DOCSLIB.ORG

Mouse Itgb1bp1 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

https://www.alphaknockout.com Mouse Itgb1bp1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Itgb1bp1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Itgb1bp1 gene (NCBI Reference Sequence: NM_008403 ; Ensembl: ENSMUSG00000062352 ) is located on Mouse chromosome 12. 7 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 7 (Transcript: ENSMUST00000076260). Exon 3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Itgb1bp1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-149N4 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null allele exhibit postnatal lethality, reduced weight and length, reduced ossification, and skull and skeleton abnormalities. Mice homozygous for a gene trap mutation are viable and do not exhibit any obvious abnormalites. Exon 3 starts from about 12.17% of the coding region. The knockout of Exon 3 will result in frameshift of the gene. The size of intron 2 for 5'-loxP site insertion: 2501 bp, and the size of intron 3 for 3'-loxP site insertion: 1917 bp. The size of effective cKO region: ~579 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 3 4 7 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Itgb1bp1 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7079bp) | A(25.43% 1800) | C(21.1% 1494) | T(31.56% 2234) | G(21.91% 1551) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr12 - 21277149 21280148 3000 browser details YourSeq 239 1562 1968 3000 86.5% chr5 + 106361907 106362358 452 browser details YourSeq 238 1498 1923 3000 86.7% chr8 + 86691150 86691694 545 browser details YourSeq 228 1408 1918 3000 85.0% chr13 - 113704795 113705293 499 browser details YourSeq 219 1551 1916 3000 83.8% chr15 + 41341368 41341759 392 browser details YourSeq 212 1407 1863 3000 88.2% chr3 - 69818219 69818685 467 browser details YourSeq 209 1469 1930 3000 86.2% chr7 - 140368946 140369442 497 browser details YourSeq 194 1601 1916 3000 85.7% chr15 + 42208580 42208911 332 browser details YourSeq 189 1414 1885 3000 86.9% chr13 + 30404836 30405347 512 browser details YourSeq 186 1436 1918 3000 83.1% chr12 - 27979444 27979940 497 browser details YourSeq 184 1603 1976 3000 90.8% chr5 + 32369653 32370045 393 browser details YourSeq 175 1405 1978 3000 84.8% chrX - 75595260 75595889 630 browser details YourSeq 175 1407 1896 3000 86.1% chr1 + 119492161 119492746 586 browser details YourSeq 172 1409 1976 3000 89.6% chr10 - 45816415 45817062 648 browser details YourSeq 161 1505 1971 3000 84.8% chr10 - 34053706 34054191 486 browser details YourSeq 151 1612 1971 3000 88.3% chr9 + 14962650 14963010 361 browser details YourSeq 143 1552 1968 3000 85.8% chr15 + 37619829 37620234 406 browser details YourSeq 142 1550 1968 3000 77.1% chr5 + 66243623 66244075 453 browser details YourSeq 139 1407 1916 3000 79.6% chr18 + 73081332 73081763 432 browser details YourSeq 136 1414 1955 3000 85.2% chr14 - 120809851 120810391 541 Note: The 3000 bp section upstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr12 - 21273570 21276569 3000 browser details YourSeq 224 1348 2513 3000 97.9% chr11 + 97725466 97972363 246898 browser details YourSeq 192 2357 2623 3000 93.2% chrX + 13250827 13251306 480 browser details YourSeq 173 2280 2518 3000 88.3% chr4 + 107355013 107355212 200 browser details YourSeq 160 2346 2517 3000 98.3% chr2 - 26328368 26328539 172 browser details YourSeq 160 2320 2518 3000 90.3% chr1 - 157288824 157288999 176 browser details YourSeq 154 2361 2616 3000 85.3% chr4 + 125159867 125160119 253 browser details YourSeq 152 2305 2508 3000 92.6% chr1 - 99440740 99440958 219 browser details YourSeq 152 2323 2517 3000 89.7% chr13 + 92093378 92093542 165 browser details YourSeq 149 2346 2513 3000 94.7% chr10 + 33988750 33988918 169 browser details YourSeq 147 2359 2516 3000 96.2% chr12 + 28653409 28653565 157 browser details YourSeq 145 2360 2530 3000 92.9% chr1 - 85449801 85449984 184 browser details YourSeq 143 2346 2519 3000 91.4% chr15 - 22263998 22264173 176 browser details YourSeq 143 2373 2573 3000 92.4% chr1 - 86296702 86297280 579 browser details YourSeq 142 2358 2517 3000 95.0% chr1 - 72618610 72618776 167 browser details YourSeq 141 2333 2513 3000 89.5% chrX - 103188729 103188880 152 browser details YourSeq 141 2314 2514 3000 86.7% chr1 - 61661063 61661240 178 browser details YourSeq 140 2358 2516 3000 94.4% chr6 - 113708609 113708770 162 browser details YourSeq 139 505 657 3000 95.5% chr17 + 24172604 24172756 153 browser details YourSeq 138 503 664 3000 91.4% chr2 - 104944614 104944774 161 Note: The 3000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Itgb1bp1 integrin beta 1 binding protein 1 [ Mus musculus (house mouse) ] Gene ID: 16413, updated on 24-Oct-2019 Gene summary Official Symbol Itgb1bp1 provided by MGI Official Full Name integrin beta 1 binding protein 1 provided by MGI Primary source MGI:MGI:1306802 See related Ensembl:ENSMUSG00000062352 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Icap1; AI449260; AU019480 Expression Ubiquitous expression in testis adult (RPKM 30.9), subcutaneous fat pad adult (RPKM 11.0) and 24 other tissues See more Orthologs human all Genomic context Location: 12; 12 A1.3 See Itgb1bp1 in Genome Data Viewer Exon count: 8 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 12 NC_000078.6 (21267246..21286292, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 12 NC_000078.5 (21275667..21292098, complement) Chromosome 12 - NC_000078.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 7 transcripts Gene: Itgb1bp1 ENSMUSG00000062352 Description integrin beta 1 binding protein 1 [Source:MGI Symbol;Acc:MGI:1306802] Gene Synonyms bodenin Location Chromosome 12: 21,240,825-21,286,284 reverse strand. GRCm38:CM001005.2 About this gene This gene has 7 transcripts (splice variants), 198 orthologues, is a member of 1 Ensembl protein family and is associated with 25 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Itgb1bp1-201 ENSMUST00000076260.11 1921 200aa ENSMUSP00000075609.4 Protein coding CCDS25833 O35671 TSL:1 GENCODE basic APPRIS P1 Itgb1bp1-206 ENSMUST00000173729.7 1701 200aa ENSMUSP00000134627.1 Protein coding CCDS25833 O35671 TSL:1 GENCODE basic APPRIS P1 Itgb1bp1-207 ENSMUST00000232072.1 954 200aa ENSMUSP00000156312.1 Protein coding CCDS25833 O35671 GENCODE basic APPRIS P1 Itgb1bp1-202 ENSMUST00000172834.1 801 188aa ENSMUSP00000134508.1 Protein coding - Q3UGH2 TSL:1 GENCODE basic Itgb1bp1-205 ENSMUST00000173688.1 512 84aa ENSMUSP00000133557.1 Protein coding - G3UX55 CDS 5' incomplete TSL:3 Itgb1bp1-204 ENSMUST00000173614.1 858 No protein - Retained intron - - TSL:2 Itgb1bp1-203 ENSMUST00000172962.1 448 No protein - lncRNA - - TSL:3 Page 6 of 8 https://www.alphaknockout.com 65.46 kb Forward strand 21.24Mb 21.25Mb 21.26Mb 21.27Mb 21.28Mb 21.29Mb Genes Asap2-204 >protein coding Cpsf3-204 >nonsense mediated decay (Comprehensive set... Asap2-202 >protein coding Cpsf3-207 >protein coding Asap2-203 >protein coding Cpsf3-206 >protein coding Asap2-201 >protein coding Cpsf3-209 >protein coding Cpsf3-201 >protein coding Cpsf3-211 >protein coding Cpsf3-205 >protein coding Gm25821-201 >snoRNA Contigs AC156032.4 > Genes (Comprehensive set... < Itgb1bp1-203lncRNA < Gm20535-201lncRNA < Itgb1bp1-207protein coding < Itgb1bp1-201protein coding < Itgb1bp1-206protein coding < Itgb1bp1-205protein coding < Itgb1bp1-202protein coding < Itgb1bp1-204retained intron Regulatory Build 21.24Mb 21.25Mb 21.26Mb 21.27Mb 21.28Mb
Recommended publications
  • Expression Profiling of KLF4

    Expression Profiling of KLF4

    Expression Profiling of KLF4 AJCR0000006 Supplemental Data Figure S1. Snapshot of enriched gene sets identified by GSEA in Klf4-null MEFs. Figure S2. Snapshot of enriched gene sets identified by GSEA in wild type MEFs. 98 Am J Cancer Res 2011;1(1):85-97 Table S1: Functional Annotation Clustering of Genes Up-Regulated in Klf4 -Null MEFs ILLUMINA_ID Gene Symbol Gene Name (Description) P -value Fold-Change Cell Cycle 8.00E-03 ILMN_1217331 Mcm6 MINICHROMOSOME MAINTENANCE DEFICIENT 6 40.36 ILMN_2723931 E2f6 E2F TRANSCRIPTION FACTOR 6 26.8 ILMN_2724570 Mapk12 MITOGEN-ACTIVATED PROTEIN KINASE 12 22.19 ILMN_1218470 Cdk2 CYCLIN-DEPENDENT KINASE 2 9.32 ILMN_1234909 Tipin TIMELESS INTERACTING PROTEIN 5.3 ILMN_1212692 Mapk13 SAPK/ERK/KINASE 4 4.96 ILMN_2666690 Cul7 CULLIN 7 2.23 ILMN_2681776 Mapk6 MITOGEN ACTIVATED PROTEIN KINASE 4 2.11 ILMN_2652909 Ddit3 DNA-DAMAGE INDUCIBLE TRANSCRIPT 3 2.07 ILMN_2742152 Gadd45a GROWTH ARREST AND DNA-DAMAGE-INDUCIBLE 45 ALPHA 1.92 ILMN_1212787 Pttg1 PITUITARY TUMOR-TRANSFORMING 1 1.8 ILMN_1216721 Cdk5 CYCLIN-DEPENDENT KINASE 5 1.78 ILMN_1227009 Gas2l1 GROWTH ARREST-SPECIFIC 2 LIKE 1 1.74 ILMN_2663009 Rassf5 RAS ASSOCIATION (RALGDS/AF-6) DOMAIN FAMILY 5 1.64 ILMN_1220454 Anapc13 ANAPHASE PROMOTING COMPLEX SUBUNIT 13 1.61 ILMN_1216213 Incenp INNER CENTROMERE PROTEIN 1.56 ILMN_1256301 Rcc2 REGULATOR OF CHROMOSOME CONDENSATION 2 1.53 Extracellular Matrix 5.80E-06 ILMN_2735184 Col18a1 PROCOLLAGEN, TYPE XVIII, ALPHA 1 51.5 ILMN_1223997 Crtap CARTILAGE ASSOCIATED PROTEIN 32.74 ILMN_2753809 Mmp3 MATRIX METALLOPEPTIDASE
  • Methylome and Transcriptome Maps of Human Visceral and Subcutaneous

    Methylome and Transcriptome Maps of Human Visceral and Subcutaneous

    www.nature.com/scientificreports OPEN Methylome and transcriptome maps of human visceral and subcutaneous adipocytes reveal Received: 9 April 2019 Accepted: 11 June 2019 key epigenetic diferences at Published: xx xx xxxx developmental genes Stephen T. Bradford1,2,3, Shalima S. Nair1,3, Aaron L. Statham1, Susan J. van Dijk2, Timothy J. Peters 1,3,4, Firoz Anwar 2, Hugh J. French 1, Julius Z. H. von Martels1, Brodie Sutclife2, Madhavi P. Maddugoda1, Michelle Peranec1, Hilal Varinli1,2,5, Rosanna Arnoldy1, Michael Buckley1,4, Jason P. Ross2, Elena Zotenko1,3, Jenny Z. Song1, Clare Stirzaker1,3, Denis C. Bauer2, Wenjia Qu1, Michael M. Swarbrick6, Helen L. Lutgers1,7, Reginald V. Lord8, Katherine Samaras9,10, Peter L. Molloy 2 & Susan J. Clark 1,3 Adipocytes support key metabolic and endocrine functions of adipose tissue. Lipid is stored in two major classes of depots, namely visceral adipose (VA) and subcutaneous adipose (SA) depots. Increased visceral adiposity is associated with adverse health outcomes, whereas the impact of SA tissue is relatively metabolically benign. The precise molecular features associated with the functional diferences between the adipose depots are still not well understood. Here, we characterised transcriptomes and methylomes of isolated adipocytes from matched SA and VA tissues of individuals with normal BMI to identify epigenetic diferences and their contribution to cell type and depot-specifc function. We found that DNA methylomes were notably distinct between diferent adipocyte depots and were associated with diferential gene expression within pathways fundamental to adipocyte function. Most striking diferential methylation was found at transcription factor and developmental genes. Our fndings highlight the importance of developmental origins in the function of diferent fat depots.
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene

    Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene

    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
  • A De Novo Microdeletion 2P24.3-25.1 Identified in a Girl with Global Development Delay Hristo Y

    A De Novo Microdeletion 2P24.3-25.1 Identified in a Girl with Global Development Delay Hristo Y

    SHORT COMMUNICATION BioDiscovery A de novo microdeletion 2p24.3-25.1 identified in a girl with global development delay Hristo Y. Ivanov1#, Vili K. Stoyanova1,2*#, Radoslava Vazharova3,4#, Aleksandar Linev2, Ivan Ivanov1,2, Samuil Ivanov4, Lubomir Balabanski4, Draga Toncheva4,5 1Medical University - Plovdiv, Department of Pediatrics and Medical Genetics, Plovdiv, Bulgaria 2University Hospital „St. George „- Plovdiv, Bulgaria 3Sofia University „St. Kliment Ohridski“, Faculty of Medicine, Department of Biology, Medical Genetics and Microbiology, Sofia, Bulgaria 4Gynecology and Assisted Reproduction Hospital «Dr. Malinov»; Sofia, Bulgaria 5Medical University - Sofia, Department of Medical Genetics, Bulgaria Abstract Interstitial microdeletions of the distal 2p are very rare. A small number of cases have been reported in the literature, involving regions 2p23-p25, 2p23-p24 and 2p24-p25. The most common symptoms involve: intrauterine growth retardation, developmental delay, mental retardation, microcephaly, craniofacial anomalies, musculoskeletal abnormalities, congenital heart defect and hearing impairment. Herein we report on a Caucasian girl, born after in vitro fertilization with discrete facial dysmorphism, growth failure, borderline neurodevelopment and congenital heart defect. A de novo pericentric inversion of chromosome 2 was identified by routine karyotyping. An interstitial microdeletion of 2p24.3p25.1 was found by array karyotyping and following FISH analysis revealed that the deletion affects the inverted chromosome 2. This case illustrates the utility of high resolution methods to identify submicroscopic quantitative changes in structurally rearranged chromosomes. The precise determination of the genetic content of small quantitative changes in the genome provides important information for genetic counseling, enabling to predict the course of disease and the planning of adequate therapy and prophylaxis in affected families.
  • Downloaded Expression Matrices Are Already Preprocessed Such That Outliers Are Rejected and Expression Counts Are Quantile Normalized As Standard Normal Distribution

    Downloaded Expression Matrices Are Already Preprocessed Such That Outliers Are Rejected and Expression Counts Are Quantile Normalized As Standard Normal Distribution

    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.13.249839; this version posted August 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Profiling variable-number tandem repeat variation across populations using repeat-pangenome graphs Tsung-Yu Lu, The Human Genome Structural Variation Consortium, Mark Chaisson Abstract Variable number tandem repeats (VNTR) are genetic loci composed of consecutive repeats of short segments of DNA, with hypervariable repeat count and composition across individuals. Many genes have coding VNTR sequences, and noncoding VNTR variants are associated with a wide spectrum of clinical disorders such as Alzheimer's disease, bipolar disorder and colorectal cancer. The identification of VNTR length and composition provides the basis for downstream analysis such as expression quantitative trait loci discovery and genome wide association studies. Disease studies that use high-throughput short read sequencing do not resolve the repeat structures of many VNTR loci because the VNTR sequence is missing from the reference or is too repetitive to map. We solve the VNTR mapping problem for short reads by representing a collection of genomes with a repeat-pangenome graph, a data structure that encodes both the population diversity and repeat structure of VNTR loci. We developed software to build a repeat-pangenome using haplotype-resolved single-molecule sequencing assemblies, and to estimate VNTR length and sequence composition based on the alignment of short read sequences to the graph.
  • Cerebral Cavernous Malformation Protein CCM1 Inhibits Sprouting Angiogenesis by Activating DELTA-NOTCH Signaling

    Cerebral Cavernous Malformation Protein CCM1 Inhibits Sprouting Angiogenesis by Activating DELTA-NOTCH Signaling

    Cerebral cavernous malformation protein CCM1 inhibits sprouting angiogenesis by activating DELTA-NOTCH signaling Joycelyn Wüstehubea,b,1, Arne Bartola,b,1, Sven S. Lieblera,b, René Brütscha, Yuan Zhuc, Ute Felbord, Ulrich Surec, Hellmut G. Augustina,b, and Andreas Fischera,b,2 aVascular Biology and Tumor Angiogenesis, Medical Faculty Mannheim, Heidelberg University, D-68167 Mannheim, Germany; bVascular Oncology and Metastasis, German Cancer Research Center (DKFZ-ZMBH Alliance), D-69120 Heidelberg, Germany; cDepartment of Neurosurgery, University Hospital Essen, D-45122 Essen, Germany; and dInstitute of Human Genetics, University Hospital Greifswald, D-17475 Greifswald, Germany Edited by Napoleone Ferrara, Genentech, Inc., South San Francisco, CA, and approved June 7, 2010 (received for review January 7, 2010) Cerebral cavernous malformations (CCM) are frequent vascular strongly reduced, suggesting a defect in arterial/venous differenti- abnormalities caused by mutations in one of the CCM genes. ation (11). In contrast, loss of ccm1 in zebrafish does not alter ar- CCM1 (also known as KRIT1) stabilizes endothelial junctions and is terial marker gene expression, but leads to dilation of major vessels essential for vascular morphogenesis in mouse embryos. However, because of excessive spreading of endothelial cells (12). The clinical cellular functions of CCM1 during the early steps of the CCM path- observation that CCM lesions grow in response to VEGF (13) ogenesis remain unknown. We show here that CCM1 represents an suggests that their formation could be driven by angiogenesis: the antiangiogenic protein to keep the human endothelium quiescent. growth of new blood vessels from preexisting ones. We conse- CCM1 inhibits endothelial proliferation, apoptosis, migration, lu- quently hypothesized that CCM lesions may reflect a pathological men formation, and sprouting angiogenesis in primary human en- angiogenesis.
  • Mescs. Genes Were Categorized According to GO Groups

    Mescs. Genes Were Categorized According to GO Groups

    Supplementary information Table S1. List of primers for RT-PCR and ChIP-qPCR during differentiation of mESCs. Gene Forward (5' to 3') Reverse (5’ to 3') Amplicon size RT-qPCR Brachyury CCAGCTCTAAGGAACCACCG ACTCCGAGGCTAGACCAGTT 137 bp Cdx2 TGTACACAGACCATCAGCGG CCAAATTTTAACCTGCCTCTCGG 125 bp Dnmt3b GCCAGACCTTGGAAACCTCA TTGTTTCCTGAAAGAAGGCCC 139 bp Dppa5a GACCCTCGTGACCCGTAAAG CCCTGTGGGCCAAACAGATA 117 bp Enpp2 CAGAGGAAGTCAGCAGACCC CCAATTTGTTCTTTGGCTCTACCT 105 bp Eomes ACAACTACGATTCATCCCATCAGA GGGCTTGAGGCAAAGTGTTG 96 bp Esrp1 GGCCTGGCCTACAATACTGG CATCCTCGGTTGCATACTGGT 73 bp Esrrb CCTTAGTCACAAAGAGACACAGAC TTCGGTTCAGCAGCATGGTT 150 bp Gapdh CGTGCCGCCTGGAGAAACC TGGAAGAGTGGGAGTTGCTGTTG 144 bp GATA4 CCCTGGAAGACACCCCAATC ATTGCACAGGTAGTGTCCCG 127 bp Grb10 GCGTCCTAGCTCTGTACCTTG GACCATGCTCTGGTTGGCTT 109 bp Hand1 CGGAAAAGGGAGTTGCCTCA GGTGCGCCCTTTAATCCTCT 81 bp Kdr GAGATTACAAGGCTTTCAGCA CCTCCGTTTGAGATGAGAGAG 119 bp Klf4 GACTAACCGTTGGCGTGAGG CGGGTTGTTACTGCTGCAAG 106 bp Lefty1 CTCGATCAACCGCCAGTCCT TGCCACCTCTCGAAGGTTCTG 150 bp Lefty2 CCTGGACAGCGCGGATG GCCTGCCACCTCTCGAAAAT 136 bp Lrp2 AGCGGCTACAGTGGAGAGTA AAGAGCCATTGTCGTCCCTG 72 bp Nanog AGGATGAAGTGCAAGCGGTG CTGGTGCTGAGCCCTGAAT 76 bp Nestin GAGGCGCTGGAACAGAGATT TAGACCCTGCTTCTCCTGCT 105 bp Nodal CTGGCGTACATGTTGAGCCT GGTCACGTCCACATCTTGCG 87 bp Pdgfa AGGAGGAGACAGATGTGAGGT TTCAGGAATGTCACACGCCA 81 bp Pdha2 TGGAATGGGAACCTCCAACG CTGCAAACTTGGTTGCCTCC 128 bp Pou3f1 TCCCCACAGCGAAAGGTAAC GGGGACTCTCCTCTCTTCGT 74 bp Pou5f1 (Oct4) GCAGATAGGAACTTGCTGGGT CACCTTTCCAAAGAGAACGCC 149 bp Slc27a2 CATCGTGGTTGGGGCTACTT GGTACCGAAGCAGTTCACCA
  • A Survey of Genetic Human Cortical Gene Expression

    A Survey of Genetic Human Cortical Gene Expression

    LETTERS A survey of genetic human cortical gene expression Amanda J Myers1,2,10, J Raphael Gibbs1,3,10, Jennifer A Webster4,5,10, Kristen Rohrer1, Alice Zhao1, Lauren Marlowe1, Mona Kaleem1, Doris Leung1, Leslie Bryden1, Priti Nath1, Victoria L Zismann4,5, Keta Joshipura4,5, Matthew J Huentelman4,5, Diane Hu-Lince4,5, Keith D Coon4–6, David W Craig4,5, John V Pearson4,5, Peter Holmans7, Christopher B Heward8, Eric M Reiman4,5,9, Dietrich Stephan4,5,9 & John Hardy1,3 It is widely assumed that genetic differences in gene expression not receive any neurologic assessment. Very little has been done with underpin much of the difference among individuals and many other tissues because of their inaccessibility. However, it is well of the quantitative traits of interest to geneticists. Despite this, established that mRNA is stable postmortem in the human brain8, http://www.nature.com/naturegenetics there has been little work on genetic variability in human gene and our and others’ studies have shown that the apolipoprotein expression and almost none in the human brain, because E(APOE) and microtubule-associated protein tau (MAPT)genes tools for assessing this genetic variability have not been are subject to distortions in allelic expression9–11.Additionally,several available. Now, with whole-genome SNP genotyping arrays studies using inbred mouse strains have mapped important expression and whole-transcriptome expression arrays, such experiments quantitative trait loci (eQTL) in the mouse brain1–3.Withthisback- have become feasible. We have carried out whole-genome ground, we developed a resource that allows the assessment of the genotyping and expression analysis on a series of 193 genetic effects on normal human cortical gene expression.
  • The Rhox Homeobox Gene Cluster Is Imprinted and Selectively Targeted for Regulation by Histone H1 and DNA Methylationᰔ James A

    The Rhox Homeobox Gene Cluster Is Imprinted and Selectively Targeted for Regulation by Histone H1 and DNA Methylationᰔ James A

    MOLECULAR AND CELLULAR BIOLOGY, Mar. 2011, p. 1275–1287 Vol. 31, No. 6 0270-7306/11/$12.00 doi:10.1128/MCB.00734-10 Copyright © 2011, American Society for Microbiology. All Rights Reserved. The Rhox Homeobox Gene Cluster Is Imprinted and Selectively Targeted for Regulation by Histone H1 and DNA Methylationᰔ James A. MacLean II,2,6 Anilkumar Bettegowda,1,6† Byung Ju Kim,3† Chih-Hong Lou,1† Seung-Min Yang,3† Anjana Bhardwaj,6 Sreenath Shanker,6 Zhiying Hu,6 Yuhong Fan,3,5 Sigrid Eckardt,4 K. John McLaughlin,4 Arthur I. Skoultchi,3 and Miles F. Wilkinson1,6* Department of Reproductive Medicine, University of California—San Diego School of Medicine, La Jolla, California 920931; Department of Physiology, Southern Illinois University, Carbondale, Illinois 629012; Department of Cell Biology, Albert Einstein College of Medicine, Bronx, New York 104613; Center for Molecular and Human Genetics, The Research Institute at Nationwide Children’s Hospital, Columbus, Ohio 432054; School of Biology, Georgia Institute of Technology, Atlanta, Georgia 303325; and Department of Biochemistry and Molecular Biology, The University of Texas, M. D. Anderson Cancer Center, Houston, Texas 770306 Received 24 June 2010/Returned for modification 18 July 2010/Accepted 5 January 2011 Histone H1 is an abundant and essential component of chromatin whose precise role in regulating gene expression is poorly understood. Here, we report that a major target of H1-mediated regulation in embryonic stem (ES) cells is the X-linked Rhox homeobox gene cluster. To address the underlying mechanism, we examined the founding member of the Rhox gene cluster—Rhox5—and found that its distal promoter (Pd) loses H1, undergoes demethylation, and is transcriptionally activated in response to loss of H1 genes in ES cells.
  • Anti-RAP1A + RAP1B Antibody (ARG57715)

    Anti-RAP1A + RAP1B Antibody (ARG57715)

    Product datasheet [email protected] ARG57715 Package: 100 μl anti-RAP1A + RAP1B antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes RAP1A + RAP1B Tested Reactivity Hu, Ms, Rat Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name RAP1A + RAP1B Antigen Species Human Immunogen Synthetic peptide from Human RAP1A. Conjugation Un-conjugated Alternate Names Ras-related protein Krev-1; C21KG; SMGP21; Ras-related protein Rap-1A; RAP1; KREV1; KREV-1; G-22K; GTP-binding protein smg p21A; K-REV; RAL1B Application Instructions Application table Application Dilution WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Mouse lung Calculated Mw RAP1A and RAP1B: 21 kDa Observed Size 21 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol RAP1A; RAP1B Gene Full Name RAP1A, member of RAS oncogene family; RAP1B, member of RAS oncogene family Background This gene encodes a member of the Ras family of small GTPases.
  • Supplemental Table S3. List of the Genes Down-Regulated 1-2 Days Following CTX Treatment

    Supplemental Table S3. List of the Genes Down-Regulated 1-2 Days Following CTX Treatment

    Supplemental Table S3. List of the genes down-regulated 1-2 days following CTX treatment Parametric Gene symbol Description EntrezID p-value* BAG2 BCL2-associated athanogene 2 9532 6.20E-06 MCM6 MCM6 minichromosome maintenance deficient 6 4175 6.87E-05 BLMH bleomycin hydrolase 642 7.17E-05 UBB ubiquitin B 7314 7.46E-05 STMN1 stathmin 1/oncoprotein 18 3925 9.12E-05 PTBP2 polypyrimidine tract binding protein 2 58155 9.69E-05 KLRC4 killer cell lectin-like receptor subfamily K, member 1 22914 1.41E-04 LRBA LPS-responsive vesicle trafficking, beach and anchor containing 987 1.81E-04 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 4170 1.84E-04 RNF10 ring finger protein 10 9921 1.91E-04 GO67 golgin-67 23015 2.11E-04 HMGN2P18 high mobility group nucleosomal binding domain 2 pseudogene 18 648822 2.19E-04 C9orf78 chromosome 9 open reading frame 78 51759 2.20E-04 CCND2 cyclin D2 894 2.21E-04 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 7525 2.44E-04 PSME4 proteasome (prosome, macropain) activator subunit 4 23198 2.50E-04 HARS2 histidyl-tRNA synthetase 2 92675 2.50E-04 NSUN2 NOL1/NOP2/Sun domain family, member 2 54888 2.65E-04 EML4 echinoderm microtubule associated protein like 4 27436 2.88E-04 EEF1G eukaryotic translation elongation factor 1 gamma 1937 3.05E-04 CREM cAMP responsive element modulator 1390 3.08E-04 FBXO7 F-box protein 7 25793 3.08E-04 SLC25A37 mitochondrial solute carrier protein 51312 3.41E-04 IGHG1 immunoglobulin heavy constant gamma 1 (G1m marker) 3500 3.56E-04 IGJ immunoglobulin J polypeptide, linker protein for
  • Identification of Significant Pathways in Gastric Cancer Based on Protein-Protein Interaction Networks and Cluster Analysis

    Identification of Significant Pathways in Gastric Cancer Based on Protein-Protein Interaction Networks and Cluster Analysis

    Genetics and Molecular Biology, 35, 3, 701-708 (2012) Copyright © 2012, Sociedade Brasileira de Genética. Printed in Brazil www.sbg.org.br Research Article Identification of significant pathways in gastric cancer based on protein-protein interaction networks and cluster analysis Kongwang Hu1 and Feihu Chen2 1Department of General Surgery, The First Affiliated Hospital of Anhui Medical University, Anhui, P.R. China. 2School of Pharmacology, Anhui Medical University, Anhui, P.R. China. Abstract Gastric cancer is one of the most common and lethal cancers worldwide. However, despite its clinical importance, the regulatory mechanisms involved in the aggressiveness of this cancer are still poorly understood. A better under- standing of the biology, genetics and molecular mechanisms of gastric cancer would be useful in developing novel targeted approaches for treating this disease. In this study we used protein-protein interaction networks and cluster analysis to comprehensively investigate the cellular pathways involved in gastric cancer. A primary immunodefi- ciency pathway, focal adhesion, ECM-receptor interactions and the metabolism of xenobiotics by cytochrome P450 were identified as four important pathways associated with the progression of gastric cancer. The genes in these pathways, e.g., ZAP70, IGLL1, CD79A, COL6A3, COL3A1, COL1A1, CYP2C18 and CYP2C9, may be considered as potential therapeutic targets for gastric cancer. Key words: graph clustering, pathway crosstalk, protein-protein interaction network. Received: March 12, 2012; Accepted: May 4, 2012. Introduction mal persons (Offerhaus et al., 1992). b-catenin is fre- Gastric cancer is one of the most common malignan- quently mutated in gastric cancer (Clements et al., 2002). In cies worldwide (Lin et al., 2007b).