Amino Acid Polymorphisms Altering the Glycosylation of IL-2 Do Not Protect from Type 1 Diabetes in the NOD Mouse

Amino acid polymorphisms altering the glycosylation of IL-2 do not protect from type 1 diabetes in the NOD mouse

Masahito Kamanakaa, Dan Rainbowb, Karin Schuster-Gosslerc, Elizabeth E. Eynona,d, Alexander V. Chervonskyc,e, Linda S. Wickerb, and Richard A. Flavella,d,1

aDepartment of Immunobiology and dHoward Hughes Medical Institute, Yale University School of Medicine, New Haven, CT 06520; bJuvenile Diabetes Research Foundation/Wellcome Trust Diabetes and Inﬂammation, Laboratory, Department of Medical Genetics, Cambridge Institute for Medical Research, University of Cambridge, Cambridge CB2 0XY, United Kingdom; cThe Jackson Laboratory, Bar Harbor, ME 04609; and eDepartment of Pathology, University of Chicago, Chicago, IL 60637

Contributed by Richard A. Flavell, April 30, 2009 (sent for review February 20, 2009) Idd3 is one of many gene regions that affect the development of for the NOD and B6 allotypes (6). IL-2 secreted from NOD cells type 1 diabetes (T1D) in the nonobese diabetic (NOD) mouse. Idd3 exhibited one major homogenous band of a larger apparent mo- has been localized to a 650-kb region on chromosome 3 containing lecular weight than that of the major B6 IL-2 product; and for B6 the IL-2 gene. Exon 1 of the IL-2 gene is polymorphic between the IL-2, additional lower molecular weight bands were also present. In susceptible NOD and the protective C57BL/6 (B6) alleles, causing a comparison of several mouse strains, proline at amino acid multiple amino acid changes that have been proposed to be position 6 correlated with a NOD-like electrophoresis pattern, responsible for the differing glycosylation status. To address whereas serine at position 6 associated with a B6-like pattern (6). whether this coding polymorphism recapitulates the disease sup- Considering the importance of IL-2 in immunity, a difference in the pression mediated by the B6 Idd3 allele, we generated knockin structure and/or glycosylation of IL-2 may have a significant effect mice in which exon 1 of the B6 IL-2 allele replaces the homologous on T1D development. Indeed, IL-2 can bind to heparan sulfate region in the NOD allele. We generated these mice by targeting the through its glycosylated residues and deposit itself on tissue matrix IMMUNOLOGY NOD allele of NOD/129 F1 ES cells. IL-2 protein from the knockin via this interaction (7, 8). Thus, it was proposed that differences in mice showed the glycosylation pattern of the B6 IL-2 isoform, glycosylation might affect the binding ability of IL-2 to the tissue conﬁrming that the amino acid differences encoded within exon 1 matrix, which may subsequently lead to abnormal homeostasis of T affect the glycosylation of the IL-2 protein. However, unlike cells observed in NOD mice (9). These facts suggest that the NOD.B6 Idd3 congenic mice, the knockin mice were not protected structural difference in IL-2 might affect the immunity of NOD from T1D. Furthermore, the difference in amino acid sequence in mice and may explain the reduced incidence of diabetes in NOD.B6 the IL-2 protein did not affect the level of expression of IL-2. This Idd3 congenic mice. approach provides a general method for the determination of a The most definitive way to address this problem is to generate a functional role of a given genomic sequence in a disease process. mouse in which the IL-2 gene of NOD mouse is replaced with that Further, our result demonstrates that the variants in exon 1 of the of B6. However, it has been difficult to generate a knockin mouse IL-2 gene are not responsible for T1D suppression in NOD.B6 Idd3 on the NOD background because of the difficulty in obtaining good mice, thereby supporting the hypothesis that variants in the ES cell lines capable of efficient germ-line transmission. On the regulatory region affecting expression levels are causative. other hand, backcrossing to the NOD strain of genetically modified mice typically developed from 129 or B6 ES cells have the problem Idd3 ͉ NOD ES cells ͉ ﬂanking gene problem that linked, non-NOD-derived flanking genes are retained during back-crossing (10). Knockout and transgenic mice generated in 1D is a multifactorial disease to which multiple genetic and different genetic backgrounds have been backcrossed to NOD mice Tenvironmental factors contribute. The genetic control of T1D to assess the role of proteins in the T1D development. Even with has been well characterized by linkage analyses of T1D-prone NOD extensive backcrossing, flanking regions from the original strain remain. These genes or sequences can have a significant effect on mice and nondiabetic strains (1). Regions influencing disease are ␥ termed Idd for insulin-dependent diabetes and have been exten- the phenotype of the mice. For example, IFN- receptor knockout sively studied for the responsible genes (2). Among them, Idd3 on mice have shown opposite phenotypes dependent on the number of mouse chromosome 3 has a significant effect on T1D development backcross generations because of this flanking gene problem (11). and lymphocyte infiltration into the pancreatic islets (3, 4). For a similar reason, analysis of congenic mice has not been able to precisely pinpoint the region responsible for disease susceptibility. NOD.B6 Idd3 congenic mice that have the Idd3 region from the B6 Although NOD ES cells are ideal as a solution to the ‘‘linked strain are protected from T1D and insulitis. By the study of genes’’ problem, these cells are not yet efficient in germ-line NOD.B6 Idd3 congenic strains, the Idd3 region has been mapped transmission (12). To overcome the poor transmission rate of pure to a 650-kb region, which includes the genes encoding IL-2, IL-21, NOD ES cells, F ES cells of NOD and 129 have been generated and FGF-2 (5) (Fig. 1). Among them, IL-2 and IL-21 have notable 1 by us (between the 129S1/SvImJ and NOD/ShiLtJ strains) and roles in the immune response. IL-2 promotes the proliferation of T others (13). All genes of these ES cells contain 1 copy each of the cells and is required for the development and maintenance of naturally occurring regulatory cells (nTreg), which negatively con-

trol immune responses. Importantly, the NOD and B6 IL-2 alleles Author contributions: M.K., L.S.W., and R.A.F. designed research; M.K. and D.R. performed have multiple variants in exon 1 that alter the amino acid sequence research; K.S.-G., E.E.E., and A.V.C. contributed new reagents/analytic tools; M.K. and D.R. (3). In the case of NOD, position 6 and 10 of the mature protein of analyzed data; and M.K., D.R., L.S.W., and R.A.F. wrote the paper. IL-2 are prolines, whereas, in B6, they are serines. In addition, The authors declare no conﬂict of interest. amino acid 12–15 of the mature IL-2 protein in NOD is deleted in Freely available online through the PNAS open access option. B6; the 8 glutamine repeat of amino acid 19–26 in NOD is 4 1To whom correspondence should be addressed. E-mail: richard.ﬂ[email protected]. residues longer in B6. Electrophoresis of IL-2 molecules revealed This article contains supporting information online at www.pnas.org/cgi/content/full/ differential mobility, thus indicating different glycosylation patterns 0904780106/DCSupplemental.

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0904780106 PNAS Early Edition ͉ 1of5 Downloaded by guest on September 24, 2021 D3Nds76 Il2 D3Nds36 3Bm291A3 20Bm291A3 Chromosome 3 Il21

Fgf2 Centrin4 Tenr Kiaa1109 Kiaa1371

NOD Ala Pro Thr Ser Ser Pro Thr Ser Ser Pro Thr Ser Ser Ser Thr Ala Glu Ala(Gln)8

C57BL/6 Ala Pro Thr Ser Ser Ser Thr Ser Ser Ser Thr ------Ala Glu Ala(Gln)12

Fig. 1. The genes located in the Idd3 region. The genes located in the Idd3 region, which is deﬁned by recombination points of congenic mouse strains having been phenotyped at Idd3, are between the deﬁned marker in Fgf2 and 20Bm291A3. Idd3 contains the genes encoding IL-2 and IL-21, as well as several other genes. Comparison of the sequences of Exon I of the IL-2 gene predicts that the amino acid sequence of mature proteins produced from the NOD and B6 are different. The location of micro satellite markers D3Nds76 and D3Nds36 are shown. The diagram is not proportional in regard to gene length. The left side is telomeric.

NOD and 129 alleles. By homologous recombination, we can and a portion of intron II were replaced with that of B6. We cloned generate knockout or knockin NOD alleles without altering any of the IL-2 gene from a NOD BAC library and made a construct as the flanking DNA. Here, we used these F1 ES cells to generate shown in Fig. 2A. We exchanged the Sbf1-ClaI fragment containing knockin mice in which the IL-2 gene of the NOD genome was exons I and II cloned from the B6 genome to the corresponding replaced with that of B6. Our results demonstrate that the structural region in the NOD-derived DNA. We transfected this construct change in the IL-2 molecule is not responsible for the disease into the ES cells and picked 90 colonies after selection with G418 suppression found in NOD.B6 Idd3 congenic mice. and ganciclovir. We prepared DNA from these colonies and identified 10 clones having successful homologous recombination Results by Southern blotting using the 5Ј and 3Ј probes shown in Fig. 2B. Establishment of F1 ES Cells for Knockout Experiment. We generated At this point, as the ES cells were heterozygous for 129 and NOD, NOD/129 F1 ES cells from embryos obtained after crossing the targeting could have occurred in either the 129 or NOD allele. NOD/ShiLtJ with 129/SvImJ mice as described in the materials and It was difficult to determine which allele was targeted because methods. Several ES cell lines were established and tested for their sequences from NOD and 129 are almost identical within and ability to produce chimeras capable of transmitting the NOD/129 F1 surrounding the IL-2 gene. One of the ways to identify the targeted genome from ES cells. We chose several ES cell lines and demon- allele is by generating homozygous knockout ES cells followed by strated that these cells were capable of good germ-line transmission; the analysis of microsatellite markers. By using higher levels of we then used them to generate knockin mice. G418, it is possible to select clones in which duplication of allele containing neomycin resistance gene has occurred (14). We were Generation of IL-2 Knockin Mice. To elucidate how structural differ- unable to find clones that survived in high concentrations (2 ences in IL-2 contribute to the development of T1D, we generated mg/mL) of G418 in our F1 ES cells. Instead we generated chimeric an IL-2 knockin mouse in which exons I and II as well as intron I mice from each clone and determining the targeted allele in a

SbfI A PsiI BclI ClaI RV Portion of the IL-2 genomic region of NOD mice III III

SbfI RV Targeting Vector neo TK

SbfI RV PsiI ClaI RV After Removal of Neo Gene III III

Homologous + - + - - ++ 1kb B Recombination C Neo removed ~20kb Gene from C57BL/6 ~20kb Mice

6kb 6kb LoxP 4.5kb Southern blotting probe

Fig. 2. Generation of IL-2 knockin mice. (A) The construct for IL-2 knockin mice (NOD.IL-2B6ex1). The DNA for the region surrounding IL-2 Exon I was cloned from a genomic library of the NOD mouse. The IL-2 gene of B6 mice (shaded box) was cloned by PCR and replaced the corresponding NOD sequence. The construct was completed by cloning the long- and short-arm fragments into a pEasyﬂox plasmid containing a neomycin resistance gene and thymidine kinase gene. (Top) Genome of NOD mice. (Middle) Targeting vector. (Bottom) Genome after successful homologous recombination and removal of the neomycin resistance gene. (B) Southern blotting of ES DNA to identify targeted clones. The Ϸ20-kb band is of NOD genome, and the 6-kb band is of clones successfully targeted. (C) Southern blotting of ES DNA to identify clones in which the neomycin gene has been removed. The 6-kb band is of the targeted clone, and the 4.5-kb band identiﬁes clones in which the neomycin gene has been removed. The Southern blots shown were performed using the 3Ј end probe.

2of5 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0904780106 Kamanaka et al. Downloaded by guest on September 24, 2021 A NOD allele targeted case 129 allele targeted case A NOD NOD.IL-2B6ex1

Chimera NOD Chimera NOD IL-2

IL-10 NOD NOD/129 NOD Chr. 3 129 Chr. 3 D3Nds36 IL-2 Exon I 129 B6 (mutant) B

2B6ex1 Clone #24.9 ) - ni .IL B IL-2NOD control D.B6 Idd3 OD NOD Targeted allele --++ ++ - - + -2 (T. N NO IL NOD. NOD ( 230 bp) 129 (222 bp)

Clone #6.31 Targeted allele +++ + + - B6 - NOD ( 230 bp) 129 (222 bp) C57BL /6 (212 bp)

Fig. 3. Identification of ES clones that targeted the NOD allele in F ES cells. 1 Fig. 4. Intracellular and western analysis of IL-2 from NOD.IL-2B6ex1 mouse. (A) (A) Retrospective identification of alleles targeted in F1 ES cells. Chimeric mice ϩ Intracellular IL-2 in CD4 T cells detected by FACS. Splenocytes were stimulated IMMUNOLOGY from ES cells were crossed with NOD mice. The ES clone could have had either with PMA and ionomycin for 5 h and intracellular IL-2 and IL-10 were detected by the NOD or 129 allele targeted. In the former, pups having the NOD allele FACS. The plot shows CD4ϩ gated cells. (B) IL-2 secreted from NOD.IL-2B6ex1 cells targeted should have the NOD/NOD genotype at D3Nds36, whereas pups not detected by Western blotting. Culture supernatant from NOD.IL-2NOD control, having a targeted allele should have a NOD/129 genotype at D3Nds36.Inthe NOD.IL-2B6ex1, NOD, and NOD.B6 Idd3 splenocytes were collected after stimu- latter case, the opposite pattern is expected. (B) The electrophoresis of the lation with PHA for 12 h. Recombinant IL-2 derived from insect cells and the D3Nds36 microsatellite PCR products from the pups derived from ES clones. supernatants were subjected to electrophoresis and blotted with an IL-2-specific (Upper) Result of clone no. 24.9. (Lower) Result of clone no. 6.31. On the top antibody. Please note that the right side migrated more slowly than the left of each lane is indicated the presence (ϩ) or absence (Ϫ) of the targeted gene. because of the particular gel electrophoresis performed. B6 indicates mouse DNA (i.e., not of ES cell origin). NOD and 129 alleles at D3Nds36 were distinguished by the 230 and 222 bp bands, respectively. manipulation could have affected its transcription. Specifically, retrospective fashion. Although the Idd3 region from NOD and 129 although the neomycin resistance gene was removed from the ES is almost identical around the IL-2 gene, there is a microsatellite cells, 1 loxP site remains in intron II, which could affect the gene marker, D3Nds36, which can distinguish between the NOD and 129 regulation. As shown in Fig. 4A, the protein level of IL-2 at the alleles. By the combined analysis of the mutated gene and the single cell level was not altered in activated CD4 T cells. We analyzed the frequencies and the numbers of nTreg cells detected D3Nds36 allele, we could retrospectively determine which allele was ϩ ϩ targeted in the ES cells (Fig. 3A). We removed the neo resistance as CD4 CD25 cells, but found no significant difference between NOD.IL-2B6ex1 and NOD controls (P ϭ 0.59). As the glycosyla- gene by transient transfection with a Cre recombinase expressing tion pattern of IL-2 has been reported to correlate with the IL-2 aa plasmid into these ES cells. We then picked colonies and identified sequence, we performed Western blotting of IL-2 in the superna- several colonies from 3 parental clones that were successfully tant collected from splenocytes stimulated with PHA (Fig. 4B). The deleted for the neomycin gene (Fig. 2C). We produced chimeras mobility of IL-2 protein in polyacrylamide gels from knockin mice B from 3 ES clones and crossed these mice with NOD mice. Fig. 3 was the same as that of IL-2 produced by cells from NOD.B6 Idd3 shows the results of the analysis of microsatellite markers. The pups congenic mice, and both proteins migrated more quickly than did derived from clone no. 24.9 showed the pattern corresponding to NOD IL-2 protein. These results demonstrate that the amino acid targeting of the NOD allele. In this case, mutant allele positive mice sequence variation encoded by exon 1 is responsible for the showed a single D3Nds36 band corresponding to the NOD allele, different glycosylation patterns of the B6 and NOD IL-2 allotypes. whereas pups not having the mutation showed double bands corresponding to the 129 and NOD alleles. On the other hand, Development of T1D. We next tested whether the structural variation clone no. 6.9 and another clone (not shown) showed the opposite of the IL-2 gene affected T1D development. Mice were backcrossed pattern, indicating that targeting took place in the 129 allele. Thus, 12 times to the NOD parental strain and the mice derived from we further backcrossed the pups derived from clone no. 24.9 to the interbreeding of IL-2 knockin heterozygous mice were used to NOD background using the expedited approach (‘‘speed backcross- assess the frequency of diabetes and insulitis. As shown in Fig. 5A, ing’’), selecting at each generation for the greatest number of NOD the progeny homozygous for the knockin allele (NOD.IL-2B6ex1), alleles at Idd markers for 12 generations (15). In summary, we have developed T1D with a similar overall frequency as the mice established a method to generate knockin/knockout mice in NOD/ homozygous for the NOD IL-2 allele although there was a slight 129 F1 ES cells and generated NOD mice in which a portion of the delay in the development of disease (P ϭ 0.044). Both the NOD and NOD IL-2 gene is replaced with that of B6. the NOD.IL-2B6ex1 progeny developed more T1D than the NOD.B6 Idd3 congenic mice examined contemporaneously (P ϭ Analysis of the IL-2 Knockin Mice. First, we confirmed the expression 0.0000043 and P ϭ 0.00004769, respectively). As the Idd3 region of IL-2 in the knockin mice (NOD.IL-2B6ex1), as the genetic derived from the B6 strain is known to inhibit insulitis in NOD.B6

Kamanaka et al. PNAS Early Edition ͉ 3of5 Downloaded by guest on September 24, 2021 NOD x NOD.B6 Idd3 F1 A 100 A NOD x NOD.IL-2B6ex1 F1 Product size (bp) Product size (bp)

B6 NOD B6 NOD

40 60 Disease free mice (%) B NOD (n=52) 50 NOD.IL-2B6ex1 (n=39) Idd3 20 NOD.B6 (n=21) 40

0 20 % of PCR product

0 50 100 150 200 10 Age of mice (days) 0 NOD x NOD.IL-2B6ex1 F1 NOD x NOD.B6 Idd3 F1 100 B Fig. 6. Allele-specific expression (ASE) of IL-2. (A) Example of the results obtained from an ASE assay. The IL-2 gene was amplified with fluorescence- 80 labeled primers and digested with restriction enzyme. PCR products from the B6 and NOD alleles were quantified by measuring the fluorescence peaks. (B) 60 Comparison of allele specific expression of IL-2 gene. The expression levels of each allele from NOD ϫ NOD.IL-2B6ex1 and NOD ϫ NOD.B6 Idd3 F1 mice are presented. The error bars indicate standard deviations. The open bars repre- 40 sent the NOD allele and the filled bars represent the B6 allele. *, P ϭ 0.029, Mann–Whitney U test.

Percentage of Animals Percentage of 20

0 followed by cleavage with a restriction enzyme that cuts only the B6 NOD NOD.IL-2B6ex1 NOD.B6 Idd3 PCR product. As shown in Fig. 6, IL-2 mRNA expression from the knockin allele is equivalent to that from the NOD allele. As Fig. 5. Development of T1D in NOD.IL-2B6ex1 mice. (A) Frequency of expected, the B6 allele was expressed more than NOD allele in cells diabetes in NOD.IL-2B6ex1 mice. NOD.IL-2NOD control, NOD.IL-2B6ex1, and from NOD ϫ NOD.B6 Idd3 F1 mice. Therefore, from these results, NOD.B6 Idd3 congenic mice were analyzed for the development of T1D. (B) we conclude that the structural difference in the IL-2 molecule does The frequency and severity of insulitis in NOD.IL-2B6ex1 mice. The severity of not affect its expression level. insulitis was evaluated in female NOD.IL-2NOD (n ϭ 11), NOD.IL-2B6ex1 (n ϭ Recently, Yamanouchi et al. (5) showed that polymorphisms in ϭ 10), and NOD.B6 Idd3 mice (n 9) at 8 weeks of age. Each animal received one the IL-2 gene locus other than those determining the amino acid of the following scores: none (white bar, all islets observed are free of insulitis), mild (hatched bar, Ͻ 10% of the islets are inﬁltrated), moderate sequence difference are likely important in disease suppression by (gray bar, 10–50% of the islets are affected), or extensive (black bar, Ͼ 50% the B6 Idd3 allele. They also showed that transcriptional activity of of the islets have insulitis). IL-2 in cells from NOD.B6 Idd3 mice is higher than that from NOD cells. Their finding is compatible with our observation that the structural variation in the IL-2 molecule does not contribute Idd3 mice, we examined the pancreatic islets of NOD.IL-2B6ex1 substantially to disease development. These observations, there- mice. As shown in the Fig. 5B, there was no significant difference fore, place emphasis on the importance of the region(s) of the IL-2 between NOD.IL-2B6ex1 and littermate NOD.IL-2NOD controls gene that control IL-2 expression. The region that is responsible for (P ϭ 0.67). Compared with these 2 groups of mice, NOD.B6 Idd3 the IL-2 gene transcriptional difference might be located in the mice had much reduced infiltration of lymphocytes into the islets extended 5Ј region of IL-2. Del Rio et al. (16) reported that the SNP (NOD.IL-2NOD controls vs. NOD.B6 Idd3, P ϭ 0.002; NOD.IL- at Ϫ1010C is responsible for the quantitative difference of IL-2 2B6ex1 vs. NOD.B6 Idd3, P ϭ 0.016). These results of T1D transcription because the variant alters AP-1 binding at this site. development and insulitis indicate that the structural difference of This hypothesis has yet to be tested in the disease model in vivo. the IL-2 protein contributes only slightly to the frequency of T1D To conclude, we found that disease inhibition by the B6 Idd3 and the disease suppression mediated by the B6 Idd3 allele. allele is mostly caused, not through amino acid differences in the Therefore the large protective effect of the B6 Idd3 region must be IL-2 structural gene but elsewhere, perhaps the sequences caused by the IL-2 polymorphisms found in the regulatory regions regulating IL-2 expression. In this report, we have established a of the gene (5) rather than in exon 1. system to generate knockout/knockin directly into the NOD genome obviating the concerns related to flanking regions. Allele Specific Expression (ASE) Assay. Yamanouchi et al. showed that autoimmune disease susceptibility and resistance alleles at Idd3 Materials and Methods correlates with differential expression of IL-2 (5). They reported Generation of NOD/129 F1 ES Cell Lines. 129/SvImJ females (agouti) were bred that IL-2 mRNA expression from the B6 allele is higher than from to NOD/ShiLtJ (albino) males and the d3.5 embryos were isolated and kept in a drop of KSOM medium (Millipore) covered with oil for 24 h. Subsequently, the NOD allele. Therefore, we tested whether the structural change embryos were transferred into 96-well plates (1 embryo per well) containing in IL-2 affected the expression. We generated 2 groups of F1 mice: an embryonic ﬁbroblast cell layer and DMEM supplemented with 15% FCS NOD ϫ NOD.IL-2B6ex1 and NOD ϫ NOD.B6 Idd3. We quan- (selected lot from Sigma) and LIF. After 5 days, cells were trypsinized and kept tified the allele specific expression level of IL-2 by RT-PCR for 5–6 days with the daily medium changes. Growing colonies were ex-

4of5 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0904780106 Kamanaka et al. Downloaded by guest on September 24, 2021 panded into larger plates and frozen or tested for germ-line transmission. For ␮g/mL streptomycin, and 50 ␮M 2-mercaptoethanol) with 50 ng/mL phorbol that, F1 ES cells were injected into d3.5 blastocysts from matings of B6 mice. All 12-myristate 13-acetate (PMA) and 250 ng/mL ionomycin for 5 h with an addition ES cell lines could generate Ϸ100% chimerism in the mice produced (Table S1). of GolgiStop during the last 2 h. Cells were stained with anti-CD4 antibody and Male chimeras from 5 ES lines (line nos. 5, 6, 7, 8, and 9) when mated with NOD fixed using BD Cytofix/Cytoperm kit. Then cells were stained with antibodies female mice produced white offspring, indicating that the NOD allele from against IL-2 and IL-10 and were analyzed using a FACSCalibur (BD Biosciences). NOD/129 F1 ES cells was transmitted ( Table S2). Western Blotting. SDS/PAGE was performed on recombinant mouse IL-2 sam- Generation of Knockin ES Cells. To generate the knockin construct targeting ples (the B6 allele expressed in baculovirus-infected Trichoplusia ni insect cells, the IL-2 locus, we first cloned the IL-2 gene from NOD by screening a NOD BD) and IL-2-containing culture supernatants from NOD.IL-2NOD control, genomic library. The segment of the gene to be substituted was obtained from NOD.IL-2B6ex1, NOD, and NOD.B6 Idd3 according to the procedure of Lae- B6 DNA by PCR and confirmed by sequencing; a targeting construct to knock mmli. Proteins were transferred onto nylon membranes using standard pro- in the B6 IL-2 gene was generated as follows. The Psil-Clal fragment from the cedures. The membrane was incubated with anti-IL-2 antibody (JES6–1A12, cloned NOD IL-2 gene was cloned into the pBluescript vector. Then, the BD), was washed twice, and was incubated with HRP-conjugated sheep anti- Ј Sbfl-Bcll fragment was cut out and substituted with the corresponding seg- rat Ig antibody (F(ab )2 fragment) (Amersham). The membrane was developed ment from B6 mice. This substituted Psi-ClaI fragment was cut by Bcll and using West Pico Luminol/Enhancer solutions (Pierce). linked to a fragment encoding the neomycin resistance gene flanked by loxP sequences. The fragment was then removed using Notl and Xhol and cloned Analysis of T1D Development. Diabetes was monitored by measuring urine into our standard thymidine kinase-expressing vector to yield the construct. glucose with Diastix (Bayer). Animals were considered diabetic after 2 con- Ն DNA of this targeting construct was linearized by cleavage with Notl and secutive readings of 500 mg/dL. The frequency of diabetes was compared electroporated into one of the 129/NOD ES cell lines (no. 7). Ten million cells between strains with the Kaplan–Meier log-rank test. were plated in selection media that are routinely used for our 129 ES cells (DMEM, 15% FCS, 103 units/mL LIF, 2 mM L-glutamine, 300 ␮g/mL G418, and 1 Histology of Islets. The presence of insulitis was assessed after fixation of ␮M ganciclovir). Ninety colonies were obtained and transferred to duplicate pancreata in buffered 10% formalin and paraffin sectioning. Tissue sections (5 ␮ 24 well plates. DNA was prepared from these cells and cleaved by restriction m) were stained with hematoxylin and eosin and examined for the presence enzymes. Southern blotting analysis was performed to identify those clones in of mononuclear cell infiltration. Two noncontiguous sections of pancreas were examined for each mouse. Comparisons of groups were performed using which appropriate gene targeting had occurred. For the 5Ј side of the inte- the Mann–Whitney U test. gration event, DNA was cleaved with EcoRV and BamHI and hybridized with a probe as illustrated in Fig. 2. Southern blot showed that all 10 clones ϫ exhibited the correct DNA pattern (for example, see Fig. 2). To analyze the 3Ј Allele-Specific Expression (ASE) assay of IL-2 gene. NOD NOD.IL-2B6ex1 F1 ϫ ␮ side of the integration event, DNA was cleaved with EcoRV and Southern blots and NOD NOD.B6 Idd3 F1 mice were injected with 5 g of anti-CD3 and were

killed after 1 h. CD4 T cells were isolated by MACS (Miltenyi) using negative IMMUNOLOGY generated. Hybridization with the second probe (see Fig. 2) yielded the selection with anti-CD8 (TIB105, ATCC), anti-NK1.1(HB191, ATCC), anti- appropriate hybridization pattern for the same 10 clones. We were encour- IA(M5114, ATCC). Total RNA was purified from these cells by TRIzol (Invitro- aged by the relatively high frequency (10/90 cell lines or 11%) of homologous gen) according to the manufacturer’s instructions, and was DNase treated recombination that we have observed with these ES cells. Karyotypic analysis using the RNase-free DNase kit (Qiagen). 1 ␮g of DNase treated total RNA was of these 10 ES cell lines was performed and it was confirmed they had no used as the template for cDNA synthesis using SuperScript II reverse transcrip- obvious chromosomal abnormality. tase (Invitrogen). We performed RT-PCR on the IL-2 gene using primers labeled with the fluorescent dye Fluorescein (Fam) (forward Fam-CATTCCCTT- Identification of Clones Targeted to NOD Allele. To identify clones whose NOD TCCCAACACAT, reverse AACGTGTAAATAACATGTGACCAGA). PCR product allele was targeted, the microsatellite marker D3nds36 was used in a retro- (154 bp) has (EcoRV, New England Biolabs) cleavage site in B6 allele generat- spective manner as described in the result section. PCR was performed with ing an 88bp fragment that is not in NOD. After digestion of the PCR product, primer pair 5Ј-ATGAGTTGGGAAGCTTGTGC-3Ј and 5Ј-GTAAAGGCCAAGG- it was analyzed by capillary electrophoresis (Applied Biosystems 3730xl) and GAAAAGG-3Ј. Then polyacrylamide gel electrophoresis was performed, and analyzed by Genemapper software to quantitate the PCR product from each the gel stained with ethidium bromide. The targeted clones were identified by allele. Allele specific expression was calculated as a percentage in added value digestion of PCR product amplified by cattgacacttgtgctccttgt and cagcat- of B6 and NOD allele. caaaatgcaatcatct. The B6 allele has an EcoRV site within this product, whereas the NOD allele does not. PCR product of the NOD allele is not cleaved with ACKNOWLEDGMENTS. We thank Linda Evangelisti and Cindy Hughes for gen- EcoRV and produces a 569 bp band, whereas the B6 product is cleaved into 2 erating ES cells and chimeric mice, respectively; Judy Stein for screening; Jonathan bands of 443 bp and 126 bp. The mice were backcrossed to NOD/ShiLtJ with the Alderman for managing the mouse program; Fran Manzo for help with manu- same screening method described above. script preparation; and Li Wen for providing NOD mice with the support of National Institutes of Health, Yale University, New Haven, CT, Grant P30 DK 045735-17. R.A.F. is an investigator of the Howard Hughes Medical Institute. ϫ 6 Intracellular Staining of Cytokines. 5 10 splenocytes from NOD.IL-2B6ex1 L.S.W. is a Juvenile Diabetes Research Foundation/Wellcome Trust Principal Re- knockin and their control NOD littermates were isolated and cultured in RPMI search Fellow. This work was supported by National Institutes of Health Grants medium 1640 (10% FBS, 100 ␮g/mL L-glutamine, 100 units/mL penicillin, 100 DK064312 and DK04735.

1. Serreze DV, Leiter EH (1994) Genetic and pathogenic basis of autoimmune diabetes in 10. Ridgway WM, Healy B, Smink LJ, Rainbow D, Wicker LS (2007) New tools for deﬁning NOD mice. Curr Opin Immunol 6:900–906. the ‘genetic background’ of inbred mouse strains. Nat Immunol 8:669–673. 2. Maier LM, Wicker LS (2005) Genetic susceptibility to type 1 diabetes. Curr Opin 11. Kanagawa O, Xu G, Tevaarwerk A, Vaupel BA (2000) Protection of nonobese diabetic mice Immunol 17:601–608. from diabetes by gene(s) closely linked to IFN-gamma receptor loci. J Immunol 164:3919–3923. 3. Ghosh S, et al. (1993) Polygenic control of autoimmune diabetes in nonobese diabetic 12. Nagafuchi S, et al. Establishment of an embryonic stem (ES) cell line derived from a mice. Nat Genet 4:404–409. non-obese diabetic (NOD) mouse: in vivo differentiation into lymphocytes and poten- 4. Wicker LS, et al. (1994) Resistance alleles at two non-major histocompatibility complex- tial for germ line transmission. FEBS Lett 455:101–104, 1999. linked insulin-dependent diabetes loci on chromosome 3, Idd3 and Idd10, protect 13. Brook FA, et al. (2003) The derivation of highly germline-competent embryonic stem nonobese diabetic mice from diabetes. J Exp Med 180:1705–1713. cells containing NOD-derived genome. Diabetes 52:205–208. 5. Yamanouchi J, et al. (2007) Interleukin-2 gene variation impairs regulatory T cell 14. Mortensen RM, Conner DA, Chao S, Geisterfer-Lowrance AA, Seidman JG (1992) function and causes autoimmunity. Nat Genet 39:329–337. Production of homozygous mutant ES cells with a single targeting construct. Mol Cell 6. Podolin PL, et al. (2000) Differential glycosylation of interleukin 2, the molecular basis Biol 12:2391–2395. for the NOD Idd3 type 1 diabetes gene? Cytokine 12:477–482. 7. Wrenshall LE, Platt JL (1999) Regulation of T cell homeostasis by heparan sulfate-bound 15. Serreze DV, et al. (1996) B lymphocytes are essential for the initiation of T cell-mediated IL-2. J Immunol 163:3793–3800. autoimmune diabetes: Analysis of a new ‘‘speed congenic’’ stock of NOD. Ig mu null 8. Wrenshall LE, Platt JL, Stevens ET, Wight TN, Miller JD (2003) Propagation and control mice. J Exp Med 184:2049–2053. of T cell responses by heparan sulfate-bound IL-2. J Immunol 170:5470–5474. 16. del Rio R, et al. (2008) SNPs upstream of the minimal promoter control IL-2 expression 9. King C, Ilic A, Koelsch K, Sarvetnick N (2004) Homeostatic expansion of T cells during and are candidates for the autoimmune disease-susceptibility locus Aod2/Idd3/Eae3. immune insufﬁciency generates autoimmunity. Cell 117:265–277. Genes Immun 9:115–121.

Kamanaka et al. PNAS Early Edition ͉ 5of5 Downloaded by guest on September 24, 2021