Copyright 0 1994 by the Genetics Society of America

Suppressor U1 snRNAs in Drosophila

Patrick C. H. Lo', Debjani Roy2 and Stephen M. Mount' Department of Biological Sciences, Columbia University, New York, New York 10027 Manuscript received April 25, 1994 Accepted for publication June 29, 1994

ABSTRACT Although the role of U1 small nuclear RNAs (snRNAs) in 5' splice site recognition is well established, suppressor U1 snRNAs active in intact multicellular animals have been lacking. Here we describe sup- pression of a 5' splice site mutation inthe Drosophila melanogaster white gene ( dR18)by compensatory changes in U1 snRNA. Mutation of positions -I and +6 of the 5' splice site of the second intron (ACG I GTGACT to ACC I GTGAGC) results in the accumulation of RNA retaining this 74nucleotide intron in both transfected cells and transgenic flies.U1-3G, a suppressor U1 snRNA which restores base- pairing at position +6 of the mutant intron, increases the ratioof spliced to unspliced dR1*RNA up to fivefold in transfected Schneider cells and increases eye pigmentationin dR1* flies. U1-9G, which targets position -1, suppresses dR1*in transfected cells lesswell. UI-3G,9G has the same effect as U1-3G although it accumulates to lower levels. Suppression of dR'*has revealed that the Ulb embryonic variant (GI34 to U) is active in Schneider cells and pupal eye discs. However, the combination of9G with 134U leads to reduced accumulation of both Ulb-9G and UIb3C,9G, possibly because nucleotides 9 and 134 both participate in a potential long-range intramolecular base-pairing interaction. High levels of functional U1-3G suppressor reduce both viability and fertility in transformed flies. These resultsshow that, despite the difficultiesinherent in stably altering splice site selection in multicellular organisms,it is possible to " obtain suppressor U1 snRNAs in flies.

PLICING of messenger RNA precursors in higher al. 1988; SILICIANOand GUTHRIE1988) and in mamma- S eukaryotes is a complex process that results in the lian cells (COHENet al. 1993). precise removal of introns fromprimary transcripts [see However, base-pairing between U1 RNA and the 5' GREEN(1991), MOOREet al. (1993) and WISE(1993) for splice site is not thesole determinant of 5' splice site use reviews]. Splicing involves two transesterification reac- (SILICIANOand GUTHRIE1988; SERAPHIN and ROSBASH tions thatare preceded by formation of the spliceosome, 1990). For example, mutation of yeast U1 so that it is a large dynamic structurecontaining many factors. capable of pairing with a G to A mutation in the invariant Among these factors are small nuclear ribonucleopro- position + 1 of the intron allowed efficient suppression tein particles (snRNPs) containing the U snRNAs, in- of the first step of splicing, but not thesecond (SILICIANO cluding U1, U2, U4, U5and U6. Numerous studies have and GUTHRIE1988). This result implies that atleast some identified sequences at the two splice sites and at the nucleotides, including the invariant G at position +1, lariat site as critical for the specification of splicing. At are recognized twice in thepathway towardproper splic- 5' splice sites there is a nine nucleotide consensus se- ing. Furthermore, there is genetic (NEWMANand NOR- quence, MAGI GTRAGT, which is highly conserved MAN 1991) and in vitro (NELSONand GREEN1988; ZAPP (MOUNT1982; SENAPATHY~~al. 1990; MOUNTet al. 1992). and BERGET1989) data indicating thateven the first step The 5' end of U1 RNA and this nine nucleotide con- of RNA splicing involves recognition of the 5' splice site sensus are perfectly complementary (LERNERet al. 1980; by factors in addition to the U1 snRNP. Specifically, ge- ROGERSand WALL1980), and base-pairing with Ul RNA netic suppression experiments in yeast indicate inter- contributes to 5' splice site recognition. Genetic evi- actions between U5 and exon sequences immediately dence forthis interaction between U1 and 5' splice sites flanking both splice sites (NEWMANand NORMAN1991, has been provided by the demonstration that a com- 1992). These studies have been directly confirmed by pensatory change in the5' end of U1 RNA can suppress cross-linking studies in mammalian splicing extracts a 5' splice site mutation. Thiswas first shown by transient (WYATTet al. 1992; SONTHEIMERand STEITZ1993) that transfections in HeLa cells (ZHUANGand WEINER1986) have identified an interaction between U5 and the 5' and later by stable transformation in yeast (SERAPHIN et splice site that is maintained through bothsteps of splic- ing. A role forU6 snRNA in 5' splice site choice has also ABELSON ' Present address: Brookdale Center, Mt. Sinai School of Medicine, One been indicatedby cross-linking ( SAWAand 1992; Gustav L. Levy Place, New York, New York 10029. SAWAand SHIMURA1992; WASSARMANand STEITZ1992), Present address: Department of Biology, New York University, Washington Square, New York, New York 10003. and confirmed by suppression studies that support a 'To whom correspondence should be addressed. 3-base pair interaction between a conserved region of

Genetics 138 365-378 (October, 1994) 366 P. C. H. Lo,and D. Roy S. M. Mount

U6 and nucleotides +4 to +6 of the 5‘ splice site alleles can be easily observed (LINDSLEYand ZIMM1992) (KANDELS-LEWISand SERAPHIN 1993; LESSERand GUTHRXE and has proven useful in numerous studies (for ex- 1993). This interaction follows recognition by U1, sug- ample, RABINOW and BIRCHLER1989; PENGand MOUNT gesting that U6 has a role in proofreading during 5’ 1990; KURKULOSet al. 1991). splice site selection. Finally, protein factors that influ- Drosophila possesses an embryonic U1 sequence vari- ence which of two competing 5’ splice siteswill be used ant that differs from the predominantform (Ula) by a have been described (Fu and MANIATIS 1990; GE and single nucleotide change,G134 to U, located at thevery MANLEY 1990; KRAINER et al. 1990; HARPER and MANLEY 3’ border of the consensus Drosophila Sm binding site 1991; MAYEDA and KRAINER 1992; MAYEDA et al. 1992). (LO and MOUNT1990). As with numerous highermeta- Although many, if not all, of these proteins containRNA zoan species, this sequence variant (Ulb) is primarily binding domains, it remains unclear whether they in- expressed during embryogenesis. Although embryonic teract directly with the 5’ splice site. Rather, their effect U1 variants are also found in sea urchin (SANTIAGOand may be mediated through the U1 snRNP, as there is MARZLUFF 1989),Xenopus (FORBESet al. 1984; LUNDand evidence that the SR proteins ASF/SF2 and SC35 inter- DAHLBERG1987), and mouse (LUNDet al. 1985), there act directly with the U1 snRNP (Wu and ~~ANIATIS1993; have been no studies of the functionof these embryonic KOHTZet al. 1994). variants in any of these species. Thus, our first use of Not only is 5’ splice site selection dependent on fac- suppression by U1 RNAs has been to determine if the tors other than U1, but the U1 snRNP also has other Drosophila embryonic Ulb sequence variant is roles in splicing. Genetic suppression studies in Schizo- functional. sacchromycespombe have revealed that U1 snRNAiscriti- In this study we demonstrate that mutation of posi- cal for 3’ splice site recognition via base-pairing (REICH tions -1 and +6 at the5’ splice site of the second intron et al. 1992), although this appears not to be the case in of the Drosophila white gene leads to theaccumulation Saccharomyces cerevisiae (SERAPHINand KANDELS-LEWIS of unspliced RNA in both transfected Drosophila cells 1993).Furthermore, U1snRNPs incapable ofbase- and transformed flies. Compensatory mutations in the pairing with the 5’ splice site can still contribute tosplic- 5’ end of U1 are able to suppress this defect in both ing, as indicated by stabilization of complexes contain- co-transfected cells and in transformed flies. Both Ula ing U2 snRNP (BARABINOet al. 1990) andthe and Ulb can act as efficient suppressors, indicating that observation that the splicing of certain substrates re- the embryonic form can function in developing pigment quires the U1 snRNP but notbase-pairing (SEIWERTand cells. There are inherent difficulties in stably altering STEITZ1993). splice site selection in multicellular organisms, and we In view of the complexity of 5’ splice site recognition, have indeed observed deleterious effects on viability and genetic suppression in Drosophila melanogaster is po- fertility. Nevertheless, by demonstrating thatsuppressor tentially useful in clarifymg the role of U1 snRNA in U1 snRNAs can hnction in flies, we have shown that splicing and in identifylng other factors that interact suppression studies designed to clarify the roleof the U1 with U1in splice site choice. However, suppression of 5’ snRNP and identify additional key factors in splicing are splice site mutations by compensatory mutations in U1 possible. had notpreviously been demonstratedin any intact mul- ticellular organism, and was potentially impossible. Ex- MATERIALS ANDMETHODS pression of U1 RNAs with altered 5’ termini in mam- Construction of dRI8: Mutations at positions -1 and +6 of malian cellsaffects 5’ splicesite selection (YUO and the 5’ splice siteof the white second intron were generated by WEINER1989a; COHENet al. 1993). Thus, we were con- in vitro mutagenesisusing the polymerasechain reaction cerned that suppressor U1 RNAs, by altering the effi- (PCR) (SAIKIet ul. 1988). A degenerate oligonucleotide (5‘- ciency or fidelity of splicing, would have deleterious ef- TACCGGCGCCCAGGAAACATITGCTCAAGAACNGTGAG- NTTCTAT-3’) spanning theNurI restriction site at11127 and fects in a complex organism such as the fruit fly whose the 5’ splice site at 11156 was used in combination with an development depends on the proper expression, and oligonucleotide (MG5: 5’CCAGGGTCGTCTTTCCGGCAC- splicing, of many genes. In order to minimize problems CGGAACTGCCC-3‘) inthe downstream exon togenerate of this sort, we have examined suppression of mutations PCR products with mutations at these two positions. These in positions within the 5‘ splice site consensus that are mutagenized PCR products were then cloned into M13mp19 for sequencing, and 13 of the 16 possible combinations of only moderately conserved (-lG and +6Tare present in nucleotides at positions -1 and +6 were obtained. Selected 71 and 68% of Drosophila 5‘ splice sites, respectively) mutations, including the-1C, +6C double mutation (DR18) (MOUNTet al. 1992). We also placed these mutations in were then cloned as a PvuI/NurI fragment into P[B4hsfi-ulI the Drosophila white gene because differences in eye which consists of a functional white gene under the control of pigmentation thatresult from twofold differences in the the hsp70 promoter, in a P element transformation vector (STELLERand PIRRO~TA1985). expression of white are easily recognized over a large Construction of U1 suppressors: The 3A to G (UI-3G) and range of expression (between 1 and 50% of wild-type 9c to G (U1-9G) single site compensatory mutations and the levels). Because of this sensitivity, suppression of white double mutant suppressor with both compensatory mutations U 1 snRNAsSuppressor U1 in Drosophila 367 in U1 (U1-3G,9G) were generated in vitro by PCR using the saline and allowed to recover in fresh medium for 3-4 days Drosophila Ula geneof the clonepDmU1.4b. The pDmU1.4b before being harvested for total RNA isolation. Cell number construct consists of a l-kb EcoRI/BumHI fragment from the and viability were assessedby counting and uypan blue stain- Drosophila U1-21.1 gene including 430 bp of 5"flanking se- ing. Isolation of total RNA by guanidinium isothiocyanate/ quence and 400 bp of 3"flanking sequence (MOUNT1983). A SDS lysis and a CsCl step gradient were as described by KING 50-mer oligonucleotide complementary to the 5'end of the U1 STON (1989). This total RNA was then treated with RNase-free coding sequence and part of its immediately 5"flanking se- DNase (RQl DNase, Promega Biotech Inc.) to remove any quence (PL15: 5'-CGCCTTCGTGATCACGGTTAACCTCT- contaminating plasmid or genomic DNA. ACGCCX3GTAAGYATGCTITCCTC-3';S = G or C; Y = A or Immunoprecipitation of U1 snRNPs from nuclear extracts G) was used in combination with oligonucleotide PL14 (5'- of co-transfected Schneider cells: Nuclear extracts from co- CAACCCAACTGCAGATGTAAC-3'), a 21-mer that hybridized transfected Schneider cellswere prepared as described in in the U1 5"flanking sequence about 120 bp upstream of the DICNAMet al. (1983), with modifications for small scaleprepa- U1 coding sequence. PCR products were digested with PstI rations (LEEand GREEN1990). Immunoprecipitation of U1 and BclI and replaced the same PstI-BcZI fragment of snRNPs from these nuclear extracts using a human anti-U1 pDmU1.4b. Clones were sequenced to identify the desired mu- RNP antiserum (antiserum MA; a kind gift of PAULROTHMAN) tations in the 5' end of the U1 coding sequence. The Ula and isolation of U1 snRNA from the immunoprecipitated U1 suppressors obtained were named pPL25 (Ula-3G), pPL24 snRNPs were as previously described (LO and MOUNT1990). (Ula-SG), and pPL23 (Ula-3G,9G). Quantitative reverse transcription PCR assay: Total RNA Chimeric Ulb constructs possessing the Ulb sequence was isolated from adult flies as previously described (LO and variation (G134 to U) and 1.1 kb of Ulb 3"flanking sequences MOUNT1990). Each sample of purified total RNA (500 ng; with a Ula promoter were constructed by substituting a 1.2-kb treated with RNase-free DNase) was first annealed (70" for 5 BamHI/BcZI fragment (derived from the U1-82.1 gene in the min; slow cool to 30") in 10 pl [20 mM Tris (pH 8.4), 25 mM clone pPL6) (Lo and MOUNT1990) for the equivalent frag- KC11 with 10pmol of a 32-mer that hybridizes inthe white third ment in each of the Ula suppressor constructs and pDmUl.4b. exon, immediately downstream of the second intron (oligo- This resulted in the creation of hybrid U1 suppressor genes. nucleotide MG5: 5'-GCAGGGTCGTCTTTCCGGCACCGGA- These plasmids were named pPL33 (Ulb-wt), pPL32 (Ulb- ACTGCCC-3') . The annealings were brought up to 20 pl [20 3G), pPL3l (Ulb-SG), and pPL30 (Ulb3G,9G). mM Tris (pH 8.4),25 mM KCl, 1.5 mM MgCl,, 0.05 mM dNTPs, For the Pelement-mediatedtransformation offlies, all eight 10 U RNasin (Promega)] onice and reverse transcribed with U1 suppressor genes were cloned into theuermilion-Pelement 1 unitof avianmyeloblastosisvirus (AMV) reverse transcriptase transformation vector pYC1.8 (FRIDELLand SEARLES1991). The (Life Sciences) for 40 min at 42". These reactions were brought EcoRI/SaZI fragment containing the U1 gene with all its as- sociated 5'- and 3"flanking sequence from each U1 suppressor up to 50 pl [20 mM Tris (pH 8.4), 25 mM KCl, 1.5 mM MgCl,, construct was end-filled and ligated into SalISut and end-filled 0.05 mM dNTPs, 12.5 pCi [a-32P]dCTP(3,000 Ci/mmol)] on pYC1.8 to generate vermilion-Pelement transformation clones ice and added to this were 2 units of Tug polymerase (Cetus) of each of the eight suppressor genes. These clones were des- and 100 fmol of a 25-mer that anneals in the white second ignated as follows: Ula-wt= pPL29; Ula-3G = pPL28; Ula-9G exon, immediately upstream of the second intron (oligo- = pPL27; Ula-3G,9G = pPL26; Ulb-wt = pPL37; Ulb3G = nucleotide JW2: 5'-CGGAATTCAGCGACATACCGGCG pPL36; Ulb-9G = pPL35; and Ulb-3G,9G = pPL34. 3'). Each PCR mixture was then aliquoted into 0.5-ml tubes Transformation of flies: Microinjection and P element- and overlaid with 50 pl of water-saturated mineral oil. The mediated transformation were carried out as described tubes were quickly transferred from ice to a thermal cycler at

94" and amplified for a variable number of cycles (94" for 1 (SPRADLINGand RUBIN1982), using P [ ry+ 1\2-31(99B) as a stable genomic source of P transposase (ROBERTSONet al. 1988). min, 60" (2 set/' ramp rate)for 1 min, 72" for 1 min); samples Expression of P[ dR18]in a w- background was used to identify were separated on a 5% nondenaturing polyacrylamide gel, transformants of this transgene. The -1 alteration also changes which was then dried and visualized by autoradiography. Ra- the codon at the splice site from GUU (Val) to CUU (Leu). dioactivity inthe gels was quantitated with a PhosphorImager Although this position is a hydrophobic amino acid conserved (Molecular Dynamics) using ImageQuant software (v. 3.1), among related proteins, many proteins in this family (ABC and the intensity of bands was reported as "pixel value." While transporters) have leucine in this position (HIGGINS1992). Fur- variation between experiments in transfection studies was ac- thermore, the ability of P[dRf8]to confer some pigmentation ceptably small (see error bars in Figure 4), unknown sources is evidence that the valine to leucine substitution does not of variation between fly RNA preparations (data not shown) affect protein function, as does agreement between the level made it impossible to verify the suppression in transformed of pigmentation observed and that expected from the effi- flies by examining RNA from dR18 flies. ciency of splicing. Transformants of the U1 clones in pYC1.8 Primer extension assays of U1 sequence variants: Primer were obtained by injection of u;P[ry+ 1\2-3](99B) embryos. extension assays were performed as previously described (Lo The resulting Go flies were crossed to v;TMG/CxD flies and and MOUNT1990), with the following modifications. Four mi- transformants among the F, were identified as vermilion+flies crograms of total RNA (treated with RNase-free DNase) was in a vermilion- background. Chromosomes were isolated from annealed to 200 pmol of theappropriate "P-end-labeled single transgenic males lacking P[y' 112-31 (99B) by standard primer and extended with AMV reverse transcriptase (Life genetic methods (ASHBURNER 1989). Sciences) in the presence of the appropriate combination of Co-transfectionexperiments: Drosophila Schneider L2 three dNTPs (375 p~)and one ddNTP (94 VM). Extension of cells were maintained in 1 X Schneider's Drosophila medium a %-mer complementary to U1 positions 7-39 (PL18: (Gibco) supplemented with 10% fetal bovine serum (heat- S'-CCTTCGTGATCACGCTTAACCTCTACGCCAGGT-3')in inactivated; Gibco). Calcium phosphate/DNA transfection of the presence of ddTTP results in a 37-nucleotide extension Schneider L2 cells was carried out as described in HANet al. product from U1 snRNAs with a wild-type nucleotide A at po- (1989). Cells were exposed to the DNA-calcium phosphate sition 3 (Ul-wtor Ul-gG), anda 39 nucleotide extension prod- precipitate (7 pg of U1 plasmid and 3.5 1-18 of dR18plasmid) uct from templates with a G atthat position (Ul-3G or U1-3G, for 18-24 hr and then washed with 1 X phosphate-buffered 9G). Extension of a 27-mer complementary to U1 positions 368 P. C. P. 368 H. Lo, D. Roy and S. M. Mount

13-39 (oligonucleotide PL19:5'-CCTTCGTGATCACGGT- tion. Its suitability and accuracy depends on the small TAACCTCTACGS') inthe presence of ddGTP, results in a 31 size of the intron, and our ability to quantify the two nucleotide extension product from wild-type templates (UI-wt or U1-3G) and a 32-nucleotide product from 9G templates. product bands during exponentialamplification. Extension of a 28-mer complementary to U1 positions 137-164 Using this quantitative RT-PCR assay, we examined (PL4: 5'-TCGGGACGGCGCGAACGCCAlTCCCGGC-3') in the s/u ratio of white RNAs from flies carrying either the presence of ddCTP, results in a 31-nucleotide extension P[ dR"] orthe P[B4hsp-w] parental allele (Figure 2). It product from Ula (134G) and a 32-nucleotide product from is clear that the -1C, +6C double mutation causes de- Ulb (134U). fects in the splicing of the second intron of dR".Al- though the unspliced RNA species is detectable by the RESULTS RT-PCR assay in both the dR"and wc samples (e.g., A 5' splice site mutation leadingto accumulation of an lanes 4, 5, 10 and ll),the second intron of dR"is in- unspliced intron: It is critical for this study that the 5' efficiently removed (lanes 4 or lo), and the s/u ratio is splice site mutation chosen for analysis be suppressible, about one,60-fold lessthan wild type.This is optimal for and that theresulting alteration in the efficiency of splic- detecting even low levels of suppression or enhance- ingbe recognizable in the white phenotypebeing ment by extragenic modifiers, including thesuppressor scored. We introduced mutations positionsat -1 and +6 U1 RNAs described in this study. of the 5'splice site ofthe second intronof the whitegene Suppressor U1 RNAs: To examine suppression of the of D. melanogaster, a 74nucleotide intron whose splic- splicing defect of d"', we placed compensatory base ing has been studied in our laboratory in vitro (Guo et changes in the 5' end of the wild-type Drosophila U1 al. 1993). The wild-type site, ACG I GTGAGTT, has snRNA (designated U1-wt) that would partially or fully seven consecutive nucleotides that couldpotentially pair restore base-pairing of U1 withdR1' (Figure 1).An A to with the 5' end of U1 RNA (Figure 1A). Mutations at G base change atU1 position 3 would allowbase-pairing positions -1 and +6 should weaken this base-pairing with the f6U to C mutation of dR1',while a C to G without disrupting it by reducing the number of con- change at U1 position 9 would allow base-pairing with secutive base pairs between the white 5' splice site and the -1G to C mutation (Figure 1A). Both single site sup- wild-type U1 RNA from seven to five, reducing the AG pressors (designated U1-3G and U1-9G,respectively) of binding by approximately 4.8 kcal/mol (Figure 1A). and the doubly mutant suppressor (U1-3G,9G)were The -1C, +6C double mutation (ACGIGTGAGT to placed in the context of a wild-type Ula gene with 1.1 ACC I GTGAGC) and each of the two component single kb of upstream, and 0.2 kb of downstream, flanking se- mutations were obtained, and each was placed in the quences. Based on analyses of the control of U1 tran- context of a functionalwhite allele in aP element trans scription in Drosophila and other species (HERNANDEZ formation vector (P[B4hsp-w]) (STELLERand PIRROTTA and LUCITO1988; VANKANand FILIPOWICZ1989; ZAMROD 1985).Transformants carrying the -1C, +6C allele et al. 1993), and the pattern of interspecific conserva- (P[dR"]) were identified by eye color, and chromo- tion of U1 flanking sequence elements (LO and MOUNT somes carrying this transgene were isolated by standard 1990),it seemed likely that this would be sufficient flank- genetic methods. These flies displayed an apricot eye ing sequences to allow correct transcription and pro- color ideal for suppression studies. cessing in vivo. We first examined theeffect of this mutation on splic- To test the significance of the Ulb embryonic variant ing by comparing white RNA from flies carrying either (134G to U; see Figure l),hybrids between Ula and Ulb P[dR18]or the P[B4hsp-w] parental allele, which differ were constructed.These hybrid genes carry the 5'- only by the two base changes at-1 and + 6 of the 5'splice flanking sequence of the Ula suppressor genes, but the site of the second intron. In both transgenes the white Ulb variant nucleotide and 3'-flanking sequence of gene is under the control of the hsp70 promoter. The Ulb. Thus, all eight U1 constructs should be under the activity of the uninduced heat shock promoter in the same transcriptional control, as has been demonstrated relevant cells ofthe developing eye iscomparable to that for mouse Ula/Ulb hybrid genes transfected in mouse of the natural white promoter, and hsp70-white fusions tissue culture cells (CACERESet al. 1992). TheseUlb sup- are phenotypically identical to the correspondingwhite pressors were used to examine the effect of the Ulb genes (STELLERand PIRROTTA1985; KURKULOS et al. sequence variant on the ability of the U1 compensatory 1994). RNAs that retain the second intron accumulate mutations to suppress dR18. in dR1',and the ratio between the abundance of nor- The ability of the suppressor U1 RNAs to alleviate the mally spliced forms and these unspliced forms (hence- splicing defect of 7UDR1' was first analyzed by calcium forth "the s/u ratio") can be determinedby quantitative phosphate co-transfections of Drosophila Schneider tis- reverse transcription and PCR (RT-PCR) [for a review sue culture cells withthe dR18 plasmid and each of the see FOLEYet al. (1993); see MATERIALS AND METHODS]. This eight U1 genes. Total RNA was isolated from the trans- technique involves the direct quantitationof PCRprod- fected cells, and the s/u ratio for dR"in the presence ucts by incorporation of radioactivity during amplifica- of each U1 construct was determined by quantitative Suppressor U1 snRNAs in Drosophila 369

47 (kcal/mol) A - w.t. 5'ss 5'-..A C GIG U AG G U U..-3' I 11.1 I I -12.0 w.t. Ula 3'-..G U C C A WW C A U..-5'

DR18 5' ss 5'-..A C GIG U GA G C U..-3' I1*1 I -7.2 w.t. Ula 3"..G U C C A WW C A U..-S'

DRlS 5' ss 5"..A C CIG U Q A G C U..-3' I I*II I -10.7 u1 -x 3"..G U C C A WW C Q U..-5'

DRl 8 5' ss 5'-..A C GIG U G A G 6 U..-3' I I I*I I -8.9 FIGURE1 .Sequences of suppressor U1 RNAs. U1-9G 3"..G U E C A W\y C A U..-5' (A) Potential base-pairing between the 5' splice site of the white second intron with the 5' end of U1. Pairing between the wild-type 5' splice site with wild-type U1 is shown at top. Below this is shown the 5' splice site base-paired with DR18 5' ss 5"..A C ClG U G A G U..-3' dR" -12.4 wild-type Drosophila U1 and each of the suppres I 11'1 I I sor U1 RNAs described in this study. For com- u1 -X,% 3"..G U Q C A W\y C U..-5' parative purposes, the contribution of each pair- ing to AG3, (TURNERet al. 1988) is indicated to the right. AG2, values would be similar.(B) Location B of U1-3G, Ul-gG, and Ulb sequence changes on the Drosophila U1 molecule. The nucleotide UCAcGA A A A changes of the U1-3G and U1-9G compensatory mutations and the Ulb sequence variation are m G G 3GPPP,J?nl shown on the standard secondary structure of the 'GCG wild-type Drosophila Ula molecule (MOUNTand C G STEITZ1981). Conserved nucleotides (5-9 and U1-3G C G' A U 133-137) that participate in a possible long range Wl A U interaction (STURCHLERet al. 1992) are bracketed.

C G C- A U II GVGC GCGUA CGGAG~~AGGCUUGGCC AUUG~ UGCGU GUCUCCAGUUGAGUCGG~ A G GC u cc U CG A UA A 'A U U A u Ill U UA U AU Ula 370 P. C. H. Lo. D. Roy and S. M. Mount

IS cydes 17 cyda 19 cycles I II 1 4 mng FICURF.2.-Re\~erse transcription-PCR assav of - p RNA from flies carrying 71j'H'S. Total RNA (100 OD c+ e3 and 500 ng; treated with RNascfrce DNase) from n3h JJR/A'( 71,//f.%';p[71jVt/8] 1) or ?I)* (II)~"';P[IWt.sp-71)]) adult flies was subjected to 15, 17, and I!) cycles of RT-PCR (see MMT.RIA~S AND Mn-tIoDs). The re- unsplid- sulting labeled PCR productc were separated on a 8% nondenaturing acylamide gel and visual- ized bv autoradiography. tRNA = negative con- trol of RT-PCR using 5 pg of carrier tRNA. plas mid DNA = positive control RT-PCR using I pg spud- of pP[rd'"#] plasmid DNA to verify size of the unspliced band.

12 3 4 5 6 7 8 9 101112131415 1817 16 RT-PCR. Because no 7uhite RNA could be detected in parallel suppression experiment. When extracted RNAs nontransfected cells (data not shown), all of the RNA from the immunoprecipitated U1 snRNPswere analyzed seen here must be derived from 7U""X. Typical results for by the 3G and 9G primer extension assays, it was oh the Ula series of suppressors from one experiment are served that all six suppressor mutations were present in shown in Figure 3. In this experiment, theamplification U1 snRNPs in approximately the same relative levels of the spliccd and unspliced cDNA bands is exponential seen in the total RNA .samples (Figure 5B; compare (linear on the semilog plots) from cycles 18 to 22 in all Figure 5A). four RNA samples. Since these products are all being Ula-3G and Ulb3G partiallysuppress the dRf8 exponentially amplified in the same manner (the eight double mutation in transfected cells: Co-transfection semilog-plotted lines are parallel), we can reliably com- with the wild-type U la gene had virtuallyno effect on the pute the S/II ratio for each co-transfection sample and S/II ratio of IU"'"~' (Figure 4). indicating that transfection compare the different ratios with each other. A com- with Ula constructs per se has a negligible effect on the plete experiment involved co-transfection of 7~'"'~ with splicing efficiency of the ruhife second intron. Thiswas each of the eightsuppressors, plus a negative control of also observed for co-transfection withwild-type Ulb no added suppressor. To facilitate a comparison of the (Figure 4), in which case we could directly veri9 an in- results from three independent experiments, the s/u crease in the amount of Ulb with the Ulb primer ex- ratios of eachexperiment were normalized to the tension assay (Figure 5A, lanes 8 us. 9). Therefore, any sample with no added suppressor. These normalized ra- suppression observed with theother U1 constructs tios ("-fold suppression") were then averaged for each should be attributable to their respective compensatoty suppressor construct from thethree experiments base changes in the 5' end of the U1 coding sequence. (Figure 4). Both U 1-3G suppressors were expressedat steady state With no added suppressor U1, the s/u ratio for 7flR'* levels readily detected by the U1-3G assay (Figure 5A, under our transfection conditions averages 0.22, indi- lanes 4 and lo), and each was able to suppress the splic- cating a hundredfold decrease in splicing efficiency rela- ing defect of 7flRIXto the same extent (4-sfold; Figure tive to the equivalent construct with a wild-type 5' splice 4). These resulu show that it is possible to partially sup site, which has a s/u ratio of 22. While this s/u ratio press the 7U""" 5' splice site double mutation in trans- indicates that splicing is about fivefold more efficient in fected cells with a U1 snRNA bearing a single compen- flies than in transfected cells, the decrease in splicing satory mutation complementary to the +6C intronic efficiency is comparable to the 60-fold decrease oh mutation of 7~''~'~.These results also showthat theU la- served with ru"R'Xflies(Figure 2; data notshown). Steady U 1b hybrid genes areactive in Schneider cells and that state levels of suppressor U1 snRNAs were determined the U1 b variant of 11. melnnoguster is functional in vivo. by primer extension assays using the same RNA samples More suppression is achieved with Ula-3G,9G than (see MATERIAIS AND METHODS). Assays specific for Ul-SG, with Ulb3G,9G: Because UI-SG,SG should restore full U1-9G and Ulbwere carried out by extension of a spe- base-pairing of U1 with the double mutant 5' splice site cific labeled primer in the presence of three deoxynucle- of ru""", it was expected to be a more efficient suppres- otides and onedideoxynucleotide, resulting in one ex- sor than the U 1-3G suppressor. The Ula-3G,9G suppres- tension product for the wild-type sequence andanother sor caused a 4-5-fold partial suppression of the 7~''~'~ slightly longer extension product for the mutant se- splicing defect in transfections, similar to that observed quence (Figure 5A). That these U1 snRNA sequence with the Ul-SG suppressors (Figure4). However, because variants were present in snRNP particles was confirmed the level of the Ula-SG,SC suppressorin transfected cells by immunoprecipitation with an anti-U1 snRNP anti- wa9 much lower than that of the Ula-3G suppressor(Fig- body, using nuclear extracts of transfected cells from a ure 5A, 3G assay of lane 6 vs. 4). it appears that the Ula- SuppressorsnRNAs U1 in Drosophila 37 I

U1.-wt UW3C U1.-9C UI.-X;,9C 3.-Typical quantitative RT-PCR results 7-1 7-1 FIGCRE B a for Ula suppressor co-transfections. Quantitative Craa 18 19 20 21 22 9 18 $9 20 21 n 18 1s 20 21 n 5 18 1s 20 21 22 S RT-PCR (18-22cycles) wascamedouton total RNA samplesfrom Schneidercellsco-transfectedwith the "nlpl- ~ 7 0 -195 J""pIasmid and the indicated Ula suppressor con- "! struct. The RNnw control ("RNaw")for each set of RT-PCR reactions had DNaw-free RNaw added to the primer annealing of the reverse wanscription step and were subjected to 22 cyclesof RT-PCK. An autoradiograph of the labeled PCR products .wpa- rpt- -0. , 0 -121 rated on 5% nondenaturing gel is shown at top. Quantitation is shown below. The spliced and un- spliced ban& from each set of RT-PCR reactions were quantitated in arbitrary units (pixel value) a5

Id described in M~~ERLUSAYD M~~I)Sand plotted -*M against the number of PCRcycles on a semilog graph. The graph for eachset of RT-PCR reactions Id is shownbeneath the corresponding portion of the PCR eyclea PCR cyclr PCR ye*r PCR ycln autoradiograph.

U1-9Gsuppresses d'R'8weaklyornot at all:: Suppres- sion by U1-9G depends on restoration of base-pairing between the ninth nucleotide of U1 and the exonic-1 position of the 5' splice site. While the Ula-3G single site compensatory mutation suppresses 7J"I8 fairly well at 4-5foId. Ula-9G suppresses only 2-fold. This is despite 44 a steady state level of the U 1a-9G suppressor that is simi- lar to that of Ula-3G (Figure 5A; 9G assay of lane 5 vs. 3G assay of lane 4). We conclude that Ula-9G is less efficient as a suppressor than is Ula-3G. Intriguingly, Ulb9G shows little if any suppression. An examination of the Ulb9G steady state level reveals that this is again attributable to a somewhat lower level of expression of the U 1b form. However, the level of the Ulb9G suppressor in the transfected cells is still sig- nificant (Figure 5A, 9G assay of lane 11). lying between 01 v) -.sa ab ab ab abthat of the U lb3G,9G suppressor (3G and 9G assays of IaL lane 12) and that of the U1 b3G suppressor (3G assay of a, "" 2 U1-wt U13G U1-9G U13G,9G lane 10). U13G suppressors function in whole flies: Having FIGURE4.Suppression of dR"by U1 compensatory mu- established that thesplicing defect of ~'""~wa..suppress- tations in Schneider cell cmransfections. The -fold suppres- sion (see text) of UI"~'~by each of the eight U1 suppressors in ible by the appropriate compensatory mutations in the Schneider cell co-transfections is shown; a and b refer to the 5' end of U1 snRNA in transfected Schneider cells, we adult (134G) and embryonic (134U) forms, respectively. The next asked whether the same suppressor U 1 RNA5 could baselinevalue of in theabsence of co-transfection with phenotypically suppress the eye color defect of IJ)~''in U 1 is defined as 1. Error bars show the standard deviation of flies. All eight suppressorConstructS werecloned into a three separate experiments. suitable Pelement transformation vector carrying the v+ 3G,% suppressor is indeed a more efficient suppressor. marker (FRIDELLand SFARLL.1991) and second chro- In contrast to the Ulaform of the 3G,9G suppressor, mosome insertion lines were obtained by standard U 1b3G,9G suppressed less than Bfold, significantly methods (see MATERIALS AND METHODS). To test for the lower than the 4-5fold suppression observed with the effect of each suppressor on the apricot eye color of Ula form. This difference can be attributed to a steady zd)'IR, flies with or without one copy ofa U1 suppressor state level of Ulb3G,SG that is even lower than that of were compared. Among the eight U1 constructs, trans- Ula-3C,9G, as detected by both the 3G and 9G assays formant lines that phenotypically suppressed the eye (Figure 5A, lane 12 vs. 6).This lower level of Ulb3G,9G color defect of 78'"were obtained only for the Ul-3G was also seen relative to the U lbwt and Ulb3G con- suppresors. OneU 1a-3G and two U 1b3G transforman t structs using the Ulb assay (Figure 5A, lane 12 vs. lanes lines showed partial suppression of the ufRIR phenotype 9 and 10). However, the reasons for the lower levels of (Figure 6).The strongest suppression was observed for U 1 b3G,9Gare not known (see DISCUSSION). the Ulb3G line lcl, which darkened the w'"'* apricot 372 P. C. H. Lo, D. Roy and S. M. Mount

eye color appreciably (Figure 6A). Slightly weaker sup A. pression was shown by the other Ulb-3G line, 4bl (Fig- ure 6B). The one Ula-3G line that suppresses pheno- typically, 55e1, had theweakest darkening effect of these DR18 + Ula DR18 + Ulb 'Dl r'O three lines on the w"R'R eye color (Figure 6C). In con- a- a - 0 - trast to these three actively suppressing lines, three 30, O 30, 8 no wt 30 90 90 8 no wt 30 90 90 Ula-3G lines and one Ulb-3G line had no detectable 111111111111 effect on theeye color phenotype of zd'R'8. An example of this, the Ulb-3G line 8b1, is shown in Figure 6D for 30 - comparison with the three other lines. Wl - Expression of the U1-3G suppressor snRNAs in the three actively suppressing transformant lines was exam- ined by the 3G primer extension assay in total RNA 9G - 9G samples from adult flies heterozygous for the suppres- wt - assay sors (Figure 7). These three lines were compared to three other U1-3G lines, two Ula-3G and one Ulb-3G, that did not phenotypically suppress dRiR.As can be Ulb- Ulb seen in lanes 4, 6, and 7 of Figure 7, expression of the wt - assay U1-3G suppressors in the three active lines was easily detectable over the background levels of the two nega- 123 4 5 6 7 8 9 101112 tive controls in lanes 1 and 5, and the amountof U1-3G suppressor relative to endogenous U1 is roughly the B. same for these three lines. The samples from the phe- notypically non-suppressing U1-3G lines (Figure 7, lanes OR18 + Ula DR18 + Ulb 2 " 2, 3, and 8) did not show any levels of the U1-3G ex- a 0 tension product above the background levels of the 36, 36. e no wl 3G 9G 9G wt 3G 9G 9G negative control lanes. 111111111I Thus, suppressor U1 snRNAs active in whole fliesare able to partially suppress the eye color phenotype of 30 - dRiRto differing extents. Non-suppressing Ul-3G lines wt - do not appear to express U1-3G snRNA (Figure 7), so phenotypic suppression is correlated with expression of the transformed U1-3G construct. However, in those 90 - 9G lines that do show expression of UlSG, the degree of wt - assay .. phenotypic suppression is not quantitatively correlated I2345678910 with the relative expression levels of U1-3G. FIGURE5.-Expression of U1 RNAs in co-transfected Schnei- Functional UlSG leads to defects in viability and fer- der cells as determined by primer extension assays. (A) Primer tility: During the construction of stocks carrying the extension assays on total RNA from Schneider cell co- U1-3G insertion lines, it appeared that noneof the three transfections. Total RNA was annealed to the appropriate"P- actively suppressing lines were viable as homozygotes, end-labeled primer and extended under theappropriate con- whereas all of the four non-suppressing lines were ho- ditions for the 3G, 9G, and Ulb assays (see MATERIALS AND METHODS). Extension products from these assays were sepa- mozygous viable.This observation suggested that lethal- rated on a 15% sequencing gel and visualized by autoradiog- ity might result from expression of the U1-3G suppressor raphy. Each assay is shownon a separate panel; indicated to the snRNA above a critical level. To testthis possibility, left ofeach panel are the positions of the wild-type extension crosses leading to trans-heterozygous combinations of product ("wt") and the slightly longer extension product in- dicative of each particular base change being assayed ("3G," U1-3G suppressors were carried out. Flies carrying any YG," and "Ulb"). The "no DR18" lane is a negative control of two copies of the three active transgenes were inviable, Schneider cells transfected with a control plasmid (pUC19). but combinations involving any of three inactive lines The "no" lane for the Ula andU lbsuppressor co-transfections were viable(Table 1). Since one copy ofan active U1-3G are negative controls of w''''~plasmid co-transfected with no transgene did not cause subvitality when compared to suppressor. The data shown here is typical of three separate assays from independent transfections. (B)Primer extension sibling flies with no U1-3G transgene (data not shown), assays on U1 snRNA isolated from U1 snRNPs immunopre- it is clear that the expression level of suppressor U1 cipitated from nuclear extracts of theSchneider cell co- snRNAs from two copies, and not onecopy, ofan active transfections. The U1 snRNA from the immunoprecipitated U1-3G transgene can cause semi-lethality. U1 snRNPs weresubjected to the 3G and 9G assays, shown in For all three active lines, homozygous adults were ob- the two separate panels. served at low frequencies during maintenanceof stocks. Suppressor U1 snRNAs in Drosophila 373

FIGURE 6.-Phenotypic suppression of dR1'by UlSG in transformed flies. In each panel are shown two sibling male flies carrying one copy of P[dR1']; thefly on the left has no UlSG transgene, while the fly on the right has one copy of a U1-3G transgene. (A) The effect of one copy of P[Ulb-3G]lcl on P[dR1']. Genotypes: wlll', P[dR1']3;Cy0/+ (left) and w'"', P[dR1']3;P[v+, Ulb3G]lcl/+ (right). (B)The effect of one copy of P[Ulb3G]4bl on P[dR1']. Genotypes: wl"', P[dR1']3;Cy0/+ (left) and wl"', P[dR1']3;P[v+,U1b3G]4bl/+ (rifht). (C) The effect of one copyof P[Ula-3G]55el on P[dm']. Genotypes:wlI1', P[dR1']3;CyO/+ (left) and wl''', P[dR' ]3;P[v+,Ula-3G]55el/+ (right). (D) The effect of one copy of nonexpressing P[Ulb 3G18bl on P[dRIB].Genotypes: wl"', P[dR1']3;CyO/+ (left) and wl"', P[dR1']3;P[v+,U1b-3G]8bl]/+ (right).All flies shown are wild-type for the vermilion locus.

When crosses of these homozygous escapers to other U1 snRNA is not the sole determinant of 5' splice site strains wereattempted, it was discovered that fertility was recognition. Suppressor U1 RNh in transiently trans- reduced in both sexes oftwo of these three lines (P [Ulb- fected cells were expressed in the context of endog- 3Gllcl and P[Ulb3G]4bl; data not shown). The se- enous wild-type U1,and were only a fraction the of total verity of infertility correlates with the strength of sup U1 snRNA (Figure 5). Similarly, because wild-type Dro- pression ofdR1', and is stronger in homozygous females sophila strains possess five or six potentially active U1 than in corresponding homozygous males ofthe same snRNA genes (Lo and MOUNT1990), a single Ul sup line. pressor transgene, expressed at an equivalentlevel, would contribute only 1/13th to l/llth of the U1 RNA DISCUSSION in a diploid fly. Again, an excess of wild-type U1 was We have nowdemonstrated suppression of a 5' splice indeed confirmed by primer extension assays (Figure 7, site mutation in D. melunoguster by compensatory mu- lanes 4, 6 and 7). tations in the 5' end of U1, both molecularly in trans- Two characteristics of dRlecontribute to our ability fected cellsand phenotypically in transformed flies. This to detect partial suppression by the U1 compensatory is the first demonstration of genetic suppression of a 5' mutations. The first is that this 5' splice site mutation splice sitemutation in a whole metazoan organism.The results in the accumulation of an RNA that retains the suppression we have observed both in transfected cells second intron, indicating both that splicing of this in- and in transformed flies is partial, a result that would tron is defective and that this unspliced white RNA is have been expected in both cases because of a back- relatively stable compared to the spliced RNA in both ground of wild-type U1, and because base-pairing with transfected cellsand transformed flies. Whilewe do not 374 P. C. H. Lo. D. Roy and S. M. Mount U1a-3G U1 b-3G compared to either the Ula-3G or Ula-9G constructs. flies flies Both of the single mutant Ula constructs are expressed at comparable levels to each other but the doubly mu- tant Ula-SG,SC construct attains a much lower steady state level than these two constructs This suggests that two mutations in the 5' end of U1 somehow cause it to 11111III be less stable than the single mutant U1 suppressors. We note that mutations affecting the stabilty of human U1 have been described previously, and these were typically 3G - &". those that might be expected to affect RNA structure or snRNP assembly (Yuo and WEINER1989b). Our data on the differing steady state levels of U1 12345678 suppressors, whatever their cause, can be combined with FIGURE assay total RNA 7.-U1-3G primerextension of data on the suppression of the splicing defect of IU"~" samples from UI-3C transformant fly lines. Total RNA samples from adult flies with a single copy of the indicated Ula-3G or in transfected cells to determine therelative efficiencies UIb3G uansgene were analyzed by the U13G asay. The nega of the different Ula suppressor constructs. When cor- tive controlswere total RNAs assayed from adult sibling flieslack- rected for differences in abundance, the efficiency of ing a UI transgene. Genotypes: lane I, d""/Y;~yO/P[dJR'ql; suppression for the Ula series of compensatory muta- lane 2, ~J"N/~P[v+,Ula-~C]51d2/P[dJR'~1;lane 3, d'"/ tions is 3G,9G > 3G > 9G. It is not surprising that the Y;P[v+,Ula-~C].i5b3/P[~J'r'~1;lane 4, d"RfiP[v+,Ula-3Cl- 5%l/P[7&JR'ql; lane 5, d"N/y;CyO/P[dJR'T1; lane 6, J""/ 3G,9C suppressor is the most efficient suppressor be- ~P[u+,U1b-3G]Icl/P[uPR'41;lane 7, w"'8fiP[v+,Ulb3Cl- cause it fullyrestores base-pairing betweenthe 5' end of 4bl/P[dJH'71; lane 8, d~'R~,P[v+.Ulb-3G]8bl/P[~R'~1. U1 and the double mutant5' splice site of d'"' (Figure 1A). As for the single site suppressors, U1-3G is clearly know the half-lives of the spliced and unspliced forms, more efficient than U1-9G. This result could be due to a comparison of steady state s/u ratios between samples a greaterintrinsic effect of the +6 intronic mutation on should directly reflect relative splicing efficiencies so splicing compared to the -1 exonic mutation. In support long as these half-lives are constant and are independent of this possibility, co-transfection results with the single of RNA abundance. The second important feature of point mutations -IC and +6C indicated that the splic- dHfXis the severity of its splicing defect, which allowed ing defect is relatively mild in both cases, but that the us to discern partial suppression by the various U1 sup +6C point mutant ha. a somewhat greater splicing de- pressors in the transfected cells and transformed flies. If fect than the -IC point mutant (data not shown). AI- the splicing defect of the 5' splice site mutation in the ternatively, the difference could reflect the ease of sup white second intron were milder, it might have proven pression. U1-3G base-pairingwith the 1d"""5' splice site difficult to discern low levels ofsuppression by the com- is likely to be more stable than U1-9C base-pairing(AG3, pensatory U1 mutations. = -10.7 kcal/mol us. AG3, = -8.9 kcal/mol; Figure 1A). Suppressor U1 RNAs differ in theirefficiency of sup A third possibility is suggested by evidence that each of pression: While all eight U1 constructs possessed the these positions is also recognized by another U RNA same L'la promoter, they reproducibly reached differ- position -1 base pairs with nucleotide U40 of U5, and ent steady state levels in transfected Schneider cells. position +6 base pairs with nucleotide A41 of U6 (see Even if transcription rates were identical for all the U1 Introduction). Thus, it is also possible that the splicing suppressor constructs, there areseveral possiblereasons of this particular intron is more dependent upon correct for these different levels. One possibility is that the dis- U5 recognition than upon correct U6 recognition, or tinct Ulbspecific 3'-flanking sequence of the Ulb sup that the-IC change has a greatereffect on pairing with pressor constructs affect the efficiencyofpost- U5 than the +6Cchange hasonpairingwith U6. Finally, transcriptional processing of these U 1b molecules. This a fourth possibility is that the U1-9C mutation prevent. appears to be unlikely because a similar hybrid mouse base-pairing betweenU 1 RNA and the -1 position of the U1 gene with Ulb coding and 3' flanking sequence at- 3' splice site. Such pairing in the fission yeast S. pombe tached to a U la promoter accumulates the U1 b snRNA is supported by suppression of 3' splice site mutations in transfected cells to comparable levelswith Ula snRNA and lethality of mutations affecting the corresponding from a complete Ula gene (CACERES et al. 1992). An- U1 nucleotide (REICH et al. 1992). In contrast, mutations other possibility, which we favor, is that either of the at this position in S. cerevisiae are not lethal, and al- compensatory base changes in the 5' portion of the U1 though suppression of 5' splice site mutations is ob suppressors or the U1 b sequence variation, or some served, no effect on 3' splice site choice is seen (S~RAPHIN combination thereof, affect the stability of U1 RNAs in and KANDELFLEWIS1993). the Schneider cells. One example of this is the lower Ulb is less tolerant of the U1-9G mutation; support relative abundance of the Ula-SG,SG suppressor when for a long-rangeintramolecular interaction: The Suppressorin U1 snRNAs Drosophila 375

TABLE 1

Viability of combinations of two P[Ul-SG] transgenes

Males

lcl (Ulb) 4bl (Ulb) 55el (Ula)55el(Ulb) 4bl (Ulb) lcl 8bl (Ulb) 51d2 (Ula) 55b3 (Ula) Females (active) (active) (active) (inactive) (inactive) (inactive)

lcl (Ulb) [<1.3%] [<1.0%1 [<0.8%1 51% 51% 65 % (active) (0/151) (0/195) 0/245) (42/206) (491’241) (54/220) 4bl (Ulb) [<0.7%] [<0.8%] [<0.8%] 66% 83% 96% (active) (0/279) (0/240) (101/312)(0/249) (77/263) (55/221) 55el (Ula) [<0.8%1 0.9% 1.6% 83% 96% 113% (active) (0/252) (1/232) (2/253) (78/267)(123/340) (95/292) 8bl (Ulb) 49 % 86% 75% 77% 67% 127% (inactive) (21/107) (68/227) (62/228) (74/267) (74/294) (135/347) 51d2 (Ula) 38% 65 % 118% 78 % 34% 119% (inactive) (22/137) (53/215) (87/234) (35/241)(93/331) ( 128/334) 55b3 (Ula) 34% 105% 80% 128% 110% 91% (inactive) (12/82) (85/246) (82/287) (138/353) (120/339) (116/370) The survival of flies with two U1-3G transgenes (P[U1-3G]p/P[U1-3C]m) is expressed as a percentage of the expected number. These results are derived from crosses between P[U1-3G]p/CyO and P[U1-3G]m/CyO. The expected number of flies with two transgenes is one-half that of flies with CyO, which are recognized by the dominant marker Curly. Cy0 homozygotes die. Shown in parentheses underneath each percentage are the number of flies without the dominant Curly marker (P[U1-3G]p/P[UI-3G]m flies) over the total number of flies from that cross. The paternal P[U1-3G] transgene is indicated along the top and the maternal P[Ul-SG] transgene is at the left. For crosses with no homozygous or trans-heterozygous U1-3G progeny, the percentages are indicated as an upper boundin brackets (e.g. [<0.8%]) since we did obtain homozygous progeny from stocks of the active lines (see text).

Ulb-9G suppressor presents another interesting ex- from the 5’ splice site is required for the completion of ample of what is likelyto besequence-specific instability spliceosome assembly (KONFORTIet al. 1993). This pro- in a U1 suppressor. In comparison to the levels of the cess maybe facilitated by restoration of base-pairing be- Ulb-wt or UlB3G snRNAs, the steady state levelof tween the U1 5‘ end and the internal GGUAG site at Ulb-9G is lower, implying that the combination of the positions 133-137. Ulb sequence variation (134U) with the U1-9G muta- The embryonicUlb variant is functional as a suppres tion is destabilizing. The low level ofthe Ulb3G,9Gsup sor: In common with numerous other complex meta- pressor also seems to beconsistent with this idea. While zoans (FORBESet al. 1984; LUNDet al. 1985; LUNDand both doubly mutant suppressors appear tobe less stable, DAHLBERG 1987; SANTIAGOand -LUFF 1989),Drosoph- we observed significantly lower levels Ulb-3G,9G of than ila possesses a Ulb sequence variant that is expressed Ula-3G,9G (Figure 5A, compare toUlb-3G and Ula-3G; primarily during embryogenesis (LO and MOUNT1990). this data is typical ofthree separate measurements from However, in no case has it been determined whether three independent transfections). Thus, an extremely embryonic forms of the U1 molecule are functional,and low steady state level of U1-3G,9Goccurs specifically in if so, whether they possesssome alternative or additional the case of Ulb. roles in splicing that may be pertinent to early devel- The destabilizing effect of the combination of the opment. Comparison of the efficiency ofsuppression of G134 to U changeof Ulbwith theC9 to Gcompensatory gRz8by Ula and Ulbvariants with the same compen- mutation on UlsnRNA observed for both Ulb-9G and satory U1 mutation provides a functional assay of the Ulb3G,9G is interesting in light of a long range inter- Ulb variant. We have shown that the Ulb variant of the action involving base-pairing between the conserved se- U1-3G suppressor can function comparably to the Ula quences P9ACC atpositions 5-9 and GGUAG at posi- suppressor in co-transfections, although it is possible tions 133-137 (STURCHLERet al. 1992) (see Figure 1B). that it is less efficient since there appears to be more Both the 134U sequence variation and the9G mutation Ulb-3G than Ula-3G in the co-transfected cells (Figure separately disrupt a different GC base pair of this in- 5A, lanes 4 and 10).Since the Ulb-9G suppressor is ex- teraction. In combination, these two sequence changes pressed at a level that is easily detectable (albeit lower in Ulb-9G would disrupt two adjacent GC base pairs than Ula-9G) but suppresses poorly, if at all, we infer leaving only three weak base pairs (two A-9 and one that Ulb-9G is less efficient than Ula-SG, or may be G-U) in this long range interaction. Thus,it is possible entirely nonfunctional. Suppression of dR”by Ulb- that the integrity of this postulated long range interac- 3G,9G is clear, but we could not ascertain its efficiency tion is necessary for the stability of Drosophila UI. A relative to theUla-3G,9G suppressor because its level of possible function of this interaction is suggested by re- expression above background was difficult to deter- sults demonstrating that displacement of the U1 5‘ end mine. Insummary, then, atleast one (Ulb-SG), andpos- 376 P. C. H. Lo, D. Roy and S. M. Mount

sibly all three, Ulb suppressors are less efficient in sup- there is a threshold for lethality in flies that is reached pressing dR1*in co-transfected cells thanthe by the expression level of two suppressor U1-3G trans- corresponding Ula suppressors. However, the case of genes. However, a single copyof the suppressor U1 Ulb3G is sufficient to establish that the Ulb variant is transgene provides consistent and easily scored pheno- a functional form of U1 RNA. typic suppression without significant effects on viability Because no activeU1-9G or U1-3G,9G transgenes or fertility. Besides this semi-lethality, effectson fertility were obtained, it is possible that these variants are lethal of both homozygous males and females were observed in a single dose (see below). In any case, we could ex- for some of these actively suppressing lines. The degree amine the question of Ulb function in transgenic flies of infertility was correlated with the strength of pheno- only for the U1-3G suppressor constructs. Phenotypic typic suppression of dR18 for the two strongest trans- suppression of dR1*was observed for lines of both the genes. A likely explanation for these adverse biological Ula and Ulbforms of the 3G suppressor, which con- effects is incorrect splicing of the pre-mRNAs of one or firms that the Ulb-3G suppressor can function to sup- more developmentally important genes. Perturbation of press dR1*as Ula-3G does. Though the expression of even a single such splicing event in a complex develop- the U1-3G suppressors was demonstrated in total adult mental pathway may be sufficient to disturb normal de- RNA for each of the three actively suppressing lines, velopment. In thecase offemale fertility, it is known that there was no obvious quantitative correlation between a number of genes involved in oogenesis are alterna- expression level and the strengthof phenotypic suppres- tively spliced, such as SxZ (BELLet al. 1991; BOPPet al. sion of dR1*.However, we have not determinedif all or 1993) and otu (STEINHAUERand KALFAYAN 1992). An ex- only some of the tissues of the fly are expressing the amination of the effects of U1suppressors on expression U1-3G suppressors and the morerelevant assay of mea- of these particular genes has so far been impossible be- suring the steady state levels of the 3G suppressors only cause of the extremely small (and unpredictable) num- in the pigmentcells ofdeveloping eye discsin mid-pupal ber of infertile homozygous escapers. stages, where the suppression of the splicing defect of The existence of a U1 suppression system in a com- dR1*actually occurs, is technically impossible. Without plex metazoan such as Drosophila should prove useful this specific information, it is impossible to make firm in genetic analyses ofthe role of U1 insplicing. Agenetic quantitative conclusions about the relativeefficiency screen for mutations which either increase or decrease with whichUlb-3G andUla-3G phenotypically suppress the suppression seen with the active U1-3G transgenes dR1*in flies. However, these results make it clear that may yield genes whose products are involved in the rec- Ulb can function in a variety of tissues. ognition of the 5' splice site by U1, an important early Other phenotypesof suppressor Ul snRNAs: While step in splicing. More significantly, the observation that we observed suppression of a 5' splice site mutation de- we can detect theactivity ofa dispensable suppressor U 1 fective in bothpositions -1 and +6, expression of these RNA against a background of wild-type U1should allow suppressor U1snRNAs in vivo could be expected to detailed study of features required for the expression affect the splicing of other precursor mRNAs, possibly and function of U1 RNA. In this manner it should be with deleterious biological effects. This could occur possible to utilize the power of Drosophila genetics to through the activation of cryptic 5' splice sites in pre- delineate in greater detail the role of U1 snRNA in the cursor mRNAs that happen by chance to be comple- early steps of splicing. mentary to the 5' end of the suppressor U1 snRNAs, We thank PAULROTHMAN for human autoimmune sera, and RICARDO resulting in the missplicing of those pre-mRNAs (YUO MANCEBO for screening sera. We thank LARRY CHASIN,ALAN WEINERand and WEINER1989a; COHENet al. 1993;CORTES et al. DANKALDERON for their comments on the manuscript. We also ac- 1993). In thevarious Schneider cell co-transfection ex- knowledge the technical support of Douc BRAATEN,LARA PENNY, GREW GONSALVES and NIKOLAVOJTOV.This workwas supported by grants from periments that were conducted, none of the cells co- the March of Dimes Birth DefectsFoundation (Basic Research Grant transfected with the different suppressors showed an al- Fk92-0347), the National Institutes of Health (GM37991),and a Na- tered growth rate when compared with control cells co- tional Science Foundation Presidential Young Investigator Award to transfected with carrier DNA (datanot shown). It S.M.M. appears,therefore, that there are no serious conse- quences for cell growth due to the expression of our LITERATURE CITED

suppressor U1 constructs at thelevels we have observed ASHBURNER, M., 1989 Drosophila: A LaboratoryHandbook. Cold in Schneider cells. Spring Harbor Laboratory, Cold Spring Harbor, N.Y. This contrasts with the effects of U1-3G suppressors in BWINO, S. L., B. J. BLENCOWE,U. RKIER, B. S. SPROATand A. I. UOND, 1990 Targeted snRNP depletion reveals an additional role for transformed flies, in which case two copies of an active mammalian U1 snRNPin spliceosome assembly. Cell63: 293-302. U1-3G are invariably, though not completely, lethal BELL, L.R., J. I. HORABIN,P. SCHEDLand T. W. CLINE,1991 Positive (Table 1).The effect of the active U1-3G suppressors on autoregulation of Sex-lethal by alternative splicing maintains the female determined state in Drosophila. Cell 65: 229-239. viability is dosage-dependent, i.e., lethality requires two BOPP,D., J. I. HORABIN,R. A. LERSCH,T. W. CLINEand P. SCHEDL, copies of active U1-3G suppressors, which suggests that 1993 Expression of the Sex-lethal gene is controlled at multiple SuppressorDrosophila U1 snRNAs in 377

levels during Drosophila oogenesis. Development 118: 797-812. splice site specificity:implications for the active site. Science262: CACERES,J. F., D. MCKENZIE, R. THIMMAPAYAand E. LUND, 1992 Control 1982-1988. of mouse Ula and UlbsnRNA gene expression by differential LINDSLEY,D.L., and G. G. ZIMM,1992 The Genome of Drosophila transcription. Nucleic Acids Res. 20: 4247-4254. melanogaster. Academic Press, New York. COHEN,J. B., S. D. BROZand A. D. LEVINSON,1993 U1 small nuclear Lo, P. C. H., and S. M. MOUNT,1990 Drosophila melanogastergenes RNAs with altered specificity can be stably expressed in mamma- for U1 snRNAvariantsand their expression during development. lian cellsand promote permanentchanges in pre-mRNA splicing. Nucleic Acids Res. 18: 6971-6979. Mol. Cell. Biol. 13: 2666-2676. LUND,E., and J. E. DAHLBERG, 1987Differential accumulation of U1 CORTES,J. J., E. J. SONTHEIMER,S. D. SEMRTand J. A. STEITZ,1993 Mu- and U4 small nuclear RNAs during Xenopus development. Genes tations in the conserved loop of human U5 snRNA generate use Dev. 1: 39-46. of novel cryptic 5’ splice sites in vivo. EMBO J. 13: 5181-5189. LUND,E., B. KAHAN,and J. E. DAHLBERG, 1985Differential control of DIGNAM,J. D., R. M. LEBOVITZand R. G. ROEDER,1983 Accurate tran- U1 small nuclear RNA expression during mouse development. scription initiation by RNApolymerase I1 in a soluble extract from Science 229: 1271-1274. isolated mammalian nuclei. Nucleic Acids Res. 11: 1475-1489. MAYEDA, A.,and A. KRAINER,1992 Regulation of alternative splicing FOLEY,K. P., M. W. LEONARDand J. D. ENCEL,1993 Quantitation of by hnRNP A1 and splicing factor SF2. Cell 68: 365-372. RNA using the polymerase chain reaction. Trends Genet. 9 MAYEDA, A., A. M. ZAHLER,A. R. KRAINER and M.B. ROTH, 1992 Two 380-385. members of a conserved family of nuclear phosphoproteins are FORBES, D. M.J., W. KIRSCHNER, D. CAPUT, J. E. DAHLBERGand E. LUND, involved in general and alternative splicing. Proc. Natl. Acad.Sci. 1984 Differential expression of multiple U1 small nuclear RNAs USA 89 1301-1304. in oocytes and embryos of Xenopus laevis. Cell 38: 681-689. MOORE,M. J., C. C. QuERYand P. A.SHARP, 1993 Splicingof precursors FRIDELL,Y. W., and L. L. SEARLES,1991 Vermilion as a small selectable to mRNA by the spliceosome, pp. 303-358 in The RNA World, marker gene for Drosophila transformation. Nucleic Acids Res. edited by R. F. GESTELANDand J. F. ATKINS. ColdSpring Harbor 18: 5082. Laboratory, Cold Spring Harbor, N.Y. Fu, X.-D., and T. MANIATIS,1990 Factor required for mammalian spli- MOUNT,S. M., 1982 Acatalogue ofsplicejunction sequences. Nucleic ceosome assembly is localized todiscrete regions in the nucleus. Acids Res. 10: 459-472. Nature 343: 437-441. MOUNT,S. M., 1983 Involvement of U1 small nuclear RNA-protein GE, H., and J. L. MANLEY, 1990 A protein factor, ASF, controls cell- complexes in splicing. Ph.D. Thesis.Yale University, New Haven, specific alternative splicing of SV40 early pre-mRNAin vitro.Cell Conn. 42: 355-367. MOUNT,S. M., and J. A. STEITZ, 1981Sequence of U1 RNA from Dro- GREEN,M. R.,1991 Biochemical mechanisms ofconstitutive and sophilamelanogaster implications for U1 secondary structure regulated pre-mRNA splicing. Annu. Rev. Cell Biol. 7: 559-600. and possibleinvolvement in splicing.Nucleic AcidsRes. 9: Guo, M., P. C. H. LO and S. M. MOUNT,1993 Species-specific signals 6351-6368. for the splicing of a short Drosophila intron in vitro. Mol. Cell. MOUNT,S. M.,C. Bum, G. HERTZ,G. D. STORMO,0. WHITE et al., Biol. 13: 1104-1118. 1992 Splicing signalsin Drosophila: intron size, information HAN,R, M. S. LEVrNEandj. L. MANLEY,1989 Synergistic activation and content, and consensus sequences. Nucleic Acids Res. 20 4255- repression of transcription by Drosophila homeobox proteins. 4262. Cell 56: 573-583. NELSON,K. IC, and M.R. GREEN,1988 Splice site selection and HARPER,J. E.,andJ. L. MANLEY,1991 Anovel protein factor is required ribonucleoprotein complex assembly during in vitro pre-mRNA for use of distal alternative 5’ splice sitesin vitro.Mol. Cell. Biol. splicing. Genes Dev. 2: 319-329. 11: 5945-5953. NEWMAN,A. J., and C. NORMAN,1991 Mutations in yeast U5 snRNA HERNANDEZ,and N., R. LUCITO,1988 Elements required for transcrip alter the specificity of 5’ splice site cleavage. Cell65: 115-123. tion initiation of the human U2 snRNA gene coincide with ele- NEWMAN,A. J., and C. NORMAN,1992 U5 snRNA interacts with exon ments required for snRNA3’ end formation. EMBO J. 7: sequences at the 5’ and 3’ splice sites. Cell 68: 743-754. 3125-3134. PENG,X., and S. M. MOUNT, 1990 Characterization of Enhancer-of- HIGGINS,C. F., 1992 ABC transporters: from microorganisms to man. white-apricot and its effects on the copia insertion allele white- Annu. Rev. Cell Biol. 8: 67-113. apricot in Drosophila melanogaster. Genetics 126: 1061-1069. KANDELSLEWIS,S., and B. SERAPHIN,1993 Role of U6snRNA in 5’ &INOW, L., and J. A. BIRCHLER,1989 A dosage-sensitivemodifier of splice site selection. Science 262 2035-2039. retrotransposon-induced alleles of the Drosphilawhite locus. KINGSTON, R. E., 1989 Guanidium method for total RNApreparation, EMBO J. 8 879-890. pp. 4.2.1-4.2.5 in Current Protocols in Molecular Biology,edited REICH, c. I., R. W. VANHOY,G. L. PORTERand J. A. WISE, 1992 Mu- byF. M. AUSUBEL,R. BRENT,R. E. KINGSTON, D. D. MOORE, J. G. tations at the 3’ splice site can be suppressed by compensatory SEIDMANet al. John Wiley & Sons, New York. base changes in U1 snRNA in fission yeast. Cell 69 1159-1169. KOHTZ,J. D., S. F. JAMISON,C. L. WILL, P. ZUO, R. LUHRMANNet al., ROBERTSON,H. M., C. R. PRESTON,R. W. PHILLIS,D. M. JOHNSON~CHLITZ, 1994 Protein-protein interactions and 5’ splice site recognition W. K BENZet al., 1988 A stable source of P element transposase in mammalian mRNA precursors. Nature 368: 119-124. in Drosophila melanogaster. Genetics 118: 461-470. KONFORTI,B. B., M. J. KOZIOLKIEWICZand M. M. KONARSKA,1993 Dis- ROGERS,J., and R. WALL, 1980 A mechanism for RNA splicing. Proc. ruption of base pairing between the 5’ splice siteand the 5’ end Natl. Acad. Sci. USA 77: 1877-1879. of U1snRNA is required for spliceosome assembly.Cell 75: SAIKI,R. R, D. H. GELFAND,S. STOFFEL, S. SCHARF,R. HICUCHI et al., 863-873. 1988 Primerdirected enzymatic amplification ofDNA with a WNER,A. R., G. C. CONWAYand D. KOZAK,1990 The essential pre- thermostable polymerase. Science 239 487-491. mRNA splicing factor SF2 influences 5’ splice site selection by SANTIAGO, C.,and W. F. MARZLUFF, 1989 Expression of the U1RNA activating proximal sites. Cell 62: 35-42. repeat duringearly seaurchin development: evidence for a switch KURKULOS,M., J. M. WEINBERG,M.E. PEPLINGand S. M. MOUNT, in U1 RNA genes during development. Proc. Natl. Acad. Sci.USA 1991Polyadenylation in copia requires unusually distant up 86: 2572-2576. stream sequences. Proc. Natl. Acad. Sci. USA 88: 3038-3042, SAWA,H., and J. ABELSON,1992 Evidence for a base-pairing interac- KURKULOS,M., J. M. WEINBERG,D.ROY and S. M. MOUNT,1994 P tion between U6 smallnuclear RNA and the 5’ splicesite during element mediated in vivo deletion analysis of white-apricot: the splicing reaction in yeast. Proc. Natl.Acad. Sci. USA 89 deletions between direct repeats are strongly favored. Genetics 11269-11273. 136: 1001-1011. SAWA,H., and Y. SHIMURA,1992 Association of U6 snRNA with the 5‘ LEE,R A. W., and M. R. GREEN,1990 Small-scale preparation of ex- splice siteregion of pre-mRNA in the spliceosome. Genes Dev. 6: tracts from radiolabeled cells efficient in pre-mRNAsplicing. 244-254. Methods Enzymol. 181: 20-30. SEIWERT,S. D., andJ. A. STEITZ,1993 Uncoupling two functions of the LERNER,M. R., J. A. BOW, S. M. MOUNT,S. L. WOLINand J. A. STEITZ, U1 smallnuclear ribonucleoprotein particle during in vitrosplic- 1980 Are snRNPs involved in splicing? Nature 283 220-224. ing. Mol. Cell. Biol. 13: 3135-3145. LESSER, C.F., and C. GUTHRIE,1993 Mutations in U6 snRNA that alter SENAPATHY,P., M. B. SHAPIROand N. L. HARRIS,1990 Splice junctions, 378 P. C. H. Lo, D. Roy and S. M. Mount

branch point sites, and exons: sequence statistics, identification, stream element anda -30 ‘TATA box’ are requiredfor transcrip and applications to the human genome project. Methods Enzy- tion of the U2 snRNA gene of Arabidopsis thaliana. EMBO J. 8: mol. 183: 252-278. 3875-3882. SERAPHIN,B., and S. KANDELS-LEWIS,1993 3’ splice site recognition in WASSARMAN,D. A,, andJ. A. STEITZ,1992 Interactions of small nuclear S. cerevisiae does not require base pairing with U1 snRNA. Cell RNAs with precursor messenger RNA during in vitro splicing. 73: 803-812. Science 257: 1918-1925. SERAPHIN,B., and M.ROSBASH, 1990 Exon mutationsuncouple 5’ WISE,J. A., 1993 Guides to the heartof the spliceosome. Science 262: splice site selection from U1 snRNA pairing. Cell 63 619-629. 1978-1979. SERAPHIN,B., L. KRETZNER and M.ROSBASH, 1988 A U1 snRNApre- Wu, J. W., and T. MANIATIS, 1993 Specific interactions between pro- mRNA base pairing interaction is required early in yeast spliceo- teins implicated in splice site selection and regulated alternative some assembly but does not uniquely define the 5’ splice site. splicing. Cell 75: 1061-1070. EMBO J. 7: 2533-2538. WYATT,J. R., E. J. SONTHEIMERand J. A. STEITZ,1992 Site-specific cross- SILICIANO,P. G., and C. GUTHRIE,1988 5‘ splice site selection in yeast: linking of mammalian U5 snRNP to the 5’ splice site before the genetic alterations in base-pairing with U1 reveal additional re- first step of pre-mRNA splicing. Genes Dev. 6: 2542-2553. quirements. Genes Dev. 2: 1258-1267. YUO,C. Y., and A. M. WEINER,1989a A U1 small nuclear ribonucleo- SONTHEIMER,E. J., andJ. A. STEITZ,1993 The U5 and U6 small nuclear protein particle with altered specificity induces alternative splic- RNAs as active site components of the spliceosome. Science 262: ing of an adenovirus E1A mRNA precursor. Mol. Cell. Biol. 9: 1989-1996. 3429-3437. SPKADLING,A. C., and G. M. RUBIN,1982 Transposition of cloned P YUO, C. Y., and A. M. WEINER,1989b Genetic analysis of the role of elements into Drosophila germ line chromosomes. Science 218: human U1 snRNA in mRNA splicing. I. Effect of mutations in the 341-347. highly conserved stem-loop I of U1. Genes Dev. 3: 697-707. STEINHAUER,W. R., and L. J. KALFAYAN, 1992 A specific ovarian tumor ZAMROD,Z., C. M. ME,Y. SONGand W. E. STUMPH,1993 In vitro protein isoform is required for efficient differentiation of germ transcription of a DrosophilaU1 small nuclear RNAgene requires cells in Drosophila oogenesis. Genes Dev. 6: 233-243. TATA box-binding protein and two proximal cis-acting elements STELLER,H., and V. PIRROTTA, 1985 Expression of the Drosophila with stringent spacing requirements. Mol. Cell. Biol. 13: 5918- white gene under the controlof the hsp 70heat shock promoter. 5927. EMBO J 4 3765-3772. ZAPP, M. L., and S. M. BERGET,1989 Evidence for nuclearfactors STURCHLER,C., P. CARBON and A. KROL, 1992 An additional long range involved in the recognition of 5’ splice sites. Nucleic Acids Res. interaction in human U1 snRNA. Nucleic Acids Res. 20: 1215- 17: 2655-2674. 1221. ZHUANG,Y., and A. M. WEINER,1986 A compensatory base change in TURNER,D. H., N. SUCIMOTOand S. M. FREIER,1988 RNA structure U1 snRNA suppresses a 5’ splice site mutation. Cell 46: 827-835. prediction. Annu. Rev. Biophys. Biophys. Chem. 17: 167-192. VANKAN,P., and W. FILIPOWCZ,1989 A U-snRNA gene-specific up- Communicating editor: A. CHOVNICK