<I>Drosophila Melanogaster</I>

University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange

Masters Theses Graduate School

8-2011

Functional analysis of the Cyp6a8 gene promoter of Drosophila melanogaster for caffeine- and Phenobarbital-inducibility by site- directed mutagenesis

Olivia Nichole Hill [email protected]

Follow this and additional works at: https://trace.tennessee.edu/utk_gradthes

Part of the Molecular Genetics Commons

Recommended Citation Hill, Olivia Nichole, "Functional analysis of the Cyp6a8 gene promoter of Drosophila melanogaster for caffeine- and Phenobarbital-inducibility by site-directed mutagenesis. " Master's Thesis, University of Tennessee, 2011. https://trace.tennessee.edu/utk_gradthes/979

This Thesis is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Masters Theses by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council:

I am submitting herewith a thesis written by Olivia Nichole Hill entitled "Functional analysis of the Cyp6a8 gene promoter of Drosophila melanogaster for caffeine- and Phenobarbital- inducibility by site-directed mutagenesis." I have examined the final electronic copy of this thesis for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Master of Science, with a major in Biochemistry and Cellular and Molecular Biology.

Ranjan Ganguly, Major Professor

We have read this thesis and recommend its acceptance:

Mariano Labrador, Bruce D. McKee

Accepted for the Council: Carolyn R. Hodges

Vice Provost and Dean of the Graduate School

(Original signatures are on file with official studentecor r ds.) Functional analysis of the Cyp6a8 gene promoter of Drosophila melanogaster for caffeine- and Phenobarbital-inducibility by site- directed mutagenesis

A Thesis Presented for the Master of Science Degree The University of Tennessee, Knoxville

Olivia Nichole Hill August 2011 This thesis is dedicated to my mother,

Denise Hill,

and to my grandparents,

Robert and Betty Sharp

ii ACKNOWLEDGEMENTS

I would like to first thank my family for their unending support and hard work, without which I would not have been able to follow my dreams. My mother, Denise Hill, and grandparents, Robert and Betty Sharp (DaddySharp and MamaSharp), have always encouraged my childhood interests, from drawing and painting to reading and writing. My mother always made sure that I was able to pursue these dreams, even if that meant she had to work extra hours to pay for art lessons or supplies; I would never have gotten to where I am now in life without the love and support from my mother. My grandparents have always provided me with a place to feel safe and at home, and they showed me what true love and dedication really is. For that, I am forever grateful. I will never forget catching fireflies in their backyard or the science experiments my cousins and I used to perform on slugs under the deck. Although I am officially an adult, I’m glad I’ve never really lost the spirit of my childhood. My family has always encouraged me to be true to myself, and, without them, I would not be the strong, independent person I am today.

Next, I would like to show my most sincere appreciation to my graduate mentor and advisor, Dr. Ranjan Ganguly, for believing in me and helping me to become the scientist that I am today. I am deeply grateful for his attention and guidance. He always supported me as a student and scientist, and his belief in my abilities has helped me to develop into a much more confident and knowledgeable person. He trusted me with the great responsibility of being in charge of the lab as the sole graduate student, and I am thankful for his confidence in me. He has been such an inspiration to me as a teacher, as a scientist, and, most importantly, as a person. I aspire to someday show the same compassion, intelligence, and kindness that I see in Dr.

Ganguly everyday. I would like to thank both Dr. Ranjan Ganguly and his wife, Dr. Nivedita

Ganguly, for inviting me into their home on numerous occasions. I hope we will continue our iii dinner parties and pool games even after I graduate. Dr. Nivedita Ganguly has also been an amazing inspiration to me, and she has provided a great deal of guidance as I begin my career as a teacher. I know I can always come to her for advice, encouragement, and support.

I would also like to thank my friends in the neighboring labs, especially those in Dr.

Bruce McKee and Dr. Mariano Labrador’s labs. My friends in these labs, Cherie (Shih-Jui),

Heather, Todd, Shaofei, Badri, Rihui, Ray (Jui-He), and Avik, let me borrow supplies and equipment and gave me ideas and advice when I was frustrated or at a standstill in an experiment. I will miss the conversations and laughs we had as we visited one another’s labs and took some much-needed breaks from our lab work. I would like to thank the undergraduates,

Sadie, Sandi, Molly, and Savannah, that I have had the privilege of working with in the lab. I would also like to give a special thank you to Morgan, who started out as my student, then became a lab member, and has turned into an amazing friend I’m sure I will keep for life.

I would like to express my gratitude to my committee members, Dr. Bruce McKee and

Dr. Mariano Labrador. I appreciate the time they have taken out of their busy schedules to provide advice and comments during committee meetings and on my thesis. I would also like to give a special thanks to Dr. Bruce McKee for allowing me to work in his lab before I began graduate school; he helped familiarize me with working in a lab and was the first to encourage my decision to pursue a graduate degree in Biochemistry and Cellular and Molecular Biology.

Additionally, I would like to express my appreciation for all of the professors I have had here at the University of Tennessee, during both my undergraduate and graduate careers. They have given me the foundation of knowledge that I needed to succeed in the future. I would especially like to thank the professors that have given me the opportunity to teach for them as a graduate teaching assistant. These experiences have led me to the decision to become a teacher.

iv These professors and experiences have beyond a doubt helped me grow both personally and professionally.

Finally, I would like to give a special thanks to my loved ones and friends. Growing up here in Knoxville, I have collected an amazing group of friends. I am so grateful for my high school friends that I still keep in touch with, especially Celia; I know, no matter what, I can always come to her for her honest advice and opinions, and I love her for that. I would like to also thank Fallon for being a wonderful best friend over the past ten years and for never letting a single moment with her be boring. I would like to thank Vita for being an incredible friend and workout buddy; even after she left the lab, she was still always willing to help when I called her with questions. We have grown so close, and I look forward to spending even more time together as we both begin our “grown-up” careers. Last, but definitely not least, I am sincerely grateful to

Kevin Ritter. His love, support, and companionship have helped me through my graduate school years. I still remember our first date right before I went to teach my first biology lab. From that moment to now, Kevin has believed in me and encouraged me regardless of the circumstances.

As this chapter closes, I am excited and hopeful about what the next chapter of our lives together will bring.

v ABSTRACT

Cytochrome P450 enzymes (CYPs), found in almost all organisms, are involved in endobiotic metabolism and detoxification of xenobiotic compounds, such as drugs, pollutants, and insecticides. In insects, CYPs play a major role in conferring resistance to various insecticides including DDT. In Drosophila and other insects, DDT-resistant strains exhibit increased expression of multiple P450 genes; however, the mechanism of overexpression is unknown. Since many CYP genes including Cyp6a8 of Drosophila are induced by caffeine and other xenobiotics, these chemicals are used as tools to understand the regulation of these genes.

Previously it was shown that the 0.8-kb (-1/-732) and 0.2-kb (-1/-170) upstream DNA of Cyp6a8 of the DDT-resistant 91-R strain support caffeine, DDT, and Phenobarbital induction in adult flies and S2 cells, the 0.2-kb DNA has many transcriptionally important sequence motifs. In the present investigation, site-directed mutagenesis was performed on the putative TATA box and

CREB/AP-1 motifs located at the -97/-101, -57/-61, -43/-47, and -6/-10 regions of the 0.2- and

0.8 DNAs to determine their cis-regulatory role in caffeine and PB induction in S2 cells using luciferase reporter system. Results showed that all four deletions in 0.2- and 0.8-kb DNA decreased both basal and caffeine-induced activities, but maximum effect was seen with the -57/-

61 deletion. Second, the TATA mutations greatly decreased basal activity, but they did not decrease caffeine-inducibility as much as the -57/-61 mutations. Third, the effects of other three deletions on basal activities were not as pronounced in the 0.8-kb environment as were seen in the 0.2-kb environment. Taken together these results suggest that of all four putative CREB/AP1 sites the one located at -57/-61 region is most important for both basal and caffeine-induced activities. The results also suggest that the additional 600 bases upstream of -1/-170 have distal

vi elements that interact with the proximal promoter in the 0.2-kb DNA and boost basal transcription. A model suggesting interactions of all cis elements with the basal promoter for basal and induced transcription has been proposed.

vii Table of Contents

Chapter Page

I. General Introduction 1

Cytochrome P450 enzymes and biological functions 1

Insect P450s: xenobiotic metabolism 4

Cytochrome P450 overexpression and pesticide resistance 4

Cytochrome P450 inducibility by caffeine and Phenobarbital 5

Cyp6a8 gene function and induction 7

Objectives of present investigation 8

II. Materials and Methods 10

Mutagenesis of Cyp6a8 0.2-kb upstream DNA 10

Transient transfection and treatment of S2 cells 15

Cell extract preparation 16

Dual luciferase assay 16

Statistical analysis 17

S2 cell treatment, RNA isolation and cDNA preparation 17

Fly treatment, RNA isolation, and cDNA preparation 18

Real-time PCR 19

III. Results and Discussion 22

Optimization of F-luc and R-luc DNA quantities and tranfection parameters 22

Effect of putative CREB/AP1 site mutations on basal and caffeine-induced 26 transcriptional activities of Cyp6a8 promoter DNAs

Effect of TATA box mutation on basal and caffeine-induced transcriptional 29 activities of Cyp6a8 promoter DNAs

viii

Phenobarbital-induced activity of Cyp6a8 promoter DNAs 33

Effects of -57/-61 and putative TATA mutations on synergistic activity 36 of caffeine and Phenobarbital

Effect of caffeine on endogenous CYP, D-Jun, and D-Fos expression 39

IV. Conclusions 45

V. References 49

VI. Vita 56

ix List of Figures

Figure Page

1 Locations of the putative TATA box, AP-1, and CREB sites in the 0.2- 12 kb upstream DNA of Cyp6a8 gene

2 Diagram of primers used in sequencing the luciferase gene and 14 upstream DNA of Cyp6a8 cloned into pGL2Basic(N)

3 Optimizing F-luc DNA for transfections 24

4 Optimizing R-luc DNA for transfection 24

5 Optimizing ratio of micrograms DNA to microliters Effectene 25

6 Optimizing post-transfection time for caffeine treatment 25

7 Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, 27 -57/-61, -43/-47, and -6/-10 on the basal and caffeine-induced transcriptional activity of the 0.2-kb DNA

8 Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, 27 -57/-61, -43/-47, and -6/-10 on the basal and caffeine-induced transcriptional activity of the 0.8-kb DNA

9 Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, 31 -57/-61, -43/-47, and -6/-10 on the fold induction of the 0.2-kb DNA after 24 hours of 4mM caffeine treatment

10 Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, 31 -57/-61, -43/-47, and -6/-10 on the fold induction of the 0.8-kb DNA after 24 hours of 4mM caffeine treatment

11 Effect of the deletion and base substitution mutations of the TATA and - 32 57/-61 CREB/AP1 sites on basal and caffeine-induced transcriptional activity of the 0.8-kb DNA

12 Effect of the deletion and base substitution mutations of the TATA and - 32 57/-61 CREB/AP1 sites on fold induction of the 0.8-kb DNA following 8mM caffeine treatment

13 Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, 34 -57/-61, -43/-47, and -6/-10 regions on the basal and PB-induced transcriptional activity of the 0.8-kb DNA x

14 Effect of the deletion and base substitution mutations of the TATA and - 34 57/-61 CREB/AP1 sites on basal and PB-induced transcriptional activity of the 0.8-kb DNA

15 Fold induction of 0.8-kb DNAs after 24 hours of 1mM Phenobarbital 35 treatment

16 Deletion and base substitution mutations of the TATA and -57/-61 38 CREB/AP1 sites affect the synergistic effect of caffeine and PB on the transcriptional activity of the 0.8-kb DNA

17 Base pair substitution mutations of the TATA and -57/-61 CREB/AP1 38 sites alter the synergistic effect of caffeine and PB on the transcriptional activity of the 0.8-kb DNA, shown here as fold induction

18 Analysis of Cyp, D-Fos, and D-Jun gene expression in S2 cells by real- 40 time PCR

19 Analysis of Cyp, D-Fos, and D-Jun gene expression after caffeine 42 treatment in Canton-S and dnc1 mutant fly strains by real-time PCR

20 Model of cis elements of Cyp6a8 promoter involved in xenobiotic 47 induction

xi List of Tables

Table Page

1 Primers used for sequencing and site-directed mutagenesis of luciferase 13 reporter constructs

2 Primers used to determine the expression of Cyp6a8, Cyp6a2, Cyp6g1, 20 D-Fos, and D-Jun in S2 cells and flies by real-time PCR.

xii I. Introduction

Cytochrome P450 enzymes and biological functions

With few exceptions, almost all organisms from bacteria to humans possess cytochrome

P450 enzymes, or CYPs. Cytochrome P450s were discovered in rat liver microsomes in the

1950s. When microsomes were treated with sodium dithionite, a reducing agent, and carbon monoxide, an optical absorbance peak at 450 nm was observed (Klingenberg et al., 1958;

Estabrook, 1996; Omura, 1999). The pigment that caused this absorbance peak was later found to be cytochrome P450 monooxygenase enzyme (CYP) that contains a heme moiety (Omura and

Sato, 1962 and 1964). The discovery of the CYP’s role as a terminal oxidase in drug metabolism by Cooper et al. (1965) led to the understanding of the detoxifying function of CYP enzymes.

CYP enzymes are found in various tissues of metazoans. These enzymes catalyze numerous endogenous reactions, including those involved in steroid hormone biosynthetic pathways in animals and plants. They also play an important role in the metabolism of numerous exogenous substances (xenobiotics) that living organisms consume everyday. The most common reaction that is catalyzed by CYPs is called the monooxygenase reaction, shown below:

P450 enzyme + 2NAD(P)H + O2 + R 2NAD(P) + H2O + RO

In this reaction, one atom of molecular oxygen (O2) is reduced to water while the other oxygen atom is incorporated into the substrate (Scott et al., 2001). Certain P450s have also been found to catalyze carbon hydroxylation, aromatic dehalogenation, ring coupling, ring formation, and oxidative aryl migration (Lamb et al., 2007). The substrate specificity of cytochrome P450s 1 varies; some P450s metabolize a broad spectrum of multiple substrates, such as CYP1A1, which can metabolize over twenty compounds, and others metabolize a more narrow set of substrates, like the CYP7A1 enzyme which metabolizes only one substrate (Rendic & Di Carlo, 1997).

Since cytochrome P450 enzymes catalyze the first step in detoxification, they are often referred to as phase I enzymes (Nebert & Gonzalez, 1987).

CYPs comprise one of the largest and oldest multigene families of enzymes which are found in bacteria, plants, and animals. For this reason, most organisms have multiple isoforms of P450 enzymes. Humans have 57 CYP enzymes (Myasoedova, 2008), while Drosophila has

90 Cyp genes, of which seven are believed to be pseudogenes (Feyereisen, 2006). Many of the enzymatic functions of the cytochrome P450 monooxygenases are known in mammals and plants. CYPs are involved in the metabolism of drugs, as well as the detoxification of various toxic chemicals. Cytochrome P450s are involved in drug metabolism and bioavailability, which is the concentration of drugs in the plasma and at target sites, as well as oxidation of drugs into active forms (Guengerich, 2001). For example, tamoxifen, which is used in the treatment of breast cancer, is metabolized in the human liver by CYP2D6 via 4-hydroxylation (Dehal and

Kupfer, 1997). Additionally, P450s can act to detoxify endobiotic and xenobiotic chemicals by catalyzing reactions that result in less toxic products than the substrates (Gengerich, 2001).

In mammals, P450s participate in a variety of functions. The substrates of CYP2A include aflatoxins, coumarins, pharmaceuticals, and procarcinogens, and inducers include 4- vinylcyclohexene (Chang & Waxman, 1996; Raunio et al., 1999; Doerr-Stevens et al., 1999).

CYP6A1 in the housefly also has multiple substrates, which include cyclodiene, heptachlor, and aldrin (Andersen et al., 1994). In Papilio polyxenes, the black swallowtail butterfly, CYP6B1 and

CYP6B4 act on and are induced by plant furanocoumarins, which are in turn metabolized by

2 these CYPs (Ma et al., 1994; Hung et al., 1997). Furanocoumarins are plant toxins, and they are found in plants that Papilio feeds on. Thus, CYP6B1 and CYP6B4 confer chemical protection against furanocoumarins. Humans with certain highly-inducible forms (polymorphisms) of

CYP1A1 have increased susceptibility to lung cancer; CYP1A1 is involved in the activation of pre-carcinogens, and certain polymorphisms have been associated with increased CYP1A1 activity or inducibility (Rannug et al., 1995). Mutations of the human CYP17A1 can cause an excess of mineralocortocoids, leading to hypertension, impaired masculinization in males, and lack of pubertal development during adolescence in females (Auchus, 2001; Rosa et al., 2010).

Cytochrome P450s are involved in certain metabolic pathways in plants, such as the biosynthesis of brassinosteroids, needed for plant growth and development. DWF4, a cytochrome P450, acts as a 22-hydroxylase in brassinosteroid biosynthesis in Arabidopsis; mutations in the dwarf4 gene case a lack of cell elongation and the dwarf phenotype (Choe et al.,

1998). Plant P450s are also involved in the biosynthesis of various compounds, including fatty acids, pigments, UV protectants, accessory pigments, and signaling molecules (Schuler, 1996).

For example. CYP12B1 is proposed to have a role in calcium homeostasis, while CYP4C1 may play a role in fatty acid metabolism (Scott, 2001).

Cytochrome P450s are also involved with the production of sex hormones. In humans,

CYP19 aromatase is involved in estrogen biosynthesis from androgens; mutations of CYP19 can cause genital ambiguity and absent pubertal development in females (Simpson et al., 2002; Lin et al., 2007). Other biosynthetic pathways that are associated with CYPS include cholesterol and fatty acid biosynthesis (Guengerich et al, 2003).

Insect P450s: xenobiotic metabolism

Insects also have multiple isoforms of P450 enzymes, which have been identified mainly by sequencing. Some cytochrome P450s are involved in feeding, growth, development, and resistance to plant toxins and insecticides. However, the endogenous function of many of these enzymes is not known. Examples of P450 enzymes with known functions are those encoded by

Halloween genes of Drosophila, such as disembodied (CYP302A1), shadow (CYP315A1), and shade (CYP314A1). These P450s regulate biosynthesis of ecdysone, the steroid hormone involved in molting (Gilbert, 2004). Mutations of these Halloween genes cause embryonic deformity and lethality.

Metabolism of toxic compounds allows insects to feed on certain plants. The tobacco hornworm can metabolize nicotine in tobacco plants (Snyder & Glendinning, 1996). In another example, the black swallowtail butterfly can detoxify xanthotoxin in plant leaves (Ma et al.,

1994). These insecticide-metabolizing P450s are often constitutively over-expressed in resistant insect strains. Mosquitoes have been found to express certain genes, including cytochrome

P450s, differentially in resistant strains compared to susceptible strains (Vontas et al., 2005).

Cytochrome P450 overexpression and pesticide resistance

Since P450s are known to detoxify drugs and many xenobiotic compounds, it is expected that these enzymes may be involved in insecticide metabolism. In fact, a correlation has been found between the expression of certain CYP genes and resistance to insecticides. Higher expression of a CYP gene in the pyrethroid and organophosphate resistant strain compared to the susceptible ones have been observed for CYP6A1, CYP6D1 and CYP6D3 of Musca (Carino et

4 al., 1994; Feyereisen et al., 1995; Tomita and Scott, 1995; Kasai and Scott, 2001). Similar observations have also been made for CYP6F1 in Culex (Kasai et al., 2000) and P450 MA in

German cockroach (Scarf et al., 1999). In DDT-resistant strains of Drosophila melanogaster, the

Cyp6a2, Cyp6w1, Cyp6a8, Cyp6g1, and Cyp12d1 genes are expressed at significantly higher levels compared to the susceptible strains (Maitra et al., 1996; Dombrowski et al., 1998; Daborn et al., 2002). Research by Daborn et al. (2002) also demonstrated that overexpression of Cyp6g1 transgene in a susceptible host strain confers low levels of DDT resistance (Daborn et al., 2002;

Daborn et al., 2007). These findings suggest that CYPs play a role in conferring pesticide resistance in Drosophila.

Cytochrome P450 inducibility by caffeine and Phenobarbital

One important question that remains unanswered is how Cyp genes are regulated and overexpressed in resistant strains. Various xenobiotics, such as caffeine, Phenobarbital, and

DDT, have been used as tools to better understand the regulation of these genes (Morra et al.,

2010; Bhaskara et al, 2006; Willoughby et al., 2006; Sueyoshi and Negishi, 2001). Caffeine, which is found in tea, coffee, and other drinks and foods, is a purine alkaloid, and many people are exposed to this substance on a daily basis (Miners and Birkett, 1996). Although innumerable studies examined the effect of caffeine on various physiological and neurological properties in mammals and humans, only one study has been done so far on the effect of caffeine on mammalian CYP gene expression (Goasduff et al., 1996). Using Drosophila as a model organism, the effect of caffeine on specific CYP gene expression was first examined by Bhaskara et al. (2006, 2008) and also by Willoughby et al. (2006). Using both SL-2 cells and transgenic

5 flies, Bhaskara et al. (2008) showed that caffeine induction of Cyp6a8 and Cyp6a2 is meadiated via the cAMP pathway.

Phenobarbital (PB), a drug that is used to treat epileptic tremor and depression, has been shown to induce numerous murine P450 genes, such as CYP2A, CY2B, CYP2C, CYP2H,

CYP102/106, CYP3A, and CYP6A genes (Sueyoshi & Negishi, 2001). Many insect P450 genes, including Cyp6a8, are also be induced by PB (Maitra et al., 2000, 2002; Bhaskara et al., 2006;

Willoughby et al., 2006; Morra et al., 2010). In multiple studies in mammalian cells, CYP gene expression is regulated by various nuclear receptors, including constitutive androstane receptor

(CAR), pregane X receptor (PXR), and retinoid X receptor (RXR) (Sueyoshi & Negishi, 2001;

Wang & Negishi, 2003; Frigo et al., 2005; Mandal, 2005; Xu et al., 2005). In mammals, DNA sequence motifs, called PBREM (PB-responsive enhancer module) and XREM (xenobiotic responsive enhancer module), are known to mediate PB induction of the CYP genes (Sueyoshi &

Negishi, 2001), but this sequence is not found in the promoter regions of the Phenobarbital- inducible Cyp6a2 and Cyp6a8 genes in Drosophila (Dombrowski et al., 2998; Maitra et al.,

2002). In fact, little is known about the DNA sequence elements that are involved in PB induction of the Cyp genes in Drosophila or other insects.

The DHR96 nuclear receptor, which is the Drosophila ortholog of the human SXR and

CAR receptors, has been shown to play a role in the transcriptional response to Phenobarbital

(King-Jones et al., 2006). In a microarray study by King-Jones et al. (2006), the DHR96 null mutant exhibited increased sensitivity to the effects of Phenobarbital, as well as DDT. Another study on the Phenobarbital induction in Drosophila S2 cells showed DHR96 and BR-C (Broad-

Complex) as the key regulators of PB induction (Lin et al., 2011). In this study, the suppression of DHR96 decreased the PB induction of the housefly CYP6D1 gene promoter, while the

6 suppression of BR-C significantly increased PB induction of the CYP6D1 promoter (Lin et al.,

2011). However, microarray and qRT-PCR analyses by King-Jones et al. (2006) showed that PB inducibility of the Cyp genes of Drosophila including Cyp6a8 is not affected in DHR96 null flies.

Cyp6a8 gene function and induction

The reactions performed by Cytochrome P450s can be quite diverse, ranging from hormone biosynthesis to carcinogenesis to detoxification of xenobiotics (Werck-Reichart and

Feyereisen, 2000). Heterologous expression in yeast showed that Cyp6a8 functions in fatty acid metabolism; specifically, this enzyme catalyzes the hydroxylation of lauric acid (Helvig et al.,

2004). In a DDT-selection experiment by Le Goff et al. (2003), Cyp6a8 was found to be the only

Cyp gene with increased expression due to the selection pressure, suggesting that Cyp6a8 may play a role in insecticide resistance. In Drosophila, other Cyp genes, such as Cyp6a2, Cyp6g1,

Cyp6w1, and Cyp12d1, also show overexpression in the resistant strain, but very little studies have been done to understand the mechanism of regulation of these genes compared to Cyp6a8.

To map the cis-acting elements involved in caffeine induction of Cyp6a8, various regions of this gene’s upstream DNA between -11 and -766 nt were cloned into reporter plasmids carrying the firefly luciferase reporter genes (Maitra et al., 2002; Bhaskara et al., 2006, 2008;

Morra et al., 2010). To understand the mechanisms of caffeine and PB induction, these plasmids were used to create transgenic reporter flies and to transiently transfect or stably transform

Drosophila S2 cells. Results showed that cis-elements involved in caffeine and PB induction are located in the 0.2-kb (-11/-199) upstream DNA of the Cyp6a8 gene (Bhaskara et al., 2008; Morra

7 et al., 2010). The cis-element for DDT induction is also located in this DNA (Morra et al.,

2010). However, the specific location of the cis-elements for all these inducers is not known.

Our laboratory has been using caffeine and phenobarbital (PB) as probes to understand the mechanism of Cyp6a8 expression in Drosophila because these chemicals induce Cyp6a8 in adult flies as well as in Drosophila S2 cells in culture (Maitra et al., 2002; Bhaskara et al., 2006,

2008; Morra et al., 2010). PB and other chemical inducers have been successfully used to understand the mechanism of mammalian CYP gene regulation (Chen & Goldstein, 2009). Using caffeine and PB as probes, researchers discovered that the cis-acting elements necessary for caffeine and PB induction lie within the -199/-11 (considering +1 at ATG) region of the Cyp6a8 gene (Maitra et al. 2002; Bhaskara et al. 2006). It is expected that these cis elements would include sequences for certain DNA binding proteins, which would enhance the promoter activity and increase transcription. One of these sequence motifs is similar to the AP1 element, which binds activator protein-1 or AP-1. The other element is similar to the cAMP response element or

CRE, which binds CRE binding protein (CREB or CRE-BP). AP-1 is a homo- or heterodimer of

JUN and FOS family proteins and the genes encoding these proteins are called immediate early genes, which are induced when cAMP pathway is activated (Sng et al., 2004). Besides cJun and cFos, CREs are also found in the upstream DNA of many cAMP responsive genes. The upstream

0.8-kb DNA of Drosophila Cyp6a8 also contains many putative AP-1 and CREB motifs

(Bhaskara et al., 2006) which may be involved in induction by caffeine.

Objectives of present investigation

While there is much information about the regulation of CYP genes in mammals

(Tompkins & Wallace, 2007), very little is known about the molecular mechanism of Cyp gene

8 regulation in insects, such as Drosophila. In a study by Bhaskara et al. (2008), the mechanism of caffeine induction of Cyp6a2 and Cyp6a8 was examined both in SL-2 cells and transgenic flies.

The results of these investigations proposed that caffeine induction is partly mediated via the cAMP pathway (Bhaskara et al., 2008). PB also induces many insect CYP genes, including

Cyp6a8 (Willoughby et al., 2006; Morra et al., 2010). However, very little is known about the

DNA elements that are involved in PB and caffeine induction.

Previously, Bhaskara et al (2006) analyzed the 0.8-kb upstream DNA of Cyp6a8 using the MATCHTM program and identified twenty-six putative CREB and AP-1 sites . Since the 0.2- kb upstream DNA of Cyp6a8 supported caffeine induction in S2 cells transfected with the

0.2luc-A8 construct, it was hypothesized that some of these sites within the 0.2-kb region may play a role in caffeine induction (Bhaskara et al., 2006). Therefore, the objective of the present investigation has been to examine whether these putative sequence motifs are involved in basal as well as caffeine- and PB-induced expression of the Cyp6a8 gene. To map the cis-acting elements within the 0.2kb upstream DNA, four of these AP-1 and CREB sites within the -1/-170 region and the putative TATA box were chosen for site-directed mutagenesis in the present investigation. We hypothesize that, if any of these regions is involved in the induction by one or more of these chemicals, mutation of the bases within that region of the promoter would cause a significant decrease in the promoter activity compared to the wild-type construct. To test our hypothesis, transient transfection of S2 cells and Cyp6a8 promoter-luciferase reporter constructs were used.

9 II. Materials and Methods

1. Mutagenesis of Cyp6a8 0.2-kb upstream DNA

Figure 1 shows the nucleotide sequences of the 5’-UTR, -1/-170 region or 0.2-kb upstream DNA of the Cyp6a8 gene, and the positions of the four putative AP-1 and CREB sites in which small deletions were introduced by using the QuikChange II Site-Directed Mutagenesis

Kit (Stratagene, CA). These putative sites are located at (-97/-101), (-57/-61), (-43/-47), and (-6/-

10) regions of the 0.2luc-A8 plasmid, which contains the 0.2-kb Cyp6a8 upstream DNA from the 91-R strain cloned in front of the Firefly luciferase (F-luc) reporter gene (Maitra et al., 2002).

Each deletion reaction (25!L) contained 2.5!L of 10X reaction buffer, 2!L (equal to 25ng)

0.2luc-A8 plasmid template, 2!L (equal to 62.5ng) forward primer, 2!L (equal to 62.5ng) reverse primer, 0.5!L of the four dNTP mix provided by the manufacturer, and 16!L water. The primers used for each deletion are described in Table 1. The polymerase chain reaction was started by adding 0.5!L of Pfu Ultra HF DNA Polymerase provided in the QuikChange II kit.

The reactions were cycled as follows: 950C for 30 seconds (1 cycle), followed by 950C for 30 seconds, 550C for 1 minute, and 680C for 6 minutes for 18 cycles. The reactions were then placed on ice for 2 minutes, and 1!L Dpn I restriction enzyme was added to each reaction to digest the template (non-mutated) DNA.

For transformation, the mutated plasmids were then incubated with competent XL1-Blue cells (Stratagene, CA), and the entire transformation mixtures were plated on ampicillin- containing LB plates. The 0.5mL of transformation mixture was plated as 250µL per plate.

Colonies were picked and grown in liquid LB-ampicillin media, and DNA was isolated using the

Zyppy Plasmid Miniprep kit and protocol (Zymo Research, CA). All mutated plasmids were

10 sequenced using various primers. The sequences of these primers and the sequencing strategies are shown in Table 1 and Figure 2, respectively. Besides XL1-Blue cells, DH5! cells were also transformed with each purified mutated plasmid for frozen glycerol stocks to be kept at -80°C.

All deletions were verified by sequencing with GLprimer1 and GLprimer2 (Promega,

WI). The luciferase reporter gene in the mutated plasmids was also sequenced to make sure that no mutation was introduced in this gene. Alternatively, each mutated 0.2-kb upstream DNA insert was isolated by XhoI-HindIII digestion and cloned in front of the luc gene of XhoI-HindIII cut pGL2Basic(N) vector that was described by Maitra et al (2002). The resulting 0.2-kb mutant constructs were named: ! (-97/-101)0.2lucA8, !(-57/-61)0.2lucA8, !(-43/-47)0.2lucA8, and

!(-6/-10)0.2lucA8.

These mutations were also introduced into the 0.8luc-A8 reporter plasmid which contains the -1/-170 DNA (0.2-kb DNA) plus an additional 0.6-kb upstream DNA, (Maitra et al., 2002).

For this purpose the wild type -1/-170 region of the 0.8luc-A8 plasmid was individually replaced by the mutated -1/-170 mutated DNAs using restriction enzyme digestion. These 0.8luc-A8 mutants were named: 0.8lucA8! (-97/-101), 0.8lucA8! (-57/-61), 0.8lucA8! (-43/-47), and

0.8lucA8! (-6/-10). Besides deletion, the (-57/-61) bases were also mutated in the 0.8-luc-A8 construct via base pair substitution using the QuikChange II kit (Stratagene, CA); the bases were changed from 5’-CGTCA-3’ to 5’-TAGCC-3’, resulting in the -57bpSub-0.8lucA8 plasmid.

The putative TATA box was also mutated in the 0.8-luc-A8 construct by deleting bases -

28/-33 or by substituting 5’-GCACGG-3’ for the original 5’-TTTAAA-3’; the resulting constructs were named TataDel-0.8lucA8 and TataBpSub-0.8lucA8, respectively. GLprimer1 and GLprimer2 (Promega, WI) primers were used to amplify the 0.2-kb upstream DNA containing the -57/-61 or TATA base pair substitutions. The PCR products were digested with

-170 GTCGACGTTG GTTTCTGTCC TTATCTATTC AGACTACGAT TCTTGCCATC TCACAGTGCT -111 CREB( -97/101) CREB/AP1( -57/ -61) -110 TGGCA TTAA A GTAA ACAAAA CTCTCTCTTT CTAGCGACTG AGAA TGCAT C GTCA TGCAAA -51 (T AGCC) CREB/AP1( -43/ -47) TATA (-28/-33) CREB (-6/-10) - 50 GTA AGTCA AT TTCAG CGTTT AAAAGCA GTT TGCCTATCGT TTAC GGAACC-1 (GCA CGG )

+ 1 AGTCGTATTCGAAGATCATCCGCCTCAGC ATG

Figure 1: Locations of the putative TATA box, AP-1, and CREB sites in the 0.2-kb upstream DNA of Cyp6a8 gene. The putative sites are shaded and underlined. Bases in red were deleted by site-directed mutagenesis. Bases that substituted the original bases (in red) are shown in parentheses. The line below the TATA box indicates the extent of the putative Barbie box. The double-underlined sequence is the 5’-UTR of the gene.

12 Table 1: Primers used for sequencing and site-directed mutagenesis of luciferase reporter constructs. The numbering of the coordinates in this table considers +1 at the ATG. If considering +1 at the transcription start site, subtract 29 from the value to obtain correct coordinates.

Primer Name Sequence (5’ to 3’) Description -133A8-del(For) CATCTCACAGTGCTTGGCATTAAA Spans base -153 to -107 to introduce a deletion of bases -130 to -126 in the -133 region of Cyp6a8 0.2-kb CAAAACTCTCTCTTTCT upstream DNA; deletes the underlined bases: -133A8-del(Rvs) AGAAAGAGAGAGTTTTGTTTAA catctcacagtgcttggcattaaagtaaacaaaactctctctttct TGCCAAGCACTGTGAGATG -79A8-del(For) GAATGCATCGTCATGCAAAGTAAT Spans base -98 to -49 to introduce a deletion of bases -75 to -71 in the -79 region of Cyp6a8 0.2-kb TTCAGCGTTTAAAAGCAGTT upstream DNA; deletes the underlined bases: -79A8-del(Rvs) AACTGCTTTTAAACGCTGAAATTAC gaatgcatcgtcatgcaaagtaagtcaatttcagcgtttaaaagcagtt TTTGCATGACGATGCATTC -39A8-del(For) AGCAGTTTGCCTATCGTGAACCAG Spans base -56 to -17 to introduce a deletion of bases -39 to -35 in the -39 region of Cyp6a8 0.2-kb TCGTATTCGA upstream DNA; deletes the underlined bases: -39A8-del(Rvs) TCGAATACGACTGGTTCACGATAG agcagtttgcctatcgtttacggaaccagtcgtattcga GCAAACTGCT luc784 Fwd AAATCATTCCGGATACTGCG For sequencing luc gene of pGL2-Basic, beginning at base 784 of the Promega Vector Map, goes toward 3’ end of luc gene luc1789 Fwd CTATTGTAATACTGCGATGAGTGGC For sequencing luc gene of pGL2-Basic, beginning at base 1789 of the Promega Vector Map, goes toward 3’ end of luc gene luc1885Rvs CTTCACAAAGATCCGGCG For sequencing luc gene of pGL2-Basic, beginning at base 1885 of the Promega Vector Map, goes toward 5’ end of luc gene -95A8del#2F GCGACTGAGAATGCATTGCAAAGTAAGTCA Spans base -106 to -69 to introduce a deletion of bases -90 to -86 in the -95 region of Cyp6a8 0.2-kb ATTTGTC upstream DNA; deletes the underlined bases: -95A8del#2R GACAAATTGACTTACTTTGCAATGCATTCT ctctttctagcgactgagaatgcatcgtcatgcaaagtaagtcaattt CAGTCGC Luc1237Rvs GGTCCTCTGACACATAATTCGC For sequencing luc gene of pGL2-Basic, beginning at base 1237 of the Promega Vector Map, goes toward 5’ end of luc gene Fwd(-86)a8 bpsub GCGACTGAGAATGCATTAGCCTGCAAAGTA Spans base -107 to -64 to change bases -90 to -86 in the -95 region of Cyp6a8 upstream DNA (91-R) from AGTCAATTTCAGC CGTCA to TAGCC Rvs (-86)a8 bpsub GCTGAAATTGACTTACTTTGCAGGCTAATGC ATTCTCAGTCGC 6a8 TATAdel Fwd GTAAGTCAATTTCAGCGAGCAGTTTGCCTAT Spans base -79 to -41 (of 0.8lucA8) to introduce deletion of bases -62 to -57 (the putative TATA box) in CG the Cyp6a8 upstream DNA (91-R); deletes the underlined bases: 6a8 TATAdel Rev CGATAGGCAAACTGCTCGCTGAAATTGACTT GTAAGTCAATTTCAGCG(TTTAAA)AGCAGTTTGCCTATCG AC 6a8 bpsub TATA Fwd GTC AAT TTC AGC GGC ACG GAG CAG TTT Spans base -75 to -46 to mutate bases -62 to -57 (the putative TATA box) in the Cyp6a8 upstream DNA GCC (91-R); changes original bases (-28/-33) TTTAAA to “gcacgg” 6a8 bpsub TATA Rvs GGCAAACTGCTCCGTGCCGCTGAAATTGAC 13

Figure 2: Diagram of primers used in sequencing the Luciferase gene and upstream DNA of Cyp6a8 cloned into pGL2Basic(N). Mutations of the putative CREB/AP1 sites within the 0.2-kb upstream DNA are represented by blue triangles. The orange arrows represent the direction of the primers: right-facing arrows are forward primers and left-facing arrows are reverse primers.

14 Sal I and Hind III, and gel extractions were performed to isolate the desired bands. The digested fragments were then ligated into pGL2Basic(N) vector, which was cut with Xho I and Hind III.

2. Transient transfection and treatment of S2 cells

Transient transfection of Drosophila Schneider line 2 (S2) cells (Schneider, 1972) was performed using Effectene reagents and the protocol provided by the manufacturer (QIAGEN,

CA). The protocol was optimized for luciferase activity of both the F-luc expressing Cyp6a8-luc reporter plasmids and pRL-null vector (Promega, WI), which was used as an internal control.

Additionally, transfections were performed to determine optimum cell numbers and reagent volumes.

S2 cells were grown in HyQ SFX-Insect Medium (Hyclone, Logan, UT, USA) with

0 Pen/Strep antibiotic at 25 C without CO2. Cell density of one-day-old culture was quantified using the trypan blue exclusion technique. Approximately 1.5 x 106 cells were used per transfection experiment. These cells were pelleted by centrifugation at 400xg and resuspended in fresh media at a density of 2 x 106 cells/mL. A volume of 0.75mL of cells was seeded per well of a 24-well plate. A mixture of 250 ng of F-luc plasmid and 25 ng of pRL-null plasmid

(Promega, WI) containing the Renilla luciferase (R-luc) gene were added to Buffer EC

(QIAGEN, CA) to a final volume of 50µL. Following the manufacturer’s protocol (QIAGEN,

CA), Enhancer (2.2µL), Effectene (3µL), and fresh media (299.8µL) were mixed with the DNA mixtures. The Effectene:DNA complex was then added to the cells in a dropwise manner to a final volume of 1.105mL per well. After 24-hour incubation at 250C, the co-transfected cells were dispersed and dispensed into the wells of a 96-well plate (160!L/well). The cells were treated with 4mM or 8mM caffeine or 1mM phenobarbital by adding the appropriate volume of stock solution made in S2 cell media. Fresh media was added to each well to bring the final 15 volume to 220!L and the cells were incubated at 250C for 24 h. In each experiment all treatments were done in triplicate and each experiment was repeated with three different batches of cells.

3. Cell Extract Preparation

After twenty-four hours of treatment, the cells were pelleted by centrifuging the 96-well plates at 3000 rpm (~1000xg) for 4 minutes at room temperature. Next, the supernatant was removed from each well, and 200!L of PBS was added to each well. The plate was centrifuged again for 4 minutes. The PBS was removed, and 100!L of 1X passive lysis buffer (Promega,

WI) or PLB was added to each well. The plate was placed on a horizontal shaker and shaken at

110 rpm for 15 minutes to lyse the cells. After shaking, the liquid in each well was vigorously pipetted up and down to ensure complete cell lysis. The plates were then centrifuged at maximum speed (4400rpm) for 10 minutes at room temperature. The supernatant or the lysate was transferred from the wells to Eppendorf tubes and immediately assayed for dual luciferase activity.

4. Dual luciferase assay

The Dual-Luciferase Reporter Assay System from Promega (WI) was used to measure the luciferase activity of the cell extracts. These assays were performed by following the manufacturer’s protocol and under subdued light at room temperature. The Dual-Luciferase reagents (LAR II and Stop & Glo Reagent were brought to room temperature before performing the assay. To measure luciferase activity, 5!L cell extract and 25!L LAR II were mixed gently but quickly mixed in a 1.5mL Eppendorf tube, which was then placed in the well of a luminometer. The F-luc or firefly luciferase activity was recorded after a 15-second reading.

Then, 25!L Stop & Glo buffer was added to the tube, mixed gently, and a second 15-second

16 reading was taken for the R-luc or Renilla luciferase activity. The R-luc activity is used as an internal control to account for possible differences in transfection efficiencies for each reporter plasmid transfection. The ratios of F-luc/R-luc activity were used for data analysis.

5. Statistical analysis

Experiments were repeated three times with different batches of cells, and treatments in each experiment were performed in triplicate. Data were analyzed by Student’s t-test or

ANOVA.

6. S2 cell treatment, RNA isolation, and cDNA preparation

Drosophila S2 cells were maintained at 25oC in HyQ SFX Insect medium, protein-free with L-Glutamine (Hyclone, Logan, UT, USA), supplemented with 0.01% penicillin- streptomycin, which was obtained from Sigma (St. Louis, MO, USA). Every seventh day, the cells were split into fresh media. A total of 10 x 106 cells were incubated with plain media, 4mM db-cAMP, or 4mM caffeine at 25oC for 24 hours.

RNA was isolated from pelletted cells using TRIzol reagent and protocol (Invitrogen,

Carlsbad, CA, USA). Cells were then spun down at 400 x g at 4OC for 5 minutes, and the supernatant was removed. The cells were lysed in 1mL TRIzol reagent per 10 x 106 cells by repetitive pipetting and incubated for 5 minutes at room temperature. Next, 0.2mL of chloroform

(per 1mL TRIzol reagent) was added, the tubes were shaken vigorously by hand for 15 seconds, and the tubes were incubated at room temperature for 2-3 minutes. Tubes were centrifuged at

11,000 x g for 15 minutes at 4OC. The top aqueous phase containing RNA was transferred to a new tube; 0.5mL isopropyl alcohol (per 1mL TRIzol used) was added to the tubes, followed by an incubation of 10 minutes at room temperature. Tubes were centrifuged at 11,000 x g for 10 minutes at 4OC. The supernatant was removed, and the pellet was washed with 1mL 75% ethanol

17 in DEPC H2O per 1mL TRIzol used. The pellet and ethanol were vortexed and centrifuged at

7,500 x g for 5 minutes at 4OC. The ethanol was removed, and the pellet was airdried for 5-10 minutes, without drying completely. The RNA pellet was dissolved in 30µL DEPC H2O, pipetted up and down to resuspend, and incubated at 60OC for 10 minutes. Concentrations of

RNA were measured using the Nanodrop Spectrophotometer.

The preparation of cDNA was performed using the iScript cDNA Synthesis Kit (Bio-

Rad, Hercules, CA, USA). According to the manufacturer’s protocol, the reaction was setup as follows: 4µL 5x iScript reaction mix, 1µL iScript reverse transcriptase, 1µg total RNA, and nuclease-free water to a final volume of 20µL. The reactions were cycled as follows: 5 minutes at 25OC, 30 minutes at 42OC, 5 minutes at 85OC, hold at 4OC.

7. Fly treatment, RNA isolation, and cDNA preparation

Two strains of Drosophila melanogaster, the mutant dnc1 and control Canton-S, were used in the present investigation. The dnc1 stock was received from Indrani Ganguly of

Neuroscience laboratory, San Diego (CA). All stocks were maintained on standard corn meal- agar-molasses Drosophila medium at 25oC. Flies were placed into vials containing instant fly food prepared with either water (untreated) or 16mM caffeine solution in water (caffeine-treated) for 24 hours. Twenty flies were used for each treatment.

Total RNA was isolated from the control and treated flies using TRI Reagent (Sigma-

Aldrich, St. Louis, MO, USA). Twenty female flies per sample were homogenized in 0.2mL TRI

Reagent. 40µL of chloroform was added to each tube. The tubes were shaken vigorously for 15 seconds and incubated for 5 minutes at room temperature. The samples were centrifuged at

12,000 x g for 15 minutes at 4OC. The top aqueous phase containing the RNA was transferred to a fresh tube, and 100µL isopropanol was added and mixed. After a 5 minute incubation at room 18 temperature, the RNA was pellet by centrifuging at 12,000 x g for 10 minutes at 4OC. The supernatant was removed, and the RNA pellet was washed with 200µL of 70% ethanol. The tubes were vortexed then centrifuged at 12,000 x g for 5 minutes at 4OC. The ethanol was removed, and the tubes were airdried for 10 minutes. The pellet was resuspended in 30µL DEPC

O H2O by incubated for 10 minutes at room temperature, vortexing, and incubating in a 55 C water bath for one minute. Concentrations of RNA were measured using the Nanodrop

Spectrophotometer.

The preparation of cDNA was performed using the iScript cDNA Synthesis Kit (Bio-

8. Real-time PCR

Quantitative real-time PCR experiments were performed using iQ SYBR Green

Supermix from Bio-Rad (Hercules, CA, USA), using half the volumes specified in the manufacturer’s protocol. First, the first strand reaction (cDNA) was diluted 5-fold. Master mixes were prepared for each set of primers for the appropriate number of wells. For each well, the mix contained: 12.5µL SYBR Green QPCR mix (2X), 1.25µL forward primer, 1.25µL reverse primer, 9.0µL sterile water, and, lastly added, 1.0µL diluted cDNA. The sequences of the qRT-

PCR primers used are listed in Table 2.

Table 2: Primers used to determine the expression of Cyp6a8, Cyp6a2, Cyp6g1, D-Fos, and D- Jun in S2 cells and flies by real-time PCR. The regions of the genes spanned by the primers are shown in parentheses. RP49 was used as the reference gene for normalization of the Cyp6a8, Cyp6a2, Cyp6g1, D-Fos, and D-Jun genes.

Melting Primer Name Primer Sequence (5’ to 3’) Amplicon Length Temperature

Cyp6a8-F ggttgcctggctgccttt (+1343/+1360) 62.2°C

71pb

Cyp6a8-R gagcctgcatctgtccgaat (+1394/+1413) 62.4°C

Cyp6a2-F cgacagagatcccactgaagtatagt (+1459/+1484) 64.6°C

83bp

Cyp6a2-R tgcgttccactcgcaagtag (+1520/+1539) 62.4°C

Cyp6g1-F cctgaagccgttctacgactaca (+1381/+1403) 64.6°C

99bp

Cyp6g1-R gctgggattggtccagtacttt (+1459/+1480) 62.7°C

Fwd-Dfos qRT gaccagaccaacgagctcac (+1432/+1451) 62.5°C 69bp

Rvs-Dfos qRT ctccttgcgcatgctctc (+1483/+1500) 58.4°C

Fwd-DJun qRT gctggatctgaacagcaaga (+458/+477) 58.4°C 68bp

Rvs-DJun qRT ccggtgagttgatgaccagt (+506/+525) 60.5°C

RP49-F gcgcaccaagcacttcatc (+405/+423) 62.3°C

155bp

RP49-R gacgcactctgttgtcgatacc (+540/+560) 64.5°C

20 The real-time PCR cycler was programmed as follows:

Cycle 1: (1X) Step 1: 95.0 °C for 05:00. Cycle 2: (40X) Step 1: 95.0 °C for 00:30. Step 2: 59.0 °C for 00:30. Data collection and real-time analysis enabled. Step 3: 72.0 °C for 00:30. Cycle 3: (87X) Step 1: 52.0 °C-95.0 °C for 00:22. Increase set point temperature after cycle 2 by 0.5 °C Melt curve data collection and analysis enabled.

Data was analyzed following the !CT method described in Bio-Rad’s Real-Time PCR

Applications Guide (2006).

21 III. Results and Discussion

1. Optimization of F-luc and R-luc DNA quantities and transfection parameters

Before determining the effect of deletion and base substitution mutations on the Cyp6a8 promoter activity optimization of transfection conditions became necessary because Effectene was never used in our lab. To determine the optimal amounts of DNA needed for transfection that would give high F-luc activity, one-day old Drosophila S2 cells were transfected with 250 ng or 500 ng of 0.2lucA8 or 0.8lucA8 DNA carrying the F-luc gene. The extracts were assayed for F-luc activity and the background R-luc activity found in S2 cell extract was used as common denominator. The results (Figure 3) showed that for 0.2lucA8 plasmid, there was not much difference in the F-luc/R-luc ratio between 250 and 500 ng DNA. In the case of 0.8lucA8 plasmid, however, the F-luc/R-luc ratio of 250 ng DNA was about 1.4-fold greater than that of the 500 ng DNA. However, the difference was not found to be statistically significant. The amount of Renilla luciferase plasmid DNA (RL Null) required for highest activity was also determined, and it was found to be 50 ng (Figure 4). Therefore, in all experiments 500 ng of

0.2lucA8 or 0.8lucA8 F-luc and 50 ng R-luc plasmid DNAs were used.

In transient transfection experiments, activity of the reporter gene is dependent on transfection efficiency, which in turn depends on DNA quantity and Effectene volume. In this investigation the optimal DNA (!g) to Effectene (!L) ratio was found to be 1:10 (Figure 5). This ratio produced sufficient F-luc readings, measured by the luminometer in RLU (Relative Light

Units) per 5!L cell extract. Finally, the protocol was optimized for the length of caffeine treatment. In this experiment, S2 cells were transfected with wild-type 0.8luc-A8 plasmid.

Twenty-four hours after transfection the cells were treated for 24 or 48 h with 4 mM caffeine.

22 The results showed that 24h treatment produced higher mean F-luc/R-luc values than 48 h treatment (Figure 6). These parameters, i.e., DNA: Effectene ratio and caffeine treatment time were used in all experiments with wild-type and mutant 0.8lucA8 and 0.2lucA8 plasmids.

Figure 3: Optimizing F-luc DNA for transfections. Two quantities of Figure 4: Optimizing R-luc DNA for transfections. DNA were transfected into S2 cells to determine an amount that Four quantities of pRL-null vector (Promega, WI) would provide sufficient F-luc signal for future transient transfection were transfected into S2 cells to determine an amount experiments. Values represent mean + SD. that would provide sufficient R-luc signal for future transient transfection experiments.

Figure 5: Optimizing ratio of micrograms DNA to microliters Figure 6: Optimizing length of time for caffeine treatment. Effectene. 200ng of F-luc DNA was used in each transfection, and Transiently transfected cells were treated 24 hours post- the volume (microliters) of Effectene was adjusted appropriately to transfection with either 4mM caffeine or plain media for 24 hours reach the specified ratios. or 48 hours. Values represent mean + SD.

25 2. Effect of putative CREB/AP1 site mutations on basal and caffeine-induced transcriptional activities of Cyp6a8 promoter DNAs

Figure 1 shows the nucleotide sequence of the 0.2-kb upstream DNA of Cyp6a8.

Bioinformatic analysis (Bhaskara et al., 2006) showed that the proximal promoter region of

Cyp6a8 has four putative CREB/AP1 sites. These four sites were mutated by introducing short deletions and the effect of these mutations on the basal and caffeine-induced promoter activities were determined by transiently transfecting Drosophila S2 cells. The transfected cells were treated with 4mM caffeine for 24 h and the luciferase activities in the treated and untreated cells were determined. Figure 7 shows the comparison of the constitutive (untreated) and caffeine- induced promoter activities of the wild type and mutant constructs of 0.2lucA8 plasmid.

The results showed that constitutive level of expression was decreased in all deletions in the 0.2lucA8 constructs (Figure 7) compared to the wild-type 0.2lucA8 construct, which exhibited a mean F-luc/R-luc value of 34.74. The most pronounced decrease in constitutive expression in the 0.2-kb constructs was seen in the mutant with the (-57/-61) deletion, which had a mean F-luc/R-luc of 5.55 (Figure 7). Effect of four mutations described above on the basal activity of the 0.8-kb DNA carrying an additional 600 bp upstream DNA was also measured. The results (Figure 8) showed that -97/-101, -43/-47 and -6/-10 deletions did not greatly decrease the basal expression of the 0.8-kb DNA as they did in the case of 0.2-kb DNA (see Figure 7).

However, as observed with the 0.2-kb DNA, the -57/-61 deletion mutation decreased the basal activity of the 0.8-kb DNA 3.9-fold compared to the wild type 0.8lucA8 (Figure 8). These results suggest that the -57/-61 region plays a significant role in basal expression of the Cyp6a8 gene.

Figure 7: Effect of deletion mutations of the putative CREB/AP1 Figure 8: Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, -57/-61, -43/-47, and -6/-10 on the basal and sites at -97/-101, -57/-61, -43/-47, and -6/-10 on the basal and caffeine-induced transcriptional activity of the 0.2-kb DNA. Values caffeine-induced transcriptional activity of the 0.8-kb DNA. Values represent mean + SEM. Means of bars with letters (a) and (b) are represent mean + SEM. Means of bars with letters (c) and (d) are significantly different, p-value<0.05, from their corresponding wild- significantly different, p-value<0.05, from their corresponding type constructs (Student’s T-test). wild-type constructs (Student’s T-test).

27 It is, however, not clear why the other three mutations -97/-101, -43/-47 and -6/-10 affected basal expression of the 0.2-kb but not of the 08-kb DNA. It is possible that these three regions interact with the -57/-61 region via transregulatory protein factors to give maximum basal activity of the 0.2-kb DNA. Since the basal activity of the 0.8-kb DNA in transgenic flies as well as in transfected S2 cells is found to be about 2-3 fold greater than that of the 0.2-kb

DNA (Maitra et al., 2002; Bhaskara et al., 2006, 2008; Morra et al., 2010), it is thought that the additional 0.6-kb upstream DNA present in the 0.8-kb DNA has distal activator sequences that may interact with the -57/-61 region and basal promoter to boost transcription. This interaction appears to be independent of -97/-101, -43/-47 and -6/-10 regions because deletion of any one of these three proximal regions in 0.8-kb DNA does not affect transcription although they may also interact with the basal promoter in the absence of the distal activator sequences present in the

0.8-kb DNA. Bioinformatic analysis by Bhaskara et al (2008) showed that the additional 0.6-kb

DNA present in the 0.8-kb DNA has eleven AP1 and four CREB sequences. Future mutagenesis studies may determine whether these putative AP1 and CREB sequences play any role in the basal transcription of the Cyp6a8 gene.

Comparison of the absolute promoter activity after caffeine treatment provides an insight into the possible roles of each selected region in induction by caffeine. Results (Figure 7) showed that the levels of expression following caffeine treatment (mean F-luc/R-luc) decreased in all

0.2-kb deletion constructs compared to the wild-type. The greatest decrease was again seen in -

57/-61 deletion mutant. Caffeine-induced activity in this mutant decreased about 8-fold compared to the wild type construct. Other mutations also showed decrease in caffeine-induced activity but it was only 1.64-, 2.54- and 2.25-fold decrease for -97/-101, -43/-47 and -6/-10 mutations, respectively. In case of 0.8-kb constructs, effect of deletions on caffeine-induced

28 expression was much smaller. While -97/-101 deletion did not show any decrease in caffeine- induced expression (Figure 8), deletions in the -6/-10 and -43/-47 regions showed about 1.4 and

1.7 fold decreased expression, respectively. These findings imply that mainly the -57/-61 region is involved in the level of caffeine-inducibility of the Cyp6a8 gene; the other three regions affect the induced expression when the additional 0.6-kb upstream DNA is not present in the constructs.

Fold induction was calculated for each construct by dividing the mean F-luc/R-luc value after caffeine treatment by the mean F-luc/R-luc value for the corresponding untreated sample.

The means of all three sets of experiments for each wild type and mutant reporter constructs of

0.2- and 0.8-kb DNAs are shown in Figures 9 and 10. These data are misleading because some mutant constructs appear to be induced more than the wild type constructs. This may be due to very low basal activity in these mutant constructs. The most striking alteration in fold-induction was seen in the case of -57/-61 deletion in the 0.8lucA8 construct. This deletion caused a 3-fold decrease in fold-induction compared to the wild type construct. These results provide further support to the conclusion that the -57/-61 region plays a major role in the induction of Cyp6a8 by caffeine, which is probably mediated via CREB and the cAMP pathways.

3. Effect of TATA box mutation on basal and caffeine-induced transcriptional activities of Cyp6a8 promoter DNAs

The putative TATA box of the Cyp6a8 gene spans the -24/-35 region of the upstream

DNA. The TTTAAA bases spanning the -28/-33 region within the putative TATA box were either deleted or substituted with GCACGG. The CGTCA bases spanning the -57/-61 region of a putative CREB/AP1 site were deleted or substituted with TAGCC bases. These TATA and

CREB mutations in the 0.8-kb DNA were then examined for caffeine-induced transcription.

29 Results showed that deletion or base substitution mutation in the TATA box caused a significant decrease in both basal and caffeine-induced expression (Figure 11). Deletion as well as base pair substitution mutations of the -57/-61 region also caused a significant decrease in basal and caffeine-induced activity. In fact effect of -57/-61 mutations was more severe than the TATA box mutation.

Figure 9: Effect of deletion mutations of the putative CREB/AP1 Figure 10: Effect of deletion mutations of the putative CREB/AP1 sites at -97/-101, -57/-61, -43/-47, and -6/-10 on the fold induction sites at -97/-101, -57/-61, -43/-47, and -6/-10 on the fold induction of of the 0.2-kb DNA after 24 hours of 4mM caffeine treatment. the 0.8-kb DNA after 24 hours of 4mM caffeine treatment. Values Values represent mean + SEM. Means of bars with letters (a) are represent mean + SEM. Means of bars with letters (b) are significantly significantly different, p-value<0.05, from the corresponding wild- different, p-value<0.05, from the corresponding wild-type construct type construct (Student’s T-test). (Student’s T-test).

Figure 11: Effect of deletion and base substitution mutations of the Figure 12: Effect of deletion and base substitution mutations TATA and -57/-61 CREB/AP1 sites on basal and caffeine-induced of the TATA and -57/-61 CREB/AP1 sites on fold-induction transcriptional activity of the 0.8-kb DNA. Values represent mean + SEM. of the 0.8-kb DNA following 8mM caffeine treatment. Means of bars with letters (c) and (d) are significantly different, p- Values represent mean + SEM. Means of bars with letters value<0.05, from their corresponding wild-type constructs (Student’s T- (e) are significantly different, p-value<0.05, from the test). corresponding wild-type construct (Student’s T-test).

32 4. Phenobarbital-induced activity of Cyp6a8 promoter DNAs

Maitra et al (2002) showed that both 0.2- and 0.8-kb upstream DNAs of Cyp6a8 are induced by phenobarbital (PB). Therefore, PB-inducibility of the wild type and mutant 0.2- and

0.8-kb DNAs was examined in the present investigation. The results showed that PB-induced activity of the Cyp6a8 was also negatively affected by the mutations in the 0.8-kb reporter constructs, with the exception of the (-6/-10) deletion (Figures 13 – 15). The wild-type 0.8lucA8 exhibited a 5.2-fold induction from 1mM Phenobarbital treatment, and the two mutant constructs with the lowest induction from Phenobarbital were the (-57/-61) base pair substitution and deletion mutants, showing only 1.2-fold and 1.6-fold inductions, respectively. The other mutant constructs, including the TATA mutants, do show some negative effects on promoter activity, but the strongest effects are seen in the constructs containing a mutated (-57/-61) region. This data suggests that not only is the (-57/-61) region imperative for constitutive and caffeine- induced activity, but this region is also involved with Phenobarbital inducibility of Cyp6a8.

Figure 13: Effect of deletion mutations of the putative Figure 14: Effect of deletion and base substitution mutations of CREB/AP1 sites at -97/-101, -57/-61, -43/-47 and -6/-10 regions the TATA and -57/-61 CREB sites on basal and PB-induced on the basal and PB-induced transcriptional activity of the 0.8-kb transcriptional activity of the 0.8-kb DNA. Values represent mean DNA. Values represent mean + SEM. Means of bars with letters + SEM. Means of bars with letters (c) and (d) are significantly (a) and (b) are significantly different, p-value<0.05, from their different, p-value<0.05, from their corresponding wild-type corresponding wild-type constructs (Student’s T-test). constructs (Student’s T-test).

Figure 15: Fold induction of 0.8-kb DNAs after 24 hours of 1mM Phenobarbital treatment. Values represent mean + SEM. Means of bars with letters (e) are significantly different, p-value<0.05, from the corresponding wild-type construct (Student’s T-test).

35 5. Effects of -57/-61 and putative TATA mutations on synergistic activity of caffeine and Phenobarbital

Experiments were performed to evaluate the synergistic effects of caffeine and

Phenobarbital on the Cyp6a8 promoter and to determine if the -57/-61 region was also involved in this synergism. As seen in the wild-type 0.8lucA8 construct, caffeine and Phenobarbital (PB) do act on the promoter synergistically (Figures 16 and 17). In wild-type 0.8lucA8, the caffeine,

Phenobarbital, and caffeine plus Phenobarbital treatments resulted in 13.49-fold, 6.14-fold, and

42.84-fold inductions, respectively. The caffeine and Phenobarbital seem to have an additive affect. This synergistic induction of Cyp6a8 by caffeine and Phenobarbital was also seen in a study by Morra et al. (2010), where it was concluded that the caffeine and PB inductions are controlled by different cis elements. Constructs containing the -57/-61 base pair substitution exhibited a decrease in the induction from all treatments, with levels of induction that were 3.2,

3.6, and 7.8 times lower than the induction seen in wild-type.

Comparing the synergism of all three constructs, the -57/-61 base pair substitution diminished the induction from treatment with caffeine plus PB (5.51-fold induction) to a level very close to that of caffeine alone (4.28-fold induction). In the wild-type 0.8lucA8, the addition

Phenobarbital to the caffeine treatment caused a 3.2-fold increase in induction, compared to caffeine alone. In the (-57/-61) mutant, the caffeine plus PB treatment was only 1.3 times more than caffeine only. This suggests that, although it has been concluded that caffeine and PB induction is mediated by different cis elements, the (-57/-61) region is involved in the induction of Cyp6a8 by both of these chemicals. The pathways through which these two xenobiotics affect the Cyp6a8 promoter may somehow overlap, especially at the bases within (-57/-61) region of

36 the promoter. It is possible that by disturbing the bases in the (-57/-61) region certain trans-acting factors are unable to bind to the enhancer as efficiently.

The base pair substitution of the putative TATA box also exhibits decreased inducibility from all treatments compared to wild-type, but these effects were not nearly as severe as those seen in the (-57/-61) mutant. The decrease in constitutive (untreated) activity seen in the TATA box mutant is not surprising; the disturbance of the bases in this putative TATA box is expected to disrupt the binding of transcription factors and, as a result, hinder transcription of the gene.

The wild-type 0.8lucA8 construct was found to have an average mean F-luc/R-luc value of 103, while the (-57/-61) and TATA base pair substitution mutants had mean F-luc/R-luc values of 41 and 48, respectively. Both constructs exhibit less than half the constitutive activity seen in the wild-type construct. The decrease in caffeine- and PB-induced activity is also expected in the

TATA mutant since the basal activity of the promoter is decreased to such a great extent.

Comparison between the (-57/-61) and TATA mutations shows that the TATA mutant construct shows more inducibility by caffeine and PB than the (-57/-61) mutant. The (-57/-61) base pair substitution construct showed 4.28-fold induction from caffeine and 1.71-fold induction from

PB; the TATA mutant exhibited 8.69-fold induction from caffeine and 3.90-fold induction from

PB. While the inducibility of the TATA mutant is still decreased compared to wild-type, the decreased inducibility in the (-57/-61) mutant is even more substantial. This data further support that the (-57/-61) region have a significant role in the xenobiotic induction of Cyp6a8.

Figure 16: Deletion and base substitution mutations of the TATA Figure 17: Base pair substitution mutations of the TATA and -57/- and -57/-61 CREB/AP1 sites affect the synergistic effect of caffeine 61 CREB/AP1 sites alter the synergistic effect of caffeine and PB and PB on the transcriptional activity of the 0.8-kb DNA. Values on the transcriptional activity of the 0.8-kb DNA, shown here as represent mean + SEM. Means of bars with letters (a), (b), (c), and fold induction. Values represent mean + SEM. Means of bars with (d) are significantly different, p-value<0.05, from their letters (e), (f), and (g) are significantly different, p-value<0.05, corresponding wild-type constructs (Student’s T-test). from their corresponding wild-type constructs (Student’s T-test).

38 6. Effect of caffeine on endogenous CYP, D-Jun, and D-Fos expression

In real-time PCR experiments, the treatment of Drosophila S2 cells with caffeine produced fairly expected results concerning the induction of Cyp6a8. We see about 12-fold difference increase in mRNA from treatment with 4mM caffeine compared to untreated gene expression levels (Figure 18), which is similar to previous experiments with the luciferase reporter constructs in S2 cells. Cyp6a2 and Cyp6g1, on the other hand, were not induced much by caffeine treatment. Similar level of caffeine-inducibility of these genes has also been observed in adult flies by microarray analysis (Kuruganti and Ganguly, unpublished observations). These data suggest that Cyp6a8 is perhaps more sensitive to the effects of caffeine than Cyp6a2 or

Cyp6g1.

Previously, microarray (Kuruganti and Ganguly, unpublished results) and Northern blot experiments showed that caffeine treatment did not affect the levels of D-JUN and D-FOS RNAs in adult flies (Bhaskara et al., 2008). In the present investigation, the effect of caffeine on the expression of these genes in S2 cells was examined by qRT-PCR. The data showed that the levels of D-Fos mRNA after caffeine treatment are comparable to the D-Fos mRNA levels in untreated cells (Figure 18). On the other hand, D-Jun mRNA level slightly decreased about 14% after caffeine treatment (Figure 18). These results demonstrate that the D-jun and D-fos genes in

S2 cells and flies behave similarly with respect to caffeine-inducibility, and induction of Cyp6a8 by caffeine in S2 cells occurs through a pathway other than one involving increased or decreased transcription of D-Jun and D-Fos. Previous studies showed that D-JUN protein level is down- regulated in caffeine-treated S2 cells and flies, and it was suggested that D-JUN may act as a repressor rather than a positive regulator for the Cyp6a8 promoter activity (Bhaskara et al.,

2008).

Figure 18: Analysis of Cyp, D-Fos, and D-Jun gene expression in S2 cells by real-time PCR. S2 cells were treated with either plain media or 4mM caffeine-containing media. Fold differences were calculated by dividing the mean expression level of treated samples by the mean expression level of untreated samples. A total of three experiments were performed, each with triplicate samples. Values represent mean + SEM.

Drosophila with the mutated dunce gene have decreased levels of cAMP phosphodiesterase and increased levels of intracellular cAMP (Davis and Kiger, 1981). If caffeine induced these Cyp genes strictly by inhibiting cAMP phosphodiesterase, we expect the dnc1 flies to show little to no induction after caffeine treatment compared to the Canton-S flies with wild-type dunce gene. The dnc1 flies did show increased mRNA levels of all Cyp genes tested, Cyp6a8, Cyp6a2, and Cyp6g1, after treatment with 16mM caffeine (Figure 19), although this induction was much less than the levels seen in Canton-S caffeine-treated flies. Cyp6a8 mRNA levels were increased approximately 82- and 41-fold for caffeine-treated Canton-S and dnc1 flies, respectively, compared to each strain’s corresponding untreated mRNA levels (Figure

19). The qRT-PCR data shows a two-fold increase in inducibility of the transcription of Canton-

S Cyp6a8 compared to Cyp6a8 inducibility in dnc1 flies, when the cAMP PDE levels of the flies are decreased.

This trend of decreased inducibility in dnc1 flies is also seen with the levels of Cyp6a2 and Cyp6g1 mRNA. Again, dnc1 flies do exhibit increased mRNA levels of both genes after treatment with 16mM caffeine compared to the untreated levels; treated dnc1 flies were found to have 11.34-fold increased Cyp6a2 and 6.23-fold increased Cyp6g1 mRNA levels after caffeine treatment (Figure 19). Caffeine-treated Canton-S flies, once again, exhibited even greater induction than the dnc1 flies, with 23.51- and 9.28-fold increases in Cyp6a2 and Cyp6g1 mRNA levels, respectively. As with Cyp6a8, Cyp6a2 induction from caffeine was found to be about twice as high in the Canton-S than in the dnc1 strain. Cyp6g1 induction was roughly 1.5-fold higher in Canton-S than in dnc1.

Figure 19: Analysis of Cyp, D-Fos, and D-Jun gene expression after caffeine treatment in Canton-S and dnc1 mutant fly strains by real-time PCR. Flies cells were incubated for 24 hours in either plain food or food prepared with 16mM caffeine. Fold differences were calculated by dividing the mean expression level of treated samples by the mean expression level of untreated samples. At least two experiments were performed for each gene, each with triplicate samples. Values represent mean + SEM.

The real-time PCR data for the D-Fos and D-Jun mRNA levels, on the other hand, did not follow the trend seen with the Cyp genes in the Canton-S and dnc1 flies. The Canton-S flies showed similar effects from caffeine treatment as seen in the previous experiments with caffeine- treated S2 cells (Figures 18 and 19). With S2 cells, which are more sensitive to the effects of xeniobiotics, the mRNA levels of D-Fos and D-Jun were not greatly affected by 4mM caffeine treatment (Figure 18). Similarly, the Canton-S flies treated with 16mM caffeine did not show much change in mRNA levels of D-Fos and D-Jun; these levels were 1.3- and 0.6-times the levels of the untreated Canton-S levels of D-Fos and D-Jun mRNA.

Interestingly, the transcription of both D-Fos and D-Jun was induced by caffeine treatment in the dnc1 mutant flies (Figure 19). D-Fos and D-Jun mRNA levels in dnc1 flies were increased 13.45- and 6.45-fold, respectively, as a result of caffeine treatment (Figure 19). The reasons for caffeine induction of D-jun and D-fos in dnc1 but not in wild-type flies are not understood.

Overall, the data from the qRT-PCR experiments with the Canton-S and dnc1 flies suggest that caffeine most likely does induce Cyp6a8 through the cAMP phosphodiesterase pathway, via inhibition of PDE and increasing intracellular cAMP. However, the fact that

Cyp6a8, Cyp6a2, and Cyp6g1 are still induced in dnc1 flies, although to a lesser extent than in

Canton-S, suggests that caffeine induction may not occur exclusively through the cAMP PDE pathway. Another possibility is that the low level of cAMP that is still active in the dnc1 mutant flies does actually get inhibited by caffeine, leading to the induction of the Cyp genes that was seen in these experiments (Figure 19). Since the levels of D-Fos and D-Jun were induced in the dnc1 mutant flies following caffeine treatment, it may also be possible that D-Fos and D-Jun may

43 have some implications in the caffeine-induced upregulation of these Cyp genes when the cAMP

PDE pathway is restricted.

44 IV. Conclusions

The real-time PCR results further validate the findings of the transient transfection experiments. The endogenous CYPs, Cyp6a8, Cyp6a2, and Cyp6g1, were induced by caffeine in both Canton-S and dnc1 flies. This suggests that the results of the luciferase reporter assays in S2 cells do reflect the effects on transcription seen in the whole organism. As stated previously, the flies with mutated dunce gene have decreased levels of cAMP phosphodiesterase (PDE), causing increased levels of intracellular cAMP. These dnc1 flies still exhibit induction of Cyp6a8,

Cyp6a2, and Cyp6g1 from caffeine treatment, although to a lesser extent than the Canton-S flies with wild-type dunce gene.

The induction seen in the dnc1 mutant flies could be due to caffeine inhibiting the remaining active cAMP PDE since this mutation is not a null mutation. The inhibition of the remaining cAMP PDE would cause an additional increase in intracellular cAMP levels and, therefore, induction of the cAMP-responsive CYP genes. The decrease in active cAMP PDE in dnc1 flies compared to the Canton-S flies would explain why the Canton-S flies exhibit greater induction after caffeine treatment. The findings from the real-time PCR experiments also demonstrate the complexity of CYP gene regulation.

The significance of the effects of the -57/-61 and TATA mutations on basal and caffeine- and Phenobarbital-induced activity can clearly be seen throughout the data presented in the

Results and Discussion. The additional 0.6-kb upstream DNA, -732/-170, also has seemingly compensatory or “rescuing” characteristics for the mutations of the -97/-101, -43/-47, or -6/-10 regions. We propose two models to elucidate these findings and describe the possible state of the cis-acting elements involved in the basal transcription and the caffeine and Phenobarbital induction of the Cyp6a8 promoter (Figures 20 and 21). 45 In the proposed model (Figure 20), all of the regions investigated during this research, shown in the figure as A-E, interact with the TATA element, which is occupied by RNA polymerase II and other transcription factors. The star and the hexagon represent factors for caffeine and PB induction. The E region, -732/-170, is one of the strongest activators. If it is absent, basal transcription decreases significantly, as seen in previous studies comparing the transcriptional activity of the 0.2- and 0.8-kb upstream DNA of Cyp6a8 (Bhaskara et al., 2006).

The C region, -57/-61, is another strong activator; if it is deleted or mutated, basal transcription also drops significantly. D, B, and A are weak activators. If region E is present, the absence of D,

B, or A does not have much effect on transcriptional activity. If region E is absent, however, mutations in -97/-101 (D), -43/-47 (B), or -6/-10 (A) do negatively affect basal activity.

Furthermore, our data show that the absence or mutation of the C region most negatively affects transcriptional induction from caffeine or Phenobarbital treatment compared to the effects caused by the absence of the A, B, or D regions, when the upstream E region is present and when E is absent. These findings provide evidence that the -57/-61 region is extremely significant for basal, caffeine-, and Phenobarbital-induced activity and implicates that -57/-61 is likely an enhancer within the Cyp6a8 promoter.

Factors involved in caffeine or PB induction act via the transcription complex formed at

TATA by basal transcription machinery and the factors from A-E elements. The factors for caffeine and PB induction are different because microarray analysis showed that some genes are induced by caffeine or PB (Kuruganti and Ganguly, unpublished results). However, there does appear to be some overlap of the factors for caffeine and PB induction at -57/-61. Both chemicals require this region to be present for maximum induction, as seen in the data from the caffeine and Phenobarbital synergism experiments (Figures 16 and 17).

Figure 20: Model of cis elements of Cyp6a8 promoter involved in xenobiotic induction. Factors for caffeine and PB induction are shown as the star and hexagon. The transcription start site is represented by the black arrow. Elements in upstream DNA are shown as letters A-E.

47 This model (Figure 20) also shows the possible redundancy of the A, B, and D elements within the E region, -732/-170, of Cyp6a8 upstream DNA. When the A, B, or D regions are mutated or absent within the 0.2-kb (-170/-1) upstream DNA, the additional 0.6-kb upstream

DNA (region E) can compensate for both basal and caffeine-induced activity due to redundancy of these elements. Bhaskara et al. (2006) identified several additional CREB and AP-1 sites in the -732/-170 region, supporting this possibility of certain repetitive cis elements.

List of References

49 Andersen, J.F., Utermohlen, J.G., and Feyereisen, R., 1994. Expression of house fly CYP6A1 and NADP-cytochrome P450 reductase in Escherichia coli and reconstitution of an insecticide-metabolizing P450 system. Biochemistry 33(8), 2171-2177.

Auchus, R.J., 2001. The genetics, pathophysiology, and management of human deficiencies of P450c17. Endocrinol Metab Clin North Am 30(1), 101-119.

Bhaskara, S., Dean. E.D., Lam, V., and Ganguly, R., 2006. Induction of two cytochrome P450 genes, Cyp6a2 and Cyp6a8, of Drosophila Melanogaster by caffeine in adult flies and in cell culture. Gene 377, 56-64.

Bhaskara, S., Chandrasekharan, M.B., and Ganguly, R., 2008. Caffeine induction of Cyp6a2 and Cyp6a8 genes of Drosophila melanogaster is modulated by cAMP and D-JUN protein levels. Gene 415, 49-59.

Carino, F.A., Koener, J.F., Plapp, F.W., and Feyereisen, R., 1994. Constitutive overexpression of the cytochrome P450 gene CYP6A1 in a house fly strain with metabolic resistance to insecticides. Insect Biochem. Mol. Biol. 24, 411-418.

Chang , T.K.H., and Waxman, D.J., 1996. The CYP2A subfamily. In Cytochromes P450: Metabolic and Toxicological Aspects, 99-134. CRC Press, Boca Raton, FL.

Chen, Y., and Goldstein, J.A., 2009. The transcriptional regulation of the human CYP2C genes. Curr Drug Metab 10(6), 567-578.

Choe , S., Dilkes, B.P., Fujioka, S., Takatsuto, S., Sakurai, A., and Feldmann, K.A., 1998. The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22!- hydroxylation steps in brassinosteroid biosynthesis. Plant Cell 10(2), 231-243.

Cooper, D.Y., Levin, S., Narasimhulu, S., Rosenthal, O., and Estabrook, R.W., 1965. Photochemical action spectrum of the terminal oxidase of mixed function oxidase systems. Science 147, 400-402.

Daborn, P.J., Yen, J.L., Bogwitz, M.R., Le Goff, G., Feil, E., Jeffers, S., Tijet, N., Perry, T., Heckel, D., Batterham, P., Feyereisen, R., Wilson, T.G., and ffrench-Constant, R.H., 2002. A single P450 allele associated with insecticide resistance in Drosophila. Science 297(5590), 2253-2256.

Daborn, P.J., Lumb, C., Boey, A., Wong, W., ffrench-Constant, R.H., and Batterham, P., 2007. Evaluating insecticide resistance potential of eight Drosophila melanogaster cytochrome P450 genes by transgenic over-expression. Insect Biochem. Molec. Biology 37(5), 512- 519.

50 Davis, R.L., and Kiger Jr., J.A., 1981. Dunce mutants of Drosophila melanogaster: mutants defective in the cyclic AMP phosphodiesterase enezyme system. J. Cell Biol. 90, 101- 117.

Dehal, S.S., and Kupfer, D., 1997. CYP2D6 catalyzes tamoxifen 4-hydroxylation in human liver. Cancer Research 57, 3402-3406.

Denison, M.S., and Whitlock, Jr., J.P., 1995. Xenobiotic-inducible transcription of cytochrome P450 genes. J Biol Chem 270(31), 18175-18178.

Doerr-Stevens, J.K., Liu, J., Stevens, G.J., Kraner, J.C., Fontaine, S.M., Halpert, J.R., and Sipes, I.G., 1999. Induction of cytochrome P-450 enzymes after repeated exposure to 4- vinylcyclohexene in B6C3F1 mice. Drug Metab Dispos 27(2), 281-287.

Dombrowski, S.M., Krishnan, R., Witte, M., Maitra, S., Desing, C., Waters, L.C., and Ganguly, R., 1998. Constitutive and barbital-induced expression of the Cyp6a2 allele of a high producer strain of CYP6A2 in the genetic background of a low producer strain. Gene 221(1), 69-77.

Estabrook, R.W., 1996. The remarkable P450s: A historical overview of these versabtile hemeprotein catalysts. FASEB J 10, 202-204.

Feyereisen, R., 1995. Molecular biology of insecticide resistance. Toxicol Lett. 82-83, 83-90.

Feyereisen, R., 2006. Evolution of insect P450. Biochemical Society Transactions 34(6), 1252- 1255.

Fisone, G., Borgkvist, A., and Usiello, A., 2004. Caffeine as a psychomotor stimulant: mechanism of action. Cell Mol Life Sci 61(7-8), 857-872.

Fredholm, B.B., and Lindstrom, K., 1999. Autoradiographic comparison of the potency of several structurally unrelated adenosine receptor antagonists at adenosine A1 and A(2A) receptors. Eur J Pharmacol 380(2-3), 197-202.

Frigo, D.E., Vigh, K.A., Struckhoff, A.P., Elliott, S., Beckman, B.S., Burow, M.E., and McLachlan, J.A., 2005. Xenobiotic-induced TNF-! expression and apoptosis through the p38 MAPK signaling pathway. Toxicol Lett 155, 227-238.

Gilbert, L.I., 2004. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster. Molecular and Cellular Endocrinology 214(1- 2), 1-10.

Goasduff, T., Dreano, Y., Guillois, B., Menez, J.F., and Berthou, F., 1996. Induction of liver and kidney CYP1A1/1A2 by caffeine in rat. Biochem Pharmacol 52, 1915-1919.

51 Guengerich, F.P., 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chemical Research in Toxicology 14(6), 611-650.

Guengerich, F.P., 2003. Cytochromes P450, drugs, and diseases. Mol Interv 3(4), 194-204.

Helvig, C., Tijet, N., Feyereisen, R., Walker, F.A., and Restifo, L.L., 2004. Drosophila melanogaster CYP6A8, an insect P450 that catalyzes lauric acid (omega-1)- hydroxylation. Biochem Biophys Res Comm 325, 1495-1502.

Hung, C.F., Berenbaum, M.R., and Schuler, M.A., 1997. Isolation and characterization of CYP6B4, a furanocoumarin-inducible cytochrome P450 from a polyphagous caterpillar (Lepidoptera: Papilionidae). Insect Biochem Mol Biol 27(5), 377-385.

Kahn, R., and Durst, F., 2000. Function and evolution of plant cytochrome P450. Recent Adv Phytochem 34,151-189.

Karin, M., 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270(28), 16483-16486.

Kasai, S., and Scott, J.G., 2001. Expression and regulation of CYP6D3 in the house fly, Musca domestica. Insect Biochem Mol Biol. 32, 1-8.

King-Jones, K., Horner, M.A., Lam, G., and Thummel, C.S., 2006. The DHR96 nuclear receptor regulates xenobiotic responses in Drosophila. Cell Metabolism 4, 37-48.

Klingenberg, M., 1958. Pigments of rat liver microsomes. Arch Biochem Biophys 75, 376-386.

Lamb, D.C., Waterman, M.R., Kelly, S.L, and Guengerich, F.P., 2007. Cytochromes P450 and drug discovery. Curr Opin Biotechnol 18(6), 504-512.

Le Goff, G., Boudy, S., Daborn, P.J., Yen, J.L, Sofer, L., Lind, R., Sabourault, C., Madi-Ravazzi, L, and ffrench-Constant, R.H., 2003. Microarray analysis of cytochrome P450 mediated insecticide resistance in Drosophila. Insect Biochem Mol Biol 33, 701-708.

Lin, G.G.-H., Kozaki, T., and Scott, J.G., 2011. Hormone receptor-like in 96 and Broad- Complex modulate Phenobarbital induced transcription of cytochrome P450 CYP6D1 in Drosophila S2 cells.

Lin, L., Ercan, O., Raza, J., Burren, C.P., Creighton, S.M., Auchus, R.J., Dattani, M.T., and Achermann, J.C., 2007. Variable phenotypes associated with aromatase (CYP19) insufficiency in humans. J Clin Endocrinol Metab 92(3), 982-990.

52 Ma, R., Cohen, M.B., Berenbaum, M.R., Schuler, and M.A., 1994 Black swallowtain (Papilio polyxenes) alleles encode cytochrome P450s that selectively metabolize linear furanocoumarins. Arch Biochem Biophys 310(2), 332-340.

Maitra, S., Dombrowski, S.M., Waters, L.C., and Ganguly, R., 1996. Three second chromosome-linked clustered Cyp6 genes show differential constitutive and barbital- induced expression in DDT-resistant and susceptible strains of Drosophila melanogaster. Gene 180, 165-171.

Maitra, S., Price, C., and Ganguly, R., 2002. Cyp6a8 of Drosophila melanogaster: gene structure, and sequence and functional analysis of the upstream DNA. Insect Biochem. Mol. Biol. 32, 859-870.

Mandal, P.K., 2005. Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor biology. J Comp Physiol B 175, 221-230.

Miners, J.O., and Birkett, D.J., 1996. The use of caffeine as a metabolic probe for human drug metabolizing enzymes. Gen. Pharmacol. 27(2), 245-249.

Morra, R., Kuruganti, S., Lam, V., Lucchesi, J.C., and Ganguly, R., 2010. Functional analysis of the cis-acting elements responsible for the induction of the Cyp6a8 and Cyp6g1 genes of Drosophila melanogaster by DDT, Phenobarbital, and caffeine. Insect Molecular Biology 19(1), 121-130.

Myasoedova, K.N., 2008. New findings in studies of Cytochromes P450. Biochemistry 73(9), 965-969.

Nebert, D.W., and Gonzalez, F.J., 1987. P450 genes: structure, evolution, and regulation. Ann. Rev. Biochem. 56, 945-993.

Omura, T., and Sato, R., 1962. A new Cytochrome in liver microsomes. J Biol Chem 237, 1375- 1376.

Omura, T., and Sato, R., 1946. The carbon monoxide-binding pigement of liver microsomes. I. Evidence for its hemeprotein nature. J Biol Chem 239, 2370-2378.

Omura, T., 1999. Forty years of Cytochrome P450. Biochem Biophys Res Comm 266, 690-698.

Poulsen, S.A., and Quinn, R.J., 1998. Adenosine receptors: new opportunities for future drugs. Bioorg Med Chem 6(6), 619-641.

Rannug, A., Alexandrie, A.K., Persson, I., and Ingelman-Sundberg, M., 1995. Genetic polymorphism of cytochromes P450 1A1, 2D6 and 2E1: regulation and toxicological significance. J Occup Environ Med 37(1), 25-36.

53 Raunio, H., Rautio, A., and Pelkonen, O., 1999. The CYP2A subfamily: function, expression and genetic polymorphism. IARC Sci Publ 148, 197-207.

Rendic, S., and Di Carlo, F.J., 1997. Human cytochrome P450 enzymes: a status report summarizing their reactions, substrates, inducers, and inhibitors. Drug Metabolism Reviews 29(1-2), 413-580.

Rosa, S., Steigert, M., Lang-Muritano, M., l’Allemand, D., Schoenle, E.J., and Biason- Lauber,A., 2010. Clinical, genetic and functional characteristics of three novel CYP17A1 mutations causing combined 17!-hydroxylase/17,20-lyase deficiency.

Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochem. Molec. Biol. 29, 757-777.

Scott, J.G., and Wen, Z., 2001. Cytochromes P450 of insects: the tip of the iceberg. Pest Management Sci. 57, 958-967.

Schuler, M.A., 1996. The role of cytochrome P450 monooxygenases in plant-insect interactions. Plant Physiol 112(4), 1411-1419.

Simpson, E.R., Clyne, C., Rubin, G., Boon, W.C., Robertson, K., Britt, K., Speed, C., and Jones, M., 2002. Aromatase – A brief overview. Annual Review of Physiology 64, 93-127.

Sng, J.C., Taniura, H., and Yoneda, Y., 2004. A tale of early response genes. Biol. Pharm. Bull. 27, 606-612.

Snyder, M.J., and Glendinning, J.I., 1996. Causal connection between detoxification enzyme activity and consumption of a toxic plant compound. J Comp Physiol A 179(2), 255-261.

Sueyoshi, T., and Negishi, M., 2001. Phenobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu. Rev. Pharmacol. Toxicol. 41, 123-143.

Svenningsson, P., Strom, A., Johansson, B., Fredholm, B.B., 1995. Increased expression of c- jun, junB, AP-1, and preproenkephalin mRNA in rate striatum following a single injection of caffeine. J. Neurosci. 15, 3583-3593.

Tomita, T., and Scott, J.G., 1995. cDNA and deduced protein sequence of CYP6D1: the putative gene for a cytochrome P450 responsible for pyrethroid resistance in house fly. Insect Biochem Mol Biol. 25(2), 275-283.

Tompkins, L.M., and Wallace, A.D., 2007. Mechanisms of cytochrome P450 induction. J Biochem Mol Toxicol 21(4), 176-181.

Vontas, J., Blass, C., Koutsos, A.C., David, J.P., Kafatos, F.C., Louis, C., Hemingway, J., Christophides, G.K., and Ranson, H., 2005. Gene expression in insecticide resistant and

54 susceptible Anopheles gambiae strains constitutively or after insecticide exposure. Insect Mol Biol 14(5), 509-521.

Wang, H., and Negishi, M., 2003. Transcriptional regulation of cytochrome P450 2B genes by nuclear receptors. Curr Drug Metab 4(6), 515-525.

Werck-Reichart, D., and Feyereisen, R., 2000. Cytochromes P450: a success story. Genome Biol 1(6), 1-9.

Willoughby, L., Chung, H., Lumb, C., Robin, C., Batterham, P., and Daborn, P.J., 2006. A comparison of Drosophila melanogaster detoxification gene induction responses for six insecticides, caffeine, and Phenobarbital. Insect Biochem. And Molec. Biology 36, 934- 942.

Xu, C., Li, C.Y., and Kong, A.N., 2005. Induction of phase I, II, and III drug metabolism/transport by xenobiotics. Arch Pharm Res 28, 249-268.

Yamada, H., Ishii, Y., Yamamoto, M., and Oguri, K., 2006. Induction of the hepatic cytochrome P450 2B subfamily by xenobiotics: research history, evolutionary aspect, relation to tumorigenesis, and mechanism. Curr Drug Metab 7(4), 397-409.

55 Vita

Olivia Nichole Hill was born in Knoxville, Tennessee, on July 10, 1984, the daughter of

Anthony Joseph and Selma Denise Hill. She attended school in the Knox County School system.

In May 2002, she graduated from Halls High School as salutatorian. She entered the

Biochemistry and Cellular and Molecular Biology program at the University of Tennessee,

Knoxville, in August 2002. During college, she worked as a pharmacy technician at Fort Sanders

Regional Medical Center. She received a Bachelor of Science degree in May 2007, with a major in Biochemistry & Cellular and Molecular Biology. Beginning October 2007, she conducted research in the laboratory of Bruce McKee, Ph.D., on meiotic chromosome segregation in

Drosophila melanogaster. In August 2008, she entered the graduate program in Biochemistry and Cellular and Molecular Biology, beginning research on the molecular mechanisms governing

Cytochrome P450 gene expression in Drosophila melanogaster in the laboratory of Ranjan

Ganguly, Ph.D. She received the Master of Science degree in Biochemistry and Cellular and

Molecular Biology in August 2011.

&lt;I&gt;Drosophila Melanogaster&lt;/I&gt;

<I>Drosophila Melanogaster</I>