distantly related CHIKV strains: Asian strain PO731460 and West African strain 37997

(73). WT C57BL/6 mice were inoculated subcutaneously in the left rear footpad with 103

PFU of either CHIKV strain. Following extensive intracardiac perfusion with PBS, viral

RNA levels in the left and right ankles at 4 wpi (n = 6) were quantified by RT-qPCR. As shown in Fig. 3-2, the amount of CHIKV RNA in ankle-associated tissues at 4 wpi in mice inoculated with strain 37997 or strain PO731460 was similar to or higher than that detected in ankle tissues of mice inoculated with strain SL15649. These data indicate that CHIKV strains from all described genotypes can establish persistent infections in murine joint tissue and thus, this is not an unusual property of the recent ECSA epidemic strains.

Adaptive immunity controls persistence of CHIKV. Chronic arthritis could be caused by persistent viral infection and/or persistent immunopathology associated with B and T cell immunity. To evaluate whether the adaptive immune response controls or contributes to CHIKV-induced joint disease and also impacts the tissue-specificity of

CHIKV persistence, Rag1-/- mice, which lack mature B and T lymphocytes (33), were inoculated subcutaneously in the left rear footpad with 103 PFU of CHIKV SL15649. The

41 levels of CHIKV RNA in perfused tissues (ankles, quadriceps muscles, and spleen) at 3 dpi and 1, 2, 4, 6, and 12 wpi were quantified by RT-qPCR (Fig. 3-3A-E). The levels of

CHIKV RNA were elevated in both the left ankle joint (11-fold [P < 0.001], 4-fold [P <

0.05], 12-fold [P < 0.05], 6-fold [P < 0.01], and 7-fold [P < 0.001] at 1, 2, 4, 6, and 12 wpi, respectively) and the right ankle joint (15-fold [P < 0.001], 32-fold [P < 0.001], 23-fold [P

< 0.001], 26-fold [P < 0.001], and 404-fold [P < 0.001] at 3 dpi, 4, 6, and 12 wpi, respectively) of Rag1-/- mice compared to WT mice (Fig. 3-3A and 3-3B). These data indicate that T and/or B cell immunity contributes to the control of CHIKV infection in joint tissues but is not sufficient to mediate complete clearance. CHIKV RNA persisted in quadriceps muscle tissues of Rag1-/- mice for at least 12 wpi, but was cleared by 2 wpi from the same tissues of WT mice (Fig. 3-3C and 3-3D); thus, in contrast to the joint tissues, adaptive T and/or B cell immunity was sufficient to clear CHIKV from muscle tissues. Although the amounts of CHIKV RNA detected in the spleens of WT Rag1-/- mice were similar at 3 dpi and 1 wpi, remarkably, viral RNA persisted in the spleen of

WT mice for 6 wpi but fell below the limit of detection in the spleen of Rag1-/- mice at 2,

4, 6, and 12 wpi (Fig. 3-3E). These data suggest that the altered organization and/or cellularity of the spleen of Rag1-/- mice (34) prevents CHIKV persistence in this tissue; alternatively, although it has not been reported CHIKV could have a limited tropism for subsets of B and T cells. We also quantified the amounts of infectious virus in the serum of CHIKV-inoculated WT and Rag1-/- mice via direct plaque assays. Infectious CHIKV was present in sera from both mouse strains at 3 dpi (Fig. 3-3F) but was not detected in sera of WT mice at any of the later time points evaluated. In contrast, Rag1-/- mice developed a persistent low level of viremia (Fig. 3-3F), which showed a pattern of fluctuation. A rapid decline in titer occurred between 3 and 7 dpi that was followed by a rise in titer between 1 and 2 wpi. Another drop in titer occurred at 4 wpi prior to the establishment of a steady-state level by 6 wpi. These data are consistent with recent

42 studies showing that Rag2-/- mice and B cell-deficient mice developed a persistent viremia following CHIKV inoculation (201, 204). Taken together, these analyses suggest that adaptive immune responses modulate persistent CHIKV infection in a tissue-specific manner.

During the alphavirus replication cycle, a 26S positive-sense subgenomic RNA, co-linear with the γ′ one-third of the full-length genomic RNA, is synthesized from the

26S subgenomic promoter (5, 269). The 26S subgenomic RNA is synthesized in 3- to

10-fold molar excess of the full-length positive-strand genomic RNA; thus, quantification of this molar excess can be used as an indicator of ongoing alphavirus replication (46,

50, 270-272). We designed an additional sequence-specific RT-qPCR assay with primers and probes complementary to sequences in the E1 coding region which, in contrast to the nsP1 coding region, are found in both the full-length and subgenomic

RNAs produced in infected cells. This assay amplified full-length CHIKV positive-strand genomic RNA with similar efficiency as our nsP1-based assay (data not shown). Utilizing this assay in combination with our nsP1-based assay, we detected a 2.6 to 4.3-fold excess of CHIKV RNA with our E1-based assay in the ankle tissues of WT and Rag1-/- mice at 3 dpi (Figs. 3-4A and 3-4B), suggesting similar levels of replication in these tissues at this time point. The E1 RNA/nsP1 RNA ratios declined from 3 dpi to 4 wpi in the left ankle tissues of WT mice (P < 0.001) to an average ratio of 1.2 at 4 wpi and then increased at 6 wpi (P < 0.001) (Fig. 4A). Similarly, the E1 RNA/nsP1 RNA ratios declined or remained constant over time in the right ankle of WT mice (Fig. 3-4B). These data suggest that CHIKV replication was restricted in the joint tissues of WT mice during persistence. In contrast, the excess of RNA detected with the E1-based assay increased over time in both the left ankle (P < 0.05) and right ankle (P < 0.001) of Rag1-/- mice to levels that were higher than WT mice, suggesting higher levels of CHIKV replication

43 occurred in joint tissues of Rag1-/- mice compared to WT mice during persistence.

Consistent with these results, infectious CHIKV was detected in ankle joint tissues of

Rag1-/- but not WT mice at 42 dpi by direct plaque assay (Fig. 3-4C and data not shown). These data suggest that CHIKV RNA replication occurs at low, fluctuating levels in joint-associated tissues of WT mice and further support an important role for adaptive immunity in controlling persistent CHIKV infection.

Persistence of CHIKV is associated with pathology. The data presented thus far suggest that CHIKV RNA persists in mice preferentially in joint-associated tissues. To determine the extent to which the detection of CHIKV RNA is associated with pathology, histological changes in musculoskeletal tissues of uninfected control mice and CHIKV- infected mice at various times post-inoculation were evaluated in a blinded manner.

Consistent with prior reports (158, 159), arthritis, synovitis, tendonitis, myositis, and myocyte necrosis were most severe during the acute stage (7 dpi) (Fig. 3-5A-F).

Histopathology scores for synovitis (Fig. 3-5B), arthritis (Fig. 3-5C), and myositis (Fig. 3-

5D) during the acute stage appeared more severe for WT mice compared to Rag1-/- mice, consistent with studies reporting a possible pathogenic role of CD4+ T cells in acute CHIKV-induced disease (204). At this time point, both WT and Rag1-/- mice had an infiltrating inflammatory cell population predominantly composed of macrophages and neutrophils with admixed lymphocytes. At late times post-inoculation (4 to12 wpi) most

WT (8 of 11) and Rag1-/- (6 of 9) mice had apparent synovitis (Fig. 3-5A and B).

However, arthritis (Fig. 3-5C), metatarsal muscle inflammation (Fig. 3-5D), metatarsal muscle necrosis (Fig. 3-5E), and tendonitis (Fig. 3-5F) resolved in WT mice but remained evident in the majority of Rag1-/- mice out to 12 wpi. During this chronic stage, the infiltrating inflammatory cell population in tissues of WT mice consisted predominantly of histiocytes and lymphocytes whereas histiocytes and neutrophils were

44 predominant in the tissues of Rag1-/- mice. Thus, the persistence of CHIKV RNA is associated with pathology in joint-associated tissues, muscle tissue, and tendons.

Moreover, T and/or B cell responses appear to prevent the development of more severe chronic disease likely due to their ability to control infection. Nonetheless, synovitis failed to resolve in WT mice for at least 12 wpi, which correlated with the joint-tissue specific persistence of CHIKV RNA (Fig. 3-1 and Table 3-1).

MAb prophylaxis prevents persistence of CHIKV in tissues of Rag1-/- mice.

The studies described thus far establish a mouse model that can be used for evaluating the efficacy of therapeutic agents against chronic CHIKV infection and joint disease.

Recently, a combination of two CHIKV MAbs, CHK-152 and CHK-166 (which recognize discrete epitopes on CHIKV E2 and E1, respectively) was shown to have therapeutic efficacy in murine models of lethal CHIKV infection and acute CHIKV-induced musculoskeletal disease (220). To evaluate whether these neutralizing MAbs could prevent persistent CHIKV infection, β00 μg each of CHK-152 and CHK-166 or 400 μg of a negative control MAb (WNV E16) were administered intraperitoneally to Rag1-/- mice one day before and three days after inoculation with CHIKV. Persistence of CHIKV was evaluated at 28 days after virus inoculation. Prophylaxis with CHK-152 and CHK-166 reduced levels of infectious CHIKV in the serum to below the limit of detection (Fig. 3-

6A; P < 0.03). In addition, prophylaxis with CHK-152 and CHK-166 reduced CHIKV RNA levels in the left ankle (P < 0.02) and right ankle (P = 0.01) to below the limits of detection in 3/5 and 4/5 mice, respectively (Fig. 3-6B and 3-6C). In the two mice that were positive in these tissues, CHIKV RNA levels were reduced by >99% compared to mice treated with the negative control MAb.

MAb therapy has tissue-specific effects on persistent CHIKV infection. To evaluate whether the neutralizing anti-CHIKV MAbs could reduce or eliminate an

45 established persistent infection, β00 μg each of CHK-152 and CHK-166 or 400 μg of a negative control MAb (WNV E16) was administered intraperitoneally to Rag1-/- mice on days 21 and 25 post-CHIKV inoculation and viral burdens were evaluated at 28 dpi. As shown in Fig. 3-6D, therapeutic administration of CHK-152 and CHK-166 eliminated infectious virus from the sera (P < 0.01). In addition, while we detected infectious CHIKV in the quadriceps of 2/3 mice treated with the control MAb, 0/3 mice treated with CHK-

152 and CHK-166 had detectable infectious virus (data not shown), suggesting that the

CHIKV-specific MAbs could eliminate infectious virus in musculoskeletal tissues. This treatment regimen, however, had no effect on viral RNA levels in the left ankle (Fig. 3-

6E) or the quadriceps muscles (data not shown), although a significant, albeit small (3.2- fold, P < 0.01), reduction of CHIKV RNA was observed in the right ankle (Fig. 3-6F). In addition, the E1 RNA/nsP1 RNA ratio in the right ankle was reduced in mice treated with

CHK-152 and CHK-166 compared to mice treated with the control antibody (P = 0.001)

(Fig. 3-6G), suggesting that the CHIKV-specific MAbs reduced virus replication in this tissue. Thus, this two-dose, one-week combination MAb therapy was sufficient to reduce burdens of infectious virus although a more extended regimen may be required to clear

CHIKV from some tissues.

Discussion

A defining feature of alphavirus-induced musculoskeletal disease is the development of chronic polyarthralgia and/or polyarthritis, which can be debilitating (125,

273). The underlying processes that result in chronic disease associated with these infections are not well understood. Here, we utilized a recently developed mouse model of acute CHIKV-induced musculoskeletal disease (158) to investigate the sites and duration of CHIKV infection and musculoskeletal tissue pathology, the role of adaptive immunity in control of persistent infection, and a possible strategy to prevent or cure

46 persistent infection. Our findings suggest that CHIKV establishes persistent infections in joint-associated tissues, that persistence of CHIKV RNA is associated with ongoing synovitis, and that the sites of CHIKV persistence and tissue burdens of CHIKV are controlled by adaptive immunity. We also found that an antibody-based treatment prevents persistent CHIKV infection when administered as prophylaxis and has tissue- specific effects when administered therapeutically. Together, these studies support the hypothesis that chronic CHIKV arthritic disease is associated with persistent infection and establish a small animal model that can be utilized to investigate molecular mechanisms of chronic disease and test therapies that mitigate persistent CHIKV infection and joint pathology.

Persistence of CHIKV RNA is joint tissue-specific and controlled by adaptive immunity. Persistence of alphaviruses in vertebrate hosts was first noted in the central nervous system of both WT and scid mice inoculated intracerebrally (i.c.) with neuroadapted SINV (274, 275). Subsequent studies established that persistent CNS infection with SINV following an i.c. inoculation was controlled by IFN- production by T cells and anti-SINV antibodies produced by antibody-secreting B cells residing in the

CNS (276-279). In our studies, we found that persistence of CHIKV RNA in WT mice was joint tissue-specific, with high levels of viral RNA detected in ankle and wrist tissues, but not in several other tissues, for at least 16 wpi. Our studies also indicated that the establishment of persistent infection in joint-associated tissues of mice is a common property shared by of CHIKV strains from all three genotypes. These data are consistent with epidemiological studies which have documented the development of protracted disease symptoms during outbreaks of CHIKV in humans involving any of the three

CHIKV genotypes (69). The detection of CHIKV RNA in joint-associated tissues is also consistent with previous studies in humans in which CHIKV antigen was detected in

47 synovial biopsies collected from a patient with chronic disease (280) and in experimentally-inoculated rhesus and cynomolgous macaques in which CHIKV RNA was detected in joints at later times post-inoculation of (153, 155). Analogously, Ross

River virus RNA has been detected in knee biopsies collected from patients five weeks after the onset of joint symptoms (250).

Similar to WT mice, Rag1-/- mice failed to clear CHIKV RNA from ankle joint- associated tissues. However, the amounts of CHIKV RNA and the E1/nsP1 RNA ratio in ankle joint-associated tissues of Rag1-/- mice were elevated compared to WT mice, suggesting that adaptive immunity limits viral burden in these tissues. In contrast, WT, but not Rag1-/- mice, rapidly cleared CHIKV RNA from quadriceps muscle tissue and infectious virus from the serum. Collectively, these data suggest that T and/or B cell- mediated immunity controls CHIKV burdens in a tissue-specific manner.

Persistence of CHIKV RNA is associated with chronic synovitis. Similar to acute CHIKV rheumatological disease in WT mice, inoculation of Rag1-/- mice with

CHIKV resulted in synovitis, arthritis, myositis, and tendonitis; thus, CHIKV can induce an acute inflammatory response despite the lack of mature T and B cells. These findings are similar to studies in Rag1-/- mice infected with Ross River virus in which affected joints and muscles were infiltrated with macrophages and NK cells (161). However, our detailed assessment of tissue sections at 7 dpi revealed that Rag1-/- mice had less severe tissue pathology than WT mice during the acute stage, suggesting an early pathogenic role for T and/or B cells. These findings agree with studies reporting less severe foot swelling in CHIKV-infected Rag2-/- mice and MHC class II-deficient mice

(204, 241). More specifically, CD4+ T cells were shown to contribute to CHIKV-induced foot swelling and musculoskeletal tissue injury (204).

Assessment of tissue sections from WT and Rag1-/- mice at 4, 6, and 12 wpi revealed that CHIKV infection resulted in a low-level, chronic synovitis. Intra-articular injection of dsRNA directly into murine joint spaces also is arthritogenic (281), suggesting that viral RNA may be sufficient to cause joint inflammation and injury. Thus, persistence of CHIKV in joint-associated tissues may promote chronic inflammation of synovial membranes. In contrast, arthritis, myositis, and tendonitis resolved in the majority of WT mice, but not Rag1-/- mice, between 4 and 12 wpi. Although Rag1-/- mice had less severe acute disease, in the chronic phase arthritis, myositis, myocyte necrosis, and tendonitis were present in the majority of Rag1-/- mice. These longitudinal analyses suggest that functional T and/or B cell responses protect against chronic musculoskeletal disease. Our results are consistent with recent findings in rhesus macaques in which persistence of CHIKV in the spleen correlated with defects in adaptive immune responses (154), and in humans in which the rapid appearance of neutralizing IgG3 antibodies correlated with viral clearance and protection from chronic

CHIKV disease (213).

Prophylaxis with CHIKV-specific MAbs prevents CHIKV persistence.

Prophylaxis via passive transfer of human immune plasma or CHIKV IgG to highly susceptible Ifnar1-/- mice can protect against CHIKV-induced mortality, suggesting that antibody therapy may be a promising disease prevention option for individuals at high risk of CHIKV infection (282). More recently, prophylaxis with different CHIKV-specific

MAbs was shown to protect against lethal CHIKV infection in AGR129 mice (283), which lack receptors for type I and type II interferons as well as Rag2, and also in Ifnar1-/- mice

(220). Importantly, prophylaxis with CHIKV-specific MAbs prevented acute joint swelling and inflammatory arthritis in CHIKV-infected WT mice (220). However, none of these previous studies addressed whether antibody-based prophylaxis or treatment could

49 impact persistent CHIKV infection. We found that the combination of two neutralizing

MAbs (CHK-152 and CHK-166), which recognize discrete epitopes on CHIKV E2 and

E1, respectively, prevented persistent infection in Rag1-/- mice when administered as prophylaxis. Together with previous reports, our findings suggest that antibody-based prophylaxis in targeted at-risk populations may be a promising strategy to prevent both acute and chronic-CHIKV disease.

MAb therapy after the establishment of persistence enables tissue-specific clearance. To test whether the neutralizing anti-CHIKV MAbs could reduce or eliminate an established persistent CHIKV infection, we treated persistently-infected Rag1-/- mice three weeks after CHIKV inoculation with two doses of MAbs and evaluated viral burden one week later. Similar to the prophylaxis results, therapeutic administration of CHK-152 and CHK-166 eliminated infectious virus in the sera. MAb treatment also prevented recovery of infectious virus from quadriceps muscle tissue, suggesting that infectious virus in at least some tissues is efficiently eliminated upon treatment. In contrast to prophylaxis, therapeutic administration of CHK-152 and CHK-166 had minimal effects on

CHIKV RNA burdens in joint-associated tissues and quadriceps muscle tissue. These findings are similar to a study showing that a single dose of an anti-SINV virus MAb administered at 7 days post-infection failed to eliminate virus RNA in the CNS of scid mice (45). Although the latter study is complicated by issues of blood-brain barrier penetration and accumulation of MAb in a restricted compartment, longer MAb treatment regimens may be required to eliminate alphavirus RNA in infected tissues.

A high percentage of CHIKV-infected individuals suffer from chronic arthralgia

(110, 115, 139, 227, 252, 273) and chronic CHIKV disease can be debilitating with severe economic consequences (232, 252, 273, 284). Accordingly, an improved understanding of the molecular mechanisms of chronic CHIKV disease and the

50 development of effective therapies to prevent or treat viral persistence are critical. Our studies report a mouse model with long-term CHIKV infection and pathology localized in joint-associated tissues. In this model, adaptive immune responses control rather than contribute to the severity of tissue pathology by restricting CHIKV infection in most but not all tissues. Prophylaxis with a combination of MAbs effectively prevents persistent

CHIKV infection whereas therapeutic administration diminished infectious virus burdens in tissues. The development of this model will facilitate future studies to increase our understanding of the biological basis of chronic CHIKV infection and disease, and allow a cost-effective platform for testing new therapies that mitigate infection and pathology.

TABLE 3-1 CHIKV infection in tissues of infected animals. a Tissues were analyzed for CHIKV positive-strand RNA via RT-qPCR. Limit of detection was 100 CHIKV RNA copies/µg of RNA. Serum was analyzed for infectious virus via direct plaque assays. Limit of detection was 50 PFU/ml of serum. b Data are expressed as the number of tissues that were CHIKV positive divided by the total number of tissues analyzed. Each tissue was from an independent mouse. ND, not done. Tissue No. of positive tissues/total number of tissues by day post- Mouse or inoculationb strain Seruma 3 7 14 28 42 84 112 Left 7/7 11/11 12/12 11/11 7/7 8/8 3/3 ankle Right 7/7 11/11 8/8 9/9 7/7 5/8 3/3 ankle Left wrist ND ND 5/5 ND ND ND 2/3 Right ND ND ND ND ND ND 1/3 wrist Left 7/7 1/11 0/8 1/6 0/3 0/5 ND quad WT Right 7/7 5/11 0/8 0/9 0/3 0/5 ND quad Spleen 7/7 6/11 4/7 6/11 3/7 0/8 0/3 Liver 7/7 ND 0/3 0/3 ND ND ND Brain 5/7 ND 1/3 0/3 ND ND ND Spinal 6/7 ND 1/3 0/3 ND ND ND cord Serum 6/6 0/6 0/6 0/6 0/6 0/6 ND Left 6/6 6/6 9/9 6/6 7/7 5/5 ND ankle Right 6/6 6/6 9/9 6/6 7/7 5/5 ND ankle Left 6/6 6/6 9/9 6/6 7/7 5/5 ND quad −/− Right Rag1 6/6 6/6 9/9 6/6 7/7 5/5 ND quad Spleen 6/6 1/6 0/9 0/6 0/7 0/5 ND Liver 6/6 ND 0/3 0/6 0/5 ND ND Brain 6/6 ND ND 2/6 0/5 ND ND Serum 5/5 2/6 5/5 4/6 6/6 4/4 ND

Figure 3-1: CHIKV RNA persists in joint-associated tissue and spleen of WT mice.

Figure 3-1: CHIKV RNA persists in joint-associated tissue and spleen of WT mice. Three-week-old WTC57BL/6 mice were mock inoculated (data not shown) or inoculated with 103 PFU of CHIKV by injection in the left rear footpad. Mice were sacrificed and perfused by intracardiac injection with PBS, and total RNA was isolated from the indicated tissues. (A) At 3 dpi (n = 7 mice) and 1 (n = 11), 2 (n = 8), 4 (n = 11), 6 (n = 7), 12 (n = 8), and 16 (n = 3) wpi, CHIKV RNA in the ankles and spleen was quantified by RT-qPCR. Each data point represents the arithmetic mean ± standard errors of the means (SEM), and the dashed line indicates the limit of detection. (B to G) At 3 (n = 7), 14 (n = 3 to 7), and 28 dpi (n = 3 to 5), CHIKV RNA in the serum (B), left quad (C), right quad (D), liver (E), brain (F), and spinal cord (G) was quantified by RT-qPCR. Horizontal lines indicate the means, and dashed lines indicate the limits of detection. Data shown are derived from 2 to 3 independent experiments, except data for 16 wpi, which were derived from a single experiment.

Figure 3-2: Persistence of CHIKV RNA in joint-associated tissue is virus genotype independent. Three-week-old WT C57BL/6 mice were inoculated with 103 PFU of CHIKV strain 37997 or strain PO731460 by injection in the left rear footpad (n = 6 or 7/group). At 28 dpi, mice were sacrificed and perfused by intracardiac injection with PBS, and totalRNAwas isolated from the indicated tissues.CHIKVRNAin the left ankle (A) and right ankle (B) was quantified by RT-qPCR. Levels of CHIKV RNA from mice inoculated with 103 PFU of CHIKV strain SL15649 were quantified by the same assay for comparison. Horizontal lines indicate the means, and dashed lines indicate the limits of detection. *, P = 0.05; **, P = 0.01, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. Data shown are derived from two independent experiments.

Figure 3-3: CHIKV persistence in tissues of Rag1-/- mice.

Figure 3-3: CHIKV persistence in tissues of Rag1-/- mice. Three-week-old Rag1-/- congenic C57BL/6 mice were mock inoculated (data not shown) or inoculated with 103 PFU of CHIKV by injection in the left rear footpad. At 3 dpi (n = 6) and 1 (n = 6), 2 (n = 9), 4 (n = 6), 6 (n = 9), and 12 wpi (n = 5), mice were sacrificed and perfused by intracardial injection with 1X PBS, and total RNA was isolated from the left ankle (A), right ankle (B), left quadriceps muscle (C), right quadriceps muscle (D), and spleen (E). Levels of CHIKV RNA were quantified by RT-qPCR. For comparison, values were plotted against values in WT mice. (F) Serum was analyzed for infectious virus via direct plaque assays. Dashed lines indicate the limit of detection. *, P < 0.05; **, P < 0.01; ***, P < 0.001, as determined by two-way ANOVA followed by Bonferroni posttest analysis. Data shown are derived from at least two independent experiments.

Figure 3-4: Increased subgenomic mRNA in tissues of Rag1-/- mice. CHIKV RNA in the left ankle (A) and right ankle (B) of WT and Rag1-/- C57BL/6 mice at the indicated time points was quantified by RT-qPCR assays specific for nucleotide sequences in the nsP1 and the E1 genes in parallel as described in Materials and Methods. The E1/nsP1 ratio was plotted as an indirect measurement of subgenomic mRNA production. *, P < 0.05; **, P < 0.01; ***, P < 0.001, as determined by one-way ANOVA followed by Tukey’s multiple comparison test. (C) Infectious virus in the left and right ankles of Rag1-/- C57BL/6 mice at 42 dpi was quantified by direct plaque assay. Dashed line indicates the limit of detection. Data shown are derived from at least two independent experiments.

Figure 3-5: Chronic synovitis in WT and Rag1-/- mice. Three week-old WT and Rag1-/- C57BL/6 mice were mock inoculated or inoculated with 103 PFU of CHIKV by injection in the left rear footpad. (A) At 7 and 42 dpi, 5-µm paraffin-embedded sections were generated from the hind limbs and stained with hematoxylin and eosin. Arrows indicate areas of synovitis, as identified by an anatomic pathologist. Scale bar, 200µM. Images are representative of three mice per group. (B to F) At 1, 4, 6, and 12 wpi, 5-µm paraffin- embedded sections were generated from the hind limbs, stained with hematoxylin and eosin, and scored in a blinded manner by two anatomic pathologists for the degree of synovitis (B), arthritis (C), metatarsal muscle inflammation (D), metatarsal muscle necrosis (E), and tendonitis (F) based on the following scale for percentage of tissue affected: 0, absent (0%); 1, minimal (<10%); 2, mild (11 to 25%); 3, moderate (26 to 40%); 4, marked (41 to 60%); and 5, severe (>60%).

Figure 3-6: Efficacy of MAb prophylaxis and therapy against persistent CHIKV infection in Rag1-/- mice.

Figure 3-6: Efficacy of MAb prophylaxis and therapy against persistent CHIKV infection in Rag1-/- mice. (A to C) Three-week-old Rag1-/- C57BL/6 mice were injected i.p. with 400 µg of WNV E16 MAb or 200 µg CHK-152 and 200 µg CHK-166 MAbs on days -1 and +3. On day 0, mice were inoculated with 103 PFU of CHIKV in the left rear footpad. At 28 dpi, mice were sacrificed and perfused with PBS via intracardiac injection, and infectious virus in the serum (A) was quantified by plaque assay. Tissues (left ankle/foot [B] and right ankle/foot [C]) were homogenized in TRIzol, and CHIKV RNA was quantified by RT-qPCR. Horizontal lines indicate the means, and dashed lines indicate the limits of detection. P values were determined by Mann-Whitney tests. Data are from two independent experiments. (D to G) Three-week-old Rag1-/- C57BL/6 mice were inoculated with 103 PFU of CHIKV in the left rear footpad. On days 21 and 25, mice were injected i.p. with 400 µg of WNV E16 MAb or 200 µg CHK-152 and 200 µg CHK- 166 MAbs. At 28 dpi, mice were sacrificed and perfused with PBS via intracardiac injection. (D) Infectious virus in the serum was quantified by plaque assay. The left ankle (E) and right ankle (F) were homogenized in TRIzol, and CHIKV RNA was quantified by RT-qPCR. (G) CHIKV RNA in the right ankle was quantified by RT-qPCR assays specific for nucleotide sequences in the nsP1 and the E1 genes in parallel as described in Materials and Methods. The E1/nsP1 ratio was plotted as an indirect measurement of subgenomic mRNA production. Horizontal bars indicate the means, and dashed lines indicate the limits of detection. P values were determined by the Mann-Whitney test (D) or two-tailed unpaired t tests (F and G). Data are from two independent experiments.

CHAPTER IV

PATHOGENIC CHIKUNGUNYA VIRUS EVADES B CELL RESPONSES TO

ESTABLISH PERSISTENCE2

Introduction

Chikungunya virus (CHIKV) is a mosquito-transmitted positive-sense, enveloped

RNA virus in the Alphavirus genus of the Togaviridae. CHIKV has caused epidemics of unprecedented scale within the past decade in many regions of the world (285).

Beginning in 2004, CHIKV re-emerged from Africa and spread to islands in the Indian

Ocean and South Pacific and countries in southern Asia. In October of 2013, local transmission of CHIKV occurred on the Caribbean island of Saint Martin (95). Since that time, the virus has spread throughout much of the Americas resulting in at least 1.8 million confirmed and suspected cases in 45 countries or territories (94).

CHIKV infection typically presents with a sudden onset of high fever and severe pain in peripheral joints (107, 286). These signs and symptoms can resolve in a few weeks. However, in up to 50% of patients, musculoskeletal abnormalities, including joint swelling, joint stiffness, and tenosynovitis, endure for months to years after infection

(110, 227, 231, 232, 273). Infection by related alphaviruses such as Mayaro, o’nyong’nyong, Ross River, and Sindbis viruses also can lead to chronic musculoskeletal disease in humans (125).

Mechanisms by which alphaviruses cause chronic musculoskeletal disease remain elusive. Limited studies of human patients suggest that arthritogenic alphaviruses establish persistent infections within the host (250, 257, 280). Persistent

2 Portions of this chapter were previously published in Cell Reports. 2016. Volume 16. Issue 5 and are included with permission of the copyright holder.

CHIKV infection also has been detected in experimentally infected mice and non-human primates. In cynomolgus macaques, infectious CHIKV or CHIKV RNA is present in synovial tissue, muscle, lymphoid organs, and the liver for weeks after infection (153).

Similarly, CHIKV RNA is present in the spleen of aged rhesus macaques for at least five weeks after initial infection (154). Infection of wild-type (WT) C57BL/6 mice with CHIKV also results in chronic synovitis and persistence of CHIKV RNA specifically within joint- associated tissues (157). Consistent with these data, long term persistence of positive- and negative-strand CHIKV RNA persists in the feet of CHIKV-inoculated mice (168), and mice infected with a recombinant CHIKV strain encoding a luciferase gene display gene activity even 60 days post-infection (204). Collectively, these data suggest that

CHIKV persists for weeks to months in some tissues, and that the chronic musculoskeletal disease experienced by CHIKV patients may be due to persistent infection or inflammation.

Here, we show that the attenuated CHIKV strain 181/25, in contrast to its pathogenic parental strain AF15561, is cleared from joint-associated tissues within 4 weeks of infection. We took advantage of these disparate outcomes to investigate the viral and host determinants of CHIKV clearance and persistence. Our findings revealed that clearance of the attenuated 181/25 strain is impaired in Rag1-/- mice, B cell-deficient

μMT mice, and B cell receptor transgenic mice that cannot produce virus-specific antibody, and that the persistence of 181/25 in joint tissue of Rag1-/- mice occurred without the acquisition of adaptive mutations that confer persistence in WT mice. The amino acid at position 82 of the CHIKV E2 glycoprotein, which varies between 181/25 and AF15561, is a major determinant of CHIKV clearance and the potency of neutralization of multiple epidemic CHIKV strains by both murine and human immune sera. Notably, neutralization of AF15561 by monoclonal antibodies (MAbs) specifically targeting E2 domain B was inefficient relative to 181/25. Overall, our data suggest that

63 virus-specific antibody responses contribute to the clearance of 181/25 infection, and that AF15561 evades this response by minimizing the impact of E2 B domain neutralizing antibodies to establish persistent infection.

Results

CHIKV 181/25 is Cleared from Sites of Dissemination in WT C57BL/6 Mice.

Pathogenic CHIKV strains establish persistent infections in joint tissues of immunocompetent WT C57BL/6 mice (157, 168). To test whether an attenuated CHIKV strain also establishes persistent infection in mice, we measured viral loads in joint tissues of WT C57BL/6 mice infected with the attenuated CHIKV strain 181/25 and its pathogenic parental strain AF15561 (142), which vary at five amino acids (Fig. 4-1A).

WT mice were inoculated in the left rear footpad with AF15561 or 181/25, and viral loads in the contralateral right ankle were quantified by RT-qPCR (Fig. 4-1B). At 3 days post- inoculation (dpi), 181/25-infected mice had reduced viral RNA levels in the right ankle compared with AF15561-infected mice. These data are consistent with previous reports demonstrating that CHIKV strain 181/25 has diminished capacity to disseminate in mice from the site of inoculation (172, 260). At 7 dpi, levels of viral RNA in the contralateral right ankle of mice inoculated with 181/25 were increased compared with levels at 3 dpi

(P < 0.001), suggesting that 181/25 replicated at that site. Viral loads in the right ankle at

7 and 14 dpi were comparable in mice infected with 181/25 or AF15561 (Fig. 4-1B). By

21 dpi, however, levels of viral RNA in the right ankle of 181/25-infected mice were reduced 95-fold relative to those in AF15561-infected mice. Similarly, at 28 dpi, high levels of viral RNA were maintained in the contralateral right ankle of AF15561-infected mice, whereas viral RNA was below the limit of detection in 7 of 8 mice infected with

181/25. Viral RNA in the right ankle of AF15561-infected mice remained detectable for at least 6 weeks post-infection (Fig. 4-1B). Similar to the right ankle, viral RNA levels in the

64 wrist (Fig. 4-1C) and the spleen (Fig. 4-1D) of mice infected with 181/25 were below the limit of detection at 28 dpi whereas viral RNA remained detectable at those sites in

AF15561-infected animals. In contrast, viral RNA was detectable at 28 dpi in the ipsilateral left ankle, which is proximal to the site of inoculation (left rear footpad), of mice infected with 181/25 (Fig. 4-1E), suggesting that the kinetics, or the influence of the local microenvironment on viral RNA clearance are distinct at that site.

AF15561 has a higher ratio of genome copies to plaque-forming units (PFU) than

181/25 (25, 260). To determine whether differences in the number of CHIKV particles injected into mice contributed to differences in viral RNA persistence or clearance, we inoculated WT mice with 6.8 x 104 BHK cell PFU of 181/25, an equivalent number of genomes as contained in 1,000 BHK cell PFU of our stock of AF15561 (as determined by RT-qPCR, data not shown). Reciprocally, we also inoculated WT mice with 30 PFU of

AF15561. Higher levels of viral RNA were detectable at 28 dpi in the right ankle of mice inoculated with 30 PFU of AF15561 than mice inoculated with 6.8 x 104 BHK cell PFU of

181/25, as the latter were below the limit of detection in 8 of 11 mice (Fig. 4-1F). Thus, differential clearance of CHIKV strains AF15561 and 181/25 at sites of dissemination is not attributable to differences in the amount of viral RNA between the two strains at the time of inoculation.

Viral Determinants of CHIKV Persistence in Mice. Two mutations, I12 and

R82, in the E2 glycoprotein of CHIKV 181/25 are responsible for as attenuation of acute disease in mice (144, 260). To determine whether these mutations influenced the persistence of viral RNA in joint tissues, we inoculated mice with 181/25 containing E2 residue 12 reverted to a WT threonine (181/25E2 I12T), E2 residue 82 reverted to a WT glycine (181/25E2 R82G) or both revertant mutations together (181/25E2 I12T R82G) and quantified viral RNA levels in the right ankle at 28 dpi (Fig. 4-1G). In comparison to mice infected with 181/25, infection of mice with 181/25E2 I12T did not alter viral RNA levels in

65 the right ankle at 28 dpi (Fig. 4-1G). However, reversion of E2 residue 82 to a glycine

(181/25E2 R82G) resulted in 9 of 10 mice having detectable viral RNA in the right ankle at

28 dpi (Fig. 4-1G), albeit at lower levels than detected in the right ankle of mice inoculated with AF15561. Inoculation of mice with the double revertant 181/25E2 I12T R82G restored viral RNA levels in the right ankle at 28 dpi to those detected in AF15561- infected mice (Fig. 4-1G). Although 181/25E2 I12T was cleared from the right ankle at 28 dpi, the level of viral RNA in the right ankle of mice infected with 181/25E2 I12T R82G was higher compared with 181/25E2 R82G -infected mice, suggesting that a threonine at E2 residue 12 influences viral clearance when paired with the E2 R82G mutation.

CHIKV 181/25 Persists in Rag1-/- Mice. Based on the kinetics of CHIKV 181/25 clearance from the right ankle of WT mice (Fig. 4-1B), we hypothesized that adaptive immune responses prevented persistence of 181/25 infection. To test this hypothesis,

WT mice or Rag1-/- mice, which lack mature B and T cells, were inoculated with either

AF15561 or 181/25 and viral RNA in the right ankle at 3 dpi (Fig. 4-2A) and 28 dpi (Fig.

4-2B) was quantified by RT-qPCR. Similar to WT mice (Fig. 4-1B), viral RNA levels in the contralateral right ankle of Rag1-/- mice at 3 dpi were reduced in 181/25-infected mice in comparison to AF15561-infected mice (126-fold, P < 0.05) (Fig. 4-2A), suggesting that the lower viral loads of 181/25 in this tissue at this time point are not due to the functions of B or T lymphocytes. AF15561-infected Rag1-/- mice had higher viral

RNA levels in the right ankle at 28 dpi in comparison to AF15561-infected WT mice (26- fold; P < 0.001) (Fig. 4-2B), indicating that B and/or T cell responses (or both) contribute to the control of AF15561 infection but fail to mediate clearance. In comparison, viral

RNA levels in the right ankle of 181/25-infected Rag1-/- mice at 28 dpi were ~8,000-fold higher than those in 181/25-infected WT mice (P < 0.0001) (Fig. 4-2B). In addition, viral

RNA levels in the right ankle of 181/25- and AF15561-infected Rag1-/- mice at 28 dpi were similar (Fig. 4-2B). To confirm these findings, we measured the amounts of

66 infectious virus present in the serum and right ankle at 28 dpi. 181/25- and AF15561- infected Rag1-/- mice had detectable viremia (Fig. 4-2C) although 181/25-infected Rag1-/- mice had reduced levels relative to AF15561-infected mice (9.5-fold; P < 0.001).

However, 181/25-infected Rag1-/- mice had increased titers of infectious virus in the right ankle at 28 dpi compared with the same tissue of AF15561-infected mice (4.4-fold, P <

0.05) (Fig. 4-2D). These data suggest that CHIKV strains 181/25 and AF15561 exhibit a similar capacity to persist in joint-associated tissues in the absence of adaptive immune responses.

Reversion of attenuating mutations occurs in certain tissues of 181/25-infected

WT mice (144, 260). Therefore, we next determined whether persistence of 181/25 in

Rag1-/- mice was associated with reversion of attenuating mutations or the acquisition of other adaptive mutations. Consensus sequencing of the E2 gene in viral RNA isolated from the right ankle of 181/25-infected Rag1-/- mice did not reveal reversion of the mutations at E2 residues 12 or 82 (data not shown). This sequencing strategy does not exclude the presence of compensatory mutations outside the region sequenced or low- frequency variants that could act in a trans-complementing manner to enhance virulence

(287). To test whether persisting virus in ankle tissue of 181/25-infected Rag1-/- mice acquired the capacity to persist in WT mice, WT C57BL/6 mice were inoculated with 6

PFU of CHIKV from right ankle tissue homogenates (based on the virus titer, 6 PFU was

-/- the amount present in 20 l of homogenate) from AF15561- or 181/25-infected Rag1 mice at 28 dpi. As a control, mice were inoculated with a similar dose of AF15561 stock virus. At 28 dpi, high levels of viral RNA were detected in the right ankle of mice infected with Rag1-/- ankle-derived AF15561 or 6 PFU of stock AF15561 (Fig. 4-2E). In contrast, viral RNA levels in the right ankle of all WT mice inoculated with Rag1-/- ankle-derived

181/25 remained below the limit of detection. Additionally, WT mice inoculated with

Rag1-/- ankle-derived AF15561 and 181/25 had high levels of CHIKV-specific IgG in the

67 serum (1:8,000 to 1:64,000) at the time of harvest (data not shown), indicating that all mice had become infected. These results suggest that in the absence of B and T cell immunity, CHIKV strain 181/25 establishes a persistent infection without acquiring adaptive mutations that alter the capacity for viral persistence in WT mice.

B Cells and Virus-Specific Antibody Are Required for Clearance of CHIKV

181/25. To determine whether B cells are required for clearance of CHIKV 181/25 from joint tissues, we inoculated WT mice or μMT mice (deficient in mature B cells) with either

AF15561 or 181/25 and quantified viral loads in the right ankle at 28 dpi (Fig. 4-3A).

Although not statistically significant (P > 0.05), we found that similar to Rag1-/- mice, viral loads in AF15561-infected μMT mice trended higher compared with WT animals.

Moreover, μMT mice were unable to control 181/25 infection, with 10 of 10 mice having persistent viral RNA in the right ankle in comparison with 181/25-infected WT mice (155- fold, P < 0.0001). Furthermore, the levels of viral RNA in the right ankle of μMT mice infected with AF15561 or 181/25 were similar. These findings suggest that B cells are required for clearance of 181/25 infection in joint tissues.

As μMT mice may have altered T cell responses because of the antibody- independent functions of mature B cells (288), we repeated these experiments using

MD4 transgenic mice (MD4tr), which express a B cell receptor (BCR) specific for hen egg lysozyme (HEL) on a WT C57BL/6 background. In these mice, greater than 90% of B cells express the HEL-specific BCR due to allelic exclusion (289). Similar to μMT mice, infection of MD4tr mice with CHIKV strain AF15561 resulted in modestly elevated (6-fold) levels of viral RNA in the right ankle at 28 dpi compared with WT mice, although this difference was not statistically significant. In contrast, levels of viral RNA in the right ankle at 28 dpi in 181/25-infected MD4tr mice were higher in comparison to 181/25- infected WT mice (350-fold, P < 0.0001) (Fig. 4-3A) and closely matched the levels observed in MT mice. Moreover, levels of viral RNA in the right ankle of 181/25- and

AF15561-infected MD4tr mice at 28 dpi were similar (P > 0.05) (Fig. 4-3A). Analysis of the CHIKV-specific antibody response in these mice by ELISA confirmed markedly diminished or absent CHIKV-specific IgG in AF15561- and 181/25-infected MD4tr and

μMT mice (Fig. 4-3B). These results suggest that CHIKV-specific antibody responses are required for clearance of 181/25 from joint tissue, but the persistent AF15661 strain evades these clearance mechanisms.

Antibody Responses to CHIKV AF15561 and 181/25 Infection Are Distinct.

The magnitude of the CHIKV-specific IgG response was similar at 28 dpi in AF15561- and 181/25-infected WT mice (Fig. 4-3B). We next investigated whether differences in clearance of CHIKV AF15561 and 181/25 infection from joint tissue of WT mice were associated with differences in the kinetics or quality of the anti-CHIKV antibody response. Using a virion-based ELISA to quantify CHIKV-specific IgM and IgG present in the sera of WT mice, we found that virus-specific IgM responses to both AF15561 and

181/25 infection developed rapidly, with IgM titers peaking at 5 to 7 dpi and declining thereafter (Fig. 4-4A). Levels of anti-CHIKV IgM were higher in AF15561-infected mice at both 5 dpi (10-fold, P < 0.0001) and 7 dpi (2.5-fold, P < 0.0001) compared with those in 181/25-infected mice (Fig. 4-4A). CHIKV-specific IgG responses also developed rapidly, with titers detected at 7 dpi with either strain (Fig. 4-4B). Again, the levels of anti-CHIKV IgG in AF15561-infected WT mice at 7 dpi were higher than those detected in 181/25-infected mice (12-fold, P < 0.0001). By 14 dpi and after, CHIKV-specific IgG titers were equivalent in AF15561 and 181/25-infected mice (Fig. 4-4B) as were the individual CHIKV-specific IgG subtypes at 28 dpi (Fig. 4-4C). By these analyses, the principal differences in virus-specific antibody responses during AF15561 or 181/25 infection occurred at early times post-infection; higher antibody levels were detected in

AF15561-infected animals, which likely reflects the greater levels of viral replication and antigen in these mice.

Although early virus-specific IgM and IgG responses were greater after infection with AF15561 compared with 181/25, this pattern did not correlate with clearance of

AF15561 and 181/25 from joint tissue of WT mice. Given this lack of correlation, we investigated the qualitative activity of the virus-specific antibody response by measuring the neutralization capacity using a plaque reduction neutralization test (PRNT50) with

181/25 or AF15561 as the challenge viruses. When serum was collected at 7 dpi from

AF15561- or 181/25-infected mice and tested against the homologous virus, serum from

181/25-infected mice displayed greater neutralizing activity compared with serum from

AF15561-infected mice (22-fold, P < 0.0001) (Fig. 4-5A). However, serum from

AF15561-infected mice displayed neutralizing activity against 181/25 that was comparable to serum from 181/25-infected mice (Fig. 4-5A), despite the differences in

IgM and IgG ELISA binding titers at this time point (Fig. 4-4A and 4-4B). By combining the ELISA and neutralization data, we observed a lower (5.2-fold, P < 0.01) serum neutralization index (290) in AF15561-infected mice compared with 181/25-infected mice

(Fig. 4-5B), suggesting that the early virus-specific antibody response qualitatively differed during infection with acutely cleared (181/25) or persistent (AF15561) CHIKV strains. Serum collected from 181/25-infected mice at 7 dpi exhibited reduced neutralizing activity (Fig. 4-5A) and a reduced neutralization index (Fig. 4-5B) against

AF15561 compared with 181/25. Although we detected similar neutralization activity against 181/25 or AF15561 virus in serum collected at 28 dpi from AF15561- or 181/25- infected mice, the neutralizing activity of sera from mice infected with either virus was consistently reduced against AF15561 compared with 181/25 (Fig. 4-5C and 4-5D).

Accordingly, and similar to 7 dpi, we observed a lower serum neutralization index for sera from AF15561- or 181/25-infected mice against AF15561 (Fig. 4-5D).

To determine whether amino acid differences between 181/25 and AF15561 explained the differences in serum neutralization capacity, we performed PRNT50 assays

70 using sera from 181/25-infected mice against AF15561, AF15561E2 G82R, 181/25, and

181/25E2 R82G viruses. In comparison to neutralization of 181/25, the neutralizing activity of sera collected from 181/25-infected mice was reduced against AF15561 and 181/25E2

R82G but not AF15561E2 G82R (Fig. 4-5E). Similar results were observed using sera collected from AF15561-infected mice (Fig. 4-5F). Introduction of the E2 G82R mutation into the genome of another epidemic CHIKV strain (SL15649) (158) also enhanced neutralization of the virus by serum collected from SL15649-infected mice (Fig. 4-5G).

Furthermore, the neutralizing activity of human sera collected from individuals who acquired CHIKV infection in the Caribbean (Fig. 4-6A - 4-6C) (291) or Sri Lanka (Fig.

4A-6E – 4A-6H) was reduced against AF15561 (an Asian genotype virus with genetic similarity to CHIKV strains circulating in the Caribbean) and SL15649 (an East, Central,

South Africa genotype virus isolated during 2006 outbreak in Sri Lanka) in comparison with AF15561E2 G82R and SL15649E2 G82R. Control human sera had no effect on CHIKV infection (Fig. 4-6D and 4-6I). Thus, the amino acid at E2 residue 82 influences the neutralization of epidemic Asian and East, Central, South Africa (ECSA) genotype

CHIKV strains by both murine and human immune sera.

To define the structural basis for differences in neutralization, we tested a panel of recently characterized CHIKV-specific mouse and human monoclonal antibodies

(MAbs) with mapped epitopes in E1 and E2 (36, 221, 292, 293) for their capacity to neutralize AF15561 and 181/25. MAbs recognizing the CHIKV E1 glycoprotein (CHK-

166, CHK-269, and CHK-155) or E2 domain A or Arch region (h4J21 and h4N12) (see

Fig. 4-8 for domain organization of E2) had similar neutralizing activity against AF15561 and 181/25 (Fig. 4-7A – 4-7E). The neutralizing activity of MAbs that bind epitopes spanning E2 domains A and B [CHK-152 (220, 293) and 5M16 (292)] was reduced modestly against AF15561 compared with 181/25 (2-fold and 3-fold, respectively) (Fig.

4-7F – 4-7G). In contrast, mouse and human MAbs recognizing epitopes within the E2 B

71 domain (CHK-265, CHK-98, CHK-48, and h8I4) neutralized AF15561 much less efficiently than 181/25 (17-fold, 11.5-fold, 19-fold and 600-fold respectively) (Fig. 4-7H –

4-7K) even though polymorphic E2 residues 12 and 82 are located within the E2 A domain and not within the binding footprint of CHK-265, CHK-98, CHK-48, or h8I4 (36,

221). As expected, West Nile virus-specific mouse and human polyclonal antibodies had no effect on virus infection (Fig. 4-7L – 4-7M). These findings, along with the serum neutralization data, suggest that E2 residue 82 influences neutralization of CHIKV, with pathogenic strains evading the inhibitory activity of antibodies targeting the B domain of the E2 glycoprotein.

Discussion

Long-term clinical sequelae are a common outcome of infection with CHIKV and several related alphaviruses (125). In this study, we found that in contrast to pathogenic

CHIKV strain AF15561, attenuated CHIKV strain 181/25 was cleared from most tissues of infected WT mice within 4 weeks of infection. We reasoned that comparative studies of CHIKV AF15561 and 181/25 infection would provide insight into mechanisms that influence clearance and persistence of CHIKV infection.

Viral Determinants Influence CHIKV Clearance and Persistence. Genomes of

CHIKV strains AF15561 and 181/25 differ at five non-synonymous and five synonymous nucleotides positions (144). Mutations resulting in amino acid changes in 181/25 are in nsP1 (T301I), E2 (T12I and G82R), 6K (C42P), and E1 (A404V) (Fig 4-1A). We found that reversion of the arginine to a glycine at E2 position 82 (181/25E2 R82G) yielded increased viral loads in the contralateral ankle at 28 dpi, suggesting that an arginine at

E2 residue 82 restricts CHIKV persistence. Arginine 82 in E2 enhances the affinity of

CHIKV particles for glycosaminoglycans (GAGs) in vitro (25), which may limit the capacity of CHIKV to disseminate from early sites of primary replication in vivo (172,

260, 294). The extent to which altered interactions with GAGs influences CHIKV clearance remains to be determined, but our data suggest that an arginine at position 82 promotes CHIKV clearance by facilitating neutralization of infectious viral particles by antibodies. An arginine at position 82 also was found to impair cell-to-cell spread of

CHIKV in vitro, a mechanism by which CHIKV may evade antibody mediated neutralization; however, this mechanism has not been explored in vivo (295). We also found that the amino acid at E2 position 12 contributes to persistence of CHIKV in joint tissue, as mice infected with 181/25 encoding both revertant mutations together

(181/25E2 I12T R82G) had increased levels of persistent viral RNA in joint tissue at late times post-infection compared with mice infected with either 181/25E2 R82G or 181/25E2 I12T.

Although the mechanism by which a threonine at E2 position 12 enhances viral burden during the persistent phase of infection requires further study, E2 position 12 may stabilize the residue at E2 position 82 (144). In addition, for Semliki Forest virus, a related alphavirus, a threonine at E2 position 12 increased the pH threshold of viral fusion (33), which might enhance replication efficiency.

CHIKV 181/25 Persists in Mice Lacking the Capacity to Produce Virus-

Specific Antibodies. Pathogenic strains of CHIKV persist in joint tissue of mice, suggesting that adaptive immune responses fail to clear primary infection (157, 168). In contrast, adaptive immune responses efficiently clear attenuated strain 181/25. Rag1-/- mice infected with 181/25 exhibited a nearly 8,000-fold increase in viral load in joint tissue distal to the site of inoculation at 28 dpi relative to 181/25-infected WT mice. In addition, levels of viral RNA and infectious virus in the contralateral joint tissue of

181/25-infected Rag1-/- mice were similar or greater than those detected in AF15561- infected Rag1-/- mice. Increased titers of infectious virus in joint tissues of 181/25- infected Rag1-/- mice may be due to the enhancement of viral replication within tissues by efficient interactions with GAGs, as has been described for a GAG-binding strain of

Sindbis virus (296). Infectious virus recovered from joint tissue of 181/25-infected Rag1-/- mice at 28 dpi had not gained the capacity to establish persistence in WT mice, and reversion of the mutations in the E2 glycoprotein was not detected. Therefore, in mice lacking adaptive immune responses, AF15561 and 181/25 establish persistence in joint tissues with comparable efficiency.

Our findings that Rag1-/- mice infected with 181/25 had detectable viremia at 28 dpi contrast with a previous study in which older 8-10 week old Rag1-/- C57BL/6 mice infected with 181/25 did not have detectable viremia (297). Additionally, we consistently detected infectious virus at 28 dpi in joint tissues of Rag1-/- mice infected with 181/25. In contrast, Seymour et al. did not detect infectious virus at late times post-infection (28-56 dpi) in various tissues of 181/25-infected Rag1-/- mice although joint tissues were not examined. It is possible that the age of mice and specific tissues evaluated in the two studies accounts for the disparate findings. Absence of detectable genetic or phenotypic reversion of 181/25 virus after 4 weeks of viral persistence in the joint tissue of Rag1-/- mice also differs from studies of 181/25-infected WT mice in which rapid reversion of the attenuating mutations in virus present in the circulation and the spleen was detected

(144, 260). Deep sequencing of CHIKV from the serum, brain, or kidney of persistently infected Rag1-/- mice revealed small numbers of mutations, suggesting that CHIKV is under less selective pressure in Rag1-/- than WT mice (168, 297). Collectively, these data suggest that reversion of the attenuating mutations in 181/25 in WT mice likely is driven, at least in part, by adaptive immune responses. Similar to our findings with Rag1-

/- mice, 181/25 infection of B cell deficient μMT mice or BCR transgenic mice that have normal B cell numbers but are incapable of producing CHIKV-specific antibody, resulted in persistence of viral RNA in joint tissue at levels similar to those in AF15561-infected

WT mice. These findings suggest that CHIKV-specific antibody responses are essential

74 for clearance of 181/25 from joint tissue, and that the pathogenic AF15561 strain evades these clearance mechanisms.

Antibody Responses to Pathogenic and Attenuated CHIKV Strains are

Distinct. Characterization of the humoral immune response of WT mice to AF15561 and

181/25 infection revealed differences in the kinetics, magnitude, and quality of the antiviral antibody response. Similar to previous studies (201, 218), the anti-CHIKV IgM response peaked at day 5 after AF15561 infection. In comparison, the anti-CHIKV IgM response in 181/25-infected mice was of lower magnitude and peaked slightly later (7 dpi). AF15561 infection of WT mice also induced a rapid CHIKV-specific IgG response, with high antibody levels detected at 7 dpi. In contrast, 181/25-infected mice did not achieve similar CHIKV-specific IgG titers until 14 dpi. Thus, the kinetics and magnitude of the early virus-specific IgM and IgG response did not correlate with relative clearance of AF15561 and 181/25 in joint tissue of WT mice. In addition, characterization of the neutralizing antibody response in AF15561 and 181/25-infected mice revealed three important findings: (1) The neutralization capacity of sera from AF15561-infected and

181/25-infected mice differed when homologous virus was used in the in vitro neutralization assay, with lower neutralizing titers detected in sera from AF15561- infected mice at both 7 and 28 dpi. Given the higher ELISA titers detected in these mice, this difference resulted in a diminished neutralization index; (2) When day 7 sera from

AF15561-infected mice was tested against the heterologous 181/25 virus, we detected a lower neutralization index in comparison to day 7 sera from 181/25-infected mice. These findings indicate that the higher levels of CHIKV-specific IgM and IgG antibodies in sera from AF15561-infected mice do not translate to a higher CHIKV-neutralizing capacity, particularly at early times post-infection. Differences in the quality of CHIKV-specific antibody responses could contribute to the difference in clearance of the two viruses in

WT mice. Early neutralizing antibody responses in humans protect against acute

75 disease (298), and the appearance of neutralizing IgG3 antibodies in CHIKV-infected patients correlates with reduced chronic CHIKV-induced musculoskeletal disease (213); and (3) The neutralization capacity of sera from 181/25-infected mice against AF15561 was lower in comparison to the neutralization capacity of the same sera against the homologous virus. Although sera from AF15561-infected mice did not neutralize 181/25 as efficiently as sera from 181/25-infected mice, sera from AF15561-infected mice neutralized 181/25 to a greater extent than it did AF15561. These findings suggest that differences in the display of neutralizing epitopes in AF15561 and 181/25 virions may contribute to differential inhibition by serum. Consistent with this hypothesis, the neutralization capacity of sera collected from CHIKV-infected mice or humans in Sri

Lanka and the Caribbean was enhanced against mutated epidemic CHIKV strains encoding an arginine at E2 position 82.

181/25 is Neutralized More Efficiently by Anti-CHIKV Antibodies Targeting

E2 Domain B. To determine the molecular basis underlying differences in antibody- mediated neutralization of 181/25 and AF15561, we performed neutralization assays using a panel of MAbs targeting epitopes in distinct domains of the CHIKV E1 and E2 glycoproteins. MAbs recognizing epitopes in the E1 glycoprotein, E2 domain A, or E2

Arch region had equivalent neutralizing activity against AF15561 and 181/25.

Importantly, this finding suggests that differences in PFU-to-antigen ratios of the viruses do not explain the differential neutralization of the two viruses by sera from virus-infected mice. In contrast, several mouse and human MAbs targeting E2 domain B exhibited reduced neutralization capacity against AF15561 compared with 181/25. These findings are consistent with reports that examined the mechanism of neutralization by the E2 B domain specific anti-CHIKV MAb 5F10 (35, 295). Passage of a CHIKV isolate containing an arginine at E2 position 82 under selective pressure of MAb 5F10 selected for a glycine at position 82 (295), and structural studies suggested that 5F10 neutralizes

CHIKV encoding an arginine at E2 position 82 by locking domain B into a rigid conformation and preventing exposure of the E1 fusion loop (35). Although 5F10 binds to CHIKV strains possessing a glycine at E2 position 82, the binding does not inhibit fusion. This mechanism of locking domain B and preventing fusion appears to be common to both mouse and human neutralizing antibodies targeting E2 domain B (36,

292, 293). In our studies, MAb CHK-265, which neutralizes CHIKV by cross-linking E2 domain B to E2 domain A of an adjacent spike (Fig 4-9) (36), exhibited a substantial difference in EC50 values between AF15561 and 181/25. The mutations in 181/25 at positions 12 and 82 of E2 are located in domain A away from the CHK-265 footprint, suggesting that these mutations do not directly influence the capacity of CHK-265 to recognize the virion. Our data support a model proposed by Porta et al. in which pathogenic CHIKV strains possessing the highly conserved E2 glycine 82 retain domain

B flexibility despite bound antibody, thus permitting viral fusion and entry (35). In contrast, an arginine at E2 residue 82, located within the core of the E2/E1 trimeric spike, introduces repulsive forces that alter the spatial conformation of E2 domain B (Fig

4-9). This structural perturbation may allow antibodies to lock domain B into a rigid conformation that impedes exposure of the E1 fusion loop and entry of the virus. As the

E2 domain B appears to be a dominant immune target in humans and mice (215), the near uniform conservation of E2 glycine 82 in pathogenic strains suggests a general mechanism by which CHIKV evades neutralizing antibody responses. Based on our findings, we conclude that this immune evasion mechanism contributes to the development of viral persistence. In addition, these findings have implications for the selection of virus strains used for vaccine development and for the evaluation of vaccine- induced protective humoral immune responses.

Figure 4-1: CHIKV 181/25 is Cleared from Sites of Dissemination in WT mice.

Figure 4-1: CHIKV 181/25 is Cleared from Sites of Dissemination in WT mice. (A) CHIKV strain 181/25 has 5 non-synonymous mutations from parental CHIKV strain AF15561. nsP1 T301I, E2 T12I, E2 G82R, 6k C42F, E1 A404V. (B-E) WT C57BL/6 mice were inoculated in the left rear footpad with 103 PFU of the pathogenic CHIKV strain AF15561 or the attenuated CHIKV strain 181/25. At the time points shown, CHIKV RNA in tissues was quantified by RT-qPCR. (F) WT C57BL/6 mice were inoculated in the left rear footpad with 30 PFU of AF15561 or 68,000 PFU of 181/25. At 28 dpi, CHIKV RNA in the right ankle was quantified by RT-qPCR. (G) WT C57BL/6 mice were inoculated in the left rear footpad with 103 PFU of the virus shown. At 28 dpi, CHIKV RNA in the right ankle was quantified by RT-qPCR. Horizontal bars indicate the mean values. The dashed lines indicate the limit of detection. Data are pooled from two or more independent experiments. P values were determined by two-way ANOVA with Bonferroni's multiple comparison test (B), the Mann-Whitney-test (C-E), or one-way ANOVA with a Tukey's multiple comparison test (G). *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001.

Figure 4-2: CHIKV 181/25 Persists in Rag1-/- Mice.

Figure 4-2. CHIKV 181/25 Persists in Rag1-/- Mice (A-D) WT or Rag1-/- mice were inoculated with 103 PFU of AF15561 or 181/25. At (A) 3 dpi of Rag1-/- mice or (B) 28 dpi of WT or Rag1-/- mice, viral RNA in the right ankle was quantified by RT-qPCR. Infectious virus in the (C) serum or (D) right ankle was quantified by plaque assay. (E) WT mice were inoculated in the left rear footpad with clarified ankle tissue homogenate containing 6 PFU of virus from (D) AF15561- or 181/25-infected animals or 6 PFU of CHIKV strain AF15561. At 28 dpi, CHIKV RNA in the right ankle was quantified by RT-qPCR. Horizontal bars indicate mean values. Dashed lines indicate the limit of detection. Data are from two or more independent experiments. P values were determined by Mann-Whitney test (A and D) or one-way ANOVA with a Tukey's multiple comparison test (B, C, and E). *, P < 0.05, ***, P < 0.001, ****, P < 0.0001.

Figure 4-3. Virus-Specific Antibody is Required to Control 181/25 Infection. WT, B cell deficient µMT, or BCR transgenic MD4tr C57BL/6 mice were inoculated in the left rear footpad with 103 PFU of AF15561 or 181/25. At 28 dpi, (A) CHIKV RNA in the right ankle was quantified by RT-qPCR, and (B) CHIKV-specific IgG in the serum was quantified by a whole virion-based ELISA. Data are from two or more independent experiments. P values were determined by one-way ANOVA with a Tukey's multiple comparison test. ****, P < 0.0001.

Figure 4-4. Virus-Specific Antibody Responses in WT Mice Infected with AF15561 or 181/25 WT C57BL/6 mice were inoculated in the left rear footpad with 103 PFU of AF15561 or 181/25 (n = 5-8 mice per group). At the time points shown, a virion-based ELISA was used to quantify the serum endpoint titers of CHIKV-specific (A) IgM or (B) IgG. (C) IgG subtype-specific detection antibodies were used to quantify IgG subtypes present in serum at 28 dpi (n = 5-6 mice per group). Data are from two or more independent experiments. P values were determined by two-way ANOVA with a Bonferroni's multiple comparison test (A, B) and Student's t-test (C). *, P <0.05, **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

Figure 4-5. Serum Neutralization of CHIKV Strains.

Figure 4-5. Serum Neutralization of CHIKV Strains. (A-D) WT C57BL/6 mice were inoculated in the left rear footpad with 103 PFU of AF15561 or 181/25. At (A) 7 dpi or (C) 28 dpi, the neutralization capacity of serum was quantified using a plaque reduction neutralization test 50 (PRNT50) with AF15561 or 181/25 as the challenge virus. (B and D) A neutralization index was calculated using the formula (PRNT50)/(IgG + IgM ELISA endpoint). (E-G) The neutralizing activity of pooled serum derived from (E) 181/25-, (F) AF15561- or (G) SL15649-infected mice at 28 dpi was determined using the indicated viruses. Horizontal bars indicate mean values. Data are from two or more independent experiments. Dashed lines indicate the limit of detection. P values were determined by one-way ANOVA with a Tukey's multiple comparison test. *, P <0.05, **, P < 0.01 ***, P < 0.001, ****, P < 0.0001.

Figure 4-6. E2 Residue 82 Influences Neutralization of CHIKV with Human Immune

Sera

Figure 4-6. E2 Residue 82 Influences Neutralization of CHIKV with Human Immune Sera. (A-C and E-H) The neutralizing activity of human sera from CHIKV-immune subjects was quantified using PRNT50 analysis against the indicated viruses. (D and I) Non-immune human sera was included as a control. The serum dilutions at which 50% of AF15561 (red text), AF15561E2 G82R (black text), SL15649 (pink text), or SL15649E2 G82R (blue text) were neutralized (PRNT50) were determined by non-linear regression (95% CI). Each graph represents the mean and standard error of the mean (SEM) from two independent experiments.

Figure 4-7. Differential Neutralization of AF15561 and 181/25 by MAbs Targeting E2

Domain B

Figure 4-7. Differential Neutralization of AF15561 and 181/25 by MAbs Targeting E2 Domain B. (A-M) MAbs were incubated with 100 FFU of AF15561 (red) or 181/25 (blue) viruses for at 37°C for 1 h. MAb-virus mixtures were added to Vero cells and incu bated for 18 h. Virus-infected foci were stained and counted. Wells containing MAbs were compared with wells without MAbs to determine relative infection. (L) WNV E60 and (M) hE16 MAbs were included as isotype control MAbs. The concentrations at which 50% of AF15561 (red text) or 181/25 (blue text) were neutralized (EC50) were determined by non-linear regression and are displayed in ng/ml (95% CI). Each graph represents the mean and standard deviation (SD) from at least two independent experiments.

Figure 4-8. Domain Organization of E2-E1 heterodimer. Surface view of the CHIKV E2 and E1 heterodimer (PDB: 3N42; Voss et al. 2010). E1 is colored light grey, the E1 fusion loop is colored pink, E2 domain A is colored dark blue, E2 domain B is colored orange, E2 domain C is colored red, the E2 arch regions are colored light blue, and residue at E2 position 82 is colored yellow.

Figure 4-9. Possible model of how E2 residue 82 influences virus neutralization by antibodies that target the E2 B domain. (A) Cryo-EM reconstruction of CHIKV 181/25 in complex with CHK-265 Fab fragments (PDB: 5ANY; Fox et al. 2015). The CHK-265 Fab molecules are colored dark grey, E1 is colored light grey, E2 domain A is colored dark blue, E2 domain B is colored orange, E2 domain C is colored red, the E2 arch regions are colored light blue, and the arginine (R) residue at E2 position 82 is colored yellow. (B) CHK-265 Fab fragments in complex with a CHIKV strain encoding a glycine (G) residue at E2 position 82 (yellow) was modeled based on data reported under PDB: 2XFC (Voss et al. 2010). In this model, the interactions between CHK-265 and the A domain of E2 in a neighboring trimeric spike that occur when CHK-265 is complexed with viruses encoding an R at E2 position 82 (as shown in A) may occur less efficiently. Note the potential change in position of E2 residue 82 within the core of the trimeric spike, the change in position of domain A, and the increased space between E2 molecules of neighboring trimeric spikes in comparison with the reconstruction shown in (A).

CHAPTER V

CHIKUNGUNYA VIRUS PERSISTENCE IN RAG1-/- MICE IS ASSOCIATED WITH

MUTATIONS IN THE E2 GLYCOPROTEIN AND 3′ UNTRANSLATED REGION THAT

ENHANCE VIRAL PATHOGENECITY IN NAÏVE WT MICE

Introduction

CHIKV can establish persistent infections in humans (170, 257) and animal experimentally-infected animal models (153, 157, 168, 204). However, the viral and host determinants of CHIKV persistence are largely unknown. My work has demonstrated that adaptive immune responses control CHIKV during persistence but are unable to clear CHIKV RNA from joint-associated tissue and that CHIKV evades neutralizing antibody responses as a necessary step to establish persistence (Chapter III and IV).

However, CHIKV likely engages multiple mechanisms to establish and maintain persistence as persistent CHIKV infection occurs despite sustained innate and adaptive antiviral immune responses of the host. For example, in addition to being essential for control of CHIKV infection during the acute phase (156), the type I IFN response is sustained weeks post-infection in humans with chronic CHIKV disease and in mice persistently-infected with CHIKV (168, 170). Furthermore, CHIKV-specific antibody and

T cell responses are sustained for weeks to months post infection (201, 205, 233). Thus, we hypothesized that persistence of CHIKV requires the acquisition of adaptive mutations to host selective pressures (299-301).

As described in Chapter IV, characterization of infectious CHIKV recovered from the joint-associated tissue of infected Rag1-/- mice at day 28 post-infection with CHIKV strains AF15561 or 181/25 did not reveal phenotypic changes (See Fig 4-2E), suggesting that CHIKV strains AF15561 and 181/25 have an equal capacity to persist in mice that lack T and B cells. Furthermore, deep sequencing of viral RNA recovered from

92 the joint-associated tissue of CHIKV-infected WT mice at 42 dpi revealed a limited number of coding changes that were not highly conserved across multiple samples derived from independently-infected mice (data not shown). Cumulatively, these data suggest that CHIKV persistence in joint-associated tissues may occur in the absence of adaptive mutations.

However, tissue-specific selective pressures exist within the host. For example, lymphocytic choriomeningitis virus (LCMV) recovered from the brains of chronically- infected mice showed no phenotypic differences from the parental LCMV Armstrong strain. In contrast, LCMV recovered from the lymphoid tissue of the same mice showed profound differences and was able to establish a chronic infection along with significant immunosuppression when re-inoculated into WT mice (302, 303), demonstrating that tissue-specific selection of novel variants can occur during viral persistence. I therefore hypothesized that persistence of CHIKV may select for novel variants in a tissue-specific manner.

To explore this hypothesis, I isolated CHIKV from the serum of B and T cell deficient Rag1-/- mice at day 28 following infection with CHIKV strain AF15561.

Surprisingly, I found that CHIKV plaque-purified from this tissue displayed enhanced pathogenicity in naive WT mice. Sequencing analysis of a plaque-purified isolate identified polymorphisms in the viral E2 glycoprotein and 3′ untranslated region (UTR) that, when introduced into a cDNA clone of CHIKV strain AF15561, conferred enhanced viral dissemination and pathogenecity in mice. These mutations contrastingly modified a highly conserved amino acid in E2 and a highly divergent region of the 3′ UTR.

Importantly, initial characterization of the virus suggests that this mouse-adapted CHIKV

(MA-CHIKV) strain retains a primary tropism for musculoskeletal tissues and a musculoskeletal disease course. Further studies of the mechanisms by which these

93 mutations confer enhanced CHIKV pathogenesis in mice will provide novel insight into the virus – host interactions that influence CHIKV replication, dissemination, and virulence.

Results

I hypothesized that during persistent infection, CHIKV acquires adaptive mutations that facilitate persistence in specific tissues. I took advantage of the observation that Rag1-/- and Rag2-/- mice, in contrast to WT mice, support persistent viremia for weeks to months but do not succumb to the infection (Fig. 5-1A and B) (see also Fig 3-3F and 4-2C) (168, 204). To assess whether infectious CHIKV circulating in the serum of Rag1-/- mice had acquired adaptive mutations that enhance persistence, I inoculated WT C57BL/6 mice in the left rear footpad with β0 μl of serum collected from individual viremic Rag1-/- mice at 28 dpi. In parallel, I inoculated WT mice in the left rear footpad with 20 µl of clarified right ankle tissue homogenate collected from individual

CHIKV-infected Rag1-/- mice at 28 dpi. This volume of serum or tissue homogenate contained between 10 – 20 PFU of infectious virus as measured by direct plaque assays. Mice were monitored daily for virus-induced changes in weight as a sensitive measure of disease severity. At day 2 p.i., 4 of 5 mice inoculated with serum from persistently-infected Rag1-/- mice had failed to gain weight, and these mice gained significantly less weight than mice infected with AF15561 through 10 dpi (P < 0.001,

Two-Way ANOVA, Bonferroni post-test) (Fig. 5-1C). In contrast, and consistent with previous studies, WT mice infected with AF15561 gained weight throughout the course of infection (Fig. 5-1C). Mice inoculated with ankle tissue homogenates from CHIKV- infected Rag1-/- mice showed similar weight gain to AF15561-infected mice (P > 0.05,

Two-Way ANOVA, Bonferroni post-test). Furthermore, mice inoculated with serum from persistently-infected Rag1-/- mice exhibited more severe musculoskeletal disease signs

94 including hind limb grip loss, altered gait, and difficulty righting. In addition, these mice exhibited ruffled fur and a hunched posture. At 10 dpi, 4 of 5 mice inoculated with serum from persistently-infected Rag1-/- mice had reached humane endpoints and the experiment was terminated. These data suggested that AF15561 in the circulation, but not ankle tissue, of Rag1-/- mice had acquired adaptive mutations that enhanced acute pathogenesis in WT mice.

One possible explanation for the enhanced disease observed in WT mice inoculated with serum from persistently infected Rag1-/- mice is the co-inoculation of factors present in the serum of chronically infected Rag1-/- mice that enhanced virus- induced disease. To test this possibility, and generate biological clones of CHIKV from

Rag1-/- serum for further study, I plaque-purified CHIKV from a serum sample used to inoculate a mouse in Fig. 1C. Stocks of the individual plaque-purified isolates,

AF6811P1-P6, were generated by a single amplification on Vero cells. I inoculated WT mice with a low dose of AF15561 or plaque-purified isolates AF6811P1-P3 and monitored mice daily for virus-induced effects on weight gain (Fig. 5-1D). In contrast to mice inoculated with AF15561, mice inoculated with the plaque-purified viruses exhibited reduced weight gain and more severe musculoskeletal disease signs, indicating that the plaque-purified viral isolates retained the enhanced virulence of Rag1-/- serum-derived

AF15561 and that co-inoculation of serum factors is not responsible for the more virulent phenotype.

I selected plaque-purified isolate AF6811P2 for further evaluation and sequenced the complete viral genome at both the consensus level and by Illumina-based deep sequencing. Alignment of sequence reads to the reference AF15561 genome identified three mutations in the genome of AF6811P2: a lysine (K) to arginine (R) substitution at

E2 position 200 (E2 K200R), a synonymous A to G mutation in the E1 gene (nt 10506)

95 and a 44 nt deletion in the 3′ UTR (Table 5-1). The deep sequencing results indicated the E2 and E1 mutations were present in greater than 99.9% of reads suggesting that the AF6811P2 biologic isolate was clonal rather than a quasispecies.

To confirm that these mutations were responsible for the enhanced pathogenecity of AF6811P2, I introduced the E2 K200R mutation and the γ′ UTR deletion into the AF15561 cDNA clone to generate AF15561Eβ Kβ00R ΔUTR. WT mice were inoculated in the left rear footpad with either WT AF15561, AF6811P2 or AF15561E2 K200R

ΔUTR and mice were monitored daily for virus-induced effects on weight gain and for the development of musculoskeletal disease signs (Fig. 5-2A and 2B). Similar to AF6811P2 infected mice, AF15561Eβ Kβ00R ΔUTR mice exhibited diminished gain weight compared with mice inoculated with AF15561 (Fig. 5-2A) (P < 0.0001, Two-Way ANOVA, Bonferroni post-test) and 1 of 4 mice in both groups succumbed to the infection by 10 dpi.

Additionally, both AF6811P2 and AF15561Eβ Kβ00R ΔUTR infected mice exhibited more severe musculoskeletal disease signs compared with mice inoculated with AF15561

(Fig. 5-2B) (P < 0.0001, Two-Way ANOVA, Bonferroni post-test). These data indicate that these two mutations enhance CHIKV pathogenesis in mice.

Based on the failure of mice infected with AF15561Eβ Kβ00R ΔUTR to gain weight at early time points post-infection, I hypothesized that these mutations enhanced viral dissemination from the site of inoculation and/or increased viral burdens in infected tissues at early time points post infection. I therefore inoculated WT mice with either

AF15561 or AF15561Eβ Kβ00R ΔUTR and evaluated viral burdens in a variety of tissues at 1 and 3 dpi by focus forming assay. At 1 and 3 dpi, AF15561 and AF15561Eβ Kβ00R ΔUTR achieved similar titers in the left ankle tissue which is proximal to the site of inoculation.

In contrast to the left ankle, AF15561Eβ Kβ00R ΔUTR rapidly disseminated to distal tissues and achieved higher viral loads compared to AF15561 infected mice by 1 dpi (Fig 5-3A):

Right Ankle, 3,500 fold, P <0.0001; Right Quadriceps, 500 fold, P <0.001; Spleen, 31 fold, P <0.001; Liver, 22 fold, P <0.05; Brain, 43 fold, P <0.001. Similarly, AF15561E2

Kβ00R ΔUTR infected mice had higher amounts of virus in the serum compared with

AF15561 infected mice at 1 (300 fold, P <0.01) and 3 dpi (1,050 fold, P <0.0001) (Fig. 5-

3B). Together, these data suggest that E2 K200R and the 44nt deletion in the γ′ UTR enhance the ability of the virus to rapidly disseminate from the site of inoculation.

To evaluate the contribution of each mutation individually, I constructed AF15561 strains encoding just the E2 K200R mutation (AF15561E2 K200R) or just the γ′ UTR deletion (AF15561ΔUTR). I inoculated WT mice with either virus and compared weight gain and disease scores to mice infected with either WT AF15561 or AF15561E2 K200R

ΔUTR (Fig. 5-4A and 5-4B). Mice infected with AF15561E2 K200R exhibited a failure to gain weight and significantly enhanced disease compared to AF15561 (P < 0.0001, Two-Way

ANOVA, Bonferroni post-test) suggesting that the E2 K200R mutation contributes to enhanced pathogenesis in mice. In contrast, mice infected with AF15561ΔUTR gained weight similar to AF15561-infected mice (P > 0.05, Two-Way ANOVA, Bonferroni post- test) and exhibited mildly enhanced musculoskeletal disease (P < 0.01, Two-Way

ANOVA, Bonferroni post-test). Notably however, mice infected with AF15561E2 K200R developed less severe musculoskeletal disease compared with AF15561Eβ Kβ00R ΔUTR infected mice (P < 0.0001, Two-Way ANOVA, Bonferroni post-test) suggesting that the

γ′ UTR deletion in conjunction with the E2 K200R mutation enhances CHIKV pathogenesis to a greater extent than that of E2 K200R mutation alone.

Discussion

Previous work by our lab and other researchers has demonstrated that mice deficient in adaptive immune responses support persistence of infectious CHIKV in a variety of tissues for weeks post infection (157, 168, 201, 202, 204, 297). Despite sustaining chronic viral replication for as long as 500 dpi, Rag1-/- mice exhibit only mild to moderate signs of pathology in joint and lymphoid tissues along with modestly elevated serum levels of TNF, IL-6 and IFN- (157, 168). Thus, the isolation of a mouse-adapted strain of CHIKV from the serum of a Rag1-/- mouse was surprising. However, isolation of a neurovirulent strain of Sindbis virus from the brains of persistently-infected severe combined immune deficiency (scid) mice has been previously reported (304), suggesting that persistent replication in immunodeficient mice can select for mouse-adapted alphaviruses. Our findings are in contrast to previous work by Poo et al. in which CHIKV isolated from the serum of Rag1-/- mice at 100 dpi did not show enhanced fitness when inoculated into WT mice (168). Similarly, CHIKV isolated from the kidney or brain of

Rag1-/- mice 4 – 6 wpi showed a limited number of coding changes, all within the non- structural proteins (297), although the effects of these mutations on CHIKV replication and pathogenesis were not evaluated. It is possible that differences in the mouse model

(young vs adult mice), founder strain of CHIKV (ECSA vs Asian genotype), and source of infectious virus for the inoculum (serum or cell culture passaged) may account for this difference. Likewise, one mouse receiving serum derived-AF15561 exhibited less severe musculoskeletal disease and improved weight gain suggesting that AF15561 circulating in the serum of Rag1-/- mice may be heterogeneous. Although AF6811P2 was isolated from the serum, it is unknown which tissues or cell types in Rag1-/- mice are shedding

CHIKV into the circulation. In contrast to the serum, inoculation of ankle tissue homogenates, which contained infectious CHIKV, from persistently-infected Rag1-/- mice

98 did not result in more severe disease signs (see Chapter IV Fig 4-2E), suggesting that discrete populations of CHIKV with varying fitness may exist within the same host.

Further studies of these discrete populations may provide novel insight into tissue- specific selective pressures exerted on CHIKV during acute and chronic infection.

The host pressures that selected for the adaptive mutations in AF6811P2 are unknown. Initial studies show that AF15561 containing the mouse adaptive mutations replicates similarly in cell culture (data not shown) suggesting this virus may overcome a host restriction factor. Rag1-/- mice are able to restrict CHIKV replication in the absence of adaptive immune responses (157, 168), likely through the type I IFN response. Mice deficient in the type I IFN response rapidly succumb to CHIKV infection within days post infection (156, 165, 172), demonstrating an essential requirement of this response to control early CHIKV replication. Mouse adaptation of the related Semliki Forest virus

(SFV) resulted in a strain of SFV (L10) resistant to control by the type I IFN response

(305). This strain of SFV was generated by serial passage of an avirulent SFV strain in mouse brains, and despite inducing a robust IFN response in infected cells, displays an enhanced ability to overcome the antiviral state conferred by IFN (305). Likewise, adaptation of Ebola virus to mice correlated with mutations in virally encoded antagonists of the host IFN response (306).

Accordingly, an attractive hypothesis is that the increased pathogenicity and replicative capacity of AF6811P2 in mice is due to increased resistance to control by the host type I IFN response. The rapid onset of weight loss, enhanced dissemination and higher viral loads observed in a variety of tissues in AF15561Eβ Kβ00R ΔUTR infected mice at early time points post infection is similar to what has been observed in type I IFN deficient mice infected with clinical isolates of CHIKV (156, 172, 174). Notably, mice with defects in type I IFN responses have significantly increased CHIKV burdens in muscle

99 tissue (156) similar to what I observed in mice infected with AF15561Eβ Kβ00R ΔUTR (Fig 5-

3A and C). Antagonism of IFN induced effector functions likely also exacerbates CHIKV disease as infants and neonatal mice mount a robust type I IFN response following infection yet are unable to control the infection (167). Finally, cellular tropism of the virus may significantly influence the IFN response to alphavirus infection as seen in comparative studies of EEEV and VEEV infection in mice (18). EEEV is restricted in its ability to replicate in monocytes and dendritic cells leading to little induction of type I IFN prior to death of the animal (18). In contrast, VEEV replicates robustly in these cell types and induces a significant type I IFN response (18). Interestingly, the viral determinants of these phenotypes map to the E2 glycoprotein and the 3′ UTR (18, 307). Further studies evaluating the sensitivity of AF15561Eβ Kβ00R ΔUTR to type I IFN, the levels of IFN induced following infection in vivo and the relative virulence of AF15561 containing one or both of the identified mutations in IFN deficient mice may shed light on this hypothesis.

Importantly, the AF6811P2 and AF15561Eβ Kβ00R ΔUTR CHIKV strains retain a musculoskeletal type disease, an important consideration as mouse adaptation can lead to important differences between mouse and human disease (308, 309). The higher viral loads in the quadriceps muscle of AF15561E2 Kβ00R ΔUTR-infected mice may account for the more severe musculoskeletal disease, as musculoskeletal disease in CHIKV- and

RRV-infected mice correlates with increased viral burdens in muscle tissue (172, 186,

310). Even though mice are perfused extensively prior to dissection of tissues, further studies will be needed to determine if the enhanced viral burdens at sites of dissemination are due to enhanced replication within these tissues or if the infectious virus detected in these tissues is the result of the higher viremia in AF15561E2 K200R ΔUTR- infected mice compared to AF15561-infected mice.

100

Our data indicate that the E2 K200R mutation is sufficient to enhance CHIKV pathogenicity in mice. However, the mechanisms by which this mutation influences

CHIKV pathogenesis remain unknown. The CHIKV E2 glycoprotein forms a dimer with the E1 glycoprotein and three dimers form one of the 80 spikes on the surface on the virion (27). E2 is highly exposed on the virion and is responsible for receptor binding while also being the major target of neutralizing antibody responses (201, 215). The E2

K200 residue is highly conserved among strains of all three CHIKV genotypes.

Crystallography of the CHIKV E2 – E1 heterodimer revealed that the E2 K200 residue makes van der Waals contacts with highly conserved E1 residues (C63 and F95) located near or in, respectively, the well conserved E1 fusion loop (27), suggesting that the

K200R mutation may alter E2 – E1 interactions at this site (Fig. 5-5A). The E1 C63 and

F95 residues are conserved even in the distantly related SINV and VEEV, suggesting an important function of these E1 residues. E2 – E1 interactions in related alphaviruses have been shown to regulate pH mediated entry of the virus (33, 311) as during endosomal acidification, the E2 – E1 dimers undergo critical structural rearrangements to facilitate viral entry into the cytoplasm (26, 31). Mutations in E2 can also influence particle assembly and release in a cell- and host- specific manner (312-314), dictate viral tropism and pathogenesis in vivo (260, 294, 296, 315, 316), and play an important role in vector competence (103, 104). Further studies are therefore needed to examine whether the E2 K200R mutation influences CHIKV tropism, pH of fusion, viral assembly and release or another unknown mechanism.

Initial characterization of AF15561 containing the γ′ UTR deletion alone,

AF15561ΔUTR, and the double mutant, AF15561Eβ Kβ00R ΔUTR, suggests that the 44 nt deletion in the 3′ UTR also contributes to enhanced pathogenesis in mice. Sequence analysis of the CHIKV 3′ UTR indicates that it contains many direct repeat elements

101 formed by duplications of multiple elements within the 3′ UTR (74). Asian genotype viruses (e.g., AF15561) encode a highly divergent γ′ UTR compared to the other two

CHIKV genotypes. This divergent 3′ UTR likely formed by a large deletion in the 3′ UTR and subsequent accumulation of adaptive mutations and duplications due to founder effects as the Asian genotype diverged from a founder ECSA genotype (Fig. 5-5B) (74).

Identification of a novel duplication in Asian genotype Caribbean isolates suggests the

Asian 3′ UTR is still under selective pressures (317). Interestingly, the 44 nt deletion identified in AF6811P2 occurs in a region of the γ′ UTR, 3B, that is unique to Asian genotype viruses (Fig. 5-5B). Thus, the fitness increase conferred by the 44 nt deletion in 3B may be constrained to Asian genotype viruses. However, the 3A element, present in all genotypes of CHIKV, contains a homologous region differing by only 1 to 4 nt from the 44 nt deletion in 3B of AF6811P2 (Fig. 5-5B black box). Further studies are therefore needed to determine if the 3B deletion uniquely affects CHIKV fitness or whether manipulation of the 3A element, present in all CHIKV genotypes, can confer a similar fitness increase.

The mechanism by which the 44 nt deletion enhances pathogenesis of CHIKV in mice remains to be determined. The function of the 3′ UTR in alphaviral replication and pathogenesis is largely unknown and alphaviruses exhibit significant heterogeneity and flexibility in their 3′ UTR (5, 9, 10). Modulation of the 3′ UTR often incurs a fitness cost in insect cells or whole insects whereas large deletions are tolerated in mammalian systems (18, 20, 196, 318), suggesting critical roles for the 3′ UTR in mosquito cells.

However, the 3′ UTR is important for stability of the viral genome and likely interacts with host and tissue specific factors to facilitate viral replication (21, 319). Specifically, CHIKV and other alphavirus γ′ UTRs have been shown to interact with host HuR protein thereby protecting the viral RNA from degradation and increasing viral yields (22, 320, 321) and

102 may contribute to the destabilizing of transcripts of important host defense proteins such as Rig-I (321). The viral γ′ UTR also can have profound impacts on viral tropism and host innate immune responses to RNA virus infection. A miRNA binding site in the γ′

UTR of EEEV for a myeloid cell specific miRNA restricts viral replication in myeloid cells thereby delaying induction of the type I interferon response (18). West Nile Virus, a flavivirus, encodes a miRNA in its γ′ UTR that enhances replication in mosquito cells

(322) and an RNA secondary structure in the flavivirus UTRs can also influence viral replication and innate responses to infection (323). Thus, the functions of viral UTRs are diverse and it remains to be determined if the deletion in the γ′ UTR of AF6811P2 alleviates restriction by a host factor, alters interaction with host proteins that facilitate viral replication or modulates some other pathway to enhance viral fitness within the mouse.

The isolation and identification of the mouse-adapted AF6811P2 and identification of the E2 K200R and γ′ UTR deletion represent, to our knowledge, the first identification of a strain of CHIKV that has enhanced fitness in a mammalian host.

Although the data is consistent, further studies are needed to confirm these observations and to evaluate the role of each mutation individually in the enhanced dissemination and viral burdens observed in AF15561Eβ Kβ00R ΔUTR infected mice. This CHIKV isolate and identified mutations present a unique opportunity to study many aspects of CHIKV biology including viral-host interactions, viral protein function and viral evolution within the host. Understanding the mechanisms by which these mutations contribute to enhanced pathogenesis in mice will provide critical insight into restriction factors that control CHIKV infection and the viral mechanisms that counteract these responses.

Finally, identification of a mouse-adapted CHIKV strain that faithfully recapitulates in mice the severe, disseminated musculoskeletal disease reported in humans will also

103 further improve the mouse model towards use in understanding CHIKV pathogenesis in humans and developing novel therapeutics.

104

Table 5-1. Mutations identified in AF6811P2. Mutations identified by both consensus level and deep sequencing. Sequencing results aligned against AF15561 reference genome (Genbank accession no. EF452493).

Nucleotide Genome Mutation (WT > Amino Acid Change (WT > Position Region AF6811P2) AF6811P2) 9140 E2 A > G Lys200Arg 10506 E1 A > T Synonymous 11921 - 11964 3′ UTR Deletion NA

105

Figure 5-1. AF15561 derived from the serum of chronically infected Rag1-/- mice has enhanced pathogenesis in WT mice. (A and B) WT or Rag1-/- mice were inoculated with 103 PFU of AF15561 in the left rear foot pad. Mice were weighed daily (A) and at 28 dpi mice were euthanized and viremia was measured by plaque assay (B). Data in (B) adapted from Chapter IV Figure 4 - 2 and shown here for reference. (C) WT mice were inoculated with 20 μl of serum from individual Rag1-/- mice in (B) or 20 µl of clarified right ankle tissue homogenate containing 10 – 20 PFU into the left rear footpad and weighed daily. A representative weight curve of WT mice inoculated with a similar dose of AF15561 is shown for comparison. (D) WT mice were inoculated with 10 PFU of plaque-purified AF15561 isolates derived from Rag1-/- serum (AF6811P1-3) or AF15561 in the left rear foot pad and weighed daily. (A and B) Data from two independent experiments. P < 0.0001 calculated by Student’s T test with Welch’s correction. (C and D) Data from one experiment.

106

Figure 5-2. Mutations in CHIKV glycoprotein E2 and 3′ UTR enhance pathogenesis in mice. Mutations identified in the E2 gene and the γ′ UTR of AF6811P2 were cloned into the AF15561 cDNA clone. (A and B) WT mice were inoculated with 103 PFU of AF15561 (black squares), AF6811P2 (blue circles) or AF15561Eβ Kβ00R ΔUTR (purple triangles) in the left rear footpad and weighed daily (A) and scored for clinical disease (B). Data from one experiment with 4 mice per group. One mouse each from the AF6811P2 and AF15561Eβ Kβ00R ΔUTR group succumbed at day 10 and 9, respectively.

107

Figure 5-3. AF15561E2 K200R ΔUTR has enhanced dissemination and increased viral burdens in mice. WT mice were inoculated with 103 PFU of either AF15561 (black squares) or AF15561Eβ Kβ00R ΔUTR (blue circles) in the left rear footpad. At 1 dpi (A and B) or 3 dpi (C and D) mice were euthanized and infectious virus in the indicated tissues was measured by focus forming assay. Number of foci per gram of tissue (A and C) or ml of serum (B and D) are reported. Data from one experiment with 5 mice per group per time point. Dashed line indicates limit of detection. P values were determined by unpaired Student’s tests. *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****, P < 0.0001.

108

Figure 5-4. Mutations in CHIKV E2 and 3′ UTR contribute to enhanced pathogenesis in mice. WT mice were inoculated with 103 PFU of the indicated viruses in the left rear footpad and weighed daily (A) and scored for clinical disease (B). Data are from one experiment with 4 mice per group.

109

Figure 5-5. Mouse adaptive mutations are located in E2 and the 3′ untranslated region

110

Figure 5-5. Mouse adaptive mutations are located in E2 and the 3′ untranslated region. (A) The location of the E2 K200 residue on the chikungunya virus E2/E1 dimer is shown. E2 domain A (blue), E2 domain B (orange), E2 domain C (red). E2 residue K200 located in domain B is colored yellow. E1 is colored gray except for the E1 fusion loop which is colored magenta. The E1 residues that make van der Waal’s contacts with the E2 K200 residue (E1 C63 and E1 F95) are colored cyan. (PDB: 3N42 Voss et al. 2010). (B) The γ′ UTRs of CHIKV isolates from the three CHIKV genotypes and the mouse- adapted AF6811P2 were aligned. Direct repeat (DR) elements were annotated according to Chen et al. 2013. (74). DR 1 elements are yellow. DR 2 elements are blue. DR 3 elements are red. The 19 nt conserved sequence element preceding the poly-A tail is brown. West African (WA) genotype represented by CHIKV strain 37997 (Genbank accession no. AY726732). East Central South African (ECSA) genotype represented by CHIKV strain SL15649 (Genbank accession no. GU189061). Asian genotype represented by AF15561 (Genbank accession no. EF452493). The 44 nt deletion in DR element 3B of AF6811P2 is indicated by the cyan annotation. A region with high sequence identity to the 44 nt deletion that is present in repeat element 3A is shown in the black box. Sequence alignments performed in Geneious software (Biomatters).

111

CHAPTER VI

DISCUSSION

Project Rationale

It is clear from clinical reports that CHIKV infection of humans often results in long-term inflammation and pain in musculoskeletal tissues, particularly joints and tendons, that can impose significant health burdens on the patient. However, our understanding of this phase of CHIKV disease is critically absent. Although evidence for

CHIKV infection inducing an autoimmune inflammatory disease is lacking, a building body of evidence indicates that CHIKV and related alphaviruses establish long-term persistent infections within immunocompetent hosts. However, CHIKV infection induces rapid and robust antiviral immune responses; thus, it is unclear how CHIKV evades these responses to establish and maintain persistence. In the absence of a better understanding of CHIKV persistence and chronic disease pathogenesis, development of therapeutics to prevent or ameliorate chronic CHIKV disease is difficult.

To address these questions, my thesis work utilized a mouse model of CHIKV infection that recapitulates many aspects of acute CHIKV disease reported in humans

(158). I found that CHIKV infection of mice results in persistent infection in lymphoid and joint-associated tissue for weeks post-infection. Persistence of CHIKV in joint-associated tissue was associated with chronic pathology, including synovitis. Studies suggest that

CHIKV and related alphaviral infections induce robust adaptive immune response and that these responses have protective and pathogenic roles. To investigate the role of adaptive immune responses in chronic CHIKV infection and disease, I evaluated viral persistence and acute and chronic joint pathology in WT mice and Rag1-/- mice, which lack mature T and B cells. I found that although adaptive immune responses may contribute to acute pathology, immune deficient mice had exacerbated chronic pathology

112 and elevated viral burdens in a variety tissues. These data suggest that adaptive immune responses are necessary to limit viral persistence and reduce chronic joint pathology.

Much of our knowledge of clinical CHIKV disease comes from the large scale

Indian Ocean outbreaks of CHIKV that were caused by an ECSA genotype virus.

Consequently, it is unknown whether the outbreak in the Americas, caused by an Asian genotype virus, will have similar clinical outcomes. Limited studies suggest that Asian genotype viruses may be less inflammatory than ECSA genotype viruses suggesting there may be important differences between the CHIKV genotypes. However, little is known about whether there exist differences in the ability to establish persistence between the CHIKV genotypes. Therefore, I screened a panel of CHIKV strains representing all described CHIKV genotypes and found that all WT strains were able to establish a persistent infection in murine joint-associated tissue. In contrast, CHIKV vaccine strain 181/25, despite initially replicating to high titers, was cleared from sites of dissemination at later time points. CHIKV strain 181/25 was derived by serial passage in tissue culture of the parental CHIKV strain AF15561 and the two viruses differ at only five amino acid positions across the genome. Comparative studies between these two genetically similar strains of CHIKV revealed a critical role of antibody in control and clearance of 181/25 infection Furthermore, these studies revealed that a highly conserved glycine at position 82 in the E2 glycoprotein of AF15561 (and all other WT

CHIKV strains) facilitated evasion of a key class of neutralizing antibodies directed against the B domain of the E2 glycoprotein.

Lastly, to address the hypothesis that persistence of CHIKV is associated with accumulation of adaptive mutations in the viral genome, I isolated and characterized a strain of CHIKV from the serum of a persistently-infected Rag1-/- mouse. Sequencing of

113 this isolate revealed polymorphisms in the E2 gene and the γ′ UTR. Cumulatively, these findings improve our knowledge of CHIKV pathogenesis while also providing a foundation for exploration of critical host restriction factors and viral virulence determinants.

Chikungunya Virus Can Establish a Persistent Infection in Mice

The recent large scale epidemics of CHIKV have confirmed that a common clinical outcome of CHIKV infection is protracted, often debilitating, musculoskeletal disease signs and symptoms lasting for months to years after infection (228). Infection with related arthritogenic alphaviruses causes similar chronic disease signs and symptoms, suggesting that protracted musculoskeletal disease is a common clinical feature of infection with this group of alphaviruses (125). Patients exhibiting chronic symptoms often have swelling, redness, radiographical evidence of inflammatory joint lesions (117, 138) and elevated levels of pro-inflammatory cytokines in the circulation and the joint (170), suggesting an ongoing inflammatory immunopathology. However, despite the large scale epidemics of CHIKV and vast numbers of patients experiencing chronic disease complications, the cause of these disease signs and symptoms remains unknown. Limited data from patients suggests that chronic CHIKV disease may be associated with viral persistence (170, 250, 257). Compounding this issue are data demonstrating protective and pathogenic host immune responses to the infection (172,

191, 200, 201, 204), suggesting there may also be important host factors that contribute to the development of chronic disease. Thus, further studies are needed to understand if indeed CHIKV establishes persistent infections, the role of persistent infection in chronic disease, the role of adaptive immune responses in controlling persistent infection and the development of chronic disease, and how CHIKV evades host immune responses to establish and maintain persistence.

114

CHIKV infection of WT mice recapitulates many aspects of acute disease in humans including viremia, arthritis, myositis and tenosynovitis (158). In the first aim of this thesis, described in Chapter III, I sought to expand on these findings by evaluating the clearance kinetics of CHIKV infection in specific tissues, the resolution (or not) of histopathological lesions in musculoskeletal tissues, and the host immune responses that contribute to control of the infection. At 3 dpi with a clinical isolate of CHIKV, WT mice had high viral burdens in musculoskeletal tissues with the highest viral burdens detected in ankle-associated tissue and skeletal muscle tissue. These data are consistent with other reports indicating a strong tropism of the virus for musculoskeletal tissue in vivo, including humans (153, 159), and suggest that the excruciating joint pain reported by CHIKV-infected patients may be due to direct viral infection of these tissues

(107). CHIKV was also detected in the liver and lymphoid tissue of WT mice, consistent with other reports in mice and NHPs (153, 159). At later time points (e.g., 14 and 21 dpi)

CHIKV RNA was effectively cleared from most tissues evaluated. However, the amount of CHIKV RNA in joint-associated tissue declined until about 4 wpi at which point it established a set point and remained detectable at consistent levels for 16 wpi. The spleen also had detectable viral RNA in a subset of animals at 4 wpi (6 of 11 mice positive) and 6 wpi (3 of 7 mice positive). These data demonstrated that although CHIKV infected a variety of tissues at early time points, the virus uniquely persisted in joint- associated tissue and lymphoid tissue of mice. Furthermore, histopathological analysis of joint tissue from CHIKV-infected mice revealed that the persistence of viral RNA in this tissue was associated with synovitis, tendonitis and necrosis, supporting the hypothesis that persistent viral infection contributes to chronic CHIKV disease.

These data are consistent with other experimental infections of animals. For example, in a follow-up study to my work, CHIKV-infected WT mice were shown to have

115 viral burdens in a variety of tissues at early time points but CHIKV persisted within joint tissue of mice for at least 100 dpi (159, 168). In NHPs, CHIKV RNA, antigen and infectious virus were found to persist in joint, liver and lymphoid tissue (153-155).

Cumulatively, these data suggest that CHIKV can establish long-term persistence in joint tissue. Viral persistence in joint-associated tissue may account for the protracted joint disease signs and symptoms reported by CHIKV-infected patients. Furthermore, CHIKV may be able to establish persistence at other sites such as the liver and spleen (153) although the consequences of viral persistence in these tissues remains to be determined.

Among alphaviruses, long-term viral persistence is not unique to CHIKV.

Infection with the related RRV, MAYV and SINV results in similar protracted disease signs and symptoms for months to years following infection (124, 126, 136, 189, 223-

225) and RRV RNA was found in synovial biopsies of symptomatic patients weeks post- infection (250). Similar to my findings in mice, infection of WT C57BL/6 mice with MAYV results in long-term persistence of MAYV RNA specifically in joint-associated tissues of the ankles and wrists (Michael Diamond, personnel communication). RRV-infected WT mice had high levels of viral RNA in quadriceps muscle and ankle tissue for at least 21 dpi (203), and I have consistently detected RRV RNA in joint tissue of WT mice at 28 dpi

(data not shown), suggesting that RRV establishes persistence within joint tissue similar to CHIKV and MAYV. The finding that RRV may persist long term in muscle tissue is in contrast with my findings in CHIKV-infected WT C57BL/6 mice, but is consistent with the finding of persistent CHIKV antigen in a muscle biopsy from a CHIKV-infected patient three months post-infection (257). Furthermore, the prototypic alphavirus SINV has been studied for its ability to persist in the CNS of infected mice. WT BALB/c mice infected with SINV showed detectable viral RNA in the CNS of mice until 3 months post-infection

116 and viral RNA was still detectable 17 months post infection (275). Similarly, another study reported that SINV-infected BALB/c mice remained positive for viral RNA for at least 6 months post infection (279). These data suggest that persistence of alphaviruses may be a common outcome of infection and that alphaviruses may be uniquely poised to adopt persistent replication in vivo.

Persistence of CHIKV adds to a growing appreciation that infections with viruses typically considered to cause an acute disease may indeed establish persistent infections. Rubella virus, a virus in the Togaviridae family, has been shown to establish persistence in the periphery and synovium of children and periphery of adults with rubella-associated arthritis (324, 325). In addition, rubella virus was found to persist for three years in the eye of a patient who acquired rubella prior to birth (326). The recent large outbreak of Ebola virus, a negative-sense RNA filovirus, in West Africa revealed that Ebola virus may persist for months in the eyes and semen of survivors (327-329). In fact, 26% of male survivors remained RT-PCR positive for Ebola in their semen 9 months post infection (330). Coxsackie B viruses, a group of positive-sense RNA enteroviruses, can establish persistence in heart muscle tissue with serious clinical consequences (331-333). West Nile Virus (WNV), a positive-sense RNA flavivirus has been found in urine samples of human patients years after infection (334) and was found to persist in several tissues of a subset of mice for months post infection (335). Zika virus (ZIKV), another flavivirus, has been found to persist in semen for up to 80 days post infection (336) and sexual transmission of ZIKV is possible one month after infection (337). Parvovirus B19, a small ssDNA virus, can establish persistent infections in a variety of tissue and is associated with chronic arthritis (338). Cumulatively, viral persistence following acute infection may be an underappreciated outcome with clinical

117 consequences and the diverse pathogens able to persist within the host suggest they may utilize a variety of strategies to establish and maintain persistence.

Host Immune Responses Control Persistent Chikungunya Infection

A consistent risk factor for the development of chronic CHIKV disease is old age

(170, 208, 227, 232-234, 239) suggesting that age-related declines in adaptive immunity may contribute to CHIKV persistence and chronic disease (154, 339). Furthermore, chronic CHIKV disease is routinely reported in patients in the absence of rheumatoid factor or anti-citrullinated peptide antibodies (112, 170, 209, 252-255), arguing against development of a classical rheumatoid arthritis pathology (256). Lastly, patients who develop an early neutralizing antibody response following CHIKV infection were protected from chronic disease (213). My findings expand on these reports and further suggest that adaptive immune responses protect from chronic CHIKV infection and disease signs.

I found that CHIKV-infected Rag1-/- mice, lacking mature B and T cell responses, had significantly higher viral RNA burdens in the ankles at early and late time points compared with WT mice. At 4 and 6 wpi in the right ankle, Rag1-/- mice had >10-fold higher viral RNA burdens than CHIKV-infected WT mice, indicating that adaptive immune responses contribute to control of infection in this tissue. Furthermore, Rag1-/- mice had detectable viral RNA in the quadriceps muscle at 4 wpi whereas in WT mice

CHIKV RNA was cleared from these tissues by 2 wpi. In addition, I have been able to consistently isolate infectious CHIKV from the serum and joint-associated tissue of

Rag1-/- mice for at least 12 wpi and 6 wpi, respectively. These data suggest that although CHIKV RNA is able to persist within joint-associated tissue for weeks post infection, adaptive immune responses effectively clear CHIKV from a variety of tissues and restrict CHIKV in joint-associated tissue during persistence. Interestingly, CHIKV-

118 infected Rag1-/- mice had undetectable levels of viral RNA in the spleen after 7 dpi, in contrast to CHIKV-infected WT mice which had detectable viral RNA out to at least 6 wpi, potentially suggesting a cellular reservoir of persistence is absent in the altered lymphoid tissue of mice deficient in mature B and T lymphocytes (340).

Histopathological analysis of joint tissue showed that at early time points, in comparison to WT mice, Rag1-/- mice had reduced signs of synovitis, arthritis and muscle inflammation, suggesting that adaptive immune responses may contribute to pathology at early time points. In addition, I have observed reduced footpad swelling in

CHIKV-infected Rag1-/- mice compared to WT mice (data not shown) that is consistent with other reports in Rag2-/- mice (204). CHIKV-infected mice deficient in CD4+ T cells had reduced footpad swelling and joint pathology (204) suggesting CD4 T cells may contribute to tissue damage. However, at later time points, the elevated viral burden in joint-associated tissue of CHIKV-infected Rag1-/- mice was associated with more severe tissue pathology compared to WT mice. Rag1-/- mice had higher incidences of arthritis, muscle inflammation, muscle necrosis and tendonitis suggesting that adaptive immune responses were necessary to limit chronic joint pathology.

My data are consistent with other reports that adaptive immunity is critical for limiting acute CHIKV infection and expand these findings to demonstrate that adaptive immune responses are critical for limiting CHIKV persistence and chronic pathology.

Similar to my findings, CHIKV-infected Rag1-/- or Rag2-/- mice have been found to support persistent viremia for weeks post infection (168, 201). Humoral immune responses are likely critical for control of viremia. I have found that the decline in viremia in WT mice is coincident with early CHIKV-specific IgM and IgG responses and in addition to Rag1-/- or Rag2-/- deficient mice, μMT mice, which lack mature B cells, support persistent viremia for weeks post infection (168, 201). In addition to persistent viremia,

119

CHIKV-infected μMT mice have significantly increased acute footpad swelling compared to WT mice (168, 201). RRV-infected Tlr7-/- mice or CHIKV-infected Tlr3-/- mice have diminished neutralizing antibody responses and exacerbated acute disease (217, 218) suggesting that antibody may be required to limit acute pathology although further studies are needed as these mice are deficient in critical innate immune signaling pathways. T cell responses also appear to contribute to control of viremia, as CHIKV- infected µMT mice had significantly lower viremia compare with CHIKV-infected Rag1-/- mice (168). These data are supported by my findings in which CHIKV-infected μMT mice had lower viremia at 28 dpi than CHIKV-infected Rag1-/- mice (data not shown).

Furthermore, in a preliminary experiment, adoptive transfer of T cells was sufficient to clear infectious virus from the serum of CHIKV-infected Rag1-/- mice (data not shown).

Antibody and T cell responses to CHIKV are sustained long term in mice and humans after CHIKV infection (201, 205, 233) raising the question of why these sustained responses are ineffective at clearing CHIKV from sites of persistence.

Although not described for CHIKV, chronic infection with several other human pathogens involves progressive immune dysfunction. Sustained type I IFN signaling, as observed in tissues persistently infected with CHIKV (168), may suppress T cell responses (341,

342). LCMV sustains chronic viral infection due to T cell exhaustion (303, 343) and suppression of antibody affinity maturation (344). Similarly, persistence of Hepatitis B and C viruses is associated with T cell exhaustion (345, 346). Furthermore, antibody effector functions can become impaired during chronic infection (347, 348) preventing antibody-mediated viral clearance from tissues. Investigation into whether these pathways contribute to CHIKV persistence and chronic disease is warranted as therapies that restore proper immunological function may be effective in resolving chronic viral infections (349).

120

Lastly, my data showing that pathogenic strains of CHIKV evade humoral immune responses to establish persistence, discussed later in this chapter, demonstrate that there exist important viral determinants that facilitate evasion of adaptive immune responses. Cumulatively, my data support a role for adaptive immune responses in controlling persistent CHIKV infection and suggest that therapies that engage adaptive immune response during acute infection or stimulate adaptive immune responses during chronic infection may be beneficial in resolving the disease signs and symptoms observed during chronic CHIKV disease.

Joint and Lymphoid Tissue as Sites of Chikungunya Virus Persistence

My findings that adaptive immune responses are necessary and effective in clearing CHIKV from a variety of tissues suggest that there exist tissue specific factors that facilitate persistence of CHIKV in lymphoid and joint-associated tissue of WT mice.

Long term persistence of viruses in immunoprivileged sites such as Zika in semen (336),

Ebola virus in the eyes and semen of survivors (327-329) and SINV in the CNS of mice

(275) suggest that CHIKV persistence could involve an immunoprivileged niche.

However, it seems unlikely that the joint tissue as a whole is a site of immunoprivilege. During acute infection with CHIKV or RRV, muscle and joint tissue is heavily infiltrated with innate and adaptive immune cells (159, 161, 169). CHIKV antigen was detected in synovial macrophages surrounded by NK and CD4 T cells in a human synovial biopsy sample collected from a patient with chronic CHIKV disease (170).

Likewise, CHIKV antigen was detected in muscle tissue of a patient that was also heavily infiltrated with T cells (257). Whether B cells and/or antibody infiltrate joint tissues during CHIKV infection is unclear, however in rheumatoid arthritis antibody secreting plasma cells and pathogenic antibodies are readily found in synovial tissue, suggesting that the joint is not privileged from the antibody response (350). Furthermore,

121 my work and work in NHPs has shown that CHIKV can persist long term in lymphoid tissue (153, 157), a tissue with pervasive immune surveillance. Cumulatively these data would suggest that CHIKV can persist in tissues that are well surveilled by host adaptive immune responses.

Nevertheless, CHIKV and RRV in joint-associated tissues is likely sheltered from immune mediated clearance. Although type I IFN responses are induced and sustained within joint-associated tissue of CHIKV-infected mice (168, 241), a variant of RRV that replicates to lower levels in muscle tissue due to enhanced susceptibility to type I IFN responses replicates similarly to WT RRV in joint-associated tissue (186), suggesting that type I IFN responses are active within joint-associated tissue but may exert limited control on CHIKV. Furthermore, CHIKV in the joint-associated tissue is resistant to adaptive immunity. My findings demonstrate that adaptive immune responses effectively clear CHIKV from muscle tissue and the circulation but are unable to clear CHIKV from joint-associated tissue. Specifically, CHIKV and RRV in these tissues may be resistant to both humoral and cell-mediated responses. I found that therapeutic administration of neutralizing MAbs at day +21 and +25 effectively cleared CHIKV from the serum but only had a modest effect on CHIKV persisting in joint associated tissue of CHIKV-infected

Rag1-/- mice. Likewise, RRV-infected mice deficient in CD8 T cells had significantly elevated viral loads in muscle tissue but not joint-associated tissue (203) suggesting

CD8 T cells have limited efficacy in this tissue.

The cellular tropism of CHIKV infection in joint-associated and lymphoid tissue during the persistent phase is not known, and studies of CHIKV and other human pathogens suggest that cellular niches within joint and lymphoid tissue may have altered immune signaling or immunosuppressive microenvironments. Harvesting of joint- associated tissue for quantification of viral RNA by my methods includes the joint,

122 tendons, muscle, ligaments and bone marrow proximal to the joint. Therefore, the precise location of the CHIKV RNA within these tissues is unknown. Within the bone marrow there exist immunoprivileged niches such as the hematopoietic stem cell niche

(351). Mesenchymal stem cells (MSCs) form an important component of this niche (352) and can actively suppress local immune responses including suppressing CD4 and CD8

T cell proliferation, suppressing natural killer T cells, suppressing NK cells and interfering with dendritic cell maturation (353, 354). In addition to the bone marrow, cells with MSC characteristics are found in a multitude of tissues including the spleen (355) and MSCs have been found to infiltrate joint tissue following injury (356) although it has yet to be shown if these cell types infiltrate joint tissue following CHIKV infection.

Similarly, macrophages may be a site of CHIKV persistence (153, 170), are a major component of the inflammatory infiltrate of joints following CHIKV or RRV infection

(161, 191), can exhibit altered innate immune signaling either intrinsically (357) or upon viral infection (358, 359) and actively suppress antiviral T cell responses (200). Follicular dendritic cells are present in the spleen and lymphoid tissue (360), have been identified in the synovium of RA patients (361, 362) and can shelter viral pathogens such as HIV in a non-replicative state for months (363). Follicular dendritic cells can even convert antibody neutralized HIV into infectious forms (364) suggesting viral pathogens can escape neutralizing antibody responses in this cell type. Furthermore, persistence of parvovirus B19, a small DNA virus, in the synovium and bone marrow of patients with rheumatoid arthritis (338), rubella virus in the synovium of patients with rubella- associated arthritis (325) and persistence of the bacteria Borrelia burgdorferi, the causative agent of Lyme’s disease, in joint tissue of mice (365) suggests that joints and associated tissue may contain cell types with altered immune signaling or

123 immunosuppressive microenvironments that support long term persistence of a variety of pathogens.

Collectively, these data demonstrate that cellular niches within the sites of CHIKV persistence can have important immunological features and accordingly, a more refined understanding of the cellular tropism of CHIKV during persistence in joint-associated and lymphoid tissues is needed. These findings would be of importance not just for CHIKV pathogenesis but would also further our understanding of viral persistence in general, inflammatory joint disorders and novel immunological niches within otherwise immunologically surveilled tissues. These findings would also inform directed therapeutic techniques to ameliorate the symptoms of chronic CHIKV disease and/or resolve the chronic infection.

Chikungunya Virus Strain 181/25 has Enhanced Susceptibility to

Adaptive Immune Responses

Prior to the work described in this thesis, viral determinants that facilitate persistence of CHIKV were unknown. Viruses that establish persistent infections utilize several strategies to avoid clearance including latency (366), immunosuppression (303), infection of immune privileged niches (275, 328) and escape of neutralizing immune responses (344, 367, 368) and therefore persistence of CHIKV in vivo may require one or more of these strategies to avoid clearance by adaptive immune responses. To facilitate investigation of these hypotheses in the context of CHIKV infection and persistence, I sought to identify a strain of CHIKV unable to establish persistence.

Comparative studies between a persistent and non-persistent strain of CHIKV would allow for identification of successful immune responses and the viral mechanisms necessary to counteract these responses and establish persistence.

124

CHIKV live-attenuated vaccine strain 181/25 is attenuated for acute disease

(142, 144) and I hypothesized 181/25 may be attenuated for persistence. Indeed, when I evaluated the live-attenuated vaccine strain 181/25, I found that WT mice infected with

CHIKV strain 181/25 had significantly reduced viral burdens in joint-associated tissue distal to the site of inoculation with 7 of 8 mice having viral RNA in the right ankle below the limit of detection of our qRT-PCR assay at 28 dpi. This was in contrast to WT mice infected with the parental, pathogenic strain AF15561 which had significant viral burdens at 28 dpi in this tissue. Further analysis revealed that although mice infected with CHIKV strain 181/25 had significantly diminished viral burdens compared to AF15561-infected mice in the right ankle at 3 dpi, by 7 and 14 dpi 181/25-infected mice had similar levels of viral RNA as AF15561-infected mice. However, beginning by 21 dpi 181/25 was cleared from this tissue. In contrast, AF15561-infected mice established a persistent infection similar to what I observed in mice infected with CHIKV strain SL15649.

Cumulatively, these data indicated that although CHIKV strain 181/25 replicated efficiently at sites of dissemination at early time points, it was cleared from these sites by

3 to 4 weeks post infection.

CHIKV strain 181/25 was developed as a live-attenuated vaccine candidate by serial passage of the parental AF15561 strain in MRC-5 cells (142). Initial characterization of 181/25 demonstrated it had reduced virulence in neonatal mice, reduced or absent viremia when inoculated into NHPs and could induce protective responses against lethal CHIKV challenge (142). 181/25 reached phase II clinical trials where although immunogenic, it was found to cause transient arthralgia in some volunteers and further development was abandoned (143). Although development of

181/25 for use as a vaccine was abandoned, further studies continued to evaluate the mechanisms of attenuation. Comparative sequence analysis of AF15561 and 181/25

125 revealed 5 non-synonymous changes in the viral genome. One in the nsP1 protein

(nsP1 T301I), two in the E2 glycoprotein (E2 T12I and E2 G82R), one in the 6k accessory protein (6k C42F) and one in the E1 glycoprotein (E1 A404V) (144) (Fig 4-1).

In studies performed in mice, attenuation of CHIKV strain 181/25 for acute disease was found to be due to just the two mutations in E2, E2 T12I and E2 G82R, likely explaining the insufficient attenuation observed in human clinical trials (144).

Tissue culture adaptation of alphaviruses typically results in accumulation of mutations that enhance interactions with glycosaminoglycans (GAGs) such as heparan sulfate (294, 369). Interactions with GAGs likely attenuate alphaviruses in vivo by limiting dissemination and viremia (370), although these interactions can conversely enhance neurovirulence when virus is inoculated directly into the brain (296, 371). In CHIKV strain

181/25, GAG binding is conferred by the E2 G82R mutation (25) and limits viremia and the kinetics of viral dissemination (260, 294).

However, whether GAG binding is sufficient to attenuate CHIKV in vivo is unclear. CHIKV with an E2 R82 residue, conferring GAG binding, was found to replicate to similar titers in joint and muscle tissue at 1 dpi in WT mice and replicated to significantly higher titers in skeletal muscle tissue at 5 dpi (260). Likewise, WT CHIKV or

CHIKV containing an E2 R82 residue or novel mutations that conferred GAG-binding replicated to similar titers in joint-associated and skeletal muscle tissue at 2 dpi (294).

Although I found that at 3 dpi 181/25-infected WT mice had significantly reduced viral

RNA in the right ankle tissue, by 7 dpi these mice had similar levels of viral RNA to

AF15561-infected WT mice suggesting viruses with an E2 R82 residue replicate efficiently in joint-associated tissue. Similarly, I found that 181/25-infected Rag1-/- mice had significantly higher levels of infectious virus in ankle tissue than AF15561-infected

Rag1-/- mice. Persistence of 181/25 in joint-associated tissue of Rag1-/- was also not

126 associated with accumulation of compensatory mutations that altered its phenotype from that of stock 181/25 when inoculated into WT mice suggesting an E2 R82 residue is not selected against in joint-associated tissue. These data support the hypothesis that an E2

R82 residue and as a corollary, GAG binding, does not attenuate CHIKV replication in musculoskeletal tissue.

In contrast, dissemination of CHIKV containing an E2 R82 residue to lymphoid tissue is severely restricted (260, 294) suggesting that this residue may influence pathogenesis by altering host – viral interactions in lymphoid tissue and subsequently altering early immune responses. Indeed, I found that mice infected with AF15561 had significantly more IgM and IgG at early time points demonstrating that early adaptive immune responses to CHIKV strains containing an E2 G82 or E2 R82 residue are distinct. Furthermore, my data indicate that CHIKV strains with an R at E2 82 are more sensitive to neutralization by antibody suggesting that these strains may be more sensitive to early control by natural antibody (201). Lastly, full attenuation of pathogenic

CHIKV isolates required both the E2 T12I and E2 G82R mutations (144). My data similarly demonstrated that restoration of persistence of CHIKV strain 181/25 to that of parental strain AF15561 required reversion of both E2 position 12 and E2 position 82 to

WT codons. Together this suggests that full attenuation of 181/25 likely requires mechanisms in addition to those influenced by the residue at E2 position 82. Therefore, further studies are needed to determine if early immune responses to CHIKV containing

E2 G82 or R82 residues are distinct and if these distinct early responses contribute to the attenuation of CHIKV in vivo.

These data, in addition to my findings that CHIKV strain 181/25 was cleared from joint-associated tissue beginning at 21 dpi led me to hypothesize that 181/25 infection was more susceptible to B and T cell-mediated clearance mechanisms. To test this

127 hypothesis, I infected Rag1-/- mice with AF15561 or 181/25 and found that in contrast to infection of WT mice, infection of Rag1-/- mice with 181/25 resulted in viral persistence in the right ankle tissue. Notably, the levels of viral RNA in the right ankle tissue of 181/25- infected Rag1-/- mice was similar to that of AF15561-infected Rag1-/- mice, suggesting that in the absence of adaptive immunity 181/25 can establish a persistent infection.

Furthermore, quantification of infectious virus in the right ankle at late times post- inoculation demonstrated that 181/25-infected Rag1-/- mice had significantly higher viral loads than AF15561-infected Rag1-/- mice. AF15561- or 181/25-infected Rag1-/- mice also had persistent viremia, supporting the role of T and B cell responses in the clearance of CHIKV from the blood. Supporting the role of GAG binding in limiting

CHIKV viremia, quantification of viral loads in 181/25-infected Rag1-/- mice showed that although viral loads at 3 dpi were elevated compared to 181/25-infected WT mice, they were still significantly reduced compared to AF15561-infected Rag1-/- mice at 3 dpi.

Nevertheless, these data suggest that in the absence of adaptive immune responses

CHIKV strains AF15561 and 181/25 have a similar capacity to establish persistence in joint-associated tissue.

More specifically, I hypothesized that B cells and CHIKV-specific antibody attenuate 181/25 for persistence, as CHIKV-infection induces a rapid and robust antibody response (201), early induction of neutralizing antibodies correlate with protection from persistent disease in humans (213), and the attenuating mutations are located in E2, a dominant target of neutralizing antibody responses (212). To investigate this hypothesis, I inoculated WT or B-cell deficient μMT mice with AF15561 or 181/β5 and evaluated viral persistence at 28 dpi. Similar to what was observed with 181/25- infected Rag1-/- mice, I found that 181/25-infected μMT had high viral burdens in the right ankle at 28 dpi. Furthermore, the viral burdens in 181/25-infected µMT mice were similar

128 to the viral burdens in AF15561-infected µMT mice suggesting that in the absence of B cell responses, 181/25 is able to establish a persistent infection similar to that of

AF15561. These findings were recapitulated in 181/25-infected MD4tr mice, which while possessing mature B cells, express a B cell receptor against the irrelevant antigen hen- egg lysozyme. Together these data suggested that in the absence of adaptive immune responses, specifically B cells and CHIKV-specific antibody 181/25 could establish persistence in joint-associated tissue.

Chikungunya Virus Evades B Cell Responses to Establish Persistence

My findings raised the question that if antibody was required to control and clear

181/25, why did they not similarly control AF15561 infection? A potential explanation is that AF15561 or 181/25 infection induce distinct antibody responses. Indeed, the magnitude of early neutralizing antibody responses correlate with asymptomatic CHIKV infections (298) and early appearance of neutralizing antibody to CHIKV infection correlate with protection from chronic CHIKV disease (213). Furthermore, diminished neutralizing antibody responses in mice can exacerbate acute RRV or CHIKV infection

(217, 218). These data suggest that early antibody responses, particularly the neutralization capacity of the antibody response, can be a determinant of the clinical outcome of CHIKV infection.

Additionally, my data suggests that the kinetics of the antibody response may be important. Prophylactic administration of neutralizing MAbs on day -1 and +3 was able to block persistence of CHIKV in the serum and joint tissue of CHIKV-infected Rag1-/- mice.

In contrast, administration of neutralizing MAbs on day +21 and +25 was able to clear

CHIKV from the serum but had a modest effect on viral burdens in joint tissue of CHIKV- infected Rag1-/- mice. Furthermore, in hepatitis C virus (HCV)-infected patients, rapid appearance of neutralizing antibodies was associated with viral clearance and protection

129 from chronic infection (372). Likewise, early IgM responses are necessary to prevent

LCMV persistence (373) and poorly neutralizing antibody responses promote persistent infection with LCMV (344). Lastly, the antibody response against CHIKV likely needs to be sustained to control CHIKV infection, as adoptive transfer of mouse immune serum only transiently suppressed viremia in CHIKV-infected Rag1-/ -mice (168). These data suggest that antibody responses, particularly during the early stages of infection, may be important determinants of the outcome of CHIKV infection.

I therefore analyzed the antibody response in AF15561- or 181/25-infected mice by ELISA to measure induction of CHIKV-specific antibody. Interestingly, I found that

AF15561-infected WT mice had significantly more IgM at 5 and 7 dpi compared to

181/25-infected mice. Similarly, AF15561-infected WT mice had significantly more IgG at

7 dpi than 181/25-infected mice. At 28 dpi, AF15561- or 181/25-infected mice had similar levels of IgG. IgG antibodies exist as different isotypes (IgG1, 2b, 2c and 3 in C57BL/6 mice) with important differences in the Fc portion of the antibody that can give the IgG antibody isotypes distinct Fc effector activities (374). These Fc effector functions may be important for control of infections with CHIKV and other alphaviruses as Fab fragments, antibodies lacking the Fc portion of the antibody, are less protective than administration of whole-antibody in VEEV infection (375) and a monoclonal antibody with a point mutation abolishing Fc interactions was less protective in CHIKV-infected mice (220).

Therefore, I measured the IgG response induced in either AF15561- or 181/25-infected

WT mice at 28 dpi using isotype specific detection antibodies and found that AF15561 and 181/25 induced similar antibody isotypes with IgG2c and 2b being the dominant isotypes induced during both infections. In summary, AF15561-infected mice induced more IgM and IgG at early time points and at later time points the IgG response in

AF15561- and 181/25-infected mice was similar in magnitudes and in isotype profiles.

130

These data were discordant with my data showing that 181/25 was cleared from mice in a B cell and antibody dependent manner.

Although AF15561-infected mice had more virus-specific antibody at early time points, clinical data and data from CHIKV-infected mice suggests that the neutralization capacity of the serum may be important in controlling the infection (213, 218, 298). I therefore used a plaque reduction neutralization test (PRNT) with infectious AF15561 or

181/25 as the challenge virus to measure the neutralization capacity of serum from

AF15561- or 181/25-infected mice. From these analysis, I came to three major conclusions. First, the neutralization capacity against homologous virus of the serum from AF15561-infected mice at 7 dpi was significantly less than the neutralization capacity of serum from 181/25-infected mice. Second, when serum from AF15561- infected mice at 7 dpi was challenged with the heterologous virus, infectious 181/25, serum from AF15561-infected mice showed a significantly reduced neutralization index compared to serum from 181/25-infected mice challenged with 181/25. This demonstrated that although AF15561-infected mice had significantly more IgM and IgG at this time point, it did not translate into a concomitant increase in neutralization capacity and suggests that the early antibody response to AF15561 infection is poorly neutralizing. Furthermore, chemical depletion of IgM in the day 7 serum from AF15561- infected mice abolished neutralization activity (data not shown), suggesting that the early

IgG response induced by AF15561-infection is non-neutralizing. Third, sera from 181/25- infected mice neutralized infectious 181/25 significantly better than it was able to neutralize infectious AF15561. Similarly, sera from AF15561-infected mice neutralized infectious 181/25 significantly better than it was able to neutralize homologous infectious

AF15561. This suggested that AF15561 was resistant to neutralization by antibody potentially through an altered display of neutralizing epitopes on the virion.

131

It was interesting that AF15561 infection induced a robust CHIKV-binding but poorly neutralizing antibody response. In preliminary experiments using flow cytometry, I found that the B cells in the draining popliteal lymph node of AF15561- or 181/25- infected mice are similarly activated (as measured by CD69 expression) at 3 dpi (data not shown). However, activated B cells in AF15561- but not 181/25-infected mice had significantly reduced levels of CD21/35 (complement receptor 2/1) and CD23 on their surface (data not shown). These data suggest that early activated B cells are phenotypically distinct following AF15561 or 181/25 infection (376, 377). Although these phenotypes require further study, differential engagement of innate immune pathways by

AF15561 or 181/25 infection could influence early antibody responses. CHIKV-infected

TLR3 deficient or RRV-infected TLR7 deficient mice have poor quality antibody responses (217, 218), suggesting that innate immune responses can drive the B cell response to CHIKV infection. Furthermore, type I IFN can induce B cells into a semi- activated state, priming them to respond quickly upon B cell receptor signaling (378).

Type I IFN is also required for rapid B cell activation and induction of virus-specific antibody secretion in influenza and vesicular stomatitis virus infection (379, 380).

However, whether AF15561 and 181/25 infection results in differing levels of TLR or type

I IFN signaling remains to be shown. Additionally, lymphoid tissue of AF15561-infected

WT mice had significantly higher viral burdens at early time points compared to 181/25- infected mice (260) potentially influencing B cell responses through direct engagement of TLRs on B cells (381, 382) or induction of a local IFN response.

I only measured CHIKV-specific antibody responses and it is possible that increases in CHIKV-binding antibody in AF15561-infected mice are coincident with polyclonal, antigen non-specific activation of B cells. In my preliminary flow cytometric analysis of B cells in the draining popliteal lymph node, >70% of B cells at 3 dpi were

132

CD69+, suggesting that activation of these B cells was independent of specificity for

CHIKV. Furthermore, studies of infection with other viral pathogens suggest that viruses, through the induction of type I IFN, can induce polyclonal B cell activation. Mice infected with SFV upregulated CD69 on the majority of B and T cells within 24 hpi and this activation was dependent on type I IFN (383). Similar patterns are observed in WNV and influenza infection where >50-70% of B cells in the draining lymph nodes upregulated

CD69 at early time points post-infection in a type I IFN dependent manner (379, 384).

HIV and dengue virus can also activate B cells in a polyclonal manner (385, 386).

Alternatively, LCMV infection of mice can induce polyclonal hypergammaglobulinemia early after infection independent of type I IFN and was instead dependent on CD4 T cell help (387). Therefore, it would be interesting to further evaluate CHIKV-specific and

CHIKV-non-specific antibody responses following CHIKV-infection and to investigate whether the B cells activated early following CHIKV infection differentiate into antibody secreting plasma cells.

My finding that infectious AF15561 was more resistant to neutralization by antibody than 181/25 suggested that AF15561 and 181/25 have an altered display of neutralizing epitopes on the virion, that mutations in E2 between AF15561 and 181/25 directly altered a key neutralizing epitope or that differences in the particle-to-PFU ratio were influencing the ability of these viruses to be neutralized in vitro. To evaluate these hypotheses, I utilized the PRNT assay to map the resistance to neutralizing antibody to the residue at E2 position 82. Viruses containing an E2 G82 residue (AF15561, SL15649 or 181/25E2 R82G) were consistently resistant to neutralization by mouse serum regardless as to whether the serum was from mice infected with an E2 G82 or E2 R82 containing virus. Conversely, viruses containing an E2 R82 (AF15561E2 G82R, SL15649E2 G82R or

181/25) were consistently neutralized more efficiently by mouse serum regardless as to

133 whether the serum was from mice infected with an E2 G82 or E2 R82 containing virus. I also tested the contribution of the E2 T12I mutation and found no significant influence on neutralization (data not shown), suggesting that the residue at E2 position 82 mediated sensitivity to antibody-mediated neutralization. Furthermore, these findings were supported by additional experiments in which I evaluated serum collected from patients infected during the Caribbean CHIKV epidemic or in Sri Lanka for the ability to neutralize

CHIKV containing an E2 G82 (AF15561 or SL15649) or CHIKV containing E2 R82

(AF15561E2 G82R or SL15649E2 G82R). Consistent with my findings using sera from experimentally-infected mice, human sera from geographically diverse CHIKV outbreaks more efficiently neutralized CHIKV containing an E2 R82 residue. Taken together, these data suggest that in humans and mice, neutralization of CHIKV containing an E2 G82 residue is impaired compared to neutralization of CHIKV containing an E2 R82 residue. I therefore hypothesized that the residue at E2 position 82 altered the display of key neutralizing epitopes on viral particles.

To investigate this hypothesis, I utilized a panel of CHIKV-neutralizing mAbs with known binding epitopes to probe the surface of AF15561 and 181/25 in an attempt to identify regions where neutralizing antibody exhibited significant differences in neutralization capacity. Neutralizing antibodies directed against several domains of the virus, E2 domain A, E2 arch region and E1, equivalently neutralized AF15561 and

181/25, suggesting these epitopes were displayed similarly. Furthermore, these findings suggested that AF15561 and 181/25 could be neutralized similarly and that my findings that AF15561 was consistently harder to neutralize by mouse serum was unlikely to be due to confounding differences between AF15561 and 181/25 such as their different particle-to-PFU ratios. However, antibodies directed against E2 domain B were consistently able to neutralize 181/25 more efficiently than AF15561, suggesting that the

134 display of E2 domain B was altered between AF15561 and 181/25. This was an interesting finding as E2 position 82 residue is located in the A domain, well removed from domain B (Fig 4-8). Although the mechanism by which E2 residue 82 influences neutralization by antibodies against E2 domain B remains to be determined, studies investigating how antibodies against E2 domain B neutralize infection provide valuable insight.

E2 domain B is located at the distal end of the E2 glycoprotein (Fig 4-8) and consequently is highly exposed on the virion. Structural studies of the alphavirus E1 and

E2 glycoproteins, including those of CHIKV, revealed that at low pH, E2 domain B becomes disordered and folds away to expose the E1 fusion loop as an initial event in the fusion of the CHIKV membrane with host endosomal membrane (26, 27, 31).

Therefore, E2 domain B is intrinsically flexible and antibody binding to E2 domain B is unlikely to neutralize the virus unless it can interfere with this structural rearrangement.

Multiple studies have identified that interfering with the rearrangement of CHIKV E2 domain B is a common mechanism by which antibodies neutralize infection. CHIKV neutralizing antibody 5F10 binds to E2 domain B and likely due to steric hindrance between multiple bound antibody molecules, locks E2 domain B into a rigid conformation and prevents the necessary rearrangement of E2 domain B during low pH-mediated fusion (35). Monoclonal antibody CHK-152, binds to E2 domain A, B and arch region, and prevents rearrangement of E2 domain B (293). Likewise, human monoclonal antibodies 4J21, which binds E2 domain A and arch region, and 5M16, which binds E2 domain A, B and arch region, also neutralize by stabilizing E2 domain B. Similarly, studies of CHK-265, which showed a 17-fold difference in neutralization between

AF15561 and 181/25, neutralizes infection by binding to E2 domain B and cross-linking it to an adjacent trimeric spike (Fig 4-9) (36). Cumulatively, these findings suggest that

135 multiple epitopes on the virion targeted by antibodies functionally converge to inhibit E2 domain B flexibility and the rearrangements necessary for viral fusion. Furthermore, this common mechanism of neutralization is not limited to CHIKV. E2 domain B is a critical neutralization epitope on the Ross River viral particles and VEE viral particles (388, 389) and neutralizing antibodies against VEEV E2 domain B inhibit infection by interfering with the structural rearrangement of E2 domain B (390). This suggests that host antibody responses to diverse alphavirus infections target similar structural epitopes on the virion and neutralize infection by similar mechanisms.

I observed a 17-fold difference in mAb CHK-265 EC50 values between AF15561 and 181/25 despite E2 G82 (and E2 T12) being well outside the footprint of CHK-265

(36). Similarly, passage of CHIKV containing an E2 R82 residue under selective pressure of an E2 domain B targeting antibody selected for an E2 G82 residue despite

E2 G82 being well removed from the binding footprint of the antibody (35, 295). These data suggest that the introduction of an arginine residue at E2 position 82 introduces large conformational changes of the E2 protein that enhance susceptibility of CHIKV to neutralization by E2 domain B antibodies.

Although the mechanism by which the residue at E2 position 82 influences neutralization of AF15561 and 181/25 by antibody remains to be determined, our data support a model proposed by Porta et al. in which the conformation of the trimeric spike is altered by the residue at E2 position 82 (35). In this model, the introduction of a large, positively-charged arginine at E2 position 82 (E2 R82) introduces repulsive electrostatic forces that “open” the conformation of the spike and place Eβ domain B in close proximity to domains of adjacent trimers. In contrast, CHIKV containing a small, uncharged glycine at E2 position 82 (E2 G8β) adopt a “closed” conformation of the spike that increases the spatial separation between E2 domain B and adjacent spikes (Fig 4-

136

9). This in turn limits the ability of antibody to cross-link E2 domain B and thus, although antibody is able to bind to CHIKV containing an E2 G82, it is unable to impair rearrangement of E2 domain B during fusion (Fig 4-9). Furthermore, the “closed” conformation of the spike in E2 G82 containing viruses likely limits the accessibility of epitopes to antibody and steric hindrance imposed by bound antibody may prevent further binding of antibody necessary for efficient neutralization (35). Comparative cryo-

EM studies of CHIKV and RRV containing mutations affecting the electrostatic potential of the trimeric core, with or without bound antibody, will be needed to empirically determine the effect of introducing charged residues into the core of the trimer.

Although my work has focused on CHIKV, this mechanism may extend to other alphaviruses. Attenuated SINV strain SB-RL is attenuated due to a serine to arginine mutation at E2 position 114 (E2 S114R) (391). This mutation introduces a positively charged amino acid into the core of the trimeric spike and likely confers HS binding to

SINV (391). And although WT SINV and attenuated SB-RL bound similar amounts of neutralizing MAbs R6 and R13, SB-RL was more potently neutralized by these MAbs

(392-394). Interestingly, escape mutations of MAb R13 mapped to the E2 arch domain

(394) suggesting that introduction of positively charged amino acids into the core of the trimer can influence neutralization by antibodies targeting epitopes other than those in

E2 domain B. Furthermore, passage of VEEV vaccine strain TC-83, which contains an

E2 T120K mutation that introduces a large positively charged lysine into the core of the trimeric spike, under selective pressure of a neutralizing antibody selected for escape mutations that abolished positive charged amino acids in the core (E2 delK116) or introduced a negatively charged residue (E2 K115E), potentially compensating for the

T120K mutation (395). This suggests that similar to CHIKV, introduction of positive charges into the core of the VEEV trimeric spike enhances neutralization by antibody.

137

However, this interpretation is confounded as the binding footprint of the antibody selecting for these mutations is located within this region (390). Nevertheless, it remains likely that altering the electrostatic potential of residues within the core of the trimer of other alphaviruses enhances susceptibility to neutralization. In fact, in preliminary experiments, I found that introduction of positively-charged residues into the core of RRV

(E2 S82R and/or E2 Y86R) significantly enhanced neutralization of RRV by mouse immune serum (data not shown). Further studies are needed to evaluate the impact of these mutations on viral persistence in joint tissues of WT and B cell deficient mice.

My work identified several epitopes on the CHIKV virion that are similarly neutralizing between AF15561 and 181/25 (E2 domain A, E2 arch region, E1) suggesting that antibody responses against these epitopes could protect against chronic disease. However, my studies demonstrated that the neutralizing capacity of human and mouse immune serum was significantly reduced by a glycine residue at E2 position 82, suggesting that the neutralizing response in some CHIKV-infected humans and C57BL/6 mice is largely directed against E2 domain B. Indeed, studies with CHIKV in which E2 domain B was replaced by domain B of SFV demonstrated that human and mouse neutralizing antibody responses to CHIKV-infection predominantly target E2 domain B

(215). Thus, it is tempting to speculate that the polyclonal antibody response to CHIKV- infection may consist of few neutralizing clones and/or be limited in breadth. In a study of

MAbs isolated from CHIKV-infected mice, of 230 hybridomas producing CHIKV-binding antibody, 194 (84%) were non-neutralizing. Similarly, in a panel of 30 human hybridomas producing CHIKV-binding antibody 13 (43%) were non-neutralizing (221) with another study reporting 5 of 7 (71%) being non-neutralizing (396). Although these studies are not quantitative nor representative they suggest that neutralizing responses that arise during the endogenous response to CHIKV infection may target a limited set of

138 neutralizing epitopes. Analysis of the antibody epitopes targeted in CHIKV-infected humans, NHPs and mice showed that in addition to antibody against surface exposed epitopes on E2, antibody was directed against epitopes located within the core of the trimeric spike, regions that are likely inaccessible on the intact virion (27), or non- structural proteins (201, 211, 214) suggesting they may be non-neutralizing.

Furthermore, I observed that at early (7 dpi) or late time points (28 dpi) serum from

AF15561-infected mice retained similarly poor neutralization capacity for AF15561. I obtained similar results with serum from AF15561-infected mice 42 dpi (data not shown), demonstrating that the neutralization capacity of serum from AF15561-infected mice did not increase over time. These data are supported by studies in NHPs which demonstrated that the neutralization capacity and epitopes targeted by early (9 dpi) and late (180 dpi) antibody responses to CHIKV infection were similar (211). Likewise, in humans, the epitopes targeted at 2-3 months post infection were similar to the epitopes targeted at 21 months post infection (214). These data suggest that the early neutralizing CHIKV response may be limited in breadth and this response does not appreciably increase in quality or breadth over time. Further studies are therefore needed to understand whether the epitopes targeted in mice infected with either

AF15561 or 181/25 are similar and if the antibody response to either infection undergoes significant maturation in the weeks to months following infection.

My findings demonstrate that one mechanism that contributes to the successful clearance of 181/25 infection is the enhanced susceptibility of the virus to neutralization by antibodies directed against E2 domain B. However, whether other functions of antibodies are necessary to clear 181/25 infection is unknown. Neutralizing and non- neutralizing antibodies can be protective through their engagement of Fc receptors or complement activation (220, 397-400). However, clearance of SINV from the neurons of

139 persistently infected mice was independent of complement or NK cell activity (274) and instead may rely on cross-linking of E2 glycoproteins on the surface of the infected cell

(401).

In contrast, pathogenic strains of CHIKV resist neutralization by this response due to a highly conserved glycine in the E2 glycoprotein and establish a persistent infection within the host. In addition, pathogenic strains of CHIKV induce a rapid CHIKV- binding but poorly neutralizing antibody response suggesting that the quality of the host antibody response is an important determinant of CHIKV infection outcome. Non- neutralizing antibody or sub-neutralizing concentrations can be pathogenic, exemplified by the well-established antibody-dependent-enhancement (ADE) of dengue virus disease (402, 403). Interestingly, I have observed ADE of CHIKV infectivity during my in vitro neutralization assays and ADE has been described for RRV infection of macrophages leading to persistent infection (358) and disrupted antiviral gene expression (359). However, the in vivo relevance of these findings is currently unknown.

Furthermore, non-neutralizing antibodies can interfere with neutralizing antibody responses. Antibodies directed against a non-neutralizing epitope on HCV can interfere with antibodies directed against neutralizing epitopes allowing viral persistence despite circulation of neutralizing antibody (404, 405). Likewise, non-neutralizing antibodies prevent complete neutralization of human cytomegalovirus (406). Thus, it is possible that the early CHIKV-binding but non-neutralizing antibody response induced in AF15561- infected mice may interfere with otherwise effective antibody-mediated control of the virus. Therefore, further studies are needed to understand if the early non-neutralizing antibody response to AF15561 infection contributes to development of persistence.

These findings suggest that screening of the neutralization capacity of human sera during acute infection may provide a valuable prognostic indicator to identify those

140 at risk of developing chronic CHIKV disease. Indeed, patients with a rapid neutralizing antibody response to CHIKV infection are protected from development of chronic disease (213). My findings expand on this observation and suggest that screening of human serum for neutralization against CHIKV possessing an E2 G82 or R82 residue may identify patients whose neutralizing antibody response is directed against protective epitopes and therefore at reduced risk of developing chronic disease. Furthermore, understanding the mechanisms by which CHIKV infection induces a rapid antibody response within days of infection may inform therapeutic strategies seeking to induce rapid antibody responses such as post-exposure prophylaxis or vaccination efforts to contain spread of an outbreak.

Is Persistence of Chikungunya Virus Associated with Adaptive

Mutations in the Virus?

CHIKV, like most RNA viruses, encodes a low-fidelity RNA-dependent RNA- polymerase allowing CHIKV to potentially adapt to selective pressures by acquiring adaptive mutations in its genome. CHIKV encoding a higher-fidelity polymerase is attenuated in vivo for acute disease suggesting that the virus quasispecies and exploration of sequence space is important for acute CHIKV pathogenesis (39). CHIKV strain 181/25 rapidly reverts attenuating mutations in some tissues during acute infection of WT mice, demonstrating that selective pressures can quickly select for CHIKV variants with increased fitness (260). I found that the E1:nsP1 ratio, a marker of active viral replication, declines in response to adaptive immunity, suggesting that CHIKV may subdue its replication to avoid immune surveillance. Although the mechanism by which this occurs is unknown, mutations in the non-structural proteins can alter RNA replication

(43, 50). Additionally, persistence of several viral pathogens is associated with accumulation of adaptive mutations due to host selective pressures. Long-term infection

141 with HIV or HCV is associated with accumulation of escape mutations in antibody and T cell epitopes (299, 300, 407). Viruses can also mutate to exploit novel cellular niches as evidenced by HIV adaptation during chronic infection to use the CxCR4 co-receptor

(301, 408, 409). Similarly, LCMV Clone 13 was isolated from the spleen of a chronically infected mouse (303) and in comparison to parental strain LCMV Armstrong had accumulated mutations that allowed it to infect distinct cell types in lymphoid tissue (410-

412). Persistence of SINV in the CNS of scid mice was associated with mutations in E2 that confer enhanced neurovirulence (304). Contrastingly, persistence of coxsackie B virus in muscle tissue can occur in the absence of mutations (413). Furthermore, although alphavirus replication in mammalian cells is typically cytopathic in vitro, multiple alphaviruses can establish persistent infections of mammalian cells (272, 414-416) typically through acquisition of mutations that alter viral protein nsP2 interactions with the host. These data suggest that alphaviruses accumulate adaptive mutations to facilitate persistent replication in vitro. To date, however, limited studies have evaluated whether persistence of CHIKV in vivo is associated with accumulation of adaptive mutations.

Infectious virus recovered from the sera of CHIKV-infected Rag1-/- mice at 100 dpi and then amplified on C6/36 insect cells revealed few mutations and no overt phenotypic differences compared to WT CHIKV when inoculated into WT mice (168). Likewise, sequencing of CHIKV from the brain and kidneys of CHIKV-infected Rag1-/- mice at 4 to

6 wpi revealed few coding changes, all within the non-structural proteins (297). Thus, whether persistence of CHIKV requires accumulation of adaptive mutations in response to host selective pressures in vivo is unclear.

I performed limited deep sequencing of viral RNA from the ankle tissue of WT mice infected with CHIKV at 42 dpi and found few changes in the viral genome. In two individual mice, I identified two distinct mutations in the nsP4 gene that were present in

142

20-25% of reads, suggesting they had been selected for during persistence. The first mutation was a C>G substitution at nt position 5952 that resulted in a substitution of a proline with an arginine at nsP4 residue 96 (nsP4 P96R). The second mutation was an

A>G substitution at nt position 6132 resulting in a substitution of a glutamate with a glycine in nsP4 at residue 156 (nsP4 E156G). Intriguingly, both of these mutations were located proximally (within 1-2 aa) to residues identified in SINV that regulate RNA synthesis by influencing replicase RNA elongation activity or modulating nsP4 interactions with nsP2 (417). Although my preliminary characterization of these mutants for acute replication in vivo did not reveal any overt phenotypes compared to WT CHIKV

(data not shown), further characterization of these mutants for persistence is necessary.

In a different approach, phenotypic characterization of infectious CHIKV AF15561 recovered from joint-associated tissue of chronically infected Rag1-/- mice showed no overt changes in acute disease or persistence compared to WT AF15561, suggesting the virus had not accumulated mutations that altered viral fitness in WT mice.

However, my isolation of a mouse-adapted strain of CHIKV from the serum but not ankle tissue of Rag1-/- mice chronically-infected with CHIKV suggests that the host pressures acting upon CHIKV can select for adaptive mutations during persistence but these host pressures may be tissue specific. Furthermore, the joint tissue may be a site of limited selective pressure. This hypothesis is supported by my findings that CHIKV strain 181/25 recovered from the joint-tissue of Rag1-/- mice at 28 dpi had not accumulated mutations that allowed it to persist in WT mice. In contrast, 181/25 in lymphoid tissue of WT mice rapidly reverted attenuating mutations (260). Likewise, a strain of RRV which replicates to significantly reduced titers in skeletal muscle tissue due to mutations in nsP1 that enhance sensitivity to type I IFN replicates to similar titers as

WT RRV in joint-associated tissue (186) suggest type I IFN responses may have limited

143 efficacy against the virus in this tissue. Furthermore, my findings that CHIKV persisting in the ankle tissue of Rag1-/- mice was resistant to clearance by therapeutically administered neutralizing antibody and findings that CD8 T cells appear limited in controlling RRV viral loads in joint tissue (203), suggest that CHIKV replication in joint- associated tissue may also be under limited adaptive immune pressure.

Although the tissue or cell type shedding CHIKV into the circulation of chronically infected Rag1-/- mice is unknown, isolation of MA-CHIKV from the serum suggests that there are reservoirs within the mouse that exert significant selective pressure on CHIKV during persistence. Excitingly, initial characterization of MA-CHIKV suggests that this variant has significantly enhanced virulence in the mouse facilitating studies of several aspects of CHIKV biology including viral restriction factors and genotypic constraints on adaptation of CHIKV to its host in addition to investigating the selective pressures acting upon CHIKV during persistence.

In contrast to type I IFN deficient mice which succumb to CHIKV infection within days, Rag1-/- mice support chronic viral infection for weeks post infection. Although,

Rag1-/- mice chronically-infected with CHIKV only showed a transient systemic induction of type I IFN (168), human patients with chronic symptoms following CHIKV infection had sustained type I IFN responses (170) and CHIKV-infected WT mice had sustained upregulation of IFN stimulated genes at day 30 p.i. in joint-associated tissue (168). Thus it is likely that Rag1-/- mice control CHIKV replication through induction of a type I IFN response and accordingly MA-CHIKV may have evolved to overcome this restriction.

However, if indeed the E2 K200R mutation and/or the deletion in the γ′ UTR were selected to overcome type I IFN restriction, the mechanism is unknown. There exists three, non-exclusive general mechanisms by which MA-CHIKV could overcome restriction by the type I IFN response. First, MA-CHIKV may evade detection by host

144 antiviral sensors such as RIG-I, MDA-5 or the TLRs leading to a delay or diminishment of the type I IFN response. Alternatively, MA-CHIKV may more potently antagonize IFN signaling by interfering with necessary signaling cascades needed to translate IFN receptor signals into ISG expression. Finally, MA-CHIKV may be resistant to IFN- induced effector functions. These distinct strategies are all employed by alphaviruses

(18, 179, 305, 307, 371, 415, 418, 419), therefore it is reasonable to hypothesize that the mutations in MA-CHIKV may engage one or more of these pathways to overcome IFN restriction. Furthermore, the window for type I IFN to restrict alphavirus replication may be brief (159, 420), so mutations that alter type I IFN induction or allow viral escape from

IFN-induced restriction factors, even if only briefly, may have substantial consequences on viral pathogenesis. However, the role of the E2 K200 residue or the γ′ UTR of CHIKV in the type I IFN response is not well defined. The γ′ UTR of SINV can bind the RNA stabilizing protein HuR allowing for efficient viral replication while destabilizing host transcripts for innate antiviral proteins such as RIG-I (22, 321). However, the sequence of the CHIKV γ′ UTR that binds HuR is not affected by the 44 nt deletion identified in

MA-CHIKV (320). Interestingly, preliminary in vitro IFN sensitivity assays in Vero cells suggest that the deletion in the γ′ UTR of MA-CHIKV may indeed confer resistance to type I IFN (data not shown).

In addition, the mutations identified in MA-CHIKV may also influence tissue tropism of CHIKV within the host. Although impairment of the type I IFN response greatly expands tissue tropism of CHIKV and other alphaviruses (156, 165, 421, 422), there remain intrinsic determinants on viral tropism, encoded by the viral genome, with many determinants in the E2 glycoprotein (18, 260, 307, 421, 423-425) reflecting the role of E2 in attachment, binding and entry. These intrinsic determinants of viral tropism can have significant influence on viral pathogenesis (260, 370, 371, 421) and induction of innate

145 immune responses (18, 307, 371). The role of the CHIKV γ′ UTR in influencing tissue tropism is unknown but the host factors that interact with the 3′ UTR to facilitate viral replication may be tissue specific (319). Therefore, it is possible that the mouse adaptive mutations evolved to expand tissue tropism by alleviating virally intrinsic restrictions on

CHIKV in the mouse.

Complicating formulation of hypotheses on how the 44 nt deletion in the γ′ UTR of MA-CHIKV influences CHIKV pathogenesis is a lack of data on the sequence and

RNA secondary structure requirements of the CHIKV γ′ UTR for efficient viral replication in vivo. The γ′ UTR of viruses within the alphavirus genus are highly divergent containing numerous repeat elements (10, 74) and with the exception of a 19 nt conserved element preceding the poly-A tail (10) and binding sites for the HuR host protein (22, 320), the pressures that select for a particular γ′ UTR during CHIKV replication are unclear.

Alphaviruses containing large deletions of their 3′ UTR replicate efficiently in mammalian tissue culture cells suggesting that relatively little of the γ′ UTR is needed for the virus to replicate its genome in mammalian cells (18, 20, 196, 318). Nevertheless, it is likely that the γ′ UTR is required for efficient replication and pathogenesis in vivo. The flavivirus γ′

UTR contains direct repeat elements that form secondary structures important for viral replication (426) and inhibition of innate immune responses (323) suggesting the numerous repeat elements in the alphavirus γ′ UTR may form important secondary structures. Mfold predictions of the CHIKV γ′ UTR of all three CHIKV genotypes predicted formation of numerous stem loop secondary structures in the γ′ UTR (74).

Furthermore, these stem loop structures may be distinct at mammalian and insect body temperatures, suggesting these structures vary as CHIKV replicates in dissimilar hosts

(74). Consequently, it is tempting to speculate that the 44 nt deletion in the γ′ UTR of

MA-CHIKV alters a critical secondary structure. Mfold predictions performed by Chen et

146 al. demonstrated that the unique duplication present in the γ′ UTR of Asian genotype viruses introduces additional secondary structures to the γ′ UTR without globally altering the overall secondary structure of the γ′ UTR (74). Therefore, the 44 nt deletion may alter RNA secondary structure specifically within the unique duplicated region of the

Asian genotype γ′ UTR without altering secondary structure elsewhere in the γ′ UTR.

Indeed, preliminary RNA SHAPE analysis performed by collaborators on the WT

AF15561 γ′ UTR or γ′ UTR containing the 44 nt deletion suggest that the deletion removes a double stem-loop structure without globally altering the secondary structure of the UTR. The viral or host interactions that occur at this stem loop structure remain to be determined.

Thus, it is clear there are many potential mechanisms by which the identified mutations in E2 or γ′ UTR could influence CHIKV pathogenesis. Therefore, further characterization of MA-CHIKV and the mechanisms by which they influence CHIKV pathogenesis has the potential to reveal novel insight into critical host and viral determinants of acute and chronic CHIKV pathogenesis. Follow up experiments comparing the replication and viral burdens of WT vs MA-CHIKV in WT or type I IFN receptor deficient mice (Ifnar1-/-) or mice unable to induce an IFN response (Irf3/7-/-) mice would be informative and dictate studies needed to gain mechanistic insight into how these mutations confer adaptation to mice.

Finally, MA-CHIKV may serve as a useful tool to study broader scale evolutionary selective pressures on CHIKV. My isolation of MA-CHIKV from the serum of

Rag1-/- mice infected with Asian genotype AF15561 contrasts sharply with findings that

CHIKV isolated from the serum of Rag1-/- mice infected with an ECSA genotype CHIKV had limited coding changes and no increased virulence when re-inoculated into mice

(168). Likewise, I have isolated CHIKV from the serum of Rag1-/- mice at 42 dpi with an

147

ECSA genotype virus and preliminary in vivo characterization showed no increase in virulence (data not shown). This suggests that ECSA strains of CHIKV may be unable to similarly adapt to mice as Asian genotype viruses. Additionally, although the E2 K200 residue is conserved among Asian and all other CHIKV genotypes, the deletion in the γ′

UTR of MA-CHIKV occurs in a region of the γ′ UTR unique to Asian genotype viruses.

Together, this data suggests that MA-CHIKV might serve as a useful tool in studying whether there exist genotypic constraints on adaptation to the mammalian host, similar as to what has been observed for CHIKV adaptation to mosquito vectors (102, 103).

Additionally, the E2 K200 residue, while conserved in CHIKV and ONNV, is not conserved among related alphaviruses: MAYV (possessing E2 S200), SFV (E2 N200) and RRV (E2 N200) or more distantly related alphaviruses SINV (E2 E200) and VEEV

(E2 E200) (Fig. 6-1A). The poor conservation of E2 K200 between CHIKV and closely or distantly related alphaviruses contrasts with the absolute conservation of the residues in the glycoprotein E1 that interact with the residue at E2 position 200, E1 C63 and F95

(Fig. 6-1B and C). This suggests that residues other than a lysine at E2 position 200 are well tolerated in alphaviruses and the residue at this position may have been selected for in divergent alphaviruses due to unique selective pressures in their respective hosts.

Thus, studies investigating whether the K200R mutation uniquely influences CHIKV pathogenesis or whether other amino acids at E2 position 200 enhance CHIKV pathogenesis are warranted.

Due to the obligate cycling between mammals and insects during the life cycle of

CHIKV and related alphaviruses, mutations that arise in the wild that confer an advantage in either host are constrained by the requirement to retain fitness in the dissimilar host. Consequently, adaptation to a particular host frequently results in attenuation in the dissimilar host (312, 313, 427, 428). However, adaptation to particular

148 host selective pressures can occur without fitness costs in the dissimilar host (429).

Therefore, determining if the E2 K200R mutation or γ′ UTR deletion confer a fitness cost in the mosquito host will be of importance in predicting whether similar adaptive mutations are likely to arise in nature. These findings would provide valuable insight into the potential evolution of the Asian genotype CHIKV currently circulating in the

Americas. If gains in CHIKV fitness and pathogenesis in mammals can occur without compensatory defects in mosquito vector fitness, it could portend rapid increases in the severity of CHIKV infection.

Concluding Remarks

My work demonstrates that CHIKV establishes long term persistence in the joint- associated and lymphoid tissue of mice. Persistence of CHIKV in joint tissue of mice is associated with ongoing joint pathology strengthening the hypothesis that chronic CHIKV disease reported in many patients following acute CHIKV infection may be due to chronic viral infection. Furthermore, my work demonstrates that adaptive immune responses are necessary to limit viral burdens and joint pathology during persistence.

Additionally, I have shown that evasion of antibody responses is a necessary step in

CHIKV persistence. These data suggest that therapies that modulate the host adaptive immune response either during acute infection or during chronic disease could be effective in ameliorating symptoms. Furthermore, continued comparative studies between CHIKV strain AF15561 and 181/25 will give valuable insight into the host immune responses that dictate clinical outcome of viral infections.

Lastly, the isolation and preliminary characterization of a mouse-adapted strain of

CHIKV lays the foundation for exciting studies into the host restriction factors that limit

CHIKV replication within the host. The identification of novel mutations with the viral genome, E2 K200R and a 44 nt deletion in the γ′ UTR, that are contrastingly in highly

149 conserved and highly divergent regions of the genome will allow for investigations of evolution of CHIKV within the host and more broadly within the context of the evolution of distinct CHIKV genotypes.

Cumulatively, these findings expand our knowledge of the host and viral determinants of CHIKV persistence while facilitating future studies that will contribute to our understanding of CHIKV biology.

150

Figure 6-1. Alignments of E2 K200 and contact residues E1 C63 and F95. (A-C) Amino acid alignment of CHIKV strain AF15561 (Genbank Accession No. EF452493), ONNV (AF079456.1), MAYV (DQ001069.1), SFV (X04129.1), RRV (GQ433359.1), SINV (NC_001547.1) and VEEV (L01442.2) in the regions of E2 K200 (A) or the contact residues in E1, C63 (B) and F95 (C). Amino acids numbered according to CHIKV E2 and E1 protein sequence. 100% homology is indicated by dots. Alignment performed in Geneious Software (Biomatters).

151

REFERENCES

1. Powers AM, Brault AC, Shirako Y, Strauss EG, Kang W, Strauss JH, Weaver SC. 2001. Evolutionary relationships and systematics of the alphaviruses. J Virol 75:10118-10131.

2. Robinson MC. 1955. An epidemic of virus disease in Southern Province, Tanganyika Territory, in 1952-53. I. Clinical features. Trans R Soc Trop Med Hyg 49:28-32.

3. CDC. 2016. Eastern Equine Encephalitis Virus: CDC Fact Sheet, on Centers for Disease Control and Prevention. http://www.cdc.gov/EasternEquineEncephalitis/tech/symptoms.html. Accessed September 19, 2016

4. Satu K, Tytti M, Antti V, Olli V. 2004. Causative Agent of Pogosta Disease Isolated from Blood and Skin Lesions. Emerging Infectious Disease journal 10:889.

5. Strauss JH, Strauss EG. 1994. The alphaviruses gene expression, replication, and evolution. Microbiological Reviews 58:491-562.

6. Ahola T, Laakkonen P, Vihinen H, Kaariainen L. 1997. Critical residues of Semliki Forest virus RNA capping enzyme involved in methyltransferase and guanylyltransferase-like activities. J Virol 71:392-397.

7. Firth AE, Chung BY, Fleeton MN, Atkins JF. 2008. Discovery of frameshifting in Alphavirus 6K resolves a 20-year enigma. Virol J 5:108.

8. Snyder JE, Kulcsar KA, Schultz KLW, Riley CP, Neary JT, Marr S, Jose J, Griffin DE, Kuhn RJ. 2013. Functional Characterization of the Alphavirus TF Protein. J Virol 87:8511-8523.

9. Hyde JL, Chen R, Trobaugh DW, Diamond MS, Weaver SC, Klimstra WB, Wilusz J. 2015. The 5' and 3' ends of alphavirus RNAs--Non-coding is not non- functional. Virus Res 206:99-107.

10. Pfeffer M, Kinney R, Kaaden O. 1998. The Alphavirus 3'-Nontranslated Region: Size Heterogeneity and Arrangement of Repeated Sequence Elements. Virology 240:100-108.

152

11. Ou JH, Rice CM, Dalgarno L, Strauss EG, Strauss JH. 1982. Sequence studies of several alphavirus genomic RNAs in the region containing the start of the subgenomic RNA. Proc Natl Acad Sci U S A 79:5235-5239.

12. Frolov I, Hardy R, Rice CM. 2001. Cis-acting RNA elements at the 5' end of Sindbis virus genome RNA regulate minus- and plus-strand RNA synthesis. Rna 7:1638-1651.

13. Shirako Y, Strauss EG, Strauss JH. 2003. Modification of the 5' terminus of Sindbis virus genomic RNA allows nsP4 RNA polymerases with nonaromatic amino acids at the N terminus to function in RNA replication. J Virol 77:2301- 2309.

14. Berben-Bloemheuvel G, Kasperaitis MA, van Heugten H, Thomas AA, van Steeg H, Voorma HO. 1992. Interaction of initiation factors with the cap structure of chimaeric mRNA containing the 5'-untranslated regions of Semliki Forest virus RNA is related to translational efficiency. Eur J Biochem 208:581-587.

15. Castello A, Sanz MA, Molina S, Carrasco L. 2006. Translation of Sindbis virus 26S mRNA does not require intact eukariotic initiation factor 4G. J Mol Biol 355:942-956.

16. Ventoso I, Sanz MA, Molina S, Berlanga JJ, Carrasco L, Esteban M. 2006. Translational resistance of late alphavirus mRNA to eIF2alpha phosphorylation: a strategy to overcome the antiviral effect of protein kinase PKR. Genes Dev 20:87-100.

17. Frolov I, Schlesinger S. 1996. Translation of Sindbis virus mRNA: analysis of sequences downstream of the initiating AUG codon that enhance translation. J Virol 70:1182-1190.

18. Trobaugh DW, Gardner CL, Sun C, Haddow AD, Wang E, Chapnik E, Mildner A, Weaver SC, Ryman KD, Klimstra WB. 2014. RNA viruses can hijack vertebrate microRNAs to suppress innate immunity. Nature 506:245-248.

19. Patel RK, Burnham AJ, Gebhart NN, Sokoloski KJ, Hardy RW. 2013. Role for Subgenomic mRNA in Host Translation Inhibition during Sindbis Virus Infection of Mammalian Cells. Virology 441:171-181.

20. Kuhn R, Hong Z, Strauss JH. 1994. Mutagenesis of the 3' Nontranslated Region of Sindbis Virus RNA. J Virol 64:1465-1476.

153

21. Garneau NL, Sokoloski KJ, Opyrchal M, Neff CP, Wilusz CJ, Wilusz J. 2008. The γ′ Untranslated Region of Sindbis Virus Represses Deadenylation of Viral Transcripts in Mosquito and Mammalian Cells. J Virol 82:880-892.

22. Sokoloski KJ, Dickson AM, Chaskey EL, Garneau NL, Wilusz CJ, Wilusz J. 2010. Sindbis virus usurps the cellular HuR protein to stabilize its transcripts and promote productive infections in mammalian and mosquito cells. Cell Host Microbe 8:196-207.

23. Lopez S, Yao JS, Kuhn RJ, Strauss EG, Strauss JH. 1994. Nucleocapsid- glycoprotein interactions required for assembly of alphaviruses. J Virol 68:1316- 1323.

24. Smith TJ, Cheng RH, Olson NH, Peterson P, Chase E, Kuhn RJ, Baker TS. 1995. Putative receptor binding sites on alphaviruses as visualized by cryoelectron microscopy. Proceedings of the National Academy of Sciences 92:10648-10652.

25. Silva LA, Khomandiak S, Ashbrook AW, Weller R, Heise MT, Morrison TE, Dermody TS. 2014. A single-amino-acid polymorphism in Chikungunya virus E2 glycoprotein influences glycosaminoglycan utilization. J Virol 88:2385-2397.

26. Li L, Jose J, Xiang Y, Kuhn RJ, Rossmann MG. 2010. Structural changes of envelope proteins during alphavirus fusion. Nature 468:705-708.

27. Voss JE, Vaney MC, Duquerroy S, Vonrhein C, Girard-Blanc C, Crublet E, Thompson A, Bricogne G, Rey FA. 2010. Glycoprotein organization of Chikungunya virus particles revealed by X-ray crystallography. Nature 468:709- 712.

28. Hoornweg TE, van Duijl-Richter MK, Ayala Nunez NV, Albulescu IC, van Hemert MJ, Smit JM. 2016. Dynamics of Chikungunya Virus Cell Entry Unraveled by Single-Virus Tracking in Living Cells. J Virol 90:4745-4756.

29. Ooi YS, Stiles KM, Liu CY, Taylor GM, Kielian M. 2013. Genome-Wide RNAi Screen Identifies Novel Host Proteins Required for Alphavirus Entry. PLoS Pathog 9:e1003835.

30. Bernard E, Solignat M, Gay B, Chazal N, Higgs S, Devaux C, Briant L. 2010. Endocytosis of chikungunya virus into mammalian cells: role of clathrin and early endosomal compartments. PLoS One 5:e11479.

154

31. Gibbons DL, Vaney MC, Roussel A, Vigouroux A, Reilly B, Lepault J, Kielian M, Rey FA. 2004. Conformational change and protein-protein interactions of the fusion protein of Semliki Forest virus. Nature 427:320-325.

32. Wahlberg JM, Garoff H. 1992. Membrane fusion process of Semliki Forest virus. I: Low pH-induced rearrangement in spike protein quaternary structure precedes virus penetration into cells. J Cell Biol 116:339-348.

33. Glomb-Reinmund S, Kielian M. 1998. fus-1, a pH shift mutant of Semliki Forest virus, acts by altering spike subunit interactions via a mutation in the E2 subunit. J Virol 72:4281-4287.

34. Fields W, Kielian M. 2013. A key interaction between the alphavirus envelope proteins responsible for initial dimer dissociation during fusion. J Virol 87:3774- 3781.

35. Porta J, Mangala Prasad V, Wang CI, Akahata W, Ng LF, Rossmann MG. 2015. Structural Studies of Chikungunya Virus-Like Particles Complexed with Human Antibodies: Neutralization and Cell-to-Cell Transmission. J Virol 90:1169- 1177.

36. Fox JM, Long F, Edeling MA, Lin H, van Duijl-Richter MK, Fong RH, Kahle KM, Smit JM, Jin J, Simmons G, Doranz BJ, Crowe JE, Jr., Fremont DH, Rossmann MG, Diamond MS. 2015. Broadly Neutralizing Alphavirus Antibodies Bind an Epitope on E2 and Inhibit Entry and Egress. Cell 163:1095-1107.

37. Singh I, Helenius A. 1992. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating. J Virol 66:7049-7058.

38. Schuffenecker I, Iteman I, Michault A, Murri S, Frangeul L, Vaney MC, Lavenir R, Pardigon N, Reynes JM, Pettinelli F, Biscornet L, Diancourt L, Michel S, Duquerroy S, Guigon G, Frenkiel MP, Brehin AC, Cubito N, Despres P, Kunst F, Rey FA, Zeller H, Brisse S. 2006. Genome microevolution of chikungunya viruses causing the Indian Ocean outbreak. PLoS Med 3:e263.

39. Coffey LL, Beeharry Y, Borderia AV, Blanc H, Vignuzzi M. 2011. Arbovirus high fidelity variant loses fitness in mosquitoes and mice. Proc Natl Acad Sci U S A 108:16038-16043.

40. Kamer G, Argos P. 1984. Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Res 12:7269-7282.

155

41. De I, Sawicki SG, Sawicki DL. 1996. Sindbis virus RNA-negative mutants that fail to convert from minus-strand to plus-strand synthesis: role of the nsP2 protein. J Virol 70:2706-2719.

42. Fata CL, Sawicki SG, Sawicki DL. 2002. Modification of Asn374 of nsP1 suppresses a Sindbis virus nsP4 minus-strand polymerase mutant. J Virol 76:8641-8649.

43. Suopanki J, Sawicki DL, Sawicki SG, Kaariainen L. 1998. Regulation of alphavirus 26S mRNA transcription by replicase component nsP2. J Gen Virol 79 ( Pt 2):309-319.

44. Fata CL, Sawicki SG, Sawicki DL. 2002. Alphavirus minus-strand RNA synthesis: identification of a role for Arg183 of the nsP4 polymerase. J Virol 76:8632-8640.

45. Wang YF, Sawicki SG, Sawicki DL. 1994. Alphavirus nsP3 functions to form replication complexes transcribing negative-strand RNA. J Virol 68:6466-6475.

46. LaStarza MW, Lemm JA, Rice CM. 1994. Genetic analysis of the nsP3 region of Sindbis virus: evidence for roles in minus-strand and subgenomic RNA synthesis. J Virol 68:5781-5791.

47. Vasiljeva L, Valmu L, Kaariainen L, Merits A. 2001. Site-specific protease activity of the carboxyl-terminal domain of Semliki Forest virus replicase protein nsP2. J Biol Chem 276:30786-30793.

48. Hardy WR, Strauss JH. 1989. Processing the nonstructural polyproteins of sindbis virus: nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans. J Virol 63:4653-4664.

49. de Groot RJ, Hardy WR, Shirako Y, Strauss JH. 1990. Cleavage-site preferences of Sindbis virus polyproteins containing the non-structural proteinase. Evidence for temporal regulation of polyprotein processing in vivo. Embo j 9:2631-2638.

50. Shirako Y, Strauss JH. 1994. Regulation of Sindbis virus RNA replication: uncleaved P123 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from P123 are required for efficient plus-strand RNA synthesis. J Virol 68:1874-1885.

156

51. Lemm JA, Rümenapf T, Strauss EG, Strauss JH, Rice CM. 1994. Polypeptide requirements for assembly of functional Sindbis virus replication complexes: a model for the temporal regulation of minus- and plus-strand RNA synthesis. The EMBO Journal 13:2925-2934.

52. Mi S, Durbin R, Huang HV, Rice CM, Stollar V. 1989. Association of the Sindbis virus RNA methyltransferase activity with the nonstructural protein nsP1. Virology 170:385-391.

53. Scheidel LM, Stollar V. 1991. Mutations that confer resistance to mycophenolic acid and ribavirin on Sindbis virus map to the nonstructural protein nsP1. Virology 181:490-499.

54. Gomez de Cedrón M, Ehsani N, Mikkola ML, Garcı́a JA, Kääriäinen L. 1999. RNA helicase activity of Semliki Forest virus replicase protein NSP2. FEBS Letters 448:19-22.

55. Rikkonen M, Peranen J, Kaariainen L. 1994. ATPase and GTPase activities associated with Semliki Forest virus nonstructural protein nsP2. J Virol 68:5804- 5810.

56. Vasiljeva L, Merits A, Auvinen P, Kaariainen L. 2000. Identification of a novel function of the alphavirus capping apparatus. RNA 5'-triphosphatase activity of Nsp2. J Biol Chem 275:17281-17287.

57. Malet H, Coutard B, Jamal S, Dutartre H, Papageorgiou N, Neuvonen M, Ahola T, Forrester N, Gould EA, Lafitte D, Ferron F, Lescar J, Gorbalenya AE, de Lamballerie X, Canard B. 2009. The crystal structures of Chikungunya and Venezuelan equine encephalitis virus nsP3 macro domains define a conserved adenosine binding pocket. J Virol 83:6534-6545.

58. Strauss EG, Levinson R, Rice CM, Dalrymple J, Strauss JH. 1988. Nonstructural proteins nsP3 and nsP4 of Ross River and O'Nyong-nyong viruses: sequence and comparison with those of other alphaviruses. Virology 164:265- 274.

59. Fros JJ, Domeradzka NE, Baggen J, Geertsema C, Flipse J, Vlak JM, Pijlman GP. 2012. Chikungunya virus nsP3 blocks stress granule assembly by recruitment of G3BP into cytoplasmic foci. J Virol 86:10873-10879.

157

60. Kim DY, Reynaud JM, Rasalouskaya A, Akhrymuk I, Mobley JA, Frolov I, Frolova EI. 2016. New World and Old World Alphaviruses Have Evolved to Exploit Different Components of Stress Granules, FXR and G3BP Proteins, for Assembly of Viral Replication Complexes. PLoS Pathog 12:e1005810.

61. Frolova E, Frolov I, Schlesinger S. 1997. Packaging signals in alphaviruses. J Virol 71:248-258.

62. Kim DY, Firth AE, Atasheva S, Frolova EI, Frolov I. 2011. Conservation of a Packaging Signal and the Viral Genome RNA Packaging Mechanism in Alphavirus Evolution. J Virol 85:8022-8036.

63. Wahlberg JM, Boere WA, Garoff H. 1989. The heterodimeric association between the membrane proteins of Semliki Forest virus changes its sensitivity to low pH during virus maturation. J Virol 63:4991-4997.

64. Melancon P, Garoff H. 1987. Processing of the Semliki Forest virus structural polyprotein: role of the capsid protease. J Virol 61:1301-1309.

65. Smit JM, Klimstra WB, Ryman KD, Bittman R, Johnston RE, Wilschut J. 2001. PE2 Cleavage Mutants of Sindbis Virus: Correlation between Viral Infectivity and pH-Dependent Membrane Fusion Activation of the Spike Heterodimer. J Virol 75:11196-11204.

66. Yao JS, Strauss EG, Strauss JH. 1996. Interactions between PE2, E1, and 6K required for assembly of alphaviruses studied with chimeric viruses. J Virol 70:7910-7920.

67. Melton JV, Ewart GD, Weir RC, Board PG, Lee E, Gage PW. 2002. Alphavirus 6K proteins form ion channels. J Biol Chem 277:46923-46931.

68. Lee S, Owen KE, Choi H-K, Lee H, Lu G, Wengler G, Brown DT, Rossmann MG, Kuhn RJ. 1996. Identification of a protein binding site on the surface of the alphavirus nucleocapsid and its implication in virus assembly. Structure 4:531- 541.

69. Powers AM, Logue CH. 2007. Changing patterns of chikungunya virus: re- emergence of a zoonotic arbovirus. J Gen Virol 88:2363-2377.

158

70. Powers AM, Brault AC, Tesh RB, Weaver SC. 2000. Re-emergence of Chikungunya and O'nyong-nyong viruses evidence for distinct geographical lineages and distant evoultionary relationships. Journal of General Virology 81:471-479.

71. Diallo D, Sall AA, Buenemann M, Chen R, Faye O, Diagne CT, Faye O, Ba Y, Dia I, Watts D, Weaver SC, Hanley KA, Diallo M. 2012. Landscape Ecology of Sylvatic Chikungunya Virus and Mosquito Vectors in Southeastern Senegal. PLoS Negl Trop Dis 6:e1649.

72. Diallo M, Thonnon J, Traore-Lamizana M, Fontenille D. 1999. Vectors of Chikungunya virus in Senegal: current data and transmission cycles. Am J Trop Med Hyg 60:281-286.

73. Volk SM, Chen R, Tsetsarkin KA, Adams AP, Garcia TI, Sall AA, Nasar F, Schuh AJ, Holmes EC, Higgs S, Maharaj PD, Brault AC, Weaver SC. 2010. Genome-scale phylogenetic analyses of chikungunya virus reveal independent emergences of recent epidemics and various evolutionary rates. J Virol 84:6497- 6504.

74. Chen R, Wang E, Tsetsarkin KA, Weaver SC. 2013. Chikungunya virus 3' untranslated region: adaptation to mosquitoes and a population bottleneck as major evolutionary forces. PLoS Pathog 9:e1003591.

75. Sergon K, Njuguna C, Kalani R, Ofula V, Onyango C, Konongoi LS, Bedno S, Burke H, Dumilla AM, Konde J, Njenga MK, Sang R, Breiman RF. 2008. Seroprevalence of Chikungunya virus (CHIKV) infection on Lamu Island, Kenya, October 2004. Am J Trop Med Hyg 78:333-337.

76. Paquet C, Quatresous I, Solet JL, Sissoko D, Renault P, Pierre V, Cordel H, Lassalle C, Thiria J, Zeller H, Schuffnecker I. 2006. Chikungunya outbreak in Reunion: epidemiology and surveillance, 2005 to early January 2006. Euro Surveill 11:E060202.060203.

77. Yergolkar PN, Tandale BV, Arankalle VA, Sathe PS, Sudeep AB, Gandhe SS, Gokhle MD, Jacob GP, Hundekar SL, Mishra AC. 2006. Chikungunya outbreaks caused by African genotype, India. Emerg Infect Dis 12:1580-1583.

78. Renault P, Solet JL, Sissoko D, Balleydier E, Larrieu S, Filleul L, Lassalle C, Thiria J, Rachou E, de Valk H, Ilef D, Ledrans M, Quatresous I, Quenel P, Pierre V. 2007. A major epidemic of chikungunya virus infection on Reunion Island, France, 2005-2006. Am J Trop Med Hyg 77:727-731.

159

79. Rezza G, Nicoletti L, Angelini R, Romi R, Finarelli AC, Panning M, Cordioli P, Fortuna C, Boros S, Magurano F, Silvi G, Angelini P, Dottori M, Ciufolini MG, Majori GC, Cassone A, group Cs. 2007. Infection with chikungunya virus in Italy: an outbreak in a temperate region. The Lancet 370:1840-1846.

80. Bonilauri P, Bellini R, Calzolari M, Angelini R, Venturi L, Fallacara F, Cordioli P, Angelini P, Venturelli C, Merialdi G, Dottori M. 2008. Chikungunya virus in Aedes albopictus, Italy. Emerg Infect Dis 14:852-854.

81. Delisle E, Rousseau C, Broche B, Leparc-Goffart I, L'Ambert G, Cochet A, Prat C, Foulongne V, Ferre JB, Catelinois O, Flusin O, Tchernonog E, Moussion IE, Wiegandt A, Septfons A, Mendy A, Moyano MB, Laporte L, Maurel J, Jourdain F, Reynes J, Paty MC, Golliot F. 2015. Chikungunya outbreak in Montpellier, France, September to October 2014. Euro Surveill 20.

82. Grandadam M, Caro V, Plumet S, Thiberge JM, Souares Y, Failloux AB, Tolou HJ, Budelot M, Cosserat D, Leparc-Goffart I, Despres P. 2011. Chikungunya virus, southeastern France. Emerg Infect Dis 17:910-913.

83. Reller ME, Akoroda U, Nagahawatte A, Devasiri V, Kodikaarachchi W, Strouse JJ, Chua R, Hou Y, Chow A, Sessions OM, Ostbye T, Gubler DJ, Woods CW, Bodinayake C. 2013. Chikungunya as a cause of acute febrile illness in southern Sri Lanka. PLoS One 8:e82259.

84. Pongsiri P, Auksornkitti V, Theamboonlers A, Luplertlop N, Rianthavorn P, Poovorawan Y. 2010. Entire genome characterization of Chikungunya virus from the 2008-2009 outbreaks in Thailand. Trop Biomed 27:167-176.

85. Win MK, Chow A, Dimatatac F, Go CJ, Leo YS. 2010. Chikungunya fever in Singapore: acute clinical and laboratory features, and factors associated with persistent arthralgia. J Clin Virol 49:111-114.

86. Hapuarachchi HC, Bandara KB, Sumanadasa SD, Hapugoda MD, Lai YL, Lee KS, Tan LK, Lin RT, Ng LF, Bucht G, Abeyewickreme W, Ng LC. 2010. Re-emergence of Chikungunya virus in South-east Asia: virological evidence from Sri Lanka and Singapore. J Gen Virol 91:1067-1076.

87. Roth A, Hoy D, Horwood PF, Ropa B, Hancock T, Guillaumot L, Rickart K, Frison P, Pavlin B, Souares Y. 2014. Preparedness for Threat of Chikungunya in the Pacific. Emerging Infectious Diseases 20:e130696.

160

88. Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S. 2007. A single mutation in chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog 3:e201.

89. Kosasih H, de Mast Q, Widjaja S, Sudjana P, Antonjaya U, Ma'roef C, Riswari SF, Porter KR, Burgess TH, Alisjahbana B, van der Ven A, Williams M. 2013. Evidence for Endemic Chikungunya Virus Infections in Bandung, Indonesia. PLoS Negl Trop Dis 7:e2483.

90. Savage HM, Ledermann JP, Yug L, Burkhalter KL, Marfel M, Hancock WT. 2015. Incrimination of Aedes (Stegomyia) hensilli Farner as an Epidemic Vector of Chikungunya Virus on Yap Island, Federated States of Micronesia, 2013. The American Journal of Tropical Medicine and Hygiene 92:429-436.

91. Dupont-Rouzeyrol M, Caro V, Guillaumot L, Vazeille M, D'Ortenzio E, Thiberge JM, Baroux N, Gourinat AC, Grandadam M, Failloux AB. 2012. Chikungunya virus and the mosquito vector Aedes aegypti in New Caledonia (South Pacific Region). Vector Borne Zoonotic Dis 12:1036-1041.

92. Staples JE, Powers AM, Tomashek K, Lanciotti E, Munoz J, Savage H, Mutebi J, Barrera R, Zielinski-Gutierrez E, Perez C. Preparedness and Response for Chikungunya Virus Introduction in the Americas. Publication of the Pan American Health Organization

93. Morrison TE. 2014. Reemergence of chikungunya virus. J Virol 88:11644- 11647.

94. PAHO. 2016. Chikungunya. http://www.paho.org/hq/index.php?option=com_topics&view=article&id=343&Ite mid=40931. Accessed September 20, 2016.

95. Leparc-Goffart I, Nougairede A, Cassadou S, Prat C, de Lamballerie X. 2014. Chikungunya in the Americas. The Lancet 383:514.

96. Lanciotti RS, Valadere AM. 2014. Transcontinental movement of Asian genotype chikungunya virus. Emerg Infect Dis 20:1400-1402.

97. Nasci RS. 2014. Movement of Chikungunya Virus into the Western Hemisphere. Emerging Infectious Diseases 20:1394-1395.

161

98. CDC. 2016. Chikungunya virus in the United States. http://www.cdc.gov/chikungunya/geo/united-states.html. Accessed September 20, 2016.

99. Fauci AS, Morens DM. 2016. Zika Virus in the Americas — Yet Another Arbovirus Threat. New England Journal of Medicine 374:601-604.

100. Brathwaite Dick O, San Martín JL, Montoya RH, del Diego J, Zambrano B, Dayan GH. 2012. The History of Dengue Outbreaks in the Americas. The American Journal of Tropical Medicine and Hygiene 87:584-593.

101. Nunes MRT, Faria NR, de Vasconcelos JM, Golding N, Kraemer MU, de Oliveira LF, Azevedo RdSdS, da Silva DEA, da Silva EVP, da Silva SP, Carvalho VL, Coelho GE, Cruz ACR, Rodrigues SG, da Silva Gonçalves Vianez JL, Nunes BTD, Cardoso JF, Tesh RB, Hay SI, Pybus OG, da Costa Vasconcelos PF. 2015. Emergence and potential for spread of Chikungunya virus in Brazil. BMC Medicine 13:1-11.

102. Tsetsarkin KA, Chen R, Leal G, Forrester N, Higgs S, Huang J, Weaver SC. 2011. Chikungunya virus emergence is constrained in Asia by lineage-specific adaptive landscapes. Proc Natl Acad Sci U S A 108:7872-7877.

103. Tsetsarkin KA, McGee CE, Volk SM, Vanlandingham DL, Weaver SC, Higgs S. 2009. Epistatic roles of E2 glycoprotein mutations in adaption of chikungunya virus to Aedes albopictus and Ae. aegypti mosquitoes. PLoS One 4:e6835.

104. Tsetsarkin KA, Weaver SC. 2011. Sequential Adaptive Mutations Enhance Efficient Vector Switching by Chikungunya Virus and Its Epidemic Emergence. PLoS Pathog 7:e1002412.

105. Kraemer MU, Sinka ME, Duda KA, Mylne AQ, Shearer FM, Barker CM, Moore CG, Carvalho RG, Coelho GE, Van Bortel W, Hendrickx G, Schaffner F, Elyazar IR, Teng HJ, Brady OJ, Messina JP, Pigott DM, Scott TW, Smith DL, Wint GR, Golding N, Hay SI. 2015. The global distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. Elife 4:e08347.

106. Lumsden W. 1955. AN EPIDEMIC OF VIRUS DISEASE IN SOUTHERN PROVINCE, TANGANYIKA TERRITORY, IN 1952-53 Part II. Trans R Soc Trop Med Hyg 49.

162

107. Borgherini G, Poubeau P, Staikowsky F, Lory M, Le Moullec N, Becquart JP, Wengling C, Michault A, Paganin F. 2007. Outbreak of chikungunya on Reunion Island: early clinical and laboratory features in 157 adult patients. Clin Infect Dis 44:1401-1407.

108. Queyriaux B, Simon F, Grandadam M, Michel R, Tolou H, Boutin JP. 2008. Clinical burden of chikungunya virus infection. The Lancet Infectious Diseases

8:2-3.

109. Lam SK, Chua KB, Hooi PS, Rahimah MA, Kumari S, Tharmaratnam M, Chuah SK, Smith DW, Sampson IA. 2001. Chikungunya infection--an emerging disease in Malaysia. Southeast Asian J Trop Med Public Health 32:447-451.

110. Borgherini G, Poubeau P, Jossaume A, Gouix A, Cotte L, Michault A, Arvin- Berod C, Paganin F. 2008. Persistent arthralgia associated with chikungunya virus: a study of 88 adult patients on reunion island. Clin Infect Dis 47:469-475.

111. Sissoko D, Moendandze A, Malvy D, Giry C, Ezzedine K, Solet JL, Pierre V. 2008. Seroprevalence and risk factors of chikungunya virus infection in Mayotte, Indian Ocean, 2005-2006: a population-based survey. PLoS One 3:e3066.

112. Fourie ED, Morrison JG. 1979. Rheumatoid arthritic syndrome after chikungunya fever. S Afr Med J 56:130-132.

113. Macpherson C, Noel T, Fields P, Jungkind D, Yearwood K, Simmons M, Widjaja S, Mitchell G, Noel D, Bidaisee S, Myers TE, LaBeaud AD. 2016. Clinical and Serological Insights from the Asian Lineage Chikungunya Outbreak in Grenada, 2014: An Observational Study. Am J Trop Med Hyg doi:10.4269/ajtmh.16-0122.

114. Carey DE, Myers RM, Deranitz CM, Jadhav M, Reuben R. 1969. The 1964 chikungunya epidemic at vellore, South India, including observations on concurrent dengue. Transactions of the Royal Society of Tropical Medicine and Hygiene 63:434-445.

115. Larrieu S, Pouderoux N, Pistone T, Filleul L, Receveur MC, Sissoko D, Ezzedine K, Malvy D. 2010. Factors associated with persistence of arthralgia among Chikungunya virus-infected travellers: report of 42 French cases. J Clin Virol 47:85-88.

163

116. Thiberville SD, Boisson V, Gaudart J, Simon F, Flahault A, de Lamballerie X. 2013. Chikungunya fever: a clinical and virological investigation of outpatients on Reunion Island, South-West Indian Ocean. PLoS Negl Trop Dis 7:e2004.

117. Javelle E, Ribera A, Degasne I, Gaüzère B-A, Marimoutou C, Simon F. 2015. Specific Management of Post-Chikungunya Rheumatic Disorders: A Retrospective Study of 159 Cases in Reunion Island from 2006-2012. PLoS Neglected Tropical Diseases 9:e0003603.

118. Chaaithanya IK, Muruganandam N, Raghuraj U, Sugunan AP, Rajesh R, Anwesh M, Rai SK, Vijayachari P. 2014. Chronic inflammatory arthritis with persisting bony erosions in patients following chikungunya infection. The Indian Journal of Medical Research 140:142-145.

119. Mahendradas P, Ranganna SK, Shetty R, Balu R, Narayana KM, Babu RB, Shetty BK. 2008. Ocular Manifestations Associated with Chikungunya. Ophthalmology 115:287-291.

120. Oehler E, Fournier E, Leparc-Goffart I, Larre P, Cubizolle S, Sookhareea C, Lastere S, Ghawche F. 2015. Increase in cases of Guillain-Barre syndrome during a Chikungunya outbreak, French Polynesia, 2014 to 2015. Euro Surveill 20:30079.

121. Staikowsky F, Le Roux K, Schuffenecker I, Laurent P, Grivard P, Develay A, Michault A. 2008. Retrospective survey of Chikungunya disease in Reunion Island hospital staff. Epidemiol Infect 136:196-206.

122. Cardona-Ospina JA, Villamil-Gomez WE, Jimenez-Canizales CE, Castaneda-Hernandez DM, Rodriguez-Morales AJ. 2015. Estimating the burden of disease and the economic cost attributable to chikungunya, Colombia, 2014. Trans R Soc Trop Med Hyg 109:793-802.

123. Soumahoro MK, Boelle PY, Gauzere BA, Atsou K, Pelat C, Lambert B, La Ruche G, Gastellu-Etchegorry M, Renault P, Sarazin M, Yazdanpanah Y, Flahault A, Malvy D, Hanslik T. 2011. The Chikungunya epidemic on La Reunion Island in 2005-2006: a cost-of-illness study. PLoS Negl Trop Dis 5:e1197.

124. Aaskov JG, Mataika JU, Lawrence GW, Rabukawaqa V, Tucker MM, Miles JA, Dalglish DA. 1981. An epidemic of Ross River virus infection in Fiji, 1979. Am J Trop Med Hyg 30:1053-1059.

164

125. Suhrbier A, Jaffar-Bandjee MC, Gasque P. 2012. Arthritogenic alphaviruses-- an overview. Nat Rev Rheumatol 8:420-429.

126. Eric SH, Crystyan S, Carolina G, Stalin V, Erik JJ, Cesar R, Patricia VA, Julia SA. 2013. Mayaro Virus Infection, Amazon Basin Region, Peru, 2010– 2013. Emerging Infectious Disease journal 19:1839.

127. Kiwanuka N, Sanders EJ, Rwaguma EB, Kawamata J, Ssengooba FP, Najjemba R, Were WA, Lamunu M, Bagambisa G, Burkot TR, Dunster L, Lutwama JJ, Martin DA, Cropp CB, Karabatsos N, Lanciotti RS, Tsai TF, Campbell GL. 1999. O'nyong-nyong fever in south-central Uganda, 1996-1997: clinical features and validation of a clinical case definition for surveillance purposes. Clin Infect Dis 29:1243-1250.

128. Tesh RB, Watts DM, Russell KL, Damodaran C, Calampa C, Cabezas C, Ramirez G, Vasquez B, Hayes CG, Rossi CA, Powers AM, Hice CL, Chandler LJ, Cropp BC, Karabatsos N, Roehrig JT, Gubler DJ. 1999. Mayaro virus disease: an emerging mosquito-borne zoonosis in tropical South America. Clin Infect Dis 28:67-73.

129. Economopoulou A, Dominguez M, Helynck B, Sissoko D, Wichmann O, Quenel P, Germonneau P, Quatresous I. 2009. Atypical Chikungunya virus infections: clinical manifestations, mortality and risk factors for severe disease during the 2005-2006 outbreak on Reunion. Epidemiol Infect 137:534-541.

130. Rampal, Sharda M, Meena H. 2007. Neurological complications in Chikungunya fever. J Assoc Physicians India 55:765-769.

131. Chusri S, Siripaitoon P, Hirunpat S, Silpapojakul K. 2011. Case reports of neuro-Chikungunya in southern Thailand. Am J Trop Med Hyg 85:386-389.

132. Ramful D, Carbonnier M, Pasquet M, Bouhmani B, Ghazouani J, Noormahomed T, Beullier G, Attali T, Samperiz S, Fourmaintraux A, Alessandri JL. 2007. Mother-to-child transmission of Chikungunya virus infection. Pediatr Infect Dis J 26:811-815.

133. Robin S, Ramful D, Le Seach F, Jaffar-Bandjee MC, Rigou G, Alessandri JL. 2008. Neurologic manifestations of pediatric chikungunya infection. J Child Neurol 23:1028-1035.

165

134. Robillard P-Y, Boumahni B, Gérardin P, Michault A, Fourmaintraux A, Schuffenecker I, Carbonnier M, Djémili S, Choker G, Roge-Wolter M, Barau G. 2006. Transmission verticale materno-fœtale du virus chikungunya. La Presse Médicale 35:785-788.

135. Gerardin P, Barau G, Michault A, Bintner M, Randrianaivo H, Choker G, Lenglet Y, Touret Y, Bouveret A, Grivard P, Le Roux K, Blanc S, Schuffenecker I, Couderc T, Arenzana-Seisdedos F, Lecuit M, Robillard PY. 2008. Multidisciplinary prospective study of mother-to-child chikungunya virus infections on the island of La Reunion. PLoS Med 5:e60.

136. Turunen M, Kuusisto P, Uggeldahl PE, Toivanen A. 1998. Pogosta disease: clinical observations during an outbreak in the province of North Karelia, Finland. Br J Rheumatol 37:1177-1180.

137. Taubitz W, Cramer JP, Kapaun A, Pfeffer M, Drosten C, Dobler G, Burchard GD, Loscher T. 2007. Chikungunya fever in travelers: clinical presentation and course. Clin Infect Dis 45:e1-4.

138. Manimunda SP, Vijayachari P, Uppoor R, Sugunan AP, Singh SS, Rai SK, Sudeep AB, Muruganandam N, Chaitanya IK, Guruprasad DR. 2010. Clinical progression of chikungunya fever during acute and chronic arthritic stages and the changes in joint morphology as revealed by imaging. Trans R Soc Trop Med Hyg 104:392-399.

139. Simon F, Parola P, Grandadam M, Fourcade S, Oliver M, Brouqui P, Hance P, Kraemer P, Mohamed AA, de Lamballerie X, Charrel R, Tolou H. 2007. Chikungunya infection - An emerging rheumatism among travelers returned from Indian Ocean islands. Report of 47 cases. Medicine 86:123-137.

140. Ravichandran R, Manian M. 2008. Ribavirin therapy for Chikungunya arthritis. J Infect Dev Ctries 2:140-142.

141. Harrison VR, Eckels KH, Bartelloni PJ, Hampton C. 1971. Production and evaluation of a formalin-killed Chikungunya vaccine. J Immunol 107:643-647.

142. Levitt NH, Ramsburg HH, Hasty SE, Repik PM, Cole FE, Lupton HW. 1986. Development of an Attenuated Strain of Chikungunya Virus for Use in Vaccine Production. Vaccine 4:157-162.

143. Edelman R, Tacket CO, Wasserman SS, Bodison SA, Perry JG, Mangiafico JA. 2000. Phase II safety and immunogenicity study of live chikungunya virus vaccine TSI-GSD-218. Am J Trop Med Hyg 62:681-685.

166

144. Gorchakov R, Wang E, Leal G, Forrester NL, Plante K, Rossi SL, Partidos CD, Adams AP, Seymour RL, Weger J, Borland EM, Sherman MB, Powers AM, Osorio JE, Weaver SC. 2012. Attenuation of Chikungunya virus vaccine strain 181/clone 25 is determined by two amino acid substitutions in the E2 envelope glycoprotein. J Virol 86:6084-6096.

145. Akahata W, Yang Z-Y, Andersen H, Sun S, Holdaway HA, Kong W-P, Lewis MG, Higgs S, Rossmann MG, Rao S, Nabel GJ. 2010. A virus-like particle vaccine for epidemic Chikungunya virus protects nonhuman primates against infection. Nat Med 16:334-338.

146. Metz SW, Gardner J, Geertsema C, Le TT, Goh L, Vlak JM, Suhrbier A, Pijlman GP. 2013. Effective Chikungunya Virus-like Particle Vaccine Produced in Insect Cells. PLoS Negl Trop Dis 7:e2124.

147. Chang L-J, Dowd KA, Mendoza FH, Saunders JG, Sitar S, Plummer SH, Yamshchikov G, Sarwar UN, Hu Z, Enama ME, Bailer RT, Koup RA, Schwartz RM, Akahata W, Nabel GJ, Mascola JR, Pierson TC, Graham BS, Ledgerwood JE. Safety and tolerability of chikungunya virus-like particle vaccine in healthy adults: a phase 1 dose-escalation trial. The Lancet 384:2046-2052.

148. Hallengard D, Kakoulidou M, Lulla A, Kummerer BM, Johansson DX, Mutso M, Lulla V, Fazakerley JK, Roques P, Le Grand R, Merits A, Liljestrom P. 2014. Novel attenuated Chikungunya vaccine candidates elicit protective immunity in C57BL/6 mice. J Virol 88:2858-2866.

149. Plante K, Wang E, Partidos CD, Weger J, Gorchakov R, Tsetsarkin K, Borland EM, Powers AM, Seymour R, Stinchcomb DT, Osorio JE, Frolov I, Weaver SC. 2011. Novel chikungunya vaccine candidate with an IRES-based attenuation and host range alteration mechanism. PLoS Pathog 7:e1002142.

150. Plante KS, Rossi SL, Bergren NA, Seymour RL, Weaver SC. 2015. Extended Preclinical Safety, Efficacy and Stability Testing of a Live-attenuated Chikungunya Vaccine Candidate. PLoS Negl Trop Dis 9:e0004007.

151. Partidos CD, Paykel J, Weger J, Borland EM, Powers AM, Seymour R, Weaver SC, Stinchcomb DT, Osorio JE. 2012. Cross-protective immunity against o‘nyong-nyong virus afforded by a novel recombinant chikungunya vaccine. Vaccine 30:4638-4643.

167

152. Ramsauer K, Schwameis M, Firbas C, Müllner M, Putnak RJ, Thomas SJ, Desprès P, Tauber E, Jilma B, Tangy F. Immunogenicity, safety, and tolerability of a recombinant measles-virus-based chikungunya vaccine: a randomised, double-blind, placebo-controlled, active-comparator, first-in-man trial. The Lancet Infectious Diseases 15:519-527.

153. Labadie K, Larcher T, Joubert C, Mannioui A, Delache B, Brochard P, Guigand L, Dubreil L, Lebon P, Verrier B, de Lamballerie X, Suhrbier A, Cherel Y, Le Grand R, Roques P. 2010. Chikungunya disease in nonhuman primates involves long-term viral persistence in macrophages. J Clin Invest 120:894-906.

154. Messaoudi I, Vomaske J, Totonchy T, Kreklywich CN, Haberthur K, Springgay L, Brien JD, Diamond MS, Defilippis VR, Streblow DN. 2013. Chikungunya virus infection results in higher and persistent viral replication in aged rhesus macaques due to defects in anti-viral immunity. PLoS Negl Trop Dis 7:e2343.

155. Chen CI, Clark DC, Pesavento P, Lerche NW, Luciw PA, Reisen WK, Brault AC. 2010. Comparative pathogenesis of epidemic and enzootic Chikungunya viruses in a pregnant Rhesus macaque model. Am J Trop Med Hyg 83:1249- 1258.

156. Couderc T, Chretien F, Schilte C, Disson O, Brigitte M, Guivel-Benhassine F, Touret Y, Barau G, Cayet N, Schuffenecker I, Despres P, Arenzana- Seisdedos F, Michault A, Albert ML, Lecuit M. 2008. A mouse model for Chikungunya: young age and inefficient type-I interferon signaling are risk factors for severe disease. PLoS Pathog 4:e29.

157. Hawman DW, Stoermer KA, Montgomery SA, Pal P, Oko L, Diamond MS, Morrison TE. 2013. Chronic joint disease caused by persistent Chikungunya virus infection is controlled by the adaptive immune response. J Virol 87:13878- 13888.

158. Morrison TE, Oko L, Montgomery SA, Whitmore AC, Lotstein AR, Gunn BM, Elmore SA, Heise MT. 2011. A mouse model of chikungunya virus-induced musculoskeletal inflammatory disease: evidence of arthritis, tenosynovitis, myositis, and persistence. Am J Pathol 178:32-40.

159. Gardner J, Anraku I, Le TT, Larcher T, Major L, Roques P, Schroder WA, Higgs S, Suhrbier A. 2010. Chikungunya virus arthritis in adult wild-type mice. J Virol 84:8021-8032.

168

160. Ziegler SA, Lu L, da Rosa AP, Xiao SY, Tesh RB. 2008. An animal model for studying the pathogenesis of chikungunya virus infection. Am J Trop Med Hyg 79:133-139.

161. Morrison TE, Whitmore AC, Shabman RS, Lidbury BA, Mahalingam S, Heise MT. 2006. Characterization of Ross River virus tropism and virus-induced inflammation in a mouse model of viral arthritis and myositis. J Virol 80:737-749.

162. Seymour RL, Rossi SL, Bergren NA, Plante KS, Weaver SC. 2013. The role of innate versus adaptive immune responses in a mouse model of O'nyong-nyong virus infection. Am J Trop Med Hyg 88:1170-1179.

163. Sourisseau M, Schilte C, Casartelli N, Trouillet C, Guivel-Benhassine F, Rudnicka D, Sol-Foulon N, Le Roux K, Prevost MC, Fsihi H, Frenkiel MP, Blanchet F, Afonso PV, Ceccaldi PE, Ozden S, Gessain A, Schuffenecker I, Verhasselt B, Zamborlini A, Saib A, Rey FA, Arenzana-Seisdedos F, Despres P, Michault A, Albert ML, Schwartz O. 2007. Characterization of reemerging chikungunya virus. PLoS Pathog 3:e89.

164. Wauquier N, Becquart P, Nkoghe D, Padilla C, Ndjoyi-Mbiguino A, Leroy EM. 2011. The acute phase of Chikungunya virus infection in humans is associated with strong innate immunity and T CD8 cell activation. J Infect Dis 204:115-123.

165. Schilte C, Couderc T, Chretien F, Sourisseau M, Gangneux N, Guivel- Benhassine F, Kraxner A, Tschopp J, Higgs S, Michault A, Arenzana- Seisdedos F, Colonna M, Peduto L, Schwartz O, Lecuit M, Albert ML. 2010. Type I IFN controls chikungunya virus via its action on nonhematopoietic cells. J Exp Med 207:429-442.

166. Ng LF, Chow A, Sun YJ, Kwek DJ, Lim PL, Dimatatac F, Ng LC, Ooi EE, Choo KH, Her Z, Kourilsky P, Leo YS. 2009. IL-1beta, IL-6, and RANTES as biomarkers of Chikungunya severity. PLoS One 4:e4261.

167. Werneke SW, Schilte C, Rohatgi A, Monte KJ, Michault A, Arenzana- Seisdedos F, Vanlandingham DL, Higgs S, Fontanet A, Albert ML, Lenschow DJ. 2011. ISG15 Is Critical in the Control of Chikungunya Virus Infection Independent of UbE1L Mediated Conjugation. PLoS Pathog 7:e1002322.

169

168. Poo YS, Rudd PA, Gardner J, Wilson JA, Larcher T, Colle MA, Le TT, Nakaya HI, Warrilow D, Allcock R, Bielefeldt-Ohmann H, Schroder WA, Khromykh AA, Lopez JA, Suhrbier A. 2014. Multiple immune factors are involved in controlling acute and chronic chikungunya virus infection. PLoS Negl Trop Dis 8:e3354.

169. Teo TH, Her Z, Tan JJ, Lum FM, Lee WW, Chan YH, Ong RY, Kam YW, Leparc-Goffart I, Gallian P, Renia L, de Lamballerie X, Ng LF. 2015. Caribbean and La Reunion Chikungunya Virus Isolates Differ in Their Capacity To Induce Proinflammatory Th1 and NK Cell Responses and Acute Joint Pathology. J Virol 89:7955-7969.

170. Hoarau JJ, Jaffar Bandjee MC, Trotot PK, Das T, Li-Pat-Yuen G, Dassa B, Denizot M, Guichard E, Ribera A, Henni T, Tallet F, Moiton MP, Gauzere BA, Bruniquet S, Jaffar Bandjee Z, Morbidelli P, Martigny G, Jolivet M, Gay F, Grandadam M, Tolou H, Vieillard V, Debre P, Autran B, Gasque P. 2010. Persistent chronic inflammation and infection by Chikungunya arthritogenic alphavirus in spite of a robust host immune response. J Immunol 184:5914-5927.

171. Teng TS, Foo SS, Simamarta D, Lum FM, Teo TH, Lulla A, Yeo NK, Koh EG, Chow A, Leo YS, Merits A, Chin KC, Ng LF. 2012. Viperin restricts chikungunya virus replication and pathology. J Clin Invest 122:4447-4460.

172. Gardner CL, Burke CW, Higgs ST, Klimstra WB, Ryman KD. 2012. Interferon- alpha/beta deficiency greatly exacerbates arthritogenic disease in mice infected with wild-type chikungunya virus but not with the cell culture-adapted live- attenuated 181/25 vaccine candidate. Virology 425:103-112.

173. Her Z, Malleret B, Chan M, Ong EK, Wong SC, Kwek DJ, Tolou H, Lin RT, Tambyah PA, Renia L, Ng LF. 2010. Active infection of human blood monocytes by Chikungunya virus triggers an innate immune response. J Immunol 184:5903- 5913.

174. Rudd PA, Wilson J, Gardner J, Larcher T, Babarit C, Le TT, Anraku I, Kumagai Y, Loo YM, Gale M, Jr., Akira S, Khromykh AA, Suhrbier A. 2012. Interferon response factors 3 and 7 protect against Chikungunya virus hemorrhagic fever and shock. J Virol 86:9888-9898.

175. Honda K, Taniguchi T. 2006. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol 6:644- 658.

176. Schoggins JW, Rice CM. 2011. Interferon-stimulated genes and their antiviral effector functions. Current opinion in virology 1:519-525.

170

177. Jones PH, Maric M, Madison MN, Maury W, Roller RJ, Okeoma CM. 2013. BST-2/tetherin-mediated restriction of chikungunya (CHIKV) VLP budding is counteracted by CHIKV non-structural protein 1 (nsP1). Virology 438:37-49.

178. Brehin AC, Casademont I, Frenkiel MP, Julier C, Sakuntabhai A, Despres P. 2009. The large form of human 2',5'-Oligoadenylate Synthetase (OAS3) exerts antiviral effect against Chikungunya virus. Virology 384:216-222.

179. Fros JJ, Liu WJ, Prow NA, Geertsema C, Ligtenberg M, Vanlandingham DL, Schnettler E, Vlak JM, Suhrbier A, Khromykh AA, Pijlman GP. 2010. Chikungunya virus nonstructural protein 2 inhibits type I/II interferon-stimulated JAK-STAT signaling. J Virol 84:10877-10887.

180. Garmashova N, Gorchakov R, Frolova E, Frolov I. 2006. Sindbis virus nonstructural protein nsP2 is cytotoxic and inhibits cellular transcription. J Virol 80:5686-5696.

181. Garmashova N, Gorchakov R, Volkova E, Paessler S, Frolova E, Frolov I. 2007. The Old World and New World alphaviruses use different virus-specific proteins for induction of transcriptional shutoff. J Virol 81:2472-2484.

182. Akhrymuk I, Kulemzin SV, Frolova EI. 2012. Evasion of the innate immune response: the Old World alphavirus nsP2 protein induces rapid degradation of Rpb1, a catalytic subunit of RNA polymerase II. J Virol 86:7180-7191.

183. Gorchakov R, Frolova E, Frolov I. 2005. Inhibition of transcription and translation in Sindbis virus-infected cells. J Virol 79:9397-9409.

184. Gorchakov R, Frolova E, Williams BR, Rice CM, Frolov I. 2004. PKR- dependent and -independent mechanisms are involved in translational shutoff during Sindbis virus infection. J Virol 78:8455-8467.

185. White LK, Sali T, Alvarado D, Gatti E, Pierre P, Streblow D, Defilippis VR. 2011. Chikungunya virus induces IPS-1-dependent innate immune activation and protein kinase R-independent translational shutoff. J Virol 85:606-620.

186. Stoermer Burrack KA, Hawman DW, Jupille HJ, Oko L, Minor M, Shives KD, Gunn BM, Long KM, Morrison TE. 2014. Attenuating mutations in nsP1 reveal tissue-specific mechanisms for control of Ross River virus infection. J Virol 88:3719-3732.

171

187. Kelvin AA, Banner D, Silvi G, Moro ML, Spataro N, Gaibani P, Cavrini F, Pierro A, Rossini G, Cameron MJ, Bermejo-Martin JF, Paquette SG, Xu L, Danesh A, Farooqui A, Borghetto I, Kelvin DJ, Sambri V, Rubino S. 2011. Inflammatory cytokine expression is associated with chikungunya virus resolution and symptom severity. PLoS Negl Trop Dis 5:e1279.

188. Reddy V, Mani RS, Desai A, Ravi V. 2014. Correlation of plasma viral loads and presence of Chikungunya IgM antibodies with cytokine/chemokine levels during acute Chikungunya virus infection. J Med Virol 86:1393-1401.

189. Santiago FW, Halsey ES, Siles C, Vilcarromero S, Guevara C, Silvas JA, Ramal C, Ampuero JS, Aguilar PV. 2015. Long-Term Arthralgia after Mayaro Virus Infection Correlates with Sustained Pro-inflammatory Cytokine Response. PLoS Negl Trop Dis 9:e0004104.

190. Rulli NE, Rolph MS, Srikiatkhachorn A, Anantapreecha S, Guglielmotti A, Mahalingam S. 2011. Protection from arthritis and myositis in a mouse model of acute chikungunya virus disease by bindarit, an inhibitor of monocyte chemotactic protein-1 synthesis. J Infect Dis 204:1026-1030.

191. Poo YS, Nakaya H, Gardner J, Larcher T, Schroder WA, Le TT, Major LD, Suhrbier A. 2014. CCR2 deficiency promotes exacerbated chronic erosive neutrophil-dominated chikungunya virus arthritis. J Virol 88:6862-6872.

192. Petitdemange C, Becquart P, Wauquier N, Beziat V, Debre P, Leroy EM, Vieillard V. 2011. Unconventional repertoire profile is imprinted during acute chikungunya infection for natural killer cells polarization toward cytotoxicity. PLoS Pathog 7:e1002268.

193. Lidbury BA, Simeonovic C, Maxwell GE, Marshall ID, Hapel AJ. 2000. Macrophage-induced muscle pathology results in morbidity and mortality for Ross River virus-infected mice. J Infect Dis 181:27-34.

194. Lidbury BA, Rulli NE, Suhrbier A, Smith PN, McColl SR, Cunningham AL, Tarkowski A, van Rooijen N, Fraser RJ, Mahalingam S. 2008. Macrophage- derived proinflammatory factors contribute to the development of arthritis and myositis after infection with an arthrogenic alphavirus. J Infect Dis 197:1585- 1593.

195. Chen W, Foo SS, Taylor A, Lulla A, Merits A, Hueston L, Forwood MR, Walsh NC, Sims NA, Herrero LJ, Mahalingam S. 2015. Bindarit, an inhibitor of monocyte chemotactic protein synthesis, protects against bone loss induced by chikungunya virus infection. J Virol 89:581-593.

172

196. Chen W, Foo SS, Rulli NE, Taylor A, Sheng KC, Herrero LJ, Herring BL, Lidbury BA, Li RW, Walsh NC, Sims NA, Smith PN, Mahalingam S. 2014. Arthritogenic alphaviral infection perturbs osteoblast function and triggers pathologic bone loss. Proc Natl Acad Sci U S A 111:6040-6045.

197. Gunn BM, Morrison TE, Whitmore AC, Blevins LK, Hueston L, Fraser RJ, Herrero LJ, Ramirez R, Smith PN, Mahalingam S, Heise MT. 2012. Mannose binding lectin is required for alphavirus-induced arthritis/myositis. PLoS Pathog 8:e1002586.

198. Morrison TE, Fraser RJ, Smith PN, Mahalingam S, Heise MT. 2007. Complement contributes to inflammatory tissue destruction in a mouse model of Ross River virus-induced disease. J Virol 81:5132-5143.

199. Zaid A, Rulli NE, Rolph MS, Suhrbier A, Mahalingam S. 2011. Disease exacerbation by etanercept in a mouse model of alphaviral arthritis and myositis. Arthritis & Rheumatism 63:488-491.

200. Stoermer KA, Burrack A, Oko L, Montgomery SA, Borst LB, Gill RG, Morrison TE. 2012. Genetic ablation of arginase 1 in macrophages and neutrophils enhances clearance of an arthritogenic alphavirus. J Immunol 189:4047-4059.

201. Lum FM, Teo TH, Lee WW, Kam YW, Renia L, Ng LF. 2013. An essential role of antibodies in the control of Chikungunya virus infection. J Immunol 190:6295- 6302.

202. Hawman David W, Fox Julie M, Ashbrook Alison W, May Nicholas A, Schroeder Kristin MS, Torres Raul M, Crowe James E, Dermody Terence S, Diamond Michael S, Morrison Thomas E. 2016. Pathogenic Chikungunya Virus Evades B Cell Responses to Establish Persistence. Cell Reports doi:10.1016/j.celrep.2016.06.076.

203. Burrack KS, Montgomery SA, Homann D, Morrison TE. 2015. CD8+ T cells control Ross River virus infection in musculoskeletal tissues of infected mice. J Immunol 194:678-689.

204. Teo TH, Lum FM, Claser C, Lulla V, Lulla A, Merits A, Renia L, Ng LF. 2013. A pathogenic role for CD4+ T cells during Chikungunya virus infection in mice. J Immunol 190:259-269.

173

205. Hoarau JJ, Gay F, Pelle O, Samri A, Jaffar-Bandjee MC, Gasque P, Autran B. 2013. Identical strength of the T cell responses against E2, nsP1 and capsid CHIKV proteins in recovered and chronic patients after the epidemics of 2005- 2006 in La Reunion Island. PLoS One 8:e84695.

206. Chu H, Das SC, Fuchs JF, Suresh M, Weaver SC, Stinchcomb DT, Partidos CD, Osorio JE. 2013. Deciphering the protective role of adaptive immunity to CHIKV/IRES a novel candidate vaccine against Chikungunya in the A129 mouse model. Vaccine 31:3353-3360.

207. Calisher CH, el-Kafrawi AO, Al-Deen Mahmud MI, Travassos da Rosa AP, Bartz CR, Brummer-Korvenkontio M, Haksohusodo S, Suharyono W. 1986. Complex-specific immunoglobulin M antibody patterns in humans infected with alphaviruses. J Clin Microbiol 23:155-159.

208. Schilte C, Staikovsky F, Couderc T, Madec Y, Carpentier F, Kassab S, Albert ML, Lecuit M, Michault A. 2013. Chikungunya virus-associated long- term arthralgia: a 36-month prospective longitudinal study. PLoS Negl Trop Dis 7:e2137.

209. Chopra A, Anuradha V, Lagoo-Joshi V, Kunjir V, Salvi S, Saluja M. 2008. Chikungunya virus aches and pains: an emerging challenge. Arthritis Rheum 58:2921-2922.

210. Carter IW, Smythe LD, Fraser JR, Stallman ND, Cloonan MJ. 1985. Detection of Ross River virus immunoglobulin M antibodies by enzyme-linked immunosorbent assay using antibody class capture and comparison with other methods. Pathology 17:503-508.

211. Kam YW, Lee WW, Simarmata D, Le Grand R, Tolou H, Merits A, Roques P, Ng LF. 2014. Unique epitopes recognized by antibodies induced in Chikungunya virus-infected non-human primates: implications for the study of immunopathology and vaccine development. PLoS One 9:e95647.

212. Kam YW, Lum FM, Teo TH, Lee WW, Simarmata D, Harjanto S, Chua CL, Chan YF, Wee JK, Chow A, Lin RT, Leo YS, Le Grand R, Sam IC, Tong JC, Roques P, Wiesmuller KH, Renia L, Rotzschke O, Ng LF. 2012. Early neutralizing IgG response to Chikungunya virus in infected patients targets a dominant linear epitope on the E2 glycoprotein. EMBO Mol Med 4:330-343.

213. Kam YW, Simarmata D, Chow A, Her Z, Teng TS, Ong EK, Renia L, Leo YS, Ng LF. 2012. Early appearance of neutralizing immunoglobulin G3 antibodies is associated with chikungunya virus clearance and long-term clinical protection. J Infect Dis 205:1147-1154.

174

214. Kam YW, Lee WW, Simarmata D, Harjanto S, Teng TS, Tolou H, Chow A, Lin RT, Leo YS, Renia L, Ng LF. 2012. Longitudinal analysis of the human antibody response to Chikungunya virus infection: implications for serodiagnosis and vaccine development. J Virol 86:13005-13015.

215. Weger-Lucarelli J, Aliota MT, Kamlangdee A, Osorio JE. 2015. Identifying the Role of E2 Domains on Alphavirus Neutralization and Protective Immune Responses. PLoS Negl Trop Dis 9:e0004163.

216. McClain DJ, Pittman PR, Ramsburg HH, Nelson GO, Rossi CA, Mangiafico JA, Schmaljohn AL, Malinoski FJ. 1998. Immunologic interference from sequential administration of live attenuated alphavirus vaccines. J Infect Dis 177:634-641.

217. Neighbours LM, Long K, Whitmore AC, Heise MT. 2012. Myd88-dependent toll-like receptor 7 signaling mediates protection from severe Ross River virus- induced disease in mice. J Virol 86:10675-10685.

218. Her Z, Teng TS, Tan JJ, Teo TH, Kam YW, Lum FM, Lee WW, Gabriel C, Melchiotti R, Andiappan AK, Lulla V, Lulla A, Win MK, Chow A, Biswas SK, Leo YS, Lecuit M, Merits A, Renia L, Ng LF. 2015. Loss of TLR3 aggravates CHIKV replication and pathology due to an altered virus-specific neutralizing antibody response. EMBO Mol Med 7:24-41.

219. Goh LY, Hobson-Peters J, Prow NA, Gardner J, Bielefeldt-Ohmann H, Pyke AT, Suhrbier A, Hall RA. 2013. Neutralizing monoclonal antibodies to the E2 protein of chikungunya virus protects against disease in a mouse model. Clin Immunol 149:487-497.

220. Pal P, Dowd KA, Brien JD, Edeling MA, Gorlatov S, Johnson S, Lee I, Akahata W, Nabel GJ, Richter MK, Smit JM, Fremont DH, Pierson TC, Heise MT, Diamond MS. 2013. Development of a highly protective combination monoclonal antibody therapy against Chikungunya virus. PLoS Pathog 9:e1003312.

221. Smith SA, Silva LA, Fox JM, Flyak AI, Kose N, Sapparapu G, Khomandiak S, Ashbrook AW, Kahle KM, Fong RH, Swayne S, Doranz BJ, McGee CE, Heise MT, Pal P, Brien JD, Austin SK, Diamond MS, Dermody TS, Crowe JE, Jr. 2015. Isolation and Characterization of Broad and Ultrapotent Human Monoclonal Antibodies with Therapeutic Activity against Chikungunya Virus. Cell Host Microbe 18:86-95.

222. Brighton SW, Prozesky OW, de la Harpe AL. 1983. Chikungunya virus infection. A retrospective study of 107 cases. S Afr Med J 63:313-315.

175

223. Fraser JR. 1986. Epidemic polyarthritis and Ross River virus disease. Clin Rheum Dis 12:369-388.

224. Laine M, Luukkainen R, Jalava J, Ilonen J, Kuusisto P, Toivanen A. 2000. Prolonged arthritis associated with sindbis-related (Pogosta) virus infection. Rheumatology (Oxford) 39:1272-1274.

225. Niklasson B, Espmark A. 1986. Ockelbo disease: arthralgia 3-4 years after infection with a Sindbis virus related agent. The Lancet 1:1039-1040.

226. Simon F, Parola P, Grandadam M, Fourcade S, Oliver M, Brouqui P, Hance P, Kraemer P, Ali Mohamed A, de Lamballerie X, Charrel R, Tolou H. 2007. Chikungunya infection: an emerging rheumatism among travelers returned from Indian Ocean islands. Report of 47 cases. Medicine (Baltimore) 86:123-137.

227. Sissoko D, Malvy D, Ezzedine K, Renault P, Moscetti F, Ledrans M, Pierre V. 2009. Post-epidemic Chikungunya disease on Reunion Island: course of rheumatic manifestations and associated factors over a 15-month period. PLoS Negl Trop Dis 3:e389.

228. Dupuis-Maguiraga L, Noret M, Brun S, Le Grand R, Gras G, Roques P. 2012. Chikungunya disease: infection-associated markers from the acute to the chronic phase of arbovirus-induced arthralgia. PLoS Negl Trop Dis 6:e1446.

229. Chow A, Her Z, Ong EK, Chen JM, Dimatatac F, Kwek DJ, Barkham T, Yang H, Renia L, Leo YS, Ng LF. 2011. Persistent arthralgia induced by Chikungunya virus infection is associated with interleukin-6 and granulocyte macrophage colony-stimulating factor. J Infect Dis 203:149-157.

230. Chaaitanya IK, Muruganandam N, Sundaram SG, Kawalekar O, Sugunan AP, Manimunda SP, Ghosal SR, Muthumani K, Vijayachari P. 2011. Role of proinflammatory cytokines and chemokines in chronic arthropathy in CHIKV infection. Viral Immunol 24:265-271.

231. Gerardin P, Fianu A, Malvy D, Mussard C, Boussaid K, Rollot O, Michault A, Gauzere BA, Breart G, Favier F. 2011. Perceived morbidity and community burden after a Chikungunya outbreak: the TELECHIK survey, a population-based cohort study. BMC Med 9:5.

232. Couturier E, Guillemin F, Mura M, Leon L, Virion JM, Letort MJ, De Valk H, Simon F, Vaillant V. 2012. Impaired quality of life after chikungunya virus infection: a 2-year follow-up study. Rheumatology (Oxford) 51:1315-1322.

176

233. Gerardin P, Fianu A, Michault A, Mussard C, Boussaid K, Rollot O, Grivard P, Kassab S, Bouquillard E, Borgherini G, Gauzere BA, Malvy D, Breart G, Favier F. 2013. Predictors of Chikungunya rheumatism: a prognostic survey ancillary to the TELECHIK cohort study. Arthritis Res Ther 15:R9.

234. Essackjee K, Goorah S, Ramchurn SK, Cheeneebash J, Walker-Bone K. 2013. Prevalence of and risk factors for chronic arthralgia and rheumatoid-like polyarthritis more than 2 years after infection with chikungunya virus. Postgrad Med J 89:440-447.

235. Rodriguez-Morales AJ, Calvache-Benavides CE, Giraldo-Gomez J, Hurtado- Hurtado N, Yepes-Echeverri MC, Garcia-Loaiza CJ, Patino-Barbosa AM, Sabogal-Roman JA, Patino-Valencia S, Hidalgo-Zambrano DM, Vasquez- Serna H, Jimenez-Canizales CE. 2015. Post-chikungunya chronic arthralgia: Results from a retrospective follow-up study of 131 cases in Tolima, Colombia. Travel Med Infect Dis doi:10.1016/j.tmaid.2015.09.001.

236. Rodriguez-Morales AJ, Gil-Restrepo AF, Ramírez-Jaramillo V, Montoya- Arias CP, Acevedo-Mendoza WF, Bedoya-Arias JE, Chica-Quintero LA, Murillo-García DR, García-Robledo JE, Castrillón-Spitia JD, Londoño JJ, Bedoya-Rendón HD, Cárdenas-Pérez JdJ, Cardona-Ospina JA, Lagos- Grisales GJ. 2016. Post-chikungunya chronic inflammatory rheumatism: results from a retrospective follow-up study of 283 adult and child cases in La Virginia, Risaralda, Colombia. F1000Research 5:360.

237. Rodriguez-Morales AJ, Villamil-Gomez W, Merlano-Espinosa M, Simone- Kleber L. 2015. Post-chikungunya chronic arthralgia: a first retrospective follow- up study of 39 cases in Colombia. Clin Rheumatol doi:10.1007/s10067-015- 3041-8:1-2.

238. Laoprasopwattana K, Kaewjungwad L, Jarumanokul R, Geater A. 2012. Differential diagnosis of Chikungunya, dengue viral infection and other acute febrile illnesses in children. Pediatr Infect Dis J 31:459-463.

239. Mohd Zim MA, Sam IC, Omar SF, Chan YF, AbuBakar S, Kamarulzaman A. 2013. Chikungunya infection in Malaysia: comparison with dengue infection in adults and predictors of persistent arthralgia. J Clin Virol 56:141-145.

240. Yaseen HM, Simon F, Deparis X, Marimoutou C. 2014. Identification of initial severity determinants to predict arthritis after chikungunya infection in a cohort of French gendarmes. BMC Musculoskelet Disord 15:249.

177

241. Nakaya HI, Gardner J, Poo YS, Major L, Pulendran B, Suhrbier A. 2012. Gene profiling of Chikungunya virus arthritis in a mouse model reveals significant overlap with rheumatoid arthritis. Arthritis Rheum 64:3553-3563.

242. Schattner A, Rager-Zisman B. 1990. Virus-Induced Autoimmunity. Review of Infectious Diseases 12:204-222.

243. Fujinami RS, von Herrath MG, Christen U, Whitton JL. 2006. Molecular Mimicry, Bystander Activation, or Viral Persistence: Infections and Autoimmune Disease. Clinical Microbiology Reviews 19:80-94.

244. Gilliet M, Cao W, Liu Y-J. 2008. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat Rev Immunol 8:594-606.

245. Mokhtarian F, Zhang Z, Shi Y, Gonzales E, Sobel RA. 1999. Molecular mimicry between a viral peptide and a myelin oligodendrocyte glycoprotein peptide induces autoimmune demyelinating disease in mice. J Neuroimmunol 95:43-54.

246. Hueber W, Tomooka BH, Zhao X, Kidd BA, Drijfhout JW, Fries JF, van Venrooij WJ, Metzger AL, Genovese MC, Robinson WH. 2007. Proteomic analysis of secreted proteins in early rheumatoid arthritis: anti-citrulline autoreactivity is associated with up regulation of proinflammatory cytokines. Ann Rheum Dis 66:712-719.

247. Koch AE, Kunkel SL, Harlow LA, Johnson B, Evanoff HL, Haines GK, Burdick MD, Pope RM, Strieter RM. 1992. Enhanced production of monocyte chemoattractant protein-1 in rheumatoid arthritis. J Clin Invest 90:772-779.

248. Houssiau FA, Devogelaer J-P, Damme JV, Deuxchaisnes CND, Snick JV. 1988. Interleukin-6 in synovial fluid and serum of patients with rheumatoid arthritis and other inflammatory arthritides. Arthritis & Rheumatism 31:784-788.

249. Cornish AL, Campbell IK, McKenzie BS, Chatfield S, Wicks IP. 2009. G-CSF and GM-CSF as therapeutic targets in rheumatoid arthritis. Nat Rev Rheumatol 5:554-559.

250. Soden M, Vasudevan H, Roberts B, Coelen R, Hamlin G, Vasudevan S, La Brooy J. 2000. Detection of Viral Ribonucleic Acid and Histological Analysis of Inflamed Synovium in Ross River Virus Infection. Arthritis and Rheumatism 43:365-369.

178

251. Szekanecz Z, Koch AE. 2007. Macrophages and their products in rheumatoid arthritis. Curr Opin Rheumatol 19:289-295.

252. Moro ML, Grilli E, Corvetta A, Silvi G, Angelini R, Mascella F, Miserocchi F, Sambo P, Finarelli AC, Sambri V, Gagliotti C, Massimiliani E, Mattivi A, Pierro AM, Macini P, Study Group "Infezioni da Chikungunya in E-R. 2012. Long-term chikungunya infection clinical manifestations after an outbreak in Italy: a prognostic cohort study. J Infect 65:165-172.

253. Bouquillard E, Combe B. 2009. A report of 21 cases of rheumatoid arthritis following Chikungunya fever. A mean follow-up of two years. Joint Bone Spine 76:654-657.

254. Maud F, Emilie J, Simon R, Bruno G, Fabrice S. 2015. Post-Chikungunya Rheumatoid Arthritis, Saint Martin. Emerging Infectious Disease journal 21:530.

255. Pandya S. 2008. Methotrexate and hydroxychloroquine combination therapy in chronic chikungunya arthritis: a 16 week study. Indian Journal of Rheumatology 3:93-97.

256. Szekanecz Z, Soos L, Szabo Z, Fekete A, Kapitany A, Vegvari A, Sipka S, Szucs G, Szanto S, Lakos G. 2008. Anti-citrullinated protein antibodies in rheumatoid arthritis: as good as it gets? Clin Rev Allergy Immunol 34:26-31.

257. Ozden S, Huerre M, Riviere JP, Coffey LL, Afonso PV, Mouly V, de Monredon J, Roger JC, El Amrani M, Yvin JL, Jaffar MC, Frenkiel MP, Sourisseau M, Schwartz O, Butler-Browne G, Despres P, Gessain A, Ceccaldi PE. 2007. Human muscle satellite cells as targets of Chikungunya virus infection. PLoS One 2:e527.

258. Jupille HJ, Oko L, Stoermer KA, Heise MT, Mahalingam S, Gunn BM, Morrison TE. 2011. Mutations in nsP1 and PE2 are critical determinants of Ross River virus-induced musculoskeletal inflammatory disease in a mouse model. Virology 410:216-227.

259. Mainou BA, Zamora PF, Ashbrook AW, Dorset DC, Kim KS, Dermody TS. 2013. Reovirus Cell Entry Requires Functional Microtubules. mBio 4:e00405- 00413.

260. Ashbrook AW, Burrack KS, Silva LA, Montgomery SA, Heise MT, Morrison TE, Dermody TS. 2014. Residue 82 of the Chikungunya virus E2 attachment protein modulates viral dissemination and arthritis in mice. J Virol 88:12180- 12192.

179

261. Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast and memory- efficient alignment of short DNA sequences to the human genome. Genome Biol 10:R25.

262. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078-2079.

263. Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative Genomics Viewer. Nature biotechnology 29:24- 26.

264. Burt FJ, Rolph MS, Rulli NE, Mahalingam S, Heise MT. 2012. Chikungunya: a re-emerging virus. Lancet 379:662-671.

265. Tsetsarkin KA, Chen R, Sherman MB, Weaver SC. 2011. Chikungunya virus: evolution and genetic determinants of emergence. Curr Opin Virol 1:310-317.

266. Oliva O, San Martin JL, Nasci RS. 2011. Preparedness and Response for Chikungunya Virus: Introduction in the Americas. PAHO, Washington, D.C.

267. Simon F, Javelle E, Oliver M, Leparc-Goffart I, Marimoutou C. 2011. Chikungunya virus infection. Curr Infect Dis Rep 13:218-228.

268. Grivard P, Le Roux K, Laurent P, Fianu A, Perrau J, Gigan J, Hoarau G, Grondin N, Staikowsky F, Favier F, Michault A. 2007. Molecular and serological diagnosis of Chikungunya virus infection. Pathol Biol (Paris) 55:490- 494.

269. Jose J, Snyder JE, Kuhn RJ. 2009. A structural and functional perspective of alphavirus replication and assembly. Future Microbiol 4:837-856.

270. Raju R, Huang HV. 1991. Analysis of Sindbis virus promoter recognition in vivo, using novel vectors with two subgenomic mRNA promoters. J Virol 65:2501- 2510.

271. Lemm JA, Rice CM. 1993. Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcription. J Virol 67:1916-1926.

180

272. Atasheva S, Krendelchtchikova V, Liopo A, Frolova E, Frolov I. 2010. Interplay of acute and persistent infections caused by Venezuelan equine encephalitis virus encoding mutated capsid protein. J Virol 84:10004-10015.

273. Schilte C, Staikowsky F, Couderc T, Madec Y, Carpentier F, Kassab S, Albert ML, Lecuit M, Michault A. 2013. Chikungunya virus-associated long- term arthralgia: a 36-month prospective longitudinal study. PLoS Negl Trop Dis 7:e2137.

274. Levine B, Hardwick JM, Trapp BD, Crawford TO, Bollinger RC, Griffin DE. 1991. Antibody-Mediated Clearance of Alphavirus Infection from Neurons. Science 254:856-860.

275. Levine B, Griffin DE. 1992. Persistence of viral RNA in mouse brains after recovery from acute alphavirus encephalitis. J Virol 66:6429-6435.

276. Burdeinick-Kerr R, Wind J, Griffin DE. 2007. Synergistic roles of antibody and interferon in noncytolytic clearance of Sindbis virus from different regions of the central nervous system. J Virol 81:5628-5636.

277. Binder GK, Griffin DE. 2001. Interferon--Mediated Site-Specific Clearance of Alphavirus from CNS Neurons. Science 293:303-306.

278. Metcalf TU, Griffin DE. 2011. Alphavirus-induced encephalomyelitis: antibody- secreting cells and viral clearance from the nervous system. J Virol 85:11490- 11501.

279. Tyor WR, Wesselingh S, Levine B, Griffin DE. 1992. Long term intraparenchymal Ig secretion after acute viral encephalitis in mice. J Immunol 149:4016-4020.

280. Hoarau JJ, Jaffar Bandjee MC, Krejbich Trotot P, Das T, Li-Pat-Yuen G, Dassa B, Denizot M, Guichard E, Ribera A, Henni T, Tallet F, Moiton MP, Gauzere BA, Bruniquet S, Jaffar Bandjee Z, Morbidelli P, Martigny G, Jolivet M, Gay F, Grandadam M, Tolou H, Vieillard V, Debre P, Autran B, Gasque P. 2010. Persistent chronic inflammation and infection by Chikungunya arthritogenic alphavirus in spite of a robust host immune response. J Immunol 184:5914-5927.

281. Zare F, Bokarewa M, Nenonen N, Bergstrom T, Alexopoulou L, Flavell RA, Tarkowski A. 2004. Arthritogenic properties of double-stranded (viral) RNA. J Immunol 172:5656-5663.

181

282. Couderc T, Khandoudi N, Grandadam M, Visse C, Gangneux N, Bagot S, Prost JF, Lecuit M. 2009. Prophylaxis and therapy for Chikungunya virus infection. J Infect Dis 200:516-523.

283. Fric J, Bertin-Maghit S, Wang CI, Nardin A, Warter L. 2013. Use of human monoclonal antibodies to treat Chikungunya virus infection. J Infect Dis 207:319- 322.

284. Soumahoro M-K, Boelle P-Y, Gaüzere B-A, Atsou K, Pelat C, Lambert B, La Ruche G, Gastellu-Etchegorry M, Renault P, Sarazin M, Yazdanpanah Y, Flahault A, Malvy D, Hanslik T. 2011. The Chikungunya Epidemic on La Réunion Island in 2005–2006: A Cost-of-Illness Study. PLoS Negl Trop Dis 5:e1197.

285. Weaver SC, Forrester NL. 2015. Chikungunya: Evolutionary history and recent epidemic spread. Antiviral Res 120:32-39.

286. Staples JE, Breiman RF, Powers AM. 2009. Chikungunya fever: an epidemiological review of a re-emerging infectious disease. Clin Infect Dis 49:942-948.

287. Vignuzzi M, Stone JK, Arnold JJ, Cameron CE, Andino R. 2006. Quasispecies diversity determines pathogenesis through cooperative interactions in a viral population. Nature 439:344-348.

288. Homann D, Tishon A, Berger D, Weigle W, Von Herrath M, Oldstone MB. 1998. Evidence for an Underlying CD4 Helper and CD8 T-Cell Defect in B-Cell- Deficient Mice: Failure To Clear Persistent Virus Infection after Adoptive Immunotherapy with Virus-Specific Memory Cells from uMT/uMT Mice. J Virol 72:9208-9216.

289. Goodnow CC, Crosbie J, Adelstein S, Lavoie TB, Smith-Gill SJ, Brink RA, Pritchard-Briscoe H, Wotherspoon JS, Loblay RH, Raphael K, et al. 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334:676-682.

290. Suthar MS, Ma DY, Thomas S, Lund JM, Zhang N, Daffis S, Rudensky AY, Bevan MJ, Clark EA, Kaja MK, Diamond MS, Gale M, Jr. 2010. IPS-1 is essential for the control of West Nile virus infection and immunity. PLoS Pathog 6:e1000757.

182

291. Miner JJ, Aw Yeang HX, Fox JM, Taffner S, Malkova ON, Oh ST, Kim AH, Diamond MS, Lenschow DJ, Yokoyama WM. 2015. Chikungunya viral arthritis in the United States: a mimic of seronegative rheumatoid arthritis. Arthritis Rheumatol 67:1214-1220.

292. Long F, Fong RH, Austin SK, Chen Z, Klose T, Fokine A, Liu Y, Porta J, Sapparapu G, Akahata W, Doranz BJ, Crowe JE, Jr., Diamond MS, Rossmann MG. 2015. Cryo-EM structures elucidate neutralizing mechanisms of anti-chikungunya human monoclonal antibodies with therapeutic activity. Proc Natl Acad Sci U S A 112:13898-13903.

293. Sun S, Xiang Y, Akahata W, Holdaway H, Pal P, Zhang X, Diamond MS, Nabel GJ, Rossmann MG. 2013. Structural analyses at pseudo atomic resolution of Chikungunya virus and antibodies show mechanisms of neutralization. Elife 2:e00435.

294. Gardner CL, Hritz J, Sun C, Vanlandingham DL, Song TY, Ghedin E, Higgs S, Klimstra WB, Ryman KD. 2014. Deliberate attenuation of chikungunya virus by adaptation to heparan sulfate-dependent infectivity: a model for rational arboviral vaccine design. PLoS Negl Trop Dis 8:e2719.

295. Lee CY, Kam YW, Fric J, Malleret B, Koh EG, Prakash C, Huang W, Lee WW, Lin C, Lin RT, Renia L, Wang CI, Ng LF, Warter L. 2011. Chikungunya virus neutralization antigens and direct cell-to-cell transmission are revealed by human antibody-escape mutants. PLoS Pathog 7:e1002390.

296. Ryman KD, Gardner CL, Burke CW, Meier KC, Thompson JM, Klimstra WB. 2007. Heparan sulfate binding can contribute to the neurovirulence of neuroadapted and nonneuroadapted Sindbis viruses. J Virol 81:3563-3573.

297. Seymour RL, Adams AP, Leal G, Alcorn MD, Weaver SC. 2015. A Rodent Model of Chikungunya Virus Infection in RAG1 -/- Mice, with Features of Persistence, for Vaccine Safety Evaluation. PLoS Negl Trop Dis 9:e0003800.

298. Yoon IK, Alera MT, Lago CB, Tac-An IA, Villa D, Fernandez S, Thaisomboonsuk B, Klungthong C, Levy JW, Velasco JM, Roque VG, Jr., Salje H, Macareo LR, Hermann LL, Nisalak A, Srikiatkhachorn A. 2015. High rate of subclinical chikungunya virus infection and association of neutralizing antibody with protection in a prospective cohort in the Philippines. PLoS Negl Trop Dis 9:e0003764.

183

299. Wei X, Decker JM, Wang S, Hui H, Kappes JC, Wu X, Salazar-Gonzalez JF, Salazar MG, Kilby JM, Saag MS, Komarova NL, Nowak MA, Hahn BH, Kwong PD, Shaw GM. 2003. Antibody neutralization and escape by HIV-1. Nature 422:307-312.

300. Cox AL, Mosbruger T, Mao Q, Liu Z, Wang XH, Yang HC, Sidney J, Sette A, Pardoll D, Thomas DL, Ray SC. 2005. Cellular immune selection with hepatitis C virus persistence in humans. J Exp Med 201:1741-1752.

301. Connor RI, Sheridan KE, Ceradini D, Choe S, Landau NR. 1997. Change in Coreceptor Use Correlates with Disease Progression in HIV-1–Infected Individuals. The Journal of Experimental Medicine 185:621-628.

302. Ahmed R, Oldstone MB. 1988. Organ-specific selection of viral variants during chronic infection. J Exp Med 167:1719-1724.

303. Ahmed R, Salmi AA, Butler L, Chiller J, Oldstone MB. 1984. Selection of genetic variants of lymphocytic choriomeningitis virus in spleens of persistently infected mice. Role in suppression of cytotoxic T lymphocyte response and viral persistence. The Journal of Experimental Medicine 160:521-540.

304. Levine B, Griffin DE. 1993. Molecular analysis of neurovirulent strains of Sindbis virus that evolve during persistent infection of scid mice. J Virol 67:6872- 6875.

305. Deuber SA, Pavlovic J. 2007. Virulence of a mouse-adapted Semliki Forest virus strain is associated with reduced susceptibility to interferon. Journal of General Virology 88:1952-1959.

306. Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y. 2006. Molecular Determinants of Ebola Virus Virulence in Mice. PLoS Pathog 2:e73.

307. Gardner CL, Burke CW, Tesfay MZ, Glass PJ, Klimstra WB, Ryman KD. 2008. Eastern and Venezuelan equine encephalitis viruses differ in their ability to infect dendritic cells and macrophages: impact of altered cell tropism on pathogenesis. J Virol 82:10634-10646.

308. Bente D, Gren J, Strong JE, Feldmann H. 2009. Disease modeling for Ebola and Marburg viruses. Disease Models & Mechanisms 2:12-17.

184

309. Yauch LE, Shresta S. 2008. Mouse models of dengue virus infection and disease. Antiviral research 80:87-93.

310. Rohatgi A, Corbo JC, Monte K, Higgs S, Vanlandingham DL, Kardon G, Lenschow DJ. 2014. Infection of myofibers contributes to increased pathogenicity during infection with an epidemic strain of chikungunya virus. J Virol 88:2414-2425.

311. Roussel A, Lescar J, Vaney MC, Wengler G, Wengler G, Rey FA. 2006. Structure and interactions at the viral surface of the envelope protein E1 of Semliki Forest virus. Structure 14:75-86.

312. Jupille HJ, Medina-Rivera M, Hawman DW, Oko L, Morrison TE. 2013. A tyrosine-to-histidine switch at position 18 of the Ross River virus E2 glycoprotein is a determinant of virus fitness in disparate hosts. J Virol 87:5970-5984.

313. Li ML, Liao HJ, Simon LD, Stollar V. 1999. An amino acid change in the exodomain of the E2 protein of Sindbis virus, which impairs the release of virus from chicken cells but not from mosquito cells. Virology 264:187-194.

314. Snyder AJ, Sokoloski KJ, Mukhopadhyay S. 2012. Mutating conserved cysteines in the alphavirus e2 glycoprotein causes virus-specific assembly defects. J Virol 86:3100-3111.

315. Gardner CL, Choi-Nurvitadhi J, Sun C, Bayer A, Hritz J, Ryman KD, Klimstra WB. 2013. Natural variation in the heparan sulfate binding domain of the eastern equine encephalitis virus E2 glycoprotein alters interactions with cell surfaces and virulence in mice. J Virol 87:8582-8590.

316. Kinney RM, Chang GJ, Tsuchiya KR, Sneider JM, Roehrig JT, Woodward TM, Trent DW. 1993. Attenuation of Venezuelan equine encephalitis virus strain TC-83 is encoded by the 5'-noncoding region and the E2 envelope glycoprotein. J Virol 67:1269-1277.

317. Stapleford KA, Moratorio G, Henningsson R, Chen R, Matheus S, Enfissi A, Weissglas-Volkov D, Isakov O, Blanc H, Mounce BC, Dupont-Rouzeyrol M, Shomron N, Weaver S, Fontes M, Rousset D, Vignuzzi M. 2016. Whole- Genome Sequencing Analysis from the Chikungunya Virus Caribbean Outbreak Reveals Novel Evolutionary Genomic Elements. PLoS Negl Trop Dis 10:e0004402.

185

318. Garcia-Moreno M, Sanz MA, Carrasco L. 2016. A Viral mRNA Motif at the 3'- Untranslated Region that Confers Translatability in a Cell-Specific Manner. Implications for Virus Evolution. Sci Rep 6:19217.

319. Kuhn RJ, Griffin DE, Zhang H, Niesters HG, Strauss JH. 1992. Attenuation of Sindbis virus neurovirulence by using defined mutations in nontranslated regions of the genome RNA. J Virol 66:7121-7127.

320. Dickson AM, Anderson JR, Barnhart MD, Sokoloski KJ, Oko L, Opyrchal M, Galanis E, Wilusz CJ, Morrison TE, Wilusz J. 2012. Dephosphorylation of HuR protein during alphavirus infection is associated with HuR relocalization to the cytoplasm. J Biol Chem 287:36229-36238.

321. Barnhart MD, Moon SL, Emch AW, Wilusz CJ, Wilusz J. 2013. Changes in cellular mRNA stability, splicing, and polyadenylation through HuR protein sequestration by a cytoplasmic RNA virus. Cell Rep 5:909-917.

322. Hussain M, Torres S, Schnettler E, Funk A, Grundhoff A, Pijlman GP, Khromykh AA, Asgari S. 2012. West Nile virus encodes a microRNA-like small RNA in the 3' untranslated region which up-regulates GATA4 mRNA and facilitates virus replication in mosquito cells. Nucleic Acids Res 40:2210-2223.

323. Chapman EG, Costantino DA, Rabe JL, Moon SL, Wilusz J, Nix JC, Kieft JS. 2014. The Structural Basis of Pathogenic Subgenomic Flavivirus RNA (sfRNA) Production. Science 344:307-310.

324. Chantler JK, Ford DK, Tingle AJ. 1982. PERSISTENT RUBELLA INFECTION AND RUBELLA-ASSOCIATED ARTHRITIS. The Lancet 319:1323-1325.

325. Chantler JK, Tingle AJ, Petty RE. 1985. Persistent Rubella Virus Infection Associated with Chronic Arthritis in Children. New England Journal of Medicine 313:1117-1123.

326. Menser M, Harley JD, Hertzberg R, Dorman DC, Murphy AM. 1967. PERSISTENCE OF VIRUS IN LENS FOR THREE YEARS AFTER PRENATAL RUBELLA. The Lancet 290:387-388.

327. Sow MS, Etard JF, Baize S, Magassouba N, Faye O, Msellati P, Toure AI, Savane I, Barry M, Delaporte E. 2016. New Evidence of Long-lasting Persistence of Ebola Virus Genetic Material in Semen of Survivors. J Infect Dis doi:10.1093/infdis/jiw078.

186

328. Varkey JB, Shantha JG, Crozier I, Kraft CS, Lyon GM, Mehta AK, Kumar G, Smith JR, Kainulainen MH, Whitmer S, Ströher U, Uyeki TM, Ribner BS, Yeh S. 2015. Persistence of Ebola Virus in Ocular Fluid during Convalescence. New England Journal of Medicine 372:2423-2427.

329. Uyeki TM, Erickson BR, Brown S, McElroy AK, Cannon D, Gibbons A, Sealy T, Kainulainen MH, Schuh AJ, Kraft CS, Mehta AK, Lyon GM, 3rd, Varkey JB, Ribner BS, Ellison RT, 3rd, Carmody E, Nau GJ, Spiropoulou C, Nichol ST, Stroher U. 2016. Ebola Virus Persistence in Semen of Male Survivors. Clin Infect Dis 62:1552-1555.

330. Deen GF, Knust B, Broutet N, Sesay FR, Formenty P, Ross C, Thorson AE, Massaquoi TA, Marrinan JE, Ervin E, Jambai A, McDonald SLR, Bernstein K, Wurie AH, Dumbuya MS, Abad N, Idriss B, Wi T, Bennett SD, Davies T, Ebrahim FK, Meites E, Naidoo D, Smith S, Banerjee A, Erickson BR, Brault A, Durski KN, Winter J, Sealy T, Nichol ST, Lamunu M, Ströher U, Morgan O, Sahr F. 2015. Ebola RNA Persistence in Semen of Ebola Virus Disease Survivors — Preliminary Report. New England Journal of Medicine doi:10.1056/NEJMoa1511410.

331. Chapman NM, Kim KS. 2008. Persistent coxsackievirus infection: enterovirus persistence in chronic myocarditis and dilated cardiomyopathy. Curr Top Microbiol Immunol 323:275-292.

332. Kim KS, Hufnagel G, Chapman NM, Tracy S. 2001. The group B coxsackieviruses and myocarditis. Rev Med Virol 11:355-368.

333. Klingel K, Hohenadl C, Canu A, Albrecht M, Seemann M, Mall G, Kandolf R. 1992. Ongoing enterovirus-induced myocarditis is associated with persistent heart muscle infection: quantitative analysis of virus replication, tissue damage, and inflammation. Proceedings of the National Academy of Sciences of the United States of America 89:314-318.

334. Murray K, Walker C, Herrington E, Lewis JA, McCormick J, Beasley DW, Tesh RB, Fisher-Hoch S. 2010. Persistent infection with West Nile virus years after initial infection. J Infect Dis 201:2-4.

335. Appler KK, Brown AN, Stewart BS, Behr MJ, Demarest VL, Wong SJ, Bernard KA. 2010. Persistence of West Nile virus in the central nervous system and periphery of mice. PLoS One 5:e10649.

336. Matheron S, d'Ortenzio E, Leparc-Goffart I, Hubert B, de Lamballerie X, Yazdanpanah Y. 2016. Long-Lasting Persistence of Zika Virus in Semen. Clin Infect Dis doi:10.1093/cid/ciw509.

187

337. Turmel JM, Abgueguen P, Hubert B, Vandamme YM, Maquart M, Le Guillou- Guillemette H, Leparc-Goffart I. Late sexual transmission of Zika virus related to persistence in the semen. The Lancet 387:2501.

338. Kerr JR. 2000. Pathogenesis of human parvovirus B19 in rheumatic disease. Ann Rheum Dis 59:672-683.

339. Castle SC. 2000. Clinical relevance of age-related immune dysfunction. Clin Infect Dis 31:578-585.

340. Crowley MT, Reilly CR, Lo D. 1999. Influence of lymphocytes on the presence and organization of dendritic cell subsets in the spleen. J Immunol 163:4894- 4900.

341. Teijaro JR, Ng C, Lee AM, Sullivan BM, Sheehan KC, Welch M, Schreiber RD, de la Torre JC, Oldstone MB. 2013. Persistent LCMV infection is controlled by blockade of type I interferon signaling. Science 340:207-211.

342. Wilson EB, Yamada DH, Elsaesser H, Herskovitz J, Deng J, Cheng G, Aronow BJ, Karp CL, Brooks DG. 2013. Blockade of Chronic Type I Interferon Signaling to Control Persistent LCMV Infection. Science 340:202-207.

343. Wherry EJ, Blattman JN, Murali-Krishna K, van der Most R, Ahmed R. 2003. Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment. J Virol 77:4911-4927.

344. Eschli B, Zellweger RM, Wepf A, Lang KS, Quirin K, Weber J, Zinkernagel RM, Hengartner H. 2007. Early antibodies specific for the neutralizing epitope on the receptor binding subunit of the lymphocytic choriomeningitis virus glycoprotein fail to neutralize the virus. J Virol 81:11650-11657.

345. Boni C, Fisicaro P, Valdatta C, Amadei B, Di Vincenzo P, Giuberti T, Laccabue D, Zerbini A, Cavalli A, Missale G, Bertoletti A, Ferrari C. 2007. Characterization of hepatitis B virus (HBV)-specific T-cell dysfunction in chronic HBV infection. J Virol 81:4215-4225.

346. Urbani S, Amadei B, Tola D, Massari M, Schivazappa S, Missale G, Ferrari C. 2006. PD-1 expression in acute hepatitis C virus (HCV) infection is associated with HCV-specific CD8 exhaustion. J Virol 80:11398-11403.

188

347. Wieland A, Shashidharamurthy R, Kamphorst AO, Han JH, Aubert RD, Choudhury BP, Stowell SR, Lee J, Punkosdy GA, Shlomchik MJ, Selvaraj P, Ahmed R. 2015. Antibody effector functions mediated by Fcgamma-receptors are compromised during persistent viral infection. Immunity 42:367-378.

348. Yamada DH, Elsaesser H, Lux A, Timmerman JM, Morrison SL, de la Torre JC, Nimmerjahn F, Brooks DG. 2015. Suppression of Fcgamma-receptor- mediated antibody effector function during persistent viral infection. Immunity 42:379-390.

349. Barber DL, Wherry EJ, Masopust D, Zhu B, Allison JP, Sharpe AH, Freeman GJ, Ahmed R. 2006. Restoring function in exhausted CD8 T cells during chronic viral infection. Nature 439:682-687.

350. Silverman GJ, Carson DA. 2003. Roles of B cells in rheumatoid arthritis. Arthritis Research & Therapy 5:S1-S6.

351. Fujisaki J, Wu J, Carlson AL, Silberstein L, Putheti P, Larocca R, Gao W, Saito TI, Lo Celso C, Tsuyuzaki H, Sato T, Cote D, Sykes M, Strom TB, Scadden DT, Lin CP. 2011. In vivo imaging of Treg cells providing immune privilege to the haematopoietic stem-cell niche. Nature 474:216-219.

352. Mendez-Ferrer S, Michurina TV, Ferraro F, Mazloom AR, MacArthur BD, Lira SA, Scadden DT, Ma/'ayan A, Enikolopov GN, Frenette PS. 2010. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature 466:829-834.

353. Ryan JM, Barry FP, Murphy JM, Mahon BP. 2005. Mesenchymal stem cells avoid allogeneic rejection. J Inflamm (Lond) 2:8.

354. Krampera M, Cosmi L, Angeli R, Pasini A, Liotta F, Andreini A, Santarlasci V, Mazzinghi B, Pizzolo G, Vinante F, Romagnani P, Maggi E, Romagnani S, Annunziato F. 2006. Role for Interferon- in the Immunomodulatory Activity of Human Bone Marrow Mesenchymal Stem Cells. STEM CELLS 24:386-398.

355. Meirelles LdS, Chagastelles PC, Nardi NB. 2006. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. Journal of Cell Science 119:2204-2213.

356. Kurth TB, Dell'accio F, Crouch V, Augello A, Sharpe PT, De Bari C. 2011. Functional mesenchymal stem cell niches in adult mouse knee joint synovium in vivo. Arthritis Rheum 63:1289-1300.

189

357. Honke N, Shaabani N, Cadeddu G, Sorg UR, Zhang DE, Trilling M, Klingel K, Sauter M, Kandolf R, Gailus N, van Rooijen N, Burkart C, Baldus SE, Grusdat M, Lohning M, Hengel H, Pfeffer K, Tanaka M, Haussinger D, Recher M, Lang PA, Lang KS. 2012. Enforced viral replication activates adaptive immunity and is essential for the control of a cytopathic virus. Nat Immunol 13:51-57.

358. Linn M, Aaskov J, Suhrbier A. 1996. Antibody-dependent enhancement and persistence in macrophages of an arobvirus associated with arthritis. Journal of General Virology 77:407-411.

359. Lidbury BA, Mahalingam S. 2000. Specific ablation of antiviral gene expression in macrophages by antibody-dependent enhancement of Ross River virus infection. J Virol 74:8376-8381.

360. Heesters BA, Myers RC, Carroll MC. 2014. Follicular dendritic cells: dynamic antigen libraries. Nat Rev Immunol 14:495-504.

361. Li TF, Mandelin J, Hukkanen M, Lassus J, Sandelin J, Santavirta S, Virtanen I, Konttinen YT. 2002. Dendritic cells in rheumatoid synovial membrane after total removal of the hyaline articular cartilage. Rheumatology (Oxford) 41:319- 323.

362. Lindhout E, van Eijk M, van Pel M, Lindeman J, Dinant HJ, de Groot C. 1999. Fibroblast-like synoviocytes from rheumatoid arthritis patients have intrinsic properties of follicular dendritic cells. J Immunol 162:5949-5956.

363. Burton GF, Keele BF, Estes JD, Thacker TC, Gartner S. 2002. Follicular dendritic cell contributions to HIV pathogenesis. Semin Immunol 14:275-284.

364. Heath SL, Tew JG, Tew JG, Szakal AK, Burton GF. 1995. Follicular dendritic cells and human immunodeficiency virus infectivity. Nature 377:740-744.

365. Hodzic E, Feng S, Holden K, Freet KJ, Barthold SW. 2008. Persistence of Borrelia burgdorferi following Antibiotic Treatment in Mice. Antimicrobial Agents and Chemotherapy 52:1728-1736.

366. Coiras M, Lopez-Huertas MR, Perez-Olmeda M, Alcami J. 2009. Understanding HIV-1 latency provides clues for the eradication of long-term reservoirs. Nat Rev Micro 7:798-812.

190

367. Ciurea A, Klenerman P, Hunziker L, Horvath E, Senn BM, Ochsenbein AF, Hengartner H, Zinkernagel RM. 2000. Viral persistence in vivo through selection of neutralizing antibody-escape variants. Proc Natl Acad Sci U S A 97:2749-2754.

368. Richman DD, Wrin T, Little SJ, Petropoulos CJ. 2003. Rapid evolution of the neutralizing antibody response to HIV type 1 infection. Proc Natl Acad Sci U S A 100:4144-4149.

369. Klimstra WB, Ryman KD, Johnston RE. 1998. Adaptation of Sindbis virus to BHK cells selects for use of heparan sulfate as an attachment receptor. J Virol 72:7357-7366.

370. Bernard KA, Klimstra WB, Johnston RE. 2000. Mutations in the E2 glycoprotein of Venezuelan equine encephalitis virus confer heparan sulfate interaction, low morbidity, and rapid clearance from blood of mice. Virology 276:93-103.

371. Gardner CL, Ebel GD, Ryman KD, Klimstra WB. 2011. Heparan sulfate binding by natural eastern equine encephalitis viruses promotes neurovirulence. Proc Natl Acad Sci U S A 108:16026-16031.

372. Pestka JM, Zeisel MB, Blaser E, Schurmann P, Bartosch B, Cosset FL, Patel AH, Meisel H, Baumert J, Viazov S, Rispeter K, Blum HE, Roggendorf M, Baumert TF. 2007. Rapid induction of virus-neutralizing antibodies and viral clearance in a single-source outbreak of hepatitis C. Proc Natl Acad Sci U S A 104:6025-6030.

373. Bergthaler A, Flatz L, Verschoor A, Hegazy AN, Holdener M, Fink K, Eschli B, Merkler D, Sommerstein R, Horvath E, Fernandez M, Fitsche A, Senn BM, Verbeek JS, Odermatt B, Siegrist CA, Pinschewer DD. 2009. Impaired antibody response causes persistence of prototypic T cell-contained virus. PLoS Biol 7:e1000080.

374. Nimmerjahn F, Ravetch JV. 2008. Fcgamma receptors as regulators of immune responses. Nat Rev Immunol 8:34-47.

375. Mathews JH, Roehrig JT, Trent DW. 1985. Role of complement and the Fc portion of immunoglobulin G in immunity to Venezuelan equine encephalomyelitis virus infection with glycoprotein-specific monoclonal antibodies. J Virol 55:594-600.

191

376. Moir S, Ho J, Malaspina A, Wang W, DiPoto AC, O'Shea MA, Roby G, Kottilil S, Arthos J, Proschan MA, Chun TW, Fauci AS. 2008. Evidence for HIV- associated B cell exhaustion in a dysfunctional memory B cell compartment in HIV-infected viremic individuals. J Exp Med 205:1797-1805.

377. Jackson L, Cady CT, Cambier JC. 2009. TLR4-mediated signaling induces MMP9-dependent cleavage of B cell surface CD23. J Immunol 183:2585-2592.

378. Braun D, Caramalho I, Demengeot J. 2002. IFN-alpha/beta enhances BCR- dependent B cell responses. Int Immunol 14:411-419.

379. Coro ES, Chang WL, Baumgarth N. 2006. Type I IFN receptor signals directly stimulate local B cells early following influenza virus infection. J Immunol 176:4343-4351.

380. Fink K, Lang KS, Manjarrez-Orduno N, Junt T, Senn BM, Holdener M, Akira S, Zinkernagel RM, Hengartner H. 2006. Early type I interferon-mediated signals on B cells specifically enhance antiviral humoral responses. Eur J Immunol 36:2094-2105.

381. Browne EP. 2011. Toll-like Receptor 7 Controls the Anti-Retroviral Germinal Center Response. PLoS Pathog 7:e1002293.

382. Rawlings DJ, Schwartz MA, Jackson SW, Meyer-Bahlburg A. 2012. Integration of B cell responses through Toll-like receptors and antigen receptors. Nat Rev Immunol 12:282-294.

383. Alsharifi M, Lobigs M, Regner M, Lee E, Koskinen A, Mullbacher A. 2005. Type I interferons trigger systemic, partial lymphocyte activation in response to viral infection. J Immunol 175:4635-4640.

384. Purtha WE, Chachu KA, Virgin HWt, Diamond MS. 2008. Early B-cell activation after West Nile virus infection requires alpha/beta interferon but not antigen receptor signaling. J Virol 82:10964-10974.

385. Schnittman S, Lane H, Higgins S, Folks T, Fauci A. 1986. Direct polyclonal activation of human B lymphocytes by the acquired immune deficiency syndrome virus. Science 233:1084-1086.

386. Correa AR, Berbel AC, Papa MP, Morais AT, Pecanha LM, Arruda LB. 2015. Dengue Virus Directly Stimulates Polyclonal B Cell Activation. PLoS One 10:e0143391.

192

387. Hunziker L, Recher M, Macpherson AJ, Ciurea A, Freigang S, Hengartner H, Zinkernagel RM. 2003. Hypergammaglobulinemia and autoantibody induction mechanisms in viral infections. Nat Immunol 4:343-349.

388. Johnson BJ, Brubaker JR, Roehrig JT, Trent DW. 1990. Variants of Venezuelan equine encephalitis virus that resist neutralization define a domain of the E2 glycoprotein. Virology 177:676-683.

389. Vrati S, Fernon CA, Dalgarno L, Weir RC. 1988. Location of a major antigenic site involved in Ross River virus neutralization. Virology 162:346-353.

390. Porta J, Jose J, Roehrig JT, Blair CD, Kuhn RJ, Rossmann MG. 2014. Locking and blocking the viral landscape of an alphavirus with neutralizing antibodies. J Virol 88:9616-9623.

391. Davis NL, Fuller FJ, Dougherty WG, Olmsted RA, Johnston RE. 1986. A single nucleotide change in the E2 glycoprotein gene of Sindbis virus affects penetration rate in cell culture and virulence in neonatal mice. Proceedings of the National Academy of Sciences of the United States of America 83:6771-6775.

392. Olmsted RA, Meyer WJ, Johnston RE. 1986. Characterization of Sindbis virus epitopes important for penetration in cell culture and pathogenesis in animals. Virology 148:245-254.

393. Olmsted RA, Baric RS, Sawyer BA, Johnston RE. 1984. Sindbis Virus Mutants Selected for Rapid Growth in Cell Culture Display Attenuated Virulence in Animals. Science 225:424-427.

394. Pence DF, Davis NL, Johnston RE. 1990. Antigenic and genetic characterization of sindbis virus monoclonal antibody escape mutants which define a pathogenesis domain on glycoprotein E2. Virology 175:41-49.

395. Hunt AR, Frederickson S, Maruyama T, Roehrig JT, Blair CD. 2010. The first human epitope map of the alphaviral E1 and E2 proteins reveals a new E2 epitope with significant virus neutralizing activity. PLoS Negl Trop Dis 4:e739.

396. Fong RH, Banik SS, Mattia K, Barnes T, Tucker D, Liss N, Lu K, Selvarajah S, Srinivasan S, Mabila M, Miller A, Muench MO, Michault A, Rucker JB, Paes C, Simmons G, Kahle KM, Doranz BJ. 2014. Exposure of epitope residues on the outer face of the chikungunya virus envelope trimer determines antibody neutralizing efficacy. J Virol 88:14364-14379.

193

397. Vogt MR, Dowd KA, Engle M, Tesh RB, Johnson S, Pierson TC, Diamond MS. 2011. Poorly neutralizing cross-reactive antibodies against the fusion loop of West Nile virus envelope protein protect in vivo via Fcgamma receptor and complement-dependent effector mechanisms. J Virol 85:11567-11580.

398. Schmaljohn AL, Johnson ED, Dalrymple JM, Cole GA. 1982. Non-neutralizing monoclonal antibodies can prevent lethal alphavirus encephalitis. Nature 297:70- 72.

399. Hessell AJ, Hangartner L, Hunter M, Havenith CEG, Beurskens FJ, Bakker JM, Lanigan CMS, Landucci G, Forthal DN, Parren PWHI, Marx PA, Burton DR. 2007. Fc receptor but not complement binding is important in antibody protection against HIV. Nature 449:101-104.

400. Mehlhop E, Nelson S, Jost CA, Gorlatov S, Johnson S, Fremont DH, Diamond MS, Pierson TC. 2009. Complement protein C1q reduces the stoichiometric threshold for antibody-mediated neutralization of West Nile virus. Cell Host Microbe 6:381-391.

401. Ubol S, Levine B, Lee SH, Greenspan NS, Griffin DE. 1995. Roles of immunoglobulin valency and the heavy-chain constant domain in antibody- mediated downregulation of Sindbis virus replication in persistently infected neurons. J Virol 69:1990-1993.

402. Halstead S, O'Rourke E. 1977. Dengue viruses and mononuclear phagocytes. I. Infection enhancement by non-neutralizing antibody. The Journal of Experimental Medicine 146:201-217.

403. Halstead SB. 2003. Neutralization and Antibody-Dependent Enhancement of Dengue Viruses, p 421-467, Advances in Virus Research, vol Volume 60. Academic Press.

404. Zhang P, Wu CG, Mihalik K, Virata-Theimer ML, Yu MY, Alter HJ, Feinstone SM. 2007. Hepatitis C virus epitope-specific neutralizing antibodies in Igs prepared from human plasma. Proc Natl Acad Sci U S A 104:8449-8454.

405. Zhang P, Zhong L, Struble EB, Watanabe H, Kachko A, Mihalik K, Virata- Theimer ML, Alter HJ, Feinstone S, Major M. 2009. Depletion of interfering antibodies in chronic hepatitis C patients and vaccinated chimpanzees reveals broad cross-genotype neutralizing activity. Proc Natl Acad Sci U S A 106:7537- 7541.

194

406. Speckner A, Glykofrydes D, Ohlin M, Mach M. 1999. Antigenic domain 1 of human cytomegalovirus glycoprotein B induces a multitude of different antibodies which, when combined, results in incomplete virus neutralization. J Gen Virol 80 ( Pt 8):2183-2191.

407. Ray SC, Wang YM, Laeyendecker O, Ticehurst JR, Villano SA, Thomas DL. 1999. Acute hepatitis C virus structural gene sequences as predictors of persistent viremia: hypervariable region 1 as a decoy. J Virol 73:2938-2946.

408. Scarlatti G, Tresoldi E, Bjorndal A, Fredriksson R, Colognesi C, Deng HK, Malnati MS, Plebani A, Siccardi AG, Littman DR, Fenyo EM, Lusso P. 1997. In vivo evolution of HIV-1 co-receptor usage and sensitivity to chemokine- mediated suppression. Nat Med 3:1259-1265.

409. Schuitemaker H, Koot M, Kootstra NA, Dercksen MW, de Goede RE, van Steenwijk RP, Lange JM, Schattenkerk JK, Miedema F, Tersmette M. 1992. Biological phenotype of human immunodeficiency virus type 1 clones at different stages of infection: progression of disease is associated with a shift from monocytotropic to T-cell-tropic virus population. J Virol 66:1354-1360.

410. Borrow P, Evans CF, Oldstone MB. 1995. Virus-induced immunosuppression: immune system-mediated destruction of virus-infected dendritic cells results in generalized immune suppression. J Virol 69:1059-1070.

411. Salvato MS, Borrow P, Shimomaye E, Oldstone MB. 1991. Molecular Basis of Viral Persistence: a Signle Amino Acid Change in the Glycoprotein of Lymphocytic Choriomengingitis Virus is Associated with Suppresion of the Antiviral Cytotoxic T-lymphocyte Response and Establishment of Persistence. J Virol 65.

412. Smelt SC, Borrow P, Kunz S, Cao W, Tishon A, Lewicki H, Campbell KP, Oldstone MB. 2001. Differences in affinity of binding of lymphocytic choriomeningitis virus strains to the cellular receptor alpha-dystroglycan correlate with viral tropism and disease kinetics. J Virol 75:448-457.

413. Tam PE, Messner RP. 1999. Molecular mechanisms of coxsackievirus persistence in chronic inflammatory myopathy: viral RNA persists through formation of a double-stranded complex without associated genomic mutations or evolution. J Virol 73:10113-10121.

414. Dryga SA, Dryga OA, Schlesinger S. 1997. Identification of Mutations in a Sindbis Virus Variant Able to Establish Persistent Infection in BHK Cells: The Importance of a Mutation in the nsP2 Gene. Virology 228:74-83.

195

415. Lidbury BA, Rulli NE, Musso CM, Cossetto SB, Zaid A, Suhrbier A, Rothenfluh HS, Rolph MS, Mahalingam S. 2011. Identification and characterization of a ross river virus variant that grows persistently in macrophages, shows altered disease kinetics in a mouse model, and exhibits resistance to type I interferon. J Virol 85:5651-5663.

416. Way SJ, Lidbury BA, Banyer JL. 2002. Persistent Ross River virus infection of murine macrophages: an in vitro model for the study of viral relapse and immune modulation during long-term infection. Virology 301:281-292.

417. Hahn YS, Grakoui A, Rice CM, Strauss EG, Strauss JH. 1989. Mapping of RNA- temperature-sensitive mutants of Sindbis virus: complementation group F mutants have lesions in nsP4. J Virol 63:1194-1202.

418. Burke CW, Gardner CL, Steffan JJ, Ryman KD, Klimstra WB. 2009. Characteristics of alpha/beta interferon induction after infection of murine fibroblasts with wild-type and mutant alphaviruses. Virology 395:121-132.

419. Reynaud JM, Kim DY, Atasheva S, Rasalouskaya A, White JP, Diamond MS, Weaver SC, Frolova EI, Frolov I. 2015. IFIT1 Differentially Interferes with Translation and Replication of Alphavirus Genomes and Promotes Induction of Type I Interferon. PLoS Pathog 11:e1004863.

420. Frolov I, Akhrymuk M, Akhrymuk I, Atasheva S, Frolova EI. 2012. Early events in alphavirus replication determine the outcome of infection. J Virol 86:5055-5066.

421. Fragkoudis R, Breakwell L, McKimmie C, Boyd A, Barry G, Kohl A, Merits A, Fazakerley JK. 2007. The type I interferon system protects mice from Semliki Forest virus by preventing widespread virus dissemination in extraneural tissues, but does not mediate the restricted replication of avirulent virus in central nervous system neurons. J Gen Virol 88:3373-3384.

422. Ryman KD, Klimstra WB, Nguyen KB, Biron CA, Johnston RE. 2000. Alpha/beta interferon protects adult mice from fatal Sindbis virus infection and is an important determinant of cell and tissue tropism. J Virol 74:3366-3378.

423. Levine B, Jiang HH, Kleeman L, Yang G. 1996. Effect of E2 envelope glycoprotein cytoplasmic domain mutations on Sindbis virus pathogenesis. J Virol 70:1255-1260.

424. Lustig S, Jackson AC, Hahn CS, Griffin DE, Strauss EG, Strauss JH. 1988. Molecular basis of Sindbis virus neurovirulence in mice. J Virol 62:2329-2336.

196

425. Tucker PC, Strauss EG, Kuhn RJ, Strauss JH, Griffin DE. 1993. Viral determinants of age-dependent virulence of Sindbis virus for mice. J Virol 67:4605-4610.

426. Gritsun TS, Gould EA. 2007. Origin and evolution of 3'UTR of flaviviruses: long direct repeats as a basis for the formation of secondary structures and their significance for virus transmission. Adv Virus Res 69:203-248.

427. Coffey LL, Vasilakis N, Brault AC, Powers AM, Tripet F, Weaver SC. 2008. Arbovirus evolution in vivo is constrained by host alternation. Proc Natl Acad Sci U S A 105:6970-6975.

428. Coffey LL, Vignuzzi M. 2011. Host alternation of chikungunya virus increases fitness while restricting population diversity and adaptability to novel selective pressures. J Virol 85:1025-1035.

429. Pal P, Fox J, Hawman DW, Huang Y, Messaoudi I, Kreklywich CN, Denton M, Legasse A, Smith P, Johnson S, Axthelm M, Vanlandingham DL, Streblow D, Higgs S, Morrison TE, Diamond MS. 2014. Chikungunya viruses that escape monoclonal antibody therapy are clinically attenuated, stable and not purified in mosquitoes. J Virol 88:8213-8226.

197